Sample records for origin part iv

  1. 40 CFR 52.2465 - Original identification of plan section.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., 2FSD, and pre-dryer 3FSD from Part IV, Rule EX-4, Section 4.41(i) until December 15, 1981, submitted on...) Appendix K (7) Appendix N (8) Appendix P (9) Appendix R I., II.B., II.D., II.E., II.F., II.G., II.H., II.I...) Amendments to Part I, Subpart 1.01 (Certain Terms Defined) and to Part IV, Section 4.52 (former Section 4.705...

  2. 75 FR 68153 - To Adjust the Rules of Origin Under the United States-Bahrain Free Trade Agreement, Implement...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-04

    ... Part IV The President Proclamation 8596--To Adjust the Rules of Origin Under the United States... Adjust the Rules of Origin Under the United States-Bahrain Free Trade Agreement, Implement Modifications... the HTS the schedule of duty reductions and rules of origin necessary or appropriate to carry out the...

  3. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  4. 5 CFR 1312.5 - Authority to classify.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... classify information or material under this part shall be limited to those officials concerned with matters..., to assign original classifications as indicated to information or material that is originated by OMB... International Affairs. (iv) Associate Director for Natural Resources, Energy and Science. (2) Secret and below...

  5. 5 CFR 1312.5 - Authority to classify.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... classify information or material under this part shall be limited to those officials concerned with matters..., to assign original classifications as indicated to information or material that is originated by OMB... International Affairs. (iv) Associate Director for Natural Resources, Energy and Science. (2) Secret and below...

  6. 5 CFR 1312.5 - Authority to classify.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... classify information or material under this part shall be limited to those officials concerned with matters..., to assign original classifications as indicated to information or material that is originated by OMB... International Affairs. (iv) Associate Director for Natural Resources, Energy and Science. (2) Secret and below...

  7. A Study of Mandarin Loanwords: Lexical Stratification, Adaptation and Factors

    ERIC Educational Resources Information Center

    Kim, Tae Eun

    2012-01-01

    This dissertation is about Chinese loanwords. It is mainly divided into two parts. Part I is a general discussion about loanwords in Chinese; Chapter I and II belong to the first part. Part II is a discussion about the analyses of Mandarin loanwords originating from English. Chapter III, IV, and V are all related to the second part. Chapter VI is…

  8. Identification of Novel Human Dipeptidyl Peptidase-IV Inhibitors of Natural Origin (Part II): In Silico Prediction in Antidiabetic Extracts

    PubMed Central

    Guasch, Laura; Sala, Esther; Ojeda, María José; Valls, Cristina; Bladé, Cinta; Mulero, Miquel; Blay, Mayte; Ardévol, Anna; Garcia-Vallvé, Santiago; Pujadas, Gerard

    2012-01-01

    Background Natural extracts play an important role in traditional medicines for the treatment of diabetes mellitus and are also an essential resource for new drug discovery. Dipeptidyl peptidase IV (DPP-IV) inhibitors are potential candidates for the treatment of type 2 diabetes mellitus, and the effectiveness of certain antidiabetic extracts of natural origin could be, at least partially, explained by the inhibition of DPP-IV. Methodology/Principal Findings Using an initial set of 29,779 natural products that are annotated with their natural source and an experimentally validated virtual screening procedure previously developed in our lab (Guasch et al.; 2012) [1], we have predicted 12 potential DPP-IV inhibitors from 12 different plant extracts that are known to have antidiabetic activity. Seven of these molecules are identical or similar to molecules with described antidiabetic activity (although their role as DPP-IV inhibitors has not been suggested as an explanation for their bioactivity). Therefore, it is plausible that these 12 molecules could be responsible, at least in part, for the antidiabetic activity of these extracts through their inhibitory effect on DPP-IV. In addition, we also identified as potential DPP-IV inhibitors 6 molecules from 6 different plants with no described antidiabetic activity but that share the same genus as plants with known antidiabetic properties. Moreover, none of the 18 molecules that we predicted as DPP-IV inhibitors exhibits chemical similarity with a group of 2,342 known DPP-IV inhibitors. Conclusions/Significance Our study identified 18 potential DPP-IV inhibitors in 18 different plant extracts (12 of these plants have known antidiabetic properties, whereas, for the remaining 6, antidiabetic activity has been reported for other plant species from the same genus). Moreover, none of the 18 molecules exhibits chemical similarity with a large group of known DPP-IV inhibitors. PMID:23028712

  9. Conforming Amendments to the Regulations Governing Nondiscrimination on the Basis of Race, Color, National, Origin, Disability, Sex, and Age under the Civil Rights Restoration Act of 1987; Final Rule. Federal Register, Part IV: Department of Education, 34 CFR Parts 100, 104, 106, and 110.

    ERIC Educational Resources Information Center

    Federal Register, 2000

    2000-01-01

    The Secretary amends the regulations governing nondiscrimination on the basis of race, color, national origin, sex, handicap, and age to conform with statutory amendments made by the Civil Rights Restoration Act of 1987 (CRRA). These amendments add a definition of "program or activity" or "program" that adopts the statutory…

  10. Highly ionized gas in the Gum nebula and elsewhere - A comparison of IUE and Copernicus satellite results

    NASA Technical Reports Server (NTRS)

    Edgar, Richard J.; Savage, Blair D.

    1992-01-01

    The data from six high-dispersion IUE echelle spectra are averaged in order to obtain an interstellar absorption line spectrum with an S/N of about 30 and a resolution of about 25 km/s. The interstellar lines of C IV and Si IV are very strong and broad and N V is detected. The profiles for these species and Al III are compared to the Copernicus satellite profiles for O VI. The high ionization lines toward HD 64760 are much stronger and broader than those recorded toward Zeta Pup and Gamma super 2 Vel, the two exciting stars of the Gum nebula. The profiles for Al III and Si IV are similar and considerably narrower than the O VI profile. An origin in photoionized Gum nebula gas is suggested as the most likely explanation for Al III and Si IV. The C IV profile has a high positive velocity wing extending to approximately +80 km/s, which is similar in appearance to the positive velocity portion of the O VI profile. It is inferred that a substantial part of the observed C IV has an origin in the collisionally ionized gas most likely rsponsible for the O VI.

  11. A Compilation of Federal Education Laws. Volume IV--Vocational Education, Job Training, Rehabilitation, and Related Statutes as Amended through December 31, 1984.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC. House Committee on Education and Labor.

    This volume is a compilation of the texts of nine Federal education laws, specifically vocational education, job training, rehabilitation, and related statutes. Part I contains one law related to vocational education--the Carl D. Perkins Vocational Education Act 1984 (originally, Vocational Education Act of 1963). Part II provides the texts of six…

  12. Summary of PSD Policy Determinations made by Region IV

    EPA Pesticide Factsheets

    This document may be of assistance in applying the New Source Review (NSR) air permitting regulations including the Prevention of Significant Deterioration (PSD) requirements. This document is part of the NSR Policy and Guidance Database. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  13. EPA, FWS, NPS Coordination Procedures for Determining Air Quality Impact in Region IV Class I Areas

    EPA Pesticide Factsheets

    This document may be of assistance in applying the New Source Review (NSR) air permitting regulations including the Prevention of Significant Deterioration (PSD) requirements. This document is part of the NSR Policy and Guidance Database. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  14. Title IV-Title V Interface Guidance for States

    EPA Pesticide Factsheets

    This document may be of assistance in applying the Title V air operating permit regulations. This document is part of the Title V Policy and Guidance Database available at www2.epa.gov/title-v-operating-permits/title-v-operating-permit-policy-and-guidance-document-index. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  15. The Cosmic Century

    NASA Astrophysics Data System (ADS)

    Longair, Malcolm S.

    2013-04-01

    Part I. Stars and Stellar Evolution up to the Second World War: 1. The legacy of the nineteenth century; 2. The classification of stellar spectra; 3. Stellar structure and evolution; 4. The end points of stellar evolution; Part II. The Large-Scale Structure of the Universe, 1900-1939: 5. The Galaxy and the nature of spiral nebulae; 6. The origins of astrophysical cosmology; Part III. The Opening up of the Electromagnetic Spectrum: 7. The opening up of the electromagnetic spectrum and the new astronomies; Part IV. The Astrophysics of Stars and Galaxies since 1945: 8. Stars and stellar evolution; 9. The physics of the interstellar medium; 10. The physics of galaxies and clusters of galaxies; 11. High-energy astrophysics; Part V. Astrophysical Cosmology since 1945: 12. Astrophysical cosmology; 13. The determination of cosmological parameters; 14. The evolution of galaxies and active galaxies with cosmic epoch; 15. The origin of galaxies and the large-scale structure of the Universe; 16. The very early Universe; References; Name index; Object index; Subject index.

  16. Physics Meets Philosophy at the Planck Scale

    NASA Astrophysics Data System (ADS)

    Callender, Craig; Huggett, Nick

    2001-04-01

    Preface; 1. Introduction Craig Callendar and Nick Huggett; Part I. Theories of Quantum Gravity and their Philosophical Dimensions: 2. Spacetime and the philosophical challenge of quantum gravity Jeremy Butterfield and Christopher Isham; 3. Naive quantum gravity Steven Weinstein; 4. Quantum spacetime: what do we know? Carlo Rovelli; Part II. Strings: 5. Reflections on the fate of spacetime Edward Witten; 6. A philosopher looks at string theory Robert Weingard; 7. Black holes, dumb holes, and entropy William G. Unruh; Part III. Topological Quantum Field Theory: 8. Higher-dimensional algebra and Planck scale physics John C. Baez; Part IV. Quantum Gravity and the Interpretation of General Relativity: 9. On general covariance and best matching Julian B. Barbour; 10. Pre-Socratic quantum gravity Gordon Belot and John Earman; 11. The origin of the spacetime metric: Bell's 'Lorentzian Pedagogy' and its significance in general relativity Harvey R. Brown and Oliver Pooley; Part IV. Quantum Gravity and the Interpretation of Quantum Mechanics: 12. Quantum spacetime without observers: ontological clarity and the conceptual foundations of quantum gravity Sheldon Goldstein and Stefan Teufel; 13. On gravity's role in quantum state reduction Roger Penrose; 14. Why the quantum must yield to gravity Joy Christian.

  17. Title III/Title IV Authorities Necessary for Full and Interim Title V Program Approval

    EPA Pesticide Factsheets

    This document may be of assistance in applying the Title V air operating permit regulations. This document is part of the Title V Policy and Guidance Database available at www2.epa.gov/title-v-operating-permits/title-v-operating-permit-policy-and-guidance-document-index. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  18. Region IV's 1997 Objection to Florida Power and Light Title V Permits

    EPA Pesticide Factsheets

    This document may be of assistance in applying the Title V air operating permit regulations. This document is part of the Title V Policy and Guidance Database available at www2.epa.gov/title-v-operating-permits/title-v-operating-permit-policy-and-guidance-document-index. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  19. Guidance on Coordination Title IV/Title V Permitting Schedules

    EPA Pesticide Factsheets

    This document may be of assistance in applying the Title V air operating permit regulations. This document is part of the Title V Policy and Guidance Database available at www2.epa.gov/title-v-operating-permits/title-v-operating-permit-policy-and-guidance-document-index. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  20. Large-Area, Ensemble Molecular Electronics: Motivation and Challenges.

    PubMed

    Vilan, Ayelet; Aswal, Dinesh; Cahen, David

    2017-03-08

    We review charge transport across molecular monolayers, which is central to molecular electronics (MolEl), using large-area junctions (NmJ). We strive to provide a wide conceptual overview of three main subtopics. First, a broad introduction places NmJ in perspective to related fields of research and to single-molecule junctions (1mJ) in addition to a brief historical account. As charge transport presents an ultrasensitive probe for the electronic perfection of interfaces, in the second part ways to form both the monolayer and the contacts are described to construct reliable, defect-free interfaces. The last part is dedicated to understanding and analyses of current-voltage (I-V) traces across molecular junctions. Notwithstanding the original motivation of MolEl, I-V traces are often not very sensitive to molecular details and then provide a poor probe for chemical information. Instead, we focus on how to analyze the net electrical performance of molecular junctions, from a functional device perspective. Finally, we point to creation of a built-in electric field as a key to achieve functionality, including nonlinear current-voltage characteristics that originate in the molecules or their contacts to the electrodes. This review is complemented by a another review that covers metal-molecule-semiconductor junctions and their unique hybrid effects.

  1. 40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 28 2013-07-01 2013-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

  2. 40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 27 2014-07-01 2014-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

  3. 40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 27 2011-07-01 2011-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

  4. 40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

  5. 19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

  6. 19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 19 Customs Duties 3 2013-04-01 2013-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

  7. 19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 3 2014-04-01 2014-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

  8. 19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 19 Customs Duties 3 2012-04-01 2012-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

  9. 19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 19 Customs Duties 3 2011-04-01 2011-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

  10. 46 CFR Appendix IV to Part 150 - Data Sheet

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 5 2014-10-01 2014-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

  11. 46 CFR Appendix IV to Part 150 - Data Sheet

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 5 2013-10-01 2013-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

  12. 46 CFR Appendix IV to Part 150 - Data Sheet

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 5 2012-10-01 2012-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

  13. 46 CFR Appendix IV to Part 150 - Data Sheet

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 5 2011-10-01 2011-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

  14. 46 CFR Appendix IV to Part 150 - Data Sheet

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

  15. Response to Question on whether the Combustion of Municipal Sewage Sludge would Qualify as Municipal Solid Waste under the Exemption Provided in Section IV.B. of the Draft Changes to EPA's Emission Offset Interpretive Ruling

    EPA Pesticide Factsheets

    This document may be of assistance in applying the New Source Review (NSR) air permitting regulations including the Prevention of Significant Deterioration (PSD) requirements. This document is part of the NSR Policy and Guidance Database. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  16. 40 CFR Appendix IV to Part 600 - Reserved

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Reserved IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR VEHICLES Appendix IV to Part 600 [Reserved] ...

  17. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Pt. 600, App. IV Appendix IV to Part 600...

  18. 12 CFR Appendix IV to Part 27 - Home Loan Data Submission

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 1 2014-01-01 2014-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

  19. 12 CFR Appendix IV to Part 27 - Home Loan Data Submission

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

  20. 12 CFR Appendix IV to Part 27 - Home Loan Data Submission

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

  1. 12 CFR Appendix IV to Part 27 - Home Loan Data Submission

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 1 2012-01-01 2012-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

  2. 12 CFR Appendix IV to Part 27 - Home Loan Data Submission

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

  3. Heating mechanism(s) for transition layers in giants

    NASA Technical Reports Server (NTRS)

    Bohm-Vitense, Erika; Mena-Werth, Jose

    1991-01-01

    The emission-line fluxes of lines originating in the lower parts of the transition layers between stellar chromospheres and coronas are studied. Simon and Drake (1989) suspect different heating mechanisms for 'hot' and cool stars. Changes in the flux ratios for the C IV to C II emission lines support this suspicion. Large C IV/C II line flux ratios appear to be indicative of magnetically controlled heating. A correlation between excess continuum flux around 1950 A and C II emission-line fluxes are confirmed for the cooler giants (late F and cooler). Excess continuum flux correlates positively with large C IV/C II line flux ratio. The excess continuum flux corresponds to an increase in temperature by several hundred degrees in layers with a mean optical depth of about 0.03. For chromospherically active stars these layers experience a mechanical flux deposition of the order of 1 percent of the total radiative flux. This flux is tentatively identified as an MHD wave flux similar to Alfven waves.

  4. 76 FR 36095 - Defense Transportation Regulation, Part IV

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-21

    ... with the Defense Personal Property Program (DP3) Phase III Domestic Small Shipments (dS2) and... Regulation, Part IV Web site at http://www.transcom.mil/dtr/part-iv/phaseiii.cfm . All identified changes... based on completion of Defense Personal Property System (DPS) Phase III programming projected for FY15...

  5. Reliability Assessment of Graphite Specimens under Multiaxial Stresses

    NASA Technical Reports Server (NTRS)

    Sookdeo, Steven; Nemeth, Noel N.; Bratton, Robert L.

    2008-01-01

    An investigation was conducted to predict the failure strength response of IG-100 nuclear grade graphite exposed to multiaxial stresses. As part of this effort, a review of failure criteria accounting for the stochastic strength response is provided. The experimental work was performed in the early 1990s at the Oak Ridge National Laboratory (ORNL) on hollow graphite tubes under the action of axial tensile loading and internal pressurization. As part of the investigation, finite-element analysis (FEA) was performed and compared with results of FEA from the original ORNL report. The new analysis generally compared well with the original analysis, although some discrepancies in the location of peak stresses was noted. The Ceramics Analysis and Reliability Evaluation of Structures Life prediction code (CARES/Life) was used with the FEA results to predict the quadrants I (tensile-tensile) and quadrant IV (compression-tension) strength response of the graphite tubes for the principle of independent action (PIA), the Weibull normal stress averaging (NSA), and the Batdorf multiaxial failure theories. The CARES/Life reliability analysis showed that all three failure theories gave similar results in quadrant I but that in quadrant IV, the PIA and Weibull normal stress-averaging theories were not conservative, whereas the Batdorf theory was able to correlate well with experimental results. The conclusion of the study was that the Batdorf theory should generally be used to predict the reliability response of graphite and brittle materials in multiaxial loading situations.

  6. Qualitative or Quantitative Differences between Asperger's Disorder and Autism? Historical Considerations

    ERIC Educational Resources Information Center

    Sanders, James Ladell

    2009-01-01

    The histories of autism and Asperger's Disorder (AD), based on original contributions by Kanner and Asperger, are reviewed in relation to DSM-IV diagnostic criteria. Their original articles appear to have influenced the distinction between AD and autism made in the DSM-IV. Based on up-to-date empirical research, however, it appears that AD and…

  7. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  8. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  9. Variations of System IV period of the sulfur ions in the Io torus for the volcanic event in 2015 observed by the HISAKI/EXCEED

    NASA Astrophysics Data System (ADS)

    Ryo, A.; Misawa, H.; Tsuchiya, F.; Kagitani, M.; Yoshioka, K.; Yoshikawa, I.; Kimura, T.; Murakami, G.; Yamazaki, A.

