Science.gov

Sample records for oriented variant identification

  1. Control Oriented System Identification

    DTIC Science & Technology

    1993-08-01

    The research goals for this grant were to obtain algorithms for control oriented system identification is to construct dynamical models of systems...and measured information. Algorithms for this type of nonlinear system identification have been given that produce models suitable for gain scheduled

  2. The orientation selectivity of face identification

    PubMed Central

    Goffaux, Valerie; Greenwood, John A.

    2016-01-01

    Recent work demonstrates that human face identification is most efficient when based on horizontal, rather than vertical, image structure. Because it is unclear how this specialization for upright (compared to inverted) face processing emerges in the visual system, the present study aimed to systematically characterize the orientation sensitivity profile for face identification. With upright faces, identification performance in a delayed match-to-sample task was highest for horizontally filtered images and declined sharply with oblique and vertically filtered images. Performance was well described by a Gaussian function with a bandwidth around 25°. Face inversion reshaped this sensitivity profile dramatically, with a downward shift of the entire tuning curve as well as a reduction in the amplitude of the horizontal peak and a doubling in bandwidth. The use of naturalistic outer contours (vs. a common outline mask) was also found to reshape this sensitivity profile by increasing sensitivity to oblique information in the near-horizontal range. Altogether, although face identification is sharply tuned to horizontal angles, both inversion and outline masking can profoundly reshape this orientation sensitivity profile. This combination of image- and observer-driven effects provides an insight into the functional relationship between orientation-selective processes within primary and high-level stages of the human brain. PMID:27677359

  3. Re-ranking sequencing variants in the post-GWAS era for accurate causal variant identification.

    PubMed

    Faye, Laura L; Machiela, Mitchell J; Kraft, Peter; Bull, Shelley B; Sun, Lei

    2013-01-01

    Next generation sequencing has dramatically increased our ability to localize disease-causing variants by providing base-pair level information at costs increasingly feasible for the large sample sizes required to detect complex-trait associations. Yet, identification of causal variants within an established region of association remains a challenge. Counter-intuitively, certain factors that increase power to detect an associated region can decrease power to localize the causal variant. First, combining GWAS with imputation or low coverage sequencing to achieve the large sample sizes required for high power can have the unintended effect of producing differential genotyping error among SNPs. This tends to bias the relative evidence for association toward better genotyped SNPs. Second, re-use of GWAS data for fine-mapping exploits previous findings to ensure genome-wide significance in GWAS-associated regions. However, using GWAS findings to inform fine-mapping analysis can bias evidence away from the causal SNP toward the tag SNP and SNPs in high LD with the tag. Together these factors can reduce power to localize the causal SNP by more than half. Other strategies commonly employed to increase power to detect association, namely increasing sample size and using higher density genotyping arrays, can, in certain common scenarios, actually exacerbate these effects and further decrease power to localize causal variants. We develop a re-ranking procedure that accounts for these adverse effects and substantially improves the accuracy of causal SNP identification, often doubling the probability that the causal SNP is top-ranked. Application to the NCI BPC3 aggressive prostate cancer GWAS with imputation meta-analysis identified a new top SNP at 2 of 3 associated loci and several additional possible causal SNPs at these loci that may have otherwise been overlooked. This method is simple to implement using R scripts provided on the author's website.

  4. Leveraging ancestry to improve causal variant identification in exome sequencing for monogenic disorders.

    PubMed

    Brown, Robert; Lee, Hane; Eskin, Ascia; Kichaev, Gleb; Lohmueller, Kirk E; Reversade, Bruno; Nelson, Stanley F; Pasaniuc, Bogdan

    2016-01-01

    Recent breakthroughs in exome-sequencing technology have made possible the identification of many causal variants of monogenic disorders. Although extremely powerful when closely related individuals (eg, child and parents) are simultaneously sequenced, sequencing of a single case is often unsuccessful due to the large number of variants that need to be followed up for functional validation. Many approaches filter out common variants above a given frequency threshold (eg, 1%), and then prioritize the remaining variants according to their functional, structural and conservation properties. Here we present methods that leverage the genetic structure across different populations to improve filtering performance while accounting for the finite sample size of the reference panels. We show that leveraging genetic structure reduces the number of variants that need to be followed up by 16% in simulations and by up to 38% in empirical data of 20 exomes from individuals with monogenic disorders for which the causal variants are known.

  5. [Identification and characterization of alternativly splicing variants for murine mater gene].

    PubMed

    Cheng, Hui; Zhang, Xiao-Juan; Liu, Hai-Bo; Zhang, Yi; Huang, Zhao-Feng; Ma, Run-Lin

    2004-08-01

    Mater encoding an oocyte-specific autoantigen,and is associated with premature autoimmune ovarian dysgenesis (AOD) in mouse. Based on RT-PCR, cDNA cloning, screening, sequencing and analysis, we have detected a total of four Mater splice variants, designated as variant B, E, F and G. All these splicing forms are in frame in terms of expected protein products. Among these, B was consistent with the previous report, whereas E, F, G belong to novel splice variants that have not been reported previously. Variant E lacks exon 6, variant F both lacks exon 10 and retains a part of intron 8, variant G lacks part of exon 14, and variant H lacks part of exon 13. The cDNA sequences at all the exon-intron boundaries confirms to the "GT-AG" splicing rule. Variant B, E, F exist in all the four strains. Variant G exists only in SWR/J. According to the cDNA sequences of these four splice variants, amimo acid sequences of the corresponding expected protein isoforms were deduced, and their potential functional effects were predicted in this thesis. Further identification and characterization of these expected protein isoforms would provide valuable information for their functional importance.

  6. Identification and characterization of variant alleles at CODIS STR loci.

    PubMed

    Allor, Catherine; Einum, David D; Scarpetta, Marco

    2005-09-01

    Short tandem repeat (STR) profiles from 32,671 individuals generated by the ABI Profiler Plus and Cofiler systems were screened for variant alleles not represented within manufacturer-provided allelic ladders. A total of 85 distinct variants were identified at 12 of the 13 CODIS loci, most of which involve a truncated tetranucleotide repeat unit. Twelve novel alleles, identified at D3S1358, FGA, D18S51, D5S818, D7S820 and TPOX, were confirmed by nucleotide sequence analysis and include both insertions and deletions involving the repeat units themselves as well as DNA flanking the repeat regions. Population genetic data were collected for all variants and frequencies range from 0.0003 (many single observations) to 0.0042 (D7S820 '10.3' in North American Hispanics). In total, the variant alleles identified in this study are carried by 1.6% of the estimated 1 million individuals tested annually in the U.S. for the purposes of parentage resolution. A paternity case involving a recombination event of paternal origin is presented and demonstrates how variant alleles can significantly strengthen the genetic evidence in troublesome cases. In such instances, increased costs and turnaround time associated with additional testing may be eliminated.

  7. Tight control of light beams in photonic crystals with spatially-variant lattice orientation.

    PubMed

    Digaum, Jennefir L; Pazos, Javier J; Chiles, Jeffrey; D'Archangel, Jeffrey; Padilla, Gabriel; Tatulian, Adrian; Rumpf, Raymond C; Fathpour, Sasan; Boreman, Glenn D; Kuebler, Stephen M

    2014-10-20

    Spatially-variant photonic crystals (SVPCs), in which the orientation of the unit cell changes as a function of position, are shown to be capable of abruptly controlling light beams using just low index materials and can be made to have high polarization selectivity. Multi-photon direct laser writing in the photo-polymer SU-8 was used to fabricate three-dimensional SVPCs that direct the flow of light around a 90 degree bend. The lattice spacing and fill factor were maintained nearly constant throughout the structure. The SVPCs were characterized at a wavelength of 2.94 μm by scanning the faces with optical fibers and the results were compared to electromagnetic simulations. The lattices were shown to direct infrared light of one polarization through sharp bends while the other polarization propagated straight through the SVPC. This work introduces a new scheme for controlling light that should be useful for integrated photonics.

  8. Spatially variant tomographic imaging: Estimation, identification, and optimization

    SciTech Connect

    Baker, J.R.

    1991-11-01

    This thesis is an investigation of methods for processing multidimensional signals acquired using modern tomography systems that have an anisotropic or spatially variant response function. The main result of this research is the discovery of a new method to obtain better estimators of an unknown spatial intensity distribution by incorporating detailed knowledge about the tomograph system response function and statistical properties of the acquired signal into a mathematical model.

  9. Identification of a variant-specific phosphorylation of TH2A during spermiogenesis

    PubMed Central

    Hada, Masashi; Masuda, Koji; Yamaguchi, Kosuke; Shirahige, Katsuhiko; Okada, Yuki

    2017-01-01

    Tissue-specific histone variant incorporation into chromatin plays dynamic and important roles in tissue development. Testis is one such tissue, and a number of testis-specific histone variants are expressed that have unique roles. While it is expected that such variants acquire post-transcriptional modifications to be functional, identification of variant-specific histone modifications is challenging because of the high similarity of amino acid sequences between canonical and variant versions. Here we identified a novel phosphorylation on TH2A, a germ cell-specific histone H2A variant. TH2A-Thr127 is unique to the variant and phosphorylated concomitant with chromatin condensation including spermiogenesis and early embryonic mitosis. In sperm chromatin, phosphorylated TH2A-Thr127 (=pTH2A) is co-localized with H3.3 at transcriptional starting sites of the genome, and subsequently becomes absent from the paternal genome upon fertilization. Notably, pTH2A is recurrent and accumulated in the pericentromeric heterochromatin of both paternal and maternal chromosomes in the first mitosis of embryos, suggesting its unique regulation during spermiogenesis and early embryogenesis. PMID:28387373

  10. Crystallographic Texture and Orientation Variants in Al2O3-Y3Al5O12 Directionally Solidified Eutectic Crystals

    NASA Technical Reports Server (NTRS)

    Frazer, Colleen S.; Dickey, Elizabeth C.; Sayir, Ali; Farmer, Serene (Technical Monitor)

    2001-01-01

    Eutectic rods of Al2O3 and Y3Al5O12 were grown by a laser-heated float zone method, and their microstructure and crystallographic texture were studied by scanning electron microscopy, electron backscattered diffraction and x-ray diffraction. The composites were found to be highly textured with two twin-related crystallographic orientation relationships between the phases. Electron backscattered diffraction was employed to determine the spatial distribution of the orientational variants within the samples and to define the crystallographic orientation of various microstructural features.

  11. Identification of DLK1 variants in pituitary- and neuroendocrine tumors.

    PubMed

    Altenberger, T; Bilban, M; Auer, M; Knosp, E; Wolfsberger, S; Gartner, W; Mineva, I; Zielinski, C; Wagner, L; Luger, A

    2006-02-17

    In a gene chip analysis of common pituitary tumor types, one of the genes with the most impressive tissue-specific expression regulation was delta-like 1 (DLK1), which was strongly expressed in GH-secreting (GH-S) pituitary tumors. In addition to pituitary adenomas, various endocrine tumors were subjected to real-time-quantitative PCR revealing high expression of DLK1 in normal pituitary tissue, in GH-S-, in one prolactin-secreting pituitary adenoma and in pheochromocytomas. Additionally, three DLK1 gene-derived subvariants were identified. The first, lacking 204 bp--coding for epidermal growth factor-like domain 6 and parts of the juxtamembrane region--was named Secredeltin. In the other two splice variants (named Brevideltin and Brevideltinin), a stop codon is introduced due to a frame-shift, leading to truncated proteins of 204 and 213 aas, respectively.

  12. EBSD imaging of orientation relationships and variant groupings in different martensitic alloys and Widmanstätten iron meteorites

    SciTech Connect

    Cayron, Cyril

    2014-08-15

    An automatic method to colorize and quantify the classical Pitsch, Kurdjumov–Sachs, Greninger–Troiano and Nishiyama–Wasserman orientation relationships in the electron backscatter diffraction maps of martensitic/bainitic steels is detailed. Automatic analysis of variant grouping is also presented. The method was applied to low and high carbon steels, and to iron–nickel Widmanstätten meteorites. Many results of recent literature are confirmed. In low carbon steels the individual laths exhibit continuous orientation gradients between the classical orientation relationships, and the laths tend to be grouped by close-packed plane (morphological) packets. A crystallographic scenario describing the formation of the packets is proposed on the base of the one-step model. When the carbon content increases, the orientation spreading is reduced; and martensite tends to form plate groups and burst configurations. In iron–nickel meteorites, the centimeter long Widmanstätten laths do not exhibit continuous orientation gradients but are constituted of subgrains with uniform orientation relationship; the kamacite grains in the plessite regions are grouped into Bain zones, probably due to a recrystallization during the slow cooling of the meteorites. - Highlights: • Analysis of different low and high carbon steels and Widmanstätten meteorites • Automatic color mapping of the classical orientation relationships in EBSD maps • Quantification of variant pairing and grouping tendencies • Crystallographic scenario for the formation of morphological packets.

  13. Global ridge orientation modeling for partial fingerprint identification.

    PubMed

    Wang, Yi Alice; Hu, Jiankun

    2011-01-01

    Identifying incomplete or partial fingerprints from a large fingerprint database remains a difficult challenge today. Existing studies on partial fingerprints focus on one-to-one matching using local ridge details. In this paper, we investigate the problem of retrieving candidate lists for matching partial fingerprints by exploiting global topological features. Specifically, we propose an analytical approach for reconstructing the global topology representation from a partial fingerprint. First, we present an inverse orientation model for describing the reconstruction problem. Then, we provide a general expression for all valid solutions to the inverse model. This allows us to preserve data fidelity in the existing segments while exploring missing structures in the unknown parts. We have further developed algorithms for estimating the missing orientation structures based on some a priori knowledge of ridge topology features. Our statistical experiments show that our proposed model-based approach can effectively reduce the number of candidates for pair-wised fingerprint matching, and thus significantly improve the system retrieval performance for partial fingerprint identification.

  14. Identification of hemoglobin variants by top-down mass spectrometry using selected diagnostic product ions.

    PubMed

    Coelho Graça, Didia; Hartmer, Ralf; Jabs, Wolfgang; Beris, Photis; Clerici, Lorella; Stoermer, Carsten; Samii, Kaveh; Hochstrasser, Denis; Tsybin, Yury O; Scherl, Alexander; Lescuyer, Pierre

    2015-04-01

    Hemoglobin disorder diagnosis is a complex procedure combining several analytical steps. Due to the lack of specificity of the currently used protein analysis methods, the identification of uncommon hemoglobin variants (proteoforms) can become a hard task to accomplish. The aim of this work was to develop a mass spectrometry-based approach to quickly identify mutated protein sequences within globin chain variants. To reach this goal, a top-down electron transfer dissociation mass spectrometry method was developed for hemoglobin β chain analysis. A diagnostic product ion list was established with a color code strategy allowing to quickly and specifically localize a mutation in the hemoglobin β chain sequence. The method was applied to the analysis of rare hemoglobin β chain variants and an (A)γ-β fusion protein. The results showed that the developed data analysis process allows fast and reliable interpretation of top-down electron transfer dissociation mass spectra by nonexpert users in the clinical area.

  15. Resequencing Pathogen Microarray (RPM) for prospective detection and identification of emergent pathogen strains and variants

    NASA Astrophysics Data System (ADS)

    Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David

    2010-04-01

    High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.

  16. A new system identification approach to identify genetic variants in sequencing studies for a binary phenotype.

    PubMed

    Kang, Guolian; Bi, Wenjian; Zhao, Yanlong; Zhang, Ji-Feng; Yang, Jun J; Xu, Heng; Loh, Mignon L; Hunger, Stephen P; Relling, Mary V; Pounds, Stanley; Cheng, Cheng

    2014-01-01

    We propose in this paper a set-valued (SV) system model, which is a generalized form of logistic (LG) and Probit (Probit) regression, to be considered as a method for discovering genetic variants, especially rare genetic variants in next-generation sequencing studies, for a binary phenotype. We propose a new SV system identification method to estimate all underlying key system parameters for the Probit model and compare it with the LG model in the setting of genetic association studies. Across an extensive series of simulation studies, the Probit method maintained type I error control and had similar or greater power than the LG method, which is robust to different distributions of noise: logistic, normal, or t distributions. Additionally, the Probit association parameter estimate was 2.7-46.8-fold less variable than the LG log-odds ratio association parameter estimate. Less variability in the association parameter estimate translates to greater power and robustness across the spectrum of minor allele frequencies (MAFs), and these advantages are the most pronounced for rare variants. For instance, in a simulation that generated data from an additive logistic model with an odds ratio of 7.4 for a rare single nucleotide polymorphism with a MAF of 0.005 and a sample size of 2,300, the Probit method had 60% power whereas the LG method had 25% power at the α = 10(-6) level. Consistent with these simulation results, the set of variants identified by the LG method was a subset of those identified by the Probit method in two example analyses. Thus, we suggest the Probit method may be a competitive alternative to the LG method in genetic association studies such as candidate gene, genome-wide, or next-generation sequencing studies for a binary phenotype.

  17. Identification of lung cancer histology-specific variants applying Bayesian framework variant prioritization approaches within the TRICL and ILCCO consortia

    PubMed Central

    Brenner, Darren R.; Amos, Christopher I.; Brhane, Yonathan; Timofeeva, Maria N.; Caporaso, Neil; Wang, Yufei; Christiani, David C.; Bickeböller, Heike; Yang, Ping; Albanes, Demetrius; Stevens, Victoria L.; Gapstur, Susan; McKay, James; Boffetta, Paolo; Zaridze, David; Szeszenia-Dabrowska, Neonilia; Lissowska, Jolanta; Rudnai, Peter; Fabianova, Eleonora; Mates, Dana; Bencko, Vladimir; Foretova, Lenka; Janout, Vladimir; Krokan, Hans E.; Skorpen, Frank; Gabrielsen, Maiken E.; Vatten, Lars; Njølstad, Inger; Chen, Chu; Goodman, Gary; Lathrop, Mark; Vooder, Tõnu; Välk, Kristjan; Nelis, Mari; Metspalu, Andres; Broderick, Peter; Eisen, Timothy; Wu, Xifeng; Zhang, Di; Chen, Wei; Spitz, Margaret R.; Wei, Yongyue; Su, Li; Xie, Dong; She, Jun; Matsuo, Keitaro; Matsuda, Fumihiko; Ito, Hidemi; Risch, Angela; Heinrich, Joachim; Rosenberger, Albert; Muley, Thomas; Dienemann, Hendrik; Field, John K.; Raji, Olaide; Chen, Ying; Gosney, John; Liloglou, Triantafillos; Davies, Michael P.A.; Marcus, Michael; McLaughlin, John; Orlow, Irene; Han, Younghun; Li, Yafang; Zong, Xuchen; Johansson, Mattias; Liu, Geoffrey; Tworoger, Shelley S.; Le Marchand, Loic; Henderson, Brian E.; Wilkens, Lynne R.; Dai, Juncheng; Shen, Hongbing; Houlston, Richard S.; Landi, Maria T.; Brennan, Paul; Hung, Rayjean J.

    2015-01-01

    Large-scale genome-wide association studies (GWAS) have likely uncovered all common variants at the GWAS significance level. Additional variants within the suggestive range (0.0001> P > 5×10−8) are, however, still of interest for identifying causal associations. This analysis aimed to apply novel variant prioritization approaches to identify additional lung cancer variants that may not reach the GWAS level. Effects were combined across studies with a total of 33456 controls and 6756 adenocarcinoma (AC; 13 studies), 5061 squamous cell carcinoma (SCC; 12 studies) and 2216 small cell lung cancer cases (9 studies). Based on prior information such as variant physical properties and functional significance, we applied stratified false discovery rates, hierarchical modeling and Bayesian false discovery probabilities for variant prioritization. We conducted a fine mapping analysis as validation of our methods by examining top-ranking novel variants in six independent populations with a total of 3128 cases and 2966 controls. Three novel loci in the suggestive range were identified based on our Bayesian framework analyses: KCNIP4 at 4p15.2 (rs6448050, P = 4.6×10−7) and MTMR2 at 11q21 (rs10501831, P = 3.1×10−6) with SCC, as well as GAREM at 18q12.1 (rs11662168, P = 3.4×10−7) with AC. Use of our prioritization methods validated two of the top three loci associated with SCC (P = 1.05×10−4 for KCNIP4, represented by rs9799795) and AC (P = 2.16×10−4 for GAREM, represented by rs3786309) in the independent fine mapping populations. This study highlights the utility of using prior functional data for sequence variants in prioritization analyses to search for robust signals in the suggestive range. PMID:26363033

  18. Identification of genetic variants associated with alternative splicing using sQTLseekeR

    PubMed Central

    Monlong, Jean; Calvo, Miquel; Ferreira, Pedro G.; Guigó, Roderic

    2014-01-01

    Identification of genetic variants affecting splicing in RNA sequencing population studies is still in its infancy. Splicing phenotype is more complex than gene expression and ought to be treated as a multivariate phenotype to be recapitulated completely. Here we represent the splicing pattern of a gene as the distribution of the relative abundances of a gene’s alternative transcript isoforms. We develop a statistical framework that uses a distance-based approach to compute the variability of splicing ratios across observations, and a non-parametric analogue to multivariate analysis of variance. We implement this approach in the R package sQTLseekeR and use it to analyze RNA-Seq data from the Geuvadis project in 465 individuals. We identify hundreds of single nucleotide polymorphisms (SNPs) as splicing QTLs (sQTLs), including some falling in genome-wide association study SNPs. By developing the appropriate metrics, we show that sQTLseekeR compares favorably with existing methods that rely on univariate approaches, predicting variants that behave as expected from mutations affecting splicing. PMID:25140736

  19. Multi-species Identification of Polymorphic Peptide Variants via Propagation in Spectral Networks

    SciTech Connect

    Na, Seungjin; Payne, Samuel H.; Bandeira, Nuno

    2016-09-08

    The spectral networks approach enables the detection of pairs of spectra from related peptides and thus allows for the propagation of annotations from identified peptides to unidentified spectra. Beyond allowing for unbiased discovery of unexpected post-translational modifications, spectral networks are also applicable to multi-species comparative proteomics or metaproteomics to identify numerous orthologous versions of a protein. We present algorithmic and statistical advances in spectral networks that have made it possible to rigorously assess the statistical significance of spectral pairs and accurately estimate the error rate of identifications via propagation. In the analysis of three related Cyanothece species, a model organism for biohydrogen production, spectral networks identified peptides with highly divergent sequences with up to dozens of variants per peptide, including many novel peptides in species that lack a sequenced genome. Furthermore, spectral networks strongly suggested the presence of novel peptides even in genomically characterized species (i.e. missing from databases) in that a significant portion of unidentified multi-species networks included at least two polymorphic peptide variants.

  20. Panel sequencing for clinically oriented variant screening and copy number detection in 142 untreated multiple myeloma patients

    PubMed Central

    Kortuem, K M; Braggio, E; Bruins, L; Barrio, S; Shi, C S; Zhu, Y X; Tibes, R; Viswanatha, D; Votruba, P; Ahmann, G; Fonseca, R; Jedlowski, P; Schlam, I; Kumar, S; Bergsagel, P L; Stewart, A K

    2016-01-01

    We employed a customized Multiple Myeloma (MM)-specific Mutation Panel (M3P) to screen a homogenous cohort of 142 untreated MM patients for relevant mutations in a selection of disease-specific genes. M3Pv2.0 includes 77 genes selected for being either actionable targets, potentially related to drug–response or part of known key pathways in MM biology. We identified mutations in potentially actionable genes in 49% of patients and provided prognostic evidence of STAT3 mutations. This panel may serve as a practical alternative to more comprehensive sequencing approaches, providing genomic information in a timely and cost-effective manner, thus allowing clinically oriented variant screening in MM. PMID:26918361

  1. Evaluating alignment and variant-calling software for mutation identification in C. elegans by whole-genome sequencing

    PubMed Central

    Yun, Sijung

    2017-01-01

    Whole-genome sequencing is a powerful tool for analyzing genetic variation on a global scale. One particularly useful application is the identification of mutations obtained by classical phenotypic screens in model species. Sequence data from the mutant strain is aligned to the reference genome, and then variants are called to generate a list of candidate alleles. A number of software pipelines for mutation identification have been targeted to C. elegans, with particular emphasis on ease of use, incorporation of mapping strain data, subtraction of background variants, and similar criteria. Although success is predicated upon the sensitive and accurate detection of candidate alleles, relatively little effort has been invested in evaluating the underlying software components that are required for mutation identification. Therefore, we have benchmarked a number of commonly used tools for sequence alignment and variant calling, in all pair-wise combinations, against both simulated and actual datasets. We compared the accuracy of those pipelines for mutation identification in C. elegans, and found that the combination of BBMap for alignment plus FreeBayes for variant calling offers the most robust performance. PMID:28333980

  2. Evaluating alignment and variant-calling software for mutation identification in C. elegans by whole-genome sequencing.

    PubMed

    Smith, Harold E; Yun, Sijung

    2017-01-01

    Whole-genome sequencing is a powerful tool for analyzing genetic variation on a global scale. One particularly useful application is the identification of mutations obtained by classical phenotypic screens in model species. Sequence data from the mutant strain is aligned to the reference genome, and then variants are called to generate a list of candidate alleles. A number of software pipelines for mutation identification have been targeted to C. elegans, with particular emphasis on ease of use, incorporation of mapping strain data, subtraction of background variants, and similar criteria. Although success is predicated upon the sensitive and accurate detection of candidate alleles, relatively little effort has been invested in evaluating the underlying software components that are required for mutation identification. Therefore, we have benchmarked a number of commonly used tools for sequence alignment and variant calling, in all pair-wise combinations, against both simulated and actual datasets. We compared the accuracy of those pipelines for mutation identification in C. elegans, and found that the combination of BBMap for alignment plus FreeBayes for variant calling offers the most robust performance.

  3. Multi-species Identification of Polymorphic Peptide Variants via Propagation in Spectral Networks*

    PubMed Central

    Bandeira, Nuno

    2016-01-01

    Peptide and protein identification remains challenging in organisms with poorly annotated or rapidly evolving genomes, as are commonly encountered in environmental or biofuels research. Such limitations render tandem mass spectrometry (MS/MS) database search algorithms ineffective as they lack corresponding sequences required for peptide-spectrum matching. We address this challenge with the spectral networks approach to (1) match spectra of orthologous peptides across multiple related species and then (2) propagate peptide annotations from identified to unidentified spectra. We here present algorithms to assess the statistical significance of spectral alignments (Align-GF), reduce the impurity in spectral networks, and accurately estimate the error rate in propagated identifications. Analyzing three related Cyanothece species, a model organism for biohydrogen production, spectral networks identified peptides from highly divergent sequences from networks with dozens of variant peptides, including thousands of peptides in species lacking a sequenced genome. Our analysis further detected the presence of many novel putative peptides even in genomically characterized species, thus suggesting the possibility of gaps in our understanding of their proteomic and genomic expression. A web-based pipeline for spectral networks analysis is available at http://proteomics.ucsd.edu/software. PMID:27609420

  4. Skeletal idiopathic osteosclerosis helps to perform personal identification of unknown decedents: A novel contribution from anatomical variants through CT scan.

    PubMed

    De Angelis, D; Gibelli, D; Palazzo, E; Sconfienza, L; Obertova, Z; Cattaneo, C

    2016-07-01

    Personal identification consists of the comparison of ante-mortem information from a missing person with post-mortem data obtained from an unidentified corpse. Such procedure is based on the assessment of individualizing features which may help in providing a conclusive identification between ante-mortem and post-mortem material. Anatomical variants may provide important clues to correctly identify human remains. Areas of idiopathic osteosclerosis (IO), or dense bone islands (DBIs) characterized by radiopaque areas of dense, trabeculated, non-inflamed vital bone represent one of these, potentially individualizing, anatomical features. This study presents a case where the finding of DBI was crucial for a positive identification through CT-scan. A decomposed body was found in an apartment in June 2014 in advanced decomposition and no dental records were available to perform a comparison for positive identification. Genetic tests were not applicable because of the lack of relatives in a direct line. The analysis of the only ante-mortem documentation, a CT-scan to the deceased dating back to August 2009, showed the presence of three DBIs within the trabecular bone of the proximal portion of the right femur. The same bony district was removed from the corpse during the autopsy and analysed by CT-scan, which verified the presence of the same features. Forensic practitioners should therefore be aware of the great importance of anatomical bone variants, such as dense bone islands for identification purposes, and the importance of advanced radiological technique for addressing the individualizing potential of such variants. We propose that anatomical variants of the human skeleton should be considered as being "primary identification characteristics" similar to dental status, fingerprints and DNA.

  5. Identification of interleukin-26 in the dromedary camel (Camelus dromedarius): Evidence of alternative splicing and isolation of novel splice variants.

    PubMed

    Premraj, Avinash; Nautiyal, Binita; Aleyas, Abi G; Rasool, Thaha Jamal

    2015-10-01

    Interleukin-26 (IL-26) is a member of the IL-10 family of cytokines. Though conserved across vertebrates, the IL-26 gene is functionally inactivated in a few mammals like rat, mouse and horse. We report here the identification, isolation and cloning of the cDNA of IL-26 from the dromedary camel. The camel cDNA contains a 516 bp open reading frame encoding a 171 amino acid precursor protein, including a 21 amino acid signal peptide. Sequence analysis revealed high similarity with other mammalian IL-26 homologs and the conservation of IL-10 cytokine family domain structure including key amino acid residues. We also report the identification and cloning of four novel transcript variants produced by alternative splicing at the Exon 3-Exon 4 regions of the gene. Three of the alternative splice variants had premature termination codons and are predicted to code for truncated proteins. The transcript variant 4 (Tv4) having an insertion of an extra 120 bp nucleotides in the ORF was predicted to encode a full length protein product with 40 extra amino acid residues. The mRNA transcripts of all the variants were identified in lymph node, where as fewer variants were observed in other tissues like blood, liver and kidney. The expression of Tv2 and Tv3 were found to be up regulated in mitogen induced camel peripheral blood mononuclear cells. IL-26-Tv2 expression was also induced in camel fibroblast cells infected with Camel pox virus in-vitro. The identification of the transcript variants of IL-26 from the dromedary camel is the first report of alternative splicing for IL-26 in a species in which the gene has not been inactivated.

  6. Identification of copy number variants in whole-genome data using Reference Coverage Profiles.

    PubMed

    Glusman, Gustavo; Severson, Alissa; Dhankani, Varsha; Robinson, Max; Farrah, Terry; Mauldin, Denise E; Stittrich, Anna B; Ament, Seth A; Roach, Jared C; Brunkow, Mary E; Bodian, Dale L; Vockley, Joseph G; Shmulevich, Ilya; Niederhuber, John E; Hood, Leroy

    2015-01-01

    The identification of DNA copy numbers from short-read sequencing data remains a challenge for both technical and algorithmic reasons. The raw data for these analyses are measured in tens to hundreds of gigabytes per genome; transmitting, storing, and analyzing such large files is cumbersome, particularly for methods that analyze several samples simultaneously. We developed a very efficient representation of depth of coverage (150-1000× compression) that enables such analyses. Current methods for analyzing variants in whole-genome sequencing (WGS) data frequently miss copy number variants (CNVs), particularly hemizygous deletions in the 1-100 kb range. To fill this gap, we developed a method to identify CNVs in individual genomes, based on comparison to joint profiles pre-computed from a large set of genomes. We analyzed depth of coverage in over 6000 high quality (>40×) genomes. The depth of coverage has strong sequence-specific fluctuations only partially explained by global parameters like %GC. To account for these fluctuations, we constructed multi-genome profiles representing the observed or inferred diploid depth of coverage at each position along the genome. These Reference Coverage Profiles (RCPs) take into account the diverse technologies and pipeline versions used. Normalization of the scaled coverage to the RCP followed by hidden Markov model (HMM) segmentation enables efficient detection of CNVs and large deletions in individual genomes. Use of pre-computed multi-genome coverage profiles improves our ability to analyze each individual genome. We make available RCPs and tools for performing these analyses on personal genomes. We expect the increased sensitivity and specificity for individual genome analysis to be critical for achieving clinical-grade genome interpretation.

  7. Team-oriented leadership: the interactive effects of leader group prototypicality, accountability, and team identification.

    PubMed

    Giessner, Steffen R; van Knippenberg, Daan; van Ginkel, Wendy; Sleebos, Ed

    2013-07-01

    We examined the interactive effects of leader group prototypicality, accountability, and team identification on team-oriented behavior of leaders, thus extending the social identity perspective on leadership to the study of leader behavior. An experimental study (N = 152) supported our hypothesis that leader accountability relates more strongly to team-oriented behavior for group nonprototypical leaders than for group prototypical leaders. A multisource field study with leaders (N = 64) and their followers (N = 209) indicated that this interactive effect is more pronounced for leaders who identify more strongly with their team. We discuss how these findings further develop the social identity analysis of leadership.

  8. Overcoming asymmetric goals in teams: the interactive roles of team learning orientation and team identification.

    PubMed

    Pearsall, Matthew J; Venkataramani, Vijaya

    2015-05-01

    Although members of teams share a common, ultimate objective, they often have asymmetric or conflicting individual goals that shape the way they contribute to, and pursue, the shared goal of the team. Compounding this problem, they are frequently unaware of the nature of these goal asymmetries or even the fact that such differences exist. Drawing on, and integrating, social interdependence and representational gaps theories, we identify 2 emergent states that combine interactively to enable teams to overcome asymmetric goals: team identification and team learning orientation. Using data from long-term, real-life teams that engaged in a computer simulation designed to create both asymmetric goals and representational gaps about those goals, we found that teams were most effective when they had a high learning orientation coupled with high team identification and that this effect was mediated by teams' ability to form more accurate team goal mental models and engage in effective planning processes. Implications for theory and practice are discussed.

  9. Identification of Three Novel Splicing Variants and Expression Analysis of Chicken GPR1 Gene

    PubMed Central

    Zhang, Xueyou; Xiao, Qihai; Tian, Kai; Zhao, Xiaoling; Yin, Huadong; Li, Diyan

    2017-01-01

    GPR1 is a G protein-coupled receptor that plays critical roles in eukaryotic cells: typically, response to glucose stimulation, lipid accumulation, and transmitting nutrition signals to cAMP pathway. However, the alternative splicing of the GPR1 gene and its expression pattern in chicken tissues and ovarian follicles were unknown. In our current study, we used RACE-PCR to identify three GPR1 variants, including the full-length variant (GPR1-va1) and two alternatively spliced variants (GPR1-va2, GPR1-vb). Quantitative real-time PCR examined the expression pattern of GPR1 mRNA in chicken tissues and ovarian follicles. The result reveals that the coding sequence of the three variants cDNA is 1053, 1053, and 627 bp in length, encoding 350, 350, and 208 amino acids, respectively. The three variants of GPR1 show similar tissue distributions; GPR1 expression was abundant in the abdominal fat, lung, and heart. With the follicular development, the expression of GPR1 gene gradually increased, and GPR1-va1 and GPR1-va2 spliced variants expression in F2 were significantly higher than in F5, F4, and prehierarchical follicles (P < 0.05). Taken together, we found three novel variants of GPR1, and the results of GPR1 expression profiling in adipose tissues and ovarian follicles suggest that GPR1 may play a significant role in the lipid accumulation and progression of follicular development. PMID:28203567

  10. An Optimal Weighted Aggregated Association Test for Identification of Rare Variants Involved in Common Diseases

    PubMed Central

    Sul, Jae Hoon; Han, Buhm; He, Dan; Eskin, Eleazar

    2011-01-01

    The advent of next generation sequencing technologies allows one to discover nearly all rare variants in a genomic region of interest. This technological development increases the need for an effective statistical method for testing the aggregated effect of rare variants in a gene on disease susceptibility. The idea behind this approach is that if a certain gene is involved in a disease, many rare variants within the gene will disrupt the function of the gene and are associated with the disease. In this article, we present the rare variant weighted aggregate statistic (RWAS), a method that groups rare variants and computes a weighted sum of differences between case and control mutation counts. We show that our method outperforms the groupwise association test of Madsen and Browning in the disease-risk model that assumes that each variant makes an equally small contribution to disease risk. In addition, we can incorporate prior information into our method of which variants are likely causal. By using simulated data and real mutation screening data of the susceptibility gene for ataxia telangiectasia, we demonstrate that prior information has a substantial influence on the statistical power of association studies. Our method is publicly available at http://genetics.cs.ucla.edu/rarevariants. PMID:21368279

  11. Outperforming whom? A multilevel study of performance-prove goal orientation, performance, and the moderating role of shared team identification.

    PubMed

    Dietz, Bart; van Knippenberg, Daan; Hirst, Giles; Restubog, Simon Lloyd D

    2015-11-01

    Performance-prove goal orientation affects performance because it drives people to try to outperform others. A proper understanding of the performance-motivating potential of performance-prove goal orientation requires, however, that we consider the question of whom people desire to outperform. In a multilevel analysis of this issue, we propose that the shared team identification of a team plays an important moderating role here, directing the performance-motivating influence of performance-prove goal orientation to either the team level or the individual level of performance. A multilevel study of salespeople nested in teams supports this proposition, showing that performance-prove goal orientation motivates team performance more with higher shared team identification, whereas performance-prove goal orientation motivates individual performance more with lower shared team identification. Establishing the robustness of these findings, a second study replicates them with individual and team performance in an educational context.

  12. Object-oriented industrial solid waste identification using HJ satellite imagery: a case study of phosphogypsum

    NASA Astrophysics Data System (ADS)

    Fu, Zhuo; Shen, Wenming; Xiao, Rulin; Xiong, Wencheng; Shi, Yuanli; Chen, Baisong

    2012-10-01

    The increasing volume of industrial solid wastes presents a critical problem for the global environment. In the detection and monitoring of these industrial solid wastes, the traditional field methods are generally expensive and time consuming. With the advantages of quick observations taken at a large area, remote sensing provides an effective means for detecting and monitoring the industrial solid wastes in a large scale. In this paper, we employ an object-oriented method for detecting the industrial solid waste from HJ satellite imagery. We select phosphogypsum which is a typical industrial solid waste as our target. Our study area is located in Fuquan in Guizhou province of China. The object oriented method we adopted consists of the following steps: 1) Multiresolution segmentation method is adopted to segment the remote sensing images for obtaining the object-based images. 2) Build the feature knowledge set of the object types. 3) Detect the industrial solid wastes based on the object-oriented decision tree rule set. We analyze the heterogeneity in features of different objects. According to the feature heterogeneity, an object-oriented decision tree rule set is then built for aiding the identification of industrial solid waste. Then, based on this decision tree rule set, the industrial solid waste can be identified automatically from remote sensing images. Finally, the identified results are validated using ground survey data. Experiments and results indicate that the object-oriented method provides an effective method for detecting industrial solid wastes.

  13. Evaluation of BBL CHROMagar orientation medium for detection and presumptive identification of urinary tract pathogens.

    PubMed Central

    Hengstler, K A; Hammann, R; Fahr, A M

    1997-01-01

    The microbiological performance of BBL CHROMagar Orientation medium and CPS ID2 agar was compared to that of Columbia agar with 5% sheep blood and MacConkey agar without crystal violet for the enumeration and presumptive identification of bacteria responsible for urinary tract infections. Of a total of 658 clinical urine specimens, 118 specimens yielded no growth, 402 specimens yielded growth with cell counts of > or = 10(5) CFU/ml, and 138 specimens yielded growth with cell counts of < 10(5) CFU/ml. Of the specimens with cell counts of > or = 10(5) CFU/ml, 163 were pure cultures and 239 were mixed cultures. A total of 266 Escherichia coli organisms were isolated on both chromogenic media, 260 were isolated on blood agar, and 248 were isolated on MacConkey agar. One strain (0.4%) failed to develop the expected pink color on CHROMagar Orientation medium, and 23 strains (8.7%) failed to develop the expected pink color on CPS ID2 agar. Enterococci (CHROMagar Orientation medium, n = 266; CPS ID2 agar, n = 265) produced small blue-green colonies on both chromogenic media. Fifty of the mixed cultures contained enterococci that were detected only on the chromogenic media. The Klebsiella-Enterobacter-Serratia (KES) and the Proteus-Morganella-Providencia (PMP) groups could be identified on both chromogenic media. Of 66 isolates of the KES group, 63 grew with the expected color on CHROMagar Orientation medium and 58 of 64 isolates grew with the expected color on CPS ID2 agar. Other microorganisms required further identification. The use of chromogenic medium formulations offers a time-saving method for the reliable detection, enumeration, and presumptive identification of urinary tract pathogens. One of the greatest advantages of these media is the easy recognition of mixed cultures. PMID:9350731

  14. Identification and in vivo functional characterization of novel compound heterozygous BMP1 variants in osteogenesis imperfecta.

    PubMed

    Cho, Sung Yoon; Asharani, P V; Kim, Ok-Hwa; Iida, Aritoshi; Miyake, Noriko; Matsumoto, Naomichi; Nishimura, Gen; Ki, Chang-Seok; Hong, Geehay; Kim, Su Jin; Sohn, Young Bae; Park, Sung Won; Lee, Jieun; Kwun, Younghee; Carney, Thomas J; Huh, Rimm; Ikegawa, Shiro; Jin, Dong-Kyu

    2015-02-01

    Osteogenesis imperfecta (OI) comprises a heterogeneous group of disorders that are characterized by susceptibility to bone fractures, and range in severity from a subtle increase in fracture frequency to death in the perinatal period. Most patients have defects in type I collagen biosynthesis with autosomal-dominant inheritance, but many autosomal-recessive genes have been reported. We applied whole-exome sequencing to identify mutations in a Korean OI patient who had an umbilical hernia, frequent fractures, a markedly short stature, delayed motor development, scoliosis, and dislocation of the radial head, with a bowed radius and ulna. We identified two novel variants in the BMP1 gene: c.808A>G and c.1297G>T. The former variant caused a missense change p.(Met270Val) and the latter variant caused the skipping of exon 10. The hypofunctional nature of the two variants was demonstrated in a zebrafish assay.

  15. Identification of polymorphisms and sequence variants in the human homologue of the mouse natural resistance-associated macrophage protein gene

    SciTech Connect

    Liu, Jing; Fujiwara, T.M.; Buu, N.T.; Sanchez, F.O.; Cellier, M.; Paradis, A.J.; Frappier, D.; Skamene, E.; Gros, P.; Morgan, K.

    1995-04-01

    The most common mycobacterial disease in humans is tuberculosis, and there is evidence for genetic factors in susceptibility to tuberculosis. In the mouse, the Bcg gene controls macrophage priming for activation and is a major gene for susceptibility to infection with mycobacteria. A candidate gene for Bcg was identified by positional cloning and was designated {open_quotes}natural resistance-associated macrophage protein gene{close_quotes} (Nramp1), and the human homologue (NRAMP1) has recently been cloned. Here we report (1) the physical mapping NRAMP1 close to VIL in chromosome region 2q35 by PCR analysis of somatic cell hybrids and YAC cloning and (2) the identification of nine sequence variants in NRAMP1. Of the four variants in the coding region, there were two missense mutations and two silent substitutions. The missense mutations were a conservative alanine-to-valine substitution at codon 318 in exon9 and an aspartic acid-to-asparagine substitution at codon 543 in the predicted cytoplasmic tail of the NRAMP1 protein. A microsatellite was located in the immediate 5{prime} region of the gene, three variants were in introns, and one variant was located in the 3{prime} UTR. The allele frequencies of each of the nine variants were determined in DNA samples of 60 Caucasians and 20 Asians. In addition, we have physically linked two highly polymorphic microsatellite markers, D2S104 and D2S173, to NRAMP1 on a 1.5-Mb YAC contig. These molecular markers will be useful to assess the role of NRAMP1 in susceptibility to tuberculosis and other macrophage-mediated diseases. 40 refs., 3 figs., 2 tabs.

  16. Identification of androgen receptor variants in testis from humans and other vertebrates.

    PubMed

    Laurentino, S S; Pinto, P I S; Tomás, J; Cavaco, J E; Sousa, M; Barros, A; Power, D M; Canário, A V M; Socorro, S

    2013-06-01

    The androgen receptor (AR) is a ligand-activated transcription factor member of the nuclear receptor superfamily. The existence of alternatively spliced variants is well recognised for several members of this superfamily, most of them having functional importance. For example, several testicular oestrogen receptor variants have been suggested to play a role in the regulation of spermatogenesis. However, information on AR variants is mostly related to cancer and androgen insensitivity syndrome (AIS) cases. The objective of this study was to investigate the expression of AR variants in the testis from humans and other vertebrates. Four AR variants [ARΔ2(Stop) , ARΔ2(23Stop) , ARΔ3 and ARΔ4(120)] were identified in human testis. ARΔ2(Stop) and ARΔ3, with exon 2 or 3 deleted, respectively, were also expressed in human liver, lung, kidney and heart. In addition, ARΔ2(Stop) was expressed in rat and gilthead seabream testis, while an ARΔ3 was detected in African clawed frog testis. This is the first report revealing the existence of AR variants in the testis of evolutionarily distant vertebrate species and in nonpathological tissues. These data suggest the functional importance of these novel AR forms and demonstrate a complexity in AR signalling that is not exclusive of pathological conditions.

  17. Ultrasensitive Identification of Localization Variants of Modified Peptides Using Ion Mobility Spectrometry

    SciTech Connect

    Ibrahim, Yehia M.; Shvartsburg, Alexandre A.; Smith, Richard D.; Belov, Mikhail E.

    2011-05-28

    Localization of the modification sites on peptides is challenging, particularly when multiple modifications or mixtures of localization isomers (variants) are involved. Such variants commonly coelute in liquid chromatography and may be undistinguishable in tandem mass spectrometry (MS/MS) for lack of unique fragments. Here, we have resolved the variants of singly and doubly phosphorylated peptides employing drift tube ion mobility spectrometry (IMS) coupled to time-of-flight mass spectrometry. Even with a moderate IMS resolving power of ~80, substantial separation was achieved for both 2+ and 3+ ions normally generated by electrospray ionization, including for the variant indistinguishable by MS/MS. Variants often exhibit a distribution of 3-D conformers, which can be adjusted for optimum IMS separation by prior field heating of ions in a funnel trap. The peak assignments were confirmed using MS/MS after IMS separation, but known species could be identified using just the ion mobility "tag". Avoiding the MS/MS step lowers the detection limit of localization variants to <100 attomoles, an order of magnitude better than provided by electron transfer dissociation in an Orbitrap MS.

  18. Identification of BRCA1 missense substitutions that confer partial functional activity: potential moderate risk variants?

    PubMed Central

    Lovelock, Paul K; Spurdle, Amanda B; Mok, Myth TS; Farrugia, Daniel J; Lakhani, Sunil R; Healey, Sue; Arnold, Stephen; Buchanan, Daniel; Investigators, kConFab; Couch, Fergus J; Henderson, Beric R; Goldgar, David E; Tavtigian, Sean V; Chenevix-Trench, Georgia; Brown, Melissa A

    2007-01-01

    Introduction Many of the DNA sequence variants identified in the breast cancer susceptibility gene BRCA1 remain unclassified in terms of their potential pathogenicity. Both multifactorial likelihood analysis and functional approaches have been proposed as a means to elucidate likely clinical significance of such variants, but analysis of the comparative value of these methods for classifying all sequence variants has been limited. Methods We have compared the results from multifactorial likelihood analysis with those from several functional analyses for the four BRCA1 sequence variants A1708E, G1738R, R1699Q, and A1708V. Results Our results show that multifactorial likelihood analysis, which incorporates sequence conservation, co-inheritance, segregation, and tumour immunohistochemical analysis, may improve classification of variants. For A1708E, previously shown to be functionally compromised, analysis of oestrogen receptor, cytokeratin 5/6, and cytokeratin 14 tumour expression data significantly strengthened the prediction of pathogenicity, giving a posterior probability of pathogenicity of 99%. For G1738R, shown to be functionally defective in this study, immunohistochemistry analysis confirmed previous findings of inconsistent 'BRCA1-like' phenotypes for the two tumours studied, and the posterior probability for this variant was 96%. The posterior probabilities of R1699Q and A1708V were 54% and 69%, respectively, only moderately suggestive of increased risk. Interestingly, results from functional analyses suggest that both of these variants have only partial functional activity. R1699Q was defective in foci formation in response to DNA damage and displayed intermediate transcriptional transactivation activity but showed no evidence for centrosome amplification. In contrast, A1708V displayed an intermediate transcriptional transactivation activity and a normal foci formation response in response to DNA damage but induced centrosome amplification. Conclusion

  19. Identification of Gender-Specific Genetic Variants in Patients With Bicuspid Aortic Valve.

    PubMed

    Dargis, Natasha; Lamontagne, Maxime; Gaudreault, Nathalie; Sbarra, Laura; Henry, Cyndi; Pibarot, Philippe; Mathieu, Patrick; Bossé, Yohan

    2016-02-01

    Bicuspid aortic valve (BAV) is the most frequent congenital heart defect and has a male predominance of 3 to 1. A large proportion of patients develop valvular and aortic complications. Despite the high prevalence of BAV, its cause and genetic origins remain elusive. The goal of this study was to identify genetic variants associated with BAV. Nine genes previously associated with BAV (NOTCH1, AXIN1, EGFR, ENG, GATA5, NKX2-5, NOS3, PDIA2, and TGFBR2) were sequenced in 48 patients with BAV using the Ion Torrent Personal Genome Machine. Pathogenicity of genetic variants was evaluated with the Combined Annotation Dependent Depletion framework. A selection of 89 variants identified by sequencing or in previous BAV genetic studies was genotyped, and allele frequencies were compared in 323 patients with BAV confirmed at surgery and 584 controls. Analyses were also performed by gender. Nine novel and 19 potentially pathogenic variants were identified by next-generation sequencing and confirmed by Sanger sequencing, but they were not associated with BAV in the case-control population. A significant association was observed between an in silico-predicted benign EGFR intronic variant (rs17290301) and BAV. Analyses performed by gender revealed different variants associated with BAV in men (EGFR rs533525993 and TEX26 rs12857479) and women (NOTCH1 rs61751489, TGFBR2 rs1155705, and NKX2-5 rs2277923). In conclusion, these results constitute the first association between EGFR genetic variants and BAV in humans and support a possible role of gender-specific polymorphisms in the development of BAV.

  20. Identification of STRA6 and SKI sequence variants in patients with anophthalmia/microphthalmia

    PubMed Central

    White, Tristan; Lu, Tianyi; Metlapally, Ravikanth; Katowitz, James; Kherani, Femida; Wang, Tian-Yuan; Tran-Viet, Khanh-Nhat

    2008-01-01

    Purpose Anophthalmia and microphthalmia (A/M) are rare congenital ocular malformations presenting with the absence of eye components or small eyes with or without structural abnormalities. A/M can be isolated or syndromic. The stimulated by retinoic acid gene 6 (STRA6) and Sloan-Kettering viral oncogene homolog (SKI) genes are involved in vitamin A metabolism, and are implicated with A/M developmental abnormalities in human and animal studies. Vitamin A metabolism is vital to normal eye development and growth. This study explores the association of these genes in a cohort of subjects with A/M. Methods STRA6 and SKI were screened for sequence variants by direct sequencing of genomic DNA samples from 18 affected subjects with A/M. The DNA samples of 4 external, unrelated controls were initially screened. Eighty-nine additional unrelated controls were screened to confirm that any sequence variants found in the affected subject DNA samples were related to the phenotype. Coding regions, intron-exon boundaries, and untranslated regions were sequenced by standard techniques. Derived DNA sequences were compared to known reference sequences from public genomic databases. Results For STRA6, a novel coding non-synonymous sequence variant was found in one subject, resulting in an amino acid change from glycine to glutamic acid in residue 217. One novel nonsense sequence variant found in the same subject changed the STRA6 amino acid residue 592 from cytosine to thymine resulting in a premature stop codon. For SKI, a known coding non-synonymous sequence variant (rs28384811) was found in 3 subject DNA samples and 11/89 control DNA samples. Four novel coding-synonymous sequence variants were observed in SKI. Conclusions The STRA6 sequence variants reported in this study could play a role in the pathogenesis of A/M by structural changes to the STRA6 protein. We can attribute 4% A/M incidence in this cohort to these sequence variants. Although no SKI sequence variants were found in

  1. Identification of carriers of a variant plasma prealbumin (transthyretin) associated with familial amyloidotic polyneuropathy type I.

    PubMed Central

    Benson, M D; Dwulet, F E

    1985-01-01

    A method is described for detecting carriers of a variant plasma prealbumin that is associated with familial amyloidotic polyneuropathy (FAP) type I. It is based on the finding of an extra methionine in the variant prealbumin, at position 30 from the amino terminals. Since normal prealbumin has only one methionine (position 13), treatment with cyanogen bromide (CNBr), which cleaves only at methionines, results in two peptides. CNBr treatment of the variant prealbumin gives three peptides. The extra can then be detected in two ways: by HPLC using a reverse phase C18 column, and by sequential Edman degradation. Each method can detect as little as 1% variant prealbumin in isolated plasma prealbumin, and therefore, can identify carriers of the gene for the variant protein. Since FAP type I usually is not manifest until after the childbearing years, this method to identify carriers of the gene offers a new approach for genetic counseling of families with this disease. To date, kindreds with hereditary amyloidosis that could benefit from these studies include those with FAP type I of Swedish, Japanese, and Portuguese origins. PMID:2981253

  2. A low density microarray method for the identification of human papillomavirus type 18 variants.

    PubMed

    Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C

    2013-09-26

    We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings.

  3. A Low Density Microarray Method for the Identification of Human Papillomavirus Type 18 Variants

    PubMed Central

    Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B.; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C.

    2013-01-01

    We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings. PMID:24077317

  4. Approach/Avoidance Orientations Affect Self-Construal and Identification with In-group

    PubMed Central

    Nussinson, Ravit; Häfner, Michael; Seibt, Beate; Strack, Fritz; Trope, Yaacov

    2011-01-01

    Approach and avoidance are two basic motivational orientations. Their activation influences cognitive and perceptive processes: Previous work suggests that an approach orientation instigates a focus on larger units as compared to avoidance. Study 1 confirms this assumption using a paradigm that more directly taps a person’s tendency to represent objects as belonging to small or large units than prior studies. It was further predicted that the self should also be represented as belonging to larger units, and hence be more interdependent under approach than under avoidance. Study 2 supports this prediction. As a consequence of this focus on belonging to larger units, it was finally predicted that approach results in a stronger identification with one’s in-group than avoidance. Studies 3 and 4 support that prediction. PMID:22844229

  5. Identification of Blastocystis subtype 1 variants in the Home for Girls, Bangkok, Thailand.

    PubMed

    Thathaisong, Umaporn; Siripattanapipong, Suradej; Mungthin, Mathirut; Pipatsatitpong, Duangnate; Tan-ariya, Peerapan; Naaglor, Tawee; Leelayoova, Saovanee

    2013-02-01

    A cross-sectional study of Blastocystis infection was conducted to evaluate the prevalence, risk factors, and subtypes of Blastocystis at the Home for Girls, Bangkok, Thailand in November 2008. Of 370 stool samples, 118 (31.9%) were infected with Blastocystis. Genotypic characterization of Blastocystis was performed by polymerase chain reaction and sequence analysis of the partial small subunit ribosomal RNA (SSU rRNA) gene. Subtype 1 was the most predominant (94.8%), followed by subtype 6 (3.5%) and subtype 2 (1.7%). Sequence analyses revealed nucleotide polymorphisms for Blastocystis subtype 1, which were described as subtype 1/variant 1, subtype 1/variant 2. Blastocystis subtype 1/variant 1 was the most predominant infection occurring in almost every house. The results showed that subtype analysis of Blastocystis was useful for molecular epidemiological study.

  6. Identification of a Chicken Anemia Virus Variant-Related Gyrovirus in Stray Cats in China, 2012

    PubMed Central

    Liu, Yuanjia; Ji, Jun; Chen, Feng; Sun, Baoli; Xue, Chunyi; Ma, Jingyun; Bi, Yingzuo; Xie, Qingmei

    2014-01-01

    The chicken anemia virus (CAV), is a known member of the genus Gyrovirus and was first isolated from chickens in Japan in 1979. Some reports have also demonstrated that CAV can be identified in human stool specimens. In this study, a variant of CAV was detected using PCR with CAV-based primers in fecal samples of stray cats. The genome of CAV variant was sequenced and the results suggest that it could be a recombinant viral strain from parental CAV strains JQ690762 and AF311900. Recombination is an important evolutionary mechanism that contributes to genetic diversification. These findings indicate that CAV variant might have originated from CAV-infected chickens. The epidemiology and pathogenesis of this novel virus remains to be elucidated. This study underscores the importance of CAV surveillance and it presents the first evidence suggesting the possibility of CAV homologous recombination in cat. PMID:24689034

  7. Hybrid Approach for Language Identification Oriented to Multilingual Speech Recognition in the Basque Context

    NASA Astrophysics Data System (ADS)

    Barroso, N.; de Ipiña, K. López; Ezeiza, A.; Barroso, O.; Susperregi, U.

    The development of Multilingual Large Vocabulary Continuous Speech Recognition systems involves issues as: Language Identification, Acoustic-Phonetic Decoding, Language Modelling or the development of appropriated Language Resources. The interest on Multilingual Systems arouses because there are three official languages in the Basque Country (Basque, Spanish, and French), and there is much linguistic interaction among them, even if Basque has very different roots than the other two languages. This paper describes the development of a Language Identification (LID) system oriented to robust Multilingual Speech Recognition for the Basque context. The work presents hybrid strategies for LID, based on the selection of system elements by Support Vector Machines and Multilayer Perceptron classifiers and stochastic methods for speech recognition tasks (Hidden Markov Models and n-grams).

  8. In silico identification of new putative pathogenic variants in the NEU1 sialidase gene affecting enzyme function and subcellular localization.

    PubMed

    Bonardi, Dario; Ravasio, Viola; Borsani, Giuseppe; d'Azzo, Alessandra; Bresciani, Roberto; Monti, Eugenio; Giacopuzzi, Edoardo

    2014-01-01

    The NEU1 gene is the first identified member of the human sialidases, glycohydrolitic enzymes that remove the terminal sialic acid from oligosaccharide chains. Mutations in NEU1 gene are causative of sialidosis (MIM 256550), a severe lysosomal storage disorder showing autosomal recessive mode of inheritance. Sialidosis has been classified into two subtypes: sialidosis type I, a normomorphic, late-onset form, and sialidosis type II, a more severe neonatal or early-onset form. A total of 50 causative mutations are reported in HGMD database, most of which are missense variants. To further characterize the NEU1 gene and identify new functionally relevant protein isoforms, we decided to study its genetic variability in the human population using the data generated by two large sequencing projects: the 1000 Genomes Project (1000G) and the NHLBI GO Exome Sequencing Project (ESP). Together these two datasets comprise a cohort of 7595 sequenced individuals, making it possible to identify rare variants and dissect population specific ones. By integrating this approach with biochemical and cellular studies, we were able to identify new rare missense and frameshift alleles in NEU1 gene. Among the 9 candidate variants tested, only two resulted in significantly lower levels of sialidase activity (p<0.05), namely c.650T>C and c.700G>A. These two mutations give rise to the amino acid substitutions p.V217A and p.D234N, respectively. NEU1 variants including either of these two amino acid changes have 44% and 25% residual sialidase activity when compared to the wild-type enzyme, reduced protein levels and altered subcellular localization. Thus they may represent new, putative pathological mutations resulting in sialidosis type I. The in silico approach used in this study has enabled the identification of previously unknown NEU1 functional alleles that are widespread in the population and could be tested in future functional studies.

  9. Identification and functional characterization of four TRPA1 variants in Apolygus lucorum (Meyer-Dür)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As signal integrators that respond to various physical and chemical stimuli, transient receptor potential (TRP) channels fulfil critical functional roles in the sensory systems of both vertebrate and invertebrate organisms. Here, four variants of TRP ankyrin 1 (TRPA1) were identified and cloned from...

  10. Identification and functional characterization of NODAL rare variants in heterotaxy and isolated cardiovascular malformations

    PubMed Central

    Mohapatra, Bhagyalaxmi; Casey, Brett; Li, Hua; Ho-Dawson, Trang; Smith, Liana; Fernbach, Susan D.; Molinari, Laura; Niesh, Stephen R.; Jefferies, John Lynn; Craigen, William J.; Towbin, Jeffrey A.; Belmont, John W.; Ware, Stephanie M.

    2009-01-01

    NODAL and its signaling pathway are known to play a key role in specification and patterning of vertebrate embryos. Mutations in several genes encoding components of the NODAL signaling pathway have previously been implicated in the pathogenesis of human left–right (LR) patterning defects. Therefore, NODAL, a member of TGF-β superfamily of developmental regulators, is a strong candidate to be functionally involved in congenital LR axis patterning defects or heterotaxy. Here we have investigated whether variants in NODAL are present in patients with heterotaxy and/or isolated cardiovascular malformations (CVM) thought to be caused by abnormal heart tube looping. Analysis of a large cohort of cases (n = 269) affected with either classic heterotaxy or looping CVM revealed four different missense variants, one in-frame insertion/deletion and two conserved splice site variants in 14 unrelated subjects (14/269, 5.2%). Although similar with regard to other associated defects, individuals with the NODAL mutations had a significantly higher occurrence of pulmonary valve atresia (P = 0.001) compared with cases without a detectable NODAL mutation. Functional analyses demonstrate that the missense variant forms of NODAL exhibit significant impairment of signaling as measured by decreased Cripto (TDGF-1) co-receptor-mediated activation of artificial reporters. Expression of these NODAL proteins also led to reduced induction of Smad2 phosphorylation and impaired Smad2 nuclear import. Taken together, these results support a role for mutations and rare deleterious variants in NODAL as a cause for sporadic human LR patterning defects. PMID:19064609

  11. Identification of Variant-Specific Functions of PIK3CA by Rapid Phenotyping of Rare Mutations

    PubMed Central

    Dogruluk, Turgut; Tsang, Yiu Huen; Espitia, Maribel; Chen, Fengju; Chen, Tenghui; Chong, Zechen; Appadurai, Vivek; Dogruluk, Armel; Eterovic, Agna Karina; Bonnen, Penelope E.; Creighton, Chad J.; Chen, Ken; Mills, Gordon B.; Scott, Kenneth L.

    2015-01-01

    Large-scale sequencing efforts are uncovering the complexity of cancer genomes, which are comprised of causal “driver” mutations that promote tumor progression along with many more pathologically-neutral “passenger” events. The majority of mutations, both in known cancer drivers and uncharacterized genes, are generally of low occurrence, highlighting the need to functionally annotate the long tail of infrequent mutations present in heterogeneous cancers. Here we describe a mutation assessment pipeline enabled by high-throughput engineering of molecularly-barcoded gene variant expression clones identified by tumor sequencing. We first used this platform to functionally assess tail mutations observed in PIK3CA, which encodes the catalytic subunit alpha of the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) frequently mutated in cancer. Orthogonal screening for PIK3CA variant activity using in vitro and in vivo cell growth and transformation assays differentiated driver from passenger mutations, revealing that PIK3CA variant activity correlates imperfectly with its mutation frequency across breast cancer populations. While PIK3CA mutations with frequencies above 5% were significantly more oncogenic than wild-type in all assays, mutations occurring at 0.07 – 5.0% included those with and without oncogenic activities that ranged from weak to strong in at least one assay. Proteomic profiling coupled with therapeutic sensitivity assays on PIK3CA variant-expressing cell models revealed variant-specific activation of PI3K signaling as well as other pathways that include the MEK1/2 module of Mitogen-Activated Protein (MAP) Kinase pathway. Our data indicate that cancer treatments will need to increasingly consider the functional relevance of specific mutations in driver genes rather than considering all mutations in drivers as equivalent. PMID:26627007

  12. Identification of five novel STAR variants in ten Chinese patients with congenital lipoid adrenal hyperplasia.

    PubMed

    Huang, Zhuo; Ye, Jun; Han, Lianshu; Qiu, Wenjuan; Zhang, Huiwen; Yu, Yongguo; Liang, Lili; Gong, Zhuwen; Gu, Xuefan

    2016-04-01

    Congenital lipoid adrenal hyperplasia (CLAH) is a rare autosomal recessive disorder caused by defective synthesis of all steroids. This disorder is characterized by 46,XY sex reversal, skin hyperpigmentation, early-onset adrenal crisis and enlarged adrenal with fatty accumulation. CLAH is caused by mutations in the STAR gene. The clinical features and STAR gene mutation spectrum of a large cohort of Chinese patients with CLAH were not reported previously. We performed clinical retrospective review and genetic analysis of the STAR gene in ten unrelated Chinese phenotypic female patients who were clinically diagnosed with CLAH and followed up in our hospital from 2006 to 2015. All ten patients, including two 46,XY females and eight 46,XX females, presented skin hyperpigmentation and early salt-wasting episode, and showed normal growth and development after steroid replacement treatment. Totally 20 mutant alleles containing 11 different STAR gene mutations were identified in these ten patients, including five novel variants (two missense and three null variants), all predicted to be pathogenic in bioinformatics analysis, and six mutations described in previous literature. Among these 11 mutations, a reported mutation c.772C>T and a novel variant c.707_708delinsCTT were most frequent, accounting for 35% and 15% of the total mutant alleles, respectively. This is the first report of a large Chinese cohort with CLAH, presenting the mutation spectrum of the STAR gene and two possible founder mutations in the Chinese population, which may contribute to better genetic counseling and prenatal diagnosis.

  13. [Identification of variants in LMF1 gene associated with primary hypertriglyceridemia].

    PubMed

    Lamiquiz-Moneo, Itziar; Bea, Ana M; Mateo-Gallego, Rocío; Baila-Rueda, Lucía; Cenarro, Ana; Pocoví, Miguel; Civeira, Fernando; de Castro-Orós, Isabel

    2015-01-01

    The majority of severe primary hypertriglyceridemia (HTG) are diagnosed in adults, and their molecular bases have not yet been fully defined. The promoter, coding regions and intron-exon boundaries of LMF1 were sequenced in 112 patients with severe primary hipertrigliceridemia (defined as TG above 500mg/dl). Five patients (4.46%) were carriers of four rare variants in the LMF1 gene associated with HTG, which participate in lipoprotein lipase (LpL) function. Also, we have identified two common variants, c.194-28 T>G and c.729+18C>G that were associated with HTG, with a different allelic frequency to that observed in the general population. A bioinformatic analysis of all found variants was conducted, defining the following as potentially harmful: p.Arg364Gln, p.Arg451Trp, p.Pro562Arg and p.Leu85Leu. Our results suggest that LMF1 mutations are involved in a substantial proportion of cases with severe HTG, putting together the moderate-aggressive effect of rare mutations with polymorphisms classically associated with this disease.

  14. Identification of a novel alternative splicing variant of hemocyanin from shrimp Litopenaeus vannamei.

    PubMed

    Zhao, Shan; Lu, Xin; Zhang, Yueling; Zhao, Xianliang; Zhong, Mingqi; Li, Shengkang; Lun, Jingsheng

    2013-01-01

    Recent evidences suggest that invertebrates express families of immune molecules with high levels of sequence diversity. Hemocyanin is an important non-specific immune molecule present in the hemolymph of both mollusks and arthropods. In the present study, we characterized a novel alternative splicing variant of hemocyanin (cHE1) from Litopenaeus vannamei that produced mRNA transcript of 2579 bp in length. The isoform contained two additional sequences of 296 and 267 bp in the 5'- and 3'-terminus respectively, in comparison to that of wild type hemocyanin (cHE). Sequence of cHE1 shows 100% identity to that of hemocyanin genomic DNA (HE, which does not form an open reading frame), suggesting that cHE1 might be an alternative splicing variant due to intron retention. Moreover, cHE1 could be detected by RT-PCR from five tissues (heart, gill, stomach, intestine and brain), and from shrimps at stages from nauplius to mysis larva. Further, cHE1 mRNA transcripts were significantly increased in hearts after 12h of infection with Vibrio parahemolyticus or poly I: C, while no significant difference in the transcript levels of hepatopancreas cHE was detected in the pathogen-treated shrimps during the period. In summary, these studies suggested a novel splicing variant of hemocyanin in shrimp, which might be involved in shrimp resistance to pathogenic infection.

  15. Pathogenesis of coronary artery disease: focus on genetic risk factors and identification of genetic variants

    PubMed Central

    Sayols-Baixeras, Sergi; Lluís-Ganella, Carla; Lucas, Gavin; Elosua, Roberto

    2014-01-01

    Coronary artery disease (CAD) is the leading cause of death and disability worldwide, and its prevalence is expected to increase in the coming years. CAD events are caused by the interplay of genetic and environmental factors, the effects of which are mainly mediated through cardiovascular risk factors. The techniques used to study the genetic basis of these diseases have evolved from linkage studies to candidate gene studies and genome-wide association studies. Linkage studies have been able to identify genetic variants associated with monogenic diseases, whereas genome-wide association studies have been more successful in determining genetic variants associated with complex diseases. Currently, genome-wide association studies have identified approximately 40 loci that explain 6% of the heritability of CAD. The application of this knowledge to clinical practice is challenging, but can be achieved using various strategies, such as genetic variants to identify new therapeutic targets, personal genetic information to improve disease risk prediction, and pharmacogenomics. The main aim of this narrative review is to provide a general overview of our current understanding of the genetics of coronary artery disease and its potential clinical utility. PMID:24520200

  16. Learning to Be (In)variant: Combining Prior Knowledge and Experience to Infer Orientation Invariance in Object Recognition.

    PubMed

    Austerweil, Joseph L; Griffiths, Thomas L; Palmer, Stephen E

    2016-12-21

    How does the visual system recognize images of a novel object after a single observation despite possible variations in the viewpoint of that object relative to the observer? One possibility is comparing the image with a prototype for invariance over a relevant transformation set (e.g., translations and dilations). However, invariance over rotations (i.e., orientation invariance) has proven difficult to analyze, because it applies to some objects but not others. We propose that the invariant transformations of an object are learned by incorporating prior expectations with real-world evidence. We test this proposal by developing an ideal learner model for learning invariance that predicts better learning of orientation dependence when prior expectations about orientation are weak. This prediction was supported in two behavioral experiments, where participants learned the orientation dependence of novel images using feedback from solving arithmetic problems.

  17. Identification of a capsular variant and characterization of capsular acetylation in Klebsiella pneumoniae PLA-associated type K57

    PubMed Central

    Hsu, Chun-Ru; Liao, Chun-Hsing; Lin, Tzu-Lung; Yang, Han-Ru; Yang, Feng-Ling; Hsieh, Pei-Fang; Wu, Shih-Hsiung; Wang, Jin-Town

    2016-01-01

    Klebsiella pneumoniae can cause community-acquired pyogenic liver abscess (PLA). Capsular polysaccharide (CPS) is important for its virulence. Among 79 capsular (K) types discovered thus far, K57 is often associated with PLA. Here, we report the identification of a K57 variant. Cps gene locus sequencing revealed differences between the K57 reference strain 4425/51 (Ref-K57) and a variant, the PLA isolate A1142. While Ref-K57 cps contained orf13 encoding a putative acetyltransferase, the insertion of a putative transposase-encoding gene at this position was detected in A1142. This variation was detected in other K57 clinical strains. Biochemical analyses indicated that A1142 was deficient in CPS acetylation. Genetic replacement and complementation verified that orf13 was responsible for CPS acetylation. Acetylation increased CPS immunoreactivity to antiserum and enhanced K. pneumoniae induction of pro-inflammatory cytokines through JNK and MAPK signaling. While acetylation diminished the serum resistance of bacteria, it promoted adhesion to intestinal epithelial cells possibly via increasing production of type I fimbriae. In conclusion, acetylation-mediated capsular variation in K57 was observed. Capsular acetylation contributed to the variety and antigenic diversity of CPS, influenced its biological activities, and was involved in K. pneumoniae-host interactions. These findings have implications for vaccine design and pathogenicity of K. pneumoniae. PMID:27550826

  18. Antagonistic lactic acid bacteria isolated from goat milk and identification of a novel nisin variant Lactococcus lactis

    PubMed Central

    2014-01-01

    Background The raw goat milk microbiota is considered a good source of novel bacteriocinogenic lactic acid bacteria (LAB) strains that can be exploited as an alternative for use as biopreservatives in foods. The constant demand for such alternative tools justifies studies that investigate the antimicrobial potential of such strains. Results The obtained data identified a predominance of Lactococcus and Enterococcus strains in raw goat milk microbiota with antimicrobial activity against Listeria monocytogenes ATCC 7644. Enzymatic assays confirmed the bacteriocinogenic nature of the antimicrobial substances produced by the isolated strains, and PCR reactions detected a variety of bacteriocin-related genes in their genomes. Rep-PCR identified broad genetic variability among the Enterococcus isolates, and close relations between the Lactococcus strains. The sequencing of PCR products from nis-positive Lactococcus allowed the identification of a predicted nisin variant not previously described and possessing a wide inhibitory spectrum. Conclusions Raw goat milk was confirmed as a good source of novel bacteriocinogenic LAB strains, having identified Lactococcus isolates possessing variations in their genomes that suggest the production of a nisin variant not yet described and with potential for use as biopreservatives in food due to its broad spectrum of action. PMID:24521354

  19. The Identification of Splice Variants as Molecular Markers in Parkinson’s Disease

    DTIC Science & Technology

    2008-09-01

    acutely and chronically with MPTP show a shift in the ratio of FosB , RGS9, AChe and Ania6 splice variants in the striatum and blood. Gene expression (in...CGG TCA ACC AT 3’ FGFR1: Forward Primer 5’ TGC CTG CCA ACA AGA CAG T 3’ FosB : Forward primer 5’ AAAAGGCAGAGCTGGAGTCG 3’ FosB : Reverse primer 5...of splice isoforms of fosB and rgs9. Brain Res 1182:1-10. • Potashkin JA, Kang UJ, Loomis PA, Ding Y, Jodelka FM, Meredith GE (2007) Dysregulation

  20. Identification of novel functional sequence variants in the gene for peptidase inhibitor 3

    PubMed Central

    Chowdhury, Mahboob A; Kuivaniemi, Helena; Romero, Roberto; Edwin, Samuel; Chaiworapongsa, Tinnakorn; Tromp, Gerard

    2006-01-01

    Background Peptidase inhibitor 3 (PI3) inhibits neutrophil elastase and proteinase-3, and has a potential role in skin and lung diseases as well as in cancer. Genome-wide expression profiling of chorioamniotic membranes revealed decreased expression of PI3 in women with preterm premature rupture of membranes. To elucidate the molecular mechanisms contributing to the decreased expression in amniotic membranes, the PI3 gene was searched for sequence variations and the functional significance of the identified promoter variants was studied. Methods Single nucleotide polymorphisms (SNPs) were identified by direct sequencing of PCR products spanning a region from 1,173 bp upstream to 1,266 bp downstream of the translation start site. Fourteen SNPs were genotyped from 112 and nine SNPs from 24 unrelated individuals. Putative transcription factor binding sites as detected by in silico search were verified by electrophoretic mobility shift assay (EMSA) using nuclear extract from Hela and amnion cell nuclear extract. Deviation from Hardy-Weinberg equilibrium (HWE) was tested by χ2 goodness-of-fit test. Haplotypes were estimated using expectation maximization (EM) algorithm. Results Twenty-three sequence variations were identified by direct sequencing of polymerase chain reaction (PCR) products covering 2,439 nt of the PI3 gene (-1,173 nt of promoter sequences and all three exons). Analysis of 112 unrelated individuals showed that 20 variants had minor allele frequencies (MAF) ranging from 0.02 to 0.46 representing "true polymorphisms", while three had MAF ≤ 0.01. Eleven variants were in the promoter region; several putative transcription factor binding sites were found at these sites by database searches. Differential binding of transcription factors was demonstrated at two polymorphic sites by electrophoretic mobility shift assays, both in amniotic and HeLa cell nuclear extracts. Differential binding of the transcription factor GATA1 at -689C>G site was confirmed by a

  1. Doublet N-Terminal Oriented Proteomics for N-Terminomics and Proteolytic Processing Identification.

    PubMed

    Westermann, Benoit; Jacome, Alvaro Sebastian Vaca; Rompais, Magali; Carapito, Christine; Schaeffer-Reiss, Christine

    2017-01-01

    The study of the N-terminome and the precise identification of proteolytic processing events are key in biology. Dedicated methodologies have been developed as the comprehensive characterization of the N-terminome can hardly be achieved by standard proteomics methods. In this context, we have set up a trimethoxyphenyl phosphonium (TMPP) labeling approach that allows the characterization of both N-terminal and internal digestion peptides in a single experiment. This latter point is a major advantage of our strategy as most N-terminomics methods rely on the enrichment of N-terminal peptides and thus exclude internal peptides.We have implemented a double heavy/light TMPP labeling and an automated data validation workflow that make our doublet N-terminal oriented proteomics (dN-TOP) strategy efficient for high-throughput N-terminome analysis.

  2. RefCNV: Identification of Gene-Based Copy Number Variants Using Whole Exome Sequencing

    PubMed Central

    Chang, Lun-Ching; Das, Biswajit; Lih, Chih-Jian; Si, Han; Camalier, Corinne E.; McGregor, Paul M.; Polley, Eric

    2016-01-01

    With rapid advances in DNA sequencing technologies, whole exome sequencing (WES) has become a popular approach for detecting somatic mutations in oncology studies. The initial intent of WES was to characterize single nucleotide variants, but it was observed that the number of sequencing reads that mapped to a genomic region correlated with the DNA copy number variants (CNVs). We propose a method RefCNV that uses a reference set to estimate the distribution of the coverage for each exon. The construction of the reference set includes an evaluation of the sources of variability in the coverage distribution. We observed that the processing steps had an impact on the coverage distribution. For each exon, we compared the observed coverage with the expected normal coverage. Thresholds for determining CNVs were selected to control the false-positive error rate. RefCNV prediction correlated significantly (r = 0.96–0.86) with CNV measured by digital polymerase chain reaction for MET (7q31), EGFR (7p12), or ERBB2 (17q12) in 13 tumor cell lines. The genome-wide CNV analysis showed a good overall correlation (Spearman’s coefficient = 0.82) between RefCNV estimation and publicly available CNV data in Cancer Cell Line Encyclopedia. RefCNV also showed better performance than three other CNV estimation methods in genome-wide CNV analysis. PMID:27147817

  3. [Selection and identification of salt-tolerant variants of Taraxacum officinale].

    PubMed

    Zhang, Xinguo; Li, Yinxin; Chen, Hua; Shi, Wuliang

    2008-02-01

    In order to obtain salt-tolerant variant plants of Dandelion (Taraxacum officinale Weber), the leaf discs were excised from 20 to 30-day old seedlings to produce callus, then the induced calli were transferred to selection mediums containing 1.5% NaCl. After regenerating and rooting, these salt-tolerant calli finally developed into 12 variant plantlets. Compared with the wild-type, these regenerated plants produced more trichomes on their leaves, and had larger leaves and shorter petioles. Additionally, the dumpy roots and an approximately 2-cm bract in middle parts of the floricanes were clearly observed in these salt-tolerant plants. By RAPD (Random Amplified Polymorphic DNA) and SDS-PAGE analysis, these salt-tolerant plants showed differences from the control at DNA and protein levels. With 1.5% NaCl treatment, the antioxidant enzyme activity, proline content, and flavonoid concentration were higher in these salt-tolerant plants, whereas maloaldehyde concentration was significantly lower. Salt-tolerant lines of T. officinale showed stronger anti-oxidative activity and higher flavonoid contents.

  4. Identification of common variants associated with human hippocampal and intracranial volumes.

    PubMed

    Stein, Jason L; Medland, Sarah E; Vasquez, Alejandro Arias; Hibar, Derrek P; Senstad, Rudy E; Winkler, Anderson M; Toro, Roberto; Appel, Katja; Bartecek, Richard; Bergmann, Ørjan; Bernard, Manon; Brown, Andrew A; Cannon, Dara M; Chakravarty, M Mallar; Christoforou, Andrea; Domin, Martin; Grimm, Oliver; Hollinshead, Marisa; Holmes, Avram J; Homuth, Georg; Hottenga, Jouke-Jan; Langan, Camilla; Lopez, Lorna M; Hansell, Narelle K; Hwang, Kristy S; Kim, Sungeun; Laje, Gonzalo; Lee, Phil H; Liu, Xinmin; Loth, Eva; Lourdusamy, Anbarasu; Mattingsdal, Morten; Mohnke, Sebastian; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; O'Brien, Carol; Papmeyer, Martina; Pütz, Benno; Ramasamy, Adaikalavan; Rasmussen, Jerod; Rijpkema, Mark; Risacher, Shannon L; Roddey, J Cooper; Rose, Emma J; Ryten, Mina; Shen, Li; Sprooten, Emma; Strengman, Eric; Teumer, Alexander; Trabzuni, Daniah; Turner, Jessica; van Eijk, Kristel; van Erp, Theo G M; van Tol, Marie-Jose; Wittfeld, Katharina; Wolf, Christiane; Woudstra, Saskia; Aleman, Andre; Alhusaini, Saud; Almasy, Laura; Binder, Elisabeth B; Brohawn, David G; Cantor, Rita M; Carless, Melanie A; Corvin, Aiden; Czisch, Michael; Curran, Joanne E; Davies, Gail; de Almeida, Marcio A A; Delanty, Norman; Depondt, Chantal; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Fagerness, Jesen; Fox, Peter T; Freimer, Nelson B; Gill, Michael; Göring, Harald H H; Hagler, Donald J; Hoehn, David; Holsboer, Florian; Hoogman, Martine; Hosten, Norbert; Jahanshad, Neda; Johnson, Matthew P; Kasperaviciute, Dalia; Kent, Jack W; Kochunov, Peter; Lancaster, Jack L; Lawrie, Stephen M; Liewald, David C; Mandl, René; Matarin, Mar; Mattheisen, Manuel; Meisenzahl, Eva; Melle, Ingrid; Moses, Eric K; Mühleisen, Thomas W; Nauck, Matthias; Nöthen, Markus M; Olvera, Rene L; Pandolfo, Massimo; Pike, G Bruce; Puls, Ralf; Reinvang, Ivar; Rentería, Miguel E; Rietschel, Marcella; Roffman, Joshua L; Royle, Natalie A; Rujescu, Dan; Savitz, Jonathan; Schnack, Hugo G; Schnell, Knut; Seiferth, Nina; Smith, Colin; Steen, Vidar M; Valdés Hernández, Maria C; Van den Heuvel, Martijn; van der Wee, Nic J; Van Haren, Neeltje E M; Veltman, Joris A; Völzke, Henry; Walker, Robert; Westlye, Lars T; Whelan, Christopher D; Agartz, Ingrid; Boomsma, Dorret I; Cavalleri, Gianpiero L; Dale, Anders M; Djurovic, Srdjan; Drevets, Wayne C; Hagoort, Peter; Hall, Jeremy; Heinz, Andreas; Jack, Clifford R; Foroud, Tatiana M; Le Hellard, Stephanie; Macciardi, Fabio; Montgomery, Grant W; Poline, Jean Baptiste; Porteous, David J; Sisodiya, Sanjay M; Starr, John M; Sussmann, Jessika; Toga, Arthur W; Veltman, Dick J; Walter, Henrik; Weiner, Michael W; Bis, Joshua C; Ikram, M Arfan; Smith, Albert V; Gudnason, Vilmundur; Tzourio, Christophe; Vernooij, Meike W; Launer, Lenore J; DeCarli, Charles; Seshadri, Sudha; Andreassen, Ole A; Apostolova, Liana G; Bastin, Mark E; Blangero, John; Brunner, Han G; Buckner, Randy L; Cichon, Sven; Coppola, Giovanni; de Zubicaray, Greig I; Deary, Ian J; Donohoe, Gary; de Geus, Eco J C; Espeseth, Thomas; Fernández, Guillén; Glahn, David C; Grabe, Hans J; Hardy, John; Hulshoff Pol, Hilleke E; Jenkinson, Mark; Kahn, René S; McDonald, Colm; McIntosh, Andrew M; McMahon, Francis J; McMahon, Katie L; Meyer-Lindenberg, Andreas; Morris, Derek W; Müller-Myhsok, Bertram; Nichols, Thomas E; Ophoff, Roel A; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda W; Potkin, Steven G; Sämann, Philipp G; Saykin, Andrew J; Schumann, Gunter; Smoller, Jordan W; Wardlaw, Joanna M; Weale, Michael E; Martin, Nicholas G; Franke, Barbara; Wright, Margaret J; Thompson, Paul M

    2012-04-15

    Identifying genetic variants influencing human brain structures may reveal new biological mechanisms underlying cognition and neuropsychiatric illness. The volume of the hippocampus is a biomarker of incipient Alzheimer's disease and is reduced in schizophrenia, major depression and mesial temporal lobe epilepsy. Whereas many brain imaging phenotypes are highly heritable, identifying and replicating genetic influences has been difficult, as small effects and the high costs of magnetic resonance imaging (MRI) have led to underpowered studies. Here we report genome-wide association meta-analyses and replication for mean bilateral hippocampal, total brain and intracranial volumes from a large multinational consortium. The intergenic variant rs7294919 was associated with hippocampal volume (12q24.22; N = 21,151; P = 6.70 × 10(-16)) and the expression levels of the positional candidate gene TESC in brain tissue. Additionally, rs10784502, located within HMGA2, was associated with intracranial volume (12q14.3; N = 15,782; P = 1.12 × 10(-12)). We also identified a suggestive association with total brain volume at rs10494373 within DDR2 (1q23.3; N = 6,500; P = 5.81 × 10(-7)).

  5. Expression of GLUT8 in mouse intestine: identification of alternative spliced variants.

    PubMed

    Romero, Amparo; Gomez, Olga; Terrado, Jose; Mesonero, Jose E

    2009-04-15

    GLUT8 is a facilitative glucose transporter composed of 10 exons coding for a 477 amino acids protein. It is mainly expressed in the testis, but it has also been studied in a number of tissues such as brain, adipose tissue, and liver. In this work, we have characterized the expression of GLUT8 in the small and large intestine under normal physiological conditions. Protein assay revealed low GLUT8 protein levels in the intestine compared to the testis, with higher levels in the colon than in the small intestine. Immunohistochemistry studies showed an intracellular localization of GLUT8 in enterocytes and colonocytes with a supranuclear distribution next to the apical membrane. GLUT8 immunoreactivity was also detected in the crypt cells. Interestingly, we have identified three additional transcriptional variants in mouse intestine (mGLUT-SP1, mGLUT8-SP2, and mGLUT8-SP3) produced by the deletion of one, two, and four exons, respectively, whereas only the entire mRNA was detected in the testis. Expression of these alternative variants did not have an effect on glucose consumption in 3T3-L1 cells. Although the specific function of GLUT8 in intestine remains unclear, the alternative splicing of GLUT8 could reflect a mechanism for the regulation of the gene expression in a tissue-specific manner by targeting GLUT8 mRNA for nonsense-mediated decay.

  6. Identification and characterization of a human smad3 splicing variant lacking part of the linker region.

    PubMed

    Kjellman, Christian; Honeth, Gabriella; Järnum, Sofia; Lindvall, Magnus; Darabi, Anna; Nilsson, Ingar; Edvardsen, Klaus; Salford, Leif G; Widegren, Bengt

    2004-03-03

    Smad3 is one of the signal transducers that are activated in response to transforming growth factor-beta (TGF-beta). We have identified and characterized a splicing variant of smad3. The splicing variant (smad3-Delta3) lacks exon 3 resulting in a truncated linker region. We could detect mRNA expression of smad3-Delta3 in all investigated human tissues. Real-time PCR analyses demonstrated that the fraction of smad3-Delta3 mRNA compared to normal smad3 varies between tissues. The amount of spliced mRNA was estimated to represent 0.5-5% of the normal smad3 mRNA. When smad3-Delta3 is overexpressed in a fibrosarcoma cell line, the Smad3-Delta3 is translocated to the nucleus upon TGF-beta stimulation and binds the Smad responsive element. Using a CAGA luciferase reporter system, we demonstrate that Smad3-Delta3 has transcriptional activity and we conclude that Smad3-Delta3 possesses functional transactivating properties.

  7. Identification of CHRNA5 rare variants in African-American heavy smokers

    PubMed Central

    Doyle, Glenn A.; Chou, Andrew D.; Saung, Wint Thu; Lai, Alison T.; Lohoff, Falk W.; Berrettini, Wade H.

    2014-01-01

    The common CHRNA5 mis-sense coding single nucleotide polymorphism (SNP) rs16969968:G>A (D398N) has been shown repeatedly to confer risk for heavy smoking in individuals who carry the ‘A’ allele (encoding the 398N amino acid). The mis-sense SNP has a minor allele frequency (MAF) of ~40% in European-Americans, but only ~7% in African-Americans (http://www.ncbi.nlm.nih.gov/projects/SNP/). We reasoned that there might be other mis-sense variants among African-Americans that could confer the heavy smoking phenotype (defined here as ≥20 cigarettes per day), perhaps in a similar manner to that of the D398N polymorphism in Europeans. As such, we re-sequenced 250 African-American heavy smokers, most of whom were homozygous ‘G’ at rs16969968:G>A (MAF of 9.6% within the population). Although many novel coding SNPs were not observed, we report an interesting, although rare (perhaps personal) variant in CHRNA5 that could result in nonsense-mediated decay of the aberrant transcript. PMID:24682045

  8. Identification and Characterization of Porcine Kobuvirus Variant Isolated from Suckling Piglet in Gansu Province, China

    PubMed Central

    Fan, Shengtao; Sun, Heting; Ying, Ying; Gao, Xiaolong; Wang, Zheng; Yu, Yicong; Li, Yuanguo; Wang, Tiecheng; Yu, Zhijun; Yang, Songtao; Zhao, Yongkun; Qin, Chuan; Gao, Yuwei; Xia, Xianzhu

    2013-01-01

    Kobuviruses comprise three species, the Aichivirus A, Aichivirus B, and Aichivirus C (porcine kobuvirus). Porcine kobuvirus is endemic to pig farms and is not restricted geographically but, rather, is distributed worldwide. The complete genomic sequences of four porcine kobuvirus strains isolated during a diarrhea outbreak in piglets in the Gansu province of China were determined. Two of these strains exhibited variations relative to the traditional strains. The potential 3C/3D cleavage sites of the variant strains were Q/C, which differed from the Q/S in the traditional porcine kobuvirus genome. A 90-nucleotide deletion in the 2B protein and a single nucleotide insertion in the 3′UTR were found in the variant strains. The VP1 regions of all four porcine kobuviruses in our study were highly variable (81%–86%). Ten common amino acid mutations were found specifically at certain positions within the VP1 region. Significant recombination sites were identified using SimPlot scans of whole genome sequences. Porcine kobuviruses were also detected in pig serum, indicating that the virus can escape the gastrointestinal tract and travel to the circulatory system. These findings suggest that mutations and recombination events may have contributed to the high level of genetic diversity of porcine kobuviruses and serve as a driving force in its evolution. PMID:24145960

  9. Identification of common variants associated with human hippocampal and intracranial volumes

    PubMed Central

    Stein, Jason L; Medland, Sarah E; Vasquez, Alejandro Arias; Hibar, Derrek P; Senstad, Rudy E; Winkler, Anderson M; Toro, Roberto; Appel, Katja; Bartecek, Richard; Bergmann, Ørjan; Bernard, Manon; Brown, Andrew A; Cannon, Dara M; Chakravarty, M Mallar; Christoforou, Andrea; Domin, Martin; Grimm, Oliver; Hollinshead, Marisa; Holmes, Avram J; Homuth, Georg; Hottenga, Jouke-Jan; Langan, Camilla; Lopez, Lorna M; Hansell, Narelle K; Hwang, Kristy S; Kim, Sungeun; Laje, Gonzalo; Lee, Phil H; Liu, Xinmin; Loth, Eva; Lourdusamy, Anbarasu; Mattingsdal, Morten; Mohnke, Sebastian; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; O’Brien, Carol; Papmeyer, Martina; Pütz, Benno; Ramasamy, Adaikalavan; Rasmussen, Jerod; Rijpkema, Mark; Risacher, Shannon L; Roddey, J Cooper; Rose, Emma J; Ryten, Mina; Shen, Li; Sprooten, Emma; Strengman, Eric; Teumer, Alexander; Trabzuni, Daniah; Turner, Jessica; van Eijk, Kristel; van Erp, Theo G M; van Tol, Marie-Jose; Wittfeld, Katharina; Wolf, Christiane; Woudstra, Saskia; Aleman, Andre; Alhusaini, Saud; Almasy, Laura; Binder, Elisabeth B; Brohawn, David G; Cantor, Rita M; Carless, Melanie A; Corvin, Aiden; Czisch, Michael; Curran, Joanne E; Davies, Gail; de Almeida, Marcio A A; Delanty, Norman; Depondt, Chantal; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Fagerness, Jesen; Fox, Peter T; Freimer, Nelson B; Gill, Michael; Göring, Harald H H; Hagler, Donald J; Hoehn, David; Holsboer, Florian; Hoogman, Martine; Hosten, Norbert; Jahanshad, Neda; Johnson, Matthew P; Kasperaviciute, Dalia; Kent, Jack W; Kochunov, Peter; Lancaster, Jack L; Lawrie, Stephen M; Liewald, David C; Mandl, René; Matarin, Mar; Mattheisen, Manuel; Meisenzahl, Eva; Melle, Ingrid; Moses, Eric K; Mühleisen, Thomas W; Nauck, Matthias; Nöthen, Markus M; Olvera, Rene L; Pandolfo, Massimo; Pike, G Bruce; Puls, Ralf; Reinvang, Ivar; Rentería, Miguel E; Rietschel, Marcella; Roffman, Joshua L; Royle, Natalie A; Rujescu, Dan; Savitz, Jonathan; Schnack, Hugo G; Schnell, Knut; Seiferth, Nina; Smith, Colin; Steen, Vidar M; Valdés Hernández, Maria C; Van den Heuvel, Martijn; van der Wee, Nic J; Van Haren, Neeltje E M; Veltman, Joris A; Völzke, Henry; Walker, Robert; Westlye, Lars T; Whelan, Christopher D; Agartz, Ingrid; Boomsma, Dorret I; Cavalleri, Gianpiero L; Dale, Anders M; Djurovic, Srdjan; Drevets, Wayne C; Hagoort, Peter; Hall, Jeremy; Heinz, Andreas; Jack, Clifford R; Foroud, Tatiana M; Le Hellard, Stephanie; Macciardi, Fabio; Montgomery, Grant W; Poline, Jean Baptiste; Porteous, David J; Sisodiya, Sanjay M; Starr, John M; Sussmann, Jessika; Toga, Arthur W; Veltman, Dick J; Walter, Henrik; Weiner, Michael W; Bis, Joshua C; Ikram, M Arfan; Smith, Albert V; Gudnason, Vilmundur; Tzourio, Christophe; Vernooij, Meike W; Launer, Lenore J; DeCarli, Charles; Seshadri, Sudha; Andreassen, Ole A; Apostolova, Liana G; Bastin, Mark E; Blangero, John; Brunner, Han G; Buckner, Randy L; Cichon, Sven; Coppola, Giovanni; de Zubicaray, Greig I; Deary, Ian J; Donohoe, Gary; de Geus, Eco J C; Espeseth, Thomas; Fernández, Guillén; Glahn, David C; Grabe, Hans J; Hardy, John; Hulshoff Pol, Hilleke E; Jenkinson, Mark; Kahn, René S; McDonald, Colm; McIntosh, Andrew M; McMahon, Francis J; McMahon, Katie L; Meyer-Lindenberg, Andreas; Morris, Derek W; Müller-Myhsok, Bertram; Nichols, Thomas E; Ophoff, Roel A; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda W; Potkin, Steven G; Sämann, Philipp G; Saykin, Andrew J; Schumann, Gunter; Smoller, Jordan W; Wardlaw, Joanna M; Weale, Michael E; Martin, Nicholas G; Franke, Barbara; Wright, Margaret J; Thompson, Paul M

    2013-01-01

    Identifying genetic variants influencing human brain structures may reveal new biological mechanisms underlying cognition and neuropsychiatric illness. The volume of the hippocampus is a biomarker of incipient Alzheimer’s disease1,2 and is reduced in schizophrenia3, major depression4 and mesial temporal lobe epilepsy5. Whereas many brain imaging phenotypes are highly heritable6,7, identifying and replicating genetic influences has been difficult, as small effects and the high costs of magnetic resonance imaging (MRI) have led to underpowered studies. Here we report genome-wide association meta-analyses and replication for mean bilateral hippocampal, total brain and intracranial volumes from a large multinational consortium. The intergenic variant rs7294919 was associated with hippocampal volume (12q24.22; N = 21,151; P = 6.70 × 10−16) and the expression levels of the positional candidate gene TESC in brain tissue. Additionally, rs10784502, located within HMGA2, was associated with intracranial volume (12q14.3; N = 15,782; P = 1.12 × 10−12). We also identified a suggestive association with total brain volume at rs10494373 within DDR2 (1q23.3; N = 6,500; P = 5.81 × 10−7). PMID:22504417

  10. Identification and characterization of rabbit hemorrhagic disease virus genetic variants isolated in Korea.

    PubMed

    OEM, Jae-Ku; LEE, Kwang-Nyeong; ROH, In Soon; LEE, Kyoung-Ki; KIM, Seong-Hee; KIM, Hye-Ryoung; PARK, Choi-Kyu; JOO, Yi-Seok

    2009-11-01

    Nine isolates of rabbit hemorrhagic disease virus (RHDV) were used for the genetic characterization of RHDV strains collected from rabbits in Korea between 2006 and 2008. A phylogenetic analysis of the complete VP60 region was performed and the sequences were divided mainly into two groups. The one group consisted of original RHDV and the other contained antigenic variant strain known as RHDVa strains. Most of the Korean isolates clustered with Chinese RHDV strains and belonged to the RHDVa subtype. A comparison of the amino acid sequences among RHDVa strains and original RHDV strains revealed significant substitutions of two amino acids in the A region, two in the B region, two in the F region, and nine amino acids in the E region. Taken together, the recent RHDVa strains have gradually replaced the original RHDV and are the predominant strains in Korea.

  11. Identification of common variants influencing risk of the tauopathy Progressive Supranuclear Palsy

    PubMed Central

    Höglinger, Günter U.; Melhem, Nadine M.; Dickson, Dennis W.; Sleiman, Patrick M.A.; Wang, Li-San; Klei, Lambertus; Rademakers, Rosa; de Silva, Rohan; Litvan, Irene; Riley, David E.; van Swieten, John C.; Heutink, Peter; Wszolek, Zbigniew K.; Uitti, Ryan J.; Vandrovcova, Jana; Hurtig, Howard I.; Gross, Rachel G.; Maetzler, Walter; Goldwurm, Stefano; Tolosa, Eduardo; Borroni, Barbara; Pastor, Pau; Cantwell, Laura B.; Han, Mi Ryung; Dillman, Allissa; van der Brug, Marcel P.; Gibbs, J Raphael; Cookson, Mark R.; Hernandez, Dena G.; Singleton, Andrew B.; Farrer, Matthew J.; Yu, Chang-En; Golbe, Lawrence I.; Revesz, Tamas; Hardy, John; Lees, Andrew J.; Devlin, Bernie; Hakonarson, Hakon; Müller, Ulrich; Schellenberg, Gerard D.

    2011-01-01

    Progressive supranuclear palsy (PSP) is a movement disorder with prominent tau neuropathology. Brain diseases with abnormal tau deposits are called tauopathies, the most common being Alzheimer’s disease. Environmental causes of tauopathies include repetitive head trauma associated with some sports. To identify common genetic variation contributing to risk for tauopathies, we carried out a genome-wide association study of 1,114 PSP cases and 3,247 controls (Stage 1) followed up by a second stage where 1,051 cases and 3,560 controls were genotyped for Stage 1 SNPs that yielded P ≤ 10−3. We found significant novel signals (P < 5 × 10−8) associated with PSP risk at STX6, EIF2AK3, and MOBP. We confirmed two independent variants in MAPT affecting risk for PSP, one of which influences MAPT brain expression. The genes implicated encode proteins for vesicle-membrane fusion at the Golgi-endosomal interface, for the endoplasmic reticulum unfolded protein response, and for a myelin structural component. PMID:21685912

  12. Identification of a novel splice variant isoform of TREM-1 in human neutrophil granules1

    PubMed Central

    Baruah, Sankar; Keck, Kathy; Vrenios, Michelle; Pope, Marshall; Pearl, Merideth; Doerschug, Kevin; Klesney-Tait, Julia

    2015-01-01

    Triggering receptor expressed on myeloid cells-1 (TREM-1) is critical for inflammatory signal amplification. Humans have two forms of TREM-1: a membrane receptor (mbTREM-1), associated with the adaptor DAP12, and a soluble receptor detected at times of infection. The membrane receptor isoform acts synergistically with the TLR pathway to promote cytokine secretion and neutrophil migration while the soluble receptor functions as a counter regulatory molecule. In multiple models of sepsis, exogenous administration of soluble forms of TREM-1 attenuates inflammation and markedly improves survival. Despite intense interest in soluble TREM-1 both as a clinical predictor of survival and as a therapeutic tool, the origin of native soluble TREM-1 remains controversial. Utilizing human neutrophils, we identified a 15 kDa TREM-1 isoform in primary (azurophilic) and secondary (specific) granules. Mass spectrometric analysis, ELISA, and immunoblot confirm that the 15 kD protein is a novel splice variant of TREM-1 (TREM-1sv). Neutrophil stimulation with P. aeruginosa, LPS, or PAM(3)Cys4 resulted in degranulation and release of TREM-1sv. The addition of exogenous TREM-1sv inhibited TREM-1 receptor mediated proinflammatory cytokine production. Thus these data reveal that TREM-1 isoforms simultaneously activate and inhibit inflammation via the canonical membrane TREM-1 molecule and this newly discovered granular isoform, TREM-1sv. PMID:26561551

  13. Identification and characterization of a novel splice variant of rhesus macaque MHC IA.

    PubMed

    Dai, Zheng-Xi; Zhang, Gao-Hong; Zhang, Xi-He; Zheng, Yong-Tang

    2013-03-01

    Major histocompatibility complex class I (MHC I) molecules play a pivotal role in the immune recognition to intracellular pathogens. A number of important splice variants have already been characterized for these molecules in different species, suggesting their important roles in modulation of immune responses. In this study, we have identified and characterized a novel alternatively spliced form of rhesus macaque MHC IA (designated MHC IA-sv2) that lacks exons coding for the α2 and α3 domains. Despite lacking the α2 and α3 domains, MHC IA-sv2 is targeted to the cell surface, as a 23-kDa glycoprotein that is totally susceptible to endoglycosidase-H digestion and is reduced to 18kDa after deglycosylation with PNGase F. In contrast, the full-length MHC IA reaches the cell surface as a 43-kDa protein of form with complex-type N-glycosylation (endoglycosidase-H resistant). Moreover, we provide evidence here that MHC IA-sv2 can self-associate, forming homodimers, or associate with the fully mature MHC IA molecule, forming a heterodimeric structure in mammalian cells. These data demonstrate that the formation of heterodimers may have some functional implications in the fine tuning of MHC IA-mediated innate and adaptive immune responses.

  14. Identification of copy number variants associated with BPES-like phenotypes.

    PubMed

    Gijsbers, Antoinet C J; D'haene, Barbara; Hilhorst-Hofstee, Yvonne; Mannens, Marcel; Albrecht, Beate; Seidel, Joerg; Witt, David R; Maisenbacher, Melissa K; Loeys, Bart; van Essen, Ton; Bakker, Egbert; Hennekam, Raoul; Breuning, Martijn H; De Baere, Elfride; Ruivenkamp, Claudia A L

    2008-12-01

    Blepharophimosis-Ptosis-Epicanthus inversus syndrome (BPES) is a well-characterized rare syndrome that includes an eyelid malformation associated with (type I) or without premature ovarian failure (type II). Patients with typical BPES have four major characteristics: blepharophimosis, ptosis, epicanthus inversus and telecanthus. Mutations in the FOXL2 gene, encoding a forkhead transcription factor, are responsible for the majority of both types of BPES. However, many patients with BPES-like features, i.e., having at least two major characteristics of BPES, have an unidentified cause. Here, we report on a group of 27 patients with BPES-like features, but without an identified genetic defect in the FOXL2 gene or flanking region. These patients were analyzed with whole-genome high-density arrays in order to identify copy number variants (CNVs) that might explain the BPES-like phenotype. In nine out of 27 patients (33%) CNVs not previously described as polymorphisms were detected. Four of these patients displayed psychomotor retardation as an additional clinical characteristic. In conclusion, we demonstrate that BPES-like phenotypes are frequently caused by CNVs, and we emphasize the importance of whole-genome copy number screening to identify the underlying genetic causes of these phenotypes.

  15. Identification of a splice-site mutation in the human growth hormone-variant gene.

    PubMed Central

    MacLeod, J N; Liebhaber, S A; MacGillivray, M H; Cooke, N E

    1991-01-01

    The human growth-hormone-variant (hGH-V) gene normally expresses two alternatively spliced forms of mRNA--hGH-V and hGH-V2--in the placenta. hGH-V2 mRNA differs from hGH-V rDNA by the retention of intron 4 and represents approximately 15% of transcripts at term. In a survey of hGH-V gene expression in 20 placentas of gestational age 8-40 wk, we detected a single placenta that contained, in addition to the two normal hGH-V mRNA species, a set of two slightly larger hGH-V mRNAs. Sequence analysis of the elongated hGH-V mRNA demonstrated retention of the first 12 bases of intron 2, resulting from both a base substitution at the intron 2 splice-donor dinucleotide (GT----AT) and activation of a cryptic splice-donor site 12 bases downstream. Survey of a total of 60 additional chromosomes failed to reveal additional incidence of this mutation. The mutation, which we have designated hGH-Vintron 2, pos 1 (G----A), represents both an initial example of a nondeletional mutation within the hGH-V gene and corresponding structural alteration in the encoded hGH-V hormone. Images Figure 1 Figure 2 Figure 4 PMID:2035535

  16. Identification of Genetic and Epigenetic Variants Associated with Breast Cancer Prognosis by Integrative Bioinformatics Analysis

    PubMed Central

    Shilpi, Arunima; Bi, Yingtao; Jung, Segun; Patra, Samir K.; Davuluri, Ramana V.

    2017-01-01

    INTRODUCTION Breast cancer being a multifaceted disease constitutes a wide spectrum of histological and molecular variability in tumors. However, the task for the identification of these variances is complicated by the interplay between inherited genetic and epigenetic aberrations. Therefore, this study provides an extrapolate outlook to the sinister partnership between DNA methylation and single-nucleotide polymorphisms (SNPs) in relevance to the identification of prognostic markers in breast cancer. The effect of these SNPs on methylation is defined as methylation quantitative trait loci (meQTL). MATERIALS AND METHODS We developed a novel method to identify prognostic gene signatures for breast cancer by integrating genomic and epigenomic data. This is based on the hypothesis that multiple sources of evidence pointing to the same gene or pathway are likely to lead to reduced false positives. We also apply random resampling to reduce overfitting noise by dividing samples into training and testing data sets. Specifically, the common samples between Illumina 450 DNA methylation, Affymetrix SNP array, and clinical data sets obtained from the Cancer Genome Atlas (TCGA) for breast invasive carcinoma (BRCA) were randomly divided into training and test models. An intensive statistical analysis based on log-rank test and Cox proportional hazard model has established a significant association between differential methylation and the stratification of breast cancer patients into high- and low-risk groups, respectively. RESULTS The comprehensive assessment based on the conjoint effect of CpG–SNP pair has guided in delaminating the breast cancer patients into the high- and low-risk groups. In particular, the most significant association was found with respect to cg05370838–rs2230576, cg00956490–rs940453, and cg11340537–rs2640785 CpG–SNP pairs. These CpG–SNP pairs were strongly associated with differential expression of ADAM8, CREB5, and EXPH5 genes, respectively

  17. Identification and characterization of alternatively spliced variants of DNA methyltransferase 3a in mammalian cells.

    PubMed

    Weisenberger, Daniel J; Velicescu, Mihaela; Preciado-Lopez, Miguel A; Gonzales, Felicidad A; Tsai, Yvonne C; Liang, Gangning; Jones, Peter A

    2002-09-18

    CpG methylation is mediated by the functions of at least three active DNA methyltransferases (DNMTs). While DNMT1 is thought to perform maintenance methylation, the more recently discovered DNMT3a and DNMT3b enzymes are thought to facilitate de novo methylation. Murine Dnmt3a and 3b are developmentally regulated and a new Dnmt3a isoform, Dnmt3a2, has been recently shown to be expressed preferentially in mouse embryonic stem (ES) cells. Here we have characterized four alternatively spliced variants of human and mouse DNMT3a. These transcripts included a novel exon 1 (1beta) that was spliced into the same exon 2 acceptor splice site used by the original exon 1 (1alpha). Cloning and sequencing of the 5' region of the human DNMT3a gene revealed that exon 1beta was situated upstream of exon 1alpha and that the entire region was contained within a CpG island. We also identified other alternatively spliced species containing intron 4 inclusions that were associated with either exon 1alpha or 1beta. These were expressed at low levels in mouse and human cells. All transcripts were highly conserved between human and mouse. The levels of Dnmt3a mRNA containing exon 1beta were 3-25-fold greater in mouse ES cells than in various somatic cells as determined by semiquantitative reverse transcription-polymerase chain reaction analysis, while the levels of exon 1alpha-containing transcripts were slightly higher in human and mouse somatic cells. The preferential expression of the beta transcript in ES cells suggests that this transcript, in addition to Dnmt3a2, may also be important for de novo methylation during development.

  18. Identification of time-variant river bed properties with the ensemble Kalman filter

    NASA Astrophysics Data System (ADS)

    Kurtz, Wolfgang; Hendricks Franssen, Harrie-Jan; Vereecken, Harry

    2012-10-01

    An adequate characterization of river bed hydraulic conductivities (L) is crucial for a proper assessment of river-aquifer interactions. However, river bed characteristics may change over time due to dynamic morphological processes like scouring or sedimentation what can lead to erroneous model predictions when static leakage parameters are assumed. Sequential data assimilation with the ensemble Kalman filter (EnKF) allows for an update of model parameters in real-time and may thus be capable of assessing the transient behavior of L. Synthetic experiments with a three-dimensional finite element model of the Limmat aquifer in Zurich were used to assess the performance of data assimilation in capturing time-variant river bed properties. Reference runs were generated where L followed different temporal and/or spatial patterns which should mimic real-world sediment dynamics. Hydraulic head (h) data from these reference runs were then used as input data for EnKF which jointly updated h and L. Results showed that EnKF is able to capture the different spatio-temporal patterns of L in the reference runs well. However, the adaptation time was relatively long which was attributed to the fast decrease of ensemble variance. To improve the performance of EnKF also an adaptive filtering approach with covariance inflation was applied that allowed a faster and more accurate adaptation of model parameters. A sensitivity analysis indicated that even for a low amount of observations a reasonable adaptation of L towards the reference values can be achieved and that EnKF is also able to correct for a biased initial ensemble of L.

  19. Identification of Common Genetic Variants Influencing Spontaneous Dizygotic Twinning and Female Fertility

    PubMed Central

    Mbarek, Hamdi; Steinberg, Stacy; Nyholt, Dale R.; Gordon, Scott D.; Miller, Michael B.; McRae, Allan F.; Hottenga, Jouke Jan; Day, Felix R.; Willemsen, Gonneke; de Geus, Eco J.; Davies, Gareth E.; Martin, Hilary C.; Penninx, Brenda W.; Jansen, Rick; McAloney, Kerrie; Vink, Jacqueline M.; Kaprio, Jaakko; Plomin, Robert; Spector, Tim D.; Magnusson, Patrik K.; Reversade, Bruno; Harris, R. Alan; Aagaard, Kjersti; Kristjansson, Ragnar P.; Olafsson, Isleifur; Eyjolfsson, Gudmundur Ingi; Sigurdardottir, Olof; Iacono, William G.; Lambalk, Cornelis B.; Montgomery, Grant W.; McGue, Matt; Ong, Ken K.; Perry, John R.B.; Martin, Nicholas G.; Stefánsson, Hreinn; Stefánsson, Kari; Boomsma, Dorret I.

    2016-01-01

    Spontaneous dizygotic (DZ) twinning occurs in 1%–4% of women, with familial clustering and unknown physiological pathways and genetic origin. DZ twinning might index increased fertility and has distinct health implications for mother and child. We performed a GWAS in 1,980 mothers of spontaneous DZ twins and 12,953 control subjects. Findings were replicated in a large Icelandic cohort and tested for association across a broad range of fertility traits in women. Two SNPs were identified (rs11031006 near FSHB, p = 1.54 × 10−9, and rs17293443 in SMAD3, p = 1.57 × 10−8) and replicated (p = 3 × 10−3 and p = 1.44 × 10−4, respectively). Based on ∼90,000 births in Iceland, the risk of a mother delivering twins increased by 18% for each copy of allele rs11031006-G and 9% for rs17293443-C. A higher polygenic risk score (PRS) for DZ twinning, calculated based on the results of the DZ twinning GWAS, was significantly associated with DZ twinning in Iceland (p = 0.001). A higher PRS was also associated with having children (p = 0.01), greater lifetime parity (p = 0.03), and earlier age at first child (p = 0.02). Allele rs11031006-G was associated with higher serum FSH levels, earlier age at menarche, earlier age at first child, higher lifetime parity, lower PCOS risk, and earlier age at menopause. Conversely, rs17293443-C was associated with later age at last child. We identified robust genetic risk variants for DZ twinning: one near FSHB and a second within SMAD3, the product of which plays an important role in gonadal responsiveness to FSH. These loci contribute to crucial aspects of reproductive capacity and health. PMID:27132594

  20. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata.

  1. Identification and functional characterization of a voltage-gated chloride channel and its novel splice variant in taste bud cells.

    PubMed

    Huang, Liquan; Cao, Jie; Wang, Hong; Vo, Lynn A; Brand, Joseph G

    2005-10-28

    Taste bud cells are epithelial cells with neuronal properties. Voltage-dependent ion channels have been physiologically described in these cells. Here, we report the molecular identification and functional characterization of a voltage-gated chloride channel (ClC-4) and its novel splice variant (ClC-4A) from taste bud cells. ClC-4A skipped an exon near its 5'-end, incurring the loss of 60 amino acids at the N terminus. In situ hybridization and immunohistochemistry localized these two channels' transcripts and proteins to a subset of taste bud cells. Electrophysiological recordings of the heterologously expressed channels in Xenopus oocytes showed that ClC-4 and ClC-4A have opposite sensitivity to pH and unique ion selectivity. The chloride channel blockers niflumic acid and 5-nitro-2-(3-phenylpropylamino)benzoic acid had a slight or no inhibitory effect on the conductance of ClC-4, but both blockers inhibited ClC-4A, suggesting that ClC-4A is a candidate channel for an acid-induced 5-nitro-2-(3-phenylpropylamino)benzoic acid-sensitive current. Furthermore, these two channels may play a role in bitter-, sweet-, and umami-mediated taste transmission by regulating transmitter uptake into synaptic vesicles.

  2. Functional effects of different medium-chain acyl-CoA dehydrogenase genotypes and identification of asymptomatic variants.

    PubMed

    Sturm, Marga; Herebian, Diran; Mueller, Martina; Laryea, Maurice D; Spiekerkoetter, Ute

    2012-01-01

    Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency (OMIM 201450) is the most common inherited disorder of fatty acid metabolism presenting with hypoglycaemia, hepatopathy and Reye-like symptoms during catabolism. In the past, the majority of patients carried the prevalent c.985A>G mutation in the ACADM gene. Since the introduction of newborn screening many other mutations with unknown clinical relevance have been identified in asymptomatic newborns. In order to identify functional effects of these mutant genotypes we correlated residual MCAD (OMIM 607008) activities as measured by octanoyl-CoA oxidation in lymphocytes with both genotype and relevant medical reports in 65 newborns harbouring mutant alleles. We identified true disease-causing mutations with residual activities of 0 to 20%. In individuals carrying the c.199T>C or c.127G>A mutation on one allele, residual activities were much higher and in the range of heterozygotes (31%-60%). Therefore, both mutations cannot clearly be associated with a clinical phenotype. This demonstrates a correlation between the octanoyl-CoA oxidation rate in lymphocytes and the clinical outcome. With newborn screening, the natural course of disease is difficult to assess. The octanoyl-CoA oxidation rate, therefore, allows a risk assessment at birth and the identification of new ACADM genotypes associated with asymptomatic disease variants.

  3. Identification of distinct physiochemical properties of toxic prefibrillar species formed by A{beta} peptide variants

    SciTech Connect

    Goeransson, Anna-Lena; Nilsson, K. Peter R.; Kagedal, Katarina; Brorsson, Ann-Christin

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer Identification of toxic prefibrillar A{beta} species. Black-Right-Pointing-Pointer Fluorescence measurements using a combined set of fluorophores. Black-Right-Pointing-Pointer Morphology studies using transmission electron microscopy. -- Abstract: The formation of amyloid-{beta} peptide (A{beta}) aggregates at an early stage during the self-assembly process is an important factor in the development of Alzheimer's disease. The toxic effect is believed to be exerted by prefibrillar species of A{beta}. It is therefore important to identify which prefibrillar species are toxic and characterize their distinct properties. In the present study, we investigated the in vitro aggregation behavior of A{beta}-derived peptides possessing different levels of neurotoxic activity, using fluorescence spectroscopy in combination with transmission electron microscopy. The toxicity of various A{beta} aggregates was assessed by using cultures of human neuroblastoma cells. Through combined use of the fluorescence probe 8-anilino-1-napthalenesulfonate (ANS) and the novel luminescent probe pentamer formyl thiophene acetic acid (p-FTAA), we were able to identify those A{beta} peptide-derived prefibrillar species which exhibited cellular toxicity. In particular, species, which formed early during the aggregation process and showed strong p-FTAA and ANS fluorescence, were the species that possessed toxic activities. Moreover, by manipulating the aggregation conditions, it was possible to change the capacity of the A{beta} peptide to form nontoxic versus toxic species.

  4. Identification of the topological defects of optical indicatrix orientation in CaB4O7 glasses

    NASA Astrophysics Data System (ADS)

    Vasylkiv, Yu; Skab, I.; Vlokh, R.

    2016-08-01

    We develop an experimental method for the identification of the topological defects of optical indicatrix orientation, which appear in glass samples with residual mechanical stresses. The criteria needed to determine the sign of the strength of topological defects are formulated. The method is verified on the example of a non-annealed CaB4O7 glass sample that manifests spatially inhomogeneous residual stresses. We have found that at least seven topological defects of optical indicatrix orientation exist under the condition when a light beam propagates through a parallelepiped-shaped glass sample. The strengths of all the defects detected by us are equal to +1/2.

  5. Identification of Genome-Wide Variants and Discovery of Variants Associated with Brassica rapa Clubroot Resistance Gene Rcr1 through Bulked Segregant RNA Sequencing.

    PubMed

    Yu, Fengqun; Zhang, Xingguo; Huang, Zhen; Chu, Mingguang; Song, Tao; Falk, Kevin C; Deora, Abhinandan; Chen, Qilin; Zhang, Yan; McGregor, Linda; Gossen, Bruce D; McDonald, Mary Ruth; Peng, Gary

    2016-01-01

    Clubroot, caused by Plasmodiophora brassicae, is an important disease on Brassica species worldwide. A clubroot resistance gene, Rcr1, with efficacy against pathotype 3 of P. brassicae, was previously mapped to chromosome A03 of B. rapa in pak choy cultivar "Flower Nabana". In the current study, resistance to pathotypes 2, 5 and 6 was shown to be associated with Rcr1 region on chromosome A03. Bulked segregant RNA sequencing was performed and short read sequences were assembled into 10 chromosomes of the B. rapa reference genome v1.5. For the resistant (R) bulks, a total of 351.8 million (M) sequences, 30,836.5 million bases (Mb) in length, produced 120-fold coverage of the reference genome. For the susceptible (S) bulks, 322.9 M sequences, 28,216.6 Mb in length, produced 109-fold coverage. In total, 776.2 K single nucleotide polymorphisms (SNPs) and 122.2 K insertion / deletion (InDels) in R bulks and 762.8 K SNPs and 118.7 K InDels in S bulks were identified; each chromosome had about 87% SNPs and 13% InDels, with 78% monomorphic and 22% polymorphic variants between the R and S bulks. Polymorphic variants on each chromosome were usually below 23%, but made up 34% of the variants on chromosome A03. There were 35 genes annotated in the Rcr1 target region and variants were identified in 21 genes. The numbers of poly variants differed significantly among the genes. Four out of them encode Toll-Interleukin-1 receptor / nucleotide-binding site / leucine-rich-repeat proteins; Bra019409 and Bra019410 harbored the higher numbers of polymorphic variants, which indicates that they are more likely candidates of Rcr1. Fourteen SNP markers in the target region were genotyped using the Kompetitive Allele Specific PCR method and were confirmed to associate with Rcr1. Selected SNP markers were analyzed with 26 recombinants obtained from a segregating population consisting of 1587 plants, indicating that they were completely linked to Rcr1. Nine SNP markers were used for marker

  6. Identification and functional characterization of de novo FOXP1 variants provides novel insights into the etiology of neurodevelopmental disorder.

    PubMed

    Sollis, Elliot; Graham, Sarah A; Vino, Arianna; Froehlich, Henning; Vreeburg, Maaike; Dimitropoulou, Danai; Gilissen, Christian; Pfundt, Rolph; Rappold, Gudrun A; Brunner, Han G; Deriziotis, Pelagia; Fisher, Simon E

    2016-02-01

    De novo disruptions of the neural transcription factor FOXP1 are a recently discovered, rare cause of sporadic intellectual disability (ID). We report three new cases of FOXP1-related disorder identified through clinical whole-exome sequencing. Detailed phenotypic assessment confirmed that global developmental delay, autistic features, speech/language deficits, hypotonia and mild dysmorphic features are core features of the disorder. We expand the phenotypic spectrum to include sensory integration disorder and hypertelorism. Notably, the etiological variants in these cases include two missense variants within the DNA-binding domain of FOXP1. Only one such variant has been reported previously. The third patient carries a stop-gain variant. We performed functional characterization of the three missense variants alongside our stop-gain and two previously described truncating/frameshift variants. All variants severely disrupted multiple aspects of protein function. Strikingly, the missense variants had similarly severe effects on protein function as the truncating/frameshift variants. Our findings indicate that a loss of transcriptional repression activity of FOXP1 underlies the neurodevelopmental phenotype in FOXP1-related disorder. Interestingly, the three novel variants retained the ability to interact with wild-type FOXP1, suggesting these variants could exert a dominant-negative effect by interfering with the normal FOXP1 protein. These variants also retained the ability to interact with FOXP2, a paralogous transcription factor disrupted in rare cases of speech and language disorder. Thus, speech/language deficits in these individuals might be worsened through deleterious effects on FOXP2 function. Our findings highlight that de novo FOXP1 variants are a cause of sporadic ID and emphasize the importance of this transcription factor in neurodevelopment.

  7. Identification and analysis of function of a novel splicing variant of mouse receptor activator of NF-κB.

    PubMed

    Mukai, Satomi; Kitazawa, Riko; Ishii, Junko; Kondo, Takeshi; Hakozaki, Akihiro; Horiuchi, Keisuke; Haraguch, Ryuma; Mori, Kiyoshi; Kitazawa, Sohei

    2011-04-01

    Receptor activator of NF-κB (RANK) is a member of the tumor necrosis factor receptor (TNFR) family expressed in osteoclast precursors, and RANK-RANK ligand (RANKL) signaling is a key system for differentiation, activation and survival of osteoclasts. Here, we report the identification of a novel alternative splicing variant of mouse RANK gene (vRANK) that contains a new intervening exon between exon 1 and exon 2 of mouse full-length RANK (fRANK) mRNA. Since this novel exon contains the stop codon, vRANK encodes truncated amino acids that have a portion of the signal peptide of fRANK and an additional 19 amino acids that show no homology to previously reported domains. By transient transfection studies with vRANK-GFP and -Flag expressing constructs, vRANK was found localized mostly in the cytoplasm and partly in the cell membrane, but was not secreted into the culture supernatant. Under the stimulation of various factors, the expression of vRANK mRNA was almost parallel to that of fRANK in RAW264.7 cells not treated with M-CSF. Overexpression of vRANK, on the other hand, decreased TRACP (a marker of osteoclasts) mRNA expression as well as the number of TRACP-positive multinucleated giant cells. While the mRNA expression levels of NFATc1 (a master transcriptional factor of the osteoclast differentiation program) were not affected, apoptotic cells increased significantly in vRAN K-transfected cells treated with sRANKL. Taken together, these results suggest that vRANK is a novel osteoclast suppressor that reduces the number of RANKL-induced mature osteoclasts mainly by negating the anti-apoptotic effect of RANKL.

  8. Development of a Targeted Multi-Disorder High-Throughput Sequencing Assay for the Effective Identification of Disease-Causing Variants

    PubMed Central

    Delio, Maria; Patel, Kunjan; Maslov, Alex; Marion, Robert W.; McDonald, Thomas V.; Cadoff, Evan M.; Golden, Aaron; Greally, John M.; Vijg, Jan; Morrow, Bernice; Montagna, Cristina

    2015-01-01

    Background While next generation sequencing (NGS) is a useful tool for the identification of genetic variants to aid diagnosis and support therapy decision, high sequencing costs have limited its application within routine clinical care, especially in economically depressed areas. To investigate the utility of a multi-disease NGS based genetic test, we designed a custom sequencing assay targeting over thirty disease-associated areas including cardiac disorders, intellectual disabilities, hearing loss, collagenopathies, muscular dystrophy, Ashkenazi Jewish genetic disorders, and complex Mendelian disorders. We focused on these specific areas based on the interest of our collaborative clinical team, suggesting these diseases being the ones in need for the development of a sequencing-screening assay. Results We targeted all coding, untranslated regions (UTR) and flanking intronic regions of 650 known disease-associated genes using the Roche-NimbleGen EZ SeqCapV3 capture system and sequenced on the Illumina HiSeq 2500 Rapid Run platform. Eight controls with known variants and one HapMap sample were first sequenced to assess the performance of the panel. Subsequently, as a proof of principle and to explore the possible utility of our test, we analyzed test disease subjects (n = 16). Eight had known Mendelian disorders and eight had complex pediatric diseases. In addition to assess whether copy number variation may be of utility as a companion assay relative to these specific disease areas, we used the Affymetrix Genome-Wide SNP Array 6.0 to analyze the same samples. Conclusion We identified potentially disease-associated variants: 22 missense, 4 nonsense, 1 frameshift, and 1 splice variants (16 previously identified, 12 novel among dbSNP and 15 novel among NHLBI Exome Variant Server). We found multi-disease targeted high-throughput sequencing to be a cost efficient approach in detecting disease-associated variants to aid diagnosis. PMID:26214305

  9. Identification of a new hereditary amyloidosis prealbumin variant, Tyr-77, and detection of the gene by DNA analysis.

    PubMed Central

    Wallace, M R; Dwulet, F E; Williams, E C; Conneally, P M; Benson, M D

    1988-01-01

    In the last several years, five human plasma prealbumin (transthyretin) variants have been discovered in association with hereditary amyloidosis, a late-onset fatal disorder. We recently studied a patient of German descent with peripheral neuropathy and bowel dysfunction. Biopsied rectal tissue contained amyloid that stained with anti-human prealbumin. Amino acid sequence analysis of the patient's plasma prealbumin revealed both normal and variant prealbumin molecules, with the variant containing a tyrosine at position 77 instead of serine. We predicted a single nucleotide change in codon 77 of the variant prealbumin gene, which we then detected in the patient's DNA using the restriction enzyme SspI and a specifically tailored genomic prealbumin probe. DNA tests of other family members identified several gene carriers. This is the sixth prealbumin variant implicated in amyloidosis, and adds to the accumulating evidence that the prealbumin amyloidoses are more varied and prevalent than previously thought. Images PMID:2891727

  10. Identification and DNA sequence analysis of 15 new {alpha}{sub 1}-antitrypsin variants, including two PI*QO alleles and one deficient PI*M allele

    SciTech Connect

    Faber, J.P.; Kirchgesser, M.; Schwaab, R.; Bidlingmaier, F.; Poller, W.; Weidinger, S.; Olek, K. |

    1994-12-01

    The authors have investigated the molecular basis of 15 new {alpha}{sub 1}-antitrypsin ({alpha}1AT) variants. Phenotyping by isoelectric focusing (IEF) was used as a screening method to detect {alpha}1AT variants at the protein level. Genotyping was then performed by sequence analysis of all coding exons, exon-intron junctions, and the hepatocyte-specific promotor region including exon Ic. Three of these rare variants are alleles of clinical relevance, associated with undetectable or very low serum levels of {alpha}1AT: the PI*Q0saarbruecken allele generated by a 1-bp C-nucleotide insertion within a stretch of seven cytosines spanning residues 360-362, resulting in a 3{prime} frameshift and the acquisition of a stop codon at residue 376; a point mutation in the PI*Q0lisbon allele, resulting in a single amino acid substitution Thr{sup 68}(ACC){yields}Ile(ATC); and an in-frame trinucleotide deletion {Delta}Phe{sup 51} (TTC) in the highly deficient PI*Mpalermo allele. The remaining 12 alleles are associated with normal {alpha}1AT serum levels and are characterized by point mutations causing single amino acid substitutions in all but one case. This exception is a silent mutation, which does not affect the amino acid sequence. The limitation of IEF compared with DNA sequence analysis, for identification of new variants, their generation by mutagenesis, and the clinical relevance of the three deficiency alleles are discussed.

  11. Sex, Sexual Orientation, and Identification of Positive and Negative Facial Affect

    ERIC Educational Resources Information Center

    Rahman, Qazi; Wilson, Glenn D.; Abrahams, Sharon

    2004-01-01

    Sex and sexual orientation related differences in processing of happy and sad facial emotions were examined using an experimental facial emotion recognition paradigm with a large sample (N=240). Analysis of covariance (controlling for age and IQ) revealed that women (irrespective of sexual orientation) had faster reaction times than men for…

  12. Identification of novel host-oriented targets for Human Immunodeficiency Virus type 1 using Random Homozygous Gene Perturbation

    PubMed Central

    Mao, Hanwen; Chen, Hanson; Fesseha, Zena; Chang, Shaojing; Ung-Medoff, Huong; Van Dyke, Jessica; Kohli, Manu; Li, Wu-Bo; Goldblatt, Michael; Kinch, Michael S

    2009-01-01

    Background Human Immunodeficiency Virus (HIV) is a global threat to public health. Current therapies that directly target the virus often are rendered ineffective due to the emergence of drug-resistant viral variants. An emerging concept to combat drug resistance is the idea of targeting host mechanisms that are essential for the propagation of the virus, but have a minimal cellular effect. Results Herein, using Random Homozygous Gene Perturbation (RHGP), we have identified cellular targets that allow human MT4 cells to survive otherwise lethal infection by a wild type HIV-1NL4-3. These gene targets were validated by the reversibility of the RHGP technology, which confirmed that the RHGP itself was responsible for the resistance to HIV-1 infection. We further confirmed by siRNA knockdowns that the RHGP-identified cellular pathways are responsible for resistance to infection by either CXCR4 or CCR5 tropic HIV-1 variants. We also demonstrated that cell clones with these gene targets disrupted by RHGP were not permissible to the replication of a drug resistant HIV-1 mutant. Conclusion These studies demonstrate the power of RHGP to identify novel host targets that are essential for the viral life cycle but which can be safely perturbed without overt cytotoxicity. These findings suggest opportunities for the future development of host-oriented therapeutics with the broad spectrum potential for safe and effective inhibition of HIV infection. PMID:19788744

  13. Silencing of two alternative splicing-derived mRNA variants of chitin synthase 1 gene by RNAi is lethal to the oriental migratory locust, Locusta migratoria manilensis (Meyen).

    PubMed

    Zhang, Jianzhen; Liu, Xiaojian; Zhang, Jianqin; Li, Daqi; Sun, Yi; Guo, Yaping; Ma, Enbo; Zhu, Kun Yan

    2010-11-01

    Chitin synthases are crucial enzymes responsible for chitin biosynthesis in fungi, nematodes and arthropods. We characterized two alternative splicing-derived variants of chitin synthase 1 gene (LmCHS1) from the oriental migratory locust, Locusta migratoria manilensis (Meyen). Each cDNA of the two variants (LmCHS1A and LmCHS1B) consists of 5116 nucleotides that include a 4728-nucleotide open reading frame (ORF) encoding 1576 amino acid residues, and 67- and 321-bp non-coding regions at the 5'- and 3'-ends of the cDNA, respectively. The two variants differ only in one exon consisting of 177 nucleotides that encode 59 amino acid residues. The amino acid sequences within this alternative splicing region are 75% identical between the two variants. Both variants were expressed in all the developmental stages. However, LmCHS1A was predominately expressed in the integument whereas LmCHS1B was mainly expressed in the trachea. Our RNAi-based gene silencing study resulted in a dramatic reduction in the levels of the corresponding mRNA in the locust nymphs injected with dsRNA of LmCHS1, or either of its two variants, LmCHS1A and LmCHS1B. Consequentially, 95, 88 and 51% of mortalities were observed in the locusts injected with the LmCHS1, LmCHS1A and LmCHS1B dsRNA, respectively. The phenotypes resulted from the injection of LmCHS1A dsRNA were similar to those from the injection of LmCHS1 dsRNA, whereas the locusts injected with LmCHS1B dsRNA exhibited crimpled cuticle phenotype. Our results suggest that both variants of chitin synthase 1 are essential for insect growth and development.

  14. Identification of cancer predisposition variants in apparently healthy individuals using a next-generation sequencing-based family genomics approach.

    PubMed

    Karageorgos, Ioannis; Mizzi, Clint; Giannopoulou, Efstathia; Pavlidis, Cristiana; Peters, Brock A; Zagoriti, Zoi; Stenson, Peter D; Mitropoulos, Konstantinos; Borg, Joseph; Kalofonos, Haralabos P; Drmanac, Radoje; Stubbs, Andrew; van der Spek, Peter; Cooper, David N; Katsila, Theodora; Patrinos, George P

    2015-06-20

    Cancer, like many common disorders, has a complex etiology, often with a strong genetic component and with multiple environmental factors contributing to susceptibility. A considerable number of genomic variants have been previously reported to be causative of, or associated with, an increased risk for various types of cancer. Here, we adopted a next-generation sequencing approach in 11 members of two families of Greek descent to identify all genomic variants with the potential to predispose family members to cancer. Cross-comparison with data from the Human Gene Mutation Database identified a total of 571 variants, from which 47 % were disease-associated polymorphisms, 26 % disease-associated polymorphisms with additional supporting functional evidence, 19 % functional polymorphisms with in vitro/laboratory or in vivo supporting evidence but no known disease association, 4 % putative disease-causing mutations but with some residual doubt as to their pathological significance, and 3 % disease-causing mutations. Subsequent analysis, focused on the latter variant class most likely to be involved in cancer predisposition, revealed two variants of prime interest, namely MSH2 c.2732T>A (p.L911R) and BRCA1 c.2955delC, the first of which is novel. KMT2D c.13895delC and c.1940C>A variants are additionally reported as incidental findings. The next-generation sequencing-based family genomics approach described herein has the potential to be applied to other types of complex genetic disorder in order to identify variants of potential pathological significance.

  15. Identification of a variant antigenic neutralizing epitope in hypervariable region 1 of avian leukosis virus subgroup J.

    PubMed

    Hou, Minbo; Zhou, Defang; Li, Gen; Guo, Huijun; Liu, Jianzhu; Wang, Guihua; Zheng, Qiankun; Cheng, Ziqiang

    2016-03-08

    Avian leukosis virus subgroup J (ALV-J) is a hypervariable oncogenic retrovirus that causes great economic loss in poultry. Antigenic variations in the variable regions make the development of an effective vaccine a challenging task. In the present study, we identified a variant antigenic neutralizing epitope using reverse vaccinology methods. First, we predicted the B-cell epitopes in gp85 gene of ALV-J strains by DNAman and bioinformatics. Fourteen candidate epitopes were selected and linked in tandem with glycines or serines as a multi-epitope gene. The expressed protein of multi-epitope gene can induce high-titer antibody that can recognize nature ALV-J and neutralize the infectivity of ALV-J strains. Next, we identified a high effective epitope using eight overlapping fragments of gp85 gene reacting with mAb 2D5 and anti-multi-epitope sera. The identified epitope contained one of the predicted epitopes and localized in hyervariable region 1 (hr1), indicating a variant epitope. To better understand if the variants of the epitope have a good antigenicity, we synthesized four variants to react with mAb 2D5 and anti-ALV-J sera. The result showed that all variants could react with the two kinds of antibodies though they showed different antigenicity, while could not react with ALV-J negative sera. Thus, the variant antigenic neutralizing epitope was determined as 137-LRDFIA/E/TKWKS/GDDL/HLIRPYVNQS-158. The result shows a potential use of this variant epitopes as a novel multi-epitope vaccine against ALV-J in poultry.

  16. Study designs for identification of rare disease variants in complex diseases: the utility of family-based designs.

    PubMed

    Ionita-Laza, Iuliana; Ottman, Ruth

    2011-11-01

    The recent progress in sequencing technologies makes possible large-scale medical sequencing efforts to assess the importance of rare variants in complex diseases. The results of such efforts depend heavily on the use of efficient study designs and analytical methods. We introduce here a unified framework for association testing of rare variants in family-based designs or designs based on unselected affected individuals. This framework allows us to quantify the enrichment in rare disease variants in families containing multiple affected individuals and to investigate the optimal design of studies aiming to identify rare disease variants in complex traits. We show that for many complex diseases with small values for the overall sibling recurrence risk ratio, such as Alzheimer's disease and most cancers, sequencing affected individuals with a positive family history of the disease can be extremely advantageous for identifying rare disease variants. In contrast, for complex diseases with large values of the sibling recurrence risk ratio, sequencing unselected affected individuals may be preferable.

  17. Expanding the mutation spectrum in 182 Spanish probands with craniosynostosis: identification and characterization of novel TCF12 variants

    PubMed Central

    Paumard-Hernández, Beatriz; Berges-Soria, Julia; Barroso, Eva; Rivera-Pedroza, Carlos I; Pérez-Carrizosa, Virginia; Benito-Sanz, Sara; López-Messa, Eva; Santos, Fernando; García-Recuero, Ignacio I; Romance, Ana; Ballesta-Martínez, Juliana María; López-González, Vanesa; Campos-Barros, Ángel; Cruz, Jaime; Guillén-Navarro, Encarna; Sánchez del Pozo, Jaime; Lapunzina, Pablo; García-Miñaur, Sixto; Heath, Karen E

    2015-01-01

    Craniosynostosis, caused by the premature fusion of one or more of the cranial sutures, can be classified into non-syndromic or syndromic and by which sutures are affected. Clinical assignment is a difficult challenge due to the high phenotypic variability observed between syndromes. During routine diagnostics, we screened 182 Spanish craniosynostosis probands, implementing a four-tiered cascade screening of FGFR2, FGFR3, FGFR1, TWIST1 and EFNB1. A total of 43 variants, eight novel, were identified in 113 (62%) patients: 104 (92%) detected in level 1; eight (7%) in level 2 and one (1%) in level 3. We subsequently screened additional genes in the probands with no detected mutation: one duplication of the IHH regulatory region was identified in a patient with craniosynostosis Philadelphia type and five variants, four novel, were identified in the recently described TCF12, in probands with coronal or multisuture affectation. In the 19 Saethre–Chotzen syndrome (SCS) individuals in whom a variant was detected, 15 (79%) carried a TWIST1 variant, whereas four (21%) had a TCF12 variant. Thus, we propose that TCF12 screening should be included for TWIST1 negative SCS patients and in patients where the coronal suture is affected. In summary, a molecular diagnosis was obtained in a total of 119/182 patients (65%), allowing the correct craniosynostosis syndrome classification, aiding genetic counselling and in some cases provided a better planning on how and when surgical intervention should take place and, subsequently the appropriate clinical follow up. PMID:25271085

  18. Expanding the mutation spectrum in 182 Spanish probands with craniosynostosis: identification and characterization of novel TCF12 variants.

    PubMed

    Paumard-Hernández, Beatriz; Berges-Soria, Julia; Barroso, Eva; Rivera-Pedroza, Carlos I; Pérez-Carrizosa, Virginia; Benito-Sanz, Sara; López-Messa, Eva; Santos, Fernando; García-Recuero, Ignacio I; Romance, Ana; Ballesta-Martínez, Juliana María; López-González, Vanesa; Campos-Barros, Ángel; Cruz, Jaime; Guillén-Navarro, Encarna; Sánchez Del Pozo, Jaime; Lapunzina, Pablo; García-Miñaur, Sixto; Heath, Karen E

    2015-07-01

    Craniosynostosis, caused by the premature fusion of one or more of the cranial sutures, can be classified into non-syndromic or syndromic and by which sutures are affected. Clinical assignment is a difficult challenge due to the high phenotypic variability observed between syndromes. During routine diagnostics, we screened 182 Spanish craniosynostosis probands, implementing a four-tiered cascade screening of FGFR2, FGFR3, FGFR1, TWIST1 and EFNB1. A total of 43 variants, eight novel, were identified in 113 (62%) patients: 104 (92%) detected in level 1; eight (7%) in level 2 and one (1%) in level 3. We subsequently screened additional genes in the probands with no detected mutation: one duplication of the IHH regulatory region was identified in a patient with craniosynostosis Philadelphia type and five variants, four novel, were identified in the recently described TCF12, in probands with coronal or multisuture affectation. In the 19 Saethre-Chotzen syndrome (SCS) individuals in whom a variant was detected, 15 (79%) carried a TWIST1 variant, whereas four (21%) had a TCF12 variant. Thus, we propose that TCF12 screening should be included for TWIST1 negative SCS patients and in patients where the coronal suture is affected. In summary, a molecular diagnosis was obtained in a total of 119/182 patients (65%), allowing the correct craniosynostosis syndrome classification, aiding genetic counselling and in some cases provided a better planning on how and when surgical intervention should take place and, subsequently the appropriate clinical follow up.

  19. Postmortem genetic screening for the identification, verification, and reporting of genetic variants contributing to the sudden death of the young.

    PubMed

    Methner, D Nicole R; Scherer, Steven E; Welch, Katherine; Walkiewicz, Magdalena; Eng, Christine M; Belmont, John W; Powell, Mark C; Korchina, Viktoriya; Doddapaneni, Harsha Vardhan; Muzny, Donna M; Gibbs, Richard A; Wolf, Dwayne A; Sanchez, Luis A; Kahn, Roger

    2016-09-01

    Each year in the United States, thousands of cases of sudden and unexpected deaths of infants, children, and young adults are assigned an undetermined cause of death after postmortem investigation and autopsy. Heritable genetic variants have been suggested as the cause of up to a third of sudden death (SD) cases. Elucidation of the genetic variants involved in SD cases is important to not only help establish cause and manner of death of these individuals, but to also aid in determining whether familial genetic testing should be considered. Previously, these types of postmortem screenings have not been a feasible option for most county medical examiners' and coroners' offices. We sequenced full exons of 64 genes associated with SD in the largest known cohort (351) of infant and young SD decedents using massively parallel sequencing at <$600 per sample. Genetic variants were assessed through literature review and clinical evaluation by a multidisciplinary consortium of experts. Thirteen individuals (3.7%), eight infants (2.8% of those <1 yr of age) and five children/young adults (7.0% of those >1 yr of age), were found to have a reportable genetic variant contributing to SD. These percentages represent an estimate lower than those previously reported. Overall yields and results likely vary between studies due to differences in evaluation techniques and reporting. Additionally, we recommend ongoing assessment of data, including nonreported novel variants, as technology and literature continually advance. This study demonstrates a strategy to implement molecular autopsies in medicolegal investigations of young SD decedents.

  20. Identification of a Novel De Novo Variant in the PAX3 Gene in Waardenburg Syndrome by Diagnostic Exome Sequencing: The First Molecular Diagnosis in Korea

    PubMed Central

    Jang, Mi-Ae; Lee, Taeheon; Lee, Junnam

    2015-01-01

    Waardenburg syndrome (WS) is a clinically and genetically heterogeneous hereditary auditory pigmentary disorder characterized by congenital sensorineural hearing loss and iris discoloration. Many genes have been linked to WS, including PAX3, MITF, SNAI2, EDNRB, EDN3, and SOX10, and many additional genes have been associated with disorders with phenotypic overlap with WS. To screen all possible genes associated with WS and congenital deafness simultaneously, we performed diagnostic exome sequencing (DES) in a male patient with clinical features consistent with WS. Using DES, we identified a novel missense variant (c.220C>G; p.Arg74Gly) in exon 2 of the PAX3 gene in the patient. Further analysis by Sanger sequencing of the patient and his parents revealed a de novo occurrence of the variant. Our findings show that DES can be a useful tool for the identification of pathogenic gene variants in WS patients and for differentiation between WS and similar disorders. To the best of our knowledge, this is the first report of genetically confirmed WS in Korea. PMID:25932447

  1. Identification of Putative Olfactory Genes from the Oriental Fruit Moth Grapholita molesta via an Antennal Transcriptome Analysis

    PubMed Central

    Li, Yiping; Wu, Junxiang

    2015-01-01

    Background The oriental fruit moth, Grapholita molesta, is an extremely important oligophagous pest species of stone and pome fruits throughout the world. As a host-switching species, adult moths, especially females, depend on olfactory cues to a large extent in locating host plants, finding mates, and selecting oviposition sites. The identification of olfactory genes can facilitate investigation on mechanisms for chemical communications. Methodology/Principal Finding We generated transcriptome of female antennae of G.molesta using the next-generation sequencing technique, and assembled transcripts from RNA-seq reads using Trinity, SOAPdenovo-trans and Abyss-trans assemblers. We identified 124 putative olfactory genes. Among the identified olfactory genes, 118 were novel to this species, including 28 transcripts encoding for odorant binding proteins, 17 chemosensory proteins, 48 odorant receptors, four gustatory receptors, 24 ionotropic receptors, two sensory neuron membrane proteins, and one odor degrading enzyme. The identified genes were further confirmed through semi-quantitative reverse transcription PCR for transcripts coding for 26 OBPs and 17 CSPs. OBP transcripts showed an obvious antenna bias, whereas CSP transcripts were detected in different tissues. Conclusion Antennal transcriptome data derived from the oriental fruit moth constituted an abundant molecular resource for the identification of genes potentially involved in the olfaction process of the species. This study provides a foundation for future research on the molecules involved in olfactory recognition of this insect pest, and in particular, the feasibility of using semiochemicals to control this pest. PMID:26540284

  2. Identification of a functional variant in the KIF5A-CYP27B1-METTL1-FAM119B locus associated with multiple sclerosis

    PubMed Central

    Alcina, Antonio; Fedetz, Maria; Fernández, Óscar; Saiz, Albert; Izquierdo, Guillermo; Lucas, Miguel; Leyva, Laura; García-León, Juan-Antonio; Abad-Grau, María del Mar; Alloza, Iraide; Antigüedad, Alfredo; Garcia-Barcina, María J; Vandenbroeck, Koen; Varadé, Jezabel; de la Hera, Belén; Arroyo, Rafael; Comabella, Manuel; Montalban, Xavier; Petit-Marty, Natalia; Navarro, Arcadi; Otaegui, David; Olascoaga, Javier; Blanco, Yolanda; Urcelay, Elena; Matesanz, Fuencisla

    2013-01-01

    Background and aim Several studies have highlighted the association of the 12q13.3–12q14.1 region with coeliac disease, type 1 diabetes, rheumatoid arthritis and multiple sclerosis (MS); however, the causal variants underlying diseases are still unclear. The authors sought to identify the functional variant of this region associated with MS. Methods Tag-single nucleotide polymorphism (SNP) analysis of the associated region encoding 15 genes was performed in 2876 MS patients and 2910 healthy Caucasian controls together with expression regulation analyses. Results rs6581155, which tagged 18 variants within a region where 9 genes map, was sufficient to model the association. This SNP was in total linkage disequilibrium (LD) with other polymorphisms that associated with the expression levels of FAM119B, AVIL, TSFM, TSPAN31 and CYP27B1 genes in different expression quantitative trait loci studies. Functional annotations from Encyclopedia of DNA Elements (ENCODE) showed that six out of these rs6581155-tagged-SNPs were located in regions with regulatory potential and only one of them, rs10877013, exhibited allele-dependent (ratio A/G=9.5-fold) and orientation-dependent (forward/reverse=2.7-fold) enhancer activity as determined by luciferase reporter assays. This enhancer is located in a region where a long-range chromatin interaction among the promoters and promoter-enhancer of several genes has been described, possibly affecting their expression simultaneously. Conclusions This study determines a functional variant which alters the enhancer activity of a regulatory element in the locus affecting the expression of several genes and explains the association of the 12q13.3–12q14.1 region with MS. PMID:23160276

  3. Identification of a novel nonsense mutation in POLH in a Chinese pedigree with xeroderma pigmentosum, variant type.

    PubMed

    Liu, Xiaoyan; Zhang, Xianning; Qiao, Jianjun; Fang, Hong

    2013-01-01

    Xeroderma pigmentosum-variant (XPV) is one type of XP, a rare autosomal recessive disorder, and caused by defects in the post replication repair machinery while nucleotide-excision repair (NER) is not impaired. In the present study, we reported a Chinese family with XPV phenotype, which was confirmed by histopathological results. Genetic variants were detected by polymerase chain reaction and exon sequencing. Furthermore, the reported molecular defects in XPV patients from previous literatures were reviewed. A homozygous c.67C>T mutation in the exon 2 of DNA polymerase eta (POLH), a novel non-sense mutation in POLH, was discovered.

  4. Identification of Two Novel Mycobacterium avium Allelic Variants in Pig and Human Isolates from Brazil by PCR-Restriction Enzyme Analysis

    PubMed Central

    Leão, Sylvia Cardoso; Briones, Marcelo R. S.; Sircili, Marcelo Palma; Balian, Simone Carvalho; Mores, Nelson; Ferreira-Neto, José Soares

    1999-01-01

    Mycobacterium avium complex (MAC) is composed of environmental mycobacteria found widely in soil, water, and aerosols that can cause disease in animals and humans, especially disseminated infections in AIDS patients. MAC consists of two closely related species, M. avium and M. intracellulare, and may also include other, less-defined groups. The precise differentiation of MAC species is a fundamental step in epidemiological studies and for the evaluation of possible reservoirs for MAC infection in humans and animals. In this study, which included 111 pig and 26 clinical MAC isolates, two novel allelic M. avium PCR-restriction enzyme analysis (PRA) variants were identified, differing from the M. avium PRA prototype in the HaeIII digestion pattern. Mutations in HaeIII sites were confirmed by DNA sequencing. Identification of these isolates as M. avium was confirmed by PCR with DT1-DT6 and IS1245 primers, nucleic acid hybridization with the AccuProbe system, 16S ribosomal DNA sequencing, and biochemical tests. The characterization of M. avium PRA variants can be useful in the elucidation of factors involved in mycobacterial virulence and routes of infection and also has diagnostic significance, since they can be misidentified as M. simiae II and M. kansasii I if the PRA method is used in the clinical laboratory for identification of mycobacteria. PMID:10405407

  5. Effect of selective and distributed training on visual identification of orientation.

    PubMed

    Tschopp-Junker, Chantal; Gentaz, Edouard; Viviani, Paolo

    2010-05-01

    An experiment contrasted the effect of four training schedules in a visual orientation reproduction task. Two selective schedules involved repeated presentation of a single target orientation. Two non-selective schedules involved targets covering the first quadrant either at fixed, equispaced orientations, or distributed randomly. In pre-training sessions, we observed the classical oblique effect (precision for vertical and horizontal stimuli higher than for oblique ones). Practice improved precision with both distributed schedules, but was ineffectual for non-selective schedules. However, a significant oblique effect persisted under all conditions. We argue that the pattern of results is compatible with the hypothesis that the oblique effect reflects both the intrinsic neuronal properties of the primary visual system, and the structure of the visual space imposed by higher, more cognitive processes. The results challenge the thesis that only attentional and post-perceptual factors are able to affect the working of the early visual system.

  6. Whole-genome re-sequencing for the identification of high contribution susceptibility gene variants in patients with type 2 diabetes

    PubMed Central

    SUN, XIAOJUAN; SUI, WEIGUO; WANG, XIAOBING; HOU, XIANLIANG; OU, MINGLIN; DAI, YONG; XIANG, YUEYING

    2016-01-01

    There is increasing evidence that several genes are associated with an increased risk of type 2 diabetes (T2D); genome-wide association investigations and whole-genome re-sequencing investigations offer a useful approach for the identification of genes involved in common human diseases. To further investigate which polymorphisms confer susceptibility to T2D, the present study screened for high-contribution susceptibility gene variants Chinese patients with T2D using whole-genome re-sequencing with DNA pooling. In total, 100 Chinese individuals with T2D and 100 healthy Chinese individuals were analyzed using whole-genome re-sequencing using DNA pooling. To minimize the likelihood of systematic bias in sampling, paired-end libraries with an insert size of 500 bp were prepared for in T2D in all samples, which were then subjected to whole-genome sequencing. Each library contained four lanes. The average sequencing depth was 35.70. In the present study, 1.36 GB of clean sequence data were generated, and the resulting calculated T2D genome consensus sequence covered 99.88% of the hg19 sequence. A total of 3,974,307 single nucleotide polymorphisms were identified, of which 99.88% were in the dbSNP database. The present study also found 642,189 insertions and deletions, 5,590 structure variants (SVs), 4,713 copy number variants (CNVs) and 13,049 single nucleotide variants. A total of 1,884 somatic CNVs and 74 somatic SVs were significantly different between the cases and controls. Therefore, the present study provided validation of whole-genome re-sequencing using the DNA pooling approach. It also generated a whole-genome re-sequencing genotype database for future investigations of T2D. PMID:27035118

  7. Identification of genetic variants associated with maize flowering time using an extremely large multi-genetic background population

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flowering time is one of the major adaptive traits in domestication of maize and an important selection criterion in breeding. To detect more maize flowering time variants we evaluated flowering time traits using an extremely large multi- genetic background population that contained more than 8000 l...