    2017-12-01

    Previous ground-based and probe observations of Io plasma torus (IPT) in various wavelengths have detected a periodic variation which is longer than System III period (9.925 h). It has been called System IV period. Although various ideas to explain the origin of System IV period are proposed , little progress has been made. A previous study reported that the System IV period was 10.07 h during the Cassini's Jupiter flyby in 2000. This period was shorter than the typical period of 10.21h (Brown 1995). The Io's volcanic event just before Cassini's flyby might shorten the System IV period (Steffl et al., 2006). However, the certainty of this inference is not clear from the Cassini observation. Here, we analyzed time variations in intensities of EUV emissions from IPT obtained by the HISAKI satellite to understand the mechanism responsible for the System IV period and the influence of Io's volcanic event on IPT. The data used in this study was obtained from Dec. 2014 to the middle of May 2015. During this period, the Io's volcanic event from Jan. to Mar. 2015 was reported from the observation of Iogenic sodium emission (Yoneda et al., 2015). To find variations of the System IV period, the temporal variation of System III longitude at peak EUV intensity was derived by fitting light curves of three ion species (S II 76.5 nm + 126 nm, S III 68 nm, and S IV 65.7 nm + 140.5 nm). The System IV periods of S II before and after the Io's volcanic event were 10.16±0.008 h and 10.03±0.006 h, respectively. On the other hands, the System IV period of S II was 9.95±0.003 h during the Io's volcanic event. This is the first observational evidence which shows that the System IV period has shortened during the Io's volcanic event, which is consistent with the result from Cassini observation. Origin of the System IV period has been discussed with sub-corotation of plasma in IPT. Since the sub-corotation occurs due to mass loading of newly picked-up ions into IPT, it is expected that the System IV period becomes long during Io's volcanic event. However, the result shows the opposite feature and will give important information to constrain the origin of the System IV period. To verify above consideration, we will derive time variation in plasma parameters in IPT from the HISAKI data with plasma diagnosis analysis. This analysis will enable us to constrain the origin of the System IV period.

  10. The evolution of the zodiac in the context of ancient oriental history

    NASA Astrophysics Data System (ADS)

    Gurshtein, Alex A.

    The dates for the second (ca. 2700 B.C. to within 250 years) and the third ecliptical quartets (ca. 1200 B.C. to within 400 years) evaluated earlier are considered in the context of ancient Egyptian history. The origin of the second quartet coincides with the Great Pyramids and the initiation of the Egyptian solar, or so-called "civil" calendar, the first of such a type in the world. The third quartet is concurrent with the solar conversion of Amenhotep IV (Akhenaton) and takes place at the finale of the great Sothic period of 1461 years after the initiation of the solar calendar. It is argued that the Great Pyramids seem to be monuments to the Sun-god built in honor of the Egyptians having reached an understanding of the Sun's track upon the starry background, Akhenaton's conversion being in a direct connection with the original Pyramids' ideology. This paper is the third part of a single investigation. The first two parts "On the Origin of the Zodiacal Constellations" and "Prehistory of Zodiac Dating: Three Strata of Upper Paleolithic Constellations" were published in Vistas in Astronomy in 1993 and 1995.

  11. Arcsecond positions for milliarcsecond VLBI nuclei of extragalactic radio sources. IV - Seventeen sources

    NASA Technical Reports Server (NTRS)

    Morabito, D. D.; Preston, R. A.; Linfield, R. P.; Slade, M. A.; Jauncey, D. L.

    1986-01-01

    VLBI measurements of time delay and delay rate at 2.29 and 8.42 GHz on baselines of 10,000 km have been used to determine the positions of the milliarcsecond nuclei in 17 extragalactic radio sources with estimated accuracies of 0.1 to 0.3 arcsec. The observed sources are part of an all-sky VLBI catalog of milliarcsecond radio sources. In addition, slightly improved positions are presented for 101 sources originally reported by Morabito et al. (1983). Arcsecond positions have now been determined for 836 sources.

  12. Internal variability of fine-scale components of meteorological fields in extended-range limited-area model simulations with atmospheric and surface nudging

    NASA Astrophysics Data System (ADS)

    Separovic, Leo; Husain, Syed Zahid; Yu, Wei

    2015-09-01

    Internal variability (IV) in dynamical downscaling with limited-area models (LAMs) represents a source of error inherent to the downscaled fields, which originates from the sensitive dependence of the models to arbitrarily small modifications. If IV is large it may impose the need for probabilistic verification of the downscaled information. Atmospheric spectral nudging (ASN) can reduce IV in LAMs as it constrains the large-scale components of LAM fields in the interior of the computational domain and thus prevents any considerable penetration of sensitively dependent deviations into the range of large scales. Using initial condition ensembles, the present study quantifies the impact of ASN on IV in LAM simulations in the range of fine scales that are not controlled by spectral nudging. Four simulation configurations that all include strong ASN but differ in the nudging settings are considered. In the fifth configuration, grid nudging of land surface variables toward high-resolution surface analyses is applied. The results show that the IV at scales larger than 300 km can be suppressed by selecting an appropriate ASN setup. At scales between 300 and 30 km, however, in all configurations, the hourly near-surface temperature, humidity, and winds are only partly reproducible. Nudging the land surface variables is found to have the potential to significantly reduce IV, particularly for fine-scale temperature and humidity. On the other hand, hourly precipitation accumulations at these scales are generally irreproducible in all configurations, and probabilistic approach to downscaling is therefore recommended.

  13. 29 CFR Appendix IV to Part 1918 - Special Cargo Gear and Container Spreader Test Requirements (Mandatory) [see § 1918.61 (f), (g...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 29 Labor 7 2012-07-01 2012-07-01 false Special Cargo Gear and Container Spreader Test Requirements... REGULATIONS FOR LONGSHORING Pt. 1918, App. IV Appendix IV to Part 1918—Special Cargo Gear and Container... structural damage repair 3. Intermodal container spreaders not part of vessel's cargo handling gear Prior to...

  14. 29 CFR Appendix IV to Part 1918 - Special Cargo Gear and Container Spreader Test Requirements (Mandatory) [see § 1918.61 (f), (g...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 29 Labor 7 2014-07-01 2014-07-01 false Special Cargo Gear and Container Spreader Test Requirements... REGULATIONS FOR LONGSHORING Pt. 1918, App. IV Appendix IV to Part 1918—Special Cargo Gear and Container... structural damage repair 3. Intermodal container spreaders not part of vessel's cargo handling gear Prior to...

  15. 29 CFR Appendix IV to Part 1918 - Special Cargo Gear and Container Spreader Test Requirements (Mandatory) [see § 1918.61 (f), (g...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 29 Labor 7 2013-07-01 2013-07-01 false Special Cargo Gear and Container Spreader Test Requirements... REGULATIONS FOR LONGSHORING Pt. 1918, App. IV Appendix IV to Part 1918—Special Cargo Gear and Container... structural damage repair 3. Intermodal container spreaders not part of vessel's cargo handling gear Prior to...

  16. 46 CFR Appendix IV to Part 390 - Sample Addendum to Maritime Administration Capital Construction Fund Agreement

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Sample Addendum to Maritime Administration Capital Construction Fund Agreement IV Appendix IV to Part 390 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF... 390—Sample Addendum to Maritime Administration Capital Construction Fund Agreement This Agreement...

  17. Tanks Versus Infantry in a Smoke Environment (TISE)

    DTIC Science & Technology

    1978-08-01

    maneuvering toward stationary armor vehicles in an attempt to detect and recognize them. Finally, Part IV trials were limited free - play , two-sided...long. Each armor vehicle lane (average 40 meters in width) was marked on the ground by white tape. These markings were removed for part IV free - play trials...recognize them. Data were collected from both sides. (4) Part IV was free - play , force-on-force engagement trials. Defensive positions were tactically

  18. The Formation of Galactic Bulges

    NASA Astrophysics Data System (ADS)

    Carollo, C. Marcella; Ferguson, Henry C.; Wyse, Rosemary F. G.

    2000-03-01

    Part I. Introduction: What are galactic bulges?; Part II. The Epoch of Bulge Formation: Origin of bulges; Deep sub-mm surveys: High-z ULIRGs and the formation of spheroids; Ages and metallicities for stars in the galactic bulge; Integrated stellar populations of bulges: First results; HST-NICMOS observations of galactic bulges: Ages and dust; Inside-out bulge formation and the origin of the Hubble sequence; Part III. The Timescales of Bulge Formation: Constraints on the bulge formation timescale from stellar populations; Bulge building with mergers and winds; Role of winds, starbursts, and activity in bulge formation; Dynamical timescales of bulge formation; Part IV. Physical Processes in Bulge Formation: the role of bars for secular bulge formation; Bars and boxy/peanut-shaped bulges: an observational point of view; Boxy- and peanut-shaped bulges; A new class of bulges; The role of secondary bars in bulge formation; Radial transport of molecular gas to the nuclei of spiral galaxies; Dynamical evolution of bulge shapes; Two-component stellar systems: Phase-space constraints; Central NGC 2146 - a firehose-type bending instability?; Bulge formation: the role of the multi-phase ISM; Global evolution of a self-gravitating multi-phase ISM in the central kpc region of galaxies; Part V. Bulge Phenomenology: Bulge-disk decomposition of spiral galaxies in the near-infrared; The triaxial bulge of NGC 1371; The bulge-disk orthogonal decoupling in galaxies: NGC 4698 and NGC 4672; The kinematics and the origin of the ionized gas in NGC 4036; Optically thin thermal plasma in the galactic bulge; X-ray properties of bulges; The host galaxies of radio-loud AGN; The centers of radio-loud early-type galaxies with HST; Central UV spikes in two galactic spheroids; Conference summary: where do we stand?

  19. Planets and Life

    NASA Astrophysics Data System (ADS)

    Sullivan, Woodruff T., III; Baross, John

    2007-09-01

    Foreword; Preface; Contributors; Prologue; Part I. History: 1. History of astrobiological ideas W. T. Sullivan and D. Carney; 2. From exobiology to astrobiology S. J. Dick; Part II. The Physical Stage: 3. Formation of Earth-like habitable planets D. E. Brownlee and M. Kress; 4. Planetary atmospheres and life D. Catling and J. F. Kasting; Part III. The Origin of Life on Earth: 5. Does 'life' have a definition? C.E. Cleland and C. F. Chyba; 6. Origin of life: crucial issues R. Shapiro; 7. Origin of proteins and nucleic acids A. Ricardo and S. A. Benner; 8. The roots of metabolism G.D. Cody and J. H. Scott; 9. Origin of cellular life D. W. Deamer; Part IV. Life on Earth: 10. Evolution: a defining feature of life J. A. Baross; 11. Evolution of metabolism and early microbial communities J. A. Leigh, D. A. Stahl and J. T. Staley; 12. The earliest records of life on Earth R. Buick; 13. The origin and diversification of eukaryotes M. L. Sogin, D. J. Patterson and A. McArthur; 14. Limits of carbon life on Earth and elsewhere J. A. Baross, J. Huber and M. Schrenk; 15. Life in ice J. W. Deming and H. Eicken; 16. The evolution and diversification of life S. Awramik and K. J. McNamara; 17. Mass extinctions P. D. Ward; Part V. Potentially Habitable Worlds: 18. Mars B. M. Jakosky, F. Westall and A. Brack; 19. Europa C. F. Chyba and C. B. Phillips; 20. Titan J. I. Lunine and B. Rizk; 21. Extrasolar planets P. Butler; Part VI. Searching for Extraterrestrial Life: 22. How to search for life on other worlds C. P. McKay; 23. Instruments and strategies for detecting extraterrestrial life P. G. Conrad; 24. Societial and ethical concerns M. S. Race; 25. Planetary protection J. D. Rummel; 26. Searching for extraterrestrial intelligence J. C. Tarter; 27. Alien biochemistries P. D. Ward and S. A. Benner; Part VII. Future of the Field: 28. Disciplinary and educational opportunities L. Wells, J. Armstrong and J. Huber; Epilogue C. F. Chyba; Appendixes: A. Units and usages; B. Planetary properties; C. The geological time scale S. Awramik and K. J. McNamara; D. Astrobiological destinations on planet Earth J. Harnmeijer; E. Micro*scope web tool D. J. Patterson and M. L. Sogin; Index.

  20. [Analysis of the parental origin of MECP2 mutations in patients with Rett syndrome].

    PubMed

    Zhang, Jing-jing; Bao, Xin-hua; Cao, Guang-na; Jiang, Sheng-ling; Zhu, Xing-wang; Lu, Hong-mei; Jia, Li-fang; Pan, Hong; Wu, Xi-ru

    2010-04-01

    To identify the parental origin of methyl-CpG-binding protein 2 (MECP2) gene mutations in Chinese patients with Rett syndrome. Single nucleotide polymorphisms (SNPs) in intron 3 of the MECP2 gene were analyzed by PCR and sequencing in 115 patients with Rett syndrome. Then sequencing of the SNP region was performed for the fathers of the patients who had at least one SNP, to determine which allele was from the father. Then allele-specific PCR was performed and the products were sequenced to see whether the allele from father or mother harbored the mutation. Seventy-six of the 115 patients had at least one SNP. Three hot SNPs were found in these patients. They were: IVS3+22C >G, IVS3+266C >T and IVS3+683C>T. Among the 76 cases, 73 had a paternal origin of MECP2 mutations, and the other 3 had a maternal origin. There were multiple types of MECP2 mutation of the paternal origin, including 4 frame shift, 2 deletion and 67 point (56C >T, 6C >G, 2A >G, 2G >T and 1A >T) mutations. The mutation types of the 3 patients with maternal origin included 2 frame shift and 1 point (C >T) mutation. In Chinese RTT patients, the MECP2 mutations are mostly of paternal origin.

  1. Taxonomy and phylogeny of two species of the genus Deviata (Protista, Ciliophora) from China, with description of a new soil form, Deviata parabacilliformis sp. nov.

    PubMed

    Li, Fengchao; Lv, Zhao; Yi, Zhenzhen; Al-Farraj, Saleh A; Al-Rasheid, Khaled A S; Shao, Chen

    2014-11-01

    The morphology and morphogenesis of a soil hypotrichous ciliate, Deviata parabacilliformis sp. nov., isolated from northern China, were investigated. D. parabacilliformis measures about 75-210 × 25-60 µm in vivo, with an elongate and flexible body. It possesses one right marginal row, two to four left marginal rows and three dorsal kineties. The main morphogenetic features of D. parabacilliformis are: (i) the oral primordium originates de novo; (ii) anlage IV of the opisthe originates from parental frontoventral row V, anlage V originates de novo, and anlage VI forms from frontoventral row VI; and (iii) anlage I of the proter originates from the anterior portion of the parental paroral, anlage II originates from the buccal cirrus, anlage III originates from the parabuccal cirri, anlage IV originates from parental frontoventral row IV and anlage V forms from the anterior of parental frontoventral row VI. The morphology of an edaphic population of another species of the genus Deviata, Deviata bacilliformis (Gelei 1954) Eigner 1995, was also investigated. This work also provides the first record of SSU rRNA gene sequences for species of the genus Deviata. Molecular phylogenetic analysis suggests that Deviata is not monophyletic, and its position is poorly resolved due to weak phylogenetic signal of the 18S marker in the Stichotrichida. © 2014 IUMS.

  2. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR...

  3. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR...

  4. 40 CFR Appendix IV to Part 261 - Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... AND LISTING OF HAZARDOUS WASTE Financial Requirements for Management of Excluded Hazardous Secondary Materials Wording of the instruments. Appendix IV to Part 261 [Reserved for Radioactive Waste Test Methods] ...

  5. Ventricular tachycardia storm originating from interventricular septum successfully treated with surgical cryoablation with electroanatomic and electrophysiological mapping before dual valve replacement.

    PubMed

    Kawamura, Iwanari; Fukamizu, Seiji; Miyazawa, Satoshi; Hojo, Rintaro; Ito, Fusahiko; Watanabe, Masazumi; Nishizaki, Mitsuhiro; Sakurada, Harumizu; Hiraoka, Masayasu

    2018-02-01

    A 58-year-old man with dilated cardiomyopathy was admitted with heart failure. He had a history of two catheter ablation procedures for ventricular tachycardia (VT) originating from the intraventricular septum (IVS). Before dual valve replacement (DVR), he suffered a VT storm. An electrophysiological study revealed an extended low-voltage area at the IVS with the exit of the induced VT at the anterior side. Radiofrequency application was performed at the VT exit as a landmark for surgical cryoablation (SA). During the DVR, SA was performed at the IVS using this landmark. After SA, the patient had no ventricular tachyarrhythmia.

  6. 40 CFR 85.2114 - Basis of certification.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... an alternative, the aftermarket part manufacturer may use a different durability procedure if it can..., appendix IV. As an alternative, the aftermarket part manufacturer may use a different durability procedure..., appendix IV can be used. As an alternative, the aftermarket part manufacturer may use a different...

  7. The developmental origin of zygodactyl feet and its possible loss in the evolution of Passeriformes

    PubMed Central

    Botelho, João Francisco; Smith-Paredes, Daniel; Nuñez-Leon, Daniel; Soto-Acuña, Sergio; Vargas, Alexander O.

    2014-01-01

    The zygodactyl orientation of toes (digits II and III pointing forwards, digits I and IV pointing backwards) evolved independently in different extant bird taxa. To understand the origin of this trait in modern birds, we investigated the development of the zygodactyl foot of the budgerigar (Psittaciformes). We compared its muscular development with that of the anisodactyl quail (Galliformes) and show that while the musculus abductor digiti IV (ABDIV) becomes strongly developed at HH36 in both species, the musculus extensor brevis digiti IV (EBDIV) degenerates and almost disappears only in the budgerigar. The asymmetric action of those muscles early in the development of the budgerigar foot causes retroversion of digit IV (dIV). Paralysed budgerigar embryos do not revert dIV and are anisodactyl. Both molecular phylogenetic analysis and palaeontological information suggest that the ancestor of passerines could have been zygodactyl. We followed the development of the zebra finch (Passeriformes) foot muscles and found that in this species, both the primordia of the ABDIV and of the EBDIV fail to develop. These data suggest that loss of asymmetric forces of muscular activity exerted on dIV, caused by the absence of the ABDIV, could have resulted in secondary anisodactyly in Passeriformes. PMID:24966313

  8. The developmental origin of zygodactyl feet and its possible loss in the evolution of Passeriformes.

    PubMed

    Botelho, João Francisco; Smith-Paredes, Daniel; Nuñez-Leon, Daniel; Soto-Acuña, Sergio; Vargas, Alexander O

    2014-08-07

    The zygodactyl orientation of toes (digits II and III pointing forwards, digits I and IV pointing backwards) evolved independently in different extant bird taxa. To understand the origin of this trait in modern birds, we investigated the development of the zygodactyl foot of the budgerigar (Psittaciformes). We compared its muscular development with that of the anisodactyl quail (Galliformes) and show that while the musculus abductor digiti IV (ABDIV) becomes strongly developed at HH36 in both species, the musculus extensor brevis digiti IV (EBDIV) degenerates and almost disappears only in the budgerigar. The asymmetric action of those muscles early in the development of the budgerigar foot causes retroversion of digit IV (dIV). Paralysed budgerigar embryos do not revert dIV and are anisodactyl. Both molecular phylogenetic analysis and palaeontological information suggest that the ancestor of passerines could have been zygodactyl. We followed the development of the zebra finch (Passeriformes) foot muscles and found that in this species, both the primordia of the ABDIV and of the EBDIV fail to develop. These data suggest that loss of asymmetric forces of muscular activity exerted on dIV, caused by the absence of the ABDIV, could have resulted in secondary anisodactyly in Passeriformes. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  9. 20 CFR 410.591 - Eligibility for services and supplies under part C of title IV of the act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 20 Employees' Benefits 2 2011-04-01 2011-04-01 false Eligibility for services and supplies under part C of title IV of the act. 410.591 Section 410.591 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Payment of...