  8. Identification of rare variants of DSP gene in Sudden Unexplained Nocturnal Death Syndrome in the southern Chinese Han population

    PubMed Central

    Zhao, Qianhao; Chen, Yili; Peng, Longlun; Gao, Rui; Liu, Nian; Jiang, Pingping; Liu, Chao; Tang, Shuangbo

    2016-01-01

    Sudden unexplained nocturnal death syndrome (SUNDS) is a perplexing disorder to both forensic pathologists and clinic physicians. Desmoplakin (DSP) gene was the first desmosomal gene linked to arrhythmogenic right ventricular cardiomyopathy (ARVC) which was associated with sudden death. To identify the genetic variants of the DSP gene in SUNDS in the southern Chinese Han population, we genetically screened the DSP gene in 40 sporadic SUNDS victims, 16 Brugada syndrome (BrS) patients and 2 Early Repolarization syndrome (ERS) patients using Next Generation Sequencing (NSG) and direct Sanger sequencing. A total of 10 genetic variants of the DSP gene were detected in 11 cases, comprised of two novel missense mutations (p.I125F and p.D521A) and eight previously reported rare variants. Of eight reported variants, two were previously considered pathogenic (p.Q90R and p.R2639Q), three were predicted in silico to bepathogenic (p.R315C, p.E1357D and p.D2579H), and the rest three were predicted to be benign (p.N1234S, p.R1308Q and p.T2267S). This is the first report of DSP genetic screening in Chinese SUNDS and Brugada syndrome. Our results implies that DSP mutations contribute to the genetic cause of some SUNDS victims and maybe a new susceptible gene for Brugada syndrome. PMID:26585738

  9. Identification of rare variants of DSP gene in sudden unexplained nocturnal death syndrome in the southern Chinese Han population.

    PubMed

    Zhao, Qianhao; Chen, Yili; Peng, Longlun; Gao, Rui; Liu, Nian; Jiang, Pingping; Liu, Chao; Tang, Shuangbo; Quan, Li; Makielski, Jonathan C; Cheng, Jianding

    2016-03-01

    Sudden unexplained nocturnal death syndrome (SUNDS) is a perplexing disorder to both forensic pathologists and clinic physicians. Desmoplakin (DSP) gene was the first desmosomal gene linked to arrhythmogenic right ventricular cardiomyopathy (ARVC) which was associated with sudden death. To identify the genetic variants of the DSP gene in SUNDS in the southern Chinese Han population, we genetically screened the DSP gene in 40 sporadic SUNDS victims, 16 Brugada syndrome (BrS) patients, and 2 early repolarization syndrome (ERS) patients using next generation sequencing (NSG) and direct Sanger sequencing. A total of 10 genetic variants of the DSP gene were detected in 11 cases, comprised of two novel missense mutations (p.I125F and p.D521A) and eight previously reported rare variants. Of eight reported variants, two were previously considered pathogenic (p.Q90R and p.R2639Q), three were predicted in silico to be pathogenic (p.R315C, p.E1357D and p.D2579H), and the rest three were predicted to be benign (p.N1234S, p.R1308Q, and p.T2267S). This is the first report of DSP genetic screening in Chinese SUNDS and Brugada syndrome. Our results imply that DSP mutations contribute to the genetic cause of some SUNDS victims and maybe a new susceptible gene for Brugada syndrome.

  10. Identification of a novel pathogenic OTOF variant causative of nonsyndromic hearing loss with high frequency in the Ashkenazi Jewish population

    PubMed Central

    Fedick, Anastasia M; Jalas, Chaim; Swaroop, Ananya; Smouha, Eric E; Webb, Bryn D

    2016-01-01

    Mutations in the OTOF gene have previously been shown to cause nonsyndromic prelingual deafness (DFNB9, OMIM 601071) as well as auditory neuropathy/dys-synchrony. In this study, the OTOF NM_194248.2 c.5332G>T, p.Val1778Phe variant was identified in a large Ashkenazi Jewish family as the causative variant in four siblings with hearing loss. Our analysis reveals a carrier frequency of the OTOF c.5332G>T, p.Val1778Phe variant of 1.27% in the Ashkenazi Jewish population, suggesting that this variant may be a significant contributor to nonsyndromic sensorineural hearing loss and should be considered for inclusion in targeted hearing loss panels for this population. Of note, the degree of hearing loss associated with this phenotype ranged from mild to moderately severe, with two of the four siblings not known to have hearing loss until they were genotyped and underwent pure tone audiometry and auditory brainstem response testing. The phenotypic variability along with the auditory neuropathy/dys-synchrony, which allows for the production of otoacoustic emissions, supports that nonsyndromic hearing loss caused by OTOF mutations may be much more common in the Ashkenazi Jewish population than currently appreciated due to a lack of diagnosis. PMID:27621663

  11. Postmortem genetic screening for the identification, verification, and reporting of genetic variants contributing to the sudden death of the young

    PubMed Central

    Methner, D. Nicole R.; Scherer, Steven E.; Welch, Katherine; Walkiewicz, Magdalena; Eng, Christine M.; Belmont, John W.; Powell, Mark C.; Korchina, Viktoriya; Doddapaneni, Harsha Vardhan; Muzny, Donna M.; Gibbs, Richard A.; Wolf, Dwayne A.; Sanchez, Luis A.; Kahn, Roger

    2016-01-01

    Each year in the United States, thousands of cases of sudden and unexpected deaths of infants, children, and young adults are assigned an undetermined cause of death after postmortem investigation and autopsy. Heritable genetic variants have been suggested as the cause of up to a third of sudden death (SD) cases. Elucidation of the genetic variants involved in SD cases is important to not only help establish cause and manner of death of these individuals, but to also aid in determining whether familial genetic testing should be considered. Previously, these types of postmortem screenings have not been a feasible option for most county medical examiners’ and coroners’ offices. We sequenced full exons of 64 genes associated with SD in the largest known cohort (351) of infant and young SD decedents using massively parallel sequencing at <$600 per sample. Genetic variants were assessed through literature review and clinical evaluation by a multidisciplinary consortium of experts. Thirteen individuals (3.7%), eight infants (2.8% of those <1 yr of age) and five children/young adults (7.0% of those >1 yr of age), were found to have a reportable genetic variant contributing to SD. These percentages represent an estimate lower than those previously reported. Overall yields and results likely vary between studies due to differences in evaluation techniques and reporting. Additionally, we recommend ongoing assessment of data, including nonreported novel variants, as technology and literature continually advance. This study demonstrates a strategy to implement molecular autopsies in medicolegal investigations of young SD decedents. PMID:27435932

  12. Identification as Incentive to Care: Pre-Service Teachers' Orientation towards Inclusion in Nature

    ERIC Educational Resources Information Center

    Gedžune, Inga

    2015-01-01

    This study proposes identification with nature as a pedagogical technique in teacher education for sustainability to facilitate commitment to care about nonhuman nature, such care being an important underpinning of an inclusive and hence sustainable human-nature relationship. 29 pre-service teachers participated in a series of learning activities…

  13. Trypanosoma evansi: identification and characterization of a variant surface glycoprotein lacking cysteine residues in its C-terminal domain.

    PubMed

    Jia, Yonggen; Zhao, Xinxin; Zou, Jingru; Suo, Xun

    2011-01-01

    African trypanosomes are flagellated unicellular parasites which proliferate extracellularly in the mammalian host blood-stream and tissue spaces. They evade the hosts' antibody-mediated lyses by sequentially changing their variant surface glycoprotein (VSG). VSG tightly coats the entire parasite body, serving as a physical barrier. In Trypanosoma brucei and the closely related species Trypanosoma evansi, Trypanosoma equiperdum, each VSG polypeptide can be divided into N- and C-terminal domains, based on cysteine distribution and sequence homology. N-terminal domain, the basis of antigenic variation, is hypervariable and contains all the exposed epitopes; C-terminal domain is relatively conserved and a full set of four or eight cysteines were generally observed. We cloned two genes from two distinct variants of T. evansi, utilizing RT-PCR with VSG-specific primers. One contained a VSG type A N-terminal domain followed a C-terminal domain lacking cysteine residues. To confirm that this gene is expressed as a functional VSG, the expression and localization of the corresponding gene product were characterized using Western blotting and immunofluorescent staining of living trypanosomes. Expression analysis showed that this protein was highly expressed, variant-specific, and had a ubiquitous cellular surface localization. All these results indicated that it was expressed as a functional VSG. Our finding showed that cysteine residues in VSG C-terminal domain were not essential; the conserved C-terminal domain generally in T. brucei like VSGs would possibly evolve for regulating the VSG expression.

  14. Identification and characterization of a truncated variant of the 5-hydroxytryptamine(2A) receptor produced by alternative splicing.

    PubMed

    Guest, P C; Salim, K; Skynner, H A; George, S E; Bresnick, J N; McAllister, G

    2000-09-08

    We have identified an alternatively spliced 5-hydroxytryptamine 2A receptor (5-HT(2A)-R) transcript by PCR of human brain cDNA using degenerate oligonucleotide primers to transmembrane (TM) domains 3 and 7 of the 5-HT(2)-R subfamily. The variant contains a 118-bp insertion at the exon II/III boundary of the 5-HT(2A)-R, which produces a frame shift in the coding sequence and a premature stop codon. PCR analysis showed that the truncated receptor (5-HT(2A-tr)) and native 5-HT(2A)-R were co-expressed in most brain tissues, with the highest levels being found in hippocampus, corpus collosum, amygdala and caudate nucleus. Western blot analysis of HEK-293 cells transfected transiently with a 5-HT(2A-tr) construct showed that a 30-kDa protein was expressed on cell membranes. Co-transfection studies showed no effect of the 5-HT(2A-tr) variant on 3H-ketanserin binding to the native 5-HT(2A)-R or on functional coupling of the 5-HT(2A)-R to 5-HT-stimulated Ca(2+) mobilization. The functional significance of the 5-HT(2A-tr) variant and other truncated receptors remains to be established.

  15. Satellite identification: object oriented tools for accurate maintenance of the catalog

    NASA Astrophysics Data System (ADS)

    Kamensky, S.

    2001-10-01

    Satellite identification procedures are based on joint analysis of orbital and non-coordinate data available in the Data Processing Center. The work presents the system of software tools used for this analysis. The first section of the paper presents general composition of the model of the space situation used by the Data Processing Center, indicating and describing the basic entities, objects, classes, attributes and techniques (with the required databases and archives) used for statistical and logical inference. The place of satellite identification tasks in this system is outlined. Then a set of classifiers, used for statistical inference on satellite type (spacecraft, rocket-body, fragment; specific type (series) of a spacecraft or rocket-body) is described. These classifiers use orbital and non-orbital (estimations of sizes, rotation, ballistic characteristics) data and evaluation of the evolution of these parameters if needed. However, the actual satellite identification techniques normally involve the data on all the objects of the launch (for analysis of new satellites) and consider the structure of satellite groups and constellations - regarding the place of the analyzed satellites in them and their evolution. The examples of enhanced efficiency of the system compared to the simple cluster-based analysis are presented as well as the illustrations of the structural advantages and "richer" inference capabilities.

  16. Identification and characterization of G beta 3s2, a novel splice variant of the G-protein beta 3 subunit.

    PubMed Central

    Rosskopf, Dieter; Manthey, Iris; Habich, Christiane; Kielbik, Marzena; Eisenhardt, Andreas; Nikula, Christiane; Urban, Melanie; Kohnen, Stefanie; Graf, Eva; Ravens, Ursula; Siffert, Winfried

    2003-01-01

    The T-allele of a polymorphism (C825T) in the gene for the G-protein beta 3 subunit (GNB3) is associated with cardiovascular and metabolic disorders, distinct cellular features and altered drug responses. The molecular mechanisms that give rise to this complex phenotype have been linked to the occurrence of G beta 3s, a splice variant of GNB3. G beta 3s is predominantly expressed in cells with the 825T-allele. In the present study we describe the identification and characterization of an additional G beta 3 splice variant referred to as G beta 3s2. Its mRNA is expressed in heart, blood cells and tumour tissue, and its expression is also tightly associated with the GNB3 825T-allele. G beta 3s2 is generated by alternative splicing using non-canonical splice sites. G beta subunits belong to the family of propeller proteins and consist of seven regular propeller blades. Transcripts for G beta 3s2 are lacking 129 bp of the coding sequence of the wild-type G beta 3 protein. Thus the predicted structure consists of only six propeller blades, which resembles the structure of G beta 3s. Co-immunoprecipitation analyses indicated that G beta 3s2 dimerizes with different G gamma subunits, e.g. G gamma 5, G gamma 8(C) and G gamma 12. In Sf9 insect cells, expression of G beta 3s2 together with G gamma 12 enhances receptor-stimulated activation of G alpha(i2). Expression of G beta 3s2 in mammalian cells activated the mitogen-activated protein kinase cascade. Together, these results suggest that G beta 3s2 is a biologically active G beta variant which may play a role in the manifestation of the complex phenotype associated with the 825T-allele. PMID:12431187

  17. Systemic senile amyloidosis. Identification of a new prealbumin (transthyretin) variant in cardiac tissue: immunologic and biochemical similarity to one form of familial amyloidotic polyneuropathy.

    PubMed Central

    Gorevic, P D; Prelli, F C; Wright, J; Pras, M; Frangione, B

    1989-01-01

    Isolated amyloid fibrils from three cases of systemic senile amyloidosis (SSA) contained subunit proteins with molecular masses of 14 (10-20%), 10-12 (60-80%), and 5-6 kD (5-10%) when fractionated under reducing and dissociating conditions. This grouping was identical to that seen in SKO, a case of familial amyloidotic polyneuropathy (FAP) studied earlier. Amino acid sequencing confirmed that SSA subunit proteins were in fact prealbumin (transthyretin). Complete sequence analysis of one SSA preparation revealed the presence of a new variant Pa (TTr) molecule with a single amino acid substitution of isoleucine for valine at position 122. Further studies used an antiserum specific for SKO IV, a subunit protein of SKO previously shown to correspond to carboxy-terminal 78 residues (positions 49-127) of (TTr). Anti-SKO IV reacted with SSA in tissue at equivalent dilutions to anti-Pa (TTr) and with the 10-12-kD fraction of SSA on Western blots; reactivity was blocked by SKO IV, but not by Pa (TTr). SSA is a form of systemic amyloidosis caused by tissue deposition of Pa (TTr) and its fragments, with shared conformational or subunit antigenicity to at least one form of FAP. Identification of a new variant Pa (TTr) molecule in one case suggests further that SSA may be a genetically determined disease expressed late in life. Images PMID:2646319

  18. SVSI: fast and powerful set-valued system identification approach to identifying rare variants in sequencing studies for ordered categorical traits.

    PubMed

    Bi, Wenjian; Kang, Guolian; Zhao, Yanlong; Cui, Yuehua; Yan, Song; Li, Yun; Cheng, Cheng; Pounds, Stanley B; Borowitz, Michael J; Relling, Mary V; Yang, Jun J; Liu, Zhifa; Pui, Ching-Hon; Hunger, Stephen P; Hartford, Christine M; Leung, Wing; Zhang, Ji-Feng

    2015-07-01

    In genetic association studies of an ordered categorical phenotype, it is usual to either regroup multiple categories of the phenotype into two categories and then apply the logistic regression (LG), or apply ordered logistic (oLG), or ordered probit (oPRB) regression, which accounts for the ordinal nature of the phenotype. However, they may lose statistical power or may not control type I error due to their model assumption and/or instable parameter estimation algorithm when the genetic variant is rare or sample size is limited. To solve this problem, we propose a set-valued (SV) system model to identify genetic variants associated with an ordinal categorical phenotype. We couple this model with a SV system identification algorithm to identify all the key system parameters. Simulations and two real data analyses show that SV and LG accurately controlled the Type I error rate even at a significance level of 10(-6) but not oLG and oPRB in some cases. LG had significantly less power than the other three methods due to disregarding of the ordinal nature of the phenotype, and SV had similar or greater power than oLG and oPRB. We argue that SV should be employed in genetic association studies for ordered categorical phenotype.

  19. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.

    PubMed

    Oliveira, Duarte C; de Lencastre, Hermínia

    2002-07-01

    Full characterization of methicillin-resistant Staphylococcus aureus (MRSA) requires definition of not only the bacterial genetic background but also the structure of the complex and heterologous mec element these bacteria carry, which is associated with drug resistance determinant mecA. We report the development, validation, and application of a multiplex PCR strategy that allows quick presumptive characterization of the mec element types based on the structural features that were shown to be typical of mec elements carried by several MRSA clones. The strategy was validated by using a representative collection of pandemic MRSA clones in which the full structure of the associated mec elements was previously determined by hybridization and PCR screenings and also by DNA sequencing. The method was tested together with multilocus sequence typing and other typing methods for the characterization of 18 isolates representative of the MRSA clones recovered during a hospital outbreak in Barcelona, Spain. The multiplex PCR was shown to be rapid, robust, and capable in a single assay of identifying five structural types of the mec element among these strains, three major and two minor variants, each one of which has been already been seen among MRSA characterized earlier. This technique should be a useful addition to the armamentarium of molecular typing tools for the characterization of MRSA clonal types and for the rapid tentative identification of structural variants of the mec element.

  20. Identification of a Pyridopyrimidinone Inhibitor of Orthopoxviruses from a Diversity-Oriented Synthesis Library

    PubMed Central

    Dower, Ken; Filone, Claire Marie; Hodges, Erin N.; Bjornson, Zach B.; Rubins, Kathleen H.; Brown, Lauren E.; Schaus, Scott; Hensley, Lisa E.

    2012-01-01

    Orthopoxviruses include the prototypical vaccinia virus, the emerging infectious agent monkeypox virus, and the potential biothreat variola virus (the causative agent of smallpox). There is currently no FDA-approved drug for humans infected with orthopoxviruses. We screened a diversity-oriented synthesis library for new scaffolds with activity against vaccinia virus. This screen identified a nonnucleoside analog that blocked postreplicative intermediate and late gene expression. Viral genome replication was unaffected, and inhibition could be elicited late in infection and persisted upon drug removal. Sequencing of drug-resistant viruses revealed mutations predicted to be on the periphery of the highly conserved viral RNA polymerase large subunit. Consistent with this, the compound had broad-spectrum activity against orthopoxviruses in vitro. These findings indicate that novel chemical synthesis approaches are a potential source for new infectious disease therapeutics and identify a potentially promising candidate for development to treat orthopoxvirus-infected individuals. PMID:22205744

  1. Identification and synthesis of female sex pheromone of Oriental beetle,Anomala orientalis (Coleoptera: Scarabaeidae).

    PubMed

    Zhang, A; Facundo, H T; Robbins, P S; Linn, C E; Hanula, J L; Villani, M G; Roelofs, W L

    1994-09-01

    Females of the Oriental beetle,Anomala orientalis (Waterhouse), release a sex pheromone composed of a 9:1 blend of (Z)- and (E)-7-tetradecen-2-one. The double-bond position of the pheromone was determined by DMDS derivatization and interpretation of the fragmentation patterns produced by monounsaturated ketones. In a sustained-flight tunnel, males responded by flying toward female beetles and attempting to copulate with them. Both effluvium and whole-body extracts of OB females were analyzed, and the activity was found only in the airborne extracts. Flight-tunnel bioassays also showed that a synthetic 90:10Z/E blend on a rubber septum was attractive and that the responses of males to this blend were equivalent toZ isomer alone, but much better than to the singleE isomer.

  2. User oriented ERTS-1 images. [vegetation identification in Canada through image enhancement

    NASA Technical Reports Server (NTRS)

    Shlien, S.; Goodenough, D.

    1974-01-01

    Photographic reproduction of ERTS-1 images are capable of displaying only a portion of the total information available from the multispectral scanner. Methods are being developed to generate ERTS-1 images oriented towards special users such as agriculturists, foresters, and hydrologists by applying image enhancement techniques and interactive statistical classification schemes. Spatial boundaries and linear features can be emphasized and delineated using simple filters. Linear and nonlinear transformations can be applied to the spectral data to emphasize certain ground information. An automatic classification scheme was developed to identify particular ground cover classes such as fallow, grain, rape seed or various vegetation covers. The scheme applies the maximum likelihood decision rule to the spectral information and classifies the ERTS-1 image on a pixel by pixel basis. Preliminary results indicate that the classifier has limited success in distinguishing crops, but is well adapted for identifying different types of vegetation.

  3. Identification of a Functionally Distinct Truncated BDNF mRNA Splice Variant and Protein in Trachemys scripta elegans

    PubMed Central

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Li, Wei; Keifer, Joyce

    2013-01-01

    Brain-derived neurotrophic factor (BDNF) has a diverse functional role and complex pattern of gene expression. Alternative splicing of mRNA transcripts leads to further diversity of mRNAs and protein isoforms. Here, we describe the regulation of BDNF mRNA transcripts in an in vitro model of eyeblink classical conditioning and a unique transcript that forms a functionally distinct truncated BDNF protein isoform. Nine different mRNA transcripts from the BDNF gene of the pond turtle Trachemys scripta elegans (tBDNF) are selectively regulated during classical conditioning: exon I mRNA transcripts show no change, exon II transcripts are downregulated, while exon III transcripts are upregulated. One unique transcript that codes from exon II, tBDNF2a, contains a 40 base pair deletion in the protein coding exon that generates a truncated tBDNF protein. The truncated transcript and protein are expressed in the naïve untrained state and are fully repressed during conditioning when full-length mature tBDNF is expressed, thereby having an alternate pattern of expression in conditioning. Truncated BDNF is not restricted to turtles as a truncated mRNA splice variant has been described for the human BDNF gene. Further studies are required to determine the ubiquity of truncated BDNF alternative splice variants across species and the mechanisms of regulation and function of this newly recognized BDNF protein. PMID:23825634

  4. Identification in Saccharomyces cerevisiae of a new stable variant of alkyl hydroperoxide reductase 1 (Ahp1) induced by oxidative stress.

    PubMed

    Prouzet-Mauléon, Valérie; Monribot-Espagne, Christelle; Boucherie, Hélian; Lagniel, Gilles; Lopez, Sébastien; Labarre, Jean; Garin, Jérome; Lauquin, Guy J-M

    2002-02-15

    Yeasts lacking cytoplasmic superoxide dismutase (Cu,Zn-SOD) activity are permanently subjected to oxidative stress. We used two-dimensional PAGE to examine the proteome pattern of Saccharomyces cerevisiae strains lacking Cu,Zn-SOD. We found a new stable form of alkyl hydroperoxide reductase 1 (Ahp1) with a lower isoelectric point. This form was also present in wild type strains after treatment with tert-butyl hydroperoxide. In vitro enzyme assays showed that Ahp1p had lower specific activity in strains lacking Cu,Zn-SOD. We studied three mutants presenting a reduced production of the low pI variant under oxidative stress conditions. Two of the mutants (C62S and S59D) were totally inactive, thus suggesting that the acidic form of Ahp1p may only appear when the enzyme is functional. The other mutant (S59A) was active in vitro and was more resistant to inactivation by tert-butyl hydroperoxide than the wild type enzyme. Furthermore, the inactivation of Ahp1p in vitro is correlated with its conversion to the low pI form. These results suggest that in vivo during some particular oxidative stress (alkyl hydroperoxide treatment or lack of Cu,Zn-SOD activity but not hydrogen peroxide treatment), the catalytic cysteine of Ahp1p is more oxidized than cysteine-sulfenic acid (a natural occurring intermediate of the enzymatic reaction) and that cysteine-sulfinic acid or cysteine-sulfonic acid variant may be inactive.

  5. Re-fraction: a machine learning approach for deterministic identification of protein homologues and splice variants in large-scale MS-based proteomics.

    PubMed

    Yang, Pengyi; Humphrey, Sean J; Fazakerley, Daniel J; Prior, Matthew J; Yang, Guang; James, David E; Yang, Jean Yee-Hwa

    2012-05-04

    A key step in the analysis of mass spectrometry (MS)-based proteomics data is the inference of proteins from identified peptide sequences. Here we describe Re-Fraction, a novel machine learning algorithm that enhances deterministic protein identification. Re-Fraction utilizes several protein physical properties to assign proteins to expected protein fractions that comprise large-scale MS-based proteomics data. This information is then used to appropriately assign peptides to specific proteins. This approach is sensitive, highly specific, and computationally efficient. We provide algorithms and source code for the current version of Re-Fraction, which accepts output tables from the MaxQuant environment. Nevertheless, the principles behind Re-Fraction can be applied to other protein identification pipelines where data are generated from samples fractionated at the protein level. We demonstrate the utility of this approach through reanalysis of data from a previously published study and generate lists of proteins deterministically identified by Re-Fraction that were previously only identified as members of a protein group. We find that this approach is particularly useful in resolving protein groups composed of splice variants and homologues, which are frequently expressed in a cell- or tissue-specific manner and may have important biological consequences.

  6. Identification of multiple risk variants for ankylosing spondylitis through high-density genotyping of immune-related loci.

    PubMed

    Cortes, Adrian; Hadler, Johanna; Pointon, Jenny P; Robinson, Philip C; Karaderi, Tugce; Leo, Paul; Cremin, Katie; Pryce, Karena; Harris, Jessica; Lee, Seunghun; Joo, Kyung Bin; Shim, Seung-Cheol; Weisman, Michael; Ward, Michael; Zhou, Xiaodong; Garchon, Henri-Jean; Chiocchia, Gilles; Nossent, Johannes; Lie, Benedicte A; Førre, Øystein; Tuomilehto, Jaakko; Laiho, Kari; Jiang, Lei; Liu, Yu; Wu, Xin; Bradbury, Linda A; Elewaut, Dirk; Burgos-Vargas, Ruben; Stebbings, Simon; Appleton, Louise; Farrah, Claire; Lau, Jonathan; Kenna, Tony J; Haroon, Nigil; Ferreira, Manuel A; Yang, Jian; Mulero, Juan; Fernandez-Sueiro, Jose Luis; Gonzalez-Gay, Miguel A; Lopez-Larrea, Carlos; Deloukas, Panos; Donnelly, Peter; Bowness, Paul; Gafney, Karl; Gaston, Hill; Gladman, Dafna D; Rahman, Proton; Maksymowych, Walter P; Xu, Huji; Crusius, J Bart A; van der Horst-Bruinsma, Irene E; Chou, Chung-Tei; Valle-Oñate, Raphael; Romero-Sánchez, Consuelo; Hansen, Inger Myrnes; Pimentel-Santos, Fernando M; Inman, Robert D; Videm, Vibeke; Martin, Javier; Breban, Maxime; Reveille, John D; Evans, David M; Kim, Tae-Hwan; Wordsworth, Bryan Paul; Brown, Matthew A

    2013-07-01

    Ankylosing spondylitis is a common, highly heritable inflammatory arthritis affecting primarily the spine and pelvis. In addition to HLA-B*27 alleles, 12 loci have previously been identified that are associated with ankylosing spondylitis in populations of European ancestry, and 2 associated loci have been identified in Asians. In this study, we used the Illumina Immunochip microarray to perform a case-control association study involving 10,619 individuals with ankylosing spondylitis (cases) and 15,145 controls. We identified 13 new risk loci and 12 additional ankylosing spondylitis-associated haplotypes at 11 loci. Two ankylosing spondylitis-associated regions have now been identified encoding four aminopeptidases that are involved in peptide processing before major histocompatibility complex (MHC) class I presentation. Protective variants at two of these loci are associated both with reduced aminopeptidase function and with MHC class I cell surface expression.

  7. Identification of an erythrocyte pyruvate kinase variant in a family from Latium with non-spherocytic congenital haemolytic anaemia.

    PubMed

    Papa, G; De Laurenzi, A; Isacchi, G C; Bonifazi, G; Parziale, L; Salvati, A M

    1979-01-01

    Erythrocyte PK deficiency was detected in a family from Latium in Italy. This PK variant is characterized by normal or increased activity immediately after blood collection, instability to storage, to heat and to urea. Only in the propositus the mutant enzyme exhibited an increased Michaelis constant for PEP, slightly increased inhibition by ATP and an altered optimum pH value. The kinetic anomaly was only partially corrected by activation with F-1, 6-DP and by addition of 2-ME. From these results it can be concluded that in the family observed two distinct erythrocyte PK alterations were demonstrable: instability in the propositus and his father; low affinity for PEP and altered optimum pH value only in the propositus.

  8. Versatile O-GlcNAc transferase assay for high-throughput identification of enzyme variants, substrates, and inhibitors.

    PubMed

    Kim, Eun J; Abramowitz, Lara K; Bond, Michelle R; Love, Dona C; Kang, Dong W; Leucke, Hans F; Kang, Dae W; Ahn, Jong-Seog; Hanover, John A

    2014-06-18

    The dynamic glycosylation of serine/threonine residues on nucleocytoplasmic proteins with a single N-acetylglucosamine (O-GlcNAcylation) is critical for many important cellular processes. Cellular O-GlcNAc levels are highly regulated by two enzymes: O-GlcNAc transferase (OGT) is responsible for GlcNAc addition and O-GlcNAcase (OGA) is responsible for removal of the sugar. The lack of a rapid and simple method for monitoring OGT activity has impeded the efficient discovery of potent OGT inhibitors. In this study we describe a novel, single-well OGT enzyme assay that utilizes 6 × His-tagged substrates, a chemoselective chemical reaction, and unpurified OGT. The high-throughput Ni-NTA Plate OGT Assay will facilitate discovery of potent OGT-specific inhibitors on versatile substrates and the characterization of new enzyme variants.

  9. Identification of Novel Variants in LTBP2 and PXDN Using Whole-Exome Sequencing in Developmental and Congenital Glaucoma

    PubMed Central

    Micheal, Shazia; Siddiqui, Sorath Noorani; Zafar, Saemah Nuzhat; Iqbal, Aftab; Khan, Muhammad Imran; den Hollander, Anneke I.

    2016-01-01

    Background Primary congenital glaucoma (PCG) is the most common form of glaucoma in children. PCG occurs due to the developmental defects in the trabecular meshwork and anterior chamber of the eye. The purpose of this study is to identify the causative genetic variants in three families with developmental and primary congenital glaucoma (PCG) with a recessive inheritance pattern. Methods DNA samples were obtained from consanguineous families of Pakistani ancestry. The CYP1B1 gene was sequenced in the affected probands by conventional Sanger DNA sequencing. Whole exome sequencing (WES) was performed in DNA samples of four individuals belonging to three different CYP1B1-negative families. Variants identified by WES were validated by Sanger sequencing. Results WES identified potentially causative novel mutations in the latent transforming growth factor beta binding protein 2 (LTBP2) gene in two PCG families. In the first family a novel missense mutation (c.4934G>A; p.Arg1645Glu) co-segregates with the disease phenotype, and in the second family a novel frameshift mutation (c.4031_4032insA; p.Asp1345Glyfs*6) was identified. In a third family with developmental glaucoma a novel mutation (c.3496G>A; p.Gly1166Arg) was identified in the PXDN gene, which segregates with the disease. Conclusions We identified three novel mutations in glaucoma families using WES; two in the LTBP2 gene and one in the PXDN gene. The results will not only enhance our current understanding of the genetic basis of glaucoma, but may also contribute to a better understanding of the diverse phenotypic consequences caused by mutations in these genes. PMID:27409795

  10. A Markov chain Monte Carlo technique for identification of combinations of allelic variants underlying complex diseases in humans.

    PubMed

    Favorov, Alexander V; Andreewski, Timophey V; Sudomoina, Marina A; Favorova, Olga O; Parmigiani, Giovanni; Ochs, Michael F

    2005-12-01

    In recent years, the number of studies focusing on the genetic basis of common disorders with a complex mode of inheritance, in which multiple genes of small effect are involved, has been steadily increasing. An improved methodology to identify the cumulative contribution of several polymorphous genes would accelerate our understanding of their importance in disease susceptibility and our ability to develop new treatments. A critical bottleneck is the inability of standard statistical approaches, developed for relatively modest predictor sets, to achieve power in the face of the enormous growth in our knowledge of genomics. The inability is due to the combinatorial complexity arising in searches for multiple interacting genes. Similar "curse of dimensionality" problems have arisen in other fields, and Bayesian statistical approaches coupled to Markov chain Monte Carlo (MCMC) techniques have led to significant improvements in understanding. We present here an algorithm, APSampler, for the exploration of potential combinations of allelic variations positively or negatively associated with a disease or with a phenotype. The algorithm relies on the rank comparison of phenotype for individuals with and without specific patterns (i.e., combinations of allelic variants) isolated in genetic backgrounds matched for the remaining significant patterns. It constructs a Markov chain to sample only potentially significant variants, minimizing the potential of large data sets to overwhelm the search. We tested APSampler on a simulated data set and on a case-control MS (multiple sclerosis) study for ethnic Russians. For the simulated data, the algorithm identified all the phenotype-associated allele combinations coded into the data and, for the MS data, it replicated the previously known findings.

  11. Identification of a common variant with potential pleiotropic effect on risk of inflammatory bowel disease and colorectal cancer

    PubMed Central

    Khalili, Hamed; Gong, Jian; Brenner, Hermann; Austin, Thomas R.; Hutter, Carolyn M.; Baba, Yoshifumi; Baron, John A.; Berndt, Sonja I.; Bézieau, Stéphane; Caan, Bette; Campbell, Peter T.; Chang-Claude, Jenny; Chanock, Stephen J.; Chen, Constance; Hsu, Li; Jiao, Shuo; Conti, David V.; Duggan, David; Fuchs, Charles S.; Gala, Manish; Gallinger, Steven; Haile, Robert W.; Harrison, Tabitha A.; Hayes, Richard; Hazra, Aditi; Henderson, Brian; Haiman, Chris; Hoffmeister, Michael; Hopper, John L.; Jenkins, Mark A.; Kolonel, Laurence N.; Küry, Sébastien; LaCroix, Andrea; Marchand, Loic Le; Lemire, Mathieu; Lindor, Noralane M.; Ma, Jing; Manson, JoAnn E.; Morikawa, Teppei; Nan, Hongmei; Ng, Kimmie; Newcomb, Polly A.; Nishihara, Reiko; Potter, John D.; Qu, Conghui; Schoen, Robert E.; Schumacher, Fredrick R.; Seminara, Daniela; Taverna, Darin; Thibodeau, Stephen; Wactawski-Wende, Jean; White, Emily; Wu, Kana; Zanke, Brent W.; Casey, Graham; Hudson, Thomas J.; Kraft, Peter; Peters, Ulrike; Slattery, Martha L.; Ogino, Shuji; Chan, Andrew T.

    2015-01-01

    Although genome-wide association studies (GWAS) have separately identified many genetic susceptibility loci for ulcerative colitis (UC), Crohn’s disease (CD) and colorectal cancer (CRC), there has been no large-scale examination for pleiotropy, or shared genetic susceptibility, for these conditions. We used logistic regression modeling to examine the associations of 181 UC and CD susceptibility variants previously identified by GWAS with risk of CRC using data from the Genetics and Epidemiology of Colorectal Cancer Consortium and the Colon Cancer Family Registry. We also examined associations of significant variants with clinical and molecular characteristics in a subset of the studies. Among 11794 CRC cases and 14190 controls, rs11676348, the susceptibility single nucleotide polymorphism (SNP) for UC, was significantly associated with reduced risk of CRC (P = 7E−05). The multivariate-adjusted odds ratio of CRC with each copy of the T allele was 0.93 (95% CI 0.89–0.96). The association of the SNP with risk of CRC differed according to mucinous histological features (P heterogeneity = 0.008). In addition, the (T) allele was associated with lower risk of tumors with Crohn’s-like reaction but not tumors without such immune infiltrate (P heterogeneity = 0.02) and microsatellite instability-high (MSI-high) but not microsatellite stable or MSI-low tumors (P heterogeneity = 0.03). The minor allele (T) in SNP rs11676348, located downstream from CXCR2 that has been implicated in CRC progression, is associated with a lower risk of CRC, particularly tumors with a mucinous component, Crohn’s-like reaction and MSI-high. Our findings offer the promise of risk stratification of inflammatory bowel disease patients for complications such as CRC. PMID:26071399

  12. Observation of 'hidden' planar defects in boron carbide nanowires and identification of their orientations.

    PubMed

    Guan, Zhe; Cao, Baobao; Yang, Yang; Jiang, Youfei; Li, Deyu; Xu, Terry T

    2014-01-15

    The physical properties of nanostructures strongly depend on their structures, and planar defects in particular could significantly affect the behavior of the nanowires. In this work, planar defects (twins or stacking faults) in boron carbide nanowires are extensively studied by transmission electron microscopy (TEM). Results show that these defects can easily be invisible, i.e., no presence of characteristic defect features like modulated contrast in high-resolution TEM images and streaks in diffraction patterns. The simplified reason of this invisibility is that the viewing direction during TEM examination is not parallel to the (001)-type planar defects. Due to the unique rhombohedral structure of boron carbide, planar defects are only distinctive when the viewing direction is along the axial or short diagonal directions ([100], [010], or 1¯10) within the (001) plane (in-zone condition). However, in most cases, these three characteristic directions are not parallel to the viewing direction when boron carbide nanowires are randomly dispersed on TEM grids. To identify fault orientations (transverse faults or axial faults) of those nanowires whose planar defects are not revealed by TEM, a new approach is developed based on the geometrical analysis between the projected preferred growth direction of a nanowire and specific diffraction spots from diffraction patterns recorded along the axial or short diagonal directions out of the (001) plane (off-zone condition). The approach greatly alleviates tedious TEM examination of the nanowire and helps to establish the reliable structure-property relations. Our study calls attention to researchers to be extremely careful when studying nanowires with potential planar defects by TEM. Understanding the true nature of planar defects is essential in tuning the properties of these nanostructures through manipulating their structures.

  13. Identification and Expression Profile Analysis of Odorant Binding Proteins in the Oriental Fruit Fly Bactrocera dorsalis

    PubMed Central

    Zheng, Weiwei; Peng, Wei; Zhu, Chipan; Zhang, Qun; Saccone, Giuseppe; Zhang, Hongyu

    2013-01-01

    Olfaction is crucial in many insects for critical behaviors, including those regulating survival and reproduction. Insect odorant-binding proteins (OBPs) function in the first step of the olfactory system and play an essential role in the perception of odorants, such as pheromones and host chemicals. The oriental fruit fly, Bactrocera dorsalis, is a destructive fruit-eating pest, due to its wide host range of up to 250 different types of fruits and vegetables, and this fly causes severe economic damage to the fruit and vegetable industry. However, OBP genes have not been largely identified in B. dorsalis. Based on our previously constructed B. dorsalis cDNA library, ten OBP genes were identified in B. dorsalis for the first time. A phylogenetic tree was generated to show the relationships among the 10 OBPs of B. dorsalis to OBP sequences of two other Dipteran species, including Drosophila melanogaster and the mosquito Anopheles gambiae. The expression profiles of the ten OBPs in different tissues (heads, thoraxes, abdomens, legs, wings, male antennae and female antenna) of the mated adults were analyzed by real-time PCR. The results showed that nine of them are highly expressed in the antenna of both sexes, except BdorOBP7. Four OBPs (BdorOBP1, BdorOBP4, BdorOBP8, and BdorOBP10) are also enriched in the abdomen, and BdorOBP7 is specifically expressed in leg, indicating that it may function in other biological processes. This work will provide insight into the roles of OBPs in chemoreception and help develop new pest-control strategies. PMID:23867609

  14. Identification of beta1C-2, a novel variant of the integrin beta1 subunit generated by utilization of an alternative splice acceptor site in exon C.

    PubMed Central

    Svineng, G; Fässler, R; Johansson, S

    1998-01-01

    A new splice variant of the human integrin subunit beta1 has been identified and designated beta1C-2. It differs from the previously reported beta1C (in this report designated beta1C-1) by 18 nucleotides, and is generated by splicing from exon 6 to an alternative splice acceptor site within exon C, causing an in-frame deletion of six amino acids of the cytoplasmic region of beta1C-1. The beta1C-2 mRNA is present in several human cell lines and tissues at low levels, similarly to beta1C-1. In peripheral T-lymphocytes, beta1C-2 is the selectively expressed isoform. Neither beta1C-1 nor beta1C-2 mRNA could be detected in mouse tissues, and Southern hybridization of a mouse genomic beta1 clone with a human exon-C-specific probe failed to identify a corresponding mouse exon. The antisense orientation of exon C is highly homologous to an Alu element. Since Alu elements are restricted to primates, the beta1C-1 and beta1C-2 variants of the integrin subunit beta1 are specific for these species. The protein coded for by the beta1C-2 cDNA can be expressed and localized to the surface of beta1 deficient mouse cells. However, while stable transformed clones expressing high levels of the beta1A were commonly found, the beta1C-1 and beta1C-2 expressing clones expressed barely detectable amounts of the beta1 protein. Hence, high levels of beta1C-2 may be incompatible with cell proliferation, as previously suggested for beta1C-1. PMID:9494094

  15. EcoTILLING for the identification of allelic variants of melon eIF4E, a factor that controls virus susceptibility

    PubMed Central

    Nieto, Cristina; Piron, Florence; Dalmais, Marion; Marco, Cristina F; Moriones, Enrique; Gómez-Guillamón, Ma Luisa; Truniger, Verónica; Gómez, Pedro; Garcia-Mas, Jordi; Aranda, Miguel A; Bendahmane, Abdelhafid

    2007-01-01

    Background Translation initiation factors of the 4E and 4G protein families mediate resistance to several RNA plant viruses in the natural diversity of crops. Particularly, a single point mutation in melon eukaryotic translation initiation factor 4E (eIF4E) controls resistance to Melon necrotic spot virus (MNSV) in melon. Identification of allelic variants within natural populations by EcoTILLING has become a rapid genotype discovery method. Results A collection of Cucumis spp. was characterised for susceptibility to MNSV and Cucumber vein yellowing virus (CVYV) and used for the implementation of EcoTILLING to identify new allelic variants of eIF4E. A high conservation of eIF4E exonic regions was found, with six polymorphic sites identified out of EcoTILLING 113 accessions. Sequencing of regions surrounding polymorphisms revealed that all of them corresponded to silent nucleotide changes and just one to a non-silent change correlating with MNSV resistance. Except for the MNSV case, no correlation was found between variation of eIF4E and virus resistance, suggesting the implication of different and/or additional genes in previously identified resistance phenotypes. We have also characterized a new allele of eIF4E from Cucumis zeyheri, a wild relative of melon. Functional analyses suggested that this new eIF4E allele might be responsible for resistance to MNSV. Conclusion This study shows the applicability of EcoTILLING in Cucumis spp., but given the conservation of eIF4E, new candidate genes should probably be considered to identify new sources of resistance to plant viruses. Part of the methodology described here could alternatively be used in TILLING experiments that serve to generate new eIF4E alleles. PMID:17584936

  16. Identification of rare variants in KCTD13 at the schizophrenia risk locus 16p11.2

    PubMed Central

    Heinemann, Barbara; Strohmaier, Jana; Pfohl, Marvin A.; Giegling, Ina; Hofmann, Andrea; Ludwig, Kerstin U.; Witt, Stephanie H.; Ludwig, Michael; Forstner, Andreas J.; Albus, Margot; Schwab, Sibylle G.; Borrmann-Hassenbach, Margitta; Lennertz, Leonard; Wagner, Michael; Hoffmann, Per; Rujescu, Dan; Maier, Wolfgang; Cichon, Sven; Rietschel, Marcella; Nöthen, Markus M.

    2016-01-01

    Duplications in 16p11.2 are a risk factor for schizophrenia (SCZ). Using genetically modified zebrafish, Golzio and colleagues identified KCTD13 within 16p11.2 as a major driver of the neuropsychiatric phenotype observed in humans. The aims of the present study were to explore the role of KCTD13 in the development of SCZ and to provide a more complete picture of the allelic architecture at this risk locus. The exons of KCTD13 were sequenced in 576 patients. The mutations c.6G>T and c.598G>A were identified in one patient each. Both mutations were predicted to be functionally relevant and were absent from the 1000 Genomes Project data and the Exome Variant Server. The mutation c.6G>T was predicted to abolish a potential transcription factor-binding site for specifity protein 1. Altered specifity protein 1 expression has been reported in SCZ patients compared with controls. Further studies in large cohorts are warranted to determine the relevance of the two identified mutations. PMID:27668412

  17. Identification of genetic variants predictive of early onset pancreatic cancer through a population science analysis of functional genomic datasets.

    PubMed

    Chen, Jinyun; Wu, Xifeng; Huang, Yujing; Chen, Wei; Brand, Randall E; Killary, Ann M; Sen, Subrata; Frazier, Marsha L

    2016-08-30

    Biomarkers are critically needed for the early detection of pancreatic cancer (PC) are urgently needed. Our purpose was to identify a panel of genetic variants that, combined, can predict increased risk for early-onset PC and thereby identify individuals who should begin screening at an early age. Previously, we identified genes using a functional genomic approach that were aberrantly expressed in early pathways to PC tumorigenesis. We now report the discovery of single nucleotide polymorphisms (SNPs) in these genes associated with early age at diagnosis of PC using a two-phase study design. In silico and bioinformatics tools were used to examine functional relevance of the identified SNPs. Eight SNPs were consistently associated with age at diagnosis in the discovery phase, validation phase and pooled analysis. Further analysis of the joint effects of these 8 SNPs showed that, compared to participants carrying none of these unfavorable genotypes (median age at PC diagnosis 70 years), those carrying 1-2, 3-4, or 5 or more unfavorable genotypes had median ages at diagnosis of 64, 63, and 62 years, respectively (P = 3.0E-04). A gene-dosage effect was observed, with age at diagnosis inversely related to number of unfavorable genotypes (Ptrend = 1.0E-04). Using bioinformatics tools, we found that all of the 8 SNPs were predicted to play functional roles in the disruption of transcription factor and/or enhancer binding sites and most of them were expression quantitative trait loci (eQTL) of the target genes. The panel of genetic markers identified may serve as susceptibility markers for earlier PC diagnosis.

  18. Identification of a Putative Crf Splice Variant and Generation of Recombinant Antibodies for the Specific Detection of Aspergillus fumigatus

    PubMed Central

    Schütte, Mark; Thullier, Philippe; Pelat, Thibaut; Wezler, Xenia; Rosenstock, Philip; Hinz, Dominik; Kirsch, Martina Inga; Hasenberg, Mike; Frank, Ronald; Schirrmann, Thomas; Gunzer, Matthias

    2009-01-01

    Background Aspergillus fumigatus is a common airborne fungal pathogen for humans. It frequently causes an invasive aspergillosis (IA) in immunocompromised patients with poor prognosis. Potent antifungal drugs are very expensive and cause serious adverse effects. Their correct application requires an early and specific diagnosis of IA, which is still not properly achievable. This work aims to a specific detection of A. fumigatus by immunofluorescence and the generation of recombinant antibodies for the detection of A. fumigatus by ELISA. Results The A. fumigatus antigen Crf2 was isolated from a human patient with proven IA. It is a novel variant of a group of surface proteins (Crf1, Asp f9, Asp f16) which belong to the glycosylhydrolase family. Single chain fragment variables (scFvs) were obtained by phage display from a human naive antibody gene library and an immune antibody gene library generated from a macaque immunized with recombinant Crf2. Two different selection strategies were performed and shown to influence the selection of scFvs recognizing the Crf2 antigen in its native conformation. Using these antibodies, Crf2 was localized in growing hyphae of A. fumigatus but not in spores. In addition, the antibodies allowed differentiation between A. fumigatus and related Aspergillus species or Candida albicans by immunofluorescence microscopy. The scFv antibody clones were further characterized for their affinity, the nature of their epitope, their serum stability and their detection limit of Crf2 in human serum. Conclusion Crf2 and the corresponding recombinant antibodies offer a novel approach for the early diagnostics of IA caused by A. fumigatus. PMID:19675673

  19. Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer.

    PubMed

    Palazzo, Antonio; Lovero, Domenica; D'Addabbo, Pietro; Caizzi, Ruggiero; Marsano, René Massimiliano

    2016-01-01

    Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon's co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon's evolutionary dynamics and increases our understanding on the Tc1-mariner elements' biology.

  20. Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer

    PubMed Central

    D’Addabbo, Pietro; Caizzi, Ruggiero

    2016-01-01

    Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon’s co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon’s evolutionary dynamics and increases our understanding on the Tc1-mariner elements’ biology. PMID:27213270

  1. Identification of genes expressed by immune cells of the colon that are regulated by colorectal cancer-associated variants.

    PubMed

    Peltekova, Vanya D; Lemire, Mathieu; Qazi, Aamer M; Zaidi, Syed H E; Trinh, Quang M; Bielecki, Ryszard; Rogers, Marianne; Hodgson, Lyndsey; Wang, Mike; D'Souza, David J A; Zandi, Sasan; Chong, Taryne; Kwan, Jennifer Y Y; Kozak, Krystian; De Borja, Richard; Timms, Lee; Rangrej, Jagadish; Volar, Milica; Chan-Seng-Yue, Michelle; Beck, Timothy; Ash, Colleen; Lee, Shawna; Wang, Jianxin; Boutros, Paul C; Stein, Lincoln D; Dick, John E; Gryfe, Robert; McPherson, John D; Zanke, Brent W; Pollett, Aaron; Gallinger, Steven; Hudson, Thomas J

    2014-05-15

    A locus on human chromosome 11q23 tagged by marker rs3802842 was associated with colorectal cancer (CRC) in a genome-wide association study; this finding has been replicated in case-control studies worldwide. In order to identify biologic factors at this locus that are related to the etiopathology of CRC, we used microarray-based target selection methods, coupled to next-generation sequencing, to study 103 kb at the 11q23 locus. We genotyped 369 putative variants from 1,030 patients with CRC (cases) and 1,061 individuals without CRC (controls) from the Ontario Familial Colorectal Cancer Registry. Two previously uncharacterized genes, COLCA1 and COLCA2, were found to be co-regulated genes that are transcribed from opposite strands. Expression levels of COLCA1 and COLCA2 transcripts correlate with rs3802842 genotypes. In colon tissues, COLCA1 co-localizes with crystalloid granules of eosinophils and granular organelles of mast cells, neutrophils, macrophages, dendritic cells and differentiated myeloid-derived cell lines. COLCA2 is present in the cytoplasm of normal epithelial, immune and other cell lineages, as well as tumor cells. Tissue microarray analysis demonstrates the association of rs3802842 with lymphocyte density in the lamina propria (p = 0.014) and levels of COLCA1 in the lamina propria (p = 0.00016) and COLCA2 (tumor cells, p = 0.0041 and lamina propria, p = 6 × 10(-5)). In conclusion, genetic, expression and immunohistochemical data implicate COLCA1 and COLCA2 in the pathogenesis of colon cancer. Histologic analyses indicate the involvement of immune pathways.

  2. Cellulase variants

    DOEpatents

    Blazej, Robert; Toriello, Nicholas; Emrich, Charles; Cohen, Richard N.; Koppel, Nitzan

    2015-07-14

    This invention provides novel variant cellulolytic enzymes having improved activity and/or stability. In certain embodiments the variant cellulotyic enzymes comprise a glycoside hydrolase with or comprising a substitution at one or more positions corresponding to one or more of residues F64, A226, and/or E246 in Thermobifida fusca Cel9A enzyme. In certain embodiments the glycoside hydrolase is a variant of a family 9 glycoside hydrolase. In certain embodiments the glycoside hydrolase is a variant of a theme B family 9 glycoside hydrolase.

  3. Evaluation of CHROMagar Orientation for differentiation and presumptive identification of gram-negative bacilli and Enterococcus species.

    PubMed Central

    Merlino, J; Siarakas, S; Robertson, G J; Funnell, G R; Gottlieb, T; Bradbury, R

    1996-01-01

    A new chromogenic plate medium, CHROMagar Orientation, was evaluated for use in the differentiation and presumptive identification of gram-negative bacilli and Enterococcus species by a multipoint inoculation (replicator) technique. In this study, 1,404 gram-negative bacilli and 74 enterococcal isolates were tested on CHROMagar Orientation. Six control American Type Culture Collection strains were also included with the testing to ensure quality control of the media. Of the Escherichia coli isolates (n = 588) tested, 99.3% produced a pink-to-red color. Only in four isolates that were O-nitrophenyl-beta-D-galactopyranoside (ONPG) negative did this result differ. Proteus mirabilis and P. vulgaris were well differentiated on this medium. P. mirabilis (n = 184) produced a clear colony with diffusible brown pigment around the periphery. By contrast, 15 of 16 P. vulgaris isolates produced bluish-green colonies with a slight brown background. All Aeromonas hydrophila isolates (n = 26) tested produced clear to pink colonies at 35 to 37 degrees C. This colony color changed to blue after 2 to 3 h of incubation at room temperature. A. hydrophila exhibited stronger color and better growth at 30 degrees C. Serratia marcescens (n = 29) demonstrated an aqua blue color that deepened to a darker blue when exposed to room temperature. All enterococcal isolates (n = 74) resulted in a blue color and gave pinpoint colonies on purity subcultures at 35 to 37 degrees C after 18 h of incubation. Similarity in color resulted in failure to discriminate accurately between Klebsiella, Enterobacter, and Citrobacter species. However, these species could be readily differentiated from other members of the family Enterobacteriaceae. Pseudomonas aeruginosa (n = 151) was easily differentiated from members of the Enterobacteriaceae but was less easily distinguishable from other gram-negative nonmembers of the Enterobacteriaceae. The medium was found to facilitate easy visual detection of mixed

  4. Functional identification of a novel 14-3-3 epsilon splicing variant suggests dimerization is not necessary for 14-3-3 epsilon to inhibit UV-induced apoptosis

    SciTech Connect

    Han, Dingding; Ye, Guangming; Liu, Tingting; Chen, Cong; Yang, Xianmei; Wan, Bo; Pan, Yuanwang; Yu, Long

    2010-05-28

    14-3-3 proteins function as a dimer and have been identified to involve in diverse signaling pathways. Here we reported the identification of a novel splicing variant of human 14-3-3 epsilon (14-3-3 epsilon sv), which is derived from a novel exon 1' insertion. The insertion contains a stop codon and leads to a truncated splicing variant of 14-3-3 epsilon. The splicing variant is translated from the exon 2 and results in the deletion of an N-terminal {alpha}-helix which is crucial for the dimerization. Therefore, the 14-3-3 epsilon sv could not form a dimer with 14-3-3 zeta. However, after UV irradiation 14-3-3 epsilon sv could also support cell survival, suggesting monomer of 14-3-3 epsilon is sufficient to protect cell from apoptosis.

  5. Identification of rare DNA sequence variants in high-risk autism families and their prevalence in a large case/control population

    PubMed Central

    2014-01-01

    Background Genetics clearly plays a major role in the etiology of autism spectrum disorders (ASDs), but studies to date are only beginning to characterize the causal genetic variants responsible. Until recently, studies using multiple extended multi-generation families to identify ASD risk genes had not been undertaken. Methods We identified haplotypes shared among individuals with ASDs in large multiplex families, followed by targeted DNA capture and sequencing to identify potential causal variants. We also assayed the prevalence of the identified variants in a large ASD case/control population. Results We identified 584 non-conservative missense, nonsense, frameshift and splice site variants that might predispose to autism in our high-risk families. Eleven of these variants were observed to have odds ratios greater than 1.5 in a set of 1,541 unrelated children with autism and 5,785 controls. Three variants, in the RAB11FIP5, ABP1, and JMJD7-PLA2G4B genes, each were observed in a single case and not in any controls. These variants also were not seen in public sequence databases, suggesting that they may be rare causal ASD variants. Twenty-eight additional rare variants were observed only in high-risk ASD families. Collectively, these 39 variants identify 36 genes as ASD risk genes. Segregation of sequence variants and of copy number variants previously detected in these families reveals a complex pattern, with only a RAB11FIP5 variant segregating to all affected individuals in one two-generation pedigree. Some affected individuals were found to have multiple potential risk alleles, including sequence variants and copy number variants (CNVs), suggesting that the high incidence of autism in these families could be best explained by variants at multiple loci. Conclusions Our study is the first to use haplotype sharing to identify familial ASD risk loci. In total, we identified 39 variants in 36 genes that may confer a genetic risk of developing autism. The

  6. Characterization of glucagon-like peptide 1 receptor (GLP1R) gene in chickens: functional analysis, tissue distribution, and identification of its transcript variants.

    PubMed

    Huang, G; Li, J; Fu, H; Yan, Z; Bu, G; He, X; Wang, Y

    2012-07-01

    Glucagon-like peptide 1 (GLP1) receptor plays a critical role in mediating the biological actions of GLP1 in mammals and fish; however, the gene structure, expression, and functionality of GLP1 receptor (GLP1R) remain largely unknown in birds. In this study, the full-length cDNA of chicken GLP1R (cGLP1R) was first cloned from brain tissue by reverse transcription PCR. The putative cGLP1R is 459 amino acids in length and shares high amino acid sequence identity with that of human (79%), rat (80%), and Xenopus (75%). Using a pGL3-CRE luciferase reporter system, we found that cGLP1R expressed in Chinese hamster ovary cells could be potently activated by cGLP1 (EC(50), 0.11 nM) but not by other structurally related peptides, indicating that cGLP1R is a functional receptor specific to cGLP1. Interestingly, in addition to identification of the transcript encoding cGLP1R of 459 amino acids, eight transcript variants, which were generated by alternative mRNA splicing and predicted to encode either C-terminally or N-terminally truncated cGLP1Rs, were also identified from chicken brain or testis. In line with this finding, multiple cGLP1R transcripts were detected to be expressed in most chicken tissues examined, including pancreas, gastrointestinal tract, and various brain regions by reverse transcription PCR. Using the dual-luciferase reporter assay system, we further found that the 5'-flanking region of cGLP1R gene displays promoter activities in cultured HepG2 and HEK293 cells, suggesting that it may control cGLP1R gene transcription in chicken tissues, including nonpancreatic tissues. Taken together, the results from the present study establish a molecular basis to investigate the roles of GLP1 in chickens.

  7. Differential expression of P-type ATPases in intestinal epithelial cells: Identification of putative new atp1a1 splice-variant

    SciTech Connect

    Rocafull, Miguel A.; Thomas, Luz E.; Barrera, Girolamo J.; Castillo, Jesus R. del

    2010-01-01

    P-type ATPases are membrane proteins that couple ATP hydrolysis with cation transport across the membrane. Ten different subtypes have been described. In mammalia, 15 genes of P-type ATPases from subtypes II-A, II-B and II-C, that transport low-atomic-weight cations (Ca{sup 2+}, Na{sup +}, K{sup +} and H{sup +}), have been reported. They include reticulum and plasma-membrane Ca{sup 2+}-ATPases, Na{sup +}/K{sup +}-ATPase and H{sup +}/K{sup +}-ATPases. Enterocytes and colonocytes show functional differences, which seem to be partially due to the differential expression of P-type ATPases. These enzymes have 9 structural motifs, being the phosphorylation (E) and the Mg{sup 2+}ATP-binding (H) motifs the most preserved. These structural characteristics permitted developing a Multiplex-Nested-PCR (MN-PCR) for the simultaneous identification of different P-type ATPases. Thus, using MN-PCR, seven different cDNAs were cloned from enterocytes and colonocytes, including SERCA3, SERCA2, Na{sup +}/K{sup +}-ATPase {alpha}1-isoform, H{sup +}/K{sup +}-ATPase {alpha}2-isoform, PMCA1, PMCA4 and a cDNA-fragment that seems to be a new cassette-type splice-variant of the atp1a1 gen. PMCA4 in enterocytes and H{sup +}/K{sup +}-ATPase {alpha}2-isoform in colonocytes were differentially expressed. This cell-specific expression pattern is related with the distinctive enterocyte and colonocyte functions.

  8. CADD score has limited clinical validity for the identification of pathogenic variants in non-coding regions in a hereditary cancer panel

    PubMed Central

    Mather, Cheryl A; Mooney, Sean D; Salipante, Stephen J; Scroggins, Sheena; Wu, David; Pritchard, Colin C; Shirts, Brian H

    2016-01-01

    PURPOSE Several in silico tools have been shown to have reasonable research sensitivity and specificity for classifying sequence variants in coding regions. The recently-developed Combined Annotation Dependent Depletion (CADD) method generates predictive scores for single nucleotide variants (SNVs) in all areas of the genome, including non-coding regions. We sought to determine the clinical validity of non-coding variant CADD scores. METHODS We evaluated 12,391 unique SNVs in 624 patient samples submitted for germline mutation testing in a cancer-related gene panel. We compared the distributions of CADD scores of rare SNVs, common SNVs in our patient population, and the null distribution of all possible SNVs stratifying by genomic region. RESULTS The median CADD scores of intronic and nonsynonymous variants were significantly different between rare and common SNVs (p<0.0001). Despite these different distributions, no individual variants could be identified as plausibly causative among rare intronic variants with the highest scores. The ROC AUC for non-coding variants is modest, and the positive predictive value of CADD for intronic variants in panel testing was found to be 0.088. CONCLUSION Focused in-silico scoring systems with much higher predictive value will be necessary for clinical genomic applications. PMID:27148939

  9. Identification of a rare variant haemoglobin (Hb Sinai-Baltimore) causing spuriously low haemoglobin A(1c) values on ion exchange chromatography.

    PubMed

    Smith, Geoff; Murray, Heather; Brennan, Stephen O

    2013-01-01

    Commonly used methods for assay of haemoglobin A(1c) (HbA(1c)) are susceptible to interference from the presence of haemoglobin variants. In many systems, the common variants can be identified but scientists and pathologists must remain vigilant for more subtle variants that may result in spuriously high or low HbA(1c) values. It is clearly important to recognize these events whether HbA(1c) is being used as a monitoring tool or, as is increasingly the case, for diagnostic purposes. We report a patient with a rare haemoglobin variant (Hb Sinai-Baltimore) that resulted in spuriously low values of HbA(1c) when assayed using ion exchange chromatography, and the steps taken to elucidate the nature of the variant.

  10. Structural Identification of a Non-Glycosylated Variant at Ser126 for O-Glycosylation Site from EPO BRP, Human Recombinant Erythropoietin by LC/MS Analysis.

    PubMed

    Byeon, Jaehee; Lim, Yu-Ri; Kim, Hyong-Ha; Suh, Jung-Keun

    2015-06-01

    A variant peak was detected in the analysis of RP-HPLC of rHu-EPO, which has about 7% relative content. Fractions of the main and the variant peaks were pooled separately and further analyzed to identify the molecular structure of the variant peak. Total mass analysis for each peak fraction using ESI-TOF MS shows differences in molecular mass. The fraction of the main peak tends to result in higher molecular masses than the fraction of the variant. The detected masses for the variant are about 600-1000 Da smaller than those for the main peak. Peptide mapping analysis for each peak fraction using Asp-N and Glu-C shows differences in O-glycopeptide profiles at Ser126. The O-glycopeptides were not detected in the fraction of the variant. It is concluded that the variant peak is non-O-glycosylated rHu-EPO and the main peak is fully O-glycosylated rHu-EPO at Ser126.

  11. Identification and Functional Characterization of G6PC2 Coding Variants Influencing Glycemic Traits Define an Effector Transcript at the G6PC2-ABCB11 Locus

    PubMed Central

    Mahajan, Anubha; Sim, Xueling; Ng, Hui Jin; Manning, Alisa; Rivas, Manuel A.; Highland, Heather M.; Locke, Adam E.; Grarup, Niels; Im, Hae Kyung; Cingolani, Pablo; Flannick, Jason; Fontanillas, Pierre; Fuchsberger, Christian; Gaulton, Kyle J.; Teslovich, Tanya M.; Rayner, N. William; Robertson, Neil R.; Beer, Nicola L.; Rundle, Jana K.; Bork-Jensen, Jette; Ladenvall, Claes; Blancher, Christine; Buck, David; Buck, Gemma; Burtt, Noël P.; Gabriel, Stacey; Gjesing, Anette P.; Groves, Christopher J.; Hollensted, Mette; Huyghe, Jeroen R.; Jackson, Anne U.; Jun, Goo; Justesen, Johanne Marie; Mangino, Massimo; Murphy, Jacquelyn; Neville, Matt; Onofrio, Robert; Small, Kerrin S.; Stringham, Heather M.; Syvänen, Ann-Christine; Trakalo, Joseph; Abecasis, Goncalo; Bell, Graeme I.; Blangero, John; Cox, Nancy J.; Duggirala, Ravindranath; Hanis, Craig L.; Seielstad, Mark; Wilson, James G.; Christensen, Cramer; Brandslund, Ivan; Rauramaa, Rainer; Surdulescu, Gabriela L.; Doney, Alex S. F.; Lannfelt, Lars; Linneberg, Allan; Isomaa, Bo; Tuomi, Tiinamaija; Jørgensen, Marit E.; Jørgensen, Torben; Kuusisto, Johanna; Uusitupa, Matti; Salomaa, Veikko; Spector, Timothy D.; Morris, Andrew D.; Palmer, Colin N. A.; Collins, Francis S.; Mohlke, Karen L.; Bergman, Richard N.; Ingelsson, Erik; Lind, Lars; Tuomilehto, Jaakko; Hansen, Torben; Watanabe, Richard M.; Prokopenko, Inga; Dupuis, Josee; Karpe, Fredrik; Groop, Leif; Laakso, Markku; Pedersen, Oluf; Florez, Jose C.; Morris, Andrew P.; Altshuler, David; Meigs, James B.; Boehnke, Michael; McCarthy, Mark I.; Lindgren, Cecilia M.; Gloyn, Anna L.

    2015-01-01

    Genome wide association studies (GWAS) for fasting glucose (FG) and insulin (FI) have identified common variant signals which explain 4.8% and 1.2% of trait variance, respectively. It is hypothesized that low-frequency and rare variants could contribute substantially to unexplained genetic variance. To test this, we analyzed exome-array data from up to 33,231 non-diabetic individuals of European ancestry. We found exome-wide significant (P<5×10-7) evidence for two loci not previously highlighted by common variant GWAS: GLP1R (p.Ala316Thr, minor allele frequency (MAF)=1.5%) influencing FG levels, and URB2 (p.Glu594Val, MAF = 0.1%) influencing FI levels. Coding variant associations can highlight potential effector genes at (non-coding) GWAS signals. At the G6PC2/ABCB11 locus, we identified multiple coding variants in G6PC2 (p.Val219Leu, p.His177Tyr, and p.Tyr207Ser) influencing FG levels, conditionally independent of each other and the non-coding GWAS signal. In vitro assays demonstrate that these associated coding alleles result in reduced protein abundance via proteasomal degradation, establishing G6PC2 as an effector gene at this locus. Reconciliation of single-variant associations and functional effects was only possible when haplotype phase was considered. In contrast to earlier reports suggesting that, paradoxically, glucose-raising alleles at this locus are protective against type 2 diabetes (T2D), the p.Val219Leu G6PC2 variant displayed a modest but directionally consistent association with T2D risk. Coding variant associations for glycemic traits in GWAS signals highlight PCSK1, RREB1, and ZHX3 as likely effector transcripts. These coding variant association signals do not have a major impact on the trait variance explained, but they do provide valuable biological insights. PMID:25625282

  12. Identification of strain harboring both aac(6')-Ib and aac(6')-Ib-cr variant simultaneously in Escherichia coli and Klebsiella pneumoniae.

    PubMed

    Kim, Yun-Tae; Jang, Ji-Hyun; Kim, Hyun-Chul; Kim, Hyogyeong; Lee, Kyoung-Ryul; Park, Kyung Sun; Lee, Hee-Joo; Kim, Young-Jin

    2011-04-01

    The aac(6')-Ib gene is the most prevalent gene that encodes aminoglycoside-modifying enzymes and confers resistance to tobramycin, kanamycin, and amikacin. The aac(6')-Ib-cr variant gene can induce resistance against aminoglycoside and fluoroquinolone simultaneously. Two main methods, sequence analysis and the restriction enzyme method, can detect the aac(6')-Ib-cr variant in clinical strains. We collected the 85 strains that were believed to be aac(6')-Ib positive from clinical isolates. Among them, 38 strains were the wild-type; the remaining 47 strains were the aac(6')-Ib-cr variant. Of these 47 strains, 19 simultaneously harbored aac(6')-Ib and aac(6')-Ib-cr. Our study aims to report the characteristics of the 19 strains that simultaneously harbored both genes. This study is the first investigation published in Korea of strains that included both aac(6')-Ib and aac(6')-Ib-cr variant.

  13. Identification of Functional Variants for Cleft Lip with or without Cleft Palate in or near PAX7, FGFR2, and NOG by Targeted Sequencing of GWAS Loci

    PubMed Central

    Leslie, Elizabeth J.; Taub, Margaret A.; Liu, Huan; Steinberg, Karyn Meltz; Koboldt, Daniel C.; Zhang, Qunyuan; Carlson, Jenna C.; Hetmanski, Jacqueline B.; Wang, Hang; Larson, David E.; Fulton, Robert S.; Kousa, Youssef A.; Fakhouri, Walid D.; Naji, Ali; Ruczinski, Ingo; Begum, Ferdouse; Parker, Margaret M.; Busch, Tamara; Standley, Jennifer; Rigdon, Jennifer; Hecht, Jacqueline T.; Scott, Alan F.; Wehby, George L.; Christensen, Kaare; Czeizel, Andrew E.; Deleyiannis, Frederic W.-B.; Schutte, Brian C.; Wilson, Richard K.; Cornell, Robert A.; Lidral, Andrew C.; Weinstock, George M.; Beaty, Terri H.; Marazita, Mary L.; Murray, Jeffrey C.

    2015-01-01

    Although genome-wide association studies (GWASs) for nonsyndromic orofacial clefts have identified multiple strongly associated regions, the causal variants are unknown. To address this, we selected 13 regions from GWASs and other studies, performed targeted sequencing in 1,409 Asian and European trios, and carried out a series of statistical and functional analyses. Within a cluster of strongly associated common variants near NOG, we found that one, rs227727, disrupts enhancer activity. We furthermore identified significant clusters of non-coding rare variants near NTN1 and NOG and found several rare coding variants likely to affect protein function, including four nonsense variants in ARHGAP29. We confirmed 48 de novo mutations and, based on best biological evidence available, chose two of these for functional assays. One mutation in PAX7 disrupted the DNA binding of the encoded transcription factor in an in vitro assay. The second, a non-coding mutation, disrupted the activity of a neural crest enhancer downstream of FGFR2 both in vitro and in vivo. This targeted sequencing study provides strong functional evidence implicating several specific variants as primary contributory risk alleles for nonsyndromic clefting in humans. PMID:25704602

  14. Identification of a novel CHEK2 variant and assessment of its contribution to the risk of breast cancer in French Canadian women

    PubMed Central

    Novak, David J; Chen, Long Qi; Ghadirian, Parviz; Hamel, Nancy; Zhang, Phil; Rossiny, Vanessa; Cardinal, Guy; Robidoux, André; Tonin, Patricia N; Rousseau, Francois; Narod, Steven A; Foulkes, William D

    2008-01-01

    Background BRCA1 and BRCA2 account for the majority of the known familial breast cancer risk, however, the impact of other cancer susceptibility genes largely remains to be elucidated. Checkpoint Kinase 2 (CHEK2) is an important signal transducer of cellular responses to DNA damage, whose defects have been associated with an increase in breast cancer risk. Previous studies have identified low penetrance CHEK2 alleles such as 1100delC and I157T, as well as variants such as S428F in the Ashkenazi Jewish population and IVS2 + 1G>A in the Polish population. No founder allele has been specifically identified in the French Canadian population. Methods The 14 coding exons of CHEK2 were fully sequenced for variant alleles in a panel of 25 affected French Canadian women and 25 healthy controls. Two variants were identified of which one novel variant was further screened for in an additional panel of 667 breast cancer patients and 6548 healthy controls. Additional genotyping was conducted using allele specific PCR and a restriction digest assay. Significance of amino acid substitutions were deduced by employing comparative analysis techniques. Results Two variants were identified: the previously reported silent substitution 252A>G (E84E) and the novel missense variant, 1217G>A (R406H). No significant difference in allele distribution between French Canadian women with breast cancer and healthy controls was observed (3/692, 0.43% vs. 22/6573, 0.33%, respectively, P = 0.73). Conclusion The novel CHEK2 missense variant identified in this study, R406H, is unlikely to contribute to breast cancer risk in French Canadian women. PMID:18706089

  15. A Bioinformatics Approach to the Identification of Variants Associated with Type 1 and Type 2 Diabetes Mellitus that Reside in Functionally Validated miRNAs Binding Sites.

    PubMed

    Ghaedi, Hamid; Bastami, Milad; Jahani, Mohammad Mehdi; Alipoor, Behnam; Tabasinezhad, Maryam; Ghaderi, Omar; Nariman-Saleh-Fam, Ziba; Mirfakhraie, Reza; Movafagh, Abolfazl; Omrani, Mir Davood; Masotti, Andrea

    2016-06-01

    The present work is aimed at finding variants associated with Type 1 and Type 2 diabetes mellitus (DM) that reside in functionally validated miRNAs binding sites and that can have a functional role in determining diabetes and related pathologies. Using bioinformatics analyses we obtained a database of validated polymorphic miRNA binding sites which has been intersected with genes related to DM or to variants associated and/or in linkage disequilibrium (LD) with it and is reported in genome-wide association studies (GWAS). The workflow we followed allowed us to find variants associated with DM that also reside in functional miRNA binding sites. These data have been demonstrated to have a functional role by impairing the functions of genes implicated in biological processes linked to DM. In conclusion, our work emphasized the importance of SNPs located in miRNA binding sites. The results discussed in this work may constitute the basis of further works aimed at finding functional candidates and variants affecting protein structure and function, transcription factor binding sites, and non-coding epigenetic variants, contributing to widen the knowledge about the pathogenesis of this important disease.

  16. An evaluation of the SPIFE 3000 semi-automated gel electrophoresis system for the identification of hemoglobin variants and comparison of relative electrophoretic mobilities with manual gel electrophoresis methods.

    PubMed

    Hoyer, J D; Markley, K M; Savedra, M E; Kubik, K S; Scheidt, R M

    2010-06-01

    Laboratory identification of hemoglobin (Hb) variants can involve multiple techniques. The use of semi-automated instruments that perform gel electrophoresis and staining, such as the SPIFE 3000 electrophoresis system, can greatly reduce the labor required for these commonly used techniques. We performed a comparison of the method involved in SPIFE 3000 system with those of manual gel electrophoresis. A total of 22 540 samples were analyzed using the SPIFE 3000, and compared with mobilities on cellulose acetate and citrate agar gels using standard manual methods. The results were compared using relative electrophoretic mobilities (REM). Of the 191 Hb variants identified, only 13 had REM that differed from manual electrophoresis when analyzed using the SPIFE 3000 system. One variant (Hb O-Indonesia) showed different mobility on both acid and alkaline gels, two (Hb E, Hb Sunshine Seth) on alkaline gel only, and 10 (Hbs N-Baltimore, N-Seattle, O-Arab, Shelby, Summer Hill, Tak, Hasharon, M-Iwate, Q-Iran, and Setif) on acid gels only. The SPIFE 3000 semi-automated electrophoresis system produces similar results when compared with those of standard manual electrophoresis methods.

  17. Identification of the Functional Variant(s) that Explain the Low-Density Lipoprotein Receptor (LDLR) GWAS SNP rs6511720 Association with Lower LDL-C and Risk of CHD

    PubMed Central

    Palmen, Jutta; Kalea, Anastasia Z.

    2016-01-01

    Background The Low-Density Lipoprotein Receptor (LDLR) SNP rs6511720 (G>T), located in intron-1 of the gene, has been identified in genome-wide association studies (GWAS) as being associated with lower plasma levels of LDL-C and a lower risk of coronary heart disease (CHD). Whether or not rs6511720 is itself functional or a marker for a functional variant elsewhere in the gene is not known. Methods The association of LDLR SNP rs6511720 with incidence of CHD and levels of LDL-C was determined by reference to CARDIoGRAM, C4D and Global lipids genetics consortium (GLGC) data. SNP annotation databases were used to identify possible SNP function and prioritization. Luciferase reporter assays in the liver cell line Huh7 were used to measure the effect of variant genotype on gene expression. Electrophoretic Mobility Shift Assays (EMSAs) were used to identify the Transcription Factors (TFs) involved in gene expression regulation. Results The phenotype-genotype analysis showed that the rs6511720 minor allele is associated with lower level of LDL-C [beta = -0.2209, p = 3.85 x10-262], and lower risk of CHD [log (OR) = 0.1155, p = 1.04 x10-7]. Rs6511720 is in complete linkage. Rs6511720 is in complete linkage disequilibrium (LD) with three intron-1 SNPs (rs141787760, rs60173709, rs57217136). Luciferase reporter assays in Huh7 cells showed that the rare alleles of both rs6511720 and rs57217136 caused a significant increase in LDLR expression compared to the common alleles (+29% and +24%, respectively). Multiplex Competitor-EMSAs (MC-EMSA) identified that the transcription factor serum response element (SRE) binds to rs6511720, while retinoic acid receptor (RAR) and signal transducer and activator of transcription 1 (STAT1) bind to rs57217136. Conclusion Both LDLR rs6511720 and rs57217136 are functional variants. Both these minor alleles create enhancer-binding protein sites for TFs and may contribute to increased LDLR expression, which is consequently associated with reduced

  18. Identification of non-coding genetic variants in samples from hypoxemic respiratory disease patients that affect the transcriptional response to hypoxia

    PubMed Central

    Roche, Olga; Deguiz, María Laura; Tiana, María; Galiana-Ribote, Clara; Martinez-Alcazar, Daniel; Rey-Serra, Carlos; Ranz-Ribeiro, Beatriz; Casitas, Raquel; Galera, Raúl; Fernández-Navarro, Isabel; Sánchez-Cuéllar, Silvia; Bernard, Virginie; Ancochea, Julio; Wasserman, Wyeth W.; García-Rio, Francisco; Jimenez, Benilde; del Peso, Luis

    2016-01-01

    A wide range of diseases course with an unbalance between the consumption of oxygen by tissues and its supply. This situation triggers a transcriptional response, mediated by the hypoxia inducible factors (HIFs), that aims to restore oxygen homeostasis. Little is known about the inter-individual variation in this response and its role in the progression of disease. Herein, we sought to identify common genetic variants mapping to hypoxia response elements (HREs) and characterize their effect on transcription. To this end, we constructed a list of genome-wide HIF-binding regions from publicly available experimental datasets and studied the genetic variability in these regions by targeted re-sequencing of genomic samples from 96 chronic obstructive pulmonary disease and 144 obstructive sleep apnea patients. This study identified 14 frequent variants disrupting potential HREs. The analysis of the genomic regions containing these variants by means of reporter assays revealed that variants rs1009329, rs6593210 and rs150921338 impaired the transcriptional response to hypoxia. Finally, using genome editing we confirmed the functional role of rs6593210 in the transcriptional regulation of EGFR. In summary, we found that inter-individual variability in non-coding regions affect the response to hypoxia and could potentially impact on the progression of pulmonary diseases. PMID:27625398

  19. Identification of Male- and Female-Specific Olfaction Genes in Antennae of the Oriental Fruit Fly (Bactrocera dorsalis)

    PubMed Central

    Liu, Zhao; Smagghe, Guy; Lei, Zhongren; Wang, Jin-Jun

    2016-01-01

    The oriental fruit fly (Bactrocera dorsalis) is a species of tephritid fruit fly, endemic to Southeast Asia but also introduced to many regions of the US, and it is one of the major pest species with a broad host range of cultivated and wild fruits. Although males of B. dorsalis respond strongly to methyl eugenol and this is used for monitoring and estimating populations, the molecular mechanism of the oriental fruit fly olfaction has not been elucidated yet. Therefore, in this project, using next generation sequencing technologies, we sequenced the transcriptome of the antennae of male and female adults of B. dorsalis. We identified a total of 20 candidate odorant binding proteins (OBPs), 5 candidate chemosensory proteins (CSPs), 35 candidate odorant receptors (ORs), 12 candidate ionotropic receptors (IRs) and 4 candidate sensory neuron membrane proteins (SNMPs). The sex-specific expression of these genes was determined and a subset of 9 OR genes was further characterized by qPCR with male and female antenna, head, thorax, abdomen, leg and wing samples. In the male antennae, 595 genes showed a higher expression, while 128 genes demonstrated a higher expression in the female antennae. Interestingly, 2 ORs (BdorOR13 and BdorOR14) were highly and specifically expressed in the antennae of males, and 4 ORs (BdorOR13, BdorOR16, BdorOR18 and BdorOR35) clustered with DmOR677, suggesting pheromone reception. We believe this study with these antennae-enriched OBPs, CSPs, ORs, IRs and SNMPs can play an important role in the detection of pheromones and general odorants, and so in turn our data improve our current understanding of insect olfaction at the molecular level and provide important information for disrupting the behavior of the oriental fruit fly using chemical communication methods. PMID:26845547

  20. Identification of Male- and Female-Specific Olfaction Genes in Antennae of the Oriental Fruit Fly (Bactrocera dorsalis).

    PubMed

    Liu, Zhao; Smagghe, Guy; Lei, Zhongren; Wang, Jin-Jun

    2016-01-01

    The oriental fruit fly (Bactrocera dorsalis) is a species of tephritid fruit fly, endemic to Southeast Asia but also introduced to many regions of the US, and it is one of the major pest species with a broad host range of cultivated and wild fruits. Although males of B. dorsalis respond strongly to methyl eugenol and this is used for monitoring and estimating populations, the molecular mechanism of the oriental fruit fly olfaction has not been elucidated yet. Therefore, in this project, using next generation sequencing technologies, we sequenced the transcriptome of the antennae of male and female adults of B. dorsalis. We identified a total of 20 candidate odorant binding proteins (OBPs), 5 candidate chemosensory proteins (CSPs), 35 candidate odorant receptors (ORs), 12 candidate ionotropic receptors (IRs) and 4 candidate sensory neuron membrane proteins (SNMPs). The sex-specific expression of these genes was determined and a subset of 9 OR genes was further characterized by qPCR with male and female antenna, head, thorax, abdomen, leg and wing samples. In the male antennae, 595 genes showed a higher expression, while 128 genes demonstrated a higher expression in the female antennae. Interestingly, 2 ORs (BdorOR13 and BdorOR14) were highly and specifically expressed in the antennae of males, and 4 ORs (BdorOR13, BdorOR16, BdorOR18 and BdorOR35) clustered with DmOR677, suggesting pheromone reception. We believe this study with these antennae-enriched OBPs, CSPs, ORs, IRs and SNMPs can play an important role in the detection of pheromones and general odorants, and so in turn our data improve our current understanding of insect olfaction at the molecular level and provide important information for disrupting the behavior of the oriental fruit fly using chemical communication methods.

  1. Automatic identification of agricultural terraces through object-oriented analysis of very high resolution DSMs and multispectral imagery obtained from an unmanned aerial vehicle.

    PubMed

    Diaz-Varela, R A; Zarco-Tejada, P J; Angileri, V; Loudjani, P

    2014-02-15

    Agricultural terraces are features that provide a number of ecosystem services. As a result, their maintenance is supported by measures established by the European Common Agricultural Policy (CAP). In the framework of CAP implementation and monitoring, there is a current and future need for the development of robust, repeatable and cost-effective methodologies for the automatic identification and monitoring of these features at farm scale. This is a complex task, particularly when terraces are associated to complex vegetation cover patterns, as happens with permanent crops (e.g. olive trees). In this study we present a novel methodology for automatic and cost-efficient identification of terraces using only imagery from commercial off-the-shelf (COTS) cameras on board unmanned aerial vehicles (UAVs). Using state-of-the-art computer vision techniques, we generated orthoimagery and digital surface models (DSMs) at 11 cm spatial resolution with low user intervention. In a second stage, these data were used to identify terraces using a multi-scale object-oriented classification method. Results show the potential of this method even in highly complex agricultural areas, both regarding DSM reconstruction and image classification. The UAV-derived DSM had a root mean square error (RMSE) lower than 0.5 m when the height of the terraces was assessed against field GPS data. The subsequent automated terrace classification yielded an overall accuracy of 90% based exclusively on spectral and elevation data derived from the UAV imagery.

  2. An automated high-throughput screening method for the identification of high-yield, soluble protein variants using cell-free expression and systematic truncation.

    PubMed

    Bursey, Evan H; Kim, Chang-Yub; Yu, Minmin; Terwilliger, Thomas C; Hung, Li-Wei

    2006-12-01

    A highly automated method for rapidly identifying soluble protein variants with good expression yields has been developed. This method is based on a commercially available in vitro protein expression system. It consists of two polymerase chain reactions (PCR) followed by in vitro protein expression and protein quantification by dot blot. The PCR protocols have been improved and optimized to allow automation using commercial fluid handling devices. A PCR primer design program has also been implemented to streamline protein variant design. This automated protocol is highly reliable and has tremendously improved the throughput of expression screening as compared to conventional cell-based methods and manual in vitro methods. We have applied this method to 32 problematic targets from the TB Structural Genomics Consortium. Experimental results of these studies are reported.

  3. Association of breast cancer risk with genetic variants showing differential allelic expression: Identification of a novel breast cancer susceptibility locus at 4q21.

    PubMed

    Hamdi, Yosr; Soucy, Penny; Adoue, Véronique; Michailidou, Kyriaki; Canisius, Sander; Lemaçon, Audrey; Droit, Arnaud; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Baynes, Caroline; Blomqvist, Carl; Bogdanova, Natalia V; Bojesen, Stig E; Bolla, Manjeet K; Bonanni, Bernardo; Borresen-Dale, Anne-Lise; Brand, Judith S; Brauch, Hiltrud; Brenner, Hermann; Broeks, Annegien; Burwinkel, Barbara; Chang-Claude, Jenny; Couch, Fergus J; Cox, Angela; Cross, Simon S; Czene, Kamila; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Dörk, Thilo; Dos-Santos-Silva, Isabel; Eriksson, Mikael; Fasching, Peter A; Figueroa, Jonine; Flyger, Henrik; García-Closas, Montserrat; Giles, Graham G; Goldberg, Mark S; González-Neira, Anna; Grenaker-Alnæs, Grethe; Guénel, Pascal; Haeberle, Lothar; Haiman, Christopher A; Hamann, Ute; Hallberg, Emily; Hooning, Maartje J; Hopper, John L; Jakubowska, Anna; Jones, Michael; Kabisch, Maria; Kataja, Vesa; Lambrechts, Diether; Le Marchand, Loic; Lindblom, Annika; Lubinski, Jan; Mannermaa, Arto; Maranian, Mel; Margolin, Sara; Marme, Frederik; Milne, Roger L; Neuhausen, Susan L; Nevanlinna, Heli; Neven, Patrick; Olswold, Curtis; Peto, Julian; Plaseska-Karanfilska, Dijana; Pylkäs, Katri; Radice, Paolo; Rudolph, Anja; Sawyer, Elinor J; Schmidt, Marjanka K; Shu, Xiao-Ou; Southey, Melissa C; Swerdlow, Anthony; Tollenaar, Rob A E M; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Vachon, Celine; Van Den Ouweland, Ans M W; Wang, Qin; Winqvist, Robert; Zheng, Wei; Benitez, Javier; Chenevix-Trench, Georgia; Dunning, Alison M; Pharoah, Paul D P; Kristensen, Vessela; Hall, Per; Easton, Douglas F; Pastinen, Tomi; Nord, Silje; Simard, Jacques

    2016-12-06

    There are significant inter-individual differences in the levels of gene expression. Through modulation of gene expression, cis-acting variants represent an important source of phenotypic variation. Consequently, cis-regulatory SNPs associated with differential allelic expression are functional candidates for further investigation as disease-causing variants. To investigate whether common variants associated with differential allelic expression were involved in breast cancer susceptibility, a list of genes was established on the basis of their involvement in cancer related pathways and/or mechanisms. Thereafter, using data from a genome-wide map of allelic expression associated SNPs, 313 genetic variants were selected and their association with breast cancer risk was then evaluated in 46,451 breast cancer cases and 42,599 controls of European ancestry ascertained from 41 studies participating in the Breast Cancer Association Consortium. The associations were evaluated with overall breast cancer risk and with estrogen receptor negative and positive disease. One novel breast cancer susceptibility locus on 4q21 (rs11099601) was identified (OR = 1.05, P = 5.6x10-6). rs11099601 lies in a 135 kb linkage disequilibrium block containing several genes, including, HELQ, encoding the protein HEL308 a DNA dependant ATPase and DNA Helicase involved in DNA repair, MRPS18C encoding the Mitochondrial Ribosomal Protein S18C and FAM175A (ABRAXAS), encoding a BRCA1 BRCT domain-interacting protein involved in DNA damage response and double-strand break (DSB) repair. Expression QTL analysis in breast cancer tissue showed rs11099601 to be associated with HELQ (P = 8.28x10-14), MRPS18C (P = 1.94x10-27) and FAM175A (P = 3.83x10-3), explaining about 20%, 14% and 1%, respectively of the variance inexpression of these genes in breast carcinomas.

  4. Association of breast cancer risk with genetic variants showing differential allelic expression: Identification of a novel breast cancer susceptibility locus at 4q21

    PubMed Central

    Adoue, Véronique; Michailidou, Kyriaki; Canisius, Sander; Lemaçon, Audrey; Droit, Arnaud; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Baynes, Caroline; Blomqvist, Carl; Bogdanova, Natalia V.; Bojesen, Stig E.; Bolla, Manjeet K.; Bonanni, Bernardo; Borresen-Dale, Anne-Lise; Brand, Judith S.; Brauch, Hiltrud; Brenner, Hermann; Broeks, Annegien; Burwinkel, Barbara; Chang-Claude, Jenny; Couch, Fergus J.; Cox, Angela; Cross, Simon S.; Czene, Kamila; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Dörk, Thilo; Dos-Santos-Silva, Isabel; Eriksson, Mikael; Fasching, Peter A.; Figueroa, Jonine; Flyger, Henrik; García-Closas, Montserrat; Giles, Graham G.; Goldberg, Mark S.; González-Neira, Anna; Grenaker-Alnæs, Grethe; Guénel, Pascal; Haeberle, Lothar; Haiman, Christopher A.; Hamann, Ute; Hallberg, Emily; Hooning, Maartje J.; Hopper, John L.; Jakubowska, Anna; Jones, Michael; Kabisch, Maria; Kataja, Vesa; Lambrechts, Diether; Marchand, Loic Le; Lindblom, Annika; Lubinski, Jan; Mannermaa, Arto; Maranian, Mel; Margolin, Sara; Marme, Frederik; Milne, Roger L.; Neuhausen, Susan L.; Nevanlinna, Heli; Neven, Patrick; Olswold, Curtis; Peto, Julian; Plaseska-Karanfilska, Dijana; Pylkäs, Katri; Radice, Paolo; Rudolph, Anja; Sawyer, Elinor J.; Schmidt, Marjanka K.; Shu, Xiao-Ou; Southey, Melissa C.; Swerdlow, Anthony; Tollenaar, Rob A.E.M.; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Vachon, Celine; Van Den Ouweland, Ans M. W.; Wang, Qin; Winqvist, Robert; Investigators, kConFab/AOCS; Zheng, Wei; Benitez, Javier; Chenevix-Trench, Georgia; Dunning, Alison M.; Pharoah, Paul D. P.; Kristensen, Vessela; Hall, Per; Easton, Douglas F.; Pastinen, Tomi; Nord, Silje; Simard, Jacques

    2016-01-01

    There are significant inter-individual differences in the levels of gene expression. Through modulation of gene expression, cis-acting variants represent an important source of phenotypic variation. Consequently, cis-regulatory SNPs associated with differential allelic expression are functional candidates for further investigation as disease-causing variants. To investigate whether common variants associated with differential allelic expression were involved in breast cancer susceptibility, a list of genes was established on the basis of their involvement in cancer related pathways and/or mechanisms. Thereafter, using data from a genome-wide map of allelic expression associated SNPs, 313 genetic variants were selected and their association with breast cancer risk was then evaluated in 46,451 breast cancer cases and 42,599 controls of European ancestry ascertained from 41 studies participating in the Breast Cancer Association Consortium. The associations were evaluated with overall breast cancer risk and with estrogen receptor negative and positive disease. One novel breast cancer susceptibility locus on 4q21 (rs11099601) was identified (OR = 1.05, P = 5.6x10-6). rs11099601 lies in a 135 kb linkage disequilibrium block containing several genes, including, HELQ, encoding the protein HEL308 a DNA dependant ATPase and DNA Helicase involved in DNA repair, MRPS18C encoding the Mitochondrial Ribosomal Protein S18C and FAM175A (ABRAXAS), encoding a BRCA1 BRCT domain-interacting protein involved in DNA damage response and double-strand break (DSB) repair. Expression QTL analysis in breast cancer tissue showed rs11099601 to be associated with HELQ (P = 8.28x10-14), MRPS18C (P = 1.94x10-27) and FAM175A (P = 3.83x10-3), explaining about 20%, 14% and 1%, respectively of the variance inexpression of these genes in breast carcinomas. PMID:27792995

  5. Identification of Rare Recurrent Copy Number Variants in High-Risk Autism Families and Their Prevalence in a Large ASD Population

    PubMed Central

    Christensen, G. Bryce; Kim, Cecilia; Frackelton, Edward; Thomas, Kelly; da Silva, Renata Pellegrino; Stevens, Jeff; Baird, Lisa; Otterud, Brith; Ho, Karen; Varvil, Tena; Leppert, Tami; Lambert, Christophe G.; Leppert, Mark; Hakonarson, Hakon

    2013-01-01

    Structural variation is thought to play a major etiological role in the development of autism spectrum disorders (ASDs), and numerous studies documenting the relevance of copy number variants (CNVs) in ASD have been published since 2006. To determine if large ASD families harbor high-impact CNVs that may have broader impact in the general ASD population, we used the Affymetrix genome-wide human SNP array 6.0 to identify 153 putative autism-specific CNVs present in 55 individuals with ASD from 9 multiplex ASD pedigrees. To evaluate the actual prevalence of these CNVs as well as 185 CNVs reportedly associated with ASD from published studies many of which are insufficiently powered, we designed a custom Illumina array and used it to interrogate these CNVs in 3,000 ASD cases and 6,000 controls. Additional single nucleotide variants (SNVs) on the array identified 25 CNVs that we did not detect in our family studies at the standard SNP array resolution. After molecular validation, our results demonstrated that 15 CNVs identified in high-risk ASD families also were found in two or more ASD cases with odds ratios greater than 2.0, strengthening their support as ASD risk variants. In addition, of the 25 CNVs identified using SNV probes on our custom array, 9 also had odds ratios greater than 2.0, suggesting that these CNVs also are ASD risk variants. Eighteen of the validated CNVs have not been reported previously in individuals with ASD and three have only been observed once. Finally, we confirmed the association of 31 of 185 published ASD-associated CNVs in our dataset with odds ratios greater than 2.0, suggesting they may be of clinical relevance in the evaluation of children with ASDs. Taken together, these data provide strong support for the existence and application of high-impact CNVs in the clinical genetic evaluation of children with ASD. PMID:23341896

  6. Identification of a Latin American-specific BabA adhesin variant through whole genome sequencing of Helicobacter pylori patient isolates from Nicaragua

    DOE PAGES

    Thorell, Kaisa; Hosseini, Shaghayegh; Palacios Gonzales, Reyna Victoria Palacios; ...

    2016-02-29

    In this study, Helicobacter pylori (H. pylori) is one of the most common bacterial infections in humans and this infection can lead to gastric ulcers and gastric cancer. H. pylori is one of the most genetically variable human pathogens and the ability of the bacterium to bind to the host epithelium as well as the presence of different virulence factors and genetic variants within these genes have been associated with disease severity. Nicaragua has particularly high gastric cancer incidence and we therefore studied Nicaraguan clinical H. pylori isolates for factors that could contribute to cancer risk. The complete genomes ofmore » fifty-two Nicaraguan H. pylorii isolates were sequenced and assembled de novo, and phylogenetic and virulence factor analyses were performed. The Nicaraguan isolates showed phylogenetic relationship with West African isolates in whole-genome sequence comparisons and with Western and urban South-and Central American isolates using MLSA (Multi-locus sequence analysis). A majority, 77 % of the isolates carried the cancer-associated virulence gene cagA and also the s1/i1/m1 vacuolating cytotoxin, vacA allele combination, which is linked to increased severity of disease. Specifically, we also found that Nicaraguan isolates have a blood group-binding adhesin (BabA) variant highly similar to previously reported BabA sequences from Latin America, including from isolates belonging to other phylogenetic groups. These BabA sequences were found to be under positive selection at several amino acid positions that differed from the global collection of isolates. In conclusion, the discovery of a Latin American BabA variant, independent of overall phylogenetic background, suggests hitherto unknown host or environmental factors within the Latin American population giving H. pylori isolates carrying this adhesin variant a selective advantage, which could affect pathogenesis and risk for sequelae through specific adherence properties.« less

  7. Identification of a Latin American-specific BabA adhesin variant through whole genome sequencing of Helicobacter pylori patient isolates from Nicaragua

    SciTech Connect

    Thorell, Kaisa; Hosseini, Shaghayegh; Palacios Gonzales, Reyna Victoria Palacios; Chaotham, Chatchai; Graham, David Y.; Paszat, Lawrence; Rabeneck, Linda; Lundin, Samuel B.; Nookaew, Intawat; Sjoling, Asa

    2016-02-29

    In this study, Helicobacter pylori (H. pylori) is one of the most common bacterial infections in humans and this infection can lead to gastric ulcers and gastric cancer. H. pylori is one of the most genetically variable human pathogens and the ability of the bacterium to bind to the host epithelium as well as the presence of different virulence factors and genetic variants within these genes have been associated with disease severity. Nicaragua has particularly high gastric cancer incidence and we therefore studied Nicaraguan clinical H. pylori isolates for factors that could contribute to cancer risk. The complete genomes of fifty-two Nicaraguan H. pylorii isolates were sequenced and assembled de novo, and phylogenetic and virulence factor analyses were performed. The Nicaraguan isolates showed phylogenetic relationship with West African isolates in whole-genome sequence comparisons and with Western and urban South-and Central American isolates using MLSA (Multi-locus sequence analysis). A majority, 77 % of the isolates carried the cancer-associated virulence gene cagA and also the s1/i1/m1 vacuolating cytotoxin, vacA allele combination, which is linked to increased severity of disease. Specifically, we also found that Nicaraguan isolates have a blood group-binding adhesin (BabA) variant highly similar to previously reported BabA sequences from Latin America, including from isolates belonging to other phylogenetic groups. These BabA sequences were found to be under positive selection at several amino acid positions that differed from the global collection of isolates. In conclusion, the discovery of a Latin American BabA variant, independent of overall phylogenetic background, suggests hitherto unknown host or environmental factors within the Latin American population giving H. pylori isolates carrying this adhesin variant a selective advantage, which could affect pathogenesis and risk for sequelae through specific adherence

  8. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  9. Identification of the thiamin pyrophosphokinase gene in rainbow trout: Characteristic structure and expression of seven splice variants in tissues and cell lines and during embryo development

    USGS Publications Warehouse

    Yuge, Shinya; Richter, Catherine A.; Wright-Osment, Maureen K.; Nicks, Diane; Saloka, Stephanie K.; Tillitt, Donald E.; Li, Weiming

    2012-01-01

    Thiamin pyrophosphokinase (TPK) converts thiamin to its active form, thiamin diphosphate. In humans, TPK expression is down-regulated in some thiamin deficiency related syndrome, and enhanced during pregnancy. Rainbow trout are also vulnerable to thiamin deficiency in wild life and are useful models for thiamin metabolism research. We identified the tpk gene transcript including seven splice variants in the rainbow trout. Almost all cell lines and tissues examined showed co-expression of several tpk splice variants including a potentially major one at both mRNA and protein levels. However, relative to other tissues, the longest variant mRNA expression was predominant in the ovary and abundant in embryos. During embryogenesis, total tpk transcripts increased abruptly in early development, and decreased to about half of the peak shortly after hatching. In rainbow trout, the tpk transcript complex is ubiquitously expressed for all tissues and cells examined, and its increase in expression could be important in the early-middle embryonic stages. Moreover, decimated tpk expression in a hepatoma cell line relative to hepatic and gonadal cell lines appears to be consistent with previously reported down-regulation of thiamin metabolism in cancer.

  10. Identification and validation of immunogenic potential of India specific HPV-16 variant constructs: In-silico & in-vivo insight to vaccine development

    PubMed Central

    Kumar, Anoop; Hussain, Showket; Sharma, Gagan; Mehrotra, Ravi; Gissmann, Lutz; Das, Bhudev C.; Bharadwaj, Mausumi

    2015-01-01

    Cervical cancer is one of the most common gynecological cancers in the world but in India, it is the top most cancer among women. Persistent infection with high-risk human papillomaviruses (HR-HPVs) is the most important risk factor. The sequence variation(s) in the most common HR-HPV i.e. HPV type 16 leads to altered biological functions with possible clinical significance in the different geographical locations. Sixteen major variants (V1-V16) in full length L1 gene of HPV-16 were identified following analysis of 250 prospectively collected cervical cancer tissue biopsies and their effect on immunogenicity was studied. The effect of these major variations on the epitopes were predicted by in silico methods and the immunogenicity of variants and respective reference DNA vaccine constructs were evaluated by administration of prepared DNA vaccine constructs in female BALB/c mice to evaluate antibody titer. In the present study, L500F (V16) variation showed a significant ~2.7 fold (p < 0.002) increase in antibody titer, whereas T379P (V8) showed ~0.4 fold (p < 0.328) decrease after final injection. These results showed a promising roadmap for the development of DNA based vaccine and for the generation of effective response, though there is a need to study more prevalent variants of HPV in the Indian population. PMID:26507515

  11. Characterization of recombinant long-chain rat acyl-CoA synthetase isoforms 3 and 6: identification of a novel variant of isoform 6.

    PubMed

    Van Horn, Cynthia G; Caviglia, Jorge M; Li, Lei O; Wang, Shuli; Granger, Deborah A; Coleman, Rosalind A

    2005-02-08

    The metabolism of long-chain fatty acids in brain and their incorporation into signaling molecules such as diacylglycerol and LPA and into structural components of membranes, including myelin, requires activation by long-chain acyl-CoA synthetase (ACSL). Because ACSL3 and ACSL6 are the predominant ACSL isoforms in brain, we cloned and characterized these isoforms from rat brain and identified a novel ACSL6 clone (ACSL6_v2). ACSL6_v2 and the previously reported ACSL6_v1 represent splice variants that include exon 13 or 14, respectively. Homologue sequences of both of these variants are present in the human and mouse databases. ACSL3, ACSL6_v1, and ACSL6_v2 with Flag-epitopes at the C-termini were expressed in Escherichia coli and purified on Flag-affinity columns. The three recombinant proteins were characterized. Compared to ACSL4, another brain isoform, ACSL3, ACSL6_v1, and ACSL6_v2 showed similarities in kinetic values for CoA, palmitate, and arachidonate, but their apparent Km values for oleate were 4- to 6-fold lower than for ACSL4. In a direct competition assay with palmitate, all the polyunsaturated fatty acids tested were strong competitors only for ACSL4 with IC50 values of 0.5 to 5 microM. DHA was also strongly preferred by ACSL6_v2. The apparent Km value for ATP of ACSL6_v1 was 8-fold higher than that of ACSL6_v2. ACSL3 and the two variants of ACSL6 were more resistant than ACSL4 to heat inactivation. Despite the high amino acid identity between ACSL3 and ACSL4, rosiglitazone inhibited only ACSL4. Triacsin C, an inhibitor of ACSL1 and ACSL4, also inhibited ACSL3, but did not inhibit the ACSL6 variants. These data further document important differences in the closely related ACSL isoforms and show that amino acid changes near the consensus nucleotide binding site alter function in the two splice variants of ACSL6.

  12. Plant Gene and Alternatively Spliced Variant Annotator. A plant genome annotation pipeline for rice gene and alternatively spliced variant identification with cross-species expressed sequence tag conservation from seven plant species.

    PubMed

    Chen, Feng-Chi; Wang, Sheng-Shun; Chaw, Shu-Miaw; Huang, Yao-Ting; Chuang, Trees-Juen

    2007-03-01

    The completion of the rice (Oryza sativa) genome draft has brought unprecedented opportunities for genomic studies of the world's most important food crop. Previous rice gene annotations have relied mainly on ab initio methods, which usually yield a high rate of false-positive predictions and give only limited information regarding alternative splicing in rice genes. Comparative approaches based on expressed sequence tags (ESTs) can compensate for the drawbacks of ab initio methods because they can simultaneously identify experimental data-supported genes and alternatively spliced transcripts. Furthermore, cross-species EST information can be used to not only offset the insufficiency of same-species ESTs but also derive evolutionary implications. In this study, we used ESTs from seven plant species, rice, wheat (Triticum aestivum), maize (Zea mays), barley (Hordeum vulgare), sorghum (Sorghum bicolor), soybean (Glycine max), and Arabidopsis (Arabidopsis thaliana), to annotate the rice genome. We developed a plant genome annotation pipeline, Plant Gene and Alternatively Spliced Variant Annotator (PGAA). Using this approach, we identified 852 genes (931 isoforms) not annotated in other widely used databases (i.e. the Institute for Genomic Research, National Center for Biotechnology Information, and Rice Annotation Project) and found 87% of them supported by both rice and nonrice EST evidence. PGAA also identified more than 44,000 alternatively spliced events, of which approximately 20% are not observed in the other three annotations. These novel annotations represent rich opportunities for rice genome research, because the functions of most of our annotated genes are currently unknown. Also, in the PGAA annotation, the isoforms with non-rice-EST-supported exons are significantly enriched in transporter activity but significantly underrepresented in transcription regulator activity. We have also identified potential lineage-specific and conserved isoforms, which are

  13. Acute intermittent porphyria: identification and expression of exonic mutations in the hydroxymethylbilane synthase gene. An initiation codon missense mutation in the housekeeping transcript causes "variant acute intermittent porphyria" with normal expression of the erythroid-specific enzyme.

    PubMed Central

    Chen, C H; Astrin, K H; Lee, G; Anderson, K E; Desnick, R J

    1994-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error, results from the half-normal activity of the heme biosynthetic enzyme, hydroxymethylbilane synthase (EC 4.3.1.8). Diagnosis of AIP heterozygotes is essential to prevent acute, life-threatening neurologic attacks by avoiding various precipitating factors. Since biochemical diagnosis is problematic, the identification of hydroxymethylbilane synthase mutations has facilitated the detection of AIP heterozygotes. Molecular analyses of unrelated AIP patients revealed six exonic mutations: an initiating methionine to isoleucine substitution (M1I) in a patient with variant AIP, which precluded translation of the housekeeping, but not the erythroid-specific isozyme; four missense mutations in classical AIP patients, V93F, R116W, R201W, C247F; and a nonsense mutation W283X in a classical AIP patient, which truncated the housekeeping and erythroid-specific isozymes. Each mutation was confirmed in genomic DNA from family members. The W283X lesion was found in another unrelated AIP family. Expression of each mutation in Escherichia coli revealed that R201W, C247F, and W283X had residual activity. In vitro transcription/translation studies indicated that the M1I allele produced only the erythroid-specific enzyme, while the other mutant alleles encoded both isozymes. These mutations provide insight into the molecular pathology of classic and variant AIP and facilitate molecular diagnosis in AIP families. Images PMID:7962538

  14. A genetic polymorphism in coumarin 7-hydroxylation: Sequence of the human CYP2A genes and identification of variant CYP2A6 alleles

    SciTech Connect

    Fernandez-Salguero, P.; Hoffman, S.M.G.; Mohrenweiser, H.

    1995-09-01

    A group of human cytochrome P450 genes encompassing the CYP2A, CYP2B, and CYP2F subfamilies were cloned and assembled into a 350-kb contig localized on the long arm of chromosome 19. Three complete CYP2A genes - CYP2A6, CYP2A7, and CYP2A13 - plus two pseudogenes truncated after exon 5 were identified and sequenced. A variant CYP2A6 allele that differed from the corresponding CYP2A6 and CYP2A7 cDNAs previously sequenced was found and was designated CYP2A6{nu}2. Sequence differences in the CY-P2A6{nu}2 gene are restricted to regions encompassing exons 3, 6, and 8, which bear sequence relatedness with the corresponding exons of the CYP2A7 gene, located downstream and centromeric of CYP2A6{nu}2, suggesting recent gene-conversion events. The sequencing of all the CYP2A genes allowed the design of a PCR diagnostic test for the normal CYP2A6 allele, the CYP2A6{nu}2 allele, and a variant - designated CYP2A6{nu}1 - that encodes an enzyme with a single inactivating amino acid change. These variant alleles were found in individuals who were deficient in their ability to metabolize the CYP2A6 probe drug coumarin. The allelic frequencies of CYP2A6{nu}1 and CYP2A6{nu}2 differed significantly between Caucasian, Asian, and African-American populations. These studies establish the existence of a new cytochrome P450 genetic polymorphism. 30 refs., 4 figs., 2 tabs.

  15. Volatile organic compounds in the Pearl River Delta: Identification of source regions and recommendations for emission-oriented monitoring strategies

    NASA Astrophysics Data System (ADS)

    Yuan, Zibing; Zhong, Liuju; Lau, Alexis Kai Hon; Yu, Jian Zhen; Louie, Peter K. K.

    2013-09-01

    For the purpose of systematically characterizing the ambient volatile organic compound (VOC) levels and their emission sources in the Pearl River Delta (PRD) of China, a grid study with VOC samples simultaneously taken at 84 sites over the PRD was conducted in summer and winter of 2008 and 2009. Positive Matrix Factorization (PMF) model was applied to identify the major VOC contributing sources and their temporal and spatial variations. Nine sources were identified, with gasoline exhaust, industrial emission and LPG leakage & propellant emission the top three significant sources. They accounted for 23%, 16% and 13% of the ambient VOC levels, respectively. Control measures should be therefore targeted on mitigating the VOC emissions from the traffic-related and industrial-related sources. The total VOC level did not show strong increase from 5 a.m. to 10 a.m. during all the four sampling campaigns, which may result from stronger wind and higher mixing height at 10 a.m. Three hotspot areas with significant VOC contributions were identified by source apportionment analysis: (1) the Pearl River Estuary; (2) an area from Central Dongguan to North Shenzhen; and (3) the Zhuhai-Zhongshan-Jiangmen area. For better characterizing the roles of VOC and NOx in producing the secondary pollutants and to identify specific sources emitting excessive concentrations of precursors, the emission-oriented Photochemical Assessment Monitoring Station (PAMS) network is recommended to be established in the PRD. Three PAMS networks are suggested in correspondence to the three identified hotspot areas.

  16. Anatomy of a Red Copper Center: Spectroscopic Identification and Reactivity of the Copper Centers of Bacillus Subtilis Sco and its Cys to Ala Variants

    PubMed Central

    Siluvai, Gnana S; Mayfield, Mary; Nilges, Mark J; George, Serena DeBeer; Blackburn, Ninian J

    2010-01-01

    Sco is a mononuclear red copper protein involved in the assembly of cytochrome c oxidase. It is spectroscopically similar to red copper nitrosocyanin, but unlike the latter, which has one copper cysteine thiolate, the former has two. In addition to the two cysteine ligands (C45 and C49), the WT protein from Bacillus subtilis (hereafter named BSco) has a histidine (H135) and an unknown endogenous protein oxygen ligand in a distorted tetragonal array. We have compared the properties of the WT protein to variants in which each of the two coordinating Cys residues has been individually mutated to Ala, using UV/vis, Cu and S K edge XAS, EPR, and resonance Raman spectroscopy. Unlike the Cu(II) form of native Sco, the Cu(II) complexes of the Cys variants are unstable. The copper center of C49A undergoes autoreduction to the Cu(I) form which is shown by EXAFS to be composed of a novel 2-coordinate center with one Cys and one His ligand. C45A rearranges to a new stable Cu(II) species coordinated by C49 H135 and a second His ligand recruited from a previously uncoordinated protein side chain. The different chemistry exhibited by the Cys variants can be rationalized by whether a stable Cu(I) species can be formed by autoredox chemistry. For C49A, the remaining Cys and His residues are trans which facilitate the formation of the highly stable 2-coordinate Cu(I) species, while for C45A such a configuration cannot be attained. Resonance Raman spectroscopy of the WT protein indicates a net weak Cu–S bond strength at ~ 2.24 Å corresponding to the two thiolate copper bonds, whereas the single variant C45A shows a moderately strong Cu–S bond at ~ 2.16 Å. S K-edge data gives a total covalency of 28% for both Cu-S bonds in the WT protein. These data suggest an average covalency per Cu-S bond lower than nitrosocyanin and close to that expected for type-2 Cu(II)-thiolate systems. The data are discussed relative to the unique Cu-S characteristics of cupredoxins, whence it is

  17. Identification of genetic risk variants for deep vein thrombosis by multiplexed next-generation sequencing of 186 hemostatic/pro-inflammatory genes

    PubMed Central

    2012-01-01

    Background Next-generation DNA sequencing is opening new avenues for genetic association studies in common diseases that, like deep vein thrombosis (DVT), have a strong genetic predisposition still largely unexplained by currently identified risk variants. In order to develop sequencing and analytical pipelines for the application of next-generation sequencing to complex diseases, we conducted a pilot study sequencing the coding area of 186 hemostatic/proinflammatory genes in 10 Italian cases of idiopathic DVT and 12 healthy controls. Results A molecular-barcoding strategy was used to multiplex DNA target capture and sequencing, while retaining individual sequence information. Genomic libraries with barcode sequence-tags were pooled (in pools of 8 or 16 samples) and enriched for target DNA sequences. Sequencing was performed on ABI SOLiD-4 platforms. We produced > 12 gigabases of raw sequence data to sequence at high coverage (average: 42X) the 700-kilobase target area in 22 individuals. A total of 1876 high-quality genetic variants were identified (1778 single nucleotide substitutions and 98 insertions/deletions). Annotation on databases of genetic variation and human disease mutations revealed several novel, potentially deleterious mutations. We tested 576 common variants in a case-control association analysis, carrying the top-5 associations over to replication in up to 719 DVT cases and 719 controls. We also conducted an analysis of the burden of nonsynonymous variants in coagulation factor and anticoagulant genes. We found an excess of rare missense mutations in anticoagulant genes in DVT cases compared to controls and an association for a missense polymorphism of FGA (rs6050; p = 1.9 × 10-5, OR 1.45; 95% CI, 1.22-1.72; after replication in > 1400 individuals). Conclusions We implemented a barcode-based strategy to efficiently multiplex sequencing of hundreds of candidate genes in several individuals. In the relatively small dataset of our pilot study we were

  18. Identification of Protective Epitopes by Sequencing of the Major Outer Membrane Protein Gene of a Variant Strain of Chlamydia psittaci Serotype 1 (Chlamydophila abortus)

    PubMed Central

    Vretou, Evangelia; Psarrou, Evgenia; Kaisar, Maria; Vlisidou, Isabella; Salti-Montesanto, Viviane; Longbottom, David

    2001-01-01

    Protective monoclonal antibodies (MAbs) to the major outer membrane protein (MOMP) of species of the family Chlamydiaceae, which is the primary vaccine candidate antigen, recognize nonlinear epitopes conferred by the oligomeric conformation of the molecule. Protective MAbs failed to recognize oligomeric MOMP of the variant strain LLG, which bears amino acid substitutions in variable segments (VSs) 1, 2, and 4, and competed with monomer-specific MAbs mapping to these VSs in reference strain 577. The results suggest that multiple sites located in the three VSs contribute to the epitope of protective MAbs. PMID:11119563

  19. Isolation and identification of host cues from mango, Mangifera indica, that attract gravid female oriental fruit fly, Bactrocera dorsalis.

    PubMed

    Jayanthi, Pagadala D Kamala; Woodcock, Christine M; Caulfield, John; Birkett, Michael A; Bruce, Toby J A

    2012-04-01

    The oriental fruit fly, Bactrocera dorsalis, is an economically damaging, polyphagous pest of fruit crops in South-East Asia and Hawaii, and a quarantine pest in other parts of the world. The objective of our study was to identify new attractants for B. dorsalis from overripe mango fruits. Headspace samples of volatiles were collected from two cultivars of mango, 'Alphonso' and 'Chausa', and a strong positive behavioral response was observed when female B. dorsalis were exposed to these volatiles in olfactometer bioassays. Coupled GC-EAG with female B. dorsalis revealed 7 compounds from 'Alphonso' headspace and 15 compounds from 'Chausa' headspace that elicited an EAG response. The EAG-active compounds, from 'Alphonso', were identified, using GC-MS, as heptane, myrcene, (Z)-ocimene, (E)-ocimene, allo-ocimene, (Z)-myroxide, and γ-octalactone, with the two ocimene isomers being the dominant compounds. The EAG-active compounds from 'Chausa' were 3-hydroxy-2-butanone, 3-methyl-1-butanol, ethyl butanoate, ethyl methacrylate, ethyl crotonate, ethyl tiglate, 1-octen-3-ol, ethyl hexanoate, 3-carene, p-cymene, ethyl sorbate, α-terpinolene, phenyl ethyl alcohol, ethyl octanoate, and benzothiazole. Individual compounds were significantly attractive when a standard dose (1 μg on filter paper) was tested in the olfactometer. Furthermore, synthetic blends with the same concentration and ratio of compounds as in the natural headspace samples were highly attractive (P < 0.001), and in a choice test, fruit flies did not show any preference for the natural samples over the synthetic blends. Results are discussed in relation to developing a lure for female B. dorsalis to bait traps with.

  20. Molecular and biochemical identification of inositol 1,3,4,5,6-pentakisphosphate 2-kinase encoding mRNA variants in castor bean (Ricinus communis L.) seeds.

    PubMed

    Yu, Jaeju; Saiardi, Adolfo; Greenwood, John S; Bewley, J Derek

    2014-05-01

    During seed development, phytic acid (PA) associated with mineral cations is stored as phytin and mobilized following germination in support of seedling growth. Two parallel biosynthetic pathways for PA have been proposed; yet the pathway is still poorly understood in terms of its regulation and the enzymes involved. Here, the castor bean (Ricinus communis L.) gene for inositol 1,3,4,5,6-pentakisphosphate 2-kinase (RcIPK1) has been identified. This encodes the enzyme implicated in catalyzing the final reaction in PA biosynthesis, and its expression is enhanced in isolated germinated embryos by application of phosphate and myo-inositol (Ins). Even though only one copy of the RcIPK1 gene is present in the genome, numerous RNA variants are present, most likely due to alternative splicing. These are translated into six closely related protein isoforms according to in silico analysis. Functional analyses using yeast ipk1Δ revealed that only three of the mRNA variants can rescue a temperature-sensitive growth phenotype of this strain. High-performance liquid chromatography (HPLC) analysis of the synthesized inositol phosphates demonstrated that the ability to complement the missing yeast IPK1 enzyme is associated with the production of enzyme activity. The three active isoforms possess unique conserved motifs important for IPK1 catalytic activity.

  1. Identification and characterization of a macrophage-tropic SIV envelope glycoprotein variant in blood from early infection in SIVmac251-infected macaques.

    PubMed

    Yen, Po-Jen; Mefford, Megan E; Hoxie, James A; Williams, Kenneth C; Desrosiers, Ronald C; Gabuzda, Dana

    2014-06-01

    Macrophages play an important role in HIV/SIV pathogenesis by serving as a reservoir for viral persistence in brain and other tissues. Infected macrophages have been detected in brain early after infection, but macrophage-tropic viruses are rarely isolated until late-stage infection. Little is known about early variants that establish persistent infection in brain. Here, we characterize a unique macrophage-tropic SIV envelope glycoprotein (Env) variant from two weeks post-infection in blood of an SIVmac251-infected macaque that is closely related to sequences in brain from animals with neurological disease. SIVmac251 clones expressing this Env are highly fusogenic, and replicate efficiently in T cells and macrophages. N173 and N481 were identified as novel determinants of macrophage tropism and neutralization sensitivity. These results imply that macrophage-tropic SIV capable of establishing viral reservoirs in brain can be present in blood during early infection. Furthermore, these SIVmac251 clones will be useful for studies on pathogenesis, eradication, and vaccines.

  2. Ultrasonographic imaging of papillary thyroid carcinoma variants

    PubMed Central

    2017-01-01

    Ultrasonography (US) is routinely used to evaluate thyroid nodules. The US features of papillary thyroid carcinoma (PTC), the most common thyroid malignancy, include hypoechogenicity, spiculated/microlobulated margins, microcalcifications, and a nonparallel orientation. However, many PTC variants have been identified, some of which differ from the classic type of PTC in terms of biological behavior and clinical outcomes. This review describes the US features and clinical implications of the variants of PTC. With the introduction of active surveillance replacing immediate biopsy or surgical treatment of indolent, small PTCs, an understanding of the US characteristics of PTC variants will facilitate the individualized management of patients with PTC. PMID:28222584

  3. Metallo-β-Lactamases in Clinical Pseudomonas Isolates in Taiwan and Identification of VIM-3, a Novel Variant of the VIM-2 Enzyme

    PubMed Central

    Yan, Jing-Jou; Hsueh, Po-Ren; Ko, Wen-Chien; Luh, Kwen-Tay; Tsai, Shu-Huei; Wu, Hsiu-Mei; Wu, Jiunn-Jong

    2001-01-01

    A total of 209 clinical isolates of Pseudomonas (193 Pseudomonas aeruginosa, 10 P. putida, 4 P. stutzeri, and 2 P. fluorescens isolates) with reduced susceptibilities to imipenem and/or ceftazidime were subjected to PCR assays with primers specific for blaIMP-1, blaIMP-2, blaVIM-1, and blaVIM-2 and sequence analysis to identify the metallo-β-lactamases (MBLs) prevalent among these organisms in Taiwan; and 21 isolates gave positive results. Five isolates including two P. putida and three P. stutzeri isolates were found to carry blaIMP-1, and six isolates including five P. putida and one P. stutzeri isolates harbored blaVIM-2. The remaining 10 isolates were P. aeruginosa, and all were found to carry a novel variant of blaVIM-2, designated blaVIM-3. There are only two nucleotide differences between blaVIM-2 and blaVIM-3, leading to two amino acid alterations. Our findings indicate that VIM-2 and its variant have become the most prevalent metalloenzymes in Pseudomonas in Taiwan. Southern hybridization with the blaVIM-2-, blaVIM-3-, and blaIMP-1 -specific probes revealed that only two VIM-2-producing P. putida isolates appeared to carry the MBL gene on plasmids. Pulsed-field gel electrophoresis showed that six VIM-3-producing P. aeruginosa isolates and two IMP-1-producing P. stutzeri isolates were genetically related, suggesting that the spread of these MBL genes in Taiwan could be due to clonal dissemination as well as genetic exchange between different clones. PMID:11451678

  4. Identification of a truncated splice variant of IL-18 receptor alpha in the human and rat, with evidence of wider evolutionary conservation

    PubMed Central

    Grattan, David R.

    2014-01-01

    Interleukin-18 (IL-18) is a pro-inflammatory cytokine which stimulates activation of the nuclear factor kappa beta (NF-κB) pathway via interaction with the IL-18 receptor. The receptor itself is formed from a dimer of two subunits, with the ligand-binding IL-18Rα subunit being encoded by the IL18R1 gene. A splice variant of murine IL18r1, which has been previously described, is formed by transcription of an unspliced intron (forming a ‘type II’ IL18r1 transcript) and is predicted to encode a receptor with a truncated intracellular domain lacking the capacity to generate downstream signalling. In order to examine the relevance of this finding to human IL-18 function, we assessed the presence of a homologous transcript by reverse transcription-polymerase chain reaction (RT-PCR) in the human and rat as another common laboratory animal. We present evidence for type II IL18R1 transcripts in both species. While the mouse and rat transcripts are predicted to encode a truncated receptor with a novel 5 amino acid C-terminal domain, the human sequence is predicted to encode a truncated protein with a novel 22 amino acid sequence bearing resemblance to the ‘Box 1’ motif of the Toll/interleukin-1 receptor (TIR) domain, in a similar fashion to the inhibitory interleukin-1 receptor 2. Given that transcripts from these three species are all formed by inclusion of homologous unspliced intronic regions, an analysis of homologous introns across a wider array of 33 species with available IL18R1 gene records was performed, which suggests similar transcripts may encode truncated type II IL-18Rα subunits in other species. This splice variant may represent a conserved evolutionary mechanism for regulating IL-18 activity. PMID:25250214

  5. Characterization of high-molecular-weight glutenin subunits from Eremopyrum bonaepartis and identification of a novel variant with unusual high molecular weight and altered cysteine residues.

    PubMed

    Jiang, Qian-Tao; Zhang, Xiao-Wei; Ma, Jian; Wei, Long; Zhao, Shan; Zhao, Quan-Zhi; Qi, Peng-Fei; Lu, Zhen-Xiang; Zheng, You-Liang; Wei, Yu-Ming

    2014-04-01

    We characterized two high-molecular-weight glutenin subunit (HMW-GS) variants from Eremopyrum bonaepartis, determined their complete open reading frames, and further expressed them in a bacterial system. The variants have many novel structural features compared with typical subunits encoded by Glu-1 loci: 1Fx3.7 and 1Fy1.5 exhibit hybrid properties of x- and y-type subunits. In addition, unusual molecular mass and altered number and distribution of cysteine residues were unique features of HMW-GSs encoded by Glu-F1 from E. bonaepartis. The mature 1Fx3.7 subunit has a full length of 1,223 amino acid residues, making it the largest subunit found thus far, while 1Fy1.5 is just 496 residues. In addition, the mutated PGQQ repeat motif was found in the repetitive region of 1Fx3.7. Although it has a similar molecular mass to that previously reported for 1Dx2.2, 1Dx2.2* and 1S(sh)x2.9 subunits, 1Fx3.7 appears to have had a different evolutionary history. The N-terminal and repetitive regions have a total of four additional cysteine residues, giving 1Fx3.7 a total of eight cysteines, while 1Fy1.5 has only six cysteines because the GHCPTSPQQ nonapeptide at the end of the repetitive region is deleted. With its extra cysteine residues and the longest repetitive region, features that are relevant to good wheat quality, the 1Fx3.7 subunit gene could be an excellent candidate for applications in wheat quality improvement.

  6. Isolation of a hop-sensitive variant of Lactobacillus lindneri and identification of genetic markers for beer spoilage ability of lactic acid bacteria.

    PubMed

    Suzuki, Koji; Iijima, Kazumaru; Ozaki, Kazutaka; Yamashita, Hiroshi

    2005-09-01

    We have isolated a hop-sensitive variant of the beer spoilage bacterium Lactobacillus lindneri DSM 20692. The variant lost a plasmid carrying two contiguous open reading frames (ORF s) designated horB(L) and horC(L) that encode a putative regulator and multidrug transporter presumably belonging to the resistance-nodulation-cell division superfamily. The loss of hop resistance ability occurred with the loss of resistance to other drugs, including ethidium bromide, novobiocin, and cetyltrimethylammonium bromide. PCR and Southern blot analysis using 51 beer spoilage strains of various species of lactic acid bacteria (LAB) revealed that 49 strains possessed homologs of horB and horC. No false-positive results have been observed for nonspoilage LAB or frequently encountered brewery isolates. These features are superior to those of horA and ORF 5, previously reported genetic markers for determining the beer spoilage ability of LAB. It was further shown that the combined use of horB/horC and horA is able to detect all 51 beer spoilage strains examined in this study. Furthermore sequence comparison of horB and horC homologs identified in four different beer spoilage species indicates these homologs are 96.6 to 99.5% identical, which is not typical of distinct species. The wide and exclusive distribution of horB and horC homologs among beer spoilage LAB and their sequence identities suggest that the hop resistance ability of beer spoilage LAB has been acquired through horizontal gene transfer. These insights provide a foundation for applying trans-species genetic markers to differentiating beer spoilage LAB including previously unencountered species.

  7. Isolation of a Hop-Sensitive Variant of Lactobacillus lindneri and Identification of Genetic Markers for Beer Spoilage Ability of Lactic Acid Bacteria

    PubMed Central

    Suzuki, Koji; Iijima, Kazumaru; Ozaki, Kazutaka; Yamashita, Hiroshi

    2005-01-01

    We have isolated a hop-sensitive variant of the beer spoilage bacterium Lactobacillus lindneri DSM 20692. The variant lost a plasmid carrying two contiguous open reading frames (ORF s) designated horBL and horCL that encode a putative regulator and multidrug transporter presumably belonging to the resistance-nodulation-cell division superfamily. The loss of hop resistance ability occurred with the loss of resistance to other drugs, including ethidium bromide, novobiocin, and cetyltrimethylammonium bromide. PCR and Southern blot analysis using 51 beer spoilage strains of various species of lactic acid bacteria (LAB) revealed that 49 strains possessed homologs of horB and horC. No false-positive results have been observed for nonspoilage LAB or frequently encountered brewery isolates. These features are superior to those of horA and ORF 5, previously reported genetic markers for determining the beer spoilage ability of LAB. It was further shown that the combined use of horB/horC and horA is able to detect all 51 beer spoilage strains examined in this study. Furthermore sequence comparison of horB and horC homologs identified in four different beer spoilage species indicates these homologs are 96.6 to 99.5% identical, which is not typical of distinct species. The wide and exclusive distribution of horB and horC homologs among beer spoilage LAB and their sequence identities suggest that the hop resistance ability of beer spoilage LAB has been acquired through horizontal gene transfer. These insights provide a foundation for applying trans-species genetic markers to differentiating beer spoilage LAB including previously unencountered species. PMID:16151091

  8. Prevalence and genetic diversity of arginine catabolic mobile element (ACME) in clinical isolates of coagulase-negative staphylococci: identification of ACME type I variants in Staphylococcus epidermidis.

    PubMed

    Onishi, Mayumi; Urushibara, Noriko; Kawaguchiya, Mitsuyo; Ghosh, Souvik; Shinagawa, Masaaki; Watanabe, Naoki; Kobayashi, Nobumichi

    2013-12-01

    Arginine catabolic mobile element (ACME), a genomic island consisting of the arc and/or opp3 gene clusters found in staphylococcal species, is related to increased bacterial adaptability to hosts. Staphylococcus epidermidis is considered a major ACME reservoir; however, prevalence and genetic diversity of ACME in coagulase-negative staphylococci (CNS) have not yet been well characterized for clinical isolates in Japan. A total of 271 clinical isolates of CNS in a Japanese hospital were investigated for the presence and genotype of ACME and SCCmec. The prevalence of ACME-arcA was significantly higher (p<0.001) in S. epidermidis (45.8%) than in other CNS species (3.7%). ACME in S. epidermidis isolates (n=87) were differentiated into type I (n=33), variant forms of type I (ΔI, n=26) newly identified in this study, type II (n=6), and type ΔII (n=19). ACME-type ΔI, which were further classified into three subtypes, lacked some genetic components between the arc and opp3 clusters in archetypal type I, whereas the arc and opp3 clusters were intact. The arc cluster exhibited high sequence identity (95.8-100%) to that of type I ACME; in contrast, the opp3 cluster was highly diverse, and showed relatively lower identities (94.8-98.7%) to the identical regions in type I ACME. Twenty-one isolates of ΔI ACME-carrying S. epidermidis possessed SCCmec IVa and belonged to ST5 (clonal complex 2). Phylogenetic analysis revealed that isolates harboring ACME ΔI in this study clustered with previously reported S. epidermidis strains with other lineges, suggesting that S. epidermidis originally had some genetic variations in the opp3 cluster. In summary, ACME type ΔI, a truncated variant of ACME-I, was first identified in S. epidermidis, and revealed to be prevalent in ST5 MRSE clinical isolates with SCCmec IVa.

  9. Use of heteroduplex mobility assays (HMA) for pre-sequencing screening and identification of variant strains of swine and avian hepatitis E viruses.

    PubMed

    Sun, Z F; Huang, F F; Halbur, P G; Schommer, S K; Pierson, F W; Toth, T E; Meng, X J

    2003-10-17

    Hepatitis E virus (HEV), the causative agent of human hepatitis E, is an important public health problem in many developing countries and is also endemic in many industrialized countries including the US. The discoveries of avian and swine HEVs by our group from chickens and pigs, respectively, suggest that hepatitis E may be a zoonosis. Current methods for molecular epidemiological studies of HEV require PCR amplification of field strains of HEV followed by DNA sequencing and sequence analyses, which are laborious and expensive. As novel or variant strains of HEV continue to evolve rapidly both in humans and other animals, it is important to develop a rapid pre-sequencing screening method to select field isolates for further molecular characterization. In this study, we developed two heteroduplex mobility assays (HMA) (one for swine HEV based on the ORF2 region, and the other for avian HEV based on the ORF1 region) to genetically differentiate field strains of avian and swine HEVs from known reference strains. The ORF2 regions of 22 swine HEV isolates and the ORF1 regions of 13 avian HEV isolates were amplified by PCR, sequenced and analyzed by HMA against reference prototype swine HEV strain and reference prototype avian HEV strain, respectively. We showed that, in general, the HMA profiles correlate well with nucleotide sequence identities and with phylogenetic clustering between field strains and the reference swine HEV or avian HEV strains. Field isolates with similar HMA patterns generally showed similar sequence identities with the reference strains and clustered together in the phylogenetic trees. Therefore, by using different HEV isolates as references, the HMA developed in this study can be used as a pre-sequencing screening tool to identify variant HEV isolates for further molecular epidemiological studies.

  10. Functional Genomic mRNA Profiling of Colorectal Adenomas: Identification and in vivo Validation of CD44 and Splice Variant CD44v6 as Molecular Imaging Targets.

    PubMed

    Hartmans, Elmire; Orian-Rousseau, Veronique; Matzke-Ogi, Alexandra; Karrenbeld, Arend; de Groot, Derk Jan A; de Jong, Steven; van Dam, Gooitzen M; Fehrmann, Rudolf S N; Nagengast, Wouter B

    2017-01-01

    Colorectal cancer (CRC) is the third leading cause of cancer-related deaths worldwide. High adenoma miss rates, especially seen in high-risk patients, demand for better endoscopic detection. By fluorescently 'highlighting' specific molecular characteristics, endoscopic molecular imaging has great potential to fulfill this need. To implement this technique effectively, target proteins that distinguish adenomas from normal tissue must be identified. In this study we applied in silico Functional Genomic mRNA (FGmRNA) profiling, which is a recently developed method that results in an enhanced view on the downstream effects of genomic alterations occurring in adenomas on gene expression levels. FGmRNA profiles of sporadic adenomas were compared to normal colon tissue to identify overexpressed genes. We validated the protein expression of the top identified genes, AXIN2, CEMIP, CD44 and JUN, in sporadic adenoma patient samples via immunohistochemistry (IHC). CD44 was identified as the most attractive target protein for imaging purposes and we proved its relevance in high-risk patients by demonstrating CD44 protein overexpression in Lynch lesions. Subsequently, we show that the epithelial splice variant CD44V6 is highly overexpressed in our patient samples and we demonstrated the feasibility of visualizing adenomas in Apc(Min/+) mice in vivo by using a fluorescently labeled CD44v6 targeting peptide. In conclusion, via in silico functional genomics and ex vivo protein validation, this study identified CD44 as an attractive molecular target for both sporadic and high-risk Lynch adenomas, and demonstrates the in vivo applicability of a small peptide drug directed against splice variant CD44v6 for adenoma imaging.

  11. Identification of a regulatory variant that binds FOXA1 and FOXA2 at the CDC123/CAMK1D type 2 diabetes GWAS locus.

    PubMed

    Fogarty, Marie P; Cannon, Maren E; Vadlamudi, Swarooparani; Gaulton, Kyle J; Mohlke, Karen L

    2014-09-01

    Many of the type 2 diabetes loci identified through genome-wide association studies localize to non-protein-coding intronic and intergenic regions and likely contain variants that regulate gene transcription. The CDC123/CAMK1D type 2 diabetes association signal on chromosome 10 spans an intergenic region between CDC123 and CAMK1D and also overlaps the CDC123 3'UTR. To gain insight into the molecular mechanisms underlying the association signal, we used open chromatin, histone modifications and transcription factor ChIP-seq data sets from type 2 diabetes-relevant cell types to identify SNPs overlapping predicted regulatory regions. Two regions containing type 2 diabetes-associated variants were tested for enhancer activity using luciferase reporter assays. One SNP, rs11257655, displayed allelic differences in transcriptional enhancer activity in 832/13 and MIN6 insulinoma cells as well as in human HepG2 hepatocellular carcinoma cells. The rs11257655 risk allele T showed greater transcriptional activity than the non-risk allele C in all cell types tested. Using electromobility shift and supershift assays we demonstrated that the rs11257655 risk allele showed allele-specific binding to FOXA1 and FOXA2. We validated FOXA1 and FOXA2 enrichment at the rs11257655 risk allele using allele-specific ChIP in human islets. These results suggest that rs11257655 affects transcriptional activity through altered binding of a protein complex that includes FOXA1 and FOXA2, providing a potential molecular mechanism at this GWAS locus.

  12. Functional Genomic mRNA Profiling of Colorectal Adenomas: Identification and in vivo Validation of CD44 and Splice Variant CD44v6 as Molecular Imaging Targets

    PubMed Central

    Hartmans, Elmire; Orian-Rousseau, Veronique; Matzke-Ogi, Alexandra; Karrenbeld, Arend; de Groot, Derk Jan A.; de Jong, Steven; van Dam, Gooitzen M.; Fehrmann, Rudolf S.N.; Nagengast, Wouter B.

    2017-01-01

    Colorectal cancer (CRC) is the third leading cause of cancer-related deaths worldwide. High adenoma miss rates, especially seen in high-risk patients, demand for better endoscopic detection. By fluorescently 'highlighting' specific molecular characteristics, endoscopic molecular imaging has great potential to fulfill this need. To implement this technique effectively, target proteins that distinguish adenomas from normal tissue must be identified. In this study we applied in silico Functional Genomic mRNA (FGmRNA) profiling, which is a recently developed method that results in an enhanced view on the downstream effects of genomic alterations occurring in adenomas on gene expression levels. FGmRNA profiles of sporadic adenomas were compared to normal colon tissue to identify overexpressed genes. We validated the protein expression of the top identified genes, AXIN2, CEMIP, CD44 and JUN, in sporadic adenoma patient samples via immunohistochemistry (IHC). CD44 was identified as the most attractive target protein for imaging purposes and we proved its relevance in high-risk patients by demonstrating CD44 protein overexpression in Lynch lesions. Subsequently, we show that the epithelial splice variant CD44V6 is highly overexpressed in our patient samples and we demonstrated the feasibility of visualizing adenomas in ApcMin/+ mice in vivo by using a fluorescently labeled CD44v6 targeting peptide. In conclusion, via in silico functional genomics and ex vivo protein validation, this study identified CD44 as an attractive molecular target for both sporadic and high-risk Lynch adenomas, and demonstrates the in vivo applicability of a small peptide drug directed against splice variant CD44v6 for adenoma imaging. PMID:28255344

  13. Identification of Theileria parva and Theileria sp. (buffalo) 18S rRNA gene sequence variants in the African Buffalo (Syncerus caffer) in southern Africa.

    PubMed

    Chaisi, Mamohale E; Sibeko, Kgomotso P; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2011-12-15

    distinction between Theileria sp. (buffalo) and T. parva and indicate the existence of a single group of T. parva and two Theileria sp. (buffalo) 18S rRNA gene variants in the African buffalo. Despite the observed variation in the full-length parasite 18S rRNA gene sequences, the area in the V4 hypervariable region where the RLB and real-time PCR hybridization probes were developed was relatively conserved. The T. parva specific real-time PCR assay was able to successfully detect all T. parva variants and, although amplicons were obtained from Theileria sp. (buffalo) DNA, none of the Theileria sp. (buffalo) 18S rRNA sequence variants were detected by the T. parva-specific hybridization probes.

  14. Molecular characterization and tissue distribution of aryl hydrocarbon receptor nuclear translocator isoforms, ARNT1 and ARNT2, and identification of novel splice variants in common cormorant (Phalacrocorax carbo).

    PubMed

    Lee, Jin-Seon; Kim, Eun-Young; Iwata, Hisato; Tanabe, Shinsuke

    2007-04-01

    High levels of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related planar halogenated aromatic hydrocarbons (PHAHs) are accumulated in fish-eating birds including common cormorant (Phalacrocorax carbo). Most of the biochemical and toxic effects of TCDD are mediated by a basic helix-loop-helix and a conserved region among Per, ARNT, and Sim (bHLH/PAS) proteins, aryl hydrocarbon receptor (AHR) and AHR nuclear translocator (ARNT). To study the molecular mechanism of TCDD toxicity in common cormorant as an avian model species, characterization of the AHR/ARNT signaling pathway in this species is necessary. The present study focuses on molecular characterization of ARNT from common cormorant (ccARNT). The cDNA of the ccARNT isoform, ccARNT1 obtained by the screening of hepatic cDNA library contains a 2424-bp open reading frame that encodes 807 amino acids, exhibiting high identities (92%) with chicken ARNT. This isoform contains a unique 22 amino acid residue in 3' end of PAS A domain as is also recognized in chicken ARNT. The ccARNT2 cDNA isolated from brain tissue has a 2151-bp open reading frame. The deduced amino acid sequence of ccARNT2 protein (716 aa) shows a conservation of bHLH and PAS motif in its N-terminal region with high similarities (96% and 78%, respectively) to that of ccARNT1. Using quantitative RT-PCR methods, the tissue distribution profiles of ccARNT1 and ccARNT2 were unveiled. Both ccARNT1 and ccARNT2 mRNAs were ubiquitously expressed in all examined tissues including liver. The expression profile of ccARNT1 was comparable with that of rodent ARNT1, but ccARNT2 was not with rodent ARNT2, implying different roles of ARNT2 between the two species. There was a significant positive correlation between ARNT1 and ARNT2 mRNA expression levels in the liver of wild cormorant population, indicating that their expressions may be enforced by similar transcriptional regulation mechanism. Novel variants of ccARNT1 and ccARNT2 isoforms that were supposed to

  15. Variant CJD

    PubMed Central

    Diack, Abigail B; Head, Mark W; McCutcheon, Sandra; Boyle, Aileen; Knight, Richard; Ironside, James W; Manson, Jean C; Will, Robert G

    2014-01-01

    It is now 18 years since the first identification of a case of vCJD in the UK. Since that time, there has been much speculation over how vCJD might impact human health. To date there have been 177 case reports in the UK and a further 51 cases worldwide in 11 different countries. Since establishing that BSE and vCJD are of the same strain of agent, we have also shown that there is broad similarity between UK and non-UK vCJD cases on first passage to mice. Transgenic mouse studies have indicated that all codon 129 genotypes are susceptible to vCJD and that genotype may influence whether disease appears in a clinical or asymptomatic form, supported by the appearance of the first case of potential asymptomatic vCJD infection in a PRNP 129MV patient. Following evidence of blood transfusion as a route of transmission, we have ascertained that all blood components and leucoreduced blood in a sheep model of vCJD have the ability to transmit disease. Importantly, we recently established that a PRNP 129MV patient blood recipient with an asymptomatic infection and limited PrPSc deposition in the spleen could readily transmit disease into mice, demonstrating the potential for peripheral infection in the absence of clinical disease. This, along with the recent appendix survey which identified 16 positive appendices in a study of 32 441 cases, underlines the importance of continued CJD surveillance and maintaining control measures already in place to protect human health. PMID:25495404

  16. Identification of a Novel Rat NR2B Subunit Gene Promoter Region Variant and Its Association with Microwave-Induced Neuron Impairment.

    PubMed

    Wang, Li-Feng; Tian, Da-Wei; Li, Hai-Juan; Gao, Ya-Bing; Wang, Chang-Zhen; Zhao, Li; Zuo, Hong-Yan; Dong, Ji; Qiao, Si-Mo; Zou, Yong; Xiong, Lu; Zhou, Hong-Mei; Yang, Yue-Feng; Peng, Rui-Yun; Hu, Xiang-Jun

    2016-05-01

    Microwave radiation has been implicated in cognitive dysfunction and neuronal injury in animal models and in human investigations; however, the mechanism of these effects is unclear. In this study, single nucleotide polymorphism (SNP) sites in the rat GRIN2B promoter region were screened. The associations of these SNPs with microwave-induced rat brain dysfunction and with rat pheochromocytoma-12 (PC12) cell function were investigated. Wistar rats (n = 160) were exposed to microwave radiation (30 mW/cm(2) for 5 min/day, 5 days/week, over a period of 2 months). Screening of the GRIN2B promoter region revealed a stable C-to-T variant at nucleotide position -217 that was not induced by microwave exposure. The learning and memory ability, amino acid contents in the hippocampus and cerebrospinal fluid, and NR2B expression were then investigated in the different genotypes. Following microwave exposure, NR2B protein expression decreased, while the Glu contents in the hippocampus and CSF increased, and memory impairment was observed in the TT genotype but not the CC and CT genotypes. In PC12 cells, the effects of the T allele were more pronounced than those of the C allele on transcription factor binding ability, transcriptional activity, NR2B mRNA, and protein expression. These effects may be related to the detrimental role of the T allele and the protective role of the C allele in rat brain function and PC12 cells exposed to microwave radiation.

  17. Identification of a Nuclear Respiratory Factor 1 Recognition Motif in the Apolipoprotein E Variant APOE4 linked to Alzheimer’s Disease

    PubMed Central

    Urfer-Buchwalder, Anne; Urfer, Roman

    2017-01-01

    Alzheimer’s disease affects tens of millions of people worldwide and its prevalence continues to rise. It is caused by a combination of a subject’s heredity, environment, lifestyle, and medical condition. The most significant genetic risk factor for late onset Alzheimer’s disease is a variant of the apolipoprotein E gene, APOE4. Here we show that the single nucleotide polymorphism rs429358 that defines APOE4 is located in a short sequence motif repeated several times within exon 4 of apolipoprotein E, reminiscent of the structure of transcriptional enhancers. A JASPAR database search predicts that the T to C transition in rs429358 generates a binding motif for nuclear respiratory factor NRF1. This site appears to be part of a binding site cluster for this transcription factor on exon 4 of APOE. This de novo NRF1 binding site has therefore the potential to affect the expression of multiple genes in its genomic vicinity. Our in silico analysis, suggesting a novel function for APOE4 at the DNA level, offers a potential mechanism for the observed tissue specific neurodegeneration and the role of environmental factors in Alzheimer’s disease etiology. PMID:28094792

  18. Identification of proliferation-induced genes in Arabidopsis thaliana. Characterization of a new member of the highly evolutionarily conserved histone H2A.F/Z variant subfamily.

    PubMed Central

    Callard, D; Mazzolini, L

    1997-01-01

    The changes in gene expression associated with the reinitiation of cell division and subsequent progression through the cell cycle in Arabidopsis thaliana cell-suspension cultures were investigated. Partial synchronization of cells was achieved by a technique combining phosphate starvation and a transient treatment with the DNA replication inhibitor aphidicolin. Six cDNAs corresponding to genes highly induced in proliferating cells and showing cell-cycle-regulated expression were obtained by the mRNA differential display technique. Full-length cDNA clones (cH2BAt and cH2AvAt) corresponding to two of the display products were subsequently isolated. The cH2BAt clone codes for a novel histone H2B protein, whereas the cH2AvAt cDNA corresponds to a gene encoding a new member of the highly conserved histone H2A.F/Z subfamily of chromosomal proteins. Further studies indicated that H2AvAt mRNA expression is tightly correlated with cell proliferation in cell-suspension cultures, and that closely related analogs of the encoded protein exist in Arabidopsis. The implications of the conservation of histone H2A.F/Z variants in plants are discussed. PMID:9414552

  19. Transcriptomics and Identification of the Chemoreceptor Superfamily of the Pupal Parasitoid of the Oriental Fruit Fly, Spalangia endius Walker (Hymenoptera: Pteromalidae)

    PubMed Central

    Zhang, Yuping; Zheng, Yuan; Li, Dunsong; Fan, Yilin

    2014-01-01

    Background The oriental fruit fly, Bactrocera dorsalis Hendel, causes serious losses to fruit production and is one of the most economically important pests in many countries, including China, Spalangia endius Walker is a pupal parasitoid of various dipteran hosts, and may be considered a potentially important ectoparasitic pupal parasitoid of B. dorsalis. However, lack of genetic information on this organism is an obstacle to understanding the mechanisms behind its interaction with this host. Analysis of the S. endius transcriptome is essential to extend the resources of genetic information on this species and, to support studies on S. endius on the host B. dorsalis. Methodology/Principal Findings We performed de novo assembly RNA-seq of S. endius. We obtained nearly 10 Gbp of data using a HiSeq platform, and 36319 high-quality transcripts using Trinity software. A total of 22443 (61.79%) unigenes were aligned to homologous sequences in the jewel wasp and honeybee (Apis florae) protein set from public databases. A total of 10037 protein domains were identified in 7892 S. endius transcripts using HMMER3 software. We identified expression of six gustatory receptor and 21 odorant receptor genes in the sample, with only one gene having a high expression level in each family. The other genes had a low expression level, including two genes regulated by splicing. This result may be due to the wasps being kept under laboratory conditions. Additionally, a total of 3727 SSR markers were predicted, which could facilitate the identification of polymorphisms and functional genes within wasp populations. Conclusion/Significance This transcriptome greatly improves our genetic understanding of S. endius and provides a large number of gene sequences for further study. PMID:24505315

  20. Identification and comparative analysis of the oriental river prawn (Macrobrachium nipponense) microRNA expression profile during hypoxia using a deep sequencing approach.

    PubMed

    Sun, Shengming; Fu, Hongtuo; Ge, Xianping; Zhu, Jian; Gu, Zhimin; Xuan, Fujun

    2016-03-01

    Hypoxia refers to a state of oxygen deficiency, which is observed frequently in aquaculture ponds. MicroRNAs (miRNAs) are small non-coding RNAs that are important effectors in regulating gene expression through posttranscriptional mechanisms. They are key elements in the response to hypoxia. The oriental river prawn (Macrobrachium nipponense) is an important commercial aquaculture species, and is sensitive to hypoxia. To date, there are no reports describing M. nipponense miRNAs. In this study, Solexa deep sequencing technology was used for high-throughput analysis of miRNAs in a small RNA library isolated from four M. nipponense tissues (gill, hepatopancreas, muscle and hemocytes). In total, 9,227,356 reads were obtained, 4,293,155 of which were related to 267 unique miRNAs, including 203 conserved and 64 prawn-specific miRNAs. Furthermore, miRNA features including length distribution and end variations were characterized. Annotation of targets revealed a broad range of biological processes and signal transduction pathways regulated by M. nipponense miRNAs. In addition, 880 co-expressed and 39 specific (25 normoxia-specific and 14 hypoxia-specific) miRNAs that may be involved in the response to hypoxia were confirmed using miRNA microarray analysis from the four prawn tissues combined. Real-time quantitative PCR (qPCR) analysis of eight miRNAs in the normoxia and hypoxia groups showed good concordance between the sequencing and qPCR data. This study provides the first large-scale identification and characterization of M. nipponense miRNAs and their potential targets, and represents a foundation for further characterization of their roles in the regulation of the diversity of hypoxia processes.

  1. Cost-Effective and Rapid Presumptive Identification of Gram-Negative Bacilli in Routine Urine, Pus, and Stool Cultures: Evaluation of the Use of CHROMagar Orientation Medium in Conjunction with Simple Biochemical Tests

    PubMed Central

    Ohkusu, Kiyofumi

    2000-01-01

    The algorithm for a new identification system was designed on the basis of colony color and morphology on CHROMagar Orientation medium in conjunction with simple biochemical tests such as indole (IND), lysine decarboxylase (LDC), and ornithine decarboxylase (ODC) utilization tests with gram-negative bacilli isolated from urine samples as well as pus, stool, and other clinical specimens by the following colony characteristics, biochemical reactions, and serological results: pinkish to red, IND positive (IND+), Escherichia coli; metallic blue, IND+, LDC+, and ODC negative (ODC−), Klebsiella oxytoca; IND+, LDC−, and ODC+, Citrobacter diversus; IND+ or IND−, LDC−, and ODC−, Citrobacter freundii; IND−, LDC+, and ODC+, Enterobacter aerogenes; IND−, LDC−, and ODC+, Enterobacter cloacae; IND−, LDC+, and ODC−, Klebsiella pneumoniae; diffuse brown and IND+, Morganella morganii; IND−, Proteus mirabilis; aqua blue, Serratia marcescens; bluish green and IND+, Proteus vulgaris; transparent yellow-green, serology positive, Pseudomonas aeruginosa; clear and serology positive, Salmonella sp.; other colors and reactions, the organism was identified by the full identification methods. The accuracy and cost-effectiveness of this new system were prospectively evaluated. During an 8-month period, a total of 345 specimens yielded one or more gram-negative bacilli. A total of 472 gram-negative bacillus isolates were detected on CHROMagar Orientation medium. For 466 of the isolates (98.7%), no discrepancies in the results were obtained on the basis of the identification algorithm. The cost of identification of gram-negative bacilli during this period was reduced by about 70%. The results of this trial for the differentiation of the most commonly encountered gram-negative pathogens in clinical specimens with the new algorithm were favourable in that it permitted reliable detection and presumptive identification. In addition, this rapid identification system not only

  2. Cost-effective and rapid presumptive identification of gram-negative bacilli in routine urine, pus, and stool cultures: evaluation of the use of CHROMagar orientation medium in conjunction with simple biochemical tests.