  10. 40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 30 2011-07-01 2011-07-01 false Sample Fuel Economy Labels for 2008... PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Pt. 600, App. IV Appendix IV to Part 600—Sample Fuel Economy Labels for 2008 and Later Model Year...

  11. 10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

  12. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 28 2013-07-01 2013-07-01 false Wastes Excluded From Lab Packs Under...

  13. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 28 2012-07-01 2012-07-01 false Wastes Excluded From Lab Packs Under...

  14. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 27 2011-07-01 2011-07-01 false Wastes Excluded From Lab Packs Under...

  15. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Wastes Excluded From Lab Packs Under...

  16. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 27 2014-07-01 2014-07-01 false Wastes Excluded From Lab Packs Under...

  17. 45 CFR 310.0 - What does this part cover?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... COMPUTERIZED TRIBAL IV-D SYSTEMS AND OFFICE AUTOMATION General Provisions § 310.0 What does this part cover... and Office Automation including: (a) The automated systems options for comprehensive Tribal IV-D... and Office Automation in § 310.15 of this part; (d) The conditions for funding the installation...

  18. Expanded and independent validation of the Movement Disorder Society-Unified Parkinson's Disease Rating Scale (MDS-UPDRS).

    PubMed

    Martinez-Martin, Pablo; Rodriguez-Blazquez, Carmen; Alvarez-Sanchez, Mario; Arakaki, Tomoko; Bergareche-Yarza, Alberto; Chade, Anabel; Garretto, Nelida; Gershanik, Oscar; Kurtis, Monica M; Martinez-Castrillo, Juan Carlos; Mendoza-Rodriguez, Amelia; Moore, Henry P; Rodriguez-Violante, Mayela; Singer, Carlos; Tilley, Barbara C; Huang, Jing; Stebbins, Glenn T; Goetz, Christopher G

    2013-01-01

    The Movement Disorder Society-UPDRS (MDS-UPDRS) was published in 2008, showing satisfactory clinimetric results and has been proposed as the official benchmark scale for Parkinson's disease. The present study, based on the official MDS-UPDRS Spanish version, performed the first independent testing of the scale and adds information on its clinimetric properties. The cross-culturally adapted MDS-UPDRS Spanish version showed a comparative fit index ≥ 0.90 for each part (I-IV) relative to the English-language version and was accepted as the Official MDS-UPDRS Spanish version. Data from this scale, applied with other assessments to Spanish-speaking Parkinson's disease patients in five countries, were analyzed for an independent and complementary clinimetric evaluation. In total, 435 patients were included. Missing data were negligible and moderate floor effect (30 %) was found for Part IV. Cronbach's α index ranged between 0.79 and 0.93 and only five items did not reach the 0.30 threshold value of item-total correlation. Test-retest reliability was adequate with only two sub-scores of the item 3.17, Rest tremor amplitude, reaching κ values lower than 0.60. The intraclass correlation coefficient was higher than 0.85 for the total score of each part. Correlation of the MDS-UPDRS parts with other measures for related constructs was high (≥ 0.60) and the standard error of measurement lower than one-third baseline standard deviation for all subscales. Results confirm those of the original study and add information on scale reliability, construct validity, and precision. The MDS-UPDRS Spanish version shows satisfactory clinimetric characteristics.

  19. Features of current-voltage characteristic of nonequilibrium trench MOS barrier Schottky diode

    NASA Astrophysics Data System (ADS)

    Mamedov, R. K.; Aslanova, A. R.

    2018-06-01

    The trench MOS barrier Schottky diodes (TMBS diode) under the influence of the voltage drop of the additional electric field (AEF) appearing in the near-contact region of the semiconductor are in a nonequilibrium state and their closed external circuit flows currents in the absence of an external voltage. When an external voltage is applied to the TMBS diode, the current transmission is described by the thermionic emission theory with a specific feature. Both forward and reverse I-V characteristics of the TMBS diode consist of two parts. In the initial first part of the forward I-V characteristic there are no forward currents, but reverse saturation currents flow, in its subsequent second part the currents increase exponentially with the voltage. In the initial first part of the reverse I-V characteristic, the currents increase in an abrupt way and in the subsequent second part the saturation currents flow under the action of the image force. The mathematical expressions for forward and reverse I-V characteristic of the TMBS diode and also narrow or nanostructure Schottky diode are proposed, which are in good agreement with the results of experimental and calculated I-V characteristics.

  20. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  1. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Astrophysics Data System (ADS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-08-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  2. The Life and Death of Axis IV: Caught in the Quest for a Theory of Mental Disorder

    ERIC Educational Resources Information Center

    Probst, Barbara

    2014-01-01

    Axis IV, one of the five dimensions of clinical description, has provided a way to report psychosocial and environmental problems that may affect the diagnosis, treatment, and/or prognosis of a psychiatric disorder. Originally conceived in DSM-III as a way to rate and rank the severity of particular environmental stressors, axis IV was simplified…

  3. 40 CFR 147.2200 - State-administered program-Class I, III, IV, and V wells.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... the in situ combustion of coal are regulated by the Rail Road Commission of Texas under a separate UIC... program for Class I, III, IV, and V wells in the State of Texas, except for those wells on Indian lands... (SDWA). Notice of the original approval for Class I, III, IV, and V wells was published in the Federal...

  4. 40 CFR 147.2200 - State-administered program-Class I, III, IV, and V wells.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... the in situ combustion of coal are regulated by the Rail Road Commission of Texas under a separate UIC... program for Class I, III, IV, and V wells in the State of Texas, except for those wells on Indian lands... (SDWA). Notice of the original approval for Class I, III, IV, and V wells was published in the Federal...

  5. Tourette's: syndrome, disorder or spectrum? Classificatory challenges and an appraisal of the DSM criteria.

    PubMed

    Robertson, Mary May; Eapen, Valsamma

    2014-10-01

    The fifth version of the Diagnostic and statistical manual of mental disorders (DSM-5) was released in May 2013 after 14 years of development and almost two decades after the last edition DSM-IV was published in 1994. We review the DSM journey with regards to Tourette Syndrome from the original publication of DSM 1 in 1952 till date. In terms of changes in DSM 5, the major shift has come in the placement of Tourette Syndrome under the 'Neurodevelopmental Disorders' alongside other disorders with a developmental origin. This review provides an overview of the changes in DSM-5 highlighting key points for clinical practice and research along with a snap shot of the current use of DSM as a classificatory system in different parts of the world and suggestions for improving the subtyping and the diagnostic confidence. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Human Rehabilitation Techniques. Project Papers. Volume IV, Part B.

    ERIC Educational Resources Information Center

    Dudek, R. A.; And Others

    Volume IV, Part B of a six-volume final report (which covers the findings of a research project on policy and technology related to rehabilitation of disabled individuals) presents a continuation of papers (Part A) giving an overview of project methodology, much of the data used in projecting consequences and policymaking impacts in project…

  7. Coordinator(a) de Servicios Clinicos. Parte I (Unidad I-IV). Parte II (Unidad V-VI). Guia. Documento de Trabajo (Clinical Services Coordinator. Part I. Units I-IV. Part II. Units V-VI. Guide. Working Document).

    ERIC Educational Resources Information Center

    Puerto Rico State Dept. of Education, Hato Rey. Area for Vocational and Technical Education.

    This guide is intended for instructing secondary students in the occupation of clinical services coordinator in a hospital. The first part contains four units on the following subjects: the occupation of clinical services coordinator; interpersonal relationships; ethical/legal aspects; and communications (telephone, intercom, and others). For each…

  8. Development of alternate paragraphs for the Logical Memory subtest of the Wechsler Memory Scale-IV.

    PubMed

    Morris, Jeri; Swier-Vosnos, Amy; Woodworth, Craig; Umfleet, Laura Glass; Czipri, Sheena; Kopald, Brandon

    2014-01-01

    The purpose of the two studies included in this article was to validate an alternate form, the Morris Revision-Fourth Edition (MR-IV), to the Logical Memory paragraphs of the Wechsler Memory Scale-Fourth Edition (LM-IV) for use when retesting of individuals is desired. Study I demonstrated high correlation with the LM-IV paragraphs. Study II was a replication that again demonstrated high correlation between the original LM-IV and the new MR-IV paragraphs. High interrater reliability also was demonstrated. Consequently, the MR-IV paragraphs can be considered an alternate form to the LM-IV paragraphs. Although other attempts have been made to develop alternate stories, these new paragraphs are the only ones that are equivalent in structure, affective tone, and number of scorable units. They have considerable clinical utility and research potential.

  9. Excess junction current of silicon solar cells

    NASA Technical Reports Server (NTRS)

    Wang, E. Y.; Legge, R. N.; Christidis, N.

    1973-01-01

    The current-voltage characteristics of n(plus)-p silicon solar cells with 0.1, 1.0, 2.0, and 10 ohm-cm p-type base materials have been examined in detail. In addition to the usual I-V measurements, we have studied the temperature dependence of the slope of the I-V curve at the origin by the lock-in technique. The excess junction current coefficient (Iq) deduced from the slope at the origin depends on the square root of the intrinsic carrier concentration. The Iq obtained from the I-V curve fitting over the entire forward bias region at various temperatures shows the same temperature dependence. This result, in addition to the presence of an aging effect, suggest that the surface channel effect is the dominant cause of the excess junction current.

  10. [The genotype analysis of glucose-6-phosphate dehydrogenase deficiency in Yunnan province].

    PubMed

    Yang, Z; Chu, J; Ban, G; Huang, X; Xu, S; Li, M

    2001-08-01

    To identify glucose-6-phosphate dehydrogenase (G6PD) gene mutations in 23 patients with G6PD deficiency and to gain further understanding of the molecular and genetic background of G6PD gene in Yunnan province, China. The mutations located in exons 2-12 and in parts of introns of G6PD gene were analyzed by amplification refractory mutation system(ARMS), natural and mis-match primer PCR/restrict enzyme, polymerase chain reaction-single strand conformation polymorphism(PCR-SSCP ) analysis and automatic DNA sequencing. Among these 23 samples, 5 different point mutations in G6PD gene were identified, and they constituted 5 genotypes. There were 7 Han and 3 Dai patients with G487A mutation, 7 cases with both intron 11 T93C and C1311T mutations, 4 cases with intron 5 636 or 637 T-->del mutation, 1 case with G871A mutation, and 1 case with G487A/T93C/C1311T mutation. Two haplotypes, 93C/1311T and 93C/1311T/487A were identified in Yunnan. A strong association was observed between C1311T and the Nla III restriction site produced by intron 11 T93C. The findings of the investigators on IVS-5 636 or 637T-->del in Chinese, on G871A in mainland of China, and on G487A in the Han people of Yunnan have not been reported previously. G6PD deficiency is very heterogenous in Yunnan; G487A is one of the common mutations in that province and may be of different origins. Possibly IVS-11 T93C mutation is of non-African origin. IVS-11 T93C and C1311T might jointly result in G6PD deficiency. The above data on G6PD gene mutation types could be useful for clinical diagnosis, prevention of G6PD deficiency, and researches in the origin and migration of minorities in Yunnan or other regions.

  11. Pelvic Arterial Anatomy Relevant to Prostatic Artery Embolisation and Proposal for Angiographic Classification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Assis, André Moreira de, E-mail: andre.maa@gmail.com; Moreira, Airton Mota, E-mail: motamoreira@gmail.com; Paula Rodrigues, Vanessa Cristina de, E-mail: vanessapaular@yahoo.com.br

    PurposeTo describe and categorize the angiographic findings regarding prostatic vascularization, propose an anatomic classification, and discuss its implications for the PAE procedure.MethodsAngiographic findings from 143 PAE procedures were reviewed retrospectively, and the origin of the inferior vesical artery (IVA) was classified into five subtypes as follows: type I: IVA originating from the anterior division of the internal iliac artery (IIA), from a common trunk with the superior vesical artery (SVA); type II: IVA originating from the anterior division of the IIA, inferior to the SVA origin; type III: IVA originating from the obturator artery; type IV: IVA originating from themore » internal pudendal artery; and type V: less common origins of the IVA. Incidences were calculated by percentage.ResultsTwo hundred eighty-six pelvic sides (n = 286) were analyzed, and 267 (93.3 %) were classified into I–IV types. Among them, the most common origin was type IV (n = 89, 31.1 %), followed by type I (n = 82, 28.7 %), type III (n = 54, 18.9 %), and type II (n = 42, 14.7 %). Type V anatomy was seen in 16 cases (5.6 %). Double vascularization, defined as two independent prostatic branches in one pelvic side, was seen in 23 cases (8.0 %).ConclusionsDespite the large number of possible anatomical variations of male pelvis, four main patterns corresponded to almost 95 % of the cases. Evaluation of anatomy in a systematic fashion, following a standard classification, will make PAE a faster, safer, and more effective procedure.« less

  12. 20 CFR 634.3 - Eligible recipients.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR LABOR MARKET INFORMATION PROGRAMS UNDER TITLE IV, PART E OF THE JOB TRAINING PARTNERSHIP ACT Comprehensive Labor Market Information System § 634.3 Eligible recipients. (a) For funds appropriated pursuant to JTPA title IV, part E...

  13. Carl Sagan's Universe

    NASA Astrophysics Data System (ADS)

    Terzian, Yervant; Bilson, Elizabeth

    1997-10-01

    Preface; Carl Sagan at sixty; Part I. Planetary Exploration: 1. On the occasion of Carl Sagan's sixtieth birthday Wesley T. Huntress, Jr.; 2. The search for the origins of life: U.S. Solar system exploration, 1962-1994 Edward C. Stone; 3. Highlights of the Russian planetary program Roald Sageev; 4. From the eyepiece to the footpad: The search for life on Mars Bruce Murray; Part II. Life in the Cosmos: 5. Environments of Earth and other worlds Owen B. Toon; 6. The origin of life in a cosmic context Christopher F. Chyba; 7. Impacts and life: Living in a risky planetary system David Morrison; 8. Extraterrestrial intelligence: The significance of the search Frank D. Drake; 9. Extraterrestrial intelligence: The search programs Paul Horowitz; 10. Do the laws of physics permit wormholes for interstellar travel and machines for time travel? Kip S. Thorne; Public Address: 11. The age of exploration Carl Sagan; Part III. Science Education: 12. Does science need to be popularized? Ann Druyen; 13. Science and pseudo-science James Randi; 14. Science education in a democracy Philip Morrison; 15. The visual presentation of science Jon Lomberg; 16. Science and the press Walter Anderson; 17. Science and teaching Bill G. Aldridge; Part IV. Science, Environment and Public Policy: 18. The relationship of science and power Richard L. Garwin; 19. Nuclear-free world? Georgi Arbatov; 20. Carl Sagan and nuclear winter Richard P. Turco; 21. Public understanding of global climate change James Hansen; 22. Science and religion Joan B. Campbell; 23. Speech in honor of Carl Sagan Frank Press.

  14. Interstellar C IV and Si IV column densities toward early-type stars

    NASA Technical Reports Server (NTRS)

    Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

    1980-01-01

    Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

  15. 20 CFR 410.416 - Determining origin of pneumoconiosis, including statutory presumption.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Total Disability or Death Due to Pneumoconiosis § 410.416 Determining origin of pneumoconiosis, including statutory...

  16. 20 CFR 410.416 - Determining origin of pneumoconiosis, including statutory presumption.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Total Disability or Death Due to Pneumoconiosis § 410.416 Determining origin of pneumoconiosis, including statutory...

  17. 76 FR 22878 - Defense Transportation Regulation, Part IV

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-25

    ... Military Services, DFAS and SDDC. In addition, the proposed electronic billing processes will compliment... in the Defense Transportation Regulation (DTR) Part IV (DTR 4500.9R). This process proposes mandatory... Transportation Service Providers (TSP). Implementation of electronic payments for NTS at all Military Services...

  18. Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

    PubMed

    Lees, George E

    2013-01-01

    To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

  19. Dielectric Constant and Loss Data Part 2

    DTIC Science & Technology

    1975-12-01

    fluoride, single crystal, Melamine - formaldehyde resins , Columbia Univ., P.R.-75 IV-21,22,112; V-8,88 Manganese-magnesium ferrite, Melamine GMG, IV-2i...butylperoxy) Urea - formaldehyde resins , IV-23 hexane, P.R.-197 U.S. Army Engineering Research and War Dept., Picatinny Arsenal, see Dev. Lab., Fort...IV.-36 irradiated, P.R,-161 "Bakelite" polyvinyl chloride- "Amplifilm," IV-14; V-74 acetate, see "Vinylites" Axiiliine- formaldehyde resins , IV-21

  20. 48 CFR 1315.204-570 - Part IV representations and instructions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

  1. 48 CFR 1315.204-570 - Part IV representations and instructions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

  2. 48 CFR 1315.204-570 - Part IV representations and instructions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

  3. 48 CFR 1315.204-570 - Part IV representations and instructions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

  4. 48 CFR 1315.204-570 - Part IV representations and instructions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

  5. Enter the Madcap Prince of Wales: Students Directing "Henry IV, Part I."

    ERIC Educational Resources Information Center

    Earthman, Elise Ann

    1993-01-01

    Argues that William Shakespeare's "Henry IV, Part I" is an appropriate and useful text for secondary English classrooms. Shows how the play lends itself to performance-based instruction. Outlines ways of accomplishing student engagement, using film versions, and assigning written work. (HB)

  6. 20 CFR 410.456 - Determining origin of pneumoconiosis, including statutory presumption-survivor's claim.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Total Disability or Death Due to Pneumoconiosis § 410.456 Determining origin of pneumoconiosis...

  7. 20 CFR 410.456 - Determining origin of pneumoconiosis, including statutory presumption-survivor's claim.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Total Disability or Death Due to Pneumoconiosis § 410.456 Determining origin of pneumoconiosis...

  8. Subunit Compositions of the RNA-Silencing Enzymes Pol IV and Pol V Reveal Their Origins as Specialized Forms of RNA Polymerase II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ream, Thomas S.; Haag, J. R.; Wierzbicki, A. T.

    2009-01-30

    In addition to RNA polymerases I, II and III, which are multi-subunit RNA polymerases found in all eukaryotes, plants have catalytic subunits for two additional nuclear RNA polymerases, abbreviated as Pol IV and Pol V (formerly Pol IVa and Pol IVb, respectively). Pol IV and Pol V play non-redundant roles in siRNA-directed DNA methylation and gene silencing pathways.

  9. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  10. 78 FR 18325 - Defense Transportation Regulation, Part IV

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-26

    ... received in connection with the Defense Personal Property Program (DP3) Phase III Direct Procurement Method... at http://www.transcom.mil/dtr/part-iv/phaseiii.cfm (DPM SECTION). All identified changes will be... Defense Personal Property System (DPS) Phase III programming projected for FY17. FOR FURTHER INFORMATION...

  11. 20 CFR 410.101 - Introduction.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV.... The regulations in this part 410 (Regulation No. 10 of the Social Security Administration) relate to the provisions of part B (Black Lung Benefits) of title IV of the Federal Coal Mine Health and Safety...

  12. 45 CFR 310.40 - What requirements apply for accessing systems and records for monitoring Computerized Tribal IV-D...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... records for monitoring Computerized Tribal IV-D Systems and Office Automation? 310.40 Section 310.40... COMPUTERIZED TRIBAL IV-D SYSTEMS AND OFFICE AUTOMATION Accountability and Monitoring Procedures for... monitoring Computerized Tribal IV-D Systems and Office Automation? In accordance with Part 95 of this title...

  13. Quality assurance, an administrative means to a managerial end: Part IV.

    PubMed

    Clark, G B

    1992-01-01

    This is the fourth and final part of a series of articles on laboratory quality surveillance. Part I addressed the historical background of medical quality assurance. Part II covered surveillance guidelines of the Joint Commission on Accreditation of Healthcare Organizations (JCAHO) and the College of American Pathologists with emphasis on quality assurance (QA) and the ten-step process. Part III focused on the JCAHO transition from QA to quality assessment and improvement. Part IV concludes the series by discussing the systematic identification of quality indicators in the total quality management and continuous quality improvement environment.

  14. Origins and Evolution of Life

    NASA Astrophysics Data System (ADS)

    Gargaud, Muriel; López-García, Purificación; Martin, Hervé

    2011-01-01

    Part I. What Is Life?: 1. Problems raised by a definition of life M. Morange; 2. Some remarks about uses of cosmological anthropic 'principles' D. Lambert; 3. Minimal cell: the biologist point of view C. Brochier-Armanet; 4. Minimal cell: the computer scientist point of view H. Bersini; 5. Origins of life: computing and simulation approaches B. Billoud; Part II. Astronomical and Geophysical Context of the Emergence of Life: 6. Organic molecules in interstellar medium C. Ceccarelli and C. Cernicharo; 7. Cosmochemical evolution and the origin of life: insights from meteorites S. Pizzarello; 8. Astronomical constraints on the emergence of life M. Gounelle and T. Montmerle; 9. Formation of habitable planets J. Chambers; 10. The concept of galactic habitable zone N. Prantzos; 11. The young Sun and its influence on planetary atmospheres M. Güdel and J. Kasting; 12. Climates of the Earth G. Ramstein; Part III. Role of Water in the Emergence of Life: 13. Liquid water: a necessary condition to all forms of life K. Bartik, G. Bruylants, E. Locci and J. Reisse; 14. The role of water in the formation and evolution of planets T. Encrenaz; 15. Water on Mars J. P. Bibring; Part IV. From Non-Living Systems to Life: 16. Energetic constraints on prebiotic pathways: application to the emergence of translation R. Pascal and L. Boiteau; 17. Comparative genomics and early cell evolution A. Lazcano; 18. Origin and evolution of metabolisms J. Peretó; Part V. Mechanisms for Life Evolution: 19. Molecular phylogeny: inferring the patterns of evolution E. Douzery; 20. Horizontal gene transfer: mechanisms and evolutionary consequences D. Moreira; 21. The role of symbiosis in eukaryotic evolution A. Latorre, A. Durbán, A. Moya and J. Peretó; Part VI. Life in Extreme Conditions: 22. Life in extreme conditions: Deinococcus radiodurans, an organism able to survive prolonged desiccation and high doses of ionising radiation S. Sommer and M. Toueille; 23. Molecular effects of UV and ionizing radiations on DNA J. Cadet and T. Douki; 24. Molecular adaptations to life at high salt: lessons from Haloarcula marismortui G. Zaccai; Part VII. Traces of Life and Biosignatures: 25. Early life: nature, distribution and evolution F. Westall; 26. Early eukaryotes in precambrian oceans E. Javaux; 27. Biomineralisation mechanisms K. Benzerara and J. Miot; 28. Limits of life and biosphere: lesson from detection of microorganisms in deep sea and deep subsurface in the Earth K. Takai; Part VIII. Life Elsewhere?: 29. Titan and the Cassini-Huygens mission J. Lunine and F. Raulin; 30. The role of terrestrial analogue environments in astrobiology R. Léveillé; Index.

  15. Mariner IV Mission to Mars. Part I

    NASA Technical Reports Server (NTRS)

    James, Jack N.

    1965-01-01

    This technical report is a series of individual papers documenting the Mariner-Mars project from its beginning in 1962 following the successful Mariner-Venus mission. Part I is pre-encounter data. It includes papers on the design, development, and testing of Mariner IV, as well as papers detailing methods of maintaining communication with and obtaining data from the spacecraft during flight, and expected results during encounter with Mars. Part 11, post-encounter data, to be published later, will consist of documentation of the events taking place during Mariner IV's encounter with Mars and thereafter. The Mariner-Mars mission, the culmination of an era of spacecraft development, has contributed much new technology to be used in future projects.

  16. Analytical and Experimental Study to Improve Computer Models for Mixing and Dilution of Soluble Hazardous Chemicals.

    DTIC Science & Technology

    1982-08-01

    Trajectory and Concentration of Various Plumes 59 IV.2 Tank and Cargo Geometry Assumed for Discharge Rate Calculation Using HACS Venting Rate Model 61...Discharge Rate Calculation Using HACS Venting Rate Model 62 IV.4 Original Test Plan for Validation of the Continuous Spill Model 66 IV.5 Final Test Plan...at t= 0. exEyEz = turbulent diffusivities. p = water density. Pc = chemical density. Symbols Used Only in Continuous-Spill Models for a Steady River b

  17. 77 FR 41891 - Airworthiness Directives; Gulfstream Aerospace Corporation Airplanes

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-17

    ....regulations.gov ; or in person at the Docket Management Facility between 9 a.m. and 5 p.m., Monday through... surface (ailerons, rudder, and elevator) and corrective actions if necessary. The customer bulletins also... mils). For Model G-IV airplanes: Gulfstream IV Customer Bulletin 223, including Part I and Part II...

  18. Shunt resistance and saturation current determination in CdTe and CIGS solar cells. Part 2: application to experimental IV measurements and comparison with other methods

    NASA Astrophysics Data System (ADS)

    Rangel-Kuoppa, Victor-Tapio; Albor-Aguilera, María-de-Lourdes; Hérnandez-Vásquez, César; Flores-Márquez, José-Manuel; Jiménez-Olarte, Daniel; Sastré-Hernández, Jorge; González-Trujillo, Miguel-Ángel; Contreras-Puente, Gerardo-Silverio

    2018-04-01

    In this Part 2 of this series of articles, the procedure proposed in Part 1, namely a new parameter extraction technique of the shunt resistance (R sh ) and saturation current (I sat ) of a current-voltage (I-V) measurement of a solar cell, within the one-diode model, is applied to CdS-CdTe and CIGS-CdS solar cells. First, the Cheung method is used to obtain the series resistance (R s ) and the ideality factor n. Afterwards, procedures A and B proposed in Part 1 are used to obtain R sh and I sat . The procedure is compared with two other commonly used procedures. Better accuracy on the simulated I-V curves used with the parameters extracted by our method is obtained. Also, the integral percentage errors from the simulated I-V curves using the method proposed in this study are one order of magnitude smaller compared with the integral percentage errors using the other two methods.

  19. Exploring the Origin of Differential Binding Affinities of Human Tubulin Isotypes αβII, αβIII and αβIV for DAMA-Colchicine Using Homology Modelling, Molecular Docking and Molecular Dynamics Simulations

    PubMed Central

    Panda, Dulal; Kunwar, Ambarish

    2016-01-01

    Tubulin isotypes are found to play an important role in regulating microtubule dynamics. The isotype composition is also thought to contribute in the development of drug resistance as tubulin isotypes show differential binding affinities for various anti-cancer agents. Tubulin isotypes αβII, αβIII and αβIV show differential binding affinity for colchicine. However, the origin of differential binding affinity is not well understood at the molecular level. Here, we investigate the origin of differential binding affinity of a colchicine analogue N-deacetyl-N-(2-mercaptoacetyl)-colchicine (DAMA-colchicine) for human αβII, αβIII and αβIV isotypes, employing sequence analysis, homology modeling, molecular docking, molecular dynamics simulation and MM-GBSA binding free energy calculations. The sequence analysis study shows that the residue compositions are different in the colchicine binding pocket of αβII and αβIII, whereas no such difference is present in αβIV tubulin isotypes. Further, the molecular docking and molecular dynamics simulations results show that residue differences present at the colchicine binding pocket weaken the bonding interactions and the correct binding of DAMA-colchicine at the interface of αβII and αβIII tubulin isotypes. Post molecular dynamics simulation analysis suggests that these residue variations affect the structure and dynamics of αβII and αβIII tubulin isotypes, which in turn affect the binding of DAMA-colchicine. Further, the binding free-energy calculation shows that αβIV tubulin isotype has the highest binding free-energy and αβIII has the lowest binding free-energy for DAMA-colchicine. The order of binding free-energy for DAMA-colchicine is αβIV ≃ αβII >> αβIII. Thus, our computational approaches provide an insight into the effect of residue variations on differential binding of αβII, αβIII and αβIV tubulin isotypes with DAMA-colchicine and may help to design new analogues with higher binding affinities for tubulin isotypes. PMID:27227832

  20. Interconnections of the visual cortex with the frontal cortex in the rat.

    PubMed

    Sukekawa, K

    1988-01-01

    Horseradish peroxidase conjugated to wheat germ agglutinin (WGA-HRP) and autoradiography of tritiated leucine were used to trace the cortical origins and terminations of the connections between the visual and frontal cortices in the rat. Ipsilateral reciprocal connections between each subdivision of the visual cortex (areas 17, 18a and 18b) and the posterior half of the medial part of the frontal agranular cortex (PAGm), and their laminar organizations were confirmed. These connections did not appear to have a significant topographic organization. Although in areas 17 and 18b terminals or cells of origin in this fiber system were confined to the anterior half of these cortices, in area 18a they were observed spanning the anteroposterior extent of this cortex, with in part a column like organization. No evidence could be found for the participation of both the posterior parts of areas 17 and 18b and the anterior half of this frontal agranular cortex in these connections. Fibers from each subdivision of the visual cortex to the PAGm terminated predominantly in the lower part of layer I and in layer II. In area 17, this occipito-frontal projection was found to arise from the scattered pyramidal cells in layer V and more prominently from pyramidal cells in layer V of area 17/18a border. In area 18a, the fibers projecting to the PAGm originated mainly from pyramidal cells primarily in layer V and to a lesser extent in layers II, III and VI. Whereas in area 18b, this projection was found to arise mainly from pyramidal cells in layers II and III, to a lesser extent in layers V and VI, and less frequent in layer IV. On the other hand, the reciprocal projection to the visual cortex was found to originate largely from pyramidal cells in layers III and V of the PAGm. In areas 17 and 18a, these fibers terminated in layers I and VI, and in layers I, V and VI, respectively. Whereas in area 18b, they were distributed throughout all layers except layer II.

  1. 45 CFR 309.150 - What start-up costs are allowable for Tribal IV-D programs carried out under § 309.65(b) of this...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 2 2010-10-01 2010-10-01 false What start-up costs are allowable for Tribal IV-D... ENFORCEMENT (IV-D) PROGRAM Tribal IV-D Program Funding § 309.150 What start-up costs are allowable for Tribal IV-D programs carried out under § 309.65(b) of this part? Federal funds are available for costs of...

  2. 24 CFR Appendix IV to Subpart B of... - Promissory Note for Payment upon Resale by Homebuyer at Profit

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... Turnkey III Program Description Pt. 904, Subpt. B, App. IV Appendix IV to Subpart B of Part 904—Promissory... of (1) the Homeowner's purchase price, (2) the costs incidental to his acquisition of ownership, (3...

  3. 24 CFR Appendix IV to Subpart B of... - Promissory Note for Payment upon Resale by Homebuyer at Profit

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Turnkey III Program Description Pt. 904, Subpt. B, App. IV Appendix IV to Subpart B of Part 904—Promissory... of (1) the Homeowner's purchase price, (2) the costs incidental to his acquisition of ownership, (3...

  4. Cloning and identification of Fv-cmp, a protease from Fusarium verticillioides that truncates Zea mays and Arabidopsis thaliana class IV chitinases

    USDA-ARS?s Scientific Manuscript database

    Chitinase modifying proteins (cmps) are proteases, secreted by fungal pathogens, that were originally identified as proteins that truncate class IV chitinases of maize during ear rot. Cmps from Bipolaris zeicola and Stenocarpella maydis have been characterized, but the identities of the proteases h...

  5. The Factor Structure and Dimensional Scoring of the Generalized Anxiety Disorder Questionnaire for "DSM-IV"

    ERIC Educational Resources Information Center

    Rodebaugh, Thomas L.; Holaway, Robert M.; Heimberg, Richard G.

    2008-01-01

    Despite favorable psychometric properties, the Generalized Anxiety Disorder Questionnaire for the "Diagnostic and Statistical Manual of Mental Disorders" (4th ed.) (GAD-Q-IV) does not have a known factor structure, which calls into question use of its original weighted scoring system (usually referred to as the dimensional score).…

  6. 76 FR 5811 - Adjusted Federal Medical Assistance Percentage (FMAP) Rate for the First Quarter of Fiscal Year...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-02

    .... The increased FMAP is available for expenditures under part E of title IV (including Foster Care... temporary increase in FMAP rates for Medicaid and title IV-E Foster Care, Adoption Assistance and... are not part of the calculation process. Expenditures for which the increased FMAP is not available...

  7. Tin Whisker Risk Assessment of TDRSS IV Transponder Units 101 and 102

    NASA Technical Reports Server (NTRS)

    Zellitti, Ron; Royse, Jeff; Jackson, Steve

    2000-01-01

    This report documents the plating requirements for the electrical and mechanical parts used in the TDRSS IV transponder manufactured by MOTOROLA, INC., SSG, SSSD. The intent of this report is to identify any electrical, electromechanical or mechanical part that does not have adequate requirements to prevent the use of a pure tin finish.

  8. 77 FR 70373 - Cost of Living Adjustment to Satellite Carrier Compulsory License Royalty Rates

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-26

    ... ROYALTY FEES FOR SECONDARY TRANSMISSIONS BY SATELLITE CARRIERS 0 1. The authority citation for part 386... revising paragraphs (b)(1)(iv) and (b)(2)(iv) as follows: Sec. 386.2 Royalty fee for secondary transmission... LIBRARY OF CONGRESS Copyright Royalty Board 37 CFR Part 386 [Docket No. 2012-8 CRB Satellite COLA...

  9. Actively Experiencing Shakespeare: Students "Get on Their Feet" for "Henry IV, Part One."

    ERIC Educational Resources Information Center

    Meyer, Herbert M.; Thomsen, Lee

    1999-01-01

    Discusses how a literature and multimedia course for 11th and 12th graders used active-learning experiences to engage students with Shakespeare's "Henry IV, Part One." Describes how shouting Hal's soliloquy; constructing a chart of character relations; rewriting a scene in their own words; performing, filming, and critiquing a scene; and…

  10. Projects and Programs: Libraries and Learning Resources-1978-1979. Standards ESEA IV, PART B.

    ERIC Educational Resources Information Center

    New York State Education Dept., Albany. Bureau of School Libraries.

    These standards are intended to assist local school districts in New York State in selecting educational resources and audiovisual equipment and in providing for testing, guidance, and counseling services under Title IV, Part B of the Elementary and Secondary Education Act. The main purpose of the standards is to establish qualitative and…

  11. Availability and Use of Medical Isotopes in Canada - Performed as part of a Radiological Terrorism Risk Assessment

    DTIC Science & Technology

    2004-12-01

    placenta localization 1. Chromic chloride 2. Chromium disodium edetate 3. Labeled human serum albumin 4. Sodium chromate labeled red blood cells...orally 4. Iodinated fibrinogen, i.v. or in vitro 5. Iodinated human serum albumin (IHSA) 6. Iodinated levothyroxine , i.v. or in vitro 7...Iodinated liothyronine, in vitro 8. Iodinated povidone, i.v. 9. Iodinated rose Bengal, i.v. 10. Sodium iodide, orally or i.v. 5. 0.74 MBq (0.02 mCi

  12. Radiation preservation of foods of plant origin. Part IV. Subtropical fruits: citrus, grapes, and avocados

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomas, P.