    PubMed

    Ohkusu, K

    2000-12-01

    The algorithm for a new identification system was designed on the basis of colony color and morphology on CHROMagar Orientation medium in conjunction with simple biochemical tests such as indole (IND), lysine decarboxylase (LDC), and ornithine decarboxylase (ODC) utilization tests with gram-negative bacilli isolated from urine samples as well as pus, stool, and other clinical specimens by the following colony characteristics, biochemical reactions, and serological results: pinkish to red, IND positive (IND(+)), Escherichia coli; metallic blue, IND(+), LDC(+), and ODC negative (ODC(-)), Klebsiella oxytoca; IND(+), LDC(-), and ODC(+), Citrobacter diversus; IND(+) or IND(-), LDC(-), and ODC(-), Citrobacter freundii; IND(-), LDC(+), and ODC(+), Enterobacter aerogenes; IND(-), LDC(-), and ODC(+), Enterobacter cloacae; IND(-), LDC(+), and ODC(-), Klebsiella pneumoniae; diffuse brown and IND(+), Morganella morganii; IND(-), Proteus mirabilis; aqua blue, Serratia marcescens; bluish green and IND(+), Proteus vulgaris; transparent yellow-green, serology positive, Pseudomonas aeruginosa; clear and serology positive, Salmonella sp.; other colors and reactions, the organism was identified by the full identification methods. The accuracy and cost-effectiveness of this new system were prospectively evaluated. During an 8-month period, a total of 345 specimens yielded one or more gram-negative bacilli. A total of 472 gram-negative bacillus isolates were detected on CHROMagar Orientation medium. For 466 of the isolates (98.7%), no discrepancies in the results were obtained on the basis of the identification algorithm. The cost of identification of gram-negative bacilli during this period was reduced by about 70%. The results of this trial for the differentiation of the most commonly encountered gram-negative pathogens in clinical specimens with the new algorithm were favourable in that it permitted reliable detection and presumptive identification. In addition, this rapid

  3. Identification of Alternative Variants and Insertion of the Novel Polymorphic AluYl17 in TSEN54 Gene during Primate Evolution

    PubMed Central

    Kim, Young-Hyun; Choe, Se-Hee; Cho, Hyeon-Mu; Lee, Sang-Rae; Kim, Ji-Su; Song, Bong-Seok; Jeong, Kang-Jin; Jin, Yeung Bae; Kang, Philyong

    2016-01-01

    TSEN54 encodes a subunit of the tRNA-splicing endonuclease complex, which catalyzes the identification and cleavage of introns from precursor tRNAs. Previously, we identified an AluSx-derived alternative transcript in TSEN54 of cynomolgus monkey. Reverse transcription-polymerase chain reaction (RT-PCR) amplification and TSEN54 sequence analysis of primate and human samples identified five novel alternative transcripts, including the AluSx exonized transcript. Additionally, we performed comparative expression analysis via RT-qPCR in various cynomolgus, rhesus monkey, and human tissues. RT-qPCR amplification revealed differential expression patterns. Furthermore, genomic PCR amplification and sequencing of primate and human DNA samples revealed that AluSx elements were integrated in human and all of the primate samples tested. Intriguingly, in langur genomic DNA, an additional AluY element was inserted into AluSx of intron eight of TSEN54. The new AluY element showed polymorphic insertion. Using standardized nomenclature for Alu repeats, the polymorphic AluY of the langur TSEN54 was designated as being of the AluYl17 subfamily. Our results suggest that integration of the AluSx element in TSEN54 contributed to diversity in transcripts and induced lineage- or species-specific evolutionary events such as alternative splicing and polymorphic insertion during primate evolution. PMID:28083540

  4. Database for Parkinson Disease Mutations and Rare Variants

    DTIC Science & Technology

    2015-07-01

    due to time or knowledge restrained to sift through scattered information. Current databases do not address actual contribution of variant to PD...variant discovery , the Parkinson Disease project focuses on identification of rare variants and their differential accumulation within a gene region...During her three year fellowship in Miami, she has extended her knowledge and acquired vast experience working with next generation sequencing

  5. Detection of 5α-androst-2-en-17-one and variants: Identification of main urinary metabolites in human urine samples by GC-MS and NMR.

    PubMed

    Ayotte, Christiane; Sylvestre, Alexandre; Charlebois, Alain; Poirier, Donald

    2016-11-01

    Two steroids were identified in a supplement named D-2 following the detection of unknown compounds during the routine testing of an athlete's sample. The main glucuroconjugated metabolites were isolated from this urine by high performance liquid chromatography (HPLC) following enzymatic hydrolysis and identified by gas chromatography-mass spectrometry (GC-MS) and nuclear magnetic resonance (NMR) analyses as being 2α-hydroxy-5α-androst-3-en-17-one (M1) and 2β,3α-dihydroxy-5α-androstan-17-one (M2). A third metabolite, 3α,4β-dihydroxy-5α-androstan-17-one (M3) was also detected, however in lower amounts. The precursor steroids, 5α-androst-2-en-17-one (1) and 5α-androst-3-en-17-one (2) were present in the first D-2 products offered on the Internet. Later, the corresponding 17-hydroxyl compounds were offered as such or as esters (acetate, cypionate) in different relative ratios. Both M2 and M3 were synthesized from the trans-diaxial hydrolysis of the corresponding 2α,3α- and 3α,4α-epoxides (3). These were excreted in the hours following the controlled administration of the commercial product called D-2 R to a male volunteer and were also produced from the incubation of 1 and 2 with S9 liver fractions. Some preparations contain predominantly the alkene in C-2 and, therefore, an efficient detection method must include both primary metabolites M1 and M2. The latter was found equally in the fractions extracted following the enzymatic hydrolysis with β-glucuronidase and the chemical solvolysis, which may ease its identification. Copyright © 2016 John Wiley & Sons, Ltd.

  6. A rare hemoglobin variant, Hb Belliard

    PubMed Central

    Benavides, Raul

    2017-01-01

    There are many documented variants of hemoglobin; however, other than a limited number (such as sickle cell disease), very few are known to have any clinical significance. As advances in detection and identification continue through gel electrophoresis, capillary electrophoresis, and DNA sequencing, more rare variants are identified. Without case reporting, the significance of these variants will remain unknown or continue to be thought of as insignificant. Here we report a rare hemoglobin variant, Hb Belliard, which was detected in a 68-year-old Indian immigrant to the United States. He presented with elevated hemoglobin and was found to have a unique peak on capillary electrophoresis. The specimen was sent for sequencing and was subsequently found to have Hb Belliard. Currently, Hb Belliard is thought to be insignificant.

  7. Identification of membrane-bound variant of metalloendopeptidase neurolysin (EC 3.4.24.16) as the non-angiotensin type 1 (non-AT1), non-AT2 angiotensin binding site.

    PubMed

    Wangler, Naomi J; Santos, Kira L; Schadock, Ines; Hagen, Fred K; Escher, Emanuel; Bader, Michael; Speth, Robert C; Karamyan, Vardan T

    2012-01-02

    Recently, we discovered a novel non-angiotensin type 1 (non-AT1), non-AT2 angiotensin binding site in rodent and human brain membranes, which is distinctly different from angiotensin receptors and key proteases processing angiotensins. It is hypothesized to be a new member of the renin-angiotensin system. This study was designed to isolate and identify this novel angiotensin binding site. An angiotensin analog, photoaffinity probe 125I-SBpa-Ang II, was used to specifically label the non-AT1, non-AT2 angiotensin binding site in mouse forebrain membranes, followed by a two-step purification procedure based on the molecular size and isoelectric point of the photoradiolabeled binding protein. Purified samples were subjected to two-dimensional gel electrophoresis followed by mass spectrometry identification of proteins in the two-dimensional gel sections containing radioactivity. LC-MS/MS analysis revealed eight protein candidates, of which the four most abundant were immunoprecipitated after photoradiolabeling. Immunoprecipitation studies indicated that the angiotensin binding site might be the membrane-bound variant of metalloendopeptidase neurolysin (EC 3.4.24.16). To verify these observations, radioligand binding and photoradiolabeling experiments were conducted in membrane preparations of HEK293 cells overexpressing mouse neurolysin or thimet oligopeptidase (EC 3.4.24.15), a closely related metalloendopeptidase of the same family. These experiments also identified neurolysin as the non-AT1, non-AT2 angiotensin binding site. Finally, brain membranes of mice lacking neurolysin were nearly devoid of the non-AT1, non-AT2 angiotensin binding site, further establishing membrane-bound neurolysin as the binding site. Future studies will focus on the functional significance of this highly specific, high affinity interaction between neurolysin and angiotensins.

  8. Identification of Membrane-bound Variant of Metalloendopeptidase Neurolysin (EC 3.4.24.16) as the Non-angiotensin Type 1 (Non-AT1), Non-AT2 Angiotensin Binding Site*

    PubMed Central

    Wangler, Naomi J.; Santos, Kira L.; Schadock, Ines; Hagen, Fred K.; Escher, Emanuel; Bader, Michael; Speth, Robert C.; Karamyan, Vardan T.

    2012-01-01

    Recently, we discovered a novel non-angiotensin type 1 (non-AT1), non-AT2 angiotensin binding site in rodent and human brain membranes, which is distinctly different from angiotensin receptors and key proteases processing angiotensins. It is hypothesized to be a new member of the renin-angiotensin system. This study was designed to isolate and identify this novel angiotensin binding site. An angiotensin analog, photoaffinity probe 125I-SBpa-Ang II, was used to specifically label the non-AT1, non-AT2 angiotensin binding site in mouse forebrain membranes, followed by a two-step purification procedure based on the molecular size and isoelectric point of the photoradiolabeled binding protein. Purified samples were subjected to two-dimensional gel electrophoresis followed by mass spectrometry identification of proteins in the two-dimensional gel sections containing radioactivity. LC-MS/MS analysis revealed eight protein candidates, of which the four most abundant were immunoprecipitated after photoradiolabeling. Immunoprecipitation studies indicated that the angiotensin binding site might be the membrane-bound variant of metalloendopeptidase neurolysin (EC 3.4.24.16). To verify these observations, radioligand binding and photoradiolabeling experiments were conducted in membrane preparations of HEK293 cells overexpressing mouse neurolysin or thimet oligopeptidase (EC 3.4.24.15), a closely related metalloendopeptidase of the same family. These experiments also identified neurolysin as the non-AT1, non-AT2 angiotensin binding site. Finally, brain membranes of mice lacking neurolysin were nearly devoid of the non-AT1, non-AT2 angiotensin binding site, further establishing membrane-bound neurolysin as the binding site. Future studies will focus on the functional significance of this highly specific, high affinity interaction between neurolysin and angiotensins. PMID:22039052

  9. Histone Variants and Epigenetics

    PubMed Central

    Henikoff, Steven; Smith, M. Mitchell

    2015-01-01

    Histones package and compact DNA by assembling into nucleosome core particles. Most histones are synthesized at S phase for rapid deposition behind replication forks. In addition, the replacement of histones deposited during S phase by variants that can be deposited independently of replication provide the most fundamental level of chromatin differentiation. Alternative mechanisms for depositing different variants can potentially establish and maintain epigenetic states. Variants have also evolved crucial roles in chromosome segregation, transcriptional regulation, DNA repair, and other processes. Investigations into the evolution, structure, and metabolism of histone variants provide a foundation for understanding the participation of chromatin in important cellular processes and in epigenetic memory. PMID:25561719

  10. Mutation Update: The Spectra of Nebulin Variants and Associated Myopathies

    PubMed Central

    Lehtokari, Vilma-Lotta; Kiiski, Kirsi; Sandaradura, Sarah A.; Laporte, Jocelyn; Repo, Pauliina; Frey, Jennifer A.; Donner, Kati; Marttila, Minttu; Saunders, Carol; Barth, Peter G.; den Dunnen, Johan T.; Beggs, Alan H.; Clarke, Nigel F.; North, Kathryn N.; Laing, Nigel G.; Romero, Norma B.; Winder, Thomas L.; Pelin, Katarina; Wallgren-Pettersson, Carina

    2015-01-01

    A mutation update on the nebulin gene (NEB) is necessary because of recent developments in analysis methodology, the identification of increasing numbers and novel types of variants, and a widening in the spectrum of clinical and histological phenotypes associated with this gigantic, 183 exons containing gene. Recessive pathogenic variants in NEB are the major cause of nemaline myopathy (NM), one of the most common congenital myopathies. Moreover, pathogenic NEB variants have been identified in core-rod myopathy and in distal myopathies. In this update, we present the disease-causing variants in NEB in 159 families, 143 families with NM, and 16 families with NM-related myopathies. Eighty-eight families are presented here for the first time. We summarize 86 previously published and 126 unpublished variants identified in NEB. Furthermore, we have analyzed the NEB variants deposited in the Exome Variant Server (http://evs.gs.washington.edu/EVS/), identifying that pathogenic variants are a minor fraction of all coding variants (~7%). This indicates that nebulin tolerates substantial changes in its amino acid sequence, providing an explanation as to why variants in such a large gene result in relatively rare disorders. Lastly, we discuss the difficulties of drawing reliable genotype–phenotype correlations in NEB-associated disease. PMID:25205138

  11. Evaluation of the Biomic V3 Microbiology System for Identification of Selected Species on BBL CHROMagar Orientation Agar and CHROMagar MRSA Medium ▿

    PubMed Central

    Baron, Ellen Jo; D'Souza, Holly; Qi Wang, Andrew; Gibbs, David L.

    2008-01-01

    The Biomic V3 microbiology system identifies bacteria by reading the color of colonies selected by the user. For CHROMagar orientation, Biomic results agreed with conventional methods for 94% of the strains assayed. For CHROMagar MRSA, Biomic correctly identified 100% of the strains tested and did not misidentify two methicillin-susceptible Staphylococcus aureus strains growing on the plates. PMID:18701661

  12. Protein characterization by LC-MS/MS may be required for the DNA identification of a fusion hemoglobin: the example of Hb P-Nilotic.

    PubMed

    Zanella-Cleon, Isabelle; Delolme, Frédéric; Lacan, Philippe; Garcia, Caroline; Vinatier, Isabelle; Francina, Alain; Joly, Philippe

    2012-02-01

    DNA analysis is currently the easiest way to identify a hemoglobin variant in most cases. Nevertheless, in case of complex gene rearrangements, mass spectrometry studies may be required to orientate the DNA diagnosis. The present report shows the use of mass spectrometry techniques prior to DNA analysis for the identification of the rare P-Nilotic fusion hemoglobin. Complete protein analysis is performed by liquid chromatography-tandem mass spectrometry on the abnormal globin chain isolated by reversed-phase liquid chromatography.

  13. Wham: Identifying Structural Variants of Biological Consequence.

    PubMed

    Kronenberg, Zev N; Osborne, Edward J; Cone, Kelsey R; Kennedy, Brett J; Domyan, Eric T; Shapiro, Michael D; Elde, Nels C; Yandell, Mark

    2015-12-01

    Existing methods for identifying structural variants (SVs) from short read datasets are inaccurate. This complicates disease-gene identification and efforts to understand the consequences of genetic variation. In response, we have created Wham (Whole-genome Alignment Metrics) to provide a single, integrated framework for both structural variant calling and association testing, thereby bypassing many of the difficulties that currently frustrate attempts to employ SVs in association testing. Here we describe Wham, benchmark it against three other widely used SV identification tools-Lumpy, Delly and SoftSearch-and demonstrate Wham's ability to identify and associate SVs with phenotypes using data from humans, domestic pigeons, and vaccinia virus. Wham and all associated software are covered under the MIT License and can be freely downloaded from github (https://github.com/zeeev/wham), with documentation on a wiki (http://zeeev.github.io/wham/). For community support please post questions to https://www.biostars.org/.

  14. Wham: Identifying Structural Variants of Biological Consequence

    PubMed Central

    Kronenberg, Zev N.; Osborne, Edward J.; Cone, Kelsey R.; Kennedy, Brett J.; Domyan, Eric T.; Shapiro, Michael D.; Elde, Nels C.; Yandell, Mark

    2015-01-01

    Existing methods for identifying structural variants (SVs) from short read datasets are inaccurate. This complicates disease-gene identification and efforts to understand the consequences of genetic variation. In response, we have created Wham (Whole-genome Alignment Metrics) to provide a single, integrated framework for both structural variant calling and association testing, thereby bypassing many of the difficulties that currently frustrate attempts to employ SVs in association testing. Here we describe Wham, benchmark it against three other widely used SV identification tools–Lumpy, Delly and SoftSearch–and demonstrate Wham’s ability to identify and associate SVs with phenotypes using data from humans, domestic pigeons, and vaccinia virus. Wham and all associated software are covered under the MIT License and can be freely downloaded from github (https://github.com/zeeev/wham), with documentation on a wiki (http://zeeev.github.io/wham/). For community support please post questions to https://www.biostars.org/. PMID:26625158

  15. Orienteering injuries

    PubMed Central

    Folan, Jean M.

    1982-01-01

    At the Irish National Orienteering Championships in 1981 a survey of the injuries occurring over the two days of competition was carried out. Of 285 individual competitors there was a percentage injury rate of 5.26%. The article discusses the injuries and aspects of safety in orienteering. Imagesp236-ap237-ap237-bp238-ap239-ap240-a PMID:7159815

  16. Orientation and the Young Orienteer

    NASA Astrophysics Data System (ADS)

    Walsh, S. E.; Martland, J. R.

    Orientation within orienteering is dependent on the use of two basic strategies; that is, either a compass or Magnetic-North-based strategy, which relies on the use of one set of information; or the use of a map and landmark-based strategy which relies on the use of at least two sets of information. Walsh and found that, when given the choice, young children use the compass-based strategy when following complex potentially disorientating routes.The efficacy of these two basic orientation strategies was investigated within three different orienteering environments: (1) a familiar known environment; (2) a familiar unknown environment and (3) an unfamiliar unknown environment.Subjects, age range from 9 to 10think aloud particularly the introduction of basic skills to young performers. They support the argument that is essential to introduce the map and compass simultaneously and that relocation and orientation skills should be coached concurrently.

  17. Mucopolysaccharidosis: A New Variant?

    ERIC Educational Resources Information Center

    Primrose, D. A.

    1972-01-01

    Described is a possibly new variant of mucopolysaccharidosis characterized by progressive mental and motor deficiency, bone abnormalities, a generalized skin lesion, and abnormal mucopolysaccharides in the urine as seen in a 20-year-old female. (DB)

  18. Identification of Key Proteins and Networks Related to Grain Development in Wheat (Triticum aestivum L.) by Comparative Transcription and Proteomic Analysis of Allelic Variants in TaGW2-6A

    PubMed Central

    Du, Dengfeng; Gao, Xin; Geng, Juan; Li, Qingyan; Li, Liqun; Lv, Qian; Li, Xuejun

    2016-01-01

    In wheat, coding region allelic variants of TaGW2-6A are closely associated with grain width and weight, but the genetic mechanisms involved remain unclear. Thus, to obtain insights into the key functions regulated by TaGW2-6A during wheat grain development, we performed transcriptional and proteomic analyses of TaGW2-6A allelic variants. The transcription results showed that the TaGW2-6A allelic variants differed significantly by several orders of magnitude. Each allelic variant of TaGW2-6A reached its first transcription peak at 6 days after anthesis (DAA), but the insertion type TaGW2-6A allelic variant reached its second peak earlier than the normal type, i.e., at 12 DAA rather than 20 DAA. In total, we identified 228 differentially accumulated protein spots representing 138 unique proteins by two-dimensional gel electrophoresis and tandem MALDI-TOF/TOF-MS in these three stages. Based on the results, we found some key proteins that are closely related to wheat grain development. The results of this analysis improve our understanding of the genetic mechanisms related to TaGW2-6A during wheat grain development as well as providing insights into the biological processes involved in seed formation. PMID:27446152

  19. Analyzing Orientations

    NASA Astrophysics Data System (ADS)

    Ruggles, Clive L. N.

    Archaeoastronomical field survey typically involves the measurement of structural orientations (i.e., orientations along and between built structures) in relation to the visible landscape and particularly the surrounding horizon. This chapter focuses on the process of analyzing the astronomical potential of oriented structures, whether in the field or as a desktop appraisal, with the aim of establishing the archaeoastronomical "facts". It does not address questions of data selection (see instead Chap. 25, "Best Practice for Evaluating the Astronomical Significance of Archaeological Sites", 10.1007/978-1-4614-6141-8_25) or interpretation (see Chap. 24, "Nature and Analysis of Material Evidence Relevant to Archaeoastronomy", 10.1007/978-1-4614-6141-8_22). The main necessity is to determine the azimuth, horizon altitude, and declination in the direction "indicated" by any structural orientation. Normally, there are a range of possibilities, reflecting the various errors and uncertainties in estimating the intended (or, at least, the constructed) orientation, and in more formal approaches an attempt is made to assign a probability distribution extending over a spread of declinations. These probability distributions can then be cumulated in order to visualize and analyze the combined data from several orientations, so as to identify any consistent astronomical associations that can then be correlated with the declinations of particular astronomical objects or phenomena at any era in the past. The whole process raises various procedural and methodological issues and does not proceed in isolation from the consideration of corroborative data, which is essential in order to develop viable cultural interpretations.

  20. Identification of RNO 43 and B335 as two highly collimated bipolar flows oriented nearly in the plane of the sky

    NASA Technical Reports Server (NTRS)

    Cabrit, Sylvie; Goldsmith, Paul F.; Snell, Ronald L.

    1988-01-01

    An analysis of CO and CS line observations shows that RNO 43 and B335 are single highly collimated bipolar flows oriented nearly in the plane of the sky. The angle between the line of sight and the flow axis is estimated to be 85 deg in RNO 43 and 82 deg in B335. The results indicate that each of these flows must have a significant expansion velocity perpendicular to its axis, and that the flow in B335 must be driven by a mostly nonmolecular wind component.

  1. Orientation to student placements: needs and benefits.

    PubMed

    Worrall, Katie

    2007-02-01

    A review of evidence on the benefits and challenges of student orientation is used in this article alongside experiences of orientation days on a children's ward to consider ways in which such programmes could be improved. Orientation to clinical placements can enhance learning by helping students to feel they fit in, reduce anxiety and increase motivation to learn through early identification of learning outcomes. However, there are challenges in the practical implementation of orientation including timing of students' starting dates, staff time, consistency and level of information and teaching. Increased involvement of individual mentors could improve orientation and optimise students' learning experiences.

  2. Industrial Orientation.

    ERIC Educational Resources Information Center

    Rasor, Leslie; Brooks, Valerie

    These eight modules for an industrial orientation class were developed by a project to design an interdisciplinary program of basic skills training for disadvantaged students in a Construction Technology Program (see Note). The Drafting module overviews drafting career opportunities, job markets, salaries, educational requirements, and basic…

  3. Variation in Sexual Identification Among Behaviorally Bisexual Women in the Midwestern United States: Challenging the Established Methods for Collecting Data on Sexual Identity and Orientation.

    PubMed

    Baldwin, Aleta; Schick, Vanessa R; Dodge, Brian; van Der Pol, Barbara; Herbenick, Debby; Sanders, Stephanie A; Fortenberry, J Dennis

    2016-08-03

    Collecting information on sexual identity is critical to ensuring the visibility of minority populations who face stigmatization and discrimination related to sexual identities. However, it is challenging to capture the nuances of sexual identity with traditional survey research methods. Using a mixed-methods approach, we gathered data on the sexual identities of 80 behaviorally bisexual women in the Midwestern United States through an online survey. When provided different types of measures (e.g., open ended and fixed response) and different contexts in which to identify (e.g., private and public), participants varied in how they reported their sexual identities. Qualitative analysis of participant narratives around identity change finds partitioning and ranking of attraction is a key component in understanding behaviorally bisexual women's identities. We further identify a division regarding the desired outcomes of identity development processes. Given the multiple ways in which participants identified depending upon the type of measure and the context specified, and the variation in identification over time, results support reconsidering the capability of typical measures and methods used in survey research to capture sexual identity information. Additionally, findings highlight the utility of including multiple, context-specific measures of sexual identities in future research.

  4. Variants of Uncertainty

    DTIC Science & Technology

    1981-05-15

    Variants of Uncertainty Daniel Kahneman University of British Columbia Amos Tversky Stanford University DTI-C &%E-IECTE ~JUNO 1i 19 8 1j May 15, 1981... Dennett , 1979) in which different parts have ac- cess to different data, assign then different weights and hold different views of the situation...2robable and t..h1 provable. Oxford- Claredor Press, 1977. Dennett , D.C. Brainstorms. Hassocks: Harvester, 1979. Donchin, E., Ritter, W. & McCallum, W.C

  5. Variants of glycoside hydrolases

    DOEpatents

    Teter, Sarah; Ward, Connie; Cherry, Joel; Jones, Aubrey; Harris, Paul; Yi, Jung

    2013-02-26

    The present invention relates to variants of a parent glycoside hydrolase, comprising a substitution at one or more positions corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further comprising a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2 a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2, wherein the variants have glycoside hydrolase activity. The present invention also relates to nucleotide sequences encoding the variant glycoside hydrolases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

  6. Variants of glycoside hydrolases

    DOEpatents

    Teter, Sarah; Ward, Connie; Cherry, Joel; Jones, Aubrey; Harris, Paul; Yi, Jung

    2011-04-26

    The present invention relates to variants of a parent glycoside hydrolase, comprising a substitution at one or more positions corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further comprising a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2 a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2, wherein the variants have glycoside hydrolase activity. The present invention also relates to nucleotide sequences encoding the variant glycoside hydrolases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

  7. Efflux-mediated fluoroquinolone resistance in the multidrug-resistant Pseudomonas aeruginosa clinical isolate PA7: identification of a novel MexS variant involved in upregulation of the mexEF-oprN multidrug efflux operon

    PubMed Central

    Morita, Yuji; Tomida, Junko; Kawamura, Yoshiaki

    2014-01-01

    The emergence of multidrug-resistant Pseudomonas aeruginosa has become a serious problem in medical settings. P. aeruginosa clinical isolate PA7 is resistant to fluoroquinolones, aminoglycosides, and most β-lactams but not imipenem. In this study, enhanced efflux-mediated fluoroquinolone resistance of PA7 was shown to reflect increased expression of two resistance nodulation cell division (RND) -type multidrug efflux operons, mexEF-oprN and mexXY-oprA. Such a clinical isolate has rarely been reported because MexEF-OprN-overproducing mutants often increase susceptibility to aminoglycosides apparently owing to impairment of the MexXY system. A mutant of PA7 lacking three RND-type multidrug efflux operons (mexAB-oprM, mexEF-oprN, and mexXY-oprA) was susceptible to all anti-pseudomonas agents we tested, supporting an idea that these RND-type multidrug efflux transporters are molecular targets to overcome multidrug resistance in P. aeruginosa. mexEF-oprN-upregulation in P. aeruginosa PA7 was shown due to a MexS variant harboring the Valine-155 amino acid residue. This is the first genetic evidence shown that a MexS variant causes mexEF-oprN-upregulation in P. aeruginosa clinical isolates. PMID:25653649

  8. Association of genetic variants with diabetic nephropathy.

    PubMed

    Rizvi, Saliha; Raza, Syed Tasleem; Mahdi, Farzana

    2014-12-15

    Diabetic nephropathy accounts for the most serious microvascular complication of diabetes mellitus. It is suggested that the prevalence of diabetic nephropathy will continue to increase in future posing a major challenge to the healthcare system resulting in increased morbidity and mortality. It occurs as a result of interaction between both genetic and environmental factors in individuals with both type 1 and type 2 diabetes. Genetic susceptibility has been proposed as an important factor for the development and progression of diabetic nephropathy, and various research efforts are being executed worldwide to identify the susceptibility gene for diabetic nephropathy. Numerous single nucleotide polymorphisms have been found in various genes giving rise to various gene variants which have been found to play a major role in genetic susceptibility to diabetic nephropathy. The risk of developing diabetic nephropathy is increased several times by inheriting risk alleles at susceptibility loci of various genes like ACE, IL, TNF-α, COL4A1, eNOS, SOD2, APOE, GLUT, etc. The identification of these genetic variants at a biomarker level could thus, allow the detection of those individuals at high risk for diabetic nephropathy which could thus help in the treatment, diagnosis and early prevention of the disease. The present review discusses about the various gene variants found till date to be associated with diabetic nephropathy.

  9. Novel RNA variants in colorectal cancers

    PubMed Central

    Alagaratnam, Sharmini; Zhao, Sen; Nome, Torfinn; Løvf, Marthe; Bakken, Anne C.; Hektoen, Merete; Sveen, Anita; Lothe, Ragnhild A.; Skotheim, Rolf I.

    2015-01-01

    With an annual estimated incidence of 1.4 million, and a five-year survival rate of 60%, colorectal cancer (CRC) is a major clinical burden. To identify novel RNA variants in CRC, we analyzed exon-level microarray expression data from a cohort of 202 CRCs. We nominated 25 genes with increased expression of their 3′ parts in at least one cancer sample each. To efficiently investigate underlying transcript structures, we developed an approach using rapid amplification of cDNA ends followed by high throughput sequencing (RACE-seq). RACE products from the targeted genes in 23 CRC samples were pooled together and sequenced. We identified VWA2-TCF7L2, DHX35-BPIFA2 and CASZ1-MASP2 as private fusion events, and novel transcript structures for 17 of the 23 other candidate genes. The high-throughput approach facilitated identification of CRC specific RNA variants. These include a recurrent read-through fusion transcript between KLK8 and KLK7, and a splice variant of S100A2. Both of these were overrepresented in CRC tissue and cell lines from external RNA-seq datasets. PMID:26474385

  10. Orienting hypnosis.

    PubMed

    Hope, Anna E; Sugarman, Laurence I

    2015-01-01

    This article presents a new frame for understanding hypnosis and its clinical applications. Despite great potential to transform health and care, hypnosis research and clinical integration is impaired in part by centuries of misrepresentation and ignorance about its demonstrated efficacy. The authors contend that advances in the field are primarily encumbered by the lack of distinct boundaries and definitions. Here, hypnosis, trance, and mind are all redefined and grounded in biological, neurological, and psychological phenomena. Solutions are proposed for boundary and language problems associated with hypnosis. The biological role of novelty stimulating an orienting response that, in turn, potentiates systemic plasticity forms the basis for trance. Hypnosis is merely the skill set that perpetuates and influences trance. This formulation meshes with many aspects of Milton Erickson's legacy and Ernest Rossi's recent theory of mind and health. Implications of this hypothesis for clinical skills, professional training, and research are discussed.

  11. EDITORIAL: Optical orientation Optical orientation

    NASA Astrophysics Data System (ADS)

    SAME ADDRESS *, Yuri; Landwehr, Gottfried

    2008-11-01

    priority of the discovery in the literature, which was partly caused by the existence of the Iron Curtain. I had already enjoyed contact with Boris in the 1980s when the two volumes of Landau Level Spectroscopy were being prepared [2]. He was one of the pioneers of magneto-optics in semiconductors. In the 1950s the band structure of germanium and silicon was investigated by magneto-optical methods, mainly in the United States. No excitonic effects were observed and the band structure parameters were determined without taking account of excitons. However, working with cuprous oxide, which is a direct semiconductor with a relative large energy gap, Zakharchenya and his co-worker Seysan showed that in order to obtain correct band structure parameters, it is necessary to take excitons into account [3]. About 1970 Boris started work on optical orientation. Early work by Hanle in Germany in the 1920s on the depolarization of luminescence in mercury vapour by a transverse magnetic field was not appreciated for a long time. Only in the late 1940s did Kastler and co-workers in Paris begin a systematic study of optical pumping, which led to the award of a Nobel prize. The ideas of optical pumping were first applied by Georges Lampel to solid state physics in 1968. He demonstrated optical orientation of free carriers in silicon. The detection method was nuclear magnetic resonance; optically oriented free electrons dynamically polarized the 29Si nuclei of the host lattice. The first optical detection of spin orientation was demonstrated by with the III-V semiconductor GaSb by Parsons. Due to the various interaction mechanisms of spins with their environment, the effects occurring in semiconductors are naturally more complex than those in atoms. Optical detection is now the preferred method to detect spin alignment in semiconductors. The orientation of spins in crystals pumped with circularly polarized light is deduced from the degree of circular polarization of the recombination

  12. Mapping of Epitopes Occurring in Bovine α(s1)-Casein Variants by Peptide Microarray Immunoassay.

    PubMed

    Lisson, Maria; Erhardt, Georg

    2016-01-01

    Immunoglobulin E epitope mapping of milk proteins reveals important information about their immunologic properties. Genetic variants of αS1-casein, one of the major allergens in bovine milk, are until now not considered when discussing the allergenic potential. Here we describe the complete procedure to assess the allergenicity of αS1-casein variants B and C, which are frequent in most breeds, starting from milk with identification and purification of casein variants by isoelectric focusing (IEF) and anion-exchange chromatography, followed by in vitro gastrointestinal digestion of the casein variants, identification of the resulting peptides by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS), in silico analysis of the variant-specific peptides as allergenic epitopes, and determination of their IgE-binding properties by microarray immunoassay with cow's milk allergic human sera.

  13. Group B streptococcal opacity variants.

    PubMed Central

    Pincus, S H; Cole, R L; Wessels, M R; Corwin, M D; Kamanga-Sollo, E; Hayes, S F; Cieplak, W; Swanson, J

    1992-01-01

    Colony opacity variants were detected for type III group B streptococci (GBS). Transparent colonies predominate in the parent GBS, with occasional colonies having opaque portions. Two stable opaque variants (1.1 and 1.5) were compared with three transparent clones (1.2, 1.3, and 1.4). All grew well on blood agar and on GC medium, but variant 1.1 failed to grow on Todd-Hewitt medium. Scanning and transmission electron microscopy demonstrated that colony opacity correlated with bacterial aggregation status, with opaque variants forming longer and more organized chains. Opaque-transparent switches were observed in both directions for most variants, with transparent to opaque noted most frequently, but 1.5 did not switch at all. Switching of the opacity phenotype was observed both in vitro and in neonatal mice. Relationships between colony opacity and several cell surface phenomena were explored. (i) Opaque variant 1.1 had two surface proteins (46 and 75 kDa) that were either unique or greatly overexpressed. (ii) Variant 1.1 was deficient in type III polysaccharide, while 1.5 lacked group B antigen. Diminished capsular polysaccharide of variant 1.1 was reflected in reduced negative electrophoretic mobility and in increased buoyant density. (iii) Transparent variant colonies growing closest to a penicillin disk were opaque, but colonial variants did not differ in their sensitivity to penicillin. These data indicate that GBS can exist in both opaque and transparent forms, with opaque appearance occurring by multiple routes. Opaque variants grow poorly on Todd-Hewitt medium generally used for isolation of GBS, so any possible relationships between opacity variation and pathogenesis of GBS infection are unknown. Images PMID:1592825

  14. Variants of windmill nystagmus.

    PubMed

    Choi, Kwang-Dong; Shin, Hae Kyung; Kim, Ji-Soo; Kim, Sung-Hee; Choi, Jae-Hwan; Kim, Hyo-Jung; Zee, David S

    2016-07-01

    Windmill nystagmus is characterized by a clock-like rotation of the beating direction of a jerk nystagmus suggesting separate horizontal and vertical oscillators, usually 90° out of phase. We report oculographic characteristics in three patients with variants of windmill nystagmus in whom the common denominator was profound visual loss due to retinal diseases. Two patients showed a clock-like pattern, while in the third, the nystagmus was largely diagonal (in phase or 180° out of phase) but also periodically changed direction by 180°. We hypothesize that windmill nystagmus is a unique manifestation of "eye movements of the blind." It emerges when the central structures, including the cerebellum, that normally keep eye movements calibrated and gaze steady can no longer perform their task, because they are deprived of the retinal image motion that signals a need for adaptive recalibration.

  15. Targeted exome sequencing for the identification of a protective variant against Internet gaming disorder at rs2229910 of neurotrophic tyrosine kinase receptor, type 3 (NTRK3): A pilot study

    PubMed Central

    Kim, Jeong-Yu; Jeong, Jo-Eun; Rhee, Je-Keun; Cho, Hyun; Chun, Ji-Won; Kim, Tae-Min; Choi, Sam-Wook; Choi, Jung-Seok; Kim, Dai-Jin

    2016-01-01

    Background and aims Internet gaming disorder (IGD) has gained recognition as a potential new diagnosis in the fifth revision of the Diagnostic and Statistical Manual of Mental Disorders, but genetic evidence supporting this disorder remains scarce. Methods In this study, targeted exome sequencing was conducted in 30 IGD patients and 30 control subjects with a focus on genes linked to various neurotransmitters associated with substance and non-substance addictions, depression, and attention deficit hyperactivity disorder. Results rs2229910 of neurotrophic tyrosine kinase receptor, type 3 (NTRK3) was the only single nucleotide polymorphism (SNP) that exhibited a significantly different minor allele frequency in IGD subjects compared to controls (p = .01932), suggesting that this SNP has a protective effect against IGD (odds ratio = 0.1541). The presence of this potentially protective allele was also associated with less time spent on Internet gaming and lower scores on the Young’s Internet Addiction Test and Korean Internet Addiction Proneness Scale for Adults. Conclusions The results of this first targeted exome sequencing study of IGD subjects indicate that rs2229910 of NTRK3 is a genetic variant that is significantly related to IGD. These findings may have significant implications for future research investigating the genetics of IGD and other behavioral addictions. PMID:27826991

  16. Identification of two novel HLA-A*02 variants, A*02:319 and A*02:01:64, in two Taiwanese marrow stem cell donors by sequence-based typing.

    PubMed

    Yang, K L; Lee, S K; Yang, S Y; Kao, R H; Lin, C L; Lin, P Y

    2012-06-01

    We report here two novel variants of HLA-A*02 allele, A*02:319 and A*02:01:64, discovered in two Taiwanese unrelated volunteer bone marrow donors by sequence-based typing (SBT) method. The DNA sequence of A*02:319 is identical to A*02:07 in exons 2 and 3 but varies with one nucleotide at codon 9 (TTC->TCC). The variation caused one amino acid substitution at residue 9 (F->S). On the other hand, the DNA sequence of A*02:01:64 is identical to the sequence of A*02:01:01:01 in exons 2 and 3 except a silent mutation at codon 114 (CAC->CAT). The probable HLA-A, HLA-B and HLA-DRB1 haplotypes in association with A*02:319 and A*02:01:64 were deduced as A*02:319-B*46:01-DRB1*04 and A*02:01:64-B*38:02-DRB1*16:02, respectively.

  17. Targeted exome sequencing for the identification of a protective variant against Internet gaming disorder at rs2229910 of neurotrophic tyrosine kinase receptor, type 3 (NTRK3): A pilot study.

    PubMed

    Kim, Jeong-Yu; Jeong, Jo-Eun; Rhee, Je-Keun; Cho, Hyun; Chun, Ji-Won; Kim, Tae-Min; Choi, Sam-Wook; Choi, Jung-Seok; Kim, Dai-Jin

    2016-12-01

    Background and aims Internet gaming disorder (IGD) has gained recognition as a potential new diagnosis in the fifth revision of the Diagnostic and Statistical Manual of Mental Disorders, but genetic evidence supporting this disorder remains scarce. Methods In this study, targeted exome sequencing was conducted in 30 IGD patients and 30 control subjects with a focus on genes linked to various neurotransmitters associated with substance and non-substance addictions, depression, and attention deficit hyperactivity disorder. Results rs2229910 of neurotrophic tyrosine kinase receptor, type 3 (NTRK3) was the only single nucleotide polymorphism (SNP) that exhibited a significantly different minor allele frequency in IGD subjects compared to controls (p = .01932), suggesting that this SNP has a protective effect against IGD (odds ratio = 0.1541). The presence of this potentially protective allele was also associated with less time spent on Internet gaming and lower scores on the Young's Internet Addiction Test and Korean Internet Addiction Proneness Scale for Adults. Conclusions The results of this first targeted exome sequencing study of IGD subjects indicate that rs2229910 of NTRK3 is a genetic variant that is significantly related to IGD. These findings may have significant implications for future research investigating the genetics of IGD and other behavioral addictions.

  18. Election 2016: Voting on Variants.

    PubMed

    Cho, Raymond J; Collisson, Eric A

    2016-07-01

    Genome sequencing studies increasingly identify variants of unknown significance in provocative genes. Kim and colleagues present a system with which to functionally annotate such variants in a high-throughput, biologically relevant series of assays. Cancer Discov; 6(7); 694-6. ©2016 AACRSee related article by Kim et al., p. 714.

  19. Functional characterization of BRCA1 gene variants by mini-gene splicing assay

    PubMed Central

    Steffensen, Ane Y; Dandanell, Mette; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Nielsen, Finn C; Hansen, Thomas vO

    2014-01-01

    Mutational screening of the breast cancer susceptibility gene BRCA1 leads to the identification of numerous pathogenic variants such as frameshift and nonsense variants, as well as large genomic rearrangements. The screening moreover identifies a large number of variants, for example, missense, silent, and intron variants, which are classified as variants of unknown clinical significance owing to the lack of causal evidence. Variants of unknown clinical significance can potentially have an impact on splicing and therefore functional examinations are warranted to classify whether these variants are pathogenic or benign. Here we validate a mini-gene splicing assay by comparing the results of 24 variants with previously published data from RT-PCR analysis on RNA from blood samples/lymphoblastoid cell lines. The analysis showed an overall concordance of 100%. In addition, we investigated 13 BRCA1 variants of unknown clinical significance or putative variants affecting splicing by in silico analysis and mini-gene splicing assay. Both the in silico analysis and mini-gene splicing assay classified six BRCA1 variants as pathogenic (c.80+1G>A, c.132C>T (p.=), c.213−1G>A, c.670+1delG, c.4185+1G>A, and c.5075−1G>C), whereas six BRCA1 variants were classified as neutral (c.-19-22_-19-21dupAT, c.302−15C>G, c.547+14delG, c.4676−20A>G, c.4987−21G>T, and c.5278−14C>G) and one BRCA1 variant remained unclassified (c.670+16G>A). In conclusion, our study emphasizes that in silico analysis and mini-gene splicing assays are important for the classification of variants, especially if no RNA is available from the patient. This knowledge is crucial for proper genetic counseling of patients and their family members. PMID:24667779

  20. Functional characterization of BRCA1 gene variants by mini-gene splicing assay.

    PubMed

    Steffensen, Ane Y; Dandanell, Mette; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Nielsen, Finn C; Hansen, Thomas vO

    2014-12-01

    Mutational screening of the breast cancer susceptibility gene BRCA1 leads to the identification of numerous pathogenic variants such as frameshift and nonsense variants, as well as large genomic rearrangements. The screening moreover identifies a large number of variants, for example, missense, silent, and intron variants, which are classified as variants of unknown clinical significance owing to the lack of causal evidence. Variants of unknown clinical significance can potentially have an impact on splicing and therefore functional examinations are warranted to classify whether these variants are pathogenic or benign. Here we validate a mini-gene splicing assay by comparing the results of 24 variants with previously published data from RT-PCR analysis on RNA from blood samples/lymphoblastoid cell lines. The analysis showed an overall concordance of 100%. In addition, we investigated 13 BRCA1 variants of unknown clinical significance or putative variants affecting splicing by in silico analysis and mini-gene splicing assay. Both the in silico analysis and mini-gene splicing assay classified six BRCA1 variants as pathogenic (c.80+1G>A, c.132C>T (p.=), c.213-1G>A, c.670+1delG, c.4185+1G>A, and c.5075-1G>C), whereas six BRCA1 variants were classified as neutral (c.-19-22_-19-21dupAT, c.302-15C>G, c.547+14delG, c.4676-20A>G, c.4987-21G>T, and c.5278-14C>G) and one BRCA1 variant remained unclassified (c.670+16G>A). In conclusion, our study emphasizes that in silico analysis and mini-gene splicing assays are important for the classification of variants, especially if no RNA is available from the patient. This knowledge is crucial for proper genetic counseling of patients and their family members.

  1. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  2. Identification of a new structural variant of human apolipoprotein E, E2(Lys146 leads to Gln), in a type III hyperlipoproteinemic subject with the E3/2 phenotype.

    PubMed Central

    Rall, S C; Weisgraber, K H; Innerarity, T L; Bersot, T P; Mahley, R W; Blum, C B

    1983-01-01

    A type III hyperlipoproteinemic subject having the apolipoprotein E (apo E) phenotype E3/2 was identified. From isoelectric focusing experiments in conjunction with cysteamine treatment (a method that measures cysteine content in apo E), the E2 isoform of this subject was determined to have only one cysteine residue, in contrast to all previously studied E2 apoproteins, which had two cysteines. This single cysteine was shown to be at residue 112, the same site at which it occurs in apo E3. From amino acid and sequence analyses, it was determined that this apo E2 differed from apo E3 by the occurrence of glutamine rather than lysine at residue 146. When phospholipid X protein recombinants of the subject's isolated E3 and E2 isoforms were tested for their ability to bind to the human fibroblast apo-B,E receptor, it was found that the E3 bound normally (compared with an apo E3 control) but that the E2 had defective binding (approximately 40% of normal). Although they contained E3 as well as E2, the beta-very low density lipoproteins (beta-VLDL) from this subject were very similar in character to the beta-VLDL from an E2/2 type III hyperlipoproteinemic subject; similar subfractions could be obtained from each subject and were shown to have a similar ability to stimulate cholesteryl ester accumulation in mouse peritoneal macrophages. The new apo E2 variant has also been detected in a second type III hyperlipoproteinemic subject. Images PMID:6313758

  3. Characterization of a Mycobacterium intracellulare Variant Strain by Molecular Techniques

    PubMed Central

    Menendez, M. C.; Palenque, E.; Navarro, M. C.; Nuñez, M. C.; Rebollo, M. J.; Garcia, M. J.

    2001-01-01

    This paper describes a Mycobacterium intracellulare variant strain causing an unusual infection. Several isolates obtained from an immunocompromised patient were identified as members of the Mycobacterium avium complex (MAC) by the commercial AccuProbe system and biochemical standard identification. Further molecular approaches were undertaken for a more accurate characterization of the bacteria. Up to seven different genomic sequences were analyzed, ranging from conserved mycobacterial genes such as 16S ribosomal DNA to MAC-specific genes such as mig (macrophage-induced gene). The results obtained identify the isolates as a variant of M. intracellulare, an example of the internal variability described for members of the MAC, particularly within that species. The application of other molecular approaches is recommended for more accurate identification of bacteria described as MAC members. PMID:11724827

  4. Cellobiohydrolase variants and polynucleotides encoding same

    DOEpatents

    Wogulis, Mark

    2013-09-24

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  5. Cellobiohydrolase variants and polynucleotides encoding same

    DOEpatents

    Wogulis, Mark

    2014-10-14

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  6. Cellobiohydrolase variants and polynucleotides encoding the same

    DOEpatents

    Wogulis, Mark

    2014-09-09

    The present invention relates to variants of a parent cellobiohydrolase. The present invention also relates to polynucleotides encoding the cellobiohydrolase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the cellobiohydrolase variants.

  7. Rare Copy Number Variants

    PubMed Central

    Grozeva, Detelina; Kirov, George; Ivanov, Dobril; Jones, Ian R.; Jones, Lisa; Green, Elaine K.; St Clair, David M.; Young, Allan H.; Ferrier, Nicol; Farmer, Anne E.; McGuffin, Peter; Holmans, Peter A.; Owen, Michael J.; O’Donovan, Michael C.; Craddock, Nick

    2015-01-01

    Context Recent studies suggest that copy number variation in the human genome is extensive and may play an important role in susceptibility to disease, including neuropsychiatric disorders such as schizophrenia and autism. The possible involvement of copy number variants (CNVs) in bipolar disorder has received little attention to date. Objectives To determine whether large (>100 000 base pairs) and rare (found in <1% of the population) CNVs are associated with susceptibility to bipolar disorder and to compare with findings in schizophrenia. Design A genome-wide survey of large, rare CNVs in a case-control sample using a high-density microarray. Setting The Wellcome Trust Case Control Consortium. Participants There were 1697 cases of bipolar disorder and 2806 nonpsychiatric controls. All participants were white UK residents. Main Outcome Measures Overall load of CNVs and presence of rare CNVs. Results The burden of CNVs in bipolar disorder was not increased compared with controls and was significantly less than in schizophrenia cases. The CNVs previously implicated in the etiology of schizophrenia were not more common in cases with bipolar disorder. Conclusions Schizophrenia and bipolar disorder differ with respect to CNV burden in general and association with specific CNVs in particular. Our data are consistent with the possibility that possession of large, rare deletions may modify the phenotype in those at risk of psychosis: those possessing such events are more likely to be diagnosed as having schizophrenia, and those without them are more likely to be diagnosed as having bipolar disorder. PMID:20368508

  8. Personal Factors in Organizational Identification

    ERIC Educational Resources Information Center

    Hall, Douglas T.; And Others

    1970-01-01

    Results of a study suggested possibility of a process whereby (1) service-oriented individuals are attracted to and recruited by the Forest Service, (2) service-oriented members are likely to identify strongly with the Service, and (3) this identification results in intrinsic need satisfactions. (Author/KJ)

  9. Heteromorphic variants of chromosome 9

    PubMed Central

    2013-01-01

    Background Heterochromatic variants of pericentromere of chromosome 9 are reported and discussed since decades concerning their detailed structure and clinical meaning. However, detailed studies are scarce. Thus, here we provide the largest ever done molecular cytogenetic research based on >300 chromosome 9 heteromorphism carriers. Results In this study, 334 carriers of heterochromatic variants of chromosome 9 were included, being 192 patients from Western Europe and the remainder from Easter-European origin. A 3-color-fluorescence in situ hybridization (FISH) probe-set directed against for 9p12 to 9q13~21.1 (9het-mix) and 8 different locus-specific probes were applied for their characterization. The 9het-mix enables the characterization of 21 of the yet known 24 chromosome 9 heteromorphic patterns. In this study, 17 different variants were detected including five yet unreported; the most frequent were pericentric inversions (49.4%) followed by 9qh-variants (23.9%), variants of 9ph (11.4%), cenh (8.2%), and dicentric- (3.8%) and duplication-variants (3.3%). For reasons of simplicity, a new short nomenclature for the yet reported 24 heteromorphic patterns of chromosome 9 is suggested. Six breakpoints involved in four of the 24 variants could be narrowed down using locus-specific probes. Conclusions Based on this largest study ever done in carriers of chromosome 9 heteromorphisms, three of the 24 detailed variants were more frequently observed in Western than in Eastern Europe. Besides, there is no clear evidence that infertility is linked to any of the 24 chromosome 9 heteromorphic variants. PMID:23547710

  10. Variants of beta-glucosidases

    SciTech Connect

    Fidantsef, Ana; Lamsa, Michael; Gorre-Clancy, Brian

    2014-10-07

    The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

  11. Variants of beta-glucosidase

    SciTech Connect

    Fidantsef, Ana; Lamsa, Michael; Gorre-Clancy, Brian

    2015-07-14

    The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

  12. Variants of beta-glucosidase

    DOEpatents

    Fidantsef, Ana; Lamsa, Michael; Gorre-Clancy, Brian

    2009-12-29

    The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

  13. Variants of beta-glucosidases

    DOEpatents

    Fidantsef, Ana; Lamsa, Michael; Clancy, Brian Gorre

    2008-08-19

    The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

  14. Isotopic variants of light and heavy L-pyroglutamic acid succinimidyl esters as the derivatization reagents for DL-amino acid chiral metabolomics identification by liquid chromatography and electrospray ionization mass spectrometry.

    PubMed

    Mochizuki, Toshiki; Todoroki, Kenichiro; Inoue, Koichi; Min, Jun Zhe; Toyo'oka, Toshimasa

    2014-02-06

    L-Pyroglutamic acid succinimidyl ester (L-PGA-OSu) and its isotopic variant (L-PGA[d5]-OSu) were newly synthesized and evaluated as the chiral labeling reagents for the enantioseparation of amino acids, in terms of separation efficiency by reversed-phase chromatography and detection sensitivity by ESI-MS/MS. The enantiomers of amino acids were easily labeled with the reagents at 60°C within 10 min in an alkaline medium containing triethylamine. Although all the diastereomers derived from 18 proteolytic amino acids could not be satisfactorily separated, the pairs of 9 amino acids were completely separated by reversed-phase chromatography using the small particle (1.7 μm) ODS column (Rs=1.95-8.05). The characteristic daughter ions, i.e., m/z 84.04 and m/z 89.04, were detected from all the derivatives by the collision induced dissociation of the protonated molecular ions. A highly sensitive detection at a low-fmol level (0.5-3.2 fmol) was also obtained from the selected reaction monitoring (SRM) chromatograms. An isotope labeling strategy using light and heavy L-PGA-OSu for the differential analysis of the DL-amino acids in different sample groups is also presented in this paper. The differential analysis of biological sample (i.e., human serum) and food product (i.e., yogurt) were tried to demonstrate the efficiency of the proposed method. The ratios of the DL-amino acids in human serum samples, spiked with the different concentrations of D-amino acids, were determined by the procedures using L-PGA-OSu and L-PGA[d5]-OSu. The D/L ratios in the two sample groups at different concentrations of amino acids were similar to the theoretical values. Furthermore, the ratios of D/L-alanine values in different yogurt products were comparable to the ratios obtained from the d/l values using only light reagent (i.e., L-PGA-OSu). Consequently, the proposed strategy is useful for the differential analysis not only in biological samples but also in food products.

  15. Common genetic variants influence human subcortical brain structures.

    PubMed

    Hibar, Derrek P; Stein, Jason L; Renteria, Miguel E; Arias-Vasquez, Alejandro; Desrivières, Sylvane; Jahanshad, Neda; Toro, Roberto; Wittfeld, Katharina; Abramovic, Lucija; Andersson, Micael; Aribisala, Benjamin S; Armstrong, Nicola J; Bernard, Manon; Bohlken, Marc M; Boks, Marco P; Bralten, Janita; Brown, Andrew A; Chakravarty, M Mallar; Chen, Qiang; Ching, Christopher R K; Cuellar-Partida, Gabriel; den Braber, Anouk; Giddaluru, Sudheer; Goldman, Aaron L; Grimm, Oliver; Guadalupe, Tulio; Hass, Johanna; Woldehawariat, Girma; Holmes, Avram J; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H; Olde Loohuis, Loes M; Luciano, Michelle; Macare, Christine; Mather, Karen A; Mattheisen, Manuel; Milaneschi, Yuri; Nho, Kwangsik; Papmeyer, Martina; Ramasamy, Adaikalavan; Risacher, Shannon L; Roiz-Santiañez, Roberto; Rose, Emma J; Salami, Alireza; Sämann, Philipp G; Schmaal, Lianne; Schork, Andrew J; Shin, Jean; Strike, Lachlan T; Teumer, Alexander; van Donkelaar, Marjolein M J; van Eijk, Kristel R; Walters, Raymond K; Westlye, Lars T; Whelan, Christopher D; Winkler, Anderson M; Zwiers, Marcel P; Alhusaini, Saud; Athanasiu, Lavinia; Ehrlich, Stefan; Hakobjan, Marina M H; Hartberg, Cecilie B; Haukvik, Unn K; Heister, Angelien J G A M; Hoehn, David; Kasperaviciute, Dalia; Liewald, David C M; Lopez, Lorna M; Makkinje, Remco R R; Matarin, Mar; Naber, Marlies A M; McKay, D Reese; Needham, Margaret; Nugent, Allison C; Pütz, Benno; Royle, Natalie A; Shen, Li; Sprooten, Emma; Trabzuni, Daniah; van der Marel, Saskia S L; van Hulzen, Kimm J E; Walton, Esther; Wolf, Christiane; Almasy, Laura; Ames, David; Arepalli, Sampath; Assareh, Amelia A; Bastin, Mark E; Brodaty, Henry; Bulayeva, Kazima B; Carless, Melanie A; Cichon, Sven; Corvin, Aiden; Curran, Joanne E; Czisch, Michael; de Zubicaray, Greig I; Dillman, Allissa; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Fedko, Iryna O; Ferrucci, Luigi; Foroud, Tatiana M; Fox, Peter T; Fukunaga, Masaki; Gibbs, J Raphael; Göring, Harald H H; Green, Robert C; Guelfi, Sebastian; Hansell, Narelle K; Hartman, Catharina A; Hegenscheid, Katrin; Heinz, Andreas; Hernandez, Dena G; Heslenfeld, Dirk J; Hoekstra, Pieter J; Holsboer, Florian; Homuth, Georg; Hottenga, Jouke-Jan; Ikeda, Masashi; Jack, Clifford R; Jenkinson, Mark; Johnson, Robert; Kanai, Ryota; Keil, Maria; Kent, Jack W; Kochunov, Peter; Kwok, John B; Lawrie, Stephen M; Liu, Xinmin; Longo, Dan L; McMahon, Katie L; Meisenzahl, Eva; Melle, Ingrid; Mohnke, Sebastian; Montgomery, Grant W; Mostert, Jeanette C; Mühleisen, Thomas W; Nalls, Michael A; Nichols, Thomas E; Nilsson, Lars G; Nöthen, Markus M; Ohi, Kazutaka; Olvera, Rene L; Perez-Iglesias, Rocio; Pike, G Bruce; Potkin, Steven G; Reinvang, Ivar; Reppermund, Simone; Rietschel, Marcella; Romanczuk-Seiferth, Nina; Rosen, Glenn D; Rujescu, Dan; Schnell, Knut; Schofield, Peter R; Smith, Colin; Steen, Vidar M; Sussmann, Jessika E; Thalamuthu, Anbupalam; Toga, Arthur W; Traynor, Bryan J; Troncoso, Juan; Turner, Jessica A; Valdés Hernández, Maria C; van 't Ent, Dennis; van der Brug, Marcel; van der Wee, Nic J A; van Tol, Marie-Jose; Veltman, Dick J; Wassink, Thomas H; Westman, Eric; Zielke, Ronald H; Zonderman, Alan B; Ashbrook, David G; Hager, Reinmar; Lu, Lu; McMahon, Francis J; Morris, Derek W; Williams, Robert W; Brunner, Han G; Buckner, Randy L; Buitelaar, Jan K; Cahn, Wiepke; Calhoun, Vince D; Cavalleri, Gianpiero L; Crespo-Facorro, Benedicto; Dale, Anders M; Davies, Gareth E; Delanty, Norman; Depondt, Chantal; Djurovic, Srdjan; Drevets, Wayne C; Espeseth, Thomas; Gollub, Randy L; Ho, Beng-Choon; Hoffmann, Wolfgang; Hosten, Norbert; Kahn, René S; Le Hellard, Stephanie; Meyer-Lindenberg, Andreas; Müller-Myhsok, Bertram; Nauck, Matthias; Nyberg, Lars; Pandolfo, Massimo; Penninx, Brenda W J H; Roffman, Joshua L; Sisodiya, Sanjay M; Smoller, Jordan W; van Bokhoven, Hans; van Haren, Neeltje E M; Völzke, Henry; Walter, Henrik; Weiner, Michael W; Wen, Wei; White, Tonya; Agartz, Ingrid; Andreassen, Ole A; Blangero, John; Boomsma, Dorret I; Brouwer, Rachel M; Cannon, Dara M; Cookson, Mark R; de Geus, Eco J C; Deary, Ian J; Donohoe, Gary; Fernández, Guillén; Fisher, Simon E; Francks, Clyde; Glahn, David C; Grabe, Hans J; Gruber, Oliver; Hardy, John; Hashimoto, Ryota; Hulshoff Pol, Hilleke E; Jönsson, Erik G; Kloszewska, Iwona; Lovestone, Simon; Mattay, Venkata S; Mecocci, Patrizia; McDonald, Colm; McIntosh, Andrew M; Ophoff, Roel A; Paus, Tomas; Pausova, Zdenka; Ryten, Mina; Sachdev, Perminder S; Saykin, Andrew J; Simmons, Andy; Singleton, Andrew; Soininen, Hilkka; Wardlaw, Joanna M; Weale, Michael E; Weinberger, Daniel R; Adams, Hieab H H; Launer, Lenore J; Seiler, Stephan; Schmidt, Reinhold; Chauhan, Ganesh; Satizabal, Claudia L; Becker, James T; Yanek, Lisa; van der Lee, Sven J; Ebling, Maritza; Fischl, Bruce; Longstreth, W T; Greve, Douglas; Schmidt, Helena; Nyquist, Paul; Vinke, Louis N; van Duijn, Cornelia M; Xue, Luting; Mazoyer, Bernard; Bis, Joshua C; Gudnason, Vilmundur; Seshadri, Sudha; Ikram, M Arfan; Martin, Nicholas G; Wright, Margaret J; Schumann, Gunter; Franke, Barbara; Thompson, Paul M; Medland, Sarah E

    2015-04-09

    The highly complex structure of the human brain is strongly shaped by genetic influences. Subcortical brain regions form circuits with cortical areas to coordinate movement, learning, memory and motivation, and altered circuits can lead to abnormal behaviour and disease. To investigate how common genetic variants affect the structure of these brain regions, here we conduct genome-wide association studies of the volumes of seven subcortical regions and the intracranial volume derived from magnetic resonance images of 30,717 individuals from 50 cohorts. We identify five novel genetic variants influencing the volumes of the putamen and caudate nucleus. We also find stronger evidence for three loci with previously established influences on hippocampal volume and intracranial volume. These variants show specific volumetric effects on brain structures rather than global effects across structures. The strongest effects were found for the putamen, where a novel intergenic locus with replicable influence on volume (rs945270; P = 1.08 × 10(-33); 0.52% variance explained) showed evidence of altering the expression of the KTN1 gene in both brain and blood tissue. Variants influencing putamen volume clustered near developmental genes that regulate apoptosis, axon guidance and vesicle transport. Identification of these genetic variants provides insight into the causes of variability in human brain development, and may help to determine mechanisms of neuropsychiatric dysfunction.

  16. Common genetic variants influence human subcortical brain structures

    PubMed Central

    Hibar, Derrek P.; Stein, Jason L.; Renteria, Miguel E.; Arias-Vasquez, Alejandro; Desrivières, Sylvane; Jahanshad, Neda; Toro, Roberto; Wittfeld, Katharina; Abramovic, Lucija; Andersson, Micael; Aribisala, Benjamin S.; Armstrong, Nicola J.; Bernard, Manon; Bohlken, Marc M.; Boks, Marco P.; Bralten, Janita; Brown, Andrew A.; Chakravarty, M. Mallar; Chen, Qiang; Ching, Christopher R. K.; Cuellar-Partida, Gabriel; den Braber, Anouk; Giddaluru, Sudheer; Goldman, Aaron L.; Grimm, Oliver; Guadalupe, Tulio; Hass, Johanna; Woldehawariat, Girma; Holmes, Avram J.; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H.; Olde Loohuis, Loes M.; Luciano, Michelle; Macare, Christine; Mather, Karen A.; Mattheisen, Manuel; Milaneschi, Yuri; Nho, Kwangsik; Papmeyer, Martina; Ramasamy, Adaikalavan; Risacher, Shannon L.; Roiz-Santiañez, Roberto; Rose, Emma J.; Salami, Alireza; Sämann, Philipp G.; Schmaal, Lianne; Schork, Andrew J.; Shin, Jean; Strike, Lachlan T.; Teumer, Alexander; van Donkelaar, Marjolein M. J.; van Eijk, Kristel R.; Walters, Raymond K.; Westlye, Lars T.; Whelan, Christopher D.; Winkler, Anderson M.; Zwiers, Marcel P.; Alhusaini, Saud; Athanasiu, Lavinia; Ehrlich, Stefan; Hakobjan, Marina M. H.; Hartberg, Cecilie B.; Haukvik, Unn K.; Heister, Angelien J. G. A. M.; Hoehn, David; Kasperaviciute, Dalia; Liewald, David C. M.; Lopez, Lorna M.; Makkinje, Remco R. R.; Matarin, Mar; Naber, Marlies A. M.; McKay, D. Reese; Needham, Margaret; Nugent, Allison C.; Pütz, Benno; Royle, Natalie A.; Shen, Li; Sprooten, Emma; Trabzuni, Daniah; van der Marel, Saskia S. L.; van Hulzen, Kimm J. E.; Walton, Esther; Wolf, Christiane; Almasy, Laura; Ames, David; Arepalli, Sampath; Assareh, Amelia A.; Bastin, Mark E.; Brodaty, Henry; Bulayeva, Kazima B.; Carless, Melanie A.; Cichon, Sven; Corvin, Aiden; Curran, Joanne E.; Czisch, Michael; de Zubicaray, Greig I.; Dillman, Allissa; Duggirala, Ravi; Dyer, Thomas D.; Erk, Susanne; Fedko, Iryna O.; Ferrucci, Luigi; Foroud, Tatiana M.; Fox, Peter T.; Fukunaga, Masaki; Gibbs, J. Raphael; Göring, Harald H. H.; Green, Robert C.; Guelfi, Sebastian; Hansell, Narelle K.; Hartman, Catharina A.; Hegenscheid, Katrin; Heinz, Andreas; Hernandez, Dena G.; Heslenfeld, Dirk J.; Hoekstra, Pieter J.; Holsboer, Florian; Homuth, Georg; Hottenga, Jouke-Jan; Ikeda, Masashi; Jack, Clifford R.; Jenkinson, Mark; Johnson, Robert; Kanai, Ryota; Keil, Maria; Kent, Jack W.; Kochunov, Peter; Kwok, John B.; Lawrie, Stephen M.; Liu, Xinmin; Longo, Dan L.; McMahon, Katie L.; Meisenzahl, Eva; Melle, Ingrid; Mohnke, Sebastian; Montgomery, Grant W.; Mostert, Jeanette C.; Mühleisen, Thomas W.; Nalls, Michael A.; Nichols, Thomas E.; Nilsson, Lars G.; Nöthen, Markus M.; Ohi, Kazutaka; Olvera, Rene L.; Perez-Iglesias, Rocio; Pike, G. Bruce; Potkin, Steven G.; Reinvang, Ivar; Reppermund, Simone; Rietschel, Marcella; Romanczuk-Seiferth, Nina; Rosen, Glenn D.; Rujescu, Dan; Schnell, Knut; Schofield, Peter R.; Smith, Colin; Steen, Vidar M.; Sussmann, Jessika E.; Thalamuthu, Anbupalam; Toga, Arthur W.; Traynor, Bryan J.; Troncoso, Juan; Turner, Jessica A.; Valdés Hernández, Maria C.; van ’t Ent, Dennis; van der Brug, Marcel; van der Wee, Nic J. A.; van Tol, Marie-Jose; Veltman, Dick J.; Wassink, Thomas H.; Westman, Eric; Zielke, Ronald H.; Zonderman, Alan B.; Ashbrook, David G.; Hager, Reinmar; Lu, Lu; McMahon, Francis J.; Morris, Derek W.; Williams, Robert W.; Brunner, Han G.; Buckner, Randy L.; Buitelaar, Jan K.; Cahn, Wiepke; Calhoun, Vince D.; Cavalleri, Gianpiero L.; Crespo-Facorro, Benedicto; Dale, Anders M.; Davies, Gareth E.; Delanty, Norman; Depondt, Chantal; Djurovic, Srdjan; Drevets, Wayne C.; Espeseth, Thomas; Gollub, Randy L.; Ho, Beng-Choon; Hoffmann, Wolfgang; Hosten, Norbert; Kahn, René S.; Le Hellard, Stephanie; Meyer-Lindenberg, Andreas; Müller-Myhsok, Bertram; Nauck, Matthias; Nyberg, Lars; Pandolfo, Massimo; Penninx, Brenda W. J. H.; Roffman, Joshua L.; Sisodiya, Sanjay M.; Smoller, Jordan W.; van Bokhoven, Hans; van Haren, Neeltje E. M.; Völzke, Henry; Walter, Henrik; Weiner, Michael W.; Wen, Wei; White, Tonya; Agartz, Ingrid; Andreassen, Ole A.; Blangero, John; Boomsma, Dorret I.; Brouwer, Rachel M.; Cannon, Dara M.; Cookson, Mark R.; de Geus, Eco J. C.; Deary, Ian J.; Donohoe, Gary; Fernández, Guillén; Fisher, Simon E.; Francks, Clyde; Glahn, David C.; Grabe, Hans J.; Gruber, Oliver; Hardy, John; Hashimoto, Ryota; Hulshoff Pol, Hilleke E.; Jönsson, Erik G.

    2015-01-01

    The highly complex structure of the human brain is strongly shaped by genetic influences1. Subcortical brain regions form circuits with cortical areas to coordinate movement2, learning, memory3 and motivation4, and altered circuits can lead to abnormal behaviour and disease2. To investigate how common genetic variants affect the structure of these brain regions, here we conduct genome-wide association studies of the volumes of seven subcortical regions and the intracranial volume derived from magnetic resonance images of 30,717 individuals from 50 cohorts. We identify five novel genetic variants influencing the volumes of the putamen and caudate nucleus. We also find stronger evidence for three loci with previously established influences on hippocampal volume5 and intracranial volume6. These variants show specific volumetric effects on brain structures rather than global effects across structures. The strongest effects were found for the putamen, where a novel intergenic locus with replicable influence on volume (rs945270; P = 1.08 × 10−33; 0.52% variance explained) showed evidence of altering the expression of the KTN1 gene in both brain and blood tissue. Variants influencing putamen volume clustered near developmental genes that regulate apoptosis, axon guidance and vesicle transport. Identification of these genetic variants provides insight into the causes of variability inhuman brain development, and may help to determine mechanisms of neuropsychiatric dysfunction. PMID:25607358

  17. Biometrics, identification and surveillance.

    PubMed

    Lyon, David

    2008-11-01

    Governing by identity describes the emerging regime of a globalizing, mobile world. Governance depends on identification but identification increasingly depends on biometrics. This 'solution' to difficulties of verification is described and some technical weaknesses are discussed. The role of biometrics in classification systems is also considered and is shown to contain possible prejudice in relation to racialized criteria of identity. Lastly, the culture of biometric identification is shown to be limited to abstract data, artificially separated from the lived experience of the body including the orientation to others. It is proposed that creators of national ID systems in particular address these crucial deficiencies in their attempt to provide new modes of verification.

  18. Discontinuous space variant sub-wavelength structures for generating radially polarized light in visible region

    NASA Astrophysics Data System (ADS)

    Ghadyani, Z.; Dmitriev, S.; Lindlein, N.; Leuchs, G.; Rusina, O.; Harder, I.

    2011-08-01

    A discontinuous space variant sub-wavelength dielectric grating is designed and fabricated for generating radially polarized light in visible region (l = 632.8 nm). The design is based on sub-wavelength silicon nitride structures introducing a retardation of p/2 by form birefringence, with space variant orientation of the optical axis. The pattern is divided into concentric ring segments with constant structural parameters, therefore reducing electron-beam writing time significantly. The design avoids the technological challenges encountered in the generation of a continuous space variant grating while maintaining good quality of the resulting polarization mode.

  19. Identifying Mendelian disease genes with the Variant Effect Scoring Tool

    PubMed Central

    2013-01-01

    Background Whole exome sequencing studies identify hundreds to thousands of rare protein coding variants of ambiguous significance for human health. Computational tools are needed to accelerate the identification of specific variants and genes that contribute to human disease. Results We have developed the Variant Effect Scoring Tool (VEST), a supervised machine learning-based classifier, to prioritize rare missense variants with likely involvement in human disease. The VEST classifier training set comprised ~ 45,000 disease mutations from the latest Human Gene Mutation Database release and another ~45,000 high frequency (allele frequency >1%) putatively neutral missense variants from the Exome Sequencing Project. VEST outperforms some of the most popular methods for prioritizing missense variants in carefully designed holdout benchmarking experiments (VEST ROC AUC = 0.91, PolyPhen2 ROC AUC = 0.86, SIFT4.0 ROC AUC = 0.84). VEST estimates variant score p-values against a null distribution of VEST scores for neutral variants not included in the VEST training set. These p-values can be aggregated at the gene level across multiple disease exomes to rank genes for probable disease involvement. We tested the ability of an aggregate VEST gene score to identify candidate Mendelian disease genes, based on whole-exome sequencing of a small number of disease cases. We used whole-exome data for two Mendelian disorders for which the causal gene is known. Considering only genes that contained variants in all cases, the VEST gene score ranked dihydroorotate dehydrogenase (DHODH) number 2 of 2253 genes in four cases of Miller syndrome, and myosin-3 (MYH3) number 2 of 2313 genes in three cases of Freeman Sheldon syndrome. Conclusions Our results demonstrate the potential power gain of aggregating bioinformatics variant scores into gene-level scores and the general utility of bioinformatics in assisting the search for disease genes in large-scale exome sequencing studies. VEST is

  20. Thinking in Orienteering.

    ERIC Educational Resources Information Center

    Johansen, Bjorn Tore

    1997-01-01

    A think-aloud technique, in which 20 orienteers verbalized their exact thoughts during orienteering, was used to examine the phenomenon of cognition during orienteering. Results indicate that orienteering is experienced as a task to be accomplished, a physical movement, and a dynamic process, and that thinking involves attuning perceptions to…

  1. Developing a DNA variant database.

    PubMed

    Fung, David C Y

    2008-01-01

    Disease- and locus-specific variant databases have been a valuable resource to clinical and research geneticists. With the recent rapid developments in technologies, the number of DNA variants detected in a typical molecular genetics laboratory easily exceeds 1,000. To keep track of the growing inventory of DNA variants, many laboratories employ information technology to store the data as well as distributing the data and its associated information to clinicians and researchers via the Web. While it is a valuable resource, the hosting of a web-accessible database requires collaboration between bioinformaticians and biologists and careful planning to ensure its usability and availability. In this chapter, a series of tutorials on building a local DNA variant database out of a sample dataset will be provided. However, this tutorial will not include programming details on building a web interface and on constructing the web application necessary for web hosting. Instead, an introduction to the two commonly used methods for hosting web-accessible variant databases will be described. Apart from the tutorials, this chapter will also consider the resources and planning required for making a variant database project successful.

  2. Genes that affect brain structure and function identified by rare variant analyses of Mendelian neurologic disease

    PubMed Central

    Karaca, Ender; Harel, Tamar; Pehlivan, Davut; Jhangiani, Shalini N.; Gambin, Tomasz; Akdemir, Zeynep Coban; Gonzaga-Jauregui, Claudia; Erdin, Serkan; Bayram, Yavuz; Campbell, Ian M.; Hunter, Jill V.; Atik, Mehmed M.; Van Esch, Hilde; Yuan, Bo; Wiszniewski, Wojciech; Isikay, Sedat; Yesil, Gozde; Yuregir, Ozge O.; Bozdogan, Sevcan Tug; Aslan, Huseyin; Aydin, Hatip; Tos, Tulay; Aksoy, Ayse; De Vivo, Darryl C.; Jain, Preti; Geckinli, B. Bilge; Sezer, Ozlem; Gul, Davut; Durmaz, Burak; Cogulu, Ozgur; Ozkinay, Ferda; Topcu, Vehap; Candan, Sukru; Cebi, Alper Han; Ikbal, Mevlit; Gulec, Elif Yilmaz; Gezdirici, Alper; Koparir, Erkan; Ekici, Fatma; Coskun, Salih; Cicek, Salih; Karaer, Kadri; Koparir, Asuman; Duz, Mehmet Bugrahan; Kirat, Emre; Fenercioglu, Elif; Ulucan, Hakan; Seven, Mehmet; Guran, Tulay; Elcioglu, Nursel; Yildirim, Mahmut Selman; Aktas, Dilek; Alikaşifoğlu, Mehmet; Ture, Mehmet; Yakut, Tahsin; Overton, John D.; Yuksel, Adnan; Ozen, Mustafa; Muzny, Donna M.; Adams, David R.; Boerwinkle, Eric; Chung, Wendy K.; Gibbs, Richard A.; Lupski, James R

    2015-01-01

    Development of the human nervous system involves complex interactions between fundamental cellular processes and requires a multitude of genes, many of which remain to be associated with human disease. We applied whole exome sequencing to 128 mostly consanguineous families with neurogenetic disorders that often included brain malformations. Rare variant analyses for both single nucleotide variant (SNV) and copy number variant (CNV) alleles allowed for identification of 45 novel variants in 43 known disease genes, 41 candidate genes, and CNVs in 10 families, with an overall potential molecular cause identified in >85% of families studied. Among the candidate genes identified, we found PRUNE, VARS, and DHX37 in multiple families, and homozygous loss of function variants in AGBL2, SLC18A2, SMARCA1, UBQLN1, and CPLX1. Neuroimaging and in silico analysis of functional and expression proximity between candidate and known disease genes allowed for further understanding of genetic networks underlying specific types of brain malformations. PMID:26539891

  3. Understanding V(D)J recombination initiator RAG1 gene using molecular phylogenetic and genetic variant analyses and upgrading missense and non-coding variants of clinical importance.