    1986-01-01

    Current information on the use of ionizing radiation for improving the storage of subtropical fruits like citrus, grapes, and avocados is reviewed. The feasibility of applying radiation either alone or in combination with other physical or chemical treatments for the control of postharvest fungal diseases is considered. Irradiation effects on the physiology of the fruits as related to respiration, ethylene evolution, changes in major chemical constituents, and quality are discussed. The recent trends in the possible use of irradiation as an alternative treatment to chemical fumigants for disinfestation of citrus and avocados and the prospects for the future application ofmore » irradiation for preservation of some of these fruits are outlined. 128 references.« less

  13. Development of a Solid Rocket Propellant Nonlinear Constitutive Theory

    DTIC Science & Technology

    1975-05-01

    14 21 29 15 28 27 45 34 44 28 43 22 16 41 lü 40 58 35 57 59 56 23 55 17 54 11 53 36 30 24 18 1? J 6 0.0 0.1 0.2 0.3...Analysis 123 SECTION 6 - TASK IV - FINITE ELEMENT CODE DEMONSTRATION 139 A. Work to be Accomplished 139 B. Original Task IV Effort 139 C. Task IV...Vlscoelastlc Predictions 55 and Fyperimental Data for Sollthane 113 6 Comparison of Linear Vlscoelastlc Predictions 56 and Experimental Data for

  14. Pathological Location of Cranial Nerves in Petroclival Lesions: How to Avoid Their Injury during Anterior Petrosal Approach.

    PubMed

    Borghei-Razavi, Hamid; Tomio, Ryosuke; Fereshtehnejad, Seyed-Mohammad; Shibao, Shunsuke; Schick, Uta; Toda, Masahiro; Yoshida, Kazunari; Kawase, Takeshi

    2016-02-01

    Objectives  Numerous surgical approaches have been developed to access the petroclival region. The Kawase approach, through the middle fossa, is a well-described option for addressing cranial base lesions of the petroclival region. Our aim was to gather data about the variation of cranial nerve locations in diverse petroclival pathologies and clarify the most common pathologic variations confirmed during the anterior petrosal approach. Method  A retrospective analysis was made of both videos and operative and histologic records of 40 petroclival tumors from January 2009 to September 2013 in which the Kawase approach was used. The anatomical variations of cranial nerves IV-VI related to the tumor were divided into several location categories: superior lateral (SL), inferior lateral (IL), superior medial (SM), inferior medial (IM), and encased (E). These data were then analyzed taking into consideration pathologic subgroups of meningioma, epidermoid, and schwannoma. Results  In 41% of meningiomas, the trigeminal nerve is encased by the tumor. In 38% of the meningiomas, the trigeminal nerve is in the SL part of the tumor, and it is in 20% of the IL portion of the tumor. In 38% of the meningiomas, the trochlear nerve is encased by the tumor. The abducens nerve is not always visible (35%). The pathologic nerve pattern differs from that of meningiomas for epidermoid and trigeminal schwannomas. Conclusion  The pattern of cranial nerves IV-VI is linked to the type of petroclival tumor. In a meningioma, tumor origin (cavernous, upper clival, tentorial, and petrous apex) is the most important predictor of the location of cranial nerves IV-VI. Classification of four subtypes of petroclival meningiomas using magnetic resonance imaging is very useful to predict the location of deviated cranial nerves IV-VI intraoperatively.

  15. DIVWAG Model Documentation. Volume II. Programmer/Analyst Manual. Part 4.

    DTIC Science & Technology

    1976-07-01

    Model Constant Data Deck Structure . .. .... IV-13-A-40 Appendix B. Movement Model Program Descriptions . .. .. . .IV-13-B-1 1. Introduction...Data ................ IV-15-A-17 11. Airmobile Constant Data Deck Structure .. ...... .. IV-15-A-30 Appendix B. Airmobile Model Program Descriptions...Make no changes. 12. AIRMOBILE CONSTANT DATA DECK STRUCTURE . The deck structure required by the Airmobile Model constant data load program and the data

  16. [Crops: Classifying, Selecting, Harvesting, Grading, and Packing.] Student Materials. V.A. III. [IV-B-1 through IV-B-2; IV-C-1 through IV-C-2].

    ERIC Educational Resources Information Center

    Texas A and M Univ., College Station. Vocational Instructional Services.

    Part of a series of eight student learning modules in vocational agriculture, this booklet deals with crop-related activities. The first section is on harvesting methods and equipment. The following portions address the handling, grading, and packing of crops; and the classification and selection of fruits, vegetables, and ornamental plants. There…

  17. A 3-tier classification of cerebral arteriovenous malformations. Clinical article.

    PubMed

    Spetzler, Robert F; Ponce, Francisco A

    2011-03-01

    The authors propose a 3-tier classification for cerebral arteriovenous malformations (AVMs). The classification is based on the original 5-tier Spetzler-Martin grading system, and reflects the treatment paradigm for these lesions. The implications of this modification in the literature are explored. Class A combines Grades I and II AVMs, Class B are Grade III AVMs, and Class C combines Grades IV and V AVMs. Recommended management is surgery for Class A AVMs, multimodality treatment for Class B, and observation for Class C, with exceptions to the latter including recurrent hemorrhages and progressive neurological deficits. To evaluate whether combining grades is warranted from the perspective of surgical outcomes, the 3-tier system was applied to 1476 patients from 7 surgical series in which results were stratified according to Spetzler-Martin grades. Pairwise comparisons of individual Spetzler-Martin grades in the series analyzed showed the fewest significant differences (p < 0.05) in outcomes between Grades I and II AVMs and between Grades IV and V AVMs. In the pooled data analysis, significant differences in outcomes were found between all grades except IV and V (p = 0.38), and the lowest relative risks were found between Grades I and II (1.066) and between Grades IV and V (1.095). Using the pooled data, the predictive accuracies for surgical outcomes of the 5-tier and 3-tier systems were equivalent (receiver operating characteristic curve area 0.711 and 0.713, respectively). Combining Grades I and II AVMs and combining Grades IV and V AVMs is justified in part because the differences in surgical results between these respective pairs are small. The proposed 3-tier classification of AVMs offers simplification of the Spetzler-Martin system, provides a guide to treatment, and is predictive of outcome. The revised classification not only simplifies treatment recommendations; by placing patients into 3 as opposed to 5 groups, statistical power is markedly increased for series comparisons.

  18. Helping General Physical Educators and Adapted Physical Educators Address the Office of Civil Rights Dear Colleague Guidance Letter: Part IV--Sport Groups

    ERIC Educational Resources Information Center

    Lieberman, Lauren; Lucas, Mark; Jones, Jeffery; Humphreys, Dan; Cody, Ann; Vaughn, Bev; Storms, Tommie

    2013-01-01

    "Helping General Physical Educators and Adapted Physical Educators Address the Office of Civil Rights Dear Colleague Guidance Letter: Part IV--Sport Groups" provides the the following articles: (1) "Sport Programming Offered by Camp Abilities and the United States Association for Blind Athletes" (Lauren Lieberman and Mark…

  19. Extraction of Carbon Dioxide and Hydrogen from Seawater by an Electrochemical Acidification Cell. Part 4. Electrode Compartments of Cell Modified and Tested in Scaled-Up Mobile Unit

    DTIC Science & Technology

    2013-09-03

    Electrochemical Acidification Cell Part IV: Electrode Compartments of Cell Modified and Tested in Scaled-Up Mobile Unit September 3, 2013 Approved for public...OF ABSTRACT Extraction of Carbon Dioxide and Hydrogen from Seawater by an Electrochemical Acidification Cell Part IV: Electrode Compartments of Cell...Electrochemical acidification cell Carbon dioxide Hydrogen Polarity reversal An electrochemical acidification cell was scaled-up and integrated into a

  20. Concept analysis: lack of anonymity.

    PubMed

    Swan, Marilyn A; Hobbs, Barbara B

    2017-05-01

    To re-examine and expand understanding of the concept 'lack of anonymity' as a component of rural nursing theory. Early healthcare literature reports lack of anonymity as part of social and working environments, particularly rural nursing. Rural nursing theory included the first published concept analysis on lack of anonymity but lacked empirical referents. Workforce, societal and rural healthcare changes support an updated analysis. To further understand lack of anonymity, its present day use and applicability to diverse environments, research from multiple disciplines was reviewed. Concept analysis. A literature search using eight terms in eleven databases was conducted of literature published between 2008-2013. Walker and Avant's concept analysis methodology guided the analysis. The previous concept analysis is supported in part by current literature. The defining attributes, 'identifiable', 'establishing boundaries for public and private self and interconnectedness' in a community were updated. Updated antecedents include: (i) environmental context; (ii) opportunities to become visible; (iii) developing relationships and (iv) unconscious or limited awareness of public or personal privacy. Consequences are: (i) familiarity; (ii) visibility; (iii) awareness of privacy and (iv) manage or balance of lack of anonymity. Cases were constructed and empirical referents identified. The concept of lack of anonymity was updated; portions of the original definition remain unchanged. Empirical referents reveal the defining attributes in daily life and may guide future research on the effect of lack of anonymity on nursing practice. This analysis advances the conceptual understanding of rural nursing theory. © 2016 John Wiley & Sons Ltd.

  1. Original and future cometary orbits. IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marsden, B.G.

    1990-06-01

    The values of the original and future reciprocal semimajor axes are calulcated for 36 recent osculating cometary orbits. The results are compared with the computations of Yabushita and Hasegawa (1989). Adjustments for deriving original and future orbits are given for nine other recent comets for which only parabolic orbit determinations are available. Specific attention is given to the physical comet pair 1987 XXX/1988 III. 15 refs.

  2. Theoretical insights into the origin of magnetic exchange and magnetic anisotropy in {Re(IV)-M(II)} (M = Mn, Fe, Co, Ni and Cu) single chain magnets.

    PubMed

    Singh, Saurabh Kumar; Vignesh, Kuduva R; Archana, Velloth; Rajaraman, Gopalan

    2016-05-10

    Density functional calculations have been performed on a series of {Re(IV)-M(II)} (M = Mn(), Fe(), Co(), Ni(), Cu()) complexes to compute the magnetic exchange interaction between the Re(IV) and M(II) ions, and understand the mechanism of magnetic coupling in this series. DFT calculations yield J values of -5.54 cm(-1), +0.44 cm(-1), +10.5 cm(-1), +4.54 cm(-1) and +19 cm(-1) for complexes respectively, and these estimates are in general agreement with the experimental reports. Using molecular orbital (MO) and overlap integral analysis, we have established a mechanism of coupling for a {3d-5d} pair and the proposed mechanism rationalises both the sign and the magnitude of J values observed in this series. Our proposed mechanism of coupling has five contributing factors: (i) (Re)dyz-dyz(3d) overlap, (ii) (Re)dxz-dxz(3d) overlap, (iii) (Re)dxy-dxy(3d) overlap, (iv) (Re)eg-t2g(3d) overlaps and (v) (Re)eg-eg(3d) overlaps. Here, the first two terms are found to contribute to the antiferromagnetic part of the exchange, while the other three contribute to the ferromagnetic part. The last two terms correspond to the cross-interactions and also contribute to the ferromagnetic part of the exchange. A record high ferromagnetic J value observed for the {Re(IV)-Cu(II)} pair in complex is found to be due to a significant cross interaction between the dz(2) orbital of the Re(IV) ion and the dx(2)-y(2) orbital of the Cu(ii) ion. Magneto-structural correlations are developed for Re-C and M-N bond lengths and Re-C-N and M-N-C bond angles. Among the developed correlations, the M-N-C bond angle is found to be the most sensitive parameter which influences the sign and strength of J values in this series. The J values are found to be more positive (or less negative) as the angle increases, indicating stronger ferromagnetic coupling at linear M-N-C angles. Apart from the magnetic exchange interaction, we have also estimated the magnetic anisotropy of [ReCl4(CN)2](2-) and [(DMF)4(CN)M(II)(CN)] (M(II)-Fe(II), Co(II) and Ni(II)) units using the state-of-the-art ab initio CASSCF/PT2/RASSI-SO/SINGLE_ANISO approach. The calculated D and E values for these building units are found to be in agreement with the available experimental results. Particularly a large positive D computed for the [ReCl4(CN)2](2-) unit was found to arise from dxz/dyz → dxy excitations corresponding to the low-lying doublet states. Similarly, a very large positive D value computed for Fe(II) and Co(II) units are also rationalised based on the corresponding ground state electronic configurations computed. The non-collinearity of the Re(IV) ion and the M(II) ion axial anisotropy (DZZ) axis are found to diminish the anisotropy of the building unit, leading to the observation of moderate relaxation barriers for these molecules.

  3. 34 CFR 602.25 - Due process.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... before an appeals panel that— (i) May not include current members of the agency's decision-making body... decisions: to affirm, amend, or reverse adverse actions of the original decision-making body; and (iv... adverse action is implemented by the appeals panel or by the original decision-making body, at the agency...

  4. 4. Photocopy of photograph, original negative in the possession of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. Photocopy of photograph, original negative in the possession of John R. Morison, Peterborough, New Hampshire. Photographer unknown, 14 September 1888. INSIDE CAISSON PIER IV, 60 FEET BELOW WATER LINE, 25 POUNDS AIR PRESSURE - Sioux City Bridge, Spanning the Missouri River, Sioux City, Woodbury County, IA

  5. A Closer Look at the Alpha Persei Coronal Conundrum

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2017-03-01

    A ROSAT survey of the Alpha Per open cluster in 1993 detected its brightest star, the mid-F supergiant α Persei: the X-ray luminosity and spectral hardness were similar to coronally active late-type dwarf members. Later, in 2010, a Hubble Cosmic Origins Spectrograph SNAPshot of α Per found the far-ultraviolet (FUV) coronal-proxy Si IV unexpectedly weak. This, and a suspicious offset of the ROSAT source, suggested that a late-type companion might be responsible for the X-rays. Recently, a multifaceted program tested that premise. Ground-based optical coronography and near-UV imaging with Hubble Space Telescope (HST) Wide-Field Camera 3 searched for any close-in faint candidate coronal objects, but without success. Then, a Chandra pointing found the X-ray source single and coincident with the bright star. Significantly, the Si IV emissions of α Per, in a deeper FUV spectrum collected by the HST Cosmic Origin Spectrograph as part of the joint program, are aligned well with chromospheric atomic oxygen (which must be intrinsic to the luminous star), within the context of cooler late-F and early-G supergiants, including Cepheid variables. This pointed to the X-rays as the fundamental anomaly. The overluminous X-rays still support the case for a hyperactive dwarf secondary, albeit now spatially unresolved. However, an alternative is that α Per represents a novel class of coronal source. Resolving the first possibility now has become more difficult, because the easy solution—a well-separated companion—has been eliminated. Testing the other possibility will require a broader high-energy census of the early-F supergiants.

  6. NBSGSC - a FORTRAN program for quantitative x-ray fluorescence analysis. Technical note (final)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tao, G.Y.; Pella, P.A.; Rousseau, R.M.

    1985-04-01

    A FORTRAN program (NBSGSC) was developed for performing quantitative analysis of bulk specimens by x-ray fluorescence spectrometry. This program corrects for x-ray absorption/enhancement phenomena using the comprehensive alpha coefficient algorithm proposed by Lachance (COLA). NBSGSC is a revision of the program ALPHA and CARECAL originally developed by R.M. Rousseau of the Geological Survey of Canada. Part one of the program (CALCO) performs the calculation of theoretical alpha coefficients, and part two (CALCOMP) computes the composition of the analyte specimens. The analysis of alloys, pressed minerals, and fused specimens can currently be treated by the program. In addition to using measuredmore » x-ray tube spectral distributions, spectra from seven commonly used x-ray tube targets could also be calculated with an NBS algorithm included in the program. NBSGSC is written in FORTRAN IV for a Digital Equipment Corporation (DEC PDP-11/23) minicomputer using RLO2 firm disks and an RSX 11M operating system.« less

  7. 20 CFR 410.591 - Eligibility for services and supplies under part C of title IV of the act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Payment of... DOL regulations covering the time period in which the miner must file with DOL for these benefits are published at 20 CFR part 725. (Sec. 411, Federal Coal Mine Health and Safety Act of 1969, as amended; 85...

  8. Financial Analysis and Mathematics of Business: Part IV in a Series--Preparation for Certified Professional Secretary Examination. An Instructor's Guide for an Adult Course.

    ERIC Educational Resources Information Center

    Gonyea, Adrian C.

    The instructor's guide provides a review for those preparing to take Part IV of the Certified Professional Secretary (CPS) examination. Course content can also help secretaries update their skills in accounting and business mathematics. Organized into lessons with objectives, content outline, and teaching suggestions and references, the units…

  9. FREQUENCY DEPENDENCE OF POLARIZATION OF ZEBRA PATTERN IN TYPE-IV SOLAR RADIO BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaneda, Kazutaka; Misawa, H.; Tsuchiya, F.

    2015-08-01

    We investigated the polarization characteristics of a zebra pattern (ZP) in a type-IV solar radio burst observed with AMATERAS on 2011 June 21 for the purpose of evaluating the generation processes of ZPs. Analyzing highly resolved spectral and polarization data revealed the frequency dependence of the degree of circular polarization and the delay between two polarized components for the first time. The degree of circular polarization was 50%–70% right-handed and it varied little as a function of frequency. Cross-correlation analysis determined that the left-handed circularly polarized component was delayed by 50–70 ms relative to the right-handed component over the entiremore » frequency range of the ZP and this delay increased with the frequency. We examined the obtained polarization characteristics by using pre-existing ZP models and concluded that the ZP was generated by the double-plasma-resonance process. Our results suggest that the ZP emission was originally generated in a completely polarized state in the O-mode and was partly converted into the X-mode near the source. Subsequently, the difference between the group velocities of the O-mode and X-mode caused the temporal delay.« less

  10. 20 CFR Appendix IV to Subpart C of... - Earnings Needed for a Year of Coverage After 1950

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 1950 IV Appendix IV to Subpart C of Part 404 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Pt. 404... Minimum Social Security Earnings to Qualify for a Year of Coverage After 1950 for Purposes of the— Year...

  11. Engagement of groups in family medicine board maintenance of certification.

    PubMed

    Fisher, Dena M; Brenner, Christopher J; Cheren, Mark; Stange, Kurt C

    2013-01-01

    The American Board of Medical Specialties' Performance in Practice ("Part IV") portion of Maintenance of Certification (MOC) requirement provides an opportunity for practicing physicians to demonstrate quality improvement (QI) competence. However, specialty boards' certification of one physician at a time does not tap into the potential of collective effort. This article shares learning from a project to help family physicians work in groups to meet their Part IV MOC requirement. A year-long implementation and evaluation project was conducted. Initially, 348 members of a regional family physician organization were invited to participate. A second path was established through 3 health care systems and a county-wide learning collaborative. Participants were offered (1) a basic introduction to QI methods, (2) the option of an alternative Part IV MOC module using a patient experience survey to guide QI efforts, (3) practice-level improvement coaching, (4) support for collaboration and co-learning, and (5) provision of QI resources. More physicians participated through group (66) than individual (12) recruitment, for a total of 78 physicians in 20 practices. Participation occurred at 3 levels: individual, intrapractice, and interpractice. Within the 1-year time frame, intrapractice collaboration occurred most frequently. Interpractice and system-level collaboration has begun and continues to evolve. Physicians felt that they benefited from access to a practice coach and group process. Practice-level collaboration, access to a practice coach, flexibility in choosing and focusing improvement projects, tailored support, and involvement with professional affiliations can enhance the Part IV MOC process. Specialty boards are likely to discover productive opportunities from working with practices, professional organizations, and health care systems to support intra- and interpractice collaborative QI work that uses Part IV MOC requirements to motivate practice improvement.

  12. Fitness of the Cosmos for Life

    NASA Astrophysics Data System (ADS)

    Barrow, John D.; Conway Morris, Simon; Freeland, Stephen J.; Harper, Charles L., Jr.

    2012-08-01

    Foreword: The improbability of life George M. Whitesides; Part I. The Fitness of 'Fitness' - Henderson in Context: 1. Locating 'fitness' and Lawrence J. Henderson Everett Mendelsohn; 2. Revisiting The Fitness of the Environment Owen Gingerich; 3. Is fine-tuning remarkable? John F. Haught; 4. Complexity in context: the metaphysical implications of evolutionary theory Edward T. Oakes; 5. Tuning fine-tuning Ernan Mcmullin; Part II. The Fitness of the Cosmic Environment: 6. Fitness and the cosmic environment Paul C. W. Davies; 7. The interconnections between cosmology and life Mario Livio; 8. Chemistry and sensitivity John D. Barrow; 9. Fitness of the cosmos for the origin and evolution of life: from biochemical fine-tuning to the Anthropic Principle Julian Chela-Flores; Part III. The Fitness of the Terrestrial Environment: 10. How biofriendly is the universe? Christian de Duve; 11. Tuning into the frequencies of life: a roar of static or a precise signal? Simon Conway Morris; 12. Life on earth: the role of proteins Jayanth R. Banavar and Amos Maritan; 13. Protein-based life as an emergent property of matter: the nature and biological fitness of the protein folds Michael J. Denton; 14. Could an intelligent alien predict earth's biochemistry? Stephen J. Freeland; 15. Would Venus evolve on Mars? Bioenergetic constraints, allometric trends, and the evolution of life-history invariants Jeffrey P. Schloss; Part IV. The Fitness of the Chemical Environment: 16. Creating a perspective for comparing Albert Eschenmoser; 17. Fine-tuning and interstellar chemistry William Klemperer; 18. Framing the question of fine-tuning for intermediary metabolism Eric Smith and Harold J. Morowitz; 19. Coarse-tuning the origin of life? Guy Ourisson; 20. Plausible lipid-like peptides: prebiotic molecular self-assembly in water Shuguang Zhang; 21. Evolution revisited by inorganic chemists R. J. P. Williams and J. J. R. Fraústo da Silva; Index.

  13. Fitness of the Cosmos for Life

    NASA Astrophysics Data System (ADS)

    Barrow, John D.; Conway Morris, Simon; Freeland, Stephen J.; Harper, Charles L., Jr.

    2007-12-01

    Foreword: The improbability of life George M. Whitesides; Part I. The Fitness of 'Fitness' - Henderson in Context: 1. Locating 'fitness' and Lawrence J. Henderson Everett Mendelsohn; 2. Revisiting The Fitness of the Environment Owen Gingerich; 3. Is fine-tuning remarkable? John F. Haught; 4. Complexity in context: the metaphysical implications of evolutionary theory Edward T. Oakes; 5. Tuning fine-tuning Ernan Mcmullin; Part II. The Fitness of the Cosmic Environment: 6. Fitness and the cosmic environment Paul C. W. Davies; 7. The interconnections between cosmology and life Mario Livio; 8. Chemistry and sensitivity John D. Barrow; 9. Fitness of the cosmos for the origin and evolution of life: from biochemical fine-tuning to the Anthropic Principle Julian Chela-Flores; Part III. The Fitness of the Terrestrial Environment: 10. How biofriendly is the universe? Christian de Duve; 11. Tuning into the frequencies of life: a roar of static or a precise signal? Simon Conway Morris; 12. Life on earth: the role of proteins Jayanth R. Banavar and Amos Maritan; 13. Protein-based life as an emergent property of matter: the nature and biological fitness of the protein folds Michael J. Denton; 14. Could an intelligent alien predict earth's biochemistry? Stephen J. Freeland; 15. Would Venus evolve on Mars? Bioenergetic constraints, allometric trends, and the evolution of life-history invariants Jeffrey P. Schloss; Part IV. The Fitness of the Chemical Environment: 16. Creating a perspective for comparing Albert Eschenmoser; 17. Fine-tuning and interstellar chemistry William Klemperer; 18. Framing the question of fine-tuning for intermediary metabolism Eric Smith and Harold J. Morowitz; 19. Coarse-tuning the origin of life? Guy Ourisson; 20. Plausible lipid-like peptides: prebiotic molecular self-assembly in water Shuguang Zhang; 21. Evolution revisited by inorganic chemists R. J. P. Williams and J. J. R. Fraústo da Silva; Index.

  14. International VLBI Service for Geodesy and Astrometry 2012 Annual Report

    NASA Technical Reports Server (NTRS)

    Baver, Karen D.; Behrend, Dirk; Armstrong, Kyla L.

    2013-01-01

    This volume of reports is the 2012 Annual Report of the International VLBI Service for Geodesy and Astrometry (IVS). The individual reports were contributed by VLBI groups in the international geodetic and astrometric community who constitute the permanent components of IVS. The IVS 2012 Annual Report documents the work of the IVS components for the calendar year 2012, our fourteenth year of existence. The reports describe changes, activities, and progress ofthe IVS. Many thanks to all IVS components who contributed to this Annual Report. With the exception of the first section and parts of the last section (described below), the contents of this Annual Report also appear on the IVS Web site athttp:ivscc.gsfc.nasa.gov/publications/ar2012

  15. Education as Power. Report of Americans for Indian Opportunity Title IV, Part A, Technical Assistance Conference (Albuquerque, New Mexico, October 4-6, 1977).

    ERIC Educational Resources Information Center

    Americans for Indian Opportunity, Inc., Albuquerque, NM.

    Included in this report on the 1977 Title IV Part A Technical Assistance conference held in Albuquerque are: (1) a descriptive narrative of conference events; (2) a summary of the 120 evaluation responses; and (3) the resolutions adopted by conference participants as a specific vehicle to make their concerns known to the Office of Indian Education…

  16. Flight Attendant Fatigue. Part IV. Analysis of Incident Reports

    DTIC Science & Technology

    2009-12-01

    Flight Attendant Fatigue, Part IV: Analysis of Incident Reports Kali Holcomb Katrina Avers Lena Dobbins Joy Banks Lauren Blackwell Thomas Nesthus...Incident Reports 6. Performing Organization Code 7. Author(s) 8. Performing Organization Report No. Holcomb K, Avers K, Dobbins L, Banks J...observed by erC members of the flight attendant ASAP programs, a survey was developed. Surveys were distributed via e -Mail to 23 participants for

  17. Subunit Compositions of the RNA-Silencing Enzymes Pol IV and Pol V Reveal Their Origins as Specialized Forms of RNA Polymerase II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ream, Thomas S.; Haag, J. R.; Wierzbicki, A. T.

    2009-01-30

    In addition to RNA polymerases I, II, and III, the essential RNA polymerases present in all eukaryotes, plants have two additional nuclear RNA polymerases, abbreviated as Pol IV and Pol V, that play nonredundant roles in siRNA-directed DNA methylation and gene silencing. We show that Arabidopsis Pol IV and Pol V are composed of subunits that are paralogous or identical to the 12 subunits of Pol II. Four subunits of Pol IV are distinct from their Pol II paralogs, six subunits of Pol V are distinct from their Pol II paralogs, and four subunits differ between Pol IV and Polmore » V. Importantly, the subunit differences occur in key positions relative to the template entry and RNA exit paths. Our findings support the hypothesis that Pol IV and Pol V are Pol II-like enzymes that evolved specialized roles in the production of noncoding transcripts for RNA silencing and genome defense.« less

  18. 17 CFR Table IV to Subpart E of... - Civil Monetary Penalty Inflation Adjustments

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Civil Monetary Penalty Inflation Adjustments IV Table IV to Subpart E of Part 201 Commodity and Securities Exchanges SECURITIES AND... Securities and Exchange Commission: 15 U.S.C. 77t(d) For natural person 2001 $6,500 $7,500 For any other...

  19. Ultraviolet absorption by highly ionized atoms in the Orion Nebula

    NASA Technical Reports Server (NTRS)

    Franco, J.; Savage, B. D.

    1982-01-01

    The International Ultraviolet Explorer was used to obtain high-resolution, far-UV spectra of theta 1 A, theta 1 C, theta 1 D, and theta 2 A Orionis. The interstellar absorption lines in these spectra are discussed with an emphasis on the high-ionization lines of C IV and Si IV. Theta 2 A Ori has interstellar C IV and Si IV absorption of moderate strength at the velocity found for normal H II region ions. Theta 1 C Ori has very strong interstellar C IV and Si IV absorption at velocities blueshifted by about 25 km/s from that found for the normal H II region ions. The possible origin of the high-ionization lines by three processes is considered: X-ray ionization, collisional ionization, and UV photoionization. It is concluded that the C IV and Si IV ions toward theta 2 A and theta 1 C Ori are likely produced by UV photoionization of surrounding nebular gas. In the case of theta 1 C Ori, the velocity shift of the high-ionization lines may be produced through the acceleration of high-density globules in the core of the nebula by the stellar wind of theta 1 C Ori.

  20. A Data Warehouse to Support Condition Based Maintenance (CBM)

    DTIC Science & Technology

    2005-05-01

    Application ( VBA ) code sequence to import the original MAST-generated CSV and then create a single output table in DBASE IV format. The DBASE IV format...database architecture (Oracle, Sybase, MS- SQL , etc). This design includes table definitions, comments, specification of table attributes, primary and foreign...built queries and applications. Needs the application developers to construct data views. No SQL programming experience. b. Power Database User - knows

  1. Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

    PubMed

    Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

    2005-01-01

    Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

  2. Radiation Monitor,IV-TEPC

    NASA Image and Video Library

    2012-12-30

    View of radiation monitor,Intra-Vehicular Tissue Equivalent Proportional Counter (IV-TEPC),relocated to NOD2 P3,Part Number (P/N): SEG33120960-301,Serial Number (S/N): 1002,in the Node 2. Photo was taken during Expedition 34.

  3. Considerations of Alloy 617 Application in the Gen IV Nuclear Reactor Systems - Part I: Mechanical Property Challenges

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Weiju

    2010-01-01

    Alloy 617 is currently considered as a leading candidate material for high temperature components in the Gen IV Nuclear Reactor Systems. Because of the unprecedented severe working conditions beyond its commercial service experience required by the Gen IV systems, the alloy faces various challenges in both mechanical and metallurgical properties. This paper, as Part I of the discussion, is focused on the challenges and issues in the mechanical properties of Alloy 617 for the intended nuclear application. Considerations are given in details in its mechanical property data scatter, low creep strength in the desired high temperature range, lack of longtermmore » creep curves, high loading rate dependency, and preponderant tertiary creep. Some research and development activities are suggested with discussions on their viability to satisfy the Gen IV Nuclear Reactor System needs in near future and in the long run.« less

  4. The Mediterranean Crucible, 1942-1943: Did Technology or Tenets Achieve Air Superiority

    DTIC Science & Technology

    2012-06-01

    messages of critical Luftwaffe communications. The decryption, analysis, and dissemination of messages from the German Enigma coding machine, facilitated...the ability to “read the Luftwaffe [Enigma] keys in North Africa from the first day of their introduction” in the theater.5 This system, code ...IRIS no. 118168, in USAF Collection, AFHRA, Part IV, 1. 21 AWPD-42, Part IV, 1. superiority which enables its possessor to conduct air

  5. Education as Experimentation: A Planned Variation Model. Volume IV-B: Effects of Follow Through Models. Volume IV-C: Appendices, Part I and Part II.

    ERIC Educational Resources Information Center

    Bock, Geoffrey; And Others

    This segment of the national evaluation study of the Follow Through Planned Variation Model describes each of the 17 models represented in the study and reports the results of analyses of 4 years of student performance data for each model. First a purely descriptive synthesis of findings is presented for each model, with interpretation of the data…

  6. Narrow absorption lines complex I: one form of broad absorption line

    NASA Astrophysics Data System (ADS)

    Lu, Wei-Jian; Lin, Ying-Ru

    2018-03-01

    We discover that some of the broad absorption lines (BALs) are actually a complex of narrow absorption lines (NALs). As a pilot study of this type of BAL, we show this discovery through a typical example in this paper. Utilizing the two-epoch observations of J002710.06-094435.3 (hereafter J0027-0944) from the Sloan Digital Sky Survey (SDSS), we find that each of the C IV and Si IV BAL troughs contains at least four NAL doublets. By resolving the Si IV BAL into multiple NALs, we present the following main results and conclusions. First, all these NALs show coordinated variations between the two-epoch SDSS observations, suggesting that they all originate in the quasar outflow, and that their variations are due to global changes in the ionization condition of the absorbing gas. Secondly, a BAL consisting of a number of NAL components indicates that this type of BAL is basically the same as the intrinsic NAL, which tends to support the inclination model rather than the evolution model. Thirdly, although both the C IV and Si IV BALs originate from the same clumpy substructures of the outflow, they show different profile shapes: multiple absorption troughs for the Si IV BAL in a wider velocity range, while P-Cygni for the C IV BAL in a narrower velocity range. This can be interpreted by the substantial differences in fine structure and oscillator strength between the Si IVλλ1393, 1402 and C IVλλ1548, 1551 doublets. Based on the above conclusions, we consider that the decomposition of a BAL into NALs can serve as a way to resolve the clumpy structure for outflows, and it can be used to learn more about characteristics of the clumpy structure and to test the outflow model, when utilizing high-resolution spectra and photoionization model.

  7. Magnetospheric Accretion in Close Pre-main-sequence Binaries

    NASA Astrophysics Data System (ADS)

    Ardila, David R.; Jonhs-Krull, Christopher; Herczeg, Gregory J.; Mathieu, Robert D.; Quijano-Vodniza, Alberto

    2015-10-01

    The transfer of matter between a circumbinary disk and a young binary system remains poorly understood, obscuring the interpretation of accretion indicators. To explore the behavior of these indicators in multiple systems, we have performed the first systematic time-domain study of young binaries in the ultraviolet. We obtained far- and near-ultraviolet HST/COS spectra of the young spectroscopic binaries DQ Tau and UZ Tau E. Here we focus on the continuum from 2800 to 3200 Å and on the C iv doublet (λλ1548.19, 1550.77 Å) as accretion diagnostics. Each system was observed over three or four consecutive binary orbits, at phases ∼0, 0.2, 0.5, and 0.7. Those observations are complemented by ground-based U-band measurements. Contrary to model predictions, we do not detect any clear correlation between accretion luminosity and phase. Further, we do not detect any correlation between C iv flux and phase. For both stars the appearance of the C iv line is similar to that of single Classical T Tauri Stars (CTTSs), despite the lack of stable long-lived circumstellar disks. However, unlike the case in single CTTSs, the narrow and broad components of the C iv lines are uncorrelated, and we argue that the narrow component is powered by processes other than accretion, such as flares in the stellar magnetospheres and/or enhanced activity in the upper atmosphere. We find that both stars contribute equally to the narrow component C iv flux in DQ Tau, but the primary dominates the narrow component C iv emission in UZ Tau E. The C iv broad component flux is correlated with other accretion indicators, suggesting an accretion origin. However, the line is blueshifted, which is inconsistent with its origin in an infall flow close to the star. It is possible that the complicated geometry of the region, as well as turbulence in the shock region, are responsible for the blueshifted line profiles.

  8. OGLE-IV Transient Search report 31 December 2016, part 1

    NASA Astrophysics Data System (ADS)

    Wyrzykowski, L.; Hamanowicz, A.; Kostrzewa-Rutkowska, Z.; Klencki, J.; Sitek, M.; Udalski, A.; Kozlowski, S.; Ulaczyk, K.; Soszynski, I.; Mroz, P.; Szymanski, M. K.; Poleski, R.; Pietrukowicz, P.; Pawlak, M.; Skowron, J.

    2016-12-01

    The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 52 transients discovered in last three months.

  9. OGLE-IV Transient Search report 31 December 2016, part 2

    NASA Astrophysics Data System (ADS)

    Wyrzykowski, L.; Hamanowicz, A.; Kostrzewa-Rutkowska, Z.; Klencki, J.; Sitek, M.; Udalski, A.; Kozlowski, S.; Ulaczyk, K.; Soszynski, I.; Mroz, P.; Szymanski, M. K.; Poleski, R.; Pietrukowicz, P.; Pawlak, M.; Skowron, J.

    2016-12-01

    The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 46 transients discovered in last three months.

  10. Driver for solar cell I-V characteristic plots

    NASA Technical Reports Server (NTRS)

    Turner, G. B. (Inventor)

    1980-01-01

    A bipolar voltage ramp generator which applies a linear voltage through a resistor to a solar cell for plotting its current versus voltage (I-V) characteristic between short circuit and open circuit conditions is disclosed. The generator has automatic stops at the end points. The resistor serves the multiple purpose of providing a current sensing resistor, setting the full-scale current value, and providing a load line with a slope approximately equal to one, such that it will pass through the origin and the approximate center of the I-V curve with about equal distance from that center to each of the end points.