    PubMed

    Kumar, Abhishek; Bhandari, Anita; Sarde, Sandeep J; Muppavarapu, Sekhar; Tandon, Ravi

    2015-07-10

    The recombination-activating genes (RAGs) encode for V(D)J recombinases responsible for rearrangements of antigen-receptor genes during T and B cell development, and RAG expression is known to correlate strictly with the process of rearrangement. There have been several studies of RAG1 illustrating biochemical, physiological and immunological properties. Hitherto, there are limited studies on RAG1 focusing molecular phylogenetic analyses, evolutionary traits, and genetic variants in human populations. Hence, there is a need of a comprehensive study on this topic. In the current report, we have shed light into insights of evolutionary traits and genetic variants of human RAG1 gene using 1092 genomes from human populations. Syntenic analyses revealed that two RAG genes are physically linked and conserved on the same locus in head-to-head orientation from sea urchin to human for about 550 MY. Spliceosomal introns have been in invaded in fishes and sea urchin, whereas gene structures of RAG1 gene from tetrapods remained single exon architecture. We compiled 751 genetic variants in human RAG1 gene using 1092 human genomes; where major stockholders of variant classes are 79% single nucleotide polymorphisms (SNPs), 12.2% somatic single nucleotide variants (somatic SNVs) and 6.8% deletion. Out of 267 missense variants, 140 are deleterious mutations. We identified 284 non-coding variants with 94% regulatory in nature.

  4. They Call it Orienteering

    ERIC Educational Resources Information Center

    Wexler, Mark

    1977-01-01

    Through the use of personal anecdotes, the author details his initial experience with orienteering, a sport rapidly increasing in popularity that teaches people not to get lost in the woods. Sources of information about orienteering are provided. (BT)

  5. Exome analysis of Smith-Magenis-like syndrome cohort identifies de novo likely pathogenic variants.

    PubMed

    Berger, Seth I; Ciccone, Carla; Simon, Karen L; Malicdan, May Christine; Vilboux, Thierry; Billington, Charles; Fischer, Roxanne; Introne, Wendy J; Gropman, Andrea; Blancato, Jan K; Mullikin, James C; Gahl, William A; Huizing, Marjan; Smith, Ann C M

    2017-04-01

    Smith-Magenis syndrome (SMS), a neurodevelopmental disorder characterized by dysmorphic features, intellectual disability (ID), and sleep disturbances, results from a 17p11.2 microdeletion or a mutation in the RAI1 gene. We performed exome sequencing on 6 patients with SMS-like phenotypes but without chromosomal abnormalities or RAI1 variants. We identified pathogenic de novo variants in two cases, a nonsense variant in IQSEC2 and a missense variant in the SAND domain of DEAF1, and candidate de novo missense variants in an additional two cases. One candidate variant was located in an alpha helix of Necdin (NDN), phased to the paternally inherited allele. NDN is maternally imprinted within the 15q11.2 Prader-Willi Syndrome (PWS) region. This can help clarify NDN's role in the PWS phenotype. No definitive pathogenic gene variants were detected in the remaining SMS-like cases, but we report our findings for future comparison. This study provides information about the inheritance pattern and recurrence risk for patients with identified variants and demonstrates clinical and genetic overlap of neurodevelopmental disorders. Identification and characterization of ID-related genes that assist in development of common developmental pathways and/or gene-networks, may inform disease mechanism and treatment strategies.

  6. Multiple regression methods show great potential for rare variant association tests.

    PubMed

    Xu, ChangJiang; Ladouceur, Martin; Dastani, Zari; Richards, J Brent; Ciampi, Antonio; Greenwood, Celia M T

    2012-01-01

    The investigation of associations between rare genetic variants and diseases or phenotypes has two goals. Firstly, the identification of which genes or genomic regions are associated, and secondly, discrimination of associated variants from background noise within each region. Over the last few years, many new methods have been developed which associate genomic regions with phenotypes. However, classical methods for high-dimensional data have received little attention. Here we investigate whether several classical statistical methods for high-dimensional data: ridge regression (RR), principal components regression (PCR), partial least squares regression (PLS), a sparse version of PLS (SPLS), and the LASSO are able to detect associations with rare genetic variants. These approaches have been extensively used in statistics to identify the true associations in data sets containing many predictor variables. Using genetic variants identified in three genes that were Sanger sequenced in 1998 individuals, we simulated continuous phenotypes under several different models, and we show that these feature selection and feature extraction methods can substantially outperform several popular methods for rare variant analysis. Furthermore, these approaches can identify which variants are contributing most to the model fit, and therefore both goals of rare variant analysis can be achieved simultaneously with the use of regression regularization methods. These methods are briefly illustrated with an analysis of adiponectin levels and variants in the ADIPOQ gene.

  7. The Role of Constitutional Copy Number Variants in Breast Cancer.

    PubMed

    Walker, Logan C; Wiggins, George A R; Pearson, John F

    2015-09-08

    Constitutional copy number variants (CNVs) include inherited and de novo deviations from a diploid state at a defined genomic region. These variants contribute significantly to genetic variation and disease in humans, including breast cancer susceptibility. Identification of genetic risk factors for breast cancer in recent years has been dominated by the use of genome-wide technologies, such as single nucleotide polymorphism (SNP)-arrays, with a significant focus on single nucleotide variants. To date, these large datasets have been underutilised for generating genome-wide CNV profiles despite offering a massive resource for assessing the contribution of these structural variants to breast cancer risk. Technical challenges remain in determining the location and distribution of CNVs across the human genome due to the accuracy of computational prediction algorithms and resolution of the array data. Moreover, better methods are required for interpreting the functional effect of newly discovered CNVs. In this review, we explore current and future application of SNP array technology to assess rare and common CNVs in association with breast cancer risk in humans.

  8. The concept and the variants of the activities deployment on the Moon research and exploration

    NASA Astrophysics Data System (ADS)

    Ivanov, Victor; Lukiyashchenko, Vasily; Uspenskiy, Georgy; Tselin, Andrey

    The article presents the concept and the variants of the advanced Lunar program realization for the period up to 2050, oriented to the Moon investigation and its further exploration. The basic problems are considered decided by space and Lunar means for the Moon study, their creation technical problems as well as the preliminary technical and economical cost estimations of Lunar research and exploration phases.

  9. Odor identification in frontotemporal lobar degeneration subtypes.

    PubMed

    Magerova, Hana; Vyhnalek, Martin; Laczo, Jan; Andel, Ross; Rektorova, Irena; Kadlecova, Alexandra; Bojar, Martin; Hort, Jakub

    2014-12-01

    Odor identification impairment is a feature of several neurodegenerative disorders. Although neurodegenerative changes in the frontotemporal lobar degeneration (FTLD) subtypes involve areas important for olfactory processing, data on olfactory function in these patients are limited. An 18-item, multiple-choice odor identification test developed at our memory clinic, the Motol Hospital smell test, was administered to 9 patients with behavioral variant frontotemporal dementia, 13 patients with the language variants, primary nonfluent aphasia (n = 7) and semantic dementia (n = 6), and 8 patients with progressive supranuclear palsy. Compared to the control group (n = 15), all FTLD subgroups showed significant impairment of odor identification (P < .05). The differences between the FTLD subgroups were not significant. No correlation between odor identification and neuropsychological tests results was found. Our data suggest that odor identification impairment is a symptom common to FTLD syndromes, and it seems to be based on olfactory structure damage rather than cognitive decline.

  10. Mapping post-translational modifications of mammalian testicular specific histone variant TH2B in tetraploid and haploid germ cells and their implications on the dynamics of nucleosome structure.

    PubMed

    Pentakota, Satya Krishna; Sandhya, Sankaran; P Sikarwar, Arun; Chandra, Nagasuma; Satyanarayana Rao, Manchanahalli R

    2014-12-05

    Histones regulate a variety of chromatin templated events by their post-translational modifications (PTMs). Although there are extensive reports on the PTMs of canonical histones, the information on the histone variants remains very scanty. Here, we report the identification of different PTMs, such as acetylation, methylation, and phosphorylation of a major mammalian histone variant TH2B. Our mass spectrometric analysis has led to the identification of both conserved and unique modifications across tetraploid spermatocytes and haploid spermatids. We have also computationally derived the 3-dimensional model of a TH2B containing nucleosome in order to study the spatial orientation of the PTMs identified and their effect on nucleosome stability and DNA binding potential. From our nucleosome model, it is evident that substitution of specific amino acid residues in TH2B results in both differential histone-DNA and histone-histone contacts. Furthermore, we have also observed that acetylation on the N-terminal tail of TH2B weakens the interactions with the DNA. These results provide direct evidence that, similar to somatic H2B, the testis specific histone TH2B also undergoes multiple PTMs, suggesting the possibility of chromatin regulation by such covalent modifications in mammalian male germ cells.

  11. Analysis of histones and histone variants in plants.

    PubMed

    Trivedi, Ila; Rai, Krishan Mohan; Singh, Sunil Kumar; Kumar, Verandra; Singh, Mala; Ranjan, Amol; Lodhi, Niraj; Sawant, Samir V

    2012-01-01

    Histone proteins are the major protein components of chromatin - the physiologically relevant form of the genome (or epigenome) in all eukaryotic cells. For many years, histones were considered passive structural components of eukaryotic chromatin. In recent years, it has been demonstrated that dynamic association of histones and their variants to the genome plays a very important role in gene regulation. Histones are extensively modified during posttranslation viz. acetylation, methylation, phosphorylation, ubiquitylation, etc., and the identification of these covalent marks on canonical and variant histones is crucial for the understanding of their biological significance. Different biochemical techniques have been developed to purify and separate histone proteins; here, we describe techniques for analysis of histones from plant tissues.

  12. Three functional variants of IFN regulatory factor 5 (IRF5) define risk and protective haplotypes for human lupus

    PubMed Central

    Graham, Robert R.; Kyogoku, Chieko; Sigurdsson, Snaevar; Vlasova, Irina A.; Davies, Leela R. L.; Baechler, Emily C.; Plenge, Robert M.; Koeuth, Thearith; Ortmann, Ward A.; Hom, Geoffrey; Bauer, Jason W.; Gillett, Clarence; Burtt, Noel; Cunninghame Graham, Deborah S.; Onofrio, Robert; Petri, Michelle; Gunnarsson, Iva; Svenungsson, Elisabet; Rönnblom, Lars; Nordmark, Gunnel; Gregersen, Peter K.; Moser, Kathy; Gaffney, Patrick M.; Criswell, Lindsey A.; Vyse, Timothy J.; Syvänen, Ann-Christine; Bohjanen, Paul R.; Daly, Mark J.; Behrens, Timothy W.; Altshuler, David

    2007-01-01

    Systematic genome-wide studies to map genomic regions associated with human diseases are becoming more practical. Increasingly, efforts will be focused on the identification of the specific functional variants responsible for the disease. The challenges of identifying causal variants include the need for complete ascertainment of genetic variants and the need to consider the possibility of multiple causal alleles. We recently reported that risk of systemic lupus erythematosus (SLE) is strongly associated with a common SNP in IFN regulatory factor 5 (IRF5), and that this variant altered spicing in a way that might provide a functional explanation for the reproducible association to SLE risk. Here, by resequencing and genotyping in patients with SLE, we find evidence for three functional alleles of IRF5: the previously described exon 1B splice site variant, a 30-bp in-frame insertion/deletion variant of exon 6 that alters a proline-, glutamic acid-, serine- and threonine-rich domain region, and a variant in a conserved polyA+ signal sequence that alters the length of the 3′ UTR and stability of IRF5 mRNAs. Haplotypes of these three variants define at least three distinct levels of risk to SLE. Understanding how combinations of variants influence IRF5 function may offer etiological and therapeutic insights in SLE; more generally, IRF5 and SLE illustrates how multiple common variants of the same gene can together influence risk of common disease. PMID:17412832

  13. Interactions of form and orientation

    NASA Technical Reports Server (NTRS)

    Mittelstaedt, Horst

    1989-01-01

    It is well known that the orientation of an optical pattern relative to egocentric or extraneous references affects its figural quality, that is, alters its perceived form and concomitantly delays or quickens its identification (Rock 1973). A square presented in the frontal plane to an upright person (S), for instance, changes from a box to a diamond when it is rotated with respect to the S's median plane by 45 deg. This angle, that is, the angle between the orientations of the pattern in which the two apparent figures (Gestalten) attain a summit of purity and distinctness, will be called the figural disparity of the pattern. If, as in this case, the S is upright, the retinal meridian and the subjective vertical (SV) are both in the viewer's median plane. The question arises with respect to which of these orientation references the two figures are identified. The answer may be found when the pattern and the S are oriented in such a way that the projections of the retinal meridian and the SV into the plane of the pattern diverge by the pattern's figural disparity or its periodic multiples: that is, in this case of a square by 45 or 135 deg, respectively. Similarly, which reference determines whether an equilateral triangle is seen as a pyramid or a traffic warning sign may be revealed at a divergence of SV and retinal meridian of 60 or 180 deg, respectively. It is generally found that for head roll tilts (Rho) and figural disparities of up to 90 deg, the figure whose axis coincides with the SV is seen. At head tilts of Rho=180 deg, however, the retinal reference dominates, as a rule independently of the figural disparity.

  14. Adolescents define sexual orientation and suggest ways to measure it.

    PubMed

    Friedman, Mark S; Silvestre, Anthony J; Gold, Melanie A; Markovic, Nina; Savin-Williams, Ritch C; Huggins, James; Sell, Randal L

    2004-06-01

    Researchers disagree on how to assess adolescent sexual orientation. The relative importance of various dimensions (e.g. attraction, relationships, behavior, self-labeling) is unknown, which calls into question the validity of studies assessing adolescent sexual orientation. To address this issue, 50 male and female adolescents of varied sexual orientations participated in focus groups and interviews. Two types of sexual attraction-one a physiologic reaction and the other a cognitive response-were central to adolescent sexual orientation. Participants did not perceive sexual behavior and self-identification as necessarily relevant. Preliminary items to measure sexual attraction were developed based on these adolescents' perceptions.

  15. Variant (Swine Origin) Influenza Viruses in Humans

    MedlinePlus

    ... What's this? Submit Button Past Newsletters Variant Influenza Viruses: Background and CDC Risk Assessment and Reporting Language: ... Background CDC Assessment Reporting Background On Variant Influenza Viruses Swine flu viruses do not normally infect humans. ...

  16. RAPTR-SV: a hybrid method for the detection of structural variants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Motivation: Identification of Structural Variants (SV) in sequence data results in a large number of false positive calls using existing software, which overburdens subsequent validation. Results: Simulations using RAPTR-SV and another software package that uses a similar algorithm for SV detection...

  17. Variant Humicola grisea CBH1.1

    DOEpatents

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Larenas, Edmund

    2011-08-16

    Disclosed are variants of Humicola grisea Cel7A (CBH1.1), H. jecorina CBH1 variant or S. thermophilium CBH1, nucleic acids encoding the same and methods for producing the same. The variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted.

  18. Variant Humicola grisea CBH1.1

    DOEpatents

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Larenas, Edmund

    2011-05-31

    Disclosed are variants of Humicola grisea Cel7A (CBH1.1), H. jecorina CBH1 variant or S. thermophilium CBH1, nucleic acids encoding the same and methods for producing the same. The variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted.

  19. Variant Humicola grisea CBH1.1

    DOEpatents

    Goedegebuur, Frits [Vlaardingen, NL; Gualfetti, Peter [San Francisco, CA; Mitchinson, Colin [Half Moon Bay, CA; Larenas, Edmund [Moss Beach, CA

    2012-08-07

    Disclosed are variants of Humicola grisea Cel7A (CBH1.1), H. jecorina CBH1 variant or S. thermophilium CBH1, nucleic acids encoding the same and methods for producing the same. The variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted.

  20. Variant Humicola grisea CBH1.1

    DOEpatents

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Larenas, Edmund

    2008-12-02

    Disclosed are variants of Humicola grisea Cel7A (CBH1.1), H. jecorina CBH1 variant or S. thermophilium CBH1, nucleic acids encoding the same and methods for producing the same. The variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted.

  1. DHAD variants and methods of screening

    DOEpatents

    Kelly, Kristen J.; Ye, Rick W.

    2017-02-28

    Methods of screening for dihydroxy-acid dehydratase (DHAD) variants that display increased DHAD activity are disclosed, along with DHAD variants identified by these methods. Such enzymes can result in increased production of compounds from DHAD requiring biosynthetic pathways. Also disclosed are isolated nucleic acids encoding the DHAD variants, recombinant host cells comprising the isolated nucleic acid molecules, and methods of producing butanol.

  2. Cultural variant interaction in teaching and transmission.

    PubMed

    Abrams, Marshall

    2015-01-01

    Focus on the way in which cultural variants affect other variants' probabilities of transmission in modeling and empirical work can enrich Kline's conceptualization of teaching. For example, the problem of communicating complex cumulative culture is an adaptive problem; teaching methods that manage transmission so that acquisition of some cultural variants increases the probability of acquiring others, provide a partial solution.

  3. Variant humicola grisea CBH1.1

    DOEpatents

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Edmund, Larenas

    2014-09-09

    Disclosed are variants of Humicola grisea Cel7A (CBH1.1), H. jecorina CBH1 variant or S. thermophilium CBH1, nucleic acids encoding the same and methods for producing the same. The variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted.

  4. Variant Humicola grisea CBH1.1

    DOEpatents

    Goedegeburr, Frits; Gualfetti, Peter; Mitchinson, Colin; Larenas, Edmund

    2013-02-19

    Disclosed are variants of Humicola grisea Cel7A (CBH1.1), H. jecorina CBH1 variant or S. thermophilium CBH1, nucleic acids encoding the same and methods for producing the same. The variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted.

  5. Variant Humicola grisea CBH1.1

    DOEpatents

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Larenas, Edmund

    2014-03-18

    Disclosed are variants of Humicola grisea Cel7A (CBH1.1), H. jecorina CBH1 variant or S. thermophilium CBH1, nucleic acids encoding the same and methods for producing the same. The variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted.

  6. Clinically Relevant Variants Identified in Thoracic Aortic Aneurysm Patients by Research Exome Sequencing

    PubMed Central

    Schubert, Jeffrey A.; Landis, Benjamin J.; Shikany, Amy R.; Hinton, Robert B.; Ware, Stephanie M.

    2016-01-01

    Thoracic aortic aneurysm (TAA) is a genetically heterogeneous disease involving subclinical and progressive dilation of the thoracic aorta, which can lead to life-threatening complications such as dissection or rupture. Genetic testing is important for risk stratification and identification of at risk family members, and clinically available genetic testing panels have been expanding rapidly. However, when past testing results are normal, there is little evidence to guide decision-making about the indications and timing to pursue additional clinical genetic testing. Results from research based genetic testing can help inform this process. Here we present 10 TAA patients who have a family history of disease and who enrolled in research-based exome testing. Nine of these ten patients had previous clinical genetic testing that did not identify the cause of disease. We sought to determine the number of rare variants in 23 known TAA associated genes identified by research-based exome testing. In total, we found 10 rare variants in six patients. Likely pathogenic variants included a TGFB2 variant in one patient and a SMAD3 variant in another. These variants have been reported previously in individuals with similar phenotypes. Variants of uncertain significance of particular interest included novel variants in MYLK and MFAP5, which were identified in a third patient. In total, clinically reportable rare variants were found in 6/10 (60%) patients, with at least 2/10 (20%) patients having likely pathogenic variants identified. These data indicate that consideration of re-testing is important in TAA patients with previous negative or inconclusive results. PMID:26854089

  7. Re-sequencing expands our understanding of the phenotypic impact of variants at GWAS loci.

    PubMed

    Service, Susan K; Teslovich, Tanya M; Fuchsberger, Christian; Ramensky, Vasily; Yajnik, Pranav; Koboldt, Daniel C; Larson, David E; Zhang, Qunyuan; Lin, Ling; Welch, Ryan; Ding, Li; McLellan, Michael D; O'Laughlin, Michele; Fronick, Catrina; Fulton, Lucinda L; Magrini, Vincent; Swift, Amy; Elliott, Paul; Jarvelin, Marjo-Riitta; Kaakinen, Marika; McCarthy, Mark I; Peltonen, Leena; Pouta, Anneli; Bonnycastle, Lori L; Collins, Francis S; Narisu, Narisu; Stringham, Heather M; Tuomilehto, Jaakko; Ripatti, Samuli; Fulton, Robert S; Sabatti, Chiara; Wilson, Richard K; Boehnke, Michael; Freimer, Nelson B

    2014-01-01

    Genome-wide association studies (GWAS) have identified >500 common variants associated with quantitative metabolic traits, but in aggregate such variants explain at most 20-30% of the heritable component of population variation in these traits. To further investigate the impact of genotypic variation on metabolic traits, we conducted re-sequencing studies in >6,000 members of a Finnish population cohort (The Northern Finland Birth Cohort of 1966 [NFBC]) and a type 2 diabetes case-control sample (The Finland-United States Investigation of NIDDM Genetics [FUSION] study). By sequencing the coding sequence and 5' and 3' untranslated regions of 78 genes at 17 GWAS loci associated with one or more of six metabolic traits (serum levels of fasting HDL-C, LDL-C, total cholesterol, triglycerides, plasma glucose, and insulin), and conducting both single-variant and gene-level association tests, we obtained a more complete understanding of phenotype-genotype associations at eight of these loci. At all eight of these loci, the identification of new associations provides significant evidence for multiple genetic signals to one or more phenotypes, and at two loci, in the genes ABCA1 and CETP, we found significant gene-level evidence of association to non-synonymous variants with MAF<1%. Additionally, two potentially deleterious variants that demonstrated significant associations (rs138726309, a missense variant in G6PC2, and rs28933094, a missense variant in LIPC) were considerably more common in these Finnish samples than in European reference populations, supporting our prior hypothesis that deleterious variants could attain high frequencies in this isolated population, likely due to the effects of population bottlenecks. Our results highlight the value of large, well-phenotyped samples for rare-variant association analysis, and the challenge of evaluating the phenotypic impact of such variants.

  8. Clinicopathologic Variants of Mycosis Fungoides.

    PubMed

    Muñoz-González, H; Molina-Ruiz, A M; Requena, L

    2017-04-01

    Mycosis fungoides (MF) is the most common primary cutaneous T-cell lymphoma. The clinical course of the disease is typically characterized by progression from a nonspecific phase of erythematous macules to the appearance of plaques and ultimately, in some patients, tumors. However, numerous clinical and histopathologic variants of MF with specific therapeutic and prognostic implications have been described in recent decades. Clarification of the differential diagnosis can be frustrated by the wide range of clinical manifestations and histopathologic patterns of cutaneous infiltration, particularly in the early phases of the disease. In this paper, we review the main clinical, histopathologic, and immunohistochemical characteristics of the variants of MF described in the literature in order to facilitate early diagnosis of the disease.

  9. Oncotator: cancer variant annotation tool.

    PubMed

    Ramos, Alex H; Lichtenstein, Lee; Gupta, Manaswi; Lawrence, Michael S; Pugh, Trevor J; Saksena, Gordon; Meyerson, Matthew; Getz, Gad

    2015-04-01

    Oncotator is a tool for annotating genomic point mutations and short nucleotide insertions/deletions (indels) with variant- and gene-centric information relevant to cancer researchers. This information is drawn from 14 different publicly available resources that have been pooled and indexed, and we provide an extensible framework to add additional data sources. Annotations linked to variants range from basic information, such as gene names and functional classification (e.g. missense), to cancer-specific data from resources such as the Catalogue of Somatic Mutations in Cancer (COSMIC), the Cancer Gene Census, and The Cancer Genome Atlas (TCGA). For local use, Oncotator is freely available as a python module hosted on Github (https://github.com/broadinstitute/oncotator). Furthermore, Oncotator is also available as a web service and web application at http://www.broadinstitute.org/oncotator/.

  10. A variant of Brugada syndrome

    PubMed Central

    Switzer, Maryna Popp; Agunanne, Enoch; Abbas, Aamer

    2017-01-01

    Brugada syndrome is an inherited disorder that can present with syncope, cardiac arrest, or sudden cardiac death. Multiple genetic mutations have been described that cause this disease. We present a 56-year-old man who sustained an out-of-hospital cardiac arrest, was resuscitated, and was found to have typical features of the Brugada criteria on the electrocardiogram. Genetic testing was positive for a heterozygous mutation in the sodium voltage-gated channel alpha subunit 5 (SCN5A) gene with a p. Leu227Pro (L227P) variant located on exon 6. To our knowledge, this is the first described case with this variant causing malignant arrhythmia with a cardiac arrest. PMID:28127136

  11. A variant of Brugada syndrome.

    PubMed

    Switzer, Maryna Popp; Teleb, Mohamed; Agunanne, Enoch; Abbas, Aamer

    2017-01-01

    Brugada syndrome is an inherited disorder that can present with syncope, cardiac arrest, or sudden cardiac death. Multiple genetic mutations have been described that cause this disease. We present a 56-year-old man who sustained an out-of-hospital cardiac arrest, was resuscitated, and was found to have typical features of the Brugada criteria on the electrocardiogram. Genetic testing was positive for a heterozygous mutation in the sodium voltage-gated channel alpha subunit 5 (SCN5A) gene with a p. Leu227Pro (L227P) variant located on exon 6. To our knowledge, this is the first described case with this variant causing malignant arrhythmia with a cardiac arrest.

  12. Novel pathogenic variants and genes for myopathies identified by whole exome sequencing

    PubMed Central

    Hunter, Jesse M; Ahearn, Mary Ellen; Balak, Christopher D; Liang, Winnie S; Kurdoglu, Ahmet; Corneveaux, Jason J; Russell, Megan; Huentelman, Matthew J; Craig, David W; Carpten, John; Coons, Stephen W; DeMello, Daphne E; Hall, Judith G; Bernes, Saunder M; Baumbach-Reardon, Lisa

    2015-01-01

    Neuromuscular diseases (NMD) account for a significant proportion of infant and childhood mortality and devastating chronic disease. Determining the specific diagnosis of NMD is challenging due to thousands of unique or rare genetic variants that result in overlapping phenotypes. We present four unique childhood myopathy cases characterized by relatively mild muscle weakness, slowly progressing course, mildly elevated creatine phosphokinase (CPK), and contractures. We also present two additional cases characterized by severe prenatal/neonatal myopathy. Prior extensive genetic testing and histology of these cases did not reveal the genetic etiology of disease. Here, we applied whole exome sequencing (WES) and bioinformatics to identify likely causal pathogenic variants in each pedigree. In two cases, we identified novel pathogenic variants in COL6A3. In a third case, we identified novel likely pathogenic variants in COL6A6 and COL6A3. We identified a novel splice variant in EMD in a fourth case. Finally, we classify two cases as calcium channelopathies with identification of novel pathogenic variants in RYR1 and CACNA1S. These are the first cases of myopathies reported to be caused by variants in COL6A6 and CACNA1S. Our results demonstrate the utility and genetic diagnostic value of WES in the broad class of NMD phenotypes. PMID:26247046

  13. Adolescent sexual orientation.

    PubMed

    Spigarelli, Michael G

    2007-12-01

    Sexual orientation has been defined as the patterns of sexual thoughts, fantasies, and attractions that an individual has toward other persons of the same or opposite gender. Throughout childhood and approaching adolescence, children try to understand their own sexuality and sexual orientation in the context of the society in which they live. Typically, this attempt to understand first occurs in thoughts of a sexual nature and later through actions, usually before sexual orientation is clearly defined. How these experiences are handled, by the individual and close friends and relatives, helps to define how an individual views and accepts their sexual orientation ultimately as an adult.

  14. Variant Calling From Next Generation Sequence Data.

    PubMed

    Hansen, Nancy F

    2016-01-01

    The use of next generation nucleotide sequencing to discover and genotype small sequence variants has led to numerous insights into the molecular causes of various diseases. This chapter describes the use of freely available software to align next generation sequencing reads to a reference and then to use the resulting alignments to call, annotate, view, and filter small sequence variants. The suggested variant calling workflow includes read alignment with novoalign, the removal of polymerase chain reaction duplicate sequences with samtools or bamUtils, and the detection of variants with Freebayes or bam2mpg software. ANNOVAR is then used to annotate the predicted variants using gene models, population frequencies, and predicted mutation severity, producing variant files which can be viewed and filtered with the variant display tool VarSifter.

  15. Fast space-variant elliptical filtering using box splines.

    PubMed

    Chaudhury, Kunal Narayan; Munoz-Barrutia, Arrate; Unser, Michael

    2010-09-01

    The efficient realization of linear space-variant (non-convolution) filters is a challenging computational problem in image processing. In this paper, we demonstrate that it is possible to filter an image with a Gaussian-like elliptic window of varying size, elongation and orientation using a fixed number of computations per pixel. The associated algorithm, which is based upon a family of smooth compactly supported piecewise polynomials, the radially-uniform box splines, is realized using preintegration and local finite-differences. The radially-uniform box splines are constructed through the repeated convolution of a fixed number of box distributions, which have been suitably scaled and distributed radially in an uniform fashion. The attractive features of these box splines are their asymptotic behavior, their simple covariance structure, and their quasi-separability. They converge to Gaussians with the increase of their order, and are used to approximate anisotropic Gaussians of varying covariance simply by controlling the scales of the constituent box distributions. Based upon the second feature, we develop a technique for continuously controlling the size, elongation and orientation of these Gaussian-like functions. Finally, the quasi-separable structure, along with a certain scaling property of box distributions, is used to efficiently realize the associated space-variant elliptical filtering, which requires O(1) computations per pixel irrespective of the shape and size of the filter.

  16. Decision Making In Orienteering.

    ERIC Educational Resources Information Center

    Almeida, Katia

    1997-01-01

    Eight psychometric instruments were administered to 10 elite male Portuguese orienteers. The cognitive process involved in decision making did not differ between the best orienteers and the others. This group of athletes had a high capacity for work realization and a strong need to be in control of interpersonal situations. (Author/SV)

  17. Teaching Orienteering. Second Edition.

    ERIC Educational Resources Information Center

    McNeill, Carol; Cory-Wright, Jean; Renfrew, Tom

    The educational value provided by orienteering's blend of navigational and physical skills has given it a permanent place in the primary and secondary school curriculum in the United Kingdom. This book is a reference to orienteering for teachers, leaders, and coaches. It provides a "how to" approach to introducing and developing the…

  18. Orienteering in Camping.

    ERIC Educational Resources Information Center

    Larson, Elston F.

    One of the recent developments in camping is "orienteering", a program using a map and compass. Orienteering can be dovetailed into an overall camping program and used to "point up" the entire program, or it can be confined to a single simple game. The arrangement depends on the situation. The minimum age of the participants should be about 9 or…

  19. A Primate APOL1 Variant That Kills Trypanosoma brucei gambiense

    PubMed Central

    Cooper, Anneli; Capewell, Paul; Clucas, Caroline; Veitch, Nicola; Weir, William; Thomson, Russell; Raper, Jayne; MacLeod, Annette

    2016-01-01

    Humans are protected against infection from most African trypanosomes by lipoprotein complexes present in serum that contain the trypanolytic pore-forming protein, Apolipoprotein L1 (APOL1). The human-infective trypanosomes, Trypanosoma brucei rhodesiense in East Africa and T. b. gambiense in West Africa have separately evolved mechanisms that allow them to resist APOL1-mediated lysis and cause human African trypanosomiasis, or sleeping sickness, in man. Recently, APOL1 variants were identified from a subset of Old World monkeys, that are able to lyse East African T. b. rhodesiense, by virtue of C-terminal polymorphisms in the APOL1 protein that hinder that parasite’s resistance mechanism. Such variants have been proposed as candidates for developing therapeutic alternatives to the unsatisfactory anti-trypanosomal drugs currently in use. Here we demonstrate the in vitro lytic ability of serum and purified recombinant protein of an APOL1 ortholog from the West African Guinea baboon (Papio papio), which is able to lyse examples of all sub-species of T. brucei including T. b. gambiense group 1 parasites, the most common agent of human African trypanosomiasis. The identification of a variant of APOL1 with trypanolytic ability for both human-infective T. brucei sub-species could be a candidate for universal APOL1-based therapeutic strategies, targeted against all pathogenic African trypanosomes. PMID:27494254

  20. Probing nano-scale structures of SmC* variant phases by resonant x-ray diffraction and optical probes

    NASA Astrophysics Data System (ADS)

    Huang, C. C.

    2005-03-01

    Since the identification of antiferroelectric response in one liquid crystal compound having large polarization by Chandani et al., considerable experimental and theoretical effort has been aimed to gain a much better understanding of the molecular orientation order within each phases and associated molecular interactions. Employing polarization-analyzed resonant x-ray diffraction and specially-designed state-of-the-art ellipsometry systems, we have identified the molecular arrangements in three new SmC* variant phases, namely, SmC(alpha1)*, SmC(FI2)*, and SmC(FI1)*. Moreover, guided by our proposed phenomenological model to explain the stability of these phases, we have developed a novel experimental method to identify a new mesophase, namely, SmC(alpha2)* by employing an optical probe (wavelength = 633nm) to obtain an incommensurate nano-scale helical pitch structure with pitch length < 11nm. Collaborators of this project: P. Mach, P. Johnson, D. Olson, A. Cady, X. F. Han, L. S. Hirst, A. M. Levelut, P. Barois, H. T. Nguyen, J. W. Goodby, M. Hird, H. F. Gleeson, L. Furenlid, W. Caliebe, and R. Pindak.

  1. Object Oriented Risk Analysis Workshop

    NASA Astrophysics Data System (ADS)

    Pons, M. Güell I.; Jaboyedoff, M.

    2009-04-01

    In the framework of the RISET Project (Interfaculty Network of Support to Education and Technology) an educational tool for introducing risk analysis has been developed. This workshop enables to carry a group of students (role-play game) through a step-by-step process of risk identification and quantification. The aim is to assess risk in a characteristic alpine village regarding natural hazards (rockfall, snow avalanche, flooding…) and is oriented to affected objects such as buildings, infrastructures... The workshop contains the following steps: 1.- Planning of the study and definition of stakeholders 2.- Hazard identification 3.- Risk analysis 4.- Risk assessment 5.- Proposition of mitigation measures 6- Risk management and cost-benefit analysis. During the process, information related to past events and useful concepts are provided in order to bring up discussion and decision making. The Risk Matrix and other graphical tools allow having a visual representation of the risk level and help to prioritize counter measures. At the end of the workshop, there is the possibility to compare the results between different groups and print out a summarizing report. This approach provides a rapid and comprehensible risk evaluation. The workshop is accessible from the internet and will be used for educational purposes at bachelor and master level as well as for external persons dealing with risk analysis.

  2. Crystallographic and magnetic identification of secondary phase in orientated Bi{sub 5}Fe{sub 0.5}Co{sub 0.5}Ti{sub 3}O{sub 15} ceramics

    SciTech Connect

    Palizdar, Meghdad; Comyn, Tim P.; Ward, Michael B.; Brown, Andrew P.; Harrington, John P.; Bell, Andrew J.; Kulkarni, Santosh; Keeney, Lynette; Roy, Saibal; Pemble, Martyn; Whatmore, Roger; Quinn, Christopher; Kilcoyne, Susan H.

    2012-10-01

    The fabrication of highly-oriented polycrystalline ceramics of Bi{sub 5}Fe{sub 0.5}Co{sub 0.5}Ti{sub 3}O{sub 15}, prepared via molten salt synthesis and uniaxial pressing of high aspect ratio platelets is reported. Electron backscatter images show a secondary phase within the ceramic which is rich in cobalt and iron. The concentration of the secondary phase obtained from scanning electron microscopy is estimated at less than 2% by volume, below the detection limit of x-ray diffraction (XRD). The samples were characterized by x-ray diffraction, polarization-electric field measurements, superconducting quantum interference device as a function of sample orientation and vibrating sample magnetometry as a function of temperature. It is inferred from the data that the observed ferromagnetic response is dominated by the secondary phase. This work highlights the importance of rigorous materials characterisation in the study of multiferroics as small amounts of secondary phase, below the limit of XRD, can lead to false conclusions.

  3. Histone variants: emerging players in cancer biology

    PubMed Central

    Vardabasso, Chiara; Hasson, Dan; Ratnakumar, Kajan; Chung, Chi-Yeh; Duarte, Luis F.

    2014-01-01

    Histone variants are key players in shaping chromatin structure, and, thus, in regulating fundamental cellular processes such as chromosome segregation and gene expression. Emerging evidence points towards a role for histone variants in contributing to tumor progression, and, recently, the first cancer-associated mutation in a histone variant-encoding gene was reported. In addition, genetic alterations of the histone chaperones that specifically regulate chromatin incorporation of histone variants are rapidly being uncovered in numerous cancers. Collectively, these findings implicate histone variants as potential drivers of cancer initiation and/or progression, and, therefore, targeting histone deposition or the chromatin remodeling machinery may be of therapeutic value. Here, we review the mammalian histone variants of the H2A and H3 families in their respective cellular functions, and their involvement in tumor biology. PMID:23652611

  4. Developing a market orientation.

    PubMed

    Hallums, A

    1994-03-01

    Developing a market-orientated organization is a complex task. An organization's market orientation is reflected in its ability to fulfil its customer's needs. The organization must look outside itself and adopt a flexible response to changing needs. This paper will examine what is meant by the term marketing and why it is necessary for an organization to incorporate the marketing concept. Analysis of the organization's culture and its relevance to the development of market orientation will also be considered. Reference will be made to health care where appropriate.

  5. 49 CFR 178.502 - Identification codes for packagings.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Identification codes for packagings. 178.502... FOR PACKAGINGS Non-bulk Performance-Oriented Packaging Standards § 178.502 Identification codes for packagings. (a) Identification codes for designating kinds of packagings consist of the following: (1)...

  6. The Role of Platelet-Derived Growth Factor C and Its Splice Variant in Breast Cancer

    DTIC Science & Technology

    2014-04-01

    Clin, 2014. 64(1): p. 9-29. 2. Tsai, Y.J., et al., Identification of a novel platelet -derived growth factor-like gene, fallotein, in the human ...Award Number: W81XWH-11-1-0029 TITLE: The Role of Platelet -Derived Growth Factor C and Its Splice Variant in Breast Cancer...2011–14 2014 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-11-1-0029 The Role of Platelet -Derived Growth Factor C and its Splice Variant in

  7. Orientations to Reflective Practice.

    ERIC Educational Resources Information Center

    Wellington, Bud; Austin, Patricia

    1996-01-01

    Delineates five orientations to reflective practice: immediate, technical, deliberative, dialectic, and transpersonal, each reflecting different social science bases and beliefs and values about education. Views them as interactive, interdependent, noncompeting, aspects of reflective practice. (SK)

  8. Implementing Strategic Orientation

    ERIC Educational Resources Information Center

    Fischer, Arthur K.; Brownback, Sarah

    2012-01-01

    An HRM case dealing with problems and issues of setting up orientation programs which align with corporate strategy. Discussion concerns how such a case can be used to exhibit the alignment between HRM and business strategy.

  9. Passive orientation apparatus

    DOEpatents

    Spletzer, Barry L.; Fischer, Gary J.; Martinez, Michael A.

    2001-01-01

    An apparatus that can return a payload to a known orientation after unknown motion, without requiring external power or complex mechanical systems. The apparatus comprises a faceted cage that causes the system to rest in a stable position and orientation after arbitrary motion. A gimbal is mounted with the faceted cage and holds the payload, allowing the payload to move relative to the stable faceted cage. The payload is thereby placed in a known orientation by the interaction of gravity with the geometry of the faceted cage, the mass of the system, and the motion of the payload and gimbal. No additional energy, control, or mechanical actuation is required. The apparatus is suitable for use in applications requiring positioning of a payload to a known orientation after arbitrary or uncontrolled motion, including remote sensing and mobile robot applications.

  10. UNISOR Nuclear Orientation Facility

    SciTech Connect

    Girit, I.C.

    1988-01-01

    The combination of an on-line isotope separator and a dilution refrigerator has increased the applicability of the nuclear orientation technique to a wide range of nuclei, especially those very far from stability. The UNISOR Nuclear Orientation Facility (UNISOR/NOF) is among the two (the other being NICOLE at CERN) that have recently become operational. The following is an overall view of the UNISOR system and recent results. 24 refs., 3 figs.

  11. Perceptual-cognitive skills and performance in orienteering.

    PubMed

    Guzmán, José F; Pablos, Ana M; Pablos, Carlos

    2008-08-01

    The goal was analysis of the perceptual-cognitive skills associated with sport performance in orienteering in a sample of 22 elite and 17 nonelite runners. Variables considered were memory, basic orienteering techniques, map reading, symbol knowledge, map-terrain-map identification, and spatial organisation. A computerised questionnaire was developed to measure the variables. The reliability of the test (agreement between experts) was 90%. Findings suggested that competence in performing basic orienteering techniques efficiently was a key variable differentiating between the elite and the nonelite athletes. The results are discussed in comparison with previous studies.

  12. Assigning Main Orientation to an EOH Descriptor on Multispectral Images

    PubMed Central

    Li, Yong; Shi, Xiang; Wei, Lijun; Zou, Junwei; Chen, Fang

    2015-01-01

    This paper proposes an approach to compute an EOH (edge-oriented histogram) descriptor with main orientation. EOH has a better matching ability than SIFT (scale-invariant feature transform) on multispectral images, but does not assign a main orientation to keypoints. Alternatively, it tends to assign the same main orientation to every keypoint, e.g., zero degrees. This limits EOH to matching keypoints between images of translation misalignment only. Observing this limitation, we propose assigning to keypoints the main orientation that is computed with PIIFD (partial intensity invariant feature descriptor). In the proposed method, SIFT keypoints are detected from images as the extrema of difference of Gaussians, and every keypoint is assigned to the main orientation computed with PIIFD. Then, EOH is computed for every keypoint with respect to its main orientation. In addition, an implementation variant is proposed for fast computation of the EOH descriptor. Experimental results show that the proposed approach performs more robustly than the original EOH on image pairs that have a rotation misalignment. PMID:26140348

  13. Proteomic characterization of histone variants in the mouse testis by mass spectrometry-based top-down analysis.

    PubMed

    Kwak, Ho-Geun; Dohmae, Naoshi

    2016-11-15

    Various histones, including testis-specific histones, exist during spermatogenesis and some of them have been reported to play a key role in chromatin remodeling. Mass spectrometry (MS)-based characterization has become the important step to understand histone structures. Although individual histones or partial histone variant groups have been characterized, the comprehensive analysis of histone variants has not yet been conducted in the mouse testis. Here, we present the comprehensive separation and characterization of histone variants from mouse testes by a top-down approach using MS. Histone variants were successfully separated on a reversed phase column using high performance liquid chromatography (HPLC) with an ion-pairing reagent. Increasing concentrations of testis-specific histones were observed in the mouse testis and some somatic histones increased in the epididymis. Specifically, the increase of mass abundance in H3.2 in the epididymis was inversely proportional to the decrease in H3t in the testis, which was approximately 80%. The top-down characterization of intact histone variants in the mouse testis was performed using LC-MS/MS. The masses of separated histone variants and their expected post-translation modifications were calculated by performing deconvolution with information taken from the database. TH2A, TH2B and H3t were characterized by MS/MS fragmentation. Our approach provides comprehensive knowledge for identification of histone variants in the mouse testis that will contribute to the structural and functional research of histone variants during spermatogenesis.

  14. [Normokalemic variant of paroxysmal myoplegia].

    PubMed

    Il'ina, N A; Aver'ianov, Iu N; Antipova, R I; Sokolina, N A; Maksimenko, I M

    1977-01-01

    For the first time in Soviet literature the authors describe a family where patients from 2 generations suffered from normokalemic periodical paralysis. The patients had undergone several examinations which confirmed this diagnosis. This report confirms the existence of a normopotassemic variant of periodical paralysis. The authors demonstrate the absence of a direct relation between the development of myoplegic attacks in these patients and disorders of the electrolyte balance. The histological studies of the muscular biopsy during the attacks detected a vacuolization of muscular fiberes. Histochemical studies of some metabolities of the carbohydrate metabolism did not detect any significant changes. The achieved results point only to an increase of the glyconeogenesis process and aerobie glycolisis.¿

  15. Turner syndrome and its variants.

    PubMed

    Bharath, R; Unnikrishnan, A G; Thampy, M V; Anilkumar, Alka; Nisha, B; Praveen, V P; Nair, Vasantha; Jayakumar, R V; Kumar, Harish

    2010-02-01

    Case records of female patients with karyotype proven turner syndrome were analyzed. 11 patients had classic Turner karyotype (Group 1) and 13 patients had karyotype suggestive of one of the variants of Turner syndrome (Group 2). There was a median difference of 3 years between the age of presentation and the age of diagnosis in Group 2. Out of the thirteen patients in Group 2, 4 had no clinical stigmata of Turner Syndrome; the rest (n=9) had one or more of the typical clinical stigmata of Turner Syndrome. One patient with a complex mosaic karyotype also had an intracranial medulloblastoma. One patient in each group had coarctation of the aorta. 5 patients in Group 1 and 3 patients in Group 2 had primary hypothyroidism and received levothyroxine. The median Thyroid Stimulating Hormone levels were significantly higher among patients in group 1 than in group 2.

  16. Primary pleural liposarcoma, pleomorphic variant.

    PubMed

    Carrillo B, Jorge Alberto; Navarrete, Constanza; López Arias, María Alejandra; Peláez, Mauricio

    2014-09-01

    Primary pleural liposarcoma (PPL) is a rare tumor derived from primitive mesenchymal tissue. We report a case of a 49-year-old female patient complaining of thoracic pain and dyspnea for 3 months. The chest X-ray showed a left basal opacity of lobulated contours and the thoracic computer tomography (CT) scan revealed a left pleural collection/mass, of 18 HU density and passive pulmonary atelectasis. The patient was taken to surgery and the cytologic examination of the gelatinous mass found in the procedure confirmed the diagnosis of a pleomorphic variant of pleural liposarcoma. We emphasise in the importance of careful inspection of the origin of the tumor in the diagnostic images to allow accurate diagnosis.

  17. Functional testing strategy for coding genetic variants of unclear significance in MLH1 in Lynch syndrome diagnosis.

    PubMed

    Hinrichsen, Inga; Schäfer, Dieter; Langer, Deborah; Köger, Nicole; Wittmann, Margarethe; Aretz, Stefan; Steinke, Verena; Holzapfel, Stefanie; Trojan, Jörg; König, Rainer; Zeuzem, Stefan; Brieger, Angela; Plotz, Guido

    2015-02-01

    Lynch syndrome is caused by inactivating mutations in the MLH1 gene, but genetic variants of unclear significance frequently preclude diagnosis. Functional testing can reveal variant-conferred defects in gene or protein function. Based on functional defect frequencies and clinical applicability of test systems, we developed a functional testing strategy aimed at efficiently detecting pathogenic defects in coding MLH1 variants. In this strategy, tests of repair activity and expression are prioritized over analyses of subcellular protein localization and messenger RNA (mRNA) formation. This strategy was used for four unclear coding MLH1 variants (p.Asp41His, p.Leu507Phe, p.Gln689Arg, p.Glu605del + p.Val716Met). Expression was analyzed using a transfection system, mismatch repair (MMR) activity by complementation in vitro, mRNA formation by reverse transcriptase-PCR in carrier lymphocyte mRNA, and subcellular localization with dye-labeled fusion constructs. All tests included clinically meaningful controls. The strategy enabled efficient identification of defects in two unclear variants: the p.Asp41His variant showed loss of MMR activity, whereas the compound variant p.Glu605del + p.Val716Met had a defect of expression. This expression defect was significantly stronger than the pathogenic expression reference variant analyzed in parallel, therefore the defect of the compound variant is also pathogenic. Interestingly, the expression defect was caused additively by both of the compound variants, at least one of which is non-pathogenic when occurring by itself. Tests were neutral for p.Leu507Phe and p.Gln689Arg, and the results were consistent with available clinical data. We finally discuss the improved sensitivity and efficiency of the applied strategy and its limitations in analyzing unclear coding MLH1 variants.

  18. Hemoglobin analyses in the Netherlands reveal more than 80 different variants including six novel ones.

    PubMed

    van Zwieten, Rob; Veldthuis, Martijn; Delzenne, Barend; Berghuis, Jeffrey; Groen, Joke; Ait Ichou, Fatima; Clifford, Els; Harteveld, Cornelis L; Stroobants, An K

    2014-01-01

    More than 20,000 blood samples of individuals living in The Netherlands and suspected of hemolytic anemia or diabetes were analyzed by high resolution cation exchange high performance liquid chromatography (HPLC). Besides common disease-related hemoglobins (Hbs), rare variants were also detected. The variant Hbs were retrospectively analyzed by capillary zone electrophoresis (CZE) and by isoelectric focusing (IEF). For unambiguous identification, the globin genes were sequenced. Most of the 80 Hb variants detected by initial screening on HPLC were also separated by capillary electrophoresis (CE), but a few variants were only detectable with one of these methods. Some variants were unstable, had thalassemic properties or increased oxygen affinity, and some interfered with Hb A2 measurement, detection of sickle cell Hb or Hb A1c quantification. Two of the six novel variants, Hb Enschede (HBA2: c.308G  > A, p.Ser103Asn) and Hb Weesp (HBA1: c.301C > T, p.Leu101Phe), had no clinical consequences. In contrast, two others appeared clinically significant: Hb Ede (HBB: c.53A > T, p.Lys18Met) caused thalassemia and Hb Waterland (HBB: c.428C > T, pAla143Val) was related to mild polycytemia. Hb A2-Venlo (HBD: c.193G > A, p.Gly65Ser) and Hb A2-Rotterdam (HBD: c.38A > C, p.Asn13Thr) interfered with Hb A2 quantification. This survey shows that HPLC analysis followed by globin gene sequencing of rare variants is an effective method to reveal Hb variants.

  19. Automated segmentation of the lamina cribrosa using Frangi's filter: a novel approach for rapid identification of tissue volume fraction and beam orientation in a trabeculated structure in the eye.

    PubMed

    Campbell, Ian C; Coudrillier, Baptiste; Mensah, Johanne; Abel, Richard L; Ethier, C Ross

    2015-03-06

    The lamina cribrosa (LC) is a tissue in the posterior eye with a complex trabecular microstructure. This tissue is of great research interest, as it is likely the initial site of retinal ganglion cell axonal damage in glaucoma. Unfortunately, the LC is difficult to access experimentally, and thus imaging techniques in tandem with image processing have emerged as powerful tools to study the microstructure and biomechanics of this tissue. Here, we present a staining approach to enhance the contrast of the microstructure in micro-computed tomography (micro-CT) imaging as well as a comparison between tissues imaged with micro-CT and second harmonic generation (SHG) microscopy. We then apply a modified version of Frangi's vesselness filter to automatically segment the connective tissue beams of the LC and determine the orientation of each beam. This approach successfully segmented the beams of a porcine optic nerve head from micro-CT in three dimensions and SHG microscopy in two dimensions. As an application of this filter, we present finite-element modelling of the posterior eye that suggests that connective tissue volume fraction is the major driving factor of LC biomechanics. We conclude that segmentation with Frangi's filter is a powerful tool for future image-driven studies of LC biomechanics.

  20. Automated segmentation of the lamina cribrosa using Frangi's filter: a novel approach for rapid identification of tissue volume fraction and beam orientation in a trabeculated structure in the eye

    PubMed Central

    Campbell, Ian C.; Coudrillier, Baptiste; Mensah, Johanne; Abel, Richard L.; Ethier, C. Ross

    2015-01-01

    The lamina cribrosa (LC) is a tissue in the posterior eye with a complex trabecular microstructure. This tissue is of great research interest, as it is likely the initial site of retinal ganglion cell axonal damage in glaucoma. Unfortunately, the LC is difficult to access experimentally, and thus imaging techniques in tandem with image processing have emerged as powerful tools to study the microstructure and biomechanics of this tissue. Here, we present a staining approach to enhance the contrast of the microstructure in micro-computed tomography (micro-CT) imaging as well as a comparison between tissues imaged with micro-CT and second harmonic generation (SHG) microscopy. We then apply a modified version of Frangi's vesselness filter to automatically segment the connective tissue beams of the LC and determine the orientation of each beam. This approach successfully segmented the beams of a porcine optic nerve head from micro-CT in three dimensions and SHG microscopy in two dimensions. As an application of this filter, we present finite-element modelling of the posterior eye that suggests that connective tissue volume fraction is the major driving factor of LC biomechanics. We conclude that segmentation with Frangi's filter is a powerful tool for future image-driven studies of LC biomechanics. PMID:25589572

  1. A multivariate analysis of kinanthropometric profiles of elite female orienteers.

    PubMed

    Creagh, U; Reilly, T

    1995-03-01

    The purpose of this study was to examine the relevance of various kinanthropometric features of elite female orienteers in terms of success at the Student World Orienteering Championships (SWOC)(1992). Participants at this competition were divided into successful (final placing in top 35; n = 12) and less successful (final placing below 35; n = 11) competitors. A non-orienteering reference group was used to enable the identification of any sport specific factors. Measurements of the orienteering group were taken during the week of the SWOC and included 5 skinfold thicknesses, 2 limb girths, 2 bone breadths, 3 proportional lengths and 3 physical tests (grip strength, leg strength, flexibility). Using the results of these, percent adiposity, somatotypes and various anthropometric indices were also obtained. Age and adiposity variables were found to correlate significantly with competitive performance (p < 0.01). Discriminant function analysis successfully distinguished between the successful and less successful orienteers (Wilks' Lambda = 0.603; p < 0.01). There was no difference (p > 0.05) between the orienteering group and the reference group for the majority of the proportionality measures and similarily in the results of the physical tests. Adiposity values were higher in the non-orienteers. In conclusion, body composition measures discriminated between successful and less successful orienteers at a major event at an elite level. The primary difference between the orienteers and the reference group was in body composition rather than linear or proportional measures.

  2. Congenital pancreatic anomalies, variants, and conditions.

    PubMed

    Alexander, Lauren F

    2012-05-01

    Understanding pancreatic development and the congenital anomalies and variants that result from alterations in normal development allows for better recognition of these anomalies at diagnostic imaging. This article reviews normal pancreatic embryology and anatomy, and the appearance of the more common developmental anomalies and ductal variants, with emphasis on computed tomography and magnetic resonance imaging. Common mimics of masses are also covered.

  3. Beta-glucosidase I variants with improved properties

    SciTech Connect

    Bott, Richard R.; Kaper, Thijs; Kelemen, Bradley; Goedegebuur, Frits; Hommes, Ronaldus Wilhelmus; Kralj, Slavko; Kruithof, Paulien; Nikolaev, Igor; Van Der Kley, Wilhelmus Antonious Hendricus; Van Lieshout, Johannes Franciscus Thomas; Van Stigt Thans, Sander

    2016-09-20

    The present disclosure is generally directed to enzymes and in particular beta-glucosidase variants. Also described are nucleic acids encoding beta-glucosidase variants, compositions comprising beta-glucosidase variants, methods of using beta-glucosidase variants, and methods of identifying additional useful beta-glucosidase variants.

  4. Shock Condition Forensics and Cryptic Phase Transformations from Crystallographic Orientation Relationships in Zircon

    NASA Astrophysics Data System (ADS)

    Timms, N. E.; Erickson, T. M.; Cavosie, A. J.; Pearce, M. A.; Reddy, S. M.; Zanetti, M.; Tohver, E.; Schmieder, M.; Nemchin, A. A.; Wittmann, A.

    2016-08-01

    We present an approach to constrain pressure and temperature conditions during impact events involving identification of cryptic histories of phase transformations from orientation relationships in shocked zircon, linked to new P-T phase diagrams.

  5. Visualizing the geography of genetic variants.

    PubMed

    Marcus, Joseph H; Novembre, John

    2016-10-14

    One of the key characteristics of any genetic variant is its geographic distribution. The geographic distribution can shed light on where an allele first arose, what populations it has spread to, and in turn on how migration, genetic drift, and natural selection have acted. The geographic distribution of a genetic variant can also be of great utility for medical/clinical geneticists and collectively many genetic variants can reveal population structure. Here we develop an interactive visualization tool for rapidly displaying the geographic distribution of genetic variants. Through a REST API and dynamic front-end, the Geography of Genetic Variants (GGV) browser (http://popgen.uchicago.edu/ggv/) provides maps of allele frequencies in populations distributed across the globe.

  6. Schools as Sites for Constructing Minority Sexual Orientations

    ERIC Educational Resources Information Center

    Diorio, Joseph A.

    2006-01-01

    Sexual self-identification is seen as a finding of oneself. Much of the literature on the victimization of sexual minority youth takes the underlying reality of sexual orientations as given, and then addresses the objectionable ways in which minority youth are treated. That is, sexual classifications are taken as real, whereas the social responses…

  7. Development of an Interest-Oriented Occupational Classification System.

    ERIC Educational Resources Information Center

    Droege, Robert C.; Padgett, Adaline

    1979-01-01

    Summarizes research to develop a comprehensive and coordinated occupational testing and classification system. An extension of this research led to identification of measurable interest factors which are incorporated in a trait-oriented occupational classification structure contained in USES Guide for Occupational Exploration, a supplement to the…

  8. Dopamine system genes are associated with orienting bias among healthy individuals.

    PubMed

    Zozulinsky, Polina; Greenbaum, Lior; Brande-Eilat, Noa; Braun, Yair; Shalev, Idan; Tomer, Rachel

    2014-09-01

    Healthy individuals display subtle orienting bias, manifested as a tendency to direct greater attention toward one hemispace, and evidence suggests that this bias reflects an individual trait, which may be modulated by asymmetric dopamine signaling in striatal and frontal regions. The current study examined the hypothesis that functional genetic variants within dopaminergic genes (DAT1 3' VNTR, dopamine D2 receptor Taq1A (rs1800497) and COMT Val158Met (rs4680)) contribute to individual differences in orienting bias, as measured by the greyscales paradigm, in a sample of 197 young healthy Israeli Jewish participants. For the Taq1A variant, homozygous carriers of the A2 allele displayed significantly increased leftward orienting bias compared to the carriers of the A1 allele. Additionally, and as previously reported by others, we found that bias towards leftward orienting of attention was significantly greater among carriers of the 9-repeat allele of the DAT1 3' VNTR as compared to the individuals who were homozygous for the 10-repeat allele. No significant effect of the COMT Val158Met on orienting bias was found. Taken together, our findings support the potential influence of genetic variants on inter-individual differences in orienting bias, a phenotype relevant to both normal and impaired cognitive processes.

  9. Oriental upper blepharoplasty.

    PubMed

    Weng, Chau-Jin

    2009-02-01

    Aesthetic surgery of the upper eyelids is a very common procedure performed in cosmetic practices around the world. The word blepharoplasty, however, has a different meaning in Asia than it does elsewhere. Orientals have different periorbital anatomic characteristics, their motivations for seeking eyelid treatment are different, and operative techniques have been adapted consequently. There are also many eyelid shapes among Orientals, mostly with regard to the presence and location of the supratarsal fold and/or presence of an epicanthal fold. The surgeon must therefore master a range of surgical procedures to treat these variations adequately. It is critical to know the indications for each blepharoplasty technique as well as their complications to select the right surgery and avoid unfavorable results. Epicanthoplasty performed on the right patient can greatly improve aesthetic results while retaining ethnic characteristics. This article will discuss Oriental eyelid characteristics, preoperative patient assessment, commonly used corrective techniques for the "double-eyelid" creation, and complications and how to avoid them.

  10. Molecular Orientation in Quantasomes

    PubMed Central

    Sauer, Kenneth

    1965-01-01

    A new apparatus is described for measuring dichroism spectra with very high sensitivity for macromolecular structures oriented in a hydrodynamic gradient. The method has been used to explore the dichroism spectrum of quantasome aggregates isolated from spinach chloroplasts. The quantasome flow dichroism resembles qualitatively that observed previously using electric field orientation, in that a pigment absorbing at wavelengths longer than 680 mμ exhibits appreciably greater dichroism than those absorbing at shorter wavelengths. It is shown that the absorption oscillator for this long wavelength absorption lies parallel to the streamlines of the sheer gradient, which is assumed to be the direction in which the planes of the chloroplast lamellae are oriented. PMID:19431337

  11. The position and orientation system (POS) for airborne survey applications

    SciTech Connect

    Reid, B.; Scherzinger, B.; Lithopoulos, E.

    1996-10-01

    The Position and Orientation System (POS) is an integrated inertial/GPS system that generates accurate position (latitude, longitude, altitude) and orientation (roll, pitch, heading) for airborne survey/mapping applications as well as various other land and marine applications. POS is a GPS-aided strapdown inertial navigator that uses a Kalman filter and a closed-loop error controller to provide an optimally blended position and orientation solution from inertial data from an IMU and aiding data from a GPS receiver. This paper gives a brief description of POS and compares it to other available technologies. It then describes the various application areas of POS for airborne vehicles (POS/AV). Some applications from other POS variants, POS/LV for Land Vehicles, POS/MV for Marine Vessels, are also described. 4 refs., 4 figs., 1 tab.

  12. Orientational order in disordered superconductors

    SciTech Connect

    Toner, J. )

    1991-05-13

    Orientational order in weakly pinned Abrikosov flux lattices is studied, taking into account two heretofore neglected effects: dislocations and orientational couplings to the underlying lattice. Without orientational couplings, arbitrarily weak pinning destroys long-ranged orientational order for all spatial dimensions {ital d}{lt}4. Orientational couplings stabilize long-ranged orientational order. For fields along an axis of {ital fourfold} symmetry, {ital sixfold} (hexatic) orientational order is described by a random-field Ising model, and so does not occur in {ital d}=2 (thin films) but does in {ital d}=3 (bulk).

  13. Topography and pigeon orientation

    NASA Technical Reports Server (NTRS)

    Wagner, G.

    1972-01-01

    Two types of homing experiments with pigeons to determine the influence of topographical features on the orientation behavior of the birds are discussed. The releases and following were conducted by ground experiments in which the birds are tracked by visual observation at points of topographical interest and the helicopter method by which the birds are tracked throughout the entire flight. The ground experiments showed a strong influence of topographical features on initial orientation. The helicopter experiments showed that the ground experiments do not provide adequate information on the manner in which homing occurs.

  14. Chemokine gene variants in schizophrenia.

    PubMed

    Dasdemir, Selcuk; Kucukali, Cem Ismail; Bireller, Elif Sinem; Tuzun, Erdem; Cakmakoglu, Bedia

    2016-08-01

    Background Chemokines are known to play a major role in driving inflammation and immune responses in several neuroinflammatory diseases, including multiple sclerosis, Alzheimer's disease and Parkinson's disease. Inflammation has also been implicated in the pathogenesis of schizophrenia. Aim We aimed to investigate a potential link between chemokines and schizophrenia and analyze the role of MCP-1-A2518G, SDF-1-3'A, CCR5-delta32, CCR5-A55029G, CXCR4-C138T and CCR2-V64I gene polymorphisms in the Turkish population. Methods Genotyping was conducted by PCR-RFLP based on 140 patients and 123 unrelated healthy controls to show the relation between chemokine gene variants and schizophrenia risk. Results Frequencies of CCR5-A55029G A genotypes and CCR5-A55029G AG genotypes were found higher in patients than the controls and even also CCR2-V64I WT: CCR5-A55029G A and CCR2-V64I 64I: CCR5-A55029G A haplotypes significantly associated according to Bonferroni correction. However, no significant association was found for any of the other polymorphisms with the risk of schizophrenia. Conclusions Our findings suggest that CCR5-A55029G polymorphisms and CCR2-V64I WT: CCR5-A55029G A and CCR2-V64I 64I: CCR5-A55029G A haplotypes might have association with schizophrenia pathogenesis.

  15. Prioritizing Rare Variants with Conditional Likelihood Ratios

    PubMed Central

    Li, Weili; Dobbins, Sara; Tomlinson, Ian; Houlston, Richard; Pal, Deb K.; Strug, Lisa J.

    2016-01-01

    Background Prioritizing individual rare variants within associated genes or regions often consists of an ad hoc combination of statistical and biological considerations. From the statistical perspective, rare variants are often ranked using Fisher’s exact p values, which can lead to different rankings of the same set of variants depending on whether 1- or 2-sided p values are used. Results We propose a likelihood ratio-based measure, maxLRc, for the statistical component of ranking rare variants under a case-control study design that avoids the hypothesis-testing paradigm. We prove analytically that the maxLRc is always well-defined, even when the data has zero cell counts in the 2×2 disease-variant table. Via simulation, we show that the maxLRc outperforms Fisher’s exact p values in most practical scenarios considered. Using next-generation sequence data from 27 rolandic epilepsy cases and 200 controls in a region previously shown to be linked to and associated with rolandic epilepsy, we demonstrate that rankings assigned by the maxLRc and exact p values can differ substantially. Conclusion The maxLRc provides reliable statistical prioritization of rare variants using only the observed data, avoiding the need to specify parameters associated with hypothesis testing that can result in ranking discrepancies across p value procedures; and it is applicable to common variant prioritization. PMID:25659987

  16. Reduction of Cellular Expression Levels Is a Common Feature of Functionally Affected Pendrin (SLC26A4) Protein Variants

    PubMed Central

    de Moraes, Vanessa C S; Bernardinelli, Emanuele; Zocal, Nathalia; Fernandez, Jhonathan A; Nofziger, Charity; Castilho, Arthur M; Sartorato, Edi L; Paulmichl, Markus; Dossena, Silvia

    2016-01-01

    Sequence alterations in the pendrin gene (SLC26A4) leading to functionally affected protein variants are frequently involved in the pathogenesis of syndromic and nonsyndromic deafness. Considering the high number of SLC26A4 sequence alterations reported to date, discriminating between functionally affected and unaffected pendrin protein variants is essential in contributing to determine the genetic cause of deafness in a given patient. In addition, identifying molecular features common to the functionally affected protein variants can be extremely useful to design future molecule-directed therapeutic approaches. Here we show the functional and molecular characterization of six previously uncharacterized pendrin protein variants found in a cohort of 58 Brazilian deaf patients. Two variants (p.T193I and p.L445W) were undetectable in the plasma membrane, completely retained in the endoplasmic reticulum and showed no transport function; four (p.P142L, p.G149R, p.C282Y and p.Q413R) showed reduced function and significant, although heterogeneous, expression levels in the plasma membrane. Importantly, total expression levels of all of the functionally affected protein variants were significantly reduced with respect to the wild-type and a fully functional variant (p.R776C), regardless of their subcellular localization. Interestingly, reduction of expression may also reduce the transport activity of variants with an intrinsic gain of function (p.Q413R). As reduction of overall cellular abundance was identified as a common molecular feature of pendrin variants with affected function, the identification of strategies to prevent reduction in expression levels may represent a crucial step of potential future therapeutic interventions aimed at restoring the transport activity of dysfunctional pendrin variants. PMID:26752218

  17. Genome-Wide Study of Structural Variants in Bovine Holstein, Montbéliarde and Normande Dairy Breeds

    PubMed Central

    Boussaha, Mekki; Esquerré, Diane; Barbieri, Johanna; Djari, Anis; Pinton, Alain; Letaief, Rabia; Salin, Gérald; Escudié, Frédéric; Roulet, Alain; Fritz, Sébastien; Samson, Franck; Grohs, Cécile; Bernard, Maria; Klopp, Christophe; Boichard, Didier; Rocha, Dominique

    2015-01-01

    High-throughput sequencing technologies have offered in recent years new opportunities to study genome variations. These studies have mostly focused on single nucleotide polymorphisms, small insertions or deletions and on copy number variants. Other structural variants, such as large insertions or deletions, tandem duplications, translocations, and inversions are less well-studied, despite that some have an important impact on phenotypes. In the present study, we performed a large-scale survey of structural variants in cattle. We report the identification of 6,426 putative structural variants in cattle extracted from whole-genome sequence data of 62 bulls representing the three major French dairy breeds. These genomic variants affect DNA segments greater than 50 base pairs and correspond to deletions, inversions and tandem duplications. Out of these, we identified a total of 547 deletions and 410 tandem duplications which could potentially code for CNVs. Experimental validation was carried out on 331 structural variants using a novel high-throughput genotyping method. Out of these, 255 structural variants (77%) generated good quality genotypes and 191 (75%) of them were validated. Gene content analyses in structural variant regions revealed 941 large deletions removing completely one or several genes, including 10 single-copy genes. In addition, some of the structural variants are located within quantitative trait loci for dairy traits. This study is a pan-genome assessment of genomic variations in cattle and may provide a new glimpse into the bovine genome architecture. Our results may also help to study the effects of structural variants on gene expression and consequently their effect on certain phenotypes of interest. PMID:26317361

  18. Genome-Wide Study of Structural Variants in Bovine Holstein, Montbéliarde and Normande Dairy Breeds.

    PubMed

    Boussaha, Mekki; Esquerré, Diane; Barbieri, Johanna; Djari, Anis; Pinton, Alain; Letaief, Rabia; Salin, Gérald; Escudié, Frédéric; Roulet, Alain; Fritz, Sébastien; Samson, Franck; Grohs, Cécile; Bernard, Maria; Klopp, Christophe; Boichard, Didier; Rocha, Dominique

    2015-01-01

    High-throughput sequencing technologies have offered in recent years new opportunities to study genome variations. These studies have mostly focused on single nucleotide polymorphisms, small insertions or deletions and on copy number variants. Other structural variants, such as large insertions or deletions, tandem duplications, translocations, and inversions are less well-studied, despite that some have an important impact on phenotypes. In the present study, we performed a large-scale survey of structural variants in cattle. We report the identification of 6,426 putative structural variants in cattle extracted from whole-genome sequence data of 62 bulls representing the three major French dairy breeds. These genomic variants affect DNA segments greater than 50 base pairs and correspond to deletions, inversions and tandem duplications. Out of these, we identified a total of 547 deletions and 410 tandem duplications which could potentially code for CNVs. Experimental validation was carried out on 331 structural variants using a novel high-throughput genotyping method. Out of these, 255 structural variants (77%) generated good quality genotypes and 191 (75%) of them were validated. Gene content analyses in structural variant regions revealed 941 large deletions removing completely one or several genes, including 10 single-copy genes. In addition, some of the structural variants are located within quantitative trait loci for dairy traits. This study is a pan-genome assessment of genomic variations in cattle and may provide a new glimpse into the bovine genome architecture. Our results may also help to study the effects of structural variants on gene expression and consequently their effect on certain phenotypes of interest.

  19. Diversity in a honey bee pathogen: first report of a third master variant of the Deformed Wing Virus quasispecies.

    PubMed

    Mordecai, Gideon J; Wilfert, Lena; Martin, Stephen J; Jones, Ian M; Schroeder, Declan C

    2016-05-01

    Treatment of emerging RNA viruses is hampered by the high mutation and replication rates that enable these viruses to operate as a quasispecies. Declining honey bee populations have been attributed to the ectoparasitic mite Varroa destructor and its affiliation with Deformed Wing Virus (DWV). In the current study we use next-generation sequencing to investigate the DWV quasispecies in an apiary known to suffer from overwintering colony losses. We show that the DWV species complex is made up of three master variants. Our results indicate that a new DWV Type C variant is distinct from the previously described types A and B, but together they form a distinct clade compared with other members of the Iflaviridae. The molecular clock estimation predicts that Type C diverged from the other variants ∼319 years ago. The discovery of a new master variant of DWV has important implications for the positive identification of the true pathogen within global honey bee populations.

  20. Diversity in a honey bee pathogen: first report of a third master variant of the Deformed Wing Virus quasispecies

    PubMed Central

    Mordecai, Gideon J; Wilfert, Lena; Martin, Stephen J; Jones, Ian M; Schroeder, Declan C

    2016-01-01

    Treatment of emerging RNA viruses is hampered by the high mutation and replication rates that enable these viruses to operate as a quasispecies. Declining honey bee populations have been attributed to the ectoparasitic mite Varroa destructor and its affiliation with Deformed Wing Virus (DWV). In the current study we use next-generation sequencing to investigate the DWV quasispecies in an apiary known to suffer from overwintering colony losses. We show that the DWV species complex is made up of three master variants. Our results indicate that a new DWV Type C variant is distinct from the previously described types A and B, but together they form a distinct clade compared with other members of the Iflaviridae. The molecular clock estimation predicts that Type C diverged from the other variants ∼319 years ago. The discovery of a new master variant of DWV has important implications for the positive identification of the true pathogen within global honey bee populations. PMID:26574686

  1. Annotated checklist and key to species of Gryllotalpa (Orthoptera: Gryllotalpidae) from the Oriental region.

    PubMed

    Tan, Ming Kai

    2016-06-28

    The cosmopolitan Gryllotalpa mole cricket is the most speciose genus (70 species) in the family Gryllotalpidae. The taxonomy and diversity of Oriental species are not well understood. A species list with 26 species is presented here. An artificial key is also presented aimed to help with species identification, new species discovery and future taxonomic revision in the biodiverse Oriental region.

  2. New Faculty Orientation Plan.

    ERIC Educational Resources Information Center

    Triton Coll., River Grove, IL.

    This report provides an overview of Triton College's (Illinois) New Faculty Orientation Plan, which was developed in light of the large number of retirements and new hires expected by the year 2000. The purpose of the plan is to assist newly hired instructors to move productively into their professional roles and to become actively involved in the…

  3. Geography and Orienteering

    ERIC Educational Resources Information Center

    Adams, W. P.

    1972-01-01

    Orienteering is a rapidly growing sport, developed in Sweden, which has great possibilities for education in geography. It can be conceived as an organizing device for outdoor work and as a basis for developing map skills and for map construction. (Author)

  4. A cast orientation index.

    PubMed

    Ivanhoe, J R; Mahanna, G K

    1994-12-01

    This article describes a technique that allows multiple master casts to be precisely oriented to the same path of insertion and withdrawal. This technique is useful in situations where multiple fixed prosthodontic preparations require surveyed restorations and a single master cast is not available.

  5. Vicarious Achievement Orientation.

    ERIC Educational Resources Information Center

    Leavitt, Harold J.; And Others

    This study tests hypotheses about achievement orientation, particularly vicarious achievement. Undergraduate students (N=437) completed multiple-choice questionnaires, indicating likely responses of one person to the success of another. The sex of succeeder and observer, closeness of relationship, and setting (medical school or graduate school of…

  6. Object Oriented Learning Objects

    ERIC Educational Resources Information Center

    Morris, Ed

    2005-01-01

    We apply the object oriented software engineering (OOSE) design methodology for software objects (SOs) to learning objects (LOs). OOSE extends and refines design principles for authoring dynamic reusable LOs. Our learning object class (LOC) is a template from which individualised LOs can be dynamically created for, or by, students. The properties…

  7. Sierra Madre Oriental, Mexico

    NASA Technical Reports Server (NTRS)

    1985-01-01

    This view of the Sierra Madre Oriental, Mexico (26.5N, 102.0W) west of Monclova, shows a mining region of northern Mexico. Mine tailings can be seen on the mountain slopes and in the valley floor. In addition to mining activity, several irrigated agricultural areas supporting the local communities can be seen in the area.

  8. An orientable search coil

    NASA Astrophysics Data System (ADS)

    Holt, P. J.; Poblocki, M.

    2017-01-01

    We provide a design for a low cost orientable search coil that can be used to investigate the variation of magnetic flux with angle. This experiment is one of the required practical activities in the current A level physics specification for the AQA examination board in the UK. We demonstrate its performance and suggest other suitable investigations that can be undertaken.

  9. Genetics of allergy and allergic sensitization: common variants, rare mutations

    PubMed Central

    Bønnelykke, Klaus; Sparks, Rachel; Waage, Johannes; Milner, Joshua D

    2015-01-01

    Our understanding of the specific genetic lesions in allergy has improved in recent years due to identification of common risk variants from genome-wide association studies (GWAS) and studies of rare, monogenic diseases. Large-scale GWAS have identified novel susceptibility loci and provided information about shared genetics between allergy, related phenotypes and autoimmunity. Studies of monogenic diseases have elucidated critical cellular pathways and protein functions responsible for allergy. These complementary approaches imply genetic mechanisms involved in Th2 immunity, T-cell differentiation, TGFβ signaling, regulatory T-cell function and skin/mucosal function as well as yet unknown mechanisms associated with newly identified genes. Future studies, in combination with data on gene expression and epigenetics, are expected to increase our understanding of the pathogenesis of allergy. PMID:26386198

  10. Progressive supranuclear palsy (PSP): Richardson syndrome and other PSP variants.

    PubMed

    Lopez, G; Bayulkem, K; Hallett, M

    2016-10-01

    Phenotypic heterogeneity of progressive supranuclear palsy (PSP) has been increasingly reported in the literature and can be the source of incorrect clinical diagnosis particularly in the early stages of the disease when the classically associated symptoms of early falls and supranuclear gaze palsy may not be apparent. In addition to Richardson syndrome (RS), several atypical clinical phenotypes have been described. Advances in genetic, neuroimaging, and biochemical/molecular technologies contribute to the identification of these clinical subtypes in the context of typical PSP pathological findings. Our goal is to review the phenomenology reported in the literature that is associated with confirmed histopathological changes consistent with a PSP diagnosis and to highlight the clinical spectrum of PSP. A systematic review of the literature in PubMed through July 2015 using MeSH terms and key words related to PSP was conducted. Articles describing PSP classifications, diagnostic criteria, and case reports were reviewed and summarized. Additional PSP phenotypes not seen in recent clinicopathological studies are included. These include primary lateral sclerosis, pallido-nigro-luysian degeneration, axonal dystrophy, and multiple system atrophy in the spectrum of atypical PSP variants beyond the traditionally classified PSP subtypes. This review is intended to help with the diagnostic challenges of atypical PSP variants. We believe that large multicenter clinicopathological studies will help expand our understanding of etiology and specific mechanisms of neurodegeneration and will aid in the appropriate interpretation of outcomes when conducting clinical and basic science research.