  11. A Closer Look at the Alpha Persei Coronal Conundrum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ayres, Thomas R., E-mail: Thomas.Ayres@Colorado.edu

    2017-03-01

    A ROSAT survey of the Alpha Per open cluster in 1993 detected its brightest star, the mid-F supergiant α Persei: the X-ray luminosity and spectral hardness were similar to coronally active late-type dwarf members. Later, in 2010, a Hubble Cosmic Origins Spectrograph SNAPshot of α Per found the far-ultraviolet (FUV) coronal-proxy Si iv unexpectedly weak. This, and a suspicious offset of the ROSAT source, suggested that a late-type companion might be responsible for the X-rays. Recently, a multifaceted program tested that premise. Ground-based optical coronography and near-UV imaging with Hubble Space Telescope ( HST ) Wide-Field Camera 3 searched formore » any close-in faint candidate coronal objects, but without success. Then, a Chandra pointing found the X-ray source single and coincident with the bright star. Significantly, the Si iv emissions of α Per, in a deeper FUV spectrum collected by the HST Cosmic Origin Spectrograph as part of the joint program, are aligned well with chromospheric atomic oxygen (which must be intrinsic to the luminous star), within the context of cooler late-F and early-G supergiants, including Cepheid variables. This pointed to the X-rays as the fundamental anomaly. The overluminous X-rays still support the case for a hyperactive dwarf secondary, albeit now spatially unresolved. However, an alternative is that α Per represents a novel class of coronal source. Resolving the first possibility now has become more difficult, because the easy solution—a well-separated companion—has been eliminated. Testing the other possibility will require a broader high-energy census of the early-F supergiants.« less

  12. Colloidal systems and interfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ross, S.; Morrison, E.D.

    1988-01-01

    This book is an excellent, four-part introductory text and sourcebook for those who want to acquire a quick background in , or brush up on, the physical properties and behavior of colloidal dispersions and interfaces. Part I covers properties of particles and techniques for determining particle size and surface area. Part II concentrates on the properties of interfaces, with brief subsections on insoluble monolayers, surface active solutes in aqueous and non-aqueous media, and the thermodynamics of adsorption at interfaces. Part III considers attractive and repulsive interactions, colloid stability (DLVO theory), and kinetics of coagulation. Part IV applies these concepts tomore » emulsions, foams, and suspensions. The sections on colloid rheology, interfacial tensions, Marangoni effects, and calculation of Hamaker constants are particularly good, as are Part IV and the numerous examples of practical applications used throughout the book to illustrate the concepts.« less

  13. Shunt resistance and saturation current determination in CdTe and CIGS solar cells. Part 1: a new theoretical procedure and comparison with other methodologies

    NASA Astrophysics Data System (ADS)

    Rangel-Kuoppa, Victor-Tapio; Albor-Aguilera, María-de-Lourdes; Hérnandez-Vásquez, César; Flores-Márquez, José-Manuel; González-Trujillo, Miguel-Ángel; Contreras-Puente, Gerardo-Silverio

    2018-04-01

    A new proposal for the extraction of the shunt resistance (R sh ) and saturation current (I sat ) of a current-voltage (I-V) measurement of a solar cell, within the one-diode model, is given. First, the Cheung method is extended to obtain the series resistance (R s ), the ideality factor (n) and an upper limit for I sat . In this article which is Part 1 of two parts, two procedures are proposed to obtain fitting values for R sh and I sat within some voltage range. These two procedures are used in two simulated I-V curves (one in darkness and the other one under illumination) to recover the known solar cell parameters R sh , R s , n, I sat and the light current I lig and test its accuracy. The method is compared with two different common parameter extraction methods. These three procedures are used and compared in Part 2 in the I-V curves of CdS-CdTe and CIGS-CdS solar cells.

  14. Origin of terminal voltage variations due to self-mixing in terahertz frequency quantum cascade lasers.

    PubMed

    Grier, Andrew; Dean, Paul; Valavanis, Alexander; Keeley, James; Kundu, Iman; Cooper, Jonathan D; Agnew, Gary; Taimre, Thomas; Lim, Yah Leng; Bertling, Karl; Rakić, Aleksandar D; Li, Lianhe H; Harrison, Paul; Linfield, Edmund H; Ikonić, Zoran; Davies, A Giles; Indjin, Dragan

    2016-09-19

    We explain the origin of voltage variations due to self-mixing in a terahertz (THz) frequency quantum cascade laser (QCL) using an extended density matrix (DM) approach. Our DM model allows calculation of both the current-voltage (I-V) and optical power characteristics of the QCL under optical feedback by changing the cavity loss, to which the gain of the active region is clamped. The variation of intra-cavity field strength necessary to achieve gain clamping, and the corresponding change in bias required to maintain a constant current density through the heterostructure is then calculated. Strong enhancement of the self-mixing voltage signal due to non-linearity of the (I-V) characteristics is predicted and confirmed experimentally in an exemplar 2.6 THz bound-to-continuum QCL.

  15. OGLE-IV Transient Search report 25 September 2017 part 2

    NASA Astrophysics Data System (ADS)

    Wyrzykowski, L.; Gromadzki, M.; Hamanowicz, A.; Rybicki, K.; Klencki, J.; Kozlowski, S.; Udalski, A.; Poleski, R.; Szymanski, M. K.; Skowron, J.; Ulaczyk, K.; Pawlak, M.; Mroz, P.; Soszynski, I.; Pietrukowicz, P.; Sitek, M.; Ihanec, N.

    2017-09-01

    The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 49 new on-going and recently finished transients discovered since Jan 2017.

  16. OGLE-IV Transient Search report 25 September 2017 part 1

    NASA Astrophysics Data System (ADS)

    Wyrzykowski, L.; Gromadzki, M.; Hamanowicz, A.; Rybicki, K.; Klencki, J.; Kozlowski, S.; Udalski, A.; Poleski, R.; Szymanski, M. K.; Skowron, J.; Ulaczyk, K.; Pawlak, M.; Mroz, P.; Soszynski, I.; Pietrukowicz, P.; Sitek, M.; Ihanec, N.

    2017-09-01

    The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 50 new on-going and recently finished transients discovered since Jan 2017.

  17. OSO 8 observations of wave propagation in the solar chromosphere and transition region

    NASA Technical Reports Server (NTRS)

    Chipman, E. G.

    1978-01-01

    The University of Colorado instrument on OSO 8 has been used to observe relative phases of the 300-s intensity variation between the temperature-minimum region and several emission lines formed in the solar chromosphere and chromosphere-corona transition region. The lines used are due to Fe II, Si II, C II, Si IV, and C IV. The scattered light in the spectrograph, which originates almost entirely in the spectral region between 1700 and 1900 A, was used as a probe of the temperature-minimum region. The lines of Fe II, Si II, and C II show almost identical delays of approximately 30 s relative to the temperature minimum, while the intensity oscillations of the lines of Si IV and C IV appear to lead the temperature-minimum intensity oscillations by about 10 s.

  18. An Antarctic hypotrichous ciliate, Parasterkiella thompsoni (Foissner) nov. gen., nov. comb., recorded in Argentinean peat-bogs: morphology, morphogenesis, and molecular phylogeny.

    PubMed

    Küppers, Gabriela Cristina; Paiva, Thiago da Silva; Borges, Bárbara do Nascimento; Harada, Maria Lúcia; Garraza, Gabriela González; Mataloni, Gabriela

    2011-05-01

    The ciliate Parasterkiella thompsoni (Foissner, 1996) nov. gen., nov. comb. was originally described from Antarctica. In the present study, we report the morphology, morphogenesis during cell division, and molecular phylogeny inferred from the 18S-rDNA sequence of a population isolated from the Rancho Hambre peat bog, Tierra del Fuego Province (Argentina). The study is based on live and protargol-impregnated specimens. Molecular phylogeny was inferred from trees constructed by means of the maximum parsimony, neighbor joining, and Bayesian analyses. The interphase morphology matches the original description of the species. During the cell division, stomatogenesis begins with the de novo proliferation of two fields of basal bodies, each one left of the postoral ventral cirri and of transverse cirri, which later unify. Primordia IV-VI of the proter develop from disaggregation of cirrus IV/3, while primordium IV of the opisthe develops from cirrus IV/2 and primordia V and VI from cirrus V/4. Dorsal morphogenesis occurs in the Urosomoida pattern-that is, the fragmentation of kinety 3 is lacking. Three macronuclear nodules are generated before cytokinesis. Phylogenetic analyses consistently placed P. thompsoni within the stylonychines. New data on the morphogenesis of the dorsal ciliature justifies the transference of Sterkiella thompsoni to a new genus Parasterkiella. Copyright © 2011 Elsevier GmbH. All rights reserved.

  19. A Low-metallicity Molecular Cloud in the Lower Galactic Halo

    NASA Astrophysics Data System (ADS)

    Hernandez, Audra K.; Wakker, Bart P.; Benjamin, Robert A.; French, David; Kerp, Juergen; Lockman, Felix J.; O'Toole, Simon; Winkel, Benjamin

    2013-11-01

    We find evidence for the impact of infalling, low-metallicity gas on the Galactic disk. This is based on FUV absorption line spectra, 21 cm emission line spectra, and far-infrared (FIR) mapping to estimate the abundance and physical properties of IV21 (IVC135+54-45), a galactic intermediate-velocity molecular cloud that lies ~300 pc above the disk. The metallicity of IV21 was estimated using observations toward the subdwarf B star PG1144+615, located at a projected distance of 16 pc from the cloud's densest core, by measuring ion and H I column densities for comparison with known solar abundances. Despite the cloud's bright FIR emission and large column densities of molecular gas as traced by CO, we find that it has a sub-solar metallicity of log (Z/Z ⊙) = -0.43 ± 0.12 dex. IV21 is thus the first known sub-solar metallicity cloud in the solar neighborhood. In contrast, most intermediate-velocity clouds (IVC) have near-solar metallicities and are believed to originate in the Galactic Fountain. The cloud's low metallicity is also atypical for Galactic molecular clouds, especially in light of the bright FIR emission which suggest a substantial dust content. The measured I 100 μm/N(H I) ratio is a factor of three below the average found in high latitude H I clouds within the solar neighborhood. We argue that IV21 represents the impact of an infalling, low-metallicity high-velocity cloud that is mixing with disk gas in the lower Galactic halo. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained from MAST at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with program No. 12275. The Green Bank Telescope is part of the National Radio Astronomy Observatory which is a Facility of the National Science Foundation, operated by Associated Universities, Inc.

  20. The Birth of String Theory

    NASA Astrophysics Data System (ADS)

    Cappelli, Andrea; Castellani, Elena; Colomo, Filippo; Di Vecchia, Paolo

    2012-04-01

    Part I. Overview: 1. Introduction and synopsis; 2. Rise and fall of the hadronic string G. Veneziano; 3. Gravity, unification, and the superstring J. H. Schwarz; 4. Early string theory as a challenging case study for philosophers E. Castellani; Part II. The Prehistory: The Analytic S-Matrix: 5. Introduction to Part II; 6. Particle theory in the sixties: from current algebra to the Veneziano amplitude M. Ademollo; 7. The path to the Veneziano model H. R. Rubinstein; 8. Two-component duality and strings P. G. O. Freund; 9. Note on the prehistory of string theory M. Gell-Mann; Part III. The Dual Resonance Model: 10. Introduction to Part III; 11. From the S-matrix to string theory P. Di Vecchia; 12. Reminiscence on the birth of string theory J. A. Shapiro; 13. Personal recollections D. Amati; 14. Early string theory at Fermilab and Rutgers L. Clavelli; 15. Dual amplitudes in higher dimensions: a personal view C. Lovelace; 16. Personal recollections on dual models R. Musto; 17. Remembering the 'supergroup' collaboration F. Nicodemi; 18. The '3-Reggeon vertex' S. Sciuto; Part IV. The String: 19. Introduction to Part IV; 20. From dual models to relativistic strings P. Goddard; 21. The first string theory: personal recollections L. Susskind; 22. The string picture of the Veneziano model H. B. Nielsen; 23. From the S-matrix to string theory Y. Nambu; 24. The analogue model for string amplitudes D. B. Fairlie; 25. Factorization in dual models and functional integration in string theory S. Mandelstam; 26. The hadronic origins of string theory R. C. Brower; Part V. Beyond the Bosonic String: 27. Introduction to Part V; 28. From dual fermion to superstring D. I. Olive; 29. Dual models with fermions: memoirs of an early string theorist P. Ramond; 30. Personal recollections A. Neveu; 31. Aspects of fermionic dual models E. Corrigan; 32. The dual quark models K. Bardakci and M. B. Halpern; 33. Remembering the dawn of relativistic strings J.-L. Gervais; 34. Early string theory in Cambridge: personal recollections C. Montonen; Part VI. The Superstring: 35. Introduction to Part VI; 36. Supersymmetry in string theory F. Gliozzi; 37. Gravity from strings: personal reminiscences of early developments T. Yoneya; 38. From the Nambu-Goto to the σ-model action L. Brink; 39. Locally supersymmetric action for superstring P. Di Vecchia; 40. Personal recollections E. Cremmer; 41. The scientific contributions of Joël Scherk J. H. Schwarz; Part VII. Preparing the String Renaissance: 42. Introduction to Part VII; 43. From strings to superstrings: a personal perspective M. B. Green; 44. Quarks, strings and beyond A. M. Polyakov; 45. The rise of the superstring theory A. Cappelli and F. Colomo; Appendices; Index.

  1. 78 FR 9057 - Medicare Program; Request for Information on the Use of Clinical Quality Measures (CQMs) Reported...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-07

    ... Part II: Lifelong Learning and Self-Assessment Part III: Cognitive Expertise Part IV: Practice...: Licensure and Professional Standing Part II: Lifelong Learning and Self-Assessment Part III: Cognitive...\\ The MOC assesses physicians' commitment to lifelong learning according to the following six core...

  2. 49 CFR 383.113 - Required skills.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

  3. 49 CFR 383.113 - Required skills.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

  4. 49 CFR 383.113 - Required skills.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

  5. 49 CFR 383.113 - Required skills.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

  6. Republication of: Contributions to the theory of gravitational radiation fields. Exact solutions of the field equations of the general theory of relativity V

    NASA Astrophysics Data System (ADS)

    Kundt, Wolfgang; Trümper, Manfred

    2016-04-01

    This is an English translation of a paper by Wolfgang Kundt and Manfred Trümper, first published in 1962 in the proceedings of the Academy of Sciences and Literature in Mainz (Germany). The original paper was the last of a five-part series of articles containing the first summary of knowledge about exact solutions of Einstein's equations found until then. (All the other parts of the series have already been re-published as Golden Oldies.) This fifth contribution summarizes key points of the earlier papers and applies them, in particular results from papers II and IV in the series, in the context of the propagation of gravitational radiation when matter is present. The paper has been selected by the Editors of General Relativity and Gravitation for re-publication in the Golden Oldies series of the journal. This republication is accompanied by an editorial note written by Malcolm A.H. MacCallum and by a brief autobiography of Manfred Trümper.

  7. In vitro antibacterial, antifungal and cytotoxic activities of some triazole Schiff bases and their oxovanadium(IV) complexes.

    PubMed

    Sumrra, Sajjad H; Chohan, Zahid H

    2013-12-01

    The condensation reaction of 3,5-diamino-1,2,4-triazole with methoxy-, chloro-, bromo-, iodo- and nitro-substituted 2-hydroxybenzaldehydes formed triazole Schiff bases (L(1))-(L(6)). The synthesized ligands have been characterized through physical, spectral and analytical data. Furthermore, the reaction of synthesized Schiff bases with the oxovanadium(IV) sulphate in (1:2) (metal:ligand) molar ratio afforded the oxovanadium(IV) complexes (1)-(6). All the complexes were non-electrolytic and showed a square-pyramidal geometry. The synthesized compounds have been screened for in-vitro antibacterial, antifungal and brine shrimp bioassay. The bioactivity data showed the complexes to be more active than the original Schiff bases.

  8. New insights into Trypanosoma cruzi evolution, genotyping and molecular diagnostics from satellite DNA sequence analysis.

    PubMed

    Ramírez, Juan C; Torres, Carolina; Curto, María de Los A; Schijman, Alejandro G

    2017-12-01

    Trypanosoma cruzi has been subdivided into seven Discrete Typing Units (DTUs), TcI-TcVI and Tcbat. Two major evolutionary models have been proposed to explain the origin of hybrid lineages, but while it is widely accepted that TcV and TcVI are the result of genetic exchange between TcII and TcIII strains, the origin of TcIII and TcIV is still a matter of debate. T. cruzi satellite DNA (SatDNA), comprised of 195 bp units organized in tandem repeats, from both TcV and TcVI stocks were found to have SatDNA copies type TcI and TcII; whereas contradictory results were observed for TcIII stocks and no TcIV sequence has been analyzed yet. Herein, we have gone deeper into this matter analyzing 335 distinct SatDNA sequences from 19 T. cruzi stocks representative of DTUs TcI-TcVI for phylogenetic inference. Bayesian phylogenetic tree showed that all sequences were grouped in three major clusters, which corresponded to sequences from DTUs TcI/III, TcII and TcIV; whereas TcV and TcVI stocks had two sets of sequences distributed into TcI/III and TcII clusters. As expected, the lowest genetic distances were found between TcI and TcIII, and between TcV and TcVI sequences; whereas the highest ones were observed between TcII and TcI/III, and among TcIV sequences and those from the remaining DTUs. In addition, signature patterns associated to specific T. cruzi lineages were identified and new primers that improved SatDNA-based qPCR sensitivity were designed. Our findings support the theory that TcIII is not the result of a hybridization event between TcI and TcII, and that TcIV had an independent origin from the other DTUs, contributing to clarifying the evolutionary history of T. cruzi lineages. Moreover, this work opens the possibility of typing samples from Chagas disease patients with low parasitic loads and improving molecular diagnostic methods of T. cruzi infection based on SatDNA sequence amplification.

  9. Genome Wide DNA Methylation Profiles Provide Clues to the Origin and Pathogenesis of Germ Cell Tumors

    PubMed Central

    Rijlaarsdam, Martin A.; Tax, David M. J.; Gillis, Ad J. M.; Dorssers, Lambert C. J.; Koestler, Devin C.; de Ridder, Jeroen; Looijenga, Leendert H. J.