  11. Design of non-aggregating variants of Aβ peptide

    SciTech Connect

    Caine, Joanne M.; Churches, Quentin; Waddington, Lynne; Nigro, Julie; Breheney, Kerry; Masters, Colin L.; Nuttall, Stewart D.; Streltsov, Victor A.

    2014-10-24

    Highlights: • Non-aggregating, non-toxic variants of Aβ peptide were designed using Aβ structure. • Mutations reduce aggregation by stabilising Aβ into small non-toxic oligomers. • Identification of these residues will assist the design of future therapeutic peptides. - Abstract: Self association of the amyloid-β (Aβ{sub 42}) peptide into oligomers, high molecular weight forms, fibrils and ultimately neuritic plaques, has been correlated with progressive cognitive decline in Alzheimer’s disease. Thus, insights into the drivers of the aggregation pathway have the capacity to significantly contribute to our understanding of disease mechanism. Functional assays and a three-dimensional crystal structure of the P3 amyloidogenic region 18–41 of Aβ were used to identify residues important in self-association and to design novel non-aggregating variants of the peptide. Biophysical studies (gel filtration, SDS–PAGE, dynamic light scattering, thioflavin T assay, and electron microscopy) demonstrate that in contrast to wild type Aβ these targeted mutations lose the ability to self-associate. Loss of aggregation also correlates with reduced neuronal toxicity. Our results highlight residues and regions of the Aβ peptide important for future targeting agents aimed at the amelioration of Alzheimer’s disease.

  12. Confirmed rare copy number variants implicate novel genes in schizophrenia.

    PubMed

    Tam, Gloria W C; van de Lagemaat, Louie N; Redon, Richard; Strathdee, Karen E; Croning, Mike D R; Malloy, Mary P; Muir, Walter J; Pickard, Ben S; Deary, Ian J; Blackwood, Douglas H R; Carter, Nigel P; Grant, Seth G N

    2010-04-01

    Understanding how cognitive processes including learning, memory, decision making and ideation are encoded by the genome is a key question in biology. Identification of sets of genes underlying human mental disorders is a path towards this objective. Schizophrenia is a common disease with cognitive symptoms, high heritability and complex genetics. We have identified genes involved with schizophrenia by measuring differences in DNA copy number across the entire genome in 91 schizophrenia cases and 92 controls in the Scottish population. Our data reproduce rare and common variants observed in public domain data from >3000 schizophrenia cases, confirming known disease loci as well as identifying novel loci. We found copy number variants in PDE10A (phosphodiesterase 10A), CYFIP1 [cytoplasmic FMR1 (Fragile X mental retardation 1)-interacting protein 1], K(+) channel genes KCNE1 and KCNE2, the Down's syndrome critical region 1 gene RCAN1 (regulator of calcineurin 1), cell-recognition protein CHL1 (cell adhesion molecule with homology with L1CAM), the transcription factor SP4 (specificity protein 4) and histone deacetylase HDAC9, among others (see http://www.genes2cognition.org/SCZ-CNV). Integrating the function of these many genes into a coherent model of schizophrenia and cognition is a major unanswered challenge.

  13. Prospective diagnostic analysis of copy number variants using SNP microarrays in individuals with autism spectrum disorders

    PubMed Central

    Nava, Caroline; Keren, Boris; Mignot, Cyril; Rastetter, Agnès; Chantot-Bastaraud, Sandra; Faudet, Anne; Fonteneau, Eric; Amiet, Claire; Laurent, Claudine; Jacquette, Aurélia; Whalen, Sandra; Afenjar, Alexandra; Périsse, Didier; Doummar, Diane; Dorison, Nathalie; Leboyer, Marion; Siffroi, Jean-Pierre; Cohen, David; Brice, Alexis; Héron, Delphine; Depienne, Christel

    2014-01-01

    Copy number variants (CNVs) have repeatedly been found to cause or predispose to autism spectrum disorders (ASDs). For diagnostic purposes, we screened 194 individuals with ASDs for CNVs using Illumina SNP arrays. In several probands, we also analyzed candidate genes located in inherited deletions to unmask autosomal recessive variants. Three CNVs, a de novo triplication of chromosome 15q11–q12 of paternal origin, a deletion on chromosome 9p24 and a de novo 3q29 deletion, were identified as the cause of the disorder in one individual each. An autosomal recessive cause was considered possible in two patients: a homozygous 1p31.1 deletion encompassing PTGER3 and a deletion of the entire DOCK10 gene associated with a rare hemizygous missense variant. We also identified multiple private or recurrent CNVs, the majority of which were inherited from asymptomatic parents. Although highly penetrant CNVs or variants inherited in an autosomal recessive manner were detected in rare cases, our results mainly support the hypothesis that most CNVs contribute to ASDs in association with other CNVs or point variants located elsewhere in the genome. Identification of these genetic interactions in individuals with ASDs constitutes a formidable challenge. PMID:23632794

  14. Prospective diagnostic analysis of copy number variants using SNP microarrays in individuals with autism spectrum disorders.

    PubMed

    Nava, Caroline; Keren, Boris; Mignot, Cyril; Rastetter, Agnès; Chantot-Bastaraud, Sandra; Faudet, Anne; Fonteneau, Eric; Amiet, Claire; Laurent, Claudine; Jacquette, Aurélia; Whalen, Sandra; Afenjar, Alexandra; Périsse, Didier; Doummar, Diane; Dorison, Nathalie; Leboyer, Marion; Siffroi, Jean-Pierre; Cohen, David; Brice, Alexis; Héron, Delphine; Depienne, Christel

    2014-01-01

    Copy number variants (CNVs) have repeatedly been found to cause or predispose to autism spectrum disorders (ASDs). For diagnostic purposes, we screened 194 individuals with ASDs for CNVs using Illumina SNP arrays. In several probands, we also analyzed candidate genes located in inherited deletions to unmask autosomal recessive variants. Three CNVs, a de novo triplication of chromosome 15q11-q12 of paternal origin, a deletion on chromosome 9p24 and a de novo 3q29 deletion, were identified as the cause of the disorder in one individual each. An autosomal recessive cause was considered possible in two patients: a homozygous 1p31.1 deletion encompassing PTGER3 and a deletion of the entire DOCK10 gene associated with a rare hemizygous missense variant. We also identified multiple private or recurrent CNVs, the majority of which were inherited from asymptomatic parents. Although highly penetrant CNVs or variants inherited in an autosomal recessive manner were detected in rare cases, our results mainly support the hypothesis that most CNVs contribute to ASDs in association with other CNVs or point variants located elsewhere in the genome. Identification of these genetic interactions in individuals with ASDs constitutes a formidable challenge.

  15. A Novel Pathogenic BRCA1 Splicing Variant Produces Partial Intron Retention in the Mature Messenger RNA

    PubMed Central

    Esposito, Maria Valeria; Nunziato, Marcella; Starnone, Flavio; Telese, Antonella; Calabrese, Alessandra; D’Aiuto, Giuseppe; Pucci, Pietro; D’Aiuto, Massimiliano; Baralle, Francisco; D’Argenio, Valeria; Salvatore, Francesco

    2016-01-01

    About 10% of all breast cancers arise from hereditary mutations that increase the risk of breast and ovarian cancers; and about 25% of these are associated with the BRCA1 or BRCA2 genes. The identification of BRCA1/BRCA2 mutations can enable physicians to better tailor the clinical management of patients; and to initiate preventive measures in healthy carriers. The pathophysiological significance of newly identified variants poses challenges for genetic counseling. We characterized a new BRCA1 variant discovered in a breast cancer patient during BRCA1/2 screening by next-generation sequencing. Bioinformatic predictions; indicating that the variant is probably pathogenetic; were verified using retro-transcription of the patient’s RNA followed by PCR amplifications performed on the resulting cDNA. The variant causes the loss of a canonic donor splice site at position +2 in BRCA1 intron 21; and consequently the partial retention of 156 bp of intron 21 in the patient’s transcript; which demonstrates that this novel BRCA1 mutation plays a pathogenetic role in breast cancer. These findings enabled us to initiate appropriate counseling and to tailor the clinical management of this family. Lastly; these data reinforce the importance of studying the effects of sequence variants at the RNA level to verify their potential role in disease onset. PMID:28009814

  16. High-Throughput Diagnostic Assay for a Highly Prevalent Cardiomyopathy-Associated MYBPC3 Variant

    PubMed Central

    Barefield, David Y; Lynch, Thomas L; Jagadeesan, Aravindakshan; Sanagala, Thriveni; Sadayappan, Sakthivel

    2016-01-01

    A 25-basepair deletion variant of MYBPC3 occurs at high frequency in individuals of South Asian descent and is estimated to affect 55 million people worldwide, carrying an increased likelihood of cardiomyopathy. Since this variant is prevalent and severe in this subpopulation, quick and affordable screening to provide risk-assessment to guide treatment for these patients is critical. An RNaseH qPCR assay was developed to quickly and specifically diagnose the presence of the 25-basepair deletion variant in MYBPC3. RNAseH-blocked nucleotide primers were designed to identify the presence or absence of the wild type MYBPC3 allele or the genomic sequence containing the 25-basepair deletion. Using this assay, three blinded operators were able to accurately determine the genotype from human genomic DNA samples from blood and saliva using a qPCR thermocycler. Furthermore, positive variant subjects were examined by both electrocardiography and echocardiography for the presence of cardiomyopathy. A simple, robust assay was established, verified and validated that can be automated to detect the presence of the highly prevalent 25-basepair deletion MYBPC3 variant using both blood and saliva samples. The assay will provide quick and accurate prescreening of individuals at high risk for cardiomyopathies and allow for better clinical identification of 25-basepair deletion MYBPC3 carriers in large cohort epidemiological studies. PMID:27990320

  17. Disease variants alter transcription factor levels and methylation of their binding sites.

    PubMed

    Bonder, Marc Jan; Luijk, René; Zhernakova, Daria V; Moed, Matthijs; Deelen, Patrick; Vermaat, Martijn; van Iterson, Maarten; van Dijk, Freerk; van Galen, Michiel; Bot, Jan; Slieker, Roderick C; Jhamai, P Mila; Verbiest, Michael; Suchiman, H Eka D; Verkerk, Marijn; van der Breggen, Ruud; van Rooij, Jeroen; Lakenberg, Nico; Arindrarto, Wibowo; Kielbasa, Szymon M; Jonkers, Iris; van 't Hof, Peter; Nooren, Irene; Beekman, Marian; Deelen, Joris; van Heemst, Diana; Zhernakova, Alexandra; Tigchelaar, Ettje F; Swertz, Morris A; Hofman, Albert; Uitterlinden, André G; Pool, René; van Dongen, Jenny; Hottenga, Jouke J; Stehouwer, Coen D A; van der Kallen, Carla J H; Schalkwijk, Casper G; van den Berg, Leonard H; van Zwet, Erik W; Mei, Hailiang; Li, Yang; Lemire, Mathieu; Hudson, Thomas J; Slagboom, P Eline; Wijmenga, Cisca; Veldink, Jan H; van Greevenbroek, Marleen M J; van Duijn, Cornelia M; Boomsma, Dorret I; Isaacs, Aaron; Jansen, Rick; van Meurs, Joyce B J; 't Hoen, Peter A C; Franke, Lude; Heijmans, Bastiaan T

    2017-01-01

    Most disease-associated genetic variants are noncoding, making it challenging to design experiments to understand their functional consequences. Identification of expression quantitative trait loci (eQTLs) has been a powerful approach to infer the downstream effects of disease-associated variants, but most of these variants remain unexplained. The analysis of DNA methylation, a key component of the epigenome, offers highly complementary data on the regulatory potential of genomic regions. Here we show that disease-associated variants have widespread effects on DNA methylation in trans that likely reflect differential occupancy of trans binding sites by cis-regulated transcription factors. Using multiple omics data sets from 3,841 Dutch individuals, we identified 1,907 established trait-associated SNPs that affect the methylation levels of 10,141 different CpG sites in trans (false discovery rate (FDR) < 0.05). These included SNPs that affect both the expression of a nearby transcription factor (such as NFKB1, CTCF and NKX2-3) and methylation of its respective binding site across the genome. Trans methylation QTLs effectively expose the downstream effects of disease-associated variants.

  18. Viral population analysis and minority-variant detection using short read next-generation sequencing

    PubMed Central

    Watson, Simon J.; Welkers, Matthijs R. A.; Depledge, Daniel P.; Coulter, Eve; Breuer, Judith M.; de Jong, Menno D.; Kellam, Paul

    2013-01-01

    RNA viruses within infected individuals exist as a population of evolutionary-related variants. Owing to evolutionary change affecting the constitution of this population, the frequency and/or occurrence of individual viral variants can show marked or subtle fluctuations. Since the development of massively parallel sequencing platforms, such viral populations can now be investigated to unprecedented resolution. A critical problem with such analyses is the presence of sequencing-related errors that obscure the identification of true biological variants present at low frequency. Here, we report the development and assessment of the Quality Assessment of Short Read (QUASR) Pipeline (http://sourceforge.net/projects/quasr) specific for virus genome short read analysis that minimizes sequencing errors from multiple deep-sequencing platforms, and enables post-mapping analysis of the minority variants within the viral population. QUASR significantly reduces the error-related noise in deep-sequencing datasets, resulting in increased mapping accuracy and reduction of erroneous mutations. Using QUASR, we have determined influenza virus genome dynamics in sequential samples from an in vitro evolution of 2009 pandemic H1N1 (A/H1N1/09) influenza from samples sequenced on both the Roche 454 GSFLX and Illumina GAIIx platforms. Importantly, concordance between the 454 and Illumina sequencing allowed unambiguous minority-variant detection and accurate determination of virus population turnover in vitro. PMID:23382427

  19. Viral population analysis and minority-variant detection using short read next-generation sequencing.

    PubMed

    Watson, Simon J; Welkers, Matthijs R A; Depledge, Daniel P; Coulter, Eve; Breuer, Judith M; de Jong, Menno D; Kellam, Paul

    2013-03-19

    RNA viruses within infected individuals exist as a population of evolutionary-related variants. Owing to evolutionary change affecting the constitution of this population, the frequency and/or occurrence of individual viral variants can show marked or subtle fluctuations. Since the development of massively parallel sequencing platforms, such viral populations can now be investigated to unprecedented resolution. A critical problem with such analyses is the presence of sequencing-related errors that obscure the identification of true biological variants present at low frequency. Here, we report the development and assessment of the Quality Assessment of Short Read (QUASR) Pipeline (http://sourceforge.net/projects/quasr) specific for virus genome short read analysis that minimizes sequencing errors from multiple deep-sequencing platforms, and enables post-mapping analysis of the minority variants within the viral population. QUASR significantly reduces the error-related noise in deep-sequencing datasets, resulting in increased mapping accuracy and reduction of erroneous mutations. Using QUASR, we have determined influenza virus genome dynamics in sequential samples from an in vitro evolution of 2009 pandemic H1N1 (A/H1N1/09) influenza from samples sequenced on both the Roche 454 GSFLX and Illumina GAIIx platforms. Importantly, concordance between the 454 and Illumina sequencing allowed unambiguous minority-variant detection and accurate determination of virus population turnover in vitro.

  20. Genetic epidemiology of motor neuron disease-associated variants in the Scottish population.

    PubMed

    Black, Holly A; Leighton, Danielle J; Cleary, Elaine M; Rose, Elaine; Stephenson, Laura; Colville, Shuna; Ross, David; Warner, Jon; Porteous, Mary; Gorrie, George H; Swingler, Robert; Goldstein, David; Harms, Matthew B; Connick, Peter; Pal, Suvankar; Aitman, Timothy J; Chandran, Siddharthan

    2017-03-01

    Genetic understanding of motor neuron disease (MND) has evolved greatly in the past 10 years, including the recent identification of association between MND and variants in TBK1 and NEK1. Our aim was to determine the frequency of pathogenic variants in known MND genes and to assess whether variants in TBK1 and NEK1 contribute to the burden of MND in the Scottish population. SOD1, TARDBP, OPTN, TBK1, and NEK1 were sequenced in 441 cases and 400 controls. In addition to 44 cases known to carry a C9orf72 hexanucleotide repeat expansion, we identified 31 cases and 2 controls that carried a loss-of-function or pathogenic variant. Loss-of-function variants were found in TBK1 in 3 cases and no controls and, separately, in NEK1 in 3 cases and no controls. This study provides an accurate description of the genetic epidemiology of MND in Scotland and provides support for the contribution of both TBK1 and NEK1 to MND susceptibility in the Scottish population.

  1. Targeted Re-Sequencing Approach of Candidate Genes Implicates Rare Potentially Functional Variants in Tourette Syndrome Etiology

    PubMed Central

    Alexander, John; Potamianou, Hera; Xing, Jinchuan; Deng, Li; Karagiannidis, Iordanis; Tsetsos, Fotis; Drineas, Petros; Tarnok, Zsanett; Rizzo, Renata; Wolanczyk, Tomasz; Farkas, Luca; Nagy, Peter; Szymanska, Urszula; Androutsos, Christos; Tsironi, Vaia; Koumoula, Anastasia; Barta, Csaba; Sandor, Paul; Barr, Cathy L.; Tischfield, Jay; Paschou, Peristera; Heiman, Gary A.; Georgitsi, Marianthi

    2016-01-01

    Although the genetic basis of Tourette Syndrome (TS) remains unclear, several candidate genes have been implicated. Using a set of 382 TS individuals of European ancestry we investigated four candidate genes for TS (HDC, SLITRK1, BTBD9, and SLC6A4) in an effort to identify possibly causal variants using a targeted re-sequencing approach by next generation sequencing technology. Identification of possible disease causing variants under different modes of inheritance was performed using the algorithms implemented in VAAST. We prioritized variants using Variant ranker and validated five rare variants via Sanger sequencing in HDC and SLITRK1, all of which are predicted to be deleterious. Intriguingly, one of the identified variants is in linkage disequilibrium with a variant that is included among the top hits of a genome-wide association study for response to citalopram treatment, an antidepressant drug with off-label use also in obsessive compulsive disorder. Our findings provide additional evidence for the implication of these two genes in TS susceptibility and the possible role of these proteins in the pathobiology of TS should be revisited. PMID:27708560

  2. Exome Sequencing Identifies a Rare HSPG2 Variant Associated with Familial Idiopathic Scoliosis

    PubMed Central

    Baschal, Erin E.; Wethey, Cambria I.; Swindle, Kandice; Baschal, Robin M.; Gowan, Katherine; Tang, Nelson L.S.; Alvarado, David M.; Haller, Gabe E.; Dobbs, Matthew B.; Taylor, Matthew R.G.; Gurnett, Christina A.; Jones, Kenneth L.; Miller, Nancy H.

    2014-01-01

    Idiopathic scoliosis occurs in 3% of individuals and has an unknown etiology. The objective of this study was to identify rare variants that contribute to the etiology of idiopathic scoliosis by using exome sequencing in a multigenerational family with idiopathic scoliosis. Exome sequencing was completed for three members of this multigenerational family with idiopathic scoliosis, resulting in the identification of a variant in the HSPG2 gene as a potential contributor to the phenotype. The HSPG2 gene was sequenced in a separate cohort of 100 unrelated individuals affected with idiopathic scoliosis and also was examined in an independent idiopathic scoliosis population. The exome sequencing and subsequent bioinformatics filtering resulted in 16 potentially damaging and rare coding variants. One of these variants, p.Asn786Ser, is located in the HSPG2 gene. The variant p.Asn786Ser also is overrepresented in a larger cohort of idiopathic scoliosis cases compared with a control population (P = 0.024). Furthermore, we identified additional rare HSPG2 variants that are predicted to be damaging in two independent cohorts of individuals with idiopathic scoliosis. The HSPG2 gene encodes for a ubiquitous multifunctional protein within the extracellular matrix in which loss of function mutation are known to result in a musculoskeletal phenotype in both mouse and humans. Based on these results, we conclude that rare variants in the HSPG2 gene potentially contribute to the idiopathic scoliosis phenotype in a subset of patients with idiopathic scoliosis. Further studies must be completed to confirm the effect of the HSPG2 gene on the idiopathic scoliosis phenotype. PMID:25504735

  3. Vietnamese Refugee Orientation Handbook.

    ERIC Educational Resources Information Center

    Interagency Task Force for Indochina Refugees, Washington, DC.

    This handbook addresses itself to Vietnamese refugees and is intended to help them cope with everyday situations in the United States. The entire text is given in both Vietnamese and English. The three main sections are: (1) Refugee Status--information about the legal status of refugees, identification procedures, obligations, some Immigration and…

  4. Histone variants in plant transcriptional regulation.

    PubMed

    Jiang, Danhua; Berger, Frédéric

    2017-01-01

    Chromatin based organization of eukaryotic genome plays a profound role in regulating gene transcription. Nucleosomes form the basic subunits of chromatin by packaging DNA with histone proteins, impeding the access of DNA to transcription factors and RNA polymerases. Exchange of histone variants in nucleosomes alters the properties of nucleosomes and thus modulates DNA exposure during transcriptional regulation. Growing evidence indicates the important function of histone variants in programming transcription during developmental transitions and stress response. Here we review how histone variants and their deposition machineries regulate the nucleosome stability and dynamics, and discuss the link between histone variants and transcriptional regulation in plants. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

  5. Genetic variants of ghrelin in metabolic disorders.

    PubMed

    Ukkola, Olavi

    2011-11-01

    An increasing understanding of the role of genes in the development of obesity may reveal genetic variants that, in combination with conventional risk factors, may help to predict an individual's risk for developing metabolic disorders. Accumulating evidence indicates that ghrelin plays a role in regulating food intake and energy homeostasis and it is a reasonable candidate gene for obesity-related co-morbidities. In cross-sectional studies low total ghrelin concentrations and some genetic polymorphisms of ghrelin have been associated with obesity-associated diseases. The present review highlights many of the important problems in association studies of genetic variants and complex diseases. It is known that population-specific differences in reported associations exist. We therefore conclude that more studies on variants of ghrelin gene are needed to perform in different populations to get deeper understanding on the relationship of ghrelin gene and its variants to obesity.

  6. Gonococcal pilin variants in experimental gonorrhea.

    PubMed

    Swanson, J; Robbins, K; Barrera, O; Corwin, D; Boslego, J; Ciak, J; Blake, M; Koomey, J M

    1987-05-01

    When pilus+ Gc were introduced into a male subject's urethra, they gave rise to pilus+ variants whose pilin mRNAs differed from that of input Gc. The differences stemmed from the Gc genome's single complete pilin gene having undergone gene conversion by different partial pilin genes' sequences and by different length stretches of a single partial pilin gene. In some instances, the variant's pilin mRNA appeared to reflect two independent gene-conversion events that used sequences from two different partial pilin genes. The resulting variants' pilins exhibited antigenic differences compared with the pilin polypeptide of input Gc; these differences were discernible by immunoblotting with mAbs. Amino acid and antigenic changes occurred in a segment of the variants' pilin polypeptides that previously was thought to be conserved or constant in sequence.

  7. Swine Influenza/Variant Influenza Viruses

    MedlinePlus

    ... Past Newsletters Information on Swine Influenza/Variant Influenza Virus Language: English Español Recommend on Facebook Tweet ... disease of pigs caused by type A influenza viruses that regularly cause outbreaks of influenza in pigs. ...

  8. FTO variant associated with malformation syndrome.

    PubMed

    Rohena, Luis; Lawson, Michelle; Guzman, Edwin; Ganapathi, Mythily; Cho, Megan T; Haverfield, Eden; Anyane-Yeboa, Kwame

    2016-04-01

    Common FTO variants are associated with obesity. However, it has recently been shown that homozygous FTO c.947G>A variant, which predicts p.R316Q, and c.956C>T, which predicts p.S319F, are associated with a malformation syndrome inherited in an autosomal recessive pattern. We present a similar homozygous FTO c.965G>A variant that predicts p.R322Q, associated with a lethal malformation syndrome in a consanguineous Yemeni family. Functional studies showed that the p.R316Q, p.S219F, and p.R322Q variants render the FTO protein inactive. We further expand on the phenotype of homozygous FTO loss-of-function mutations to include eye abnormalities, gingival overgrowth, craniosynostosis, and cutaneous photosensitivity.

  9. Bisalbuminemia. A new molecular variant, albumin Vancouver.

    PubMed

    Frohlich, J; Kozier, J; Campbell, D J; Curnow, J V; Tárnoky, A L

    1978-11-01

    Of 18 members of a Fiji Indian family investigated, eight of the 12 males and two of the six females had an electrophoretically slow-type bisalbuminemia (alloalbuminemia). The albumin was characterized by the hiterto unique ratio of the two bands (Al A 35%: variant 65%), and by dye-binding studies and electrophoretic mobility in different media. The data suggest that this is a new variant, which we propose to call albumin Vancouver (Al Va).

  10. Rare variant association test with multiple phenotypes.

    PubMed

    Lee, Selyeong; Won, Sungho; Kim, Young Jin; Kim, Yongkang; Kim, Bong-Jo; Park, Taesung

    2017-04-01

    Although genome-wide association studies (GWAS) have now discovered thousands of genetic variants associated with common traits, such variants cannot explain the large degree of "missing heritability," likely due to rare variants. The advent of next generation sequencing technology has allowed rare variant detection and association with common traits, often by investigating specific genomic regions for rare variant effects on a trait. Although multiple correlated phenotypes are often concurrently observed in GWAS, most studies analyze only single phenotypes, which may lessen statistical power. To increase power, multivariate analyses, which consider correlations between multiple phenotypes, can be used. However, few existing multivariant analyses can identify rare variants for assessing multiple phenotypes. Here, we propose Multivariate Association Analysis using Score Statistics (MAAUSS), to identify rare variants associated with multiple phenotypes, based on the widely used sequence kernel association test (SKAT) for a single phenotype. We applied MAAUSS to whole exome sequencing (WES) data from a Korean population of 1,058 subjects to discover genes associated with multiple traits of liver function. We then assessed validation of those genes by a replication study, using an independent dataset of 3,445 individuals. Notably, we detected the gene ZNF620 among five significant genes. We then performed a simulation study to compare MAAUSS's performance with existing methods. Overall, MAAUSS successfully conserved type 1 error rates and in many cases had a higher power than the existing methods. This study illustrates a feasible and straightforward approach for identifying rare variants correlated with multiple phenotypes, with likely relevance to missing heritability.

  11. Variant profiling of evolving prokaryotic populations

    PubMed Central

    Zojer, Markus; Schuster, Lisa N.; Schulz, Frederik; Pfundner, Alexander; Horn, Matthias

    2017-01-01

    Genomic heterogeneity of bacterial species is observed and studied in experimental evolution experiments and clinical diagnostics, and occurs as micro-diversity of natural habitats. The challenge for genome research is to accurately capture this heterogeneity with the currently used short sequencing reads. Recent advances in NGS technologies improved the speed and coverage and thus allowed for deep sequencing of bacterial populations. This facilitates the quantitative assessment of genomic heterogeneity, including low frequency alleles or haplotypes. However, false positive variant predictions due to sequencing errors and mapping artifacts of short reads need to be prevented. We therefore created VarCap, a workflow for the reliable prediction of different types of variants even at low frequencies. In order to predict SNPs, InDels and structural variations, we evaluated the sensitivity and accuracy of different software tools using synthetic read data. The results suggested that the best sensitivity could be reached by a union of different tools, however at the price of increased false positives. We identified possible reasons for false predictions and used this knowledge to improve the accuracy by post-filtering the predicted variants according to properties such as frequency, coverage, genomic environment/localization and co-localization with other variants. We observed that best precision was achieved by using an intersection of at least two tools per variant. This resulted in the reliable prediction of variants above a minimum relative abundance of 2%. VarCap is designed for being routinely used within experimental evolution experiments or for clinical diagnostics. The detected variants are reported as frequencies within a VCF file and as a graphical overview of the distribution of the different variant/allele/haplotype frequencies. The source code of VarCap is available at https://github.com/ma2o/VarCap. In order to provide this workflow to a broad community

  12. Laryngeal Dysplasia, Squamous Cell Carcinoma, and Variants.

    PubMed

    Thompson, Lester D R

    2017-03-01

    Squamous cell carcinoma (SCC) is a malignant epithelial tumor showing evidence of squamous differentiation. It is the most common malignancy of the larynx, with several variants (verrucous, exophytic or papillary, spindle-cell, basaloid, acantholytic, adenosquamous) recognized, with well-established precursor lesions. Dysplasia is now separated into only low-grade and high-grade categories. Each SCC variant has unique cytomorphologic features and histologic differential diagnoses that are important to consider, as management and outcomes are different.

  13. Variant profiling of evolving prokaryotic populations.

    PubMed

    Zojer, Markus; Schuster, Lisa N; Schulz, Frederik; Pfundner, Alexander; Horn, Matthias; Rattei, Thomas

    2017-01-01

    Genomic heterogeneity of bacterial species is observed and studied in experimental evolution experiments and clinical diagnostics, and occurs as micro-diversity of natural habitats. The challenge for genome research is to accurately capture this heterogeneity with the currently used short sequencing reads. Recent advances in NGS technologies improved the speed and coverage and thus allowed for deep sequencing of bacterial populations. This facilitates the quantitative assessment of genomic heterogeneity, including low frequency alleles or haplotypes. However, false positive variant predictions due to sequencing errors and mapping artifacts of short reads need to be prevented. We therefore created VarCap, a workflow for the reliable prediction of different types of variants even at low frequencies. In order to predict SNPs, InDels and structural variations, we evaluated the sensitivity and accuracy of different software tools using synthetic read data. The results suggested that the best sensitivity could be reached by a union of different tools, however at the price of increased false positives. We identified possible reasons for false predictions and used this knowledge to improve the accuracy by post-filtering the predicted variants according to properties such as frequency, coverage, genomic environment/localization and co-localization with other variants. We observed that best precision was achieved by using an intersection of at least two tools per variant. This resulted in the reliable prediction of variants above a minimum relative abundance of 2%. VarCap is designed for being routinely used within experimental evolution experiments or for clinical diagnostics. The detected variants are reported as frequencies within a VCF file and as a graphical overview of the distribution of the different variant/allele/haplotype frequencies. The source code of VarCap is available at https://github.com/ma2o/VarCap. In order to provide this workflow to a broad community

  14. Assessing Politicized Sexual Orientation Identity: Validating the Queer Consciousness Scale.

    PubMed

    Duncan, Lauren E; Mincer, Elizabeth; Dunn, Sarah R

    2016-09-15

    Building on psychological theories of motivation for collective action, we introduce a new individual difference measure of queer consciousness, defined as a politicized collective identity around sexual orientation. The Queer Consciousness Scale (QCS) consists of 12 items measuring five aspects of a politicized queer identity: sense of common fate, power discontent, system blame, collective orientation, and cognitive centrality. In four samples of adult women and men of varied sexual orientations, the QCS showed good test-retest and Cronbach's reliability and excellent known-groups and predictive validity. Specifically, the QCS was positively correlated with identification as a member of the LGBTQ community, political liberalism, personal political salience, and LGBTQ activism and negatively correlated with right-wing authoritarianism and social dominance orientation. QCS mediated relationships between several individual difference variables and gay rights activism and can be used with both LGBTQ people and allies.

  15. Histone variants: key players of chromatin.

    PubMed

    Biterge, Burcu; Schneider, Robert

    2014-06-01

    Histones are fundamental structural components of chromatin. Eukaryotic DNA is wound around an octamer of the core histones H2A, H2B, H3, and H4. Binding of linker histone H1 promotes higher order chromatin organization. In addition to their structural role, histones impact chromatin function and dynamics by, e.g., post-translational histone modifications or the presence of specific histone variants. Histone variants exhibit differential expression timings (DNA replication-independent) and mRNA characteristics compared to canonical histones. Replacement of canonical histones with histone variants can affect nucleosome stability and help to create functionally distinct chromatin domains. In line with this, several histone variants have been implicated in the regulation of cellular processes such as DNA repair and transcriptional activity. In this review, we focus on recent progress in the study of core histone variants H2A.X, H2A.Z, macroH2A, H3.3, and CENP-A, as well as linker histone H1 variants, their functions and their links to development and disease.

  16. Discovery of rare variants for complex phenotypes.

    PubMed

    Kosmicki, Jack A; Churchhouse, Claire L; Rivas, Manuel A; Neale, Benjamin M

    2016-06-01

    With the rise of sequencing technologies, it is now feasible to assess the role rare variants play in the genetic contribution to complex trait variation. While some of the earlier targeted sequencing studies successfully identified rare variants of large effect, unbiased gene discovery using exome sequencing has experienced limited success for complex traits. Nevertheless, rare variant association studies have demonstrated that rare variants do contribute to phenotypic variability, but sample sizes will likely have to be even larger than those of common variant association studies to be powered for the detection of genes and loci. Large-scale sequencing efforts of tens of thousands of individuals, such as the UK10K Project and aggregation efforts such as the Exome Aggregation Consortium, have made great strides in advancing our knowledge of the landscape of rare variation, but there remain many considerations when studying rare variation in the context of complex traits. We discuss these considerations in this review, presenting a broad range of topics at a high level as an introduction to rare variant analysis in complex traits including the issues of power, study design, sample ascertainment, de novo variation, and statistical testing approaches. Ultimately, as sequencing costs continue to decline, larger sequencing studies will yield clearer insights into the biological consequence of rare mutations and may reveal which genes play a role in the etiology of complex traits.

  17. Oriented divisions, fate decisions

    PubMed Central

    Williams, Scott E.; Fuchs, Elaine

    2013-01-01

    During development, the establishment of proper tissue architecture depends upon the coordinated control of cell divisions not only in space and time, but also direction. Execution of an oriented cell division requires establishment of an axis of polarity and alignment of the mitotic spindle along this axis. Frequently, the cleavage plane also segregates fate determinants, either unequally or equally between daughter cells, the outcome of which is either an asymmetric or symmetric division, respectively. The last few years have witnessed tremendous growth in understanding both the extrinsic and intrinsic cues that position the mitotic spindle, the varied mechanisms in which the spindle orientation machinery is controlled in diverse organisms and organ systems, and the manner in which the division axis influences the signaling pathways that direct cell fate choices. PMID:24021274

  18. Earth orientation parameters

    NASA Technical Reports Server (NTRS)

    Eanes, Richard J.

    1994-01-01

    Since the beginning of regular space geodetic measurements, Satellite Laser Ranging (SLR) has routinely provided polar motion and length of day solutions. At the present time, Global Positioning Systems (GPS) regularly produces daily polar motion solutions with 0.4 mas accuracy, equivalent to the routine 1-day VLBI experiments and SLR solutions using 3 days of Lageos-1 data. This rapid progress of the GPS technique forces a review of any resource allocations for VLBI and SLR measurements of Earth orientation.

  19. Aspect-Oriented Programming

    NASA Technical Reports Server (NTRS)

    Elrad, Tzilla (Editor); Filman, Robert E. (Editor); Bader, Atef (Editor)

    2001-01-01

    Computer science has experienced an evolution in programming languages and systems from the crude assembly and machine codes of the earliest computers through concepts such as formula translation, procedural programming, structured programming, functional programming, logic programming, and programming with abstract data types. Each of these steps in programming technology has advanced our ability to achieve clear separation of concerns at the source code level. Currently, the dominant programming paradigm is object-oriented programming - the idea that one builds a software system by decomposing a problem into objects and then writing the code of those objects. Such objects abstract together behavior and data into a single conceptual and physical entity. Object-orientation is reflected in the entire spectrum of current software development methodologies and tools - we have OO methodologies, analysis and design tools, and OO programming languages. Writing complex applications such as graphical user interfaces, operating systems, and distributed applications while maintaining comprehensible source code has been made possible with OOP. Success at developing simpler systems leads to aspirations for greater complexity. Object orientation is a clever idea, but has certain limitations. We are now seeing that many requirements do not decompose neatly into behavior centered on a single locus. Object technology has difficulty localizing concerns invoking global constraints and pandemic behaviors, appropriately segregating concerns, and applying domain-specific knowledge. Post-object programming (POP) mechanisms that look to increase the expressiveness of the OO paradigm are a fertile arena for current research. Examples of POP technologies include domain-specific languages, generative programming, generic programming, constraint languages, reflection and metaprogramming, feature-oriented development, views/viewpoints, and asynchronous message brokering. (Czarneclu and

  20. Orienting and circulating sub

    SciTech Connect

    Rehm, W.A.; McDonald, W.J.; Maurer, W.C.; Leitko, C.E. Jr.

    1988-12-06

    This patent describes an apparatus for angular drilling in the earth comprising a drill string extending into a substantially vertical well bore in the earth, a fluid operated motor and drill bit operated thereby secured on the bottom end of the drill string, means supporting at least a part of the motor and drill bit at a substantial angle to the substantially vertical well bore for continuing the drilling of the well bore at an angle to the substantially vertical portion thereof, a surveying tool connected in the drill string above the motor for determining and controlling the direction of drilling, a mule shoe keying sub connected to the surveying tool for orienting the position of the motor in relation to the surveying tool, and an orienting sub connected to the mule shoe keying sub at one end and connected at the other end to the means supporting the motor at an angle, and including means to orient angularly the point of connection to the mule shoe keying sub in relation to the means supporting the motor at an angle.

  1. Temporal Mapping of Transcripts in Herpesvirus 6 Variants

    PubMed Central

    Mirandola, Prisco; Menegazzi, Paola; Merighi, Stefania; Ravaioli, Tullia; Cassai, Enzo; Di Luca, Dario

    1998-01-01

    To define the molecular features characteristic of the early stages of infection of lymphocytes with human herpesvirus 6 (HHV-6) variant A or B, we studied the temporal regulation of expression of selected sets of viral genes. Thus, U42, U94, U89-U90, U73, and U39 are α genes since their transcripts (i) were made in the presence of inhibitors of protein synthesis and (ii) were detected 3 h after infection of untreated cells. U41, U53, U31, and U19 are β genes since their expression is inhibited by cycloheximide but not by phosphonoacetate, an inhibitor of DNA synthesis. U100 is a γ gene since its spliced transcript encoding the structural glycoprotein gp82/105 was first detected 16 h after infection of untreated cells but could not be detected in cells treated with phosphonoacetate. HHV-6 variants differ in the transcription patterns of their genes. U16-U17 originates a splice transcript and is regulated as α in HHV-6B and as β in HHV-6A. U91 generates two transcripts, amplified as 476- and 374-bp PCR fragments. The 476-bp fragment is α in HHV-6A-infected cells but β in HHV-6B-infected cells. Conversely, the 374-bp fragment is β in HHV-6A-infected cells and α in HHV-6B-infected cells. Furthermore, the spliced product of U18-U19-U20 (526 bp) is β in HHV-6A-infected cells, but only a partially spliced form (1.9 kb) was detected at late stages of infection in HHV-6B. HHV-6 transcription was also studied in nonproductive lymphoid cells, and the same transcription pattern detected during lytic infection was observed. Also, HHV-6 variants maintain the differences in U91, U16-17, and U18-U19-U20. We conclude that, as expected from the sequencing data, gene expression is generally similar in HHV-6 variants. However, transcription of selected genes in HHV-6A and HHV-6B differs with respect to temporal regulation and splicing pattern. Furthermore, the identification of viral functions expressed during the different stages of lytic replication suggests that reverse

  2. Incorporating Orienteering in School Programs.

    ERIC Educational Resources Information Center

    Bradford, Douglas

    Orienteering has been described as being "either a serious sport, or a relaxing recreation". Orienteering can be a family affair or an individual fight against the clock. In its simplest form, orienteering can be described as a cross-country run, jog, or walk on a predetermined course, using a map and a compass to find several control points on…

  3. Swedish Orienteers: A Survey Study.

    ERIC Educational Resources Information Center

    Ottosson, Torgny

    1995-01-01

    A survey questionnaire was sent to 1,200 members of Swedish orienteering clubs. Some common beliefs about orienteers were verified. Respondents identifying themselves as active orienteers were often well educated and in the upper middle class, had a healthy lifestyle, and tended to participate as families. (Author/TD)

  4. Community Orientation and Media Use.

    ERIC Educational Resources Information Center

    Neuwirth, Kurt; And Others

    1989-01-01

    Examines the relationship among media use, participation in local shopping and leisure activities, and orientation toward the local community. Reexamines Robert Merton's Cosmopolitan scale, finding it to have both localite (exclusively local orientation) and cosmopolite (orientation to events outside the local community) dimensions. (MM)

  5. Moral Orientation, Gender, and Salary.

    ERIC Educational Resources Information Center

    Manning, Roger W.

    A study examined the relationship among gender, moral orientation, and pay. Although the participants were about equal in terms of gender, 48 males and 53 females, males tended to hold higher degrees. The researcher hypothesized that salaries would be differentiated based on gender and moral orientation. Assumptions were that care-oriented males…

  6. Curriculum Orientations of Virtual Teachers

    ERIC Educational Resources Information Center

    Singleton, Nicole Y.

    2013-01-01

    This study explored the curriculum orientation preferences of K-12 public school teachers who provided instruction in virtual settings (n = 47) in a midwestern state. Curriculum orientations were explored using a mixed-methods design. Quantitative assessments data revealed a pattern of curriculum orientations similar to teachers working in…

  7. Training for DD Council Orientation.

    ERIC Educational Resources Information Center

    Paul, James, Ed.; And Others

    Provided for Developmental Disabilities Councils is a resource handbook on planning orientation training for council members. The material, including three major presentations on orientation planning, advocacy, and orientation principles, is explained to be drawn from three 1975 regional conferences. Among training techniques analyzed are use of a…

  8. Orienteering for Sport and Pleasure.

    ERIC Educational Resources Information Center

    Bengtsson, Hans; Atkinson, George

    This text presents the principles of the sport of orienteering (navigating through an unknown area using a map and compass as guide) and is useful to beginners, experienced orienteers, and "armchair" orienteers. Included in the text are: (1) a glossary of key words; (2) a basic introduction to, and history of, the sport; (3) description of the…

  9. Sex Role and Dating Orientation.

    ERIC Educational Resources Information Center

    McCabe, M. P.; Collins, J. K.

    1979-01-01

    Male and female subjects from three age groups completed questionnaires on sex roles and dating orientations. Males approached dating from both a psychoaffectional and psychobiological orientation, while females approached it from a psychoaffectional orientation. Significant differences were found in dating attitudes between male and female…

  10. An integrative computational approach for prioritization of genomic variants

    SciTech Connect

    Dubchak, Inna; Balasubramanian, Sandhya; Wang, Sheng; Meydan, Cem; Sulakhe, Dinanath; Poliakov, Alexander; Börnigen, Daniela; Xie, Bingqing; Taylor, Andrew; Ma, Jianzhu; Paciorkowski, Alex R.; Mirzaa, Ghayda M.; Dave, Paul; Agam, Gady; Xu, Jinbo; Al-Gazali, Lihadh; Mason, Christopher E.; Ross, M. Elizabeth; Maltsev, Natalia; Gilliam, T. Conrad; Huang, Qingyang

    2014-12-15

    An essential step in the discovery of molecular mechanisms contributing to disease phenotypes and efficient experimental planning is the development of weighted hypotheses that estimate the functional effects of sequence variants discovered by high-throughput genomics. With the increasing specialization of the bioinformatics resources, creating analytical workflows that seamlessly integrate data and bioinformatics tools developed by multiple groups becomes inevitable. Here we present a case study of a use of the distributed analytical environment integrating four complementary specialized resources, namely the Lynx platform, VISTA RViewer, the Developmental Brain Disorders Database (DBDB), and the RaptorX server, for the identification of high-confidence candidate genes contributing to pathogenesis of spina bifida. The analysis resulted in prediction and validation of deleterious mutations in the SLC19A placental transporter in mothers of the affected children that causes narrowing of the outlet channel and therefore leads to the reduced folate permeation rate. The described approach also enabled correct identification of several genes, previously shown to contribute to pathogenesis of spina bifida, and suggestion of additional genes for experimental validations. The study demonstrates that the seamless integration of bioinformatics resources enables fast and efficient prioritization and characterization of genomic factors and molecular networks contributing to the phenotypes of interest.

  11. An integrative computational approach for prioritization of genomic variants

    DOE PAGES

    Dubchak, Inna; Balasubramanian, Sandhya; Wang, Sheng; ...

    2014-12-15

    An essential step in the discovery of molecular mechanisms contributing to disease phenotypes and efficient experimental planning is the development of weighted hypotheses that estimate the functional effects of sequence variants discovered by high-throughput genomics. With the increasing specialization of the bioinformatics resources, creating analytical workflows that seamlessly integrate data and bioinformatics tools developed by multiple groups becomes inevitable. Here we present a case study of a use of the distributed analytical environment integrating four complementary specialized resources, namely the Lynx platform, VISTA RViewer, the Developmental Brain Disorders Database (DBDB), and the RaptorX server, for the identification of high-confidence candidatemore » genes contributing to pathogenesis of spina bifida. The analysis resulted in prediction and validation of deleterious mutations in the SLC19A placental transporter in mothers of the affected children that causes narrowing of the outlet channel and therefore leads to the reduced folate permeation rate. The described approach also enabled correct identification of several genes, previously shown to contribute to pathogenesis of spina bifida, and suggestion of additional genes for experimental validations. The study demonstrates that the seamless integration of bioinformatics resources enables fast and efficient prioritization and characterization of genomic factors and molecular networks contributing to the phenotypes of interest.« less

  12. An Integrative Computational Approach for Prioritization of Genomic Variants

    PubMed Central

    Wang, Sheng; Meyden, Cem; Sulakhe, Dinanath; Poliakov, Alexander; Börnigen, Daniela; Xie, Bingqing; Taylor, Andrew; Ma, Jianzhu; Paciorkowski, Alex R.; Mirzaa, Ghayda M.; Dave, Paul; Agam, Gady; Xu, Jinbo; Al-Gazali, Lihadh; Mason, Christopher E.; Ross, M. Elizabeth; Maltsev, Natalia; Gilliam, T. Conrad

    2014-01-01

    An essential step in the discovery of molecular mechanisms contributing to disease phenotypes and efficient experimental planning is the development of weighted hypotheses that estimate the functional effects of sequence variants discovered by high-throughput genomics. With the increasing specialization of the bioinformatics resources, creating analytical workflows that seamlessly integrate data and bioinformatics tools developed by multiple groups becomes inevitable. Here we present a case study of a use of the distributed analytical environment integrating four complementary specialized resources, namely the Lynx platform, VISTA RViewer, the Developmental Brain Disorders Database (DBDB), and the RaptorX server, for the identification of high-confidence candidate genes contributing to pathogenesis of spina bifida. The analysis resulted in prediction and validation of deleterious mutations in the SLC19A placental transporter in mothers of the affected children that causes narrowing of the outlet channel and therefore leads to the reduced folate permeation rate. The described approach also enabled correct identification of several genes, previously shown to contribute to pathogenesis of spina bifida, and suggestion of additional genes for experimental validations. The study demonstrates that the seamless integration of bioinformatics resources enables fast and efficient prioritization and characterization of genomic factors and molecular networks contributing to the phenotypes of interest. PMID:25506935

  13. Frequency of thermostability variants: estimation of total rare variant frequency in human populations

    SciTech Connect

    Mohrenweiser, H.W.; Neel, J.V.

    1981-09-01

    Eight erythrocyte enzymes were examine for thermostability in an unselected sample of 100 newborn infants. Three thermolabile variants, one each of lactate dehydrogenase, glucosephosphate isomerase, and glucose-6-phosphate dehydrogenase, were identified, none of which was detectable as a variant by standard electrophoretic techniques. All were inherited. This frequency of 3.8 heritable thermostability variants per 1000 determinations is to be compared with a frequency of electrophoretically detectable variants of 1.1 per 1000 determinations, a frequency of 2.4 enzyme-deficiency variants per 1000 determinations, and a frequency of individuals with rare enzyme deficiency or electrophoretic or thermostability (or both) variants at these loci is 8.4 per 1000 determinations. A similar distribution and frequency is seen when the comparison is limited to the seven loci studied by all techniques. it is clear that not all of the electrophoretic and thermostability variants present in the population are detected by the techniques used in this study. Accordingly, it is estimated that the true frequency of carriers of a rare variant for each of these enzyme-coding loci averages greater than 10/1000. Some implications of these frequencies for human disease are discussed.

  14. Disease gene identification strategies for exome sequencing

    PubMed Central

    Gilissen, Christian; Hoischen, Alexander; Brunner, Han G; Veltman, Joris A

    2012-01-01

    Next generation sequencing can be used to search for Mendelian disease genes in an unbiased manner by sequencing the entire protein-coding sequence, known as the exome, or even the entire human genome. Identifying the pathogenic mutation amongst thousands to millions of genomic variants is a major challenge, and novel variant prioritization strategies are required. The choice of these strategies depends on the availability of well-phenotyped patients and family members, the mode of inheritance, the severity of the disease and its population frequency. In this review, we discuss the current strategies for Mendelian disease gene identification by exome resequencing. We conclude that exome strategies are successful and identify new Mendelian disease genes in approximately 60% of the projects. Improvements in bioinformatics as well as in sequencing technology will likely increase the success rate even further. Exome sequencing is likely to become the most commonly used tool for Mendelian disease gene identification for the coming years. PMID:22258526

  15. Injuries in orienteering.

    PubMed

    Linde, F

    1986-09-01

    In a one-year prospective study of 42 elite orienteers, 73 recent injuries (1.7 per runner per year) were found. Acute injuries totalled 52% and 48% were due to overuse. Ankle sprains made up 37% of acute injuries while the remaining were mainly contusions caused by falls or bumps against branches or rocks. Medial shin pain, Achilles peritendinitis, peroneal tenosynovitis and iliotibial band friction syndrome were the most frequent overuse injuries. All overuse injuries were located in the lower extremity while 18% of acute injuries was located elsewhere. Acute injuries were most frequent in the competitive season while overuse injuries occurred most often during the continuous training period.

  16. Representation of orientation distributions

    SciTech Connect

    Wenk, H.R.; Kocks, U.F.

    1985-01-01

    This paper illustrates the principles presented with a particular experimental texture: from the surface layer of a copper polycrystal cold-rolled to 60% reduction in thickness. Four incomplete pole figures (200, 220, 222, and 113) were determined by x-ray diffraction in reflection geometry. The measured pole figures nearly exhibited orthorhombic symmetry (as expected), which was then strictly enforced by averaging the four quadrants of the pole figure. The orientation distribution function was obtained using the expansion in spherical harmonics (with only even-order coefficients up to l = 18).

  17. VariantAnnotation: a Bioconductor package for exploration and annotation of genetic variants

    PubMed Central

    Obenchain, Valerie; Lawrence, Michael; Carey, Vincent; Gogarten, Stephanie; Shannon, Paul; Morgan, Martin

    2014-01-01

    Summary: VariantAnnotation is an R / Bioconductor package for the exploration and annotation of genetic variants. Capabilities exist for reading, writing and filtering variant call format (VCF) files. VariantAnnotation allows ready access to additional R / Bioconductor facilities for advanced statistical analysis, data transformation, visualization and integration with diverse genomic resources. Availability and implementation: This package is implemented in R and available for download at the Bioconductor Web site (http://bioconductor.org/packages/2.13/bioc/html/VariantAnnotation.html). The package contains extensive help pages for individual functions and a ‘vignette’ outlining typical work flows; it is made available under the open source ‘Artistic-2.0’ license. Version 1.9.38 was used in this article. Contact: vobencha@fhcrc.org PMID:24681907

  18. Temporal expression profiling identifies pathways mediating effect of causal variant on phenotype.

    PubMed

    Gupta, Saumya; Radhakrishnan, Aparna; Raharja-Liu, Pandu; Lin, Gen; Steinmetz, Lars M; Gagneur, Julien; Sinha, Himanshu

    2015-06-01

    Even with identification of multiple causal genetic variants for common human diseases, understanding the molecular processes mediating the causal variants' effect on the disease remains a challenge. This understanding is crucial for the development of therapeutic strategies to prevent and treat disease. While static profiling of gene expression is primarily used to get insights into the biological bases of diseases, it makes differentiating the causative from the correlative effects difficult, as the dynamics of the underlying biological processes are not monitored. Using yeast as a model, we studied genome-wide gene expression dynamics in the presence of a causal variant as the sole genetic determinant, and performed allele-specific functional validation to delineate the causal effects of the genetic variant on the phenotype. Here, we characterized the precise genetic effects of a functional MKT1 allelic variant in sporulation efficiency variation. A mathematical model describing meiotic landmark events and conditional activation of MKT1 expression during sporulation specified an early meiotic role of this variant. By analyzing the early meiotic genome-wide transcriptional response, we demonstrate an MKT1-dependent role of novel modulators, namely, RTG1/3, regulators of mitochondrial retrograde signaling, and DAL82, regulator of nitrogen starvation, in additively effecting sporulation efficiency. In the presence of functional MKT1 allele, better respiration during early sporulation was observed, which was dependent on the mitochondrial retrograde regulator, RTG3. Furthermore, our approach showed that MKT1 contributes to sporulation independent of Puf3, an RNA-binding protein that steady-state transcription profiling studies have suggested to mediate MKT1-pleiotropic effects during mitotic growth. These results uncover interesting regulatory links between meiosis and mitochondrial retrograde signaling. In this study, we highlight the advantage of analyzing allele

  19. Splice Variants of Perlucin from Haliotis laevigata Modulate the Crystallisation of CaCO3

    PubMed Central

    Franken, Sebastian; Grunwald, Ingo; Kelm, Sørge

    2014-01-01

    Perlucin is one of the proteins of the organic matrix of nacre (mother of pearl) playing an important role in biomineralisation. This nacreous layer can be predominately found in the mollusc lineages and is most intensively studied as a compound of the shell of the marine Australian abalone Haliotis laevigata. A more detailed analysis of Perlucin will elucidate some of the still unknown processes in the complex interplay of the organic/inorganic compounds involved in the formation of nacre as a very interesting composite material not only from a life science-based point of view. Within this study we discovered three unknown Perlucin splice variants of the Australian abalone H. laevigata. The amplified cDNAs vary from 562 to 815 base pairs and the resulting translation products differ predominantly in the absence or presence of a varying number of a 10 mer peptide C-terminal repeat. The splice variants could further be confirmed by matrix-assisted laser desorption ionisation time of flight mass spectrometry (MALDI-ToF MS) analysis as endogenous Perlucin, purified from decalcified abalone shell. Interestingly, we observed that the different variants expressed as maltose-binding protein (MBP) fusion proteins in E. coli showed strong differences in their influence on precipitating CaCO3 and that these differences might be due to a splice variant-specific formation of large protein aggregates influenced by the number of the 10 mer peptide repeats. Our results are evidence for a more complex situation with respect to Perlucin functional regulation by demonstrating that Perlucin splice variants modulate the crystallisation of calcium carbonate. The identification of differentially behaving Perlucin variants may open a completely new perspective for the field of nacre biomineralisation. PMID:24824517

  20. SubcloneSeeker: a computational framework for reconstructing tumor clone structure for cancer variant interpretation and prioritization.

    PubMed

    Qiao, Yi; Quinlan, Aaron R; Jazaeri, Amir A; Verhaak, Roeland Gw; Wheeler, David A; Marth, Gabor T

    2014-08-26

    Many tumors are composed of genetically divergent cell subpopulations. We report SubcloneSeeker, a package capable of exhaustive identification of subclone structures and evolutionary histories with bulk somatic variant allele frequency measurements from tumor biopsies. We present a statistical framework to elucidate whether specific sets of mutations are present within the same subclones, and the order in which they occur. We demonstrate how subclone reconstruction provides crucial information about tumorigenesis and relapse mechanisms; guides functional study by variant prioritization, and has the potential as a rational basis for informed therapeutic strategies for the patient. SubcloneSeeker is available at: https://github.com/yiq/SubcloneSeeker.

  1. Design oriented structural analysis

    NASA Technical Reports Server (NTRS)

    Giles, Gary L.

    1994-01-01

    Desirable characteristics and benefits of design oriented analysis methods are described and illustrated by presenting a synoptic description of the development and uses of the Equivalent Laminated Plate Solution (ELAPS) computer code. ELAPS is a design oriented structural analysis method which is intended for use in the early design of aircraft wing structures. Model preparation is minimized by using a few large plate segments to model the wing box structure. Computational efficiency is achieved by using a limited number of global displacement functions that encompass all segments over the wing planform. Coupling with other codes is facilitated since the output quantities such as deflections and stresses are calculated as continuous functions over the plate segments. Various aspects of the ELAPS development are discussed including the analytical formulation, verification of results by comparison with finite element analysis results, coupling with other codes, and calculation of sensitivity derivatives. The effectiveness of ELAPS for multidisciplinary design application is illustrated by describing its use in design studies of high speed civil transport wing structures.

  2. [Family oriented nursing care].

    PubMed

    Lima-Rodríguez, Joaquin Salvador; Lima-Serrano, Marta; Sáez-Bueno, Africa

    2009-01-01

    Nursing has experienced an important methodological development, in which it gives priority to the individual, although at a socioeconomic level a marked interest is seen in the health care of the family unit and the NANDA (North American Nursing Diagnosis Association), NIC (Nursing Interventions Classification) and NOC (Nursing Outcomes Classification) nursing guidelines, using diagnoses, criteria of results and interventions orientated towards this aim. We consider to the family as an opened system consisted of human elements, with a common history, which they form a functional unit been ruled by own procedure. In this paper we look at those aspects that must be taken into account in nursing assessment of families from a systemic perspective, including some tools for data collection and analysis of information. In addition, we identify specific areas of intervention. We believe that the family must be studied from a nursing care point of view with its own characteristics as opposed to those possessed individually by each of its members. We also believe that, when assessment is centred on the Henderson unaided activities study or the Gordon functional health patterns, they are not useful in assessing the family unit. This work offers an assessment method centred on the family unit, which helps to identify the nursing diagnoses applicable to it. Our proposal, which has been successfully used by nursing students over the last few years, hopes to contribute to quality clinical practice with a tool orientated towards the family.

  3. Novel Human Butyrylcholinesterase Variants: Toward Organophosphonate Detoxication

    PubMed Central

    2015-01-01

    Human butyrylcholinesterase (hBChE) is currently being developed as a detoxication enzyme for stoichiometric binding and/or catalytic hydrolysis of organophosphates. Herein, we describe the use of a molecular evolution method to develop novel hBChE variants with increased resistance to stereochemically defined nerve agent model compounds of soman, sarin, and cyclosarin. Novel hBChE variants (Y332S, D340H, and Y332S/D340H) were identified with an increased resistance to nerve agent model compounds that retained robust intrinsic catalytic efficiency. Molecular dynamics simulations of these variants revealed insights into the mechanism by which these structural changes conferred nerve agent model compound resistance. PMID:24902043

  4. A phonetic explanation of pronunciation variant effects.

    PubMed

    Sumner, Meghan

    2013-07-01

    Effects of word-level phonetic variation on the recognition of words with different pronunciation variants (e.g., center produced with/(out) [t]) are investigated via the semantic- and pseudoword-priming paradigms. A bias favoring clearly articulated words with canonical variants ([nt]) is found. By reducing the bias, words with different variants show robust and equivalent lexical activation. The equivalence of different word forms highlights a snag for frequency-based theories of lexical access: How are words and word productions with vastly different frequencies recognized equally well by listeners? A process-based account is proposed, suggesting that careful speech induces bottom-up processing and casual speech induces top-down processing.

  5. In silico comparative characterization of pharmacogenomic missense variants

    PubMed Central

    2014-01-01

    Background Missense pharmacogenomic (PGx) variants refer to amino acid substitutions that potentially affect the pharmacokinetic (PK) or pharmacodynamic (PD) response to drug therapies. The PGx variants, as compared to disease-associated variants, have not been investigated as deeply. The ability to computationally predict future PGx variants is desirable; however, it is not clear what data sets should be used or what features are beneficial to this end. Hence we carried out a comparative characterization of PGx variants with annotated neutral and disease variants from UniProt, to test the predictive power of sequence conservation and structural information in discriminating these three groups. Results 126 PGx variants of high quality from PharmGKB were selected and two data sets were created: one set contained 416 variants with structural and sequence information, and, the other set contained 1,265 variants with sequence information only. In terms of sequence conservation, PGx variants are more conserved than neutral variants and much less conserved than disease variants. A weighted random forest was used to strike a more balanced classification for PGx variants. Generally structural features are helpful in discriminating PGx variant from the other two groups, but still classification of PGx from neutral polymorphisms is much less effective than between disease and neutral variants. Conclusions We found that PGx variants are much more similar to neutral variants than to disease variants in the feature space consisting of residue conservation, neighboring residue conservation, number of neighbors, and protein solvent accessibility. Such similarity poses great difficulty in the classification of PGx variants and polymorphisms. PMID:25057096

  6. Functional Assessment of Disease-Associated Regulatory Variants In Vivo Using a Versatile Dual Colour Transgenesis Strategy in Zebrafish

    PubMed Central

    Bhatia, Shipra; Gordon, Christopher T.; Foster, Robert G.; Melin, Lucie; Abadie, Véronique; Baujat, Geneviève; Vazquez, Marie-Paule; Amiel, Jeanne; Lyonnet, Stanislas; van Heyningen, Veronica; Kleinjan, Dirk A.

    2015-01-01

    Disruption of gene regulation by sequence variation in non-coding regions of the genome is now recognised as a significant cause of human disease and disease susceptibility. Sequence variants in cis-regulatory elements (CREs), the primary determinants of spatio-temporal gene regulation, can alter transcription factor binding sites. While technological advances have led to easy identification of disease-associated CRE variants, robust methods for discerning functional CRE variants from background variation are lacking. Here we describe an efficient dual-colour reporter transgenesis approach in zebrafish, simultaneously allowing detailed in vivo comparison of spatio-temporal differences in regulatory activity between putative CRE variants and assessment of altered transcription factor binding potential of the variant. We validate the method on known disease-associated elements regulating SHH, PAX6 and IRF6 and subsequently characterise novel, ultra-long-range SOX9 enhancers implicated in the craniofacial abnormality Pierre Robin Sequence. The method provides a highly cost-effective, fast and robust approach for simultaneously unravelling in a single assay whether, where and when in embryonic development a disease-associated CRE-variant is affecting its regulatory function. PMID:26030420

  7. A Recurrent De Novo Variant in NACC1 Causes a Syndrome Characterized by Infantile Epilepsy, Cataracts, and Profound Developmental Delay.

    PubMed

    Schoch, Kelly; Meng, Linyan; Szelinger, Szabolcs; Bearden, David R; Stray-Pedersen, Asbjorg; Busk, Oyvind L; Stong, Nicholas; Liston, Eriskay; Cohn, Ronald D; Scaglia, Fernando; Rosenfeld, Jill A; Tarpinian, Jennifer; Skraban, Cara M; Deardorff, Matthew A; Friedman, Jeremy N; Akdemir, Zeynep Coban; Walley, Nicole; Mikati, Mohamad A; Kranz, Peter G; Jasien, Joan; McConkie-Rosell, Allyn; McDonald, Marie; Wechsler, Stephanie Burns; Freemark, Michael; Kansagra, Sujay; Freedman, Sharon; Bali, Deeksha; Millan, Francisca; Bale, Sherri; Nelson, Stanley F; Lee, Hane; Dorrani, Naghmeh; Goldstein, David B; Xiao, Rui; Yang, Yaping; Posey, Jennifer E; Martinez-Agosto, Julian A; Lupski, James R; Wangler, Michael F; Shashi, Vandana

    2017-02-02

    Whole-exome sequencing (WES) has increasingly enabled new pathogenic gene variant identification for undiagnosed neurodevelopmental disorders and provided insights into both gene function and disease biology. Here, we describe seven children with a neurodevelopmental disorder characterized by microcephaly, profound developmental delays and/or intellectual disability, cataracts, severe epilepsy including infantile spasms, irritability, failure to thrive, and stereotypic hand movements. Brain imaging in these individuals reveals delay in myelination and cerebral atrophy. We observe an identical recurrent de novo heterozygous c.892C>T (p.Arg298Trp) variant in the nucleus accumbens associated 1 (NACC1) gene in seven affected individuals. One of the seven individuals is mosaic for this variant. NACC1 encodes a transcriptional repressor implicated in gene expression and has not previously been associated with germline disorders. The probability of finding the same missense NACC1 variant by chance in 7 out of 17,228 individuals who underwent WES for diagnoses of neurodevelopmental phenotypes is extremely small and achieves genome-wide significance (p = 1.25 × 10(-14)). Selective constraint against missense variants in NACC1 makes this excess of an identical missense variant in all seven individuals more remarkable. Our findings are consistent with a germline recurrent mutational hotspot associated with an allele-specific neurodevelopmental phenotype in NACC1.

  8. Charge variants in IgG1

    PubMed Central

    Goswami, Sirj; Hutchinson, Ryan; Kwong, Zephania W; Yang, Jihong; Wang, Xiangdan; Yao, Zhenling; Sreedhara, Alavattam; Cano, Tony; Tesar, Devin; Nijem, Ihsan; Allison, David E; Wong, Pin Yee; Kao, Yung-Hsiang; Quan, Cynthia; Joshi, Amita; Harris, Reed J; Motchnik, Paul

    2010-01-01

    Antibody charge variants have gained considerable attention in the biotechnology industry due to their potential influence on stability and biological activity. Subtle differences in the relative proportions of charge variants are often observed during routine biomanufacture or process changes and pose a challenge to demonstrating product comparability. To gain further insights into the impact on biological activity and pharmacokinetics (PK) of monoclonal antibody (mAb) charge heterogeneity, we isolated the major charge forms of a recombinant humanized IgG1 and compared their in vitro properties and in vivo PK. The mAb starting material had a pI range of 8.7–9.1 and was composed of about 20% acidic variants, 12% basic variants and 68% main peak. Cation exchange displacement chromatography was used to isolate the acidic, basic and main peak fractions for animal studies. Detailed analyses were performed on the isolated fractions to identify specific chemical modification contributing to the charge differences and were also characterized for purity and in vitro potency prior to being administered either subcutaneously (SC) or intravenously (IV) in rats. All isolated materials had similar potency and rat FcRn binding relative to the starting material. Following IV or SC administration (10 mg/kg) in rats, no difference in serum PK was observed, indicating that physiochemical modifications and pI differences among charge variants were not sufficient to result in PK changes. Thus, these results provided meaningful information for the comparative evaluation of charge-related heterogeneity of mAbs and suggested that charge variants of IgGs do not affect the in vitro potency, FcRn binding affinity or the PK properties in rats. PMID:20818176

  9. Time-variant power spectrum analysis for the detection of transient episodes in HRV signal.

    PubMed

    Bianchi, A M; Mainardi, L; Petrucci, E; Signorini, M G; Mainardi, M; Cerutti, S

    1993-02-01

    A time-variant algorithm of autoregressive (AR) identification is introduced and applied to the heart rate variability (HRV) signal. The power spectrum is calculated from the AR coefficients derived from each single RR interval considered. Time-variant AR coefficients are determined through adaptive parametric identification with a forgetting factor which obtains weighed values on a running temporal window of 50 preceding measurements. Power spectrum density (PSD) is hence obtained at each cardiac cycle, making it possible to follow the dynamics of the spectral parameters on a beat-by-beat basis. These parameters are mainly the LF (low frequency) and the HF (high frequency) powers, and their ratio LF/HF. These together account for the balanced sympatho-vagal control mechanism affecting the heart rate. This method is applied to subjects suffering from transient ischemic attacks. The time variant spectral parameters suggest an early activation of LF component in the HRV power spectrum. It precedes by approximately 1.5-2 min the tachycardia and the ST displacement, generally indicative of the onset of an ischemic episode. The results suggest an arousal of sympathetic system before the acute attack.

  10. Chromosome Y genetic variants: impact in animal models and on human disease

    PubMed Central

    Prokop, J. W.

    2015-01-01

    Chromosome Y (chrY) variation has been associated with many complex diseases ranging from cancer to cardiovascular disorders. Functional roles of chrY genes outside of testes are suggested by the fact that they are broadly expressed in many other tissues and correspond to regulators of basic cellular functions (such as transcription, translation, and protein stability). However, the unique genetic properties of chrY (including the lack of meiotic crossover and the presence of numerous highly repetitive sequences) have made the identification of causal variants very difficult. Despite the prior lack of reliable sequences and/or data on genetic polymorphisms, earlier studies with animal chrY consomic strains have made it possible to narrow down the phenotypic contributions of chrY. Some of the evidence so far indicates that chrY gene variants associate with regulatory changes in the expression of other autosomal genes, in part via epigenetic effects. In humans, a limited number of studies have shown associations between chrY haplotypes and disease traits. However, recent sequencing efforts have made it possible to greatly increase the identification of genetic variants on chrY, which promises that future association of chrY with disease traits will be further refined. Continuing studies (both in humans and in animal models) will be critical to help explain the many sex-biased disease states in human that are contributed to not only by the classical sex steroid hormones, but also by chrY genetics. PMID:26286457

  11. Single variant and multi-variant trend tests for genetic association with next generation sequencing that are robust to sequencing error

    PubMed Central

    Kim, Wonkuk; Londono, Douglas; Zhou, Lisheng; Xing, Jinchuan; Nato, Andrew; Musolf, Anthony; Matise, Tara C.; Finch, Stephen J.; Gordon, Derek

    2013-01-01

    As with any new technology, next generation sequencing (NGS) has potential advantages and potential challenges. One advantage is the identification of multiple causal variants for disease that might otherwise be missed by SNP-chip technology. One potential challenge is misclassification error (as with any emerging technology) and the issue of power loss due to multiple testing. Here, we develop an extension of the linear trend test for association that incorporates differential misclassification error and may be applied to any number of SNPs. We call the statistic the linear trend test allowing for error, applied to NGS, or LTTae,NGS. This statistic allows for differential misclassification. The observed data are phenotypes for unrelated cases and controls, coverage, and the number of putative causal variants for every individual at all SNPs. We simulate data considering multiple factors (disease mode of inheritance, genotype relative risk, causal variant frequency, sequence error rate in cases, sequence error rate in controls, number of loci, and others) and evaluate type I error rate and power for each vector of factor settings. We compare our results with two recently published NGS statistics. Also, we create a fictitious disease model, based on downloaded 1000 Genomes data for 5 SNPs and 388 individuals, and apply our statistic to that data. We find that the LTTae,NGS maintains the correct type I error rate in all simulations (differential and non-differential error), while the other statistics show large inflation in type I error for lower coverage. Power for all three methods is approximately the same for all three statistics in the presence of non-differential error. Application of our statistic to the 1000 Genomes data suggests that, for the data downloaded, there is a 1.5% sequence misclassification rate over all SNPs. Finally, application of the multi-variant form of LTTae,NGS shows high power for a number of simulation settings, although it can have

  12. Wide mutation spectrum and frequent variant Ala27Thr of FBN1 identified in a large cohort of Chinese patients with sporadic TAAD

    PubMed Central

    Guo, Jun; Cai, Lun; Jia, Lixin; Li, Xiaoyan; Xi, Xin; Zheng, Shuai; Liu, Xuxia; Piao, Chunmei; Liu, Tingting; Sun, Zhongsheng; Cai, Tao; Du, Jie

    2015-01-01

    Genetic etiology in majority of patients with sporadic thoracic aortic aneurysm and dissections (STAAD) remains unknown. Recent GWAS study suggested common variant(s) in FBN1 is associated with STAAD. The present study aims to test this hypothesis and to identify mutation spectrum by targeted exome sequencing of the FBN1 gene in 146 unrelated patients with STAAD. Totally, 15.75% of FBN1 variants in STAAD were identified, including 5 disruptive and 18 missense mutations. Most of the variants were novel. Genotype-phenotype correlation analysis suggested that the maximum aortic diameter in the disruptive mutation group was significantly larger than that in the non-Cys missense mutation group. Interestingly, the variant Ala27Thr at −1 position, which is predicted to change the cleavage site of the signal peptidase of fibrillin-1, was detected in two unrelated patients. Furthermore, genotyping analysis of this variant detected 10 heterozygous Ala27Thr from additional 666 unrelated patients (1.50%), versus 7 from 1500 controls (0.47%), indicating a significant association of this variant with STAAD. Collectively, the identification of the variant Ala27Thr may represent a relatively common genetic predisposition and a novel pathogenetic mechanism for STAAD. Also, expansion of the mutation spectrum in FBN1 will be helpful in genetic counselling for Chinese patients with STAAD. PMID:26272055

  13. Neuronal representation of object orientation.

    PubMed

    Karnath, H O; Ferber, S; Bülthoff, H H

    2000-01-01

    The dissociation between object identity and object orientation observed in six patients with brain damage, has been taken as evidence for a view-invariant model of object recognition. However, there was also some indication that these patients were not generally agnosic for object orientation but were able to gain access to at least some information about objects' canonical upright. We studied a new case (KB) with spared knowledge of object identity and impaired perception of object orientation using a forced choice paradigm to contrast directly the patient's ability to perceive objects' canonical upright vs non-upright orientations. We presented 2D-pictures of objects with unambiguous canonical upright orientations in four different orientations (0 degrees, -90 degrees, +90 degrees, 180 degrees ). KB showed no impairment in identifying letters, objects, animals, or faces irrespective of their given orientation. Also, her knowledge of upright orientation of stimuli was perfectly preserved. In sharp contrast, KB was not able to judge the orientation when the stimuli were presented in a non-upright orientation. The findings give further support for a distributed view-based representation of objects in which neurons become tuned to the features present in certain views of an object. Since we see more upright than inverted animals and familiar objects, the statistics of these images leads to a larger number of neurons tuned for objects in an upright orientation. We suppose that probably for this reason KB's knowledge of upright orientation was found to be more robust against neuronal damage than knowledge of other orientations.

  14. VaRank: a simple and powerful tool for ranking genetic variants

    PubMed Central

    Geoffroy, Véronique; Pizot, Cécile; Redin, Claire; Piton, Amélie; Vasli, Nasim; Stoetzel, Corinne; Blavier, André; Laporte, Jocelyn

    2015-01-01

    Background. Most genetic disorders are caused by single nucleotide variations (SNVs) or small insertion/deletions (indels). High throughput sequencing has broadened the catalogue of human variation, including common polymorphisms, rare variations or disease causing mutations. However, identifying one variation among hundreds or thousands of others is still a complex task for biologists, geneticists and clinicians. Results. We have developed VaRank, a command-line tool for the ranking of genetic variants detected by high-throughput sequencing. VaRank scores and prioritizes variants annotated either by Alamut Batch or SnpEff. A barcode allows users to quickly view the presence/absence of variants (with homozygote/heterozygote status) in analyzed samples. VaRank supports the commonly used VCF input format for variants analysis thus allowing it to be easily integrated into NGS bioinformatics analysis pipelines. VaRank has been successfully applied to disease-gene identification as well as to molecular diagnostics setup for several hundred patients. Conclusions. VaRank is implemented in Tcl/Tk, a scripting language which is platform-independent but has been tested only on Unix environment. The source code is available under the GNU GPL, and together with sample data and detailed documentation can be downloaded from http://www.lbgi.fr/VaRank/. PMID:25780760

  15. An integrated framework for discovery and genotyping of genomic variants from high-throughput sequencing experiments.

    PubMed

    Duitama, Jorge; Quintero, Juan Camilo; Cruz, Daniel Felipe; Quintero, Constanza; Hubmann, Georg; Foulquié-Moreno, Maria R; Verstrepen, Kevin J; Thevelein, Johan M; Tohme, Joe

    2014-04-01

    Recent advances in high-throughput sequencing (HTS) technologies and computing capacity have produced unprecedented amounts of genomic data that have unraveled the genetics of phenotypic variability in several species. However, operating and integrating current software tools for data analysis still require important investments in highly skilled personnel. Developing accurate, efficient and user-friendly software packages for HTS data analysis will lead to a more rapid discovery of genomic elements relevant to medical, agricultural and industrial applications. We therefore developed Next-Generation Sequencing Eclipse Plug-in (NGSEP), a new software tool for integrated, efficient and user-friendly detection of single nucleotide variants (SNVs), indels and copy number variants (CNVs). NGSEP includes modules for read alignment, sorting, merging, functional annotation of variants, filtering and quality statistics. Analysis of sequencing experiments in yeast, rice and human samples shows that NGSEP has superior accuracy and efficiency, compared with currently available packages for variants detection. We also show that only a comprehensive and accurate identification of repeat regions and CNVs allows researchers to properly separate SNVs from differences between copies of repeat elements. We expect that NGSEP will become a strong support tool to empower the analysis of sequencing data in a wide range of research projects on different species.

  16. Orientation dependence of the orientation-contingent face aftereffect.

    PubMed

    Watson, Tamara L; Clifford, Colin W G

    2006-10-01

    Prolonged exposure to upright and inverted female and male faces produces opposite effects on subsequent judgments of the sex of faces depending on their orientation. We show that the magnitude of this orientation-contingent gender aftereffect can be predicted from simple aftereffects induced separately at the same orientations. The contingent aftereffect can also be induced in faces tilted 90 degrees to the right and left, eliminating any difference in face-processing strategy that may be in operation with upright and inverted faces. This suggests that neurons employing a single face encoding strategy can be activated in an orientation-specific manner.

  17. [Market oriented occupational medicine].

    PubMed

    Rurik, Imre; Cseh, Károly

    2012-09-09

    The history and the recent state of occupational medicine in Hungary, and its relation with governmental labor organizations are analyzed. In the past 20 years, large "socialist" factories were replaced by smaller companies employing fewer workers. They have been forced to establish contract with occupational health providers. Many of them offer primary care services, whereas family physicians having a board examination in occupational medicine are allowed to work in this field as well. The market of occupational medicine is less regulated, and ethical rules are not always considered. Undercutting prices is a common practice. The recent system could be improved by some regulations which should be respected. There is no reason to make rough changes establishing a new market for profit oriented insurance companies, and to allow employees and employers to work without specification neglecting international agreements. Occupational medicine should be supervised again by the health authorities instead of economists who have quite different, short-term priorities.

  18. Oriental mystery: ginseng

    SciTech Connect

    Yun, T.K.; Cho, H.O.; Yun, Y.S.

    1985-01-01

    As a mysterious cure-all medicine Korea ginseng has been, since four or five thousand years ago, used as a tonic in the orient. Ginseng has been known to have a tonic effect and it is the general opinion of many investigators that ginseng has the effect of normalization of physical conditions, that is; maintaining individual homeostasis. On the other hand, the authors have found that ginseng extract inhibits the incidence and also the proliferation of tumors induced by carcinogens such as urethane, DMBA and aflatoxin B. The anticarcinogenic effect of ginseng was due to its ability to enhance the natural killer activity of the host. Korea ginseng is highly effective in preventing or curing various disease such as diabetes, cancer, high blood pressure, etc.

  19. The current state of clinical interpretation of sequence variants.

    PubMed

    Hoskinson, Derick C; Dubuc, Adrian M; Mason-Suares, Heather

    2017-01-31

    Accurate and consistent variant classification is required for Precision Medicine. But clinical variant classification remains in its infancy. While recent guidelines put forth jointly by the American College of Medical Genetics and Genomics (ACMG) and Association of Molecular Pathology (AMP) for the classification of Mendelian variants has advanced the field, the degree of subjectivity allowed by these guidelines can still lead to inconsistent classification across clinical molecular genetic laboratories. In addition, there are currently no such guidelines for somatic cancer variants, only published institutional practices. Additional variant classification guidelines, including disease- or gene-specific criteria, along with inter-laboratory data sharing is critical for accurate and consistent variant interpretation.

  20. Lunar orientation in a beetle.

    PubMed

    Dacke, Marie; Byrne, Marcus J; Scholtz, Clarke H; Warrant, Eric J

    2004-02-22

    Many animals use the sun's polarization pattern to orientate, but the dung beetle Scarabaeus zambesianus is the only animal so far known to orientate using the million times dimmer polarization pattern of the moonlit sky. We demonstrate the relative roles of the moon and the nocturnal polarized-light pattern for orientation. We find that artificially changing the position of the moon, or hiding the moon's disc from the beetle's field of view, generally did not influence its orientation performance. We thus conclude that the moon does not serve as the primary cue for orientation. The effective cue is the polarization pattern formed around the moon, which is more reliable for orientation. Polarization sensitivity ratios in two photoreceptors in the dorsal eye were found to be 7.7 and 12.9, similar to values recorded in diurnal navigators. These results agree with earlier results suggesting that the detection and analysis of polarized skylight is similar in diurnal and nocturnal insects.

  1. Neuroendocrine factors distinguish juvenile psychopathy variants.

    PubMed

    Kimonis, Eva R; Goulter, Natalie; Hawes, David J; Wilbur, Rhonda R; Groer, Maureen W

    2017-03-01

    The characteristic pattern of emotional hypo-reactivity observed in primary psychopathy is not evident in secondary psychopathy, which is thought to originate from childhood adversity and co-occurring anxiety. The main aim of this study was to test whether salivary afternoon cortisol, Dehydroepiandrosterone (DHEA), and cortisol-to-DHEA concentrations, which at high levels indicate risk for chronic stress and poor mental health, distinguished secondary from primary variants of callous-unemotional (CU) traits-the affective component of psychopathy. This aim was achieved by first identifying psychopathy variants using latent profile analysis of CU, anxiety, and aggression scores among 232 incarcerated adolescent boys (M age = 16.75). Based on a subset with neuroendocrine data (n = 201), aggressive secondary CU variants had lower afternoon DHEA concentrations and higher cortisol-to-DHEA ratios and comorbid psychopathology compared with all other groups. In contrast, two primary CU variants (aggressive and non-aggressive types) emerged with profiles characterized by low to average psychopathology and high DHEA levels. Findings contribute to a growing literature base suggesting that biomarkers may distinguish youth on separable developmental pathways to psychopathy.

  2. Variant Spellings in Modern American Dictionaries.

    ERIC Educational Resources Information Center

    Emery, Donald W.

    A record of how present-day desk dictionaries are recognizing the existence of variant or secondary spellings for many common English words, this reference list can be used by teachers of English and authors of spelling lists. Originally published in 1958, this revised edition uses two dictionaries not in existence then and the revised editions of…

  3. Truncated variants of apolipoprotein B cause hypobetalipoproteinaemia.

    PubMed Central

    Collins, D R; Knott, T J; Pease, R J; Powell, L M; Wallis, S C; Robertson, S; Pullinger, C R; Milne, R W; Marcel, Y L; Humphries, S E

    1988-01-01

    Familial hypobetalipoproteinaemia is a rare autosomal dominant disorder in which levels of apo-B-containing plasma lipoproteins are approximately half-normal in heterozygotes and virtually absent in homozygotes. Here we describe mutations of the apo-B gene that cause two different truncated variants of apo-B in unrelated individuals with hypobetalipoproteinaemia. One variant, apo-B(His1795----Met-Trp-Leu-Val-Thr-Term) is predicted to be 1799 amino acids long and arises from deletion of a single nucleotide (G) from leucine codon 1794. This protein was found at low levels in very low density and low density lipoprotein fractions in the blood. The second, shorter variant, apo-B(Arg1306----Term), is caused by mutation of a CpG dinucleotide in arginine codon 1306 converting it to a stop codon and predicting a protein of 1305 residues. The product of this allele could not be detected in the circulation. The differences in size and behaviour of these two variants compared to apo-B100 or apo-B48 point to domains that may be important for the assembly, secretion or stability of apo-B-containing lipoproteins. Images PMID:2843815

  4. Novel variant of tickborne encephalitis virus, Russia.

    PubMed

    Ternovoi, Vladimir A; Protopopova, Elena V; Chausov, Eugene V; Novikov, Dmitry V; Leonova, Galina N; Netesov, Sergey V; Loktev, Valery B

    2007-10-01

    We isolated a novel strain of tickborne encephalitis virus (TBEV), Glubinnoe/2004, from a patient with a fatal case in Russia. We sequenced the strain, whose landmark features included 57 amino acid substitutions and 5 modified cleavage sites. Phylogenetically, Glubinnoe/2004 is a novel variant that belongs to the Eastern type of TBEV.

  5. Guillain-Barré Syndrome and Variants

    PubMed Central

    Barohn, Richard J.

    2014-01-01

    Synopsis Guillain-Barré syndrome (GBS) is characterized by rapidly evolving ascending weakness, mild sensory loss and hypo- or areflexia, progressing to a nadir over up to four weeks. Cerebrospinal fluid evaluation demonstrates albuminocytologic dissociation in 90% of cases. Acute inflammatory demyelinating polyneuropathy (AIDP) was the first to be recognized over a century ago and is the most common form of GBS. In AIDP, the immune attack is directed at peripheral nerve myelin with secondary by-stander axon loss. Axonal motor and sensorimotor variants have been described in the last 3 decades and are mediated by molecular mimicry targeting peripheral nerve motor axons. Besides the Miller-Fisher syndrome (MFS) and descending weakness, other rare phenotypic variants have been recently described with pure sensory variant, restricted autonomic manifestations and the pharyngeal-cervical-brachial pattern. It is important to recognize GBS and its variants due to the availability of equally effective therapies in the form of plasmapheresis and intravenous immunoglobulins. PMID:23642721

  6. Truncated variants of apolipoprotein B cause hypobetalipoproteinaemia

    SciTech Connect

    Collins, D.R.; Knott, T.J.; Pease, R.J.; Powell, L.M.; Wallis, S.C.; Robertson, S.; Pullinger, C.R.; Lloyd, K.; Miller, N.E.; Muller, D.; Scott, J. ); Humphries, S.E.; Talmud, P.J. ); Milne, R.W.; Marcel, Y.L. )

    1988-09-12

    Familial hypobetalipoproteinaemia is a rare autosomal dominant disorder in which levels of apo-B-containing plasma lipoproteins are approximately half-normal in heterozygotes and virtually absent in homozygotes. Here the authors describe mutations of the apo-B gene that cause two different truncated variants of apo-B in unrelated individuals with hypobetalipoproteinaemia. One variant is predicted to be 1,799 amino acids long and arises from deletion of a single nucleotide (G) from leucine codon 1,794. This protein was found at low levels in very low density and low density lipoprotein fractions in the blood. The second, shorter variant is caused by mutation of a CpG dinucleotide in arginine codon 1,306 converting it to a stop codon and predicting a protein of 1,305 residues. The differences in size and behavior of these two variants compared to apo-B100 or apo-B48 point to domains that may be important for the assembly, secretion or stability of apo-B-containing lipoproteins.

  7. Regional Phonological Variants in Louisiana Speech.

    ERIC Educational Resources Information Center

    Rubrecht, August Weston

    Based on tape recorded conversations of 28 informants in 18 Louisiana communities, this study investigated regional phonological variants in Louisiana speech. On the basis of settlement history and previous dialect studies, four regions are defined: northern Louisiana, the Florida Parishes, French Louisiana, and New Orleans. The informants are all…

  8. New genetic variants associated with prostate cancer

    Cancer.gov

    Researchers have newly identified 23 common genetic variants -- one-letter changes in DNA known as single-nucleotide polymorphisms or SNPs -- that are associated with risk of prostate cancer. These results come from an analysis of more than 10 million SNP

  9. Cellobiohydrolase I gene and improved variants

    DOEpatents

    Adney, William S.; Decker, Stephen R.; Mc Carter, Suzanne; Baker, John O.; Nieves, Raphael; Himmel, Michael E.; Vinzant, Todd B.

    2008-05-20

    The disclosure provides a method for preparing an active exoglucanase in a heterologous host of eukaryotic origin. The method includes mutagenesis to reduce glycosylation of the exoglucanase when expressed in a heterologous host. It is further disclosed a method to produce variant cellobiohydrolase that is stable at high temperature through mutagenesis.

  10. Progress in methods for rare variant association.

    PubMed

    Santorico, Stephanie A; Hendricks, Audrey E

    2016-02-03

    Empirical studies and evolutionary theory support a role for rare variants in the etiology of complex traits. Given this motivation and increasing affordability of whole-exome and whole-genome sequencing, methods for rare variant association have been an active area of research for the past decade. Here, we provide a survey of the current literature and developments from the Genetics Analysis Workshop 19 (GAW19) Collapsing Rare Variants working group. In particular, we present the generalized linear regression framework and associated score statistic for the 2 major types of methods: burden and variance components methods. We further show that by simply modifying weights within these frameworks we arrive at many of the popular existing methods, for example, the cohort allelic sums test and sequence kernel association test. Meta-analysis techniques are also described. Next, we describe the 6 contributions from the GAW19 Collapsing Rare Variants working group. These included development of new methods, such as a retrospective likelihood for family data, a method using genomic structure to compare cases and controls, a haplotype-based meta-analysis, and a permutation-based method for combining different statistical tests. In addition, one contribution compared a mega-analysis of family-based and population-based data to meta-analysis. Finally, the power of existing family-based methods for binary traits was compared. We conclude with suggestions for open research questions.

  11. Gene variants as risk factors for gastroschisis

    PubMed Central

    Yang, Wei; Schultz, Kathleen; Tom, Lauren; Lin, Bin; Carmichael, Suzan L.; Lammer, Edward J.; Shaw, Gary M.

    2016-01-01

    In a population‐based case‐control study in California of 228 infants, we investigated 75 genetic variants in 20 genes and risk of gastroschisis with regard to maternal age, race/ethnicity, vitamin use, and smoking exposure. We hypothesized that genes related to vascular compromise may interact with environmental factors to affect the risk of gastroschisis. Haplotypes were constructed for 75 gene variants using the HaploView program. Risk for gastroschisis associated with each gene variant was calculated for both the homozygotes and the heterozygotes, with the homozygous wildtypes as the referent. Risks were estimated as odds ratios (ORs) with 95% confidence intervals (CIs) by logistic regression. We found 11 gene variants with increased risk and four variants with decreased risk of gastroschisis for heterozygous (ORh) or homozygous variants (ORv) genotypes. These included NOS3 (rs1036145) ORh = 0.4 (95% CI: 0.2–0.7); NOS3 (rs10277237) ORv = 2.7 (95% CI: 1.3–6.0); ADD1 (rs12503220) ORh = 2.9 (95% CI: 1.6–5.4), GNB3 (rs5443) ORh = 0.2 (95% CI: 0.1–0.5), ORv = 0.4 (95% CI: 0.2–0.9); ICAM1 (rs281428) ORv = 6.9 (95% CI: 2.1–22.9), ICAM1 (rs3093030) ORv = 2.6 (95% CI: 1.2–5.6); ICAM4 (rs281438) ORv = 4.9 (95% CI: 1.4–16.6), ICAM5 (rs281417) ORh = 2.1 (95% CI: 1.1–4.1), ORv = 4.8 (95% CI: 1.7–13.6); ICAM5 (rs281440) ORh = 23.7 (95% CI: 5.5–102.5), ORv = 20.6 (95% CI: 3.4–124.3); ICAM5 (rs2075741) ORv = 2.2 (95% CI: 1.1–4.4); NAT1 ORv = 0.3 (95% CI: 0.1–0.9). There were additional associations between several gene variants and gastroschisis among women aged 20–24 and among mothers with and without vitamin use. NOS3, ADD1, ICAM1, ICAM4, and ICAM5 warrant further investigation in additional populations and with the interaction of additional environmental exposures. © 2016 Wiley Periodicals, Inc. PMID:27616475

  12. Orientation filtering for crystalline films

    DOEpatents

    Smith, Henry I.; Atwater, Harry A.; Thompson, Carl V.; Geis, Michael W.

    1986-12-30

    A substrate is coated with a film to be recrystallized. A pattern of crystallization barriers is created in the film, for example, by etching voids in the film. An encapsulation layer is generally applied to protect the film, fill the voids and otherwise enhance a recrystallization process. Recrystallization is carried out such that certain orientations pass preferentially through the barrier, generally as a result of growth-velocity anisotropy. The result is a film of a specific predetermined crystallographic orientation, a range of orientations or a set of discrete orientations.

  13. Orientation filtering for crystalline films

    DOEpatents

    Smith, H.I.; Atwater, H.A.; Thompson, C.V.; Geis, M.W.

    1986-12-30

    A substrate is coated with a film to be recrystallized. A pattern of crystallization barriers is created in the film, for example, by etching voids in the film. An encapsulation layer is generally applied to protect the film, fill the voids and otherwise enhance a recrystallization process. Recrystallization is carried out such that certain orientations pass preferentially through the barrier, generally as a result of growth-velocity anisotropy. The result is a film of a specific predetermined crystallographic orientation, a range of orientations or a set of discrete orientations. 7 figs.

  14. Visual object affordances: object orientation.

    PubMed

    Symes, Ed; Ellis, Rob; Tucker, Mike

    2007-02-01

    Five experiments systematically investigated whether orientation is a visual object property that affords action. The primary aim was to establish the existence of a pure physical affordance (PPA) of object orientation, independent of any semantic object-action associations or visually salient areas towards which visual attention might be biased. Taken together, the data from these experiments suggest that firstly PPAs of object orientation do exist, and secondly, the behavioural effects that reveal them are larger and more robust when the object appears to be graspable, and is oriented in depth (rather than just frontally) such that its leading edge appears to point outwards in space towards a particular hand of the viewer.

  15. Mouse p63 variants and chondrogenesis

    PubMed Central

    Gu, Junxia; Lu, Yaojuan; Qiao, Longwei; Ran, Deyuan; Li, Na; Cao, Hong; Gao, Yan; Zheng, Qiping

    2013-01-01

    As a critical member of the p53 family of transcription factors, p63 has been implicated a role in development than in tumor formation, because p63 is seldom mutated in human cancers, while p63 null mice exhibit severe developmental abnormalities without increasing cancer susceptibility. Notably, besides the major epithelial and cardiac defect, p63 deficient mice show severe limb and craniofacial abnormalities. In addition, humans with p63 mutations also show severe limb and digit defects, suggesting a putative role of p63 in skeletal development. There are eight p63 variants which encode for the TAp63 and ΔNp63 isoforms by alternative promoters. How these isoforms function during skeletal development is currently largely unknown. Our recent transgenic studies suggest a role of TAP63α, but not ΔNP63α, during embryonic long bone development. However, the moderate skeletal phenotypes in the TAP63α transgenic mice suggest requirement of additional p63 isoform(s) for the limb defects in p63 null mice. Here, we report analysis of mouse p63 variants in MCT and ATDC5 cells, two cell models undergo hypertrophic differentiation and mimic the process of endochondral bone formation upon growth arrest or induction. We detected increased level of p63 variants in hypertrophic MCT cells by regular RT-PCR analysis. Further analysis by qRT-PCR, we detected significantly upregulated level of γ variant (p<0.05), but not α or β variant (p>0.05), in hypertrophic MCT cells than in proliferative MCT cells. Moreover, we detected upregulated TAP63γ in ATDC5 cells undergoing hypertrophic differentiation. Our results suggest that TAp63γ plays a positive role during endochondral bone formation. PMID:24294373

  16. Dynamic Bayesian Testing of Sets of Variants in Complex Diseases

    PubMed Central

    Zhang, Yu; Ghosh, Soumitra; Hakonarson, Hakon

    2014-01-01

    Rare genetic variants have recently been studied for genome-wide associations with human complex diseases. Existing rare variant methods are based on the hypothesis-testing framework that predefined variant sets need to be tested separately. The power of those methods is contingent upon accurate selection of variants for testing, and frequently, common variants are left out for separate testing. In this article, we present a novel Bayesian method for simultaneous testing of all genome-wide variants across the whole frequency range. The method allows for much more flexible grouping of variants and dynamically combines them for joint testing. The method accounts for correlation among variant sets, such that only direct associations with the disease are reported, whereas indirect associations due to linkage disequilibrium are not. Consequently, the method can obtain much improved power and flexibility and simultaneously pinpoint multiple disease variants with high resolution. Additional covariates of categorical, discrete, and continuous values can also be added. We compared our method with seven existing categories of approaches for rare variant mapping. We demonstrate that our method achieves similar power to the best methods available to date when testing very rare variants in small SNP sets. When moderately rare or common variants are included, or when testing a large collection of variants, however, our method significantly outperforms all existing methods evaluated in this study. We further demonstrate the power and the usage of our method in a whole-genome resequencing study of type 1 diabetes. PMID:25217050

  17. Occupational Orientation: Industrial Oriented Occupations. Experimental Curriculum Materials.

    ERIC Educational Resources Information Center

    Illinois State Office of Education, Springfield.

    These experimental curriculum materials, for one of five clusters developed for the occupational orientation program in Illinois, contain teacher references and a series of learning activity packages (LAPs) designed to acquaint the student with the wide range of occupational choices available in the industrial oriented occupations field. The 30…

  18. Subcortical orientation biases explain orientation selectivity of visual cortical cells

    PubMed Central

    Vidyasagar, Trichur R; Jayakumar, Jaikishan; Lloyd, Errol; Levichkina, Ekaterina V

    2015-01-01

    The primary visual cortex of carnivores and primates shows an orderly progression of domains of neurons that are selective to a particular orientation of visual stimuli such as bars and gratings. We recorded from single-thalamic afferent fibers that terminate in these domains to address the issue whether the orientation sensitivity of these fibers could form the basis of the remarkable orientation selectivity exhibited by most cortical cells. We first performed optical imaging of intrinsic signals to obtain a map of orientation domains on the dorsal aspect of the anaesthetized cat's area 17. After confirming using electrophysiological recordings the orientation preferences of single neurons within one or two domains in each animal, we pharmacologically silenced the cortex to leave only the afferent terminals active. The inactivation of cortical neurons was achieved by the superfusion of either kainic acid or muscimol. Responses of single geniculate afferents were then recorded by the use of high impedance electrodes. We found that the orientation preferences of the afferents matched closely with those of the cells in the orientation domains that they terminated in (Pearson's r = 0.633, n = 22, P = 0.002). This suggests a possible subcortical origin for cortical orientation selectivity. PMID:25855249

  19. Germline Variants and Advanced Colorectal Adenomas: Adenoma Prevention with Celecoxib Trial Genomewide Association Study

    PubMed Central

    Wang, Jiping; Carvajal-Carmona, Luis G.; Chu, Jen-Hwa; Zauber, Ann G.; Kubo, Michikai; Matsuda, Koichi; Dunlop, Malcolm; Houlston, Richard S.; Sieber, Oliver; Lipton, Lara; Gibbs, Peter; Martin, Nicholas G.; Montgomery, Grant W.; Young, Joanne; Baird, Paul N.; Ratain, Mark J.; Nakamura, Yusuke; Weiss, Scott T.; Tomlinson, Ian; Bertagnolli, Monica M.

    2014-01-01

    Purpose Identification of single nucleotide polymorphisms (SNPs) associated with development of advanced colorectal adenomas. Experimental Design Discovery Phase: 1,406 Caucasian patients (139 advanced adenoma cases and 1,267 controls) from the Adenoma Prevention with Celecoxib (APC) trial were included in a genome-wide association study (GWAS) to identify variants associated with post-polypectomy disease recurrence. Genome-wide significance was defined as false discovery rate < 0.05, unadjusted p=7.4×10−7. Validation Phase: Results were further evaluated using 4,175 familial colorectal adenoma or CRC cases and 5,036 controls from patients of European ancestry (COloRectal Gene Identification consortium, Scotland, Australia and VQ58). Results Our study identified eight SNPs associated with advanced adenoma risk in the APC trial (rs2837156, rs7278863, rs2837237, rs2837241, rs2837254, rs741864 at 21q22.2, and rs1381392 and rs17651822 at 3p24.1, at p<10–7 level with odds ratio – OR>2). Five variants in strong pairwise linkage disequilbrium (rs7278863, rs2837237, rs741864, rs741864 and rs2837241, r2=0.8–1) are in or near the coding region for the tight junction adhesion protein, IGSF5. An additional variant associated with advanced adenomas, rs1535989 (minor allele frequency 0.11; OR 2.09; 95% confidence interval 1.50–2.91), also predicted CRC development in a validation analysis (p=0.019) using a series of adenoma cases or CRC (CORGI study) and 3 sets of CRC cases and controls (Scotland, VQ58 and Australia, N=9,211). Conclusions Our results suggest that common polymorphisms contribute to the risk of developing advanced adenomas and might also contribute to the risk of developing CRC. The variant at rs1535989 may identify patients whose risk for neoplasia warrants increased colonoscopic surveillance. PMID:24084763

  20. Propagating orientation constraints for the Hubble Space Telescope

    NASA Technical Reports Server (NTRS)

    Bose, Ashim; Gerb, Andy

    1994-01-01

    An observing program on the Hubble Space Telescope (HST) is described in terms of exposures that are obtained by one or more of the instruments onboard the HST. Many requested exposures might specify orientation requirements and accompanying ranges. Orientation refers to the amount of roll (in degrees) about the line of sight. The range give the permissible tolerance (also in degrees). These requirements may be (1) absolute (in relation to the celestial coordinate system), (2) relative to the nominal roll angle for HST during that exposure, or (3) relative (in relation to other exposures in the observing program). The TRANSformation expert system converts proposals for astronomical observations with HST into detailed observing plans. Part of the conversion involves grouping exposures into higher level structures based on exposure characteristics. Exposures constrained to be at different orientations cannot be grouped together. Because relative orientation requirements cause implicit constraints, orientation constraints have to be propagated. TRANS must also identify any inconsistencies that may exist so they can be corrected. We have designed and implemented an orientation constraint propagator as part of TRANS. The propagator is based on an informal algebra that facilitates the setting up and propagation of the orientation constraints. The constraint propagator generates constraints between directly related exposures, and propagates derived constraints between exposures that are related indirectly. It provides facilities for path-consistency checking, identification of unsatisfiable constraints, and querying of orientation relationships. The system has been successfully operational as part of TRANS for over seven months. The solution has particular significance to space applications in which satellite/telescope pointing and attitude are constrained and relationships exist between multiple configurations.

  1. Peptide Orientation Affects Selectivity in Ion-Exchange Chromatography

    SciTech Connect

    Alpert, Andrew J.; Petritis, Konstantinos; Kangas, Lars J.; Smith, R. D.; Mechtler, Karl; Mitulovic, Goran; Mohammed, Shabaz; Heck, Albert J.

    2010-06-15

    Here we demonstrate that separation of proteolytic peptides, having the same net charge and one basic residue, is affected by their specific orientation toward the stationary phase in ion-exchange chromatography. In electrostatic repulsion-hydrophilic interaction chromatography (ERLIC) with an anion-exchange material, the C-terminus of the peptides is, on average, oriented toward the stationary phase. In cation exchange, the average peptide orientation is the opposite. Data with synthetic peptides, serving as orientation probes, indicate that in tryptic/ Lys-C peptides the C-terminal carboxyl group appears to be in a zwitterionic bond with the side chain of the C-terminal Lys/Arg residue. In effect, the side chain is then less basic than the N-terminus, accounting for the specific orientation of tryptic and Lys-C peptides. Analyses of larger sets of peptides, generated from lysates by either Lys-N, Lys-C, or trypsin, reveal that specific peptide orientation affects the ability of charged side chains, such as phosphate residues, to influence retention. Phosphorylated residues that are remote in the sequence from the binding site affect retention less than those that are closer. When a peptide contains multiple charged sites, then orientation is observed to be less rigid and retention tends to be governed by the peptide’s net charge rather than its sequence. These general observations could be of value in confirming a peptide’s identification and, in particular, phosphosite assignments in proteomics analyses. More generally, orientation accounts for the ability of chromatography to separate peptides of the same composition but different sequence.

  2. Peptide Orientation Affects Selectivity in Ion-Exchange Chromatography

    SciTech Connect

    Alpert, Andrew J.; Petritis, Konstantinos; Kangas, Lars J.; Smith, Richard D.; Mechtler, Karl; Mitulovic, Goran; Mohammed, Shabaz; Heck, Albert J.

    2010-06-15

    Here we demonstrate that separation of proteolytic peptides, having the same net charge and one basic residue, is affected by their specific orientation toward the stationary phase in ion-exchange chromatography. In electrostatic repulsion-hydrophilic interaction chromatography (ERLIC) with an anion-exchange material, the C-terminus of the peptides is, on average, oriented toward the stationary phase. In cation exchange, the average peptide orientation is the opposite. Data with synthetic peptides, serving as orientation probes, indicate that in tryptic/Lys-C peptides the C-terminal carboxyl group appears to be in a zwitterionic bond with the side chain of the C-terminal Lys/Arg residue. In effect, the side chain is then less basic than the N-terminus, accounting for the specific orientation of tryptic and Lys-C peptides. Analyses of larger sets of peptides, generated from lysates by either Lys-N, Lys-C, or trypsin, reveal that specific peptide orientation affects the ability of harged side chains, such as phosphate residues, to influence retention. Phosphorylated residues that are remote in the sequence from the binding site affect retention less than those that are closer. When a peptide contains multiple charged sites, then orientation is observed to be less rigid and retention tends to be governed by the peptide’s net charge rather than its sequence. These general observations could be of value in confirming a peptide’s identification and, in particular, phosphosite assignments in proteomics analyses. More generally, orientation accounts for the ability of chromatography to separate peptides of the same compositionbut different sequence.

  3. Propagating orientation constraints for the Hubble Space Telescope

    NASA Astrophysics Data System (ADS)

    Bose, Ashim; Gerb, Andy

    1994-05-01

    An observing program on the Hubble Space Telescope (HST) is described in terms of exposures that are obtained by one or more of the instruments onboard the HST. Many requested exposures might specify orientation requirements and accompanying ranges. Orientation refers to the amount of roll (in degrees) about the line of sight. The range give the permissible tolerance (also in degrees). These requirements may be (1) absolute (in relation to the celestial coordinate system), (2) relative to the nominal roll angle for HST during that exposure, or (3) relative (in relation to other exposures in the observing program). The TRANSformation expert system converts proposals for astronomical observations with HST into detailed observing plans. Part of the conversion involves grouping exposures into higher level structures based on exposure characteristics. Exposures constrained to be at different orientations cannot be grouped together. Because relative orientation requirements cause implicit constraints, orientation constraints have to be propagated. TRANS must also identify any inconsistencies that may exist so they can be corrected. We have designed and implemented an orientation constraint propagator as part of TRANS. The propagator is based on an informal algebra that facilitates the setting up and propagation of the orientation constraints. The constraint propagator generates constraints between directly related exposures, and propagates derived constraints between exposures that are related indirectly. It provides facilities for path-consistency checking, identification of unsatisfiable constraints, and querying of orientation relationships. The system has been successfully operational as part of TRANS for over seven months. The solution has particular significance to space applications in which satellite/telescope pointing and attitude are constrained and relationships exist between multiple configurations.

  4. Precise Identification of Graphene's Crystal Structures by Removable Nanowire Epitaxy.

    PubMed

    Kim, Jonghyeok; Lim, Kitaek; Lee, Yangjin; Kim, Jongin; Kim, Kihwan; Park, Jungwon; Kim, Kwanpyo; Lee, Won Chul

    2017-03-16

    Monitoring crystallographic orientations of graphene is important for the reliable generation of graphene-based nanostructures such as van der Waals heterostructures and graphene nanoribbons because their physical properties are dependent on crystal structures. However, facile and precise identification of graphene's crystallographic orientations is still challenging because the majority of current tools rely on complex atomic-scale imaging. Here, we present an identification method for the crystal orientations and grain boundaries of graphene using the directional alignment between epitaxially grown AuCN nanowires and the underlying graphene. Because the nanowires are visible in scanning electron microscopy, crystal orientations of graphene can be inspected with simple procedures. Kernel density estimation that we used in analyzing the nanowire directions enables precise measurement of graphene's crystal orientations. We also confirm that the imaged nanowires can be simply removed without degrading graphene's quality, thus showing that the present method can be practically used for measuring graphene's crystal structures.

  5. Impression block with orientator

    NASA Astrophysics Data System (ADS)

    Brilin, V. I.; Ulyanova, O. S.

    2015-02-01

    Tool review, namely the impression block, applied to check the shape and size of the top of fish as well as to determine the appropriate tool for fishing operation was realized. For multiple application and obtaining of the impress depth of 3 cm and more, the standard volumetric impression blocks with fix rods are used. However, the registered impress of fish is not oriented in space and the rods during fishing are in the extended position. This leads to rods deformation and sinking due to accidental impacts of impression block over the borehole irregularity and finally results in faulty detection of the top end of fishing object in hole. The impression blocks with copy rods and fixed magnetic needle allow estimating the object configuration and fix the position of magnetic needle determining the position of the top end of object in hole. However, the magnetic needle fixation is realized in staged and the rods are in extended position during fishing operations as well as it is in standard design. The most efficient tool is the impression block with copy rods which directs the examined object in the borehole during readings of magnetic needles data from azimuth plate and averaging of readings. This significantly increases the accuracy of fishing toll direction. The rods during fishing are located in the body and extended only when they reach the top of fishing object.

  6. Device Oriented Project Controller

    SciTech Connect

    Dalesio, Leo; Kraimer, Martin

    2013-11-20

    This proposal is directed at the issue of developing control systems for very large HEP projects. A de-facto standard in accelerator control is the Experimental Physics and Industrial Control System (EPICS), which has been applied successfully to many physics projects. EPICS is a channel based system that requires that each channel of each device be configured and controlled. In Phase I, the feasibility of a device oriented extension to the distributed channel database was demonstrated by prototyping a device aware version of an EPICS I/O controller that functions with the current version of the channel access communication protocol. Extensions have been made to the grammar to define the database. Only a multi-stage position controller with limit switches was developed in the demonstration, but the grammar should support a full range of functional record types. In phase II, a full set of record types will be developed to support all existing record types, a set of process control functions for closed loop control, and support for experimental beam line control. A tool to configure these records will be developed. A communication protocol will be developed or extensions will be made to Channel Access to support introspection of components of a device. Performance bench marks will be made on both communication protocol and the database. After these records and performance tests are under way, a second of the grammar will be undertaken.

  7. Industrial Technology Orientation Curriculum Guide.

    ERIC Educational Resources Information Center

    Illinois State Board of Education, Springfield. Dept. of Adult, Vocational and Technical Education.

    The four courses in this guide were designed to meet the specifications for the career orientation level of Illinois' Education for Employment Curriculum Model. These orientation-level courses can be taken by high school students in any sequence: (1) communication technology; (2) energy utilization technology; (3) production technology; and (4)…

  8. Postdictive Modulation of Visual Orientation

    PubMed Central

    Kawabe, Takahiro

    2012-01-01

    The present study investigated how visual orientation is modulated by subsequent orientation inputs. Observers were presented a near-vertical Gabor patch as a target, followed by a left- or right-tilted second Gabor patch as a distracter in the spatial vicinity of the target. The task of the observers was to judge whether the target was right- or left-tilted (Experiment 1) or whether the target was vertical or not (Supplementary experiment). The judgment was biased toward the orientation of the distracter (the postdictive modulation of visual orientation). The judgment bias peaked when the target and distracter were temporally separated by 100 ms, indicating a specific temporal mechanism for this phenomenon. However, when the visibility of the distracter was reduced via backward masking, the judgment bias disappeared. On the other hand, the low-visibility distracter could still cause a simultaneous orientation contrast, indicating that the distracter orientation is still processed in the visual system (Experiment 2). Our results suggest that the postdictive modulation of visual orientation stems from spatiotemporal integration of visual orientation on the basis of a slow feature matching process. PMID:22393421

  9. Concentration of Swiss Elite Orienteers.

    ERIC Educational Resources Information Center

    Seiler, Roland; Wetzel, Jorg

    1997-01-01

    A visual discrimination task was used to measure concentration among 43 members of Swiss national orienteering teams. Subjects were above average in the number of target objects dealt with and in duration of continuous concentration. For females only, ranking in orienteering performance was related to quality of concentration (ratio of correct to…

  10. AFS Orientation Handbook. Volume IV.

    ERIC Educational Resources Information Center

    Zaremba, Mary Ann; And Others

    This handbook is intended for use by all who design, plan, and lead orientation and cross-cultural training sessions for American Field Service students, natural and host families, and volunteers. It features orientation and training resources originating in Venezuela, France, Italy, Denmark, Canada, Argentina, Japan, Portugal, Germany, and the…

  11. A Systematic Assessment of Accuracy in Detecting Somatic Mosaic Variants by Deep Amplicon Sequencing: Application to NF2 Gene

    PubMed Central

    Sestini, Roberta; Candita, Luisa; Capone, Gabriele Lorenzo; Barbetti, Lorenzo; Falconi, Serena; Frusconi, Sabrina; Giotti, Irene; Giuliani, Costanza; Torricelli, Francesca; Benelli, Matteo; Papi, Laura

    2015-01-01

    The accurate detection of low-allelic variants is still challenging, particularly for the identification of somatic mosaicism, where matched control sample is not available. High throughput sequencing, by the simultaneous and independent analysis of thousands of different DNA fragments, might overcome many of the limits of traditional methods, greatly increasing the sensitivity. However, it is necessary to take into account the high number of false positives that may arise due to the lack of matched control samples. Here, we applied deep amplicon sequencing to the analysis of samples with known genotype and variant allele fraction (VAF) followed by a tailored statistical analysis. This method allowed to define a minimum value of VAF for detecting mosaic variants with high accuracy. Then, we exploited the estimated VAF to select candidate alterations in NF2 gene in 34 samples with unknown genotype (30 blood and 4 tumor DNAs), demonstrating the suitability of our method. The strategy we propose optimizes the use of deep amplicon sequencing for the identification of low abundance variants. Moreover, our method can be applied to different high throughput sequencing approaches to estimate the background noise and define the accuracy of the experimental design. PMID:26066488

  12. Candidate genes and functional noncoding variants identified in a canine model of obsessive-compulsive disorder

    PubMed Central

    2014-01-01

    Background Obsessive-compulsive disorder (OCD), a severe mental disease manifested in time-consuming repetition of behaviors, affects 1 to 3% of the human population. While highly heritable, complex genetics has hampered attempts to elucidate OCD etiology. Dogs suffer from naturally occurring compulsive disorders that closely model human OCD, manifested as an excessive repetition of normal canine behaviors that only partially responds to drug therapy. The limited diversity within dog breeds makes identifying underlying genetic factors easier. Results We use genome-wide association of 87 Doberman Pinscher cases and 63 controls to identify genomic loci associated with OCD and sequence these regions in 8 affected dogs from high-risk breeds and 8 breed-matched controls. We find 119 variants in evolutionarily conserved sites that are specific to dogs with OCD. These case-only variants are significantly more common in high OCD risk breeds compared to breeds with no known psychiatric problems. Four genes, all with synaptic function, have the most case-only variation: neuronal cadherin (CDH2), catenin alpha2 (CTNNA2), ataxin-1 (ATXN1), and plasma glutamate carboxypeptidase (PGCP). In the 2 Mb gene desert between the cadherin genes CDH2 and DSC3, we find two different variants found only in dogs with OCD that disrupt the same highly conserved regulatory element. These variants cause significant changes in gene expression in a human neuroblastoma cell line, likely due to disrupted transcription factor binding. Conclusions The limited genetic diversity of dog breeds facilitates identification of genes, functional variants and regulatory pathways underlying complex psychiatric disorders that are mechanistically similar in dogs and humans. PMID:24995881

  13. New genetic variants of LATS1 detected in urinary bladder and colon cancer

    PubMed Central

    Saadeldin, Mona K.; Shawer, Heba; Mostafa, Ahmed; Kassem, Neemat M.; Amleh, Asma; Siam, Rania

    2015-01-01

    LATS1, the large tumor suppressor 1 gene, encodes for a serine/threonine kinase protein and is implicated in cell cycle progression. LATS1 is down-regulated in various human cancers, such as breast cancer, and astrocytoma. Point mutations in LATS1 were reported in human sarcomas. Additionally, loss of heterozygosity of LATS1 chromosomal region predisposes to breast, ovarian, and cervical tumors. In the current study, we investigated LATS1 genetic variations including single nucleotide polymorphisms (SNPs), in 28 Egyptian patients with either urinary bladder or colon cancers. The LATS1 gene was amplified and sequenced and the expression of LATS1 at the RNA level was assessed in 12 urinary bladder cancer samples. We report, the identification of a total of 29 variants including previously identified SNPs within LATS1 coding and non-coding sequences. A total of 18 variants were novel. Majority of the novel variants, 13, were mapped to intronic sequences and un-translated regions of the gene. Four of the five novel variants located in the coding region of the gene, represented missense mutations within the serine/threonine kinase catalytic domain. Interestingly, LATS1 RNA steady state levels was lost in urinary bladder cancerous tissue harboring four specific SNPs (16045 + 41736 + 34614 + 56177) positioned in the 5′UTR, intron 6, and two silent mutations within exon 4 and exon 8, respectively. This study identifies novel single-base-sequence alterations in the LATS1 gene. These newly identified variants could potentially be used as novel diagnostic or prognostic tools in cancer. PMID:25628642

  14. A Non-Synonymous HMGA2 Variant Decreases Height in Shetland Ponies and Other Small Horses

    PubMed Central

    Frischknecht, Mirjam; Jagannathan, Vidhya; Plattet, Philippe; Neuditschko, Markus; Signer-Hasler, Heidi; Bachmann, Iris; Pacholewska, Alicja; Drögemüller, Cord; Dietschi, Elisabeth

    2015-01-01

    The identification of quantitative trait loci (QTL) such as height and their underlying causative variants is still challenging and often requires large sample sizes. In humans hundreds of loci with small effects control the heritable portion of height variability. In domestic animals, typically only a few loci with comparatively large effects explain a major fraction of the heritability. We investigated height at withers in Shetland ponies and mapped a QTL to ECA 6 by genome-wide association (GWAS) using a small cohort of only 48 animals and the Illumina equine SNP70 BeadChip. Fine-mapping revealed a shared haplotype block of 793 kb in small Shetland ponies. The HMGA2 gene, known to be associated with height in horses and many other species, was located in the associated haplotype. After closing a gap in the equine reference genome we identified a non-synonymous variant in the first exon of HMGA2 in small Shetland ponies. The variant was predicted to affect the functionally important first AT-hook DNA binding domain of the HMGA2 protein (c.83G>A; p.G28E). We assessed the functional impact and found impaired DNA binding of a peptide with the mutant sequence in an electrophoretic mobility shift assay. This suggests that the HMGA2 variant also affects DNA binding in vivo and thus leads to reduced growth and a smaller stature in Shetland ponies. The identified HMGA2 variant also segregates in several other pony breeds but was not found in regular-sized horse breeds. We therefore conclude that we identified a quantitative trait nucleotide for height in horses. PMID:26474182

  15. Alternative splicing modulated by genetic variants demonstrates accelerated evolution regulated by highly conserved proteins

    PubMed Central

    Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Lin, Xianzhi; Chan, Tak-Ming; Wang, Rena; Xiao, Xinshu

    2016-01-01

    Identification of functional genetic variants and elucidation of their regulatory mechanisms represent significant challenges of the post-genomic era. A poorly understood topic is the involvement of genetic variants in mediating post-transcriptional RNA processing, including alternative splicing. Thus far, little is known about the genomic, evolutionary, and regulatory features of genetically modulated alternative splicing (GMAS). Here, we systematically identified intronic tag variants for genetic modulation of alternative splicing using RNA-seq data specific to cellular compartments. Combined with our previous method that identifies exonic tags for GMAS, this study yielded 622 GMAS exons. We observed that GMAS events are highly cell type independent, indicating that splicing-altering genetic variants could have widespread function across cell types. Interestingly, GMAS genes, exons, and single-nucleotide variants (SNVs) all demonstrated positive selection or accelerated evolution in primates. We predicted that GMAS SNVs often alter binding of splicing factors, with SRSF1 affecting the most GMAS events and demonstrating global allelic binding bias. However, in contrast to their GMAS targets, the predicted splicing factors are more conserved than expected, suggesting that cis-regulatory variation is the major driving force of splicing evolution. Moreover, GMAS-related splicing factors had stronger consensus motifs than expected, consistent with their susceptibility to SNV disruption. Intriguingly, GMAS SNVs in general do not alter the strongest consensus position of the splicing factor motif, except the more than 100 GMAS SNVs in linkage disequilibrium with polymorphisms reported by genome-wide association studies. Our study reports many GMAS events and enables a better understanding of the evolutionary and regulatory features of this phenomenon. PMID:26888265

  16. Strategies to choose from millions of imputed sequence variants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Millions of sequence variants are known, but subsets are needed for routine genomic predictions or to include on genotyping arrays. Variant selection and imputation strategies were tested using 26 984 simulated reference bulls, of which 1 000 had 30 million sequence variants, 773 had 600 000 markers...

  17. Palm-Vein Classification Based on Principal Orientation Features

    PubMed Central

    Zhou, Yujia; Liu, Yaqin; Feng, Qianjin; Yang, Feng; Huang, Jing; Nie, Yixiao

    2014-01-01

    Personal recognition using palm–vein patterns has emerged as a promising alternative for human recognition because of its uniqueness, stability, live body identification, flexibility, and difficulty to cheat. With the expanding application of palm–vein pattern recognition, the corresponding growth of the database has resulted in a long response time. To shorten the response time of identification, this paper proposes a simple and useful classification for palm–vein identification based on principal direction features. In the registration process, the Gaussian-Radon transform is adopted to extract the orientation matrix and then compute the principal direction of a palm–vein image based on the orientation matrix. The database can be classified into six bins based on the value of the principal direction. In the identification process, the principal direction of the test sample is first extracted to ascertain the corresponding bin. One-by-one matching with the training samples is then performed in the bin. To improve recognition efficiency while maintaining better recognition accuracy, two neighborhood bins of the corresponding bin are continuously searched to identify the input palm–vein image. Evaluation experiments are conducted on three different databases, namely, PolyU, CASIA, and the database of this study. Experimental results show that the searching range of one test sample in PolyU, CASIA and our database by the proposed method for palm–vein identification can be reduced to 14.29%, 14.50%, and 14.28%, with retrieval accuracy of 96.67%, 96.00%, and 97.71%, respectively. With 10,000 training samples in the database, the execution time of the identification process by the traditional method is 18.56 s, while that by the proposed approach is 3.16 s. The experimental results confirm that the proposed approach is more efficient than the traditional method, especially for a large database. PMID:25383715

  18. Olfactory Performance Is Predicted by Individual Sex-Atypicality, but Not Sexual Orientation

    PubMed Central

    Nováková, Lenka; Varella Valentová, Jaroslava; Havlíček, Jan

    2013-01-01

    Many previous studies have reported robust sex differences in olfactory perception. However, both men and women can be expected to vary in the degree to which they exhibit olfactory performance considered typical of their own or the opposite sex. Sex-atypicality is often described in terms of childhood gender nonconformity, which, however, is not a perfect correlate of non-heterosexual orientation. Here we explored intrasexual variability in psychophysical olfactory performance in a sample of 156 individuals (83 non-heterosexual) and found the lowest odor identification scores in heterosexual men. However, when childhood gender nonconformity was entered in the model along with sexual orientation, better odor identification scores were exhibited by gender-nonconforming men, and greater olfactory sensitivity by gender-conforming women, irrespective of their sexual orientation. Thus, sex-atypicality, but not sexual orientation predicts olfactory performance, and we propose that this might not be limited to olfaction, but represent a more general phenomenon. PMID:24244657

  19. Orientation relationships of Laves phase and NiAl particles in an AFA stainless steel

    NASA Astrophysics Data System (ADS)

    Trotter, Geneva; Baker, Ian

    2015-12-01

    The alumina-forming austenitic (AFA) stainless steel, Fe-20Cr-30Ni-2Nb-5Al (in at. %) was solutionized at 1250 °C in order to obtain a fully austenitic microstructure and then aged for up to 1325 h at 800 °C to precipitate the Laves phase and B2-NiAl particles typically found in AFAs. This paper describes detailed analyses of the orientation relationships between these particles and the matrix which were determined by transmission electron microscopy. Four variants of the (1 1 1)m//(0 0 0 1)p, ?m//? orientation relationship proposed by Denham and Silcock (J. Iron Steel Inst. 207 (1969) p.582) were observed for the Laves phase, and six variants of the (1 1 1)m//(0 1 1)p, ?m//? Kurdjumov-Sachs relationship were observed for the B2-NiAl phase.

  20. An Object-Oriented Collection of Minimum Degree Algorithms: Design, Implementation, and Experiences

    NASA Technical Reports Server (NTRS)

    Kumfert, Gary; Pothen, Alex

    1999-01-01

    The multiple minimum degree (MMD) algorithm and its variants have enjoyed 20+ years of research and progress in generating fill-reducing orderings for sparse, symmetric positive definite matrices. Although conceptually simple, efficient implementations of these algorithms are deceptively complex and highly specialized. In this case study, we present an object-oriented library that implements several recent minimum degree-like algorithms. We discuss how object-oriented design forces us to decompose these algorithms in a different manner than earlier codes and demonstrate how this impacts the flexibility and efficiency of our C++ implementation. We compare the performance of our code against other implementations in C or Fortran.

  1. Discussing and managing hematologic germ line variants.

    PubMed

    Kohlmann, Wendy; Schiffman, Joshua D

    2016-12-02

    With the introduction of genomic technologies, more hereditary cancer syndromes with hematologic malignancies are being described. Up to 10% of hematologic malignancies in children and adults may be the result of an underlying inherited genetic risk. Managing these patients with hereditary hematologic malignancies, including familial leukemia, remains a clinical challenge because there is little information about these relatively rare disorders. This article covers some of the issues related to the diagnosis and interpretation of variants associated with hereditary hematologic malignancies, including the importance of an accurate family history in interpreting genetic variants associated with disease. The challenges of screening other family members and offering the most appropriate early malignancy detection is also discussed. We now have a good opportunity to better define hereditary cancer syndromes with associated hematologic malignancies and contribute to clinically effective guidelines.

  2. Discussing and managing hematologic germ line variants.

    PubMed

    Kohlmann, Wendy; Schiffman, Joshua D

    2016-11-24

    With the introduction of genomic technologies, more hereditary cancer syndromes with hematologic malignancies are being described. Up to 10% of hematologic malignancies in children and adults may be the result of an underlying inherited genetic risk. Managing these patients with hereditary hematologic malignancies, including familial leukemia, remains a clinical challenge because there is little information about these relatively rare disorders. This article covers some of the issues related to the diagnosis and interpretation of variants associated with hereditary hematologic malignancies, including the importance of an accurate family history in interpreting genetic variants associated with disease. The challenges of screening other family members and offering the most appropriate early malignancy detection is also discussed. We now have a good opportunity to better define hereditary cancer syndromes with associated hematologic malignancies and contribute to clinically effective guidelines.

  3. The Saccharomyces Genome Database Variant Viewer

    PubMed Central

    Sheppard, Travis K.; Hitz, Benjamin C.; Engel, Stacia R.; Song, Giltae; Balakrishnan, Rama; Binkley, Gail; Costanzo, Maria C.; Dalusag, Kyla S.; Demeter, Janos; Hellerstedt, Sage T.; Karra, Kalpana; Nash, Robert S.; Paskov, Kelley M.; Skrzypek, Marek S.; Weng, Shuai; Wong, Edith D.; Cherry, J. Michael

    2016-01-01

    The Saccharomyces Genome Database (SGD; http://www.yeastgenome.org) is the authoritative community resource for the Saccharomyces cerevisiae reference genome sequence and its annotation. In recent years, we have moved toward increased representation of sequence variation and allelic differences within S. cerevisiae. The publication of numerous additional genomes has motivated the creation of new tools for their annotation and analysis. Here we present the Variant Viewer: a dynamic open-source web application for the visualization of genomic and proteomic differences. Multiple sequence alignments have been constructed across high quality genome sequences from 11 different S. cerevisiae strains and stored in the SGD. The alignments and summaries are encoded in JSON and used to create a two-tiered dynamic view of the budding yeast pan-genome, available at http://www.yeastgenome.org/variant-viewer. PMID:26578556

  4. MRI anatomical variants of mammillary bodies.

    PubMed

    Tagliamonte, Micaela; Sestieri, Carlo; Romani, Gian Luca; Gallucci, Massimo; Caulo, Massimo

    2015-01-01

    The mammillary bodies (MBs) are classically defined as a pair of small round structures located on the undersurface of the diencephalon. The systematic observation of MR brain images of patients with neurological diseases, but also of healthy subjects enrolled in research protocols, reveals, however, a greater anatomical variability. The aim of the present study was to define the spectrum of such variability using spatial normalized 3D TFE T1-weighted MR images in a group of 151 healthy right-handed young subjects (78 females, age range 16-39 years). The MBs were identified on reformatted coronal and axial images and classified according to morphological, positional and numerical criteria. On the basis of coronal images, MBs were first divided into symmetrical (86.1 %) and asymmetrical (13.9 %), depending on their respective height. Symmetrical MBs were further subdivided into three variants [type A (2.7 %), B (76.2 %), C (7.3 %)] according to the depth of the intermammillary sulcus. Two morphological variants were defined on axial images, depending on whether the MBs were circular (63.6 %) or elliptic (36.4 %). This latter group was further divided in two subgroups, depending on whether the MBs were parallel (21.9 %) or convergent (14.6 %). Finally, two subjects (1.3 %) presented a supernumeral MB. The transverse size of the third ventricle was greater in the type A compared to the type B and C groups. Gender did not significantly affect the frequency of MBs variants, except for the three symmetrical subgroups in which the variants A and C were more frequent in males than in females. These findings suggest the presence of an anatomical variability of the MBs, in contrast to their classical definition. Therefore, atypical presentation of MBs can be the expression of this variability rather than a marker of neurological disorders (i.e. cerebral malformation, mesial temporal sclerosis, Wernicke-Korsakoff syndrome).

  5. Sex steroids and variants of gender identity.

    PubMed

    Meyer-Bahlburg, Heino F L

    2013-09-01

    This article summarizes for the practicing endocrinologist the current literature on the psychobiology of the development of gender identity and its variants in individuals with disorders of sex development (DSD) or with non-DSD transgenderism. Gender reassignment remains the treatment of choice for strong and persistent gender dysphoria in both categories, but more research is needed on the short-term and long-term effects of puberty-suppressing medications and cross-sex hormones on brain and behavior.

  6. Variant congenital dyserythropoietic anaemia with ringed sideroblasts.

    PubMed

    Brien, W F; Mant, M J; Etches, W S

    1985-01-01

    A family is described with mild anaemia characterized by marked dyserythropoiesis and by prominent ringed sideroblasts. Inheritance is autosomal recessive. Other features include marked microcytosis, poikilocytosis, mild haemolysis, slightly increased haemoglobin A2, bone marrow erythroid hyperplasia and non-specific structural abnormalities of erythroid precursors on electron microscopy. This appears to be a previously unreported type of hereditary anaemia with both dyserythropoiesis and ringed sideroblasts. We propose the designation 'variant congenital dyserythropoietic anaemia with ringed sideroblasts'.

  7. Keratoameloblastoma, a very rare variant of ameloblastoma.

    PubMed

    Ketabi, Mohammad Ali; Dehghani, Nima; Sadeghi, Hasan Mirmohammad; Shams, Mohammad Ghasem; Mohajerani, Hasan; Azarsina, Mohadese; Azizi, Arshia

    2013-11-01

    The keratoameloblastoma is a rare histologic variant of ameloblastoma. Fewer than 15 cases of keratoameloblastoma have been documented in the literature. We report a new case of keratoameloblastoma in a 21-year-old female patient with a unilocular radiolucent lesion between the roots of the right mandibular incisors. We describe the clinical, radiographic, and histopathologic features of this lesion along with a review on the characteristics of previous cases. We also discuss about classification and management of this lesion.

  8. Molecular Characterization of Attenuated Junin Virus Variants.

    DTIC Science & Technology

    1992-07-14

    No. DAMD17-89-Z-9024 Area de Quimica Biologica y Biologia Molecular Facultad de Ciencias Exactas Universidad Nacional de La Plata Calles 47 y 115, 1900...MONITORING ORGANIZATION Area de Quimica Biologica (If applicable) y Biologia Molecular I 6c. ADDRESS (City, State, and ZIPCode) 7b. ADDRESS (City, State...AD-A260 128 AD____ MOLECULAR CHARACTERIZATION OF ATTENUATED JUNIN VIRUS VARIANTS FINAL REPORT VICTOR ROMANOWSKI PABLO D. GHIRINGHELLI CESAR G

  9. dbVar structural variant cluster set for data analysis and variant comparison

    PubMed Central

    Phan, Lon; Hsu, Jeffrey; Tri, Le Quang Minh; Willi, Michaela; Mansour, Tamer; Kai, Yan; Garner, John; Lopez, John; Busby, Ben

    2017-01-01

    dbVar houses over 3 million submitted structural variants (SSV) from 120 human studies including copy number variations (CNV), insertions, deletions, inversions, translocations, and complex chromosomal rearrangements. Users can submit multiple SSVs to dbVAR  that are presumably identical, but were ascertained by different platforms and samples,  to calculate whether the variant is rare or common in the population and allow for cross validation. However, because SSV genomic location reporting can vary – including fuzzy locations where the start and/or end points are not precisely known – analysis, comparison, annotation, and reporting of SSVs across studies can be difficult. This project was initiated by the Structural Variant Comparison Group for the purpose of generating a non-redundant set of genomic regions defined by counts of concordance for all human SSVs placed on RefSeq assembly GRCh38 (RefSeq accession GCF_000001405.26). We intend that the availability of these regions, called structural variant clusters (SVCs), will facilitate the analysis, annotation, and exchange of SV data and allow for simplified display in genomic sequence viewers for improved variant interpretation. Sets of SVCs were generated by variant type for each of the 120 studies as well as for a combined set across all studies. Starting from 3.64 million SSVs, 2.5 million and 3.4 million non-redundant SVCs with count >=1 were generated by variant type for each study and across all studies, respectively. In addition, we have developed utilities for annotating, searching, and filtering SVC data in GVF format for computing summary statistics, exporting data for genomic viewers, and annotating the SVC using external data sources. PMID:28357035

  10. Fine-Mapping of Common Genetic Variants Associated with Colorectal Tumor Risk Identified Potential Functional Variants

    PubMed Central

    Gala, Manish; Abecasis, Goncalo; Bezieau, Stephane; Brenner, Hermann; Butterbach, Katja; Caan, Bette J.; Carlson, Christopher S.; Casey, Graham; Chang-Claude, Jenny; Conti, David V.; Curtis, Keith R.; Duggan, David; Gallinger, Steven; Haile, Robert W.; Harrison, Tabitha A.; Hayes, Richard B.; Hoffmeister, Michael; Hopper, John L.; Hudson, Thomas J.; Jenkins, Mark A.; Küry, Sébastien; Le Marchand, Loic; Leal, Suzanne M.; Newcomb, Polly A.; Nickerson, Deborah A.; Potter, John D.; Schoen, Robert E.; Schumacher, Fredrick R.; Seminara, Daniela; Slattery, Martha L.; Hsu, Li; Chan, Andrew T.; White, Emily; Berndt, Sonja I.; Peters, Ulrike

    2016-01-01

    Genome-wide association studies (GWAS) have identified many common single nucleotide polymorphisms (SNPs) associated with colorectal cancer risk. These SNPs may tag correlated variants with biological importance. Fine-mapping around GWAS loci can facilitate detection of functional candidates and additional independent risk variants. We analyzed 11,900 cases and 14,311 controls in the Genetics and Epidemiology of Colorectal Cancer Consortium and the Colon Cancer Family Registry. To fine-map genomic regions containing all known common risk variants, we imputed high-density genetic data from the 1000 Genomes Project. We tested single-variant associations with colorectal tumor risk for all variants spanning genomic regions 250-kb upstream or downstream of 31 GWAS-identified SNPs (index SNPs). We queried the University of California, Santa Cruz Genome Browser to examine evidence for biological function. Index SNPs did not show the strongest association signals with colorectal tumor risk in their respective genomic regions. Bioinformatics analysis of SNPs showing smaller P-values in each region revealed 21 functional candidates in 12 loci (5q31.1, 8q24, 11q13.4, 11q23, 12p13.32, 12q24.21, 14q22.2, 15q13, 18q21, 19q13.1, 20p12.3, and 20q13.33). We did not observe evidence of additional independent association signals in GWAS-identified regions. Our results support the utility of integrating data from comprehensive fine-mapping with expanding publicly available genomic databases to help clarify GWAS associations and identify functional candidates that warrant more onerous laboratory follow-up. Such efforts may aid the eventual discovery of disease-causing variant(s). PMID:27379672

  11. The non-fluent/agrammatic variant of primary progressive aphasia.

    PubMed

    Grossman, Murray

    2012-06-01

    The non-fluent/agrammatic variant of primary progressive aphasia (naPPA) is a young-onset neurodegenerative disorder characterised by poor grammatical comprehension and expression and a disorder of speech sound production. In an era of disease-modifying treatments, the identification of naPPA might be an important step in establishing a specific cause of neurodegenerative disease. However, difficulties in defining the characteristic language deficits and heterogeneity in the anatomical distribution of disease in naPPA have led to controversy. Findings from imaging studies have linked an impairment of this uniquely human language capacity with disruption of large-scale neural networks centred in left inferior frontal and anterior superior temporal regions. Accordingly, the pathological burden of disease in naPPA is anatomically focused in these regions. Most cases of naPPA are associated with the spectrum of pathological changes found in frontotemporal lobar degeneration involving the microtubule-associated protein tau. Knowledge of these unique clinical-pathological associations should advance care for patients with this important class of neurodegenerative diseases while supplementing our knowledge of human cognitive neuroscience.

  12. Natural history and early diagnosis of LAD-1/variant syndrome.

    PubMed

    Kuijpers, Taco W; van Bruggen, Robin; Kamerbeek, Nanne; Tool, Anton T J; Hicsonmez, Gonul; Gurgey, Aytemiz; Karow, Axel; Verhoeven, Arthur J; Seeger, Karl; Sanal, Ozden; Niemeyer, Charlotte; Roos, Dirk

    2007-04-15

    The syndrome of leukocyte adhesion deficiency (LAD) combined with a severe Glanzmann-type bleeding disorder has been recognized as a separate disease entity. The variability in clinical and cell biological terms has remained largely unclear. We present data on 9 cases from 7 unrelated families, with 3 patients being actively followed for more than 12 years. The disease entity, designated LAD-1/variant syndrome, presents early in life and consists of nonpussing infections from bacterial and fungal origin, as well as a severe bleeding tendency. This is compatible with 2 major blood cell types contributing to the clinical symptoms (ie, granulocytes and platelets). In granulocytes of the patients, we found adhesion and chemotaxis defects, as well as a defect in NADPH oxidase activity triggered by unopsonized zymosan. This last test can be used as a screening test for the syndrome. Many proteins and genes involved in adhesion and signaling, including small GTPases such as Rap1 and Rap2 as well as the major Rap activity-regulating molecules, were normally present. Moreover, Rap1 activation was intact in patients' blood cells. Defining the primary defect awaits genetic linkage analysis, which may be greatly helped by a more precise understanding and awareness of the disease combined with the early identification of affected patients.

  13. Molecular prioritization strategies to identify functional genetic variants in the cardiovascular disease-associated expression QTL Vanin-1

    PubMed Central

    Kaskow, Belinda J; Diepeveen, Luke A; Michael Proffitt, J; Rea, Alexander J; Ulgiati, Daniela; Blangero, John; Moses, Eric K; Abraham, Lawrence J

    2014-01-01

    There is now good evidence that non-coding sequence variants are involved in the heritability of many common complex traits. The current ‘gold standard' approach for assessing functionality is the in vitro reporter gene assay to assess allelic differences in transcriptional activity, usually followed by electrophoretic mobility shift assays to assess allelic differences in transcription factor binding. Although widely used, these assays have inherent limitations, including the lack of endogenous chromatin context. Here we present a more contemporary approach to assessing functionality of non-coding sequence variation within the Vanin-1 (VNN1) promoter. By combining ‘gold standard' assays with in vivo assessments of chromatin accessibility, we greatly increase our confidence in the statistically assigned functional relevance. The standard assays revealed the −137 single nucleotide variant to be functional but the −587 variant to have no functional relevance. However, our in vivo tests show an allelic difference in chromatin accessibility surrounding the −587 variant supporting strong functional potential at both sites. Our approach advances the identification of functional variants by providing strong in vivo biological evidence for function. PMID:24045843

  14. HbQ-India associated with microcytosis: An uncommon hemoglobin variant associated with a common hematologic condition.

    PubMed

    Kumar Yadav, Amit; Rusia, Usha

    2010-09-05

    HbQ-India is a rare alpha chain variant that usually presents in the heterozygous state. Normally, HbQ-India is clinically silent. It becomes symptomatic when present in association with other conditions. We report a case of HbQ-India with concomitant presence of iron deficiency anemia. A 16-year-old female presented with weakness and pallor intermittently for six years. Complete blood count showed severe microcytic hypochromic anemia. Hemoglobin electrophoresis showed a prominent band in the S,D,G region. Tests for sickling were negative. High performance liquid chromatography (HPLC) showed a peak in the unknown window (4.70-4.90 min) suggestive of HbQ-India. Serum iron profile was suggestive of iron deficiency anemia. Based on the above findings, a diagnosis of coexistent HbQ-India-iron deficiency anemia was made. A family study revealed the father as having moderate anemia with similar findings while the mother was normal. Abnormal hemoglobin in the patient was confirmed by molecular diagnosis. HbQ variants are the alpha globin chain variants due to structural mutations (α64 Asp→His) inherited in autosomal dominant fashion. Three molecular variant types have been documented, namely HbQ-India, HbQ-Thailand and HbQ-Iran. Normally, HbQ is clinically silent. Therefore, careful screening of the samples using routine techniques like Hb electrophoresis and HPLC are needed for identification of such abnormal hemoglobin variants like HbQ-India.

  15. A universal computational model for predicting antigenic variants of influenza A virus based on conserved antigenic structures

    PubMed Central

    Peng, Yousong; Wang, Dayan; Wang, Jianhong; Li, Kenli; Tan, Zhongyang; Shu, Yuelong; Jiang, Taijiao

    2017-01-01

    Rapid determination of the antigenicity of influenza A virus could help identify the antigenic variants in time. Currently, there is a lack of computational models for predicting antigenic variants of some common hemagglutinin (HA) subtypes of influenza A viruses. By means of sequence analysis, we demonstrate here that multiple HA subtypes of influenza A virus undergo similar mutation patterns of HA1 protein (the immunogenic part of HA). Further analysis on the antigenic variation of influenza A virus H1N1, H3N2 and H5N1 showed that the amino acid residues’ contribution to antigenic variation highly differed in these subtypes, while the regional bands, defined based on their distance to the top of HA1, played conserved roles in antigenic variation of these subtypes. Moreover, the computational models for predicting antigenic variants based on regional bands performed much better in the testing HA subtype than those did based on amino acid residues. Therefore, a universal computational model, named PREDAV-FluA, was built based on the regional bands to predict the antigenic variants for all HA subtypes of influenza A viruses. The model achieved an accuracy of 0.77 when tested with avian influenza H9N2 viruses. It may help for rapid identification of antigenic variants in influenza surveillance. PMID:28165025

  16. Trainable high resolution melt curve machine learning classifier for large-scale reliable genotyping of sequence variants.

    PubMed

    Athamanolap, Pornpat; Parekh, Vishwa; Fraley, Stephanie I; Agarwal, Vatsal; Shin, Dong J; Jacobs, Michael A; Wang, Tza-Huei; Yang, Samuel

    2014-01-01

    High resolution melt (HRM) is gaining considerable popularity as a simple and robust method for genotyping sequence variants. However, accurate genotyping of an unknown sample for which a large number of possible variants may exist will require an automated HRM curve identification method capable of comparing unknowns against a large cohort of known sequence variants. Herein, we describe a new method for automated HRM curve classification based on machine learning methods and learned tolerance for reaction condition deviations. We tested this method in silico through multiple cross-validations using curves generated from 9 different simulated experimental conditions to classify 92 known serotypes of Streptococcus pneumoniae and demonstrated over 99% accuracy with 8 training curves per serotype. In vitro verification of the algorithm was tested using sequence variants of a cancer-related gene and demonstrated 100% accuracy with 3 training curves per sequence variant. The machine learning algorithm enabled reliable, scalable, and automated HRM genotyping analysis with broad potential clinical and epidemiological applications.

  17. Warty Carcinoma Penis: An Uncommon Variant

    PubMed Central

    Ghosh, Arnab; Shrestha, Santosh; Ghartimagar, Dilasma; Narasimhan, Raghavan; Talwar, OP

    2017-01-01

    Penile carcinoma frequency varies widely in different parts of the world and comprises 1–10% of all the malignancies in males. Majority of the cases of penile carcinoma are squamous cell carcinoma of penis comprising 60% to 70% of all cases. Warty carcinoma of penis is an unusual neoplasm and a variant of penile squamous cell carcinoma comprising 5%–10% of all the variants. The other histological variants include basaloid, verrucous, papillary, sarcomatous, mixed, and adenosquamous carcinoma. The various histological entities with an exophytic papillary lesions including warty carcinoma are together referred to as the “verruciform” group of neoplasms. The warty carcinoma has to be differentiated from these lesions and is typically distinguished by histological features of hyperkeratosis, arborescent papillomatosis, acanthosis, and prominent koilocytosis with nuclear pleomorphism. We present a case of 65-year-old male with growth measuring 6 × 4 cm in the penis who underwent total penectomy and was diagnosed as warty carcinoma penis. PMID:28154768

  18. Spatially variant periodic structures in electromagnetics

    PubMed Central

    Rumpf, Raymond C.; Pazos, Javier J.; Digaum, Jennefir L.; Kuebler, Stephen M.

    2015-01-01

    Spatial transforms are a popular technique for designing periodic structures that are macroscopically inhomogeneous. The structures are often required to be anisotropic, provide a magnetic response, and to have extreme values for the constitutive parameters in Maxwell's equations. Metamaterials and photonic crystals are capable of providing these, although sometimes only approximately. The problem still remains about how to generate the geometry of the final lattice when it is functionally graded, or spatially varied. This paper describes a simple numerical technique to spatially vary any periodic structure while minimizing deformations to the unit cells that would weaken or destroy the electromagnetic properties. New developments in this algorithm are disclosed that increase efficiency, improve the quality of the lattices and provide the ability to design aplanatic metasurfaces. The ability to spatially vary a lattice in this manner enables new design paradigms that are not possible using spatial transforms, three of which are discussed here. First, spatially variant self-collimating photonic crystals are shown to flow unguided waves around very tight bends using ordinary materials with low refractive index. Second, multi-mode waveguides in spatially variant band gap materials are shown to guide waves around bends without mixing power between the modes. Third, spatially variant anisotropic materials are shown to sculpt the near-field around electric components. This can be used to improve electromagnetic compatibility between components in close proximity. PMID:26217058

  19. UCSC Data Integrator and Variant Annotation Integrator

    PubMed Central

    Hinrichs, Angie S.; Raney, Brian J.; Speir, Matthew L.; Rhead, Brooke; Casper, Jonathan; Karolchik, Donna; Kuhn, Robert M.; Rosenbloom, Kate R.; Zweig, Ann S.; Haussler, David; Kent, W. James

    2016-01-01

    Summary: Two new tools on the UCSC Genome Browser web site provide improved ways of combining information from multiple datasets, optionally including the user's own custom track data and/or data from track hubs. The Data Integrator combines columns from multiple data tracks, showing all items from the first track along with overlapping items from the other tracks. The Variant Annotation Integrator is tailored to adding functional annotations to variant calls; it offers a more restricted set of underlying data tracks but adds predictions of each variant's consequences for any overlapping or nearby gene transcript. When available, it optionally adds additional annotations including effect prediction scores from dbNSFP for missense mutations, ENCODE regulatory summary tracks and conservation scores. Availability and implementation: The web tools are freely available at http://genome.ucsc.edu/ and the underlying database is available for download at http://hgdownload.cse.ucsc.edu/. The software (written in C and Javascript) is available from https://genome-store.ucsc.edu/ and is freely available for academic and non-profit usage; commercial users must obtain a license. Contact: angie@soe.ucsc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26740527

  20. Primary Aldosteronism and ARMC5 Variants

    PubMed Central

    Zilbermint, Mihail; Xekouki, Paraskevi; Faucz, Fabio R.; Berthon, Annabel; Gkourogianni, Alexandra; Schernthaner-Reiter, Marie Helene; Batsis, Maria; Sinaii, Ninet; Quezado, Martha M.; Merino, Maria; Hodes, Aaron; Abraham, Smita B.; Libé, Rossella; Assié, Guillaume; Espiard, Stéphanie; Drougat, Ludivine; Ragazzon, Bruno; Davis, Adam; Gebreab, Samson Y.; Neff, Ryan; Kebebew, Electron; Bertherat, Jérôme; Lodish, Maya B.

    2015-01-01

    Context: Primary aldosteronism is one of the leading causes of secondary hypertension, causing significant morbidity and mortality. A number of genetic defects have recently been identified in primary aldosteronism, whereas we identified mutations in ARMC5, a tumor-suppressor gene, in cortisol-producing primary macronodular adrenal hyperplasia. Objective: We investigated a cohort of 56 patients who were referred to the National Institutes of Health for evaluation of primary aldosteronism for ARMC5 defects. Methods: Patients underwent step-wise diagnosis, with measurement of serum aldosterone and plasma renin activity followed by imaging, saline suppression and/or oral salt loading tests, plus adrenal venous sampling. Cortisol secretion was also evaluated; unilateral or bilateral adrenalectomy was performed, if indicated. DNA, protein, and transfection studies in H295R cells were conducted by standard methods. Results: We identified 12 germline ARMC5 genetic alterations in 20 unrelated and two related individuals in our cohort (39.3%). ARMC5 sequence changes in 6 patients (10.7%) were predicted to be damaging by in silico analysis. All affected patients carrying a variant predicted to be damaging were African Americans (P = .0023). Conclusions: Germline ARMC5 variants may be associated with primary aldosteronism. Additional cohorts of patients with primary aldosteronism and metabolic syndrome, particularly African Americans, should be screened for ARMC5 sequence variants because these may underlie part of the known increased predisposition of African Americans to low renin hypertension. PMID:25822102

  1. Orosomucoid-1 Expression in Ameloblastoma Variants

    PubMed Central

    García-Muñoz, Alejandro; Bologna-Molina, Ronell; A. Rodríguez, Mario; Liceága-Reyes, Rodrigo; Farfán-Morales, Jose Eduardo; Aranda-Romo, Saray; Molina-Frechero, Nelly; González-González, Rogelio

    2016-01-01

    Odontogenic tumors constitute a group of heterogeneous lesions of benign and malignant neoplasms with variable aggressiveness. Ameloblastomas are a group of benign but locally invasive neoplasms that occur in the jaws and are derived from epithelial elements of the tooth-forming apparatus. We previously described orosomucoid-1 protein expression in odontogenic myxomas. However, whether orosomucoid-1 is expressed in other odontogenic tumors remains unknown. Since orosomucoid-1 belongs to a group of acute-phase proteins and has many functions in health and disease, we identified and analyzed orosomucoid-1 expression in ameloblastoma variants and ameloblastic carcinoma using western blot and immunohistochemical techniques. Thirty cases of ameloblastoma were analyzed for orsomucoid-1; five specimens were fresh for western blot study (four benign ameloblastomas and one ameloblastic carcinoma), and 25 cases of benign ameloblastoma for immunohistochemical assays. Orosomucoid-1 was widely expressed in each tumor variant analyzed in this study, and differential orosomucoid-1 expression was observed between benign and malignant tumor. Orosomucoid-1 may play an important role in the behavior of ameloblastomas and influence the biology and development of the variants of this tumor. PMID:27386438

  2. Random Plant Viral Variants Attain Temporal Advantages During Systemic Infections and in Turn Resist other Variants of the Same Virus

    PubMed Central

    Zhang, Xiao-Feng; Guo, Jiangbo; Zhang, Xiuchun; Meulia, Tea; Paul, Pierce; Madden, Laurence V.; Li, Dawei; Qu, Feng

    2015-01-01

    Infection of plants with viruses containing multiple variants frequently leads to dominance by a few random variants in the systemically infected leaves (SLs), for which a plausible explanation is lacking. We show here that SL dominance by a given viral variant is adequately explained by its fortuitous lead in systemic spread, coupled with its resistance to superinfection by other variants. We analyzed the fate of a multi-variant turnip crinkle virus (TCV) population in Arabidopsis and N. benthamiana plants. Both wild-type and RNA silencing-defective plants displayed a similar pattern of random dominance by a few variant genotypes, thus discounting a prominent role for RNA silencing. When introduced to plants sequentially as two subpopulations, a twelve-hour head-start was sufficient for the first set to dominate. Finally, SLs of TCV-infected plants became highly resistant to secondary invasions of another TCV variant. We propose that random distribution of variant foci on inoculated leaves allows different variants to lead systemic movement in different plants. The leading variants then colonize large areas of SLs, and resist the superinfection of lagging variants in the same areas. In conclusion, superinfection resistance is the primary driver of random enrichment of viral variants in systemically infected plants. PMID:26481091

  3. Specific genetic variants of Actinobacillus actinomycetemcomitans correlate with disease and health