    2015-01-01

    The cell of origin of the five subtypes (I-V) of germ cell tumors (GCTs) are assumed to be germ cells from different maturation stages. This is (potentially) reflected in their methylation status as fetal maturing primordial germ cells are globally demethylated during migration from the yolk sac to the gonad. Imprinted regions are erased in the gonad and later become uniparentally imprinted according to fetal sex. Here, 91 GCTs (type I-IV) and four cell lines were profiled (Illumina’s HumanMethylation450BeadChip). Data was pre-processed controlling for cross hybridization, SNPs, detection rate, probe-type bias and batch effects. The annotation was extended, covering snRNAs/microRNAs, repeat elements and imprinted regions. A Hidden Markov Model-based genome segmentation was devised to identify differentially methylated genomic regions. Methylation profiles allowed for separation of clusters of non-seminomas (type II), seminomas/dysgerminomas (type II), spermatocytic seminomas (type III) and teratomas/dermoid cysts (type I/IV). The seminomas, dysgerminomas and spermatocytic seminomas were globally hypomethylated, in line with previous reports and their demethylated precursor. Differential methylation and imprinting status between subtypes reflected their presumed cell of origin. Ovarian type I teratomas and dermoid cysts showed (partial) sex specific uniparental maternal imprinting. The spermatocytic seminomas showed uniparental paternal imprinting while testicular teratomas exhibited partial imprinting erasure. Somatic imprinting in type II GCTs might indicate a cell of origin after global demethylation but before imprinting erasure. This is earlier than previously described, but agrees with the totipotent/embryonic stem cell like potential of type II GCTs and their rare extra-gonadal localization. The results support the common origin of the type I teratomas and show strong similarity between ovarian type I teratomas and dermoid cysts. In conclusion, we identified specific and global methylation differences between GCT subtypes, providing insight into their developmental timing and underlying developmental biology. Data and extended annotation are deposited at GEO (GSE58538 and GPL18809). PMID:25859847

  10. Organic metamorphism in the California petroleum basins; Chapter A, Rock-Eval and vitrinite reflectance

    USGS Publications Warehouse

    Price, Leigh C.; Pawlewicz, Mark J.; Daws, Ted A.

    1999-01-01

    The results of ROCK-EVAL and vitrinite reflectance analyses of a large sample base from more than 70 wells located in three oil-rich California petroleum basins are reported. The cores from these wells have a wide range of present-day burial temperatures (40 ? to 220 ? C). The rocks in these basins were deposited under highly variable conditions, sometimes resulting in substantially different organic matter (OM) types in rocks tens of meters vertically apart from each other in one well. The kinetic response of these different OM types to equivalent wellknown burial histories is a pivotal point of this study. In the Los Angeles and Ventura Basins, rock organic-richness significantly increased with depth, as did kerogen hydrogen content, and the percentage of fine-grained versus coarsegrained rocks. The shales in these basins are perceived as containing primarily hydrogen-rich amorphous OM. In actuality, the shallowest 2,000 to 3,000 m of rocks in the basins, and at least the upper 6,000 m of rocks in parts of the Los Angeles Basin central syncline, are dominated by type III/IV OM. In the Los Angeles Basin, mainstage hydrocarbon (HC) generation commences in the type III/IV OM at present-day burial temperatures of 85 ? to 110 ? C, most likely around 100 ? C, and is largely complete by 220 ? C. In the Southern San Joaquin Valley Basin, mainstage HC generation commences in type III/IV OM at 150 ? C and is also largely complete by 220 ? C. In the Ventura Basin, mainstage HC generation commences above 140 ? C in type III/IV OM. The apparent lower temperatures for commencement of HC generation in the Los Angeles Basin are attributed to the fact that parts of the basin were cooled from maximal burial temperatures by increased meteoric water flows during the last glaciations. All aspects of organic metamorphism, including mainstage HC generation, are strongly suppressed in rocks with hydrogenrich OM in these basins. For example, ROCK-EVAL data suggest that mainstage HC generation has not commenced in rocks with hydrogen-rich OM at present-day temperatures of 198?C. This observation is attributed to much stronger bonds in hydrogen- rich OM compared to types III and IV OM and, therefore, significantly higher burial temperatures are required to break these bonds. This difference in OM kinetics has profound ramifications for petroleum-geochemical exploration models. Organic-matter characteristics inherited from original depositional conditions were overlaid on, and at times confused interpretation of, characteristics from organic metamorphism in all study areas. In all the basins examined in this study, immature fine-grained rocks occasionally had high to very high carbon-normalized concentrations of pre-generation indigenous bitumen. This unusual characteristic may be due to unique depositional conditions in these basins.

  11. Campaign best practice in intravenous therapy.

    PubMed

    Baldwin, Wayne; Murphy, Jayne; Shakespeare, David; Kelly, Chris; Fox, Louise; Kelly, Matthew

    Intravenous therapy is an integral part of nursing care but is associated with a high risk of infection. This article outlines a campaign that aimed to increase awareness of best practice for IV therapy and reduce the risks of healthcare-associated IV infections in hospital and community settings.

  12. Mapa mondi (Catalan Atlas of 1375), Majorcan cartographic school, and 14th century Asia

    NASA Astrophysics Data System (ADS)

    Lišèák, Vladimír

    2018-05-01

    This paper deals with the Mapa mondi drawn and written in about 1375. It is my starting study about this important map of the medieval period in the Catalan language and the finest work to come from the Majorcan cartographic school of the fourteenth century. The aim of this paper is to give a general overview of the publication with some details on descriptions of the portion of Asia, and in more details as regards China. This map is known also as the Catalan Atlas, because it is composed of several tables sketching out the world known at that time, from the Atlantic Coast of Europe to the Pacific Coast of East Asia. The main sources for the eastern parts of the world were travelogues of Marco Polo, John Mandeville, and Odoric of Pordenone. The presumable author of the Catalan Atlas, Cresques Abra-ham (1325-1387), a Jewish cartographer from Palma, was "master of mappæ mundi and compasses" to Peter IV (III), the King of Aragon. He worked on the atlas with his son Jehudà, who after the Aragonese persecutions of 1391, converted to Christianity. The atlas contained the latest information on Africa, Asia, and China and was considered to be the most complete picture of geographical knowledge as it stood in the later Middle Ages. The translations of original texts and interpretations, based on facsimiles of original source and on secondary sources until 2016, will be a part of this paper.

  13. Analytical Modelling and Optimization of the Temperature-Dependent Dynamic Mechanical Properties of Fused Deposition Fabricated Parts Made of PC-ABS.

    PubMed

    Mohamed, Omar Ahmed; Masood, Syed Hasan; Bhowmik, Jahar Lal

    2016-11-04

    Fused deposition modeling (FDM) additive manufacturing has been intensively used for many industrial applications due to its attractive advantages over traditional manufacturing processes. The process parameters used in FDM have significant influence on the part quality and its properties. This process produces the plastic part through complex mechanisms and it involves complex relationships between the manufacturing conditions and the quality of the processed part. In the present study, the influence of multi-level manufacturing parameters on the temperature-dependent dynamic mechanical properties of FDM processed parts was investigated using IV-optimality response surface methodology (RSM) and multilayer feed-forward neural networks (MFNNs). The process parameters considered for optimization and investigation are slice thickness, raster to raster air gap, deposition angle, part print direction, bead width, and number of perimeters. Storage compliance and loss compliance were considered as response variables. The effect of each process parameter was investigated using developed regression models and multiple regression analysis. The surface characteristics are studied using scanning electron microscope (SEM). Furthermore, performance of optimum conditions was determined and validated by conducting confirmation experiment. The comparison between the experimental values and the predicted values by IV-Optimal RSM and MFNN was conducted for each experimental run and results indicate that the MFNN provides better predictions than IV-Optimal RSM.

  14. Analytical Modelling and Optimization of the Temperature-Dependent Dynamic Mechanical Properties of Fused Deposition Fabricated Parts Made of PC-ABS

    PubMed Central

    Mohamed, Omar Ahmed; Masood, Syed Hasan; Bhowmik, Jahar Lal

    2016-01-01

    Fused deposition modeling (FDM) additive manufacturing has been intensively used for many industrial applications due to its attractive advantages over traditional manufacturing processes. The process parameters used in FDM have significant influence on the part quality and its properties. This process produces the plastic part through complex mechanisms and it involves complex relationships between the manufacturing conditions and the quality of the processed part. In the present study, the influence of multi-level manufacturing parameters on the temperature-dependent dynamic mechanical properties of FDM processed parts was investigated using IV-optimality response surface methodology (RSM) and multilayer feed-forward neural networks (MFNNs). The process parameters considered for optimization and investigation are slice thickness, raster to raster air gap, deposition angle, part print direction, bead width, and number of perimeters. Storage compliance and loss compliance were considered as response variables. The effect of each process parameter was investigated using developed regression models and multiple regression analysis. The surface characteristics are studied using scanning electron microscope (SEM). Furthermore, performance of optimum conditions was determined and validated by conducting confirmation experiment. The comparison between the experimental values and the predicted values by IV-Optimal RSM and MFNN was conducted for each experimental run and results indicate that the MFNN provides better predictions than IV-Optimal RSM. PMID:28774019

  15. 30 CFR 22.11 - Instructions on handling future changes in design.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Certification Center, 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  16. 30 CFR 23.14 - Instructions for handling future changes in design.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original approval and... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  17. 30 CFR 23.14 - Instructions for handling future changes in design.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original approval and... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  18. 30 CFR 22.11 - Instructions on handling future changes in design.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Certification Center, 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  19. 30 CFR 23.14 - Instructions for handling future changes in design.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original approval and... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  20. 30 CFR 22.11 - Instructions on handling future changes in design.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Certification Center, 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  1. 30 CFR 23.14 - Instructions for handling future changes in design.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ..., 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original approval and... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  2. 30 CFR 23.14 - Instructions for handling future changes in design.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original approval and... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  3. 30 CFR 22.11 - Instructions on handling future changes in design.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Certification Center, 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  4. Chromospheric models for Altair (A7 IV-V)

    NASA Technical Reports Server (NTRS)

    Ferrero, R. Freire; Gouttebroze, P.; Catalano, S.; Marilli, E.; Bruhweiler, F.; Kondo, Y.; Van Der Hucht, K.; Talavera, A.

    1995-01-01

    The star, Altair (A7 IV-V), is clearly shown to have Lyman-alpha emission of chromospheric origin, while no evidence is found for the Mg II emission reported in previous investigations. We present non-Local Thermodymanic Equilibrium (non-LTE) semiempirical models incorporating partial redistribution of the chromosphere of Altair that reproduce the observed Lyman-alpha emission and the Mg II resonance absorption at 2800 A. We unambiguously establihed that chromospheres exist at spectral types as early as A7 on the main sequence, and we also demonstrate that it very unlikely that the observed emission originates in a corotating expanding wind. This result represents a new challenge for chromospheric heating theories. It may indicate that both differential rotation and convection layers, at least near the equator, exist in this fast rotating (v sin i = 220 km/s) star.

  5. National Water Infrastructure Adaptation Assessment, Part I: Climate Change Adaptation Readiness Analysis

    EPA Science Inventory

    The report “National Water Infrastructure Adaptation Assessment” is comprised of four parts (Part I to IV), each in an independent volume. The Part I report presented herein describes a preliminary regulatory and technical analysis of water infrastructure and regulations in the ...

  6. Development of a stable low-dose aglycosylated antibody formulation to minimize protein loss during intravenous administration.

    PubMed

    Morar-Mitrica, Sorina; Puri, Manasi; Beumer Sassi, Alexandra; Fuller, Joshua; Hu, Ping; Crotts, George; Nesta, Douglas

    2015-01-01

    The physical and chemical integrity of a biopharmaceutical must be maintained not only during long-term storage but also during administration. Specifically for the intravenous (i.v.) delivery of a protein drug, loss of stability can occur when the protein formulation is compounded with i.v. bag diluents, thus modifying the original composition of the drug product. Here we present the challenges associated with the delivery of a low-dose, highly potent monoclonal antibody (mAb) via the i.v. route. Through parallel in-use stability studies and conventional formulation development, a drug product was developed in which adsorptive losses and critical oxidative degradation pathways were effectively controlled. This development approach enabled the i.v. administration of clinical doses in the range of 0.1 to 0.5 mg total protein, while ensuring liquid drug product storage stability under refrigerated conditions.

  7. Development of a stable low-dose aglycosylated antibody formulation to minimize protein loss during intravenous administration

    PubMed Central

    Morar-Mitrica, Sorina; Puri, Manasi; Beumer Sassi, Alexandra; Fuller, Joshua; Hu, Ping; Crotts, George; Nesta, Douglas

    2015-01-01

    The physical and chemical integrity of a biopharmaceutical must be maintained not only during long-term storage but also during administration. Specifically for the intravenous (i.v.) delivery of a protein drug, loss of stability can occur when the protein formulation is compounded with i.v. bag diluents, thus modifying the original composition of the drug product. Here we present the challenges associated with the delivery of a low-dose, highly potent monoclonal antibody (mAb) via the i.v. route. Through parallel in-use stability studies and conventional formulation development, a drug product was developed in which adsorptive losses and critical oxidative degradation pathways were effectively controlled. This development approach enabled the i.v. administration of clinical doses in the range of 0.1 to 0.5 mg total protein, while ensuring liquid drug product storage stability under refrigerated conditions. PMID:26073995

  8. Spray Drying as a Reliable Route to Produce Metastable Carbamazepine Form IV.

    PubMed

    Halliwell, Rebecca A; Bhardwaj, Rajni M; Brown, Cameron J; Briggs, Naomi E B; Dunn, Jaclyn; Robertson, John; Nordon, Alison; Florence, Alastair J

    2017-07-01

    Carbamazepine (CBZ) is an active pharmaceutical ingredient used in the treatment of epilepsy that can form at least 5 polymorphic forms. Metastable form IV was originally discovered from crystallization with polymer additives; however, it has not been observed from subsequent solvent-only crystallization efforts. This work reports the reproducible formation of phase pure crystalline form IV by spray drying of methanolic CBZ solution. Characterization of the material was carried out using diffraction, scanning electron microscopy, and differential scanning calorimetry. In situ Raman spectroscopy was used to monitor the spray-dried product during the spray drying process. This work demonstrates that spray drying provides a robust method for the production of form IV CBZ, and the combination of high supersaturation and rapid solid isolation from solution overcomes the apparent limitation of more traditional solution crystallization approaches to produce metastable crystalline forms. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Willis Lamb, Jr., the Hydrogen Atom, and the Lamb Shift

    Science.gov Websites

    1955, Lamb won the Nobel Prize in Physics for his discoveries concerning "the fine structure of , May 7 - September 30, 1979 Fine Structure of the Hydrogen Atom, Part I; Part II; Part III; Part IV ; Part V; Part VI (from Physical Review 1950-1953) Microwave Technique for Determining the Fine Structure

  10. Societal cost of subcutaneous and intravenous trastuzumab for HER2-positive breast cancer - An observational study prospectively recording resource utilization in a Swedish healthcare setting.

    PubMed

    Olofsson, Sara; Norrlid, Hanna; Karlsson, Eva; Wilking, Ulla; Ragnarson Tennvall, Gunnel

    2016-10-01

    Trastuzumab is part of the standard treatment for HER2-positive breast cancer. The aim of this study was to estimate the societal value of trastuzumab administered through subcutaneous (SC) injection compared to intravenous (IV) infusion. Female patients with HER2-positive breast cancer receiving SC or IV trastuzumab were consecutively enrolled from five Swedish oncology clinics from 2013 to 2015. Data on time and resource utilization was collected prospectively using patient and nurse questionnaires. Societal costs were calculated by multiplying the resource use by its corresponding unit price, including direct medical costs (pharmaceuticals, materials, nurse time, etc.), direct non-medical costs (transportation) and indirect costs (production loss, lost leisure time). Costs were reported separately for patients receiving trastuzumab for the first time and non-first time ("subsequent treatment"). In total, 101 IV and 94 SC patients were included in the study. The societal costs were lower with SC administration. For subsequent treatments the cost difference was €117 (IV €2099; SC €1983), partly explained by a higher time consumption both for nurses (14 min) and patients (23 min) with IV administration. Four IV and 16 SC patients received trastuzumab for the first time and were analysed separately, resulting in a difference in societal costs of €897 per treatment. A majority of patients preferred SC to IV administration. SC administration resulted in both less direct medical costs and indirect costs, and was consequently less costly than IV administration from a societal perspective in a Swedish setting. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Ancient origin and recent innovations of RNA polymerase IV and V

    DOE PAGES

    Huang, Yi; Kendall, Timmy; Forsythe, Evan S.; ...

    2015-03-12

    Small RNA-mediated chromatin modification is a conserved feature of eukaryotes. In flowering plants, the short interfering (si)RNAs that direct transcriptional silencing are abundant and subfunctionalization has led to specialized machinery responsible for synthesis and action of these small RNAs. In particular, plants possess polymerase (Pol) IV and Pol V, multi-subunit homologs of the canonical DNA-dependent RNA Pol II, as well as specialized members of the RNA-dependent RNA Polymerase (RDR), Dicer-like (DCL), and Argonaute (AGO) families. Together these enzymes are required for production and activity of Pol IV-dependent (p4-)siRNAs, which trigger RNA-directed DNA methylation (RdDM) at homologous sequences. p4-siRNAs accumulate highlymore » in developing endosperm, a specialized tissue found only in flowering plants, and are rare in nonflowering plants, suggesting that the evolution of flowers might coincide with the emergence of specialized RdDM machinery. Through comprehensive identification of RdDM genes from species representing the breadth of the land plant phylogeny, we describe the ancient origin of Pol IV and Pol V, suggesting that a nearly complete and functional RdDM pathway could have existed in the earliest land plants. We also uncover innovations in these enzymes that are coincident with the emergence of seed plants and flowering plants, and recent duplications that might indicate additional subfunctionalization. Phylogenetic analysis reveals rapid evolution of Pol IV and Pol V subunits relative to their Pol II counterparts and suggests that duplicates were retained and subfunctionalized through Escape from Adaptive Conflict. Finally, evolution within the carboxy-terminal domain of the Pol V largest subunit is particularly striking, where illegitimate recombination facilitated extreme sequence divergence.« less

  12. Ancient origin and recent innovations of RNA polymerase IV and V

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Yi; Kendall, Timmy; Forsythe, Evan S.

    Small RNA-mediated chromatin modification is a conserved feature of eukaryotes. In flowering plants, the short interfering (si)RNAs that direct transcriptional silencing are abundant and subfunctionalization has led to specialized machinery responsible for synthesis and action of these small RNAs. In particular, plants possess polymerase (Pol) IV and Pol V, multi-subunit homologs of the canonical DNA-dependent RNA Pol II, as well as specialized members of the RNA-dependent RNA Polymerase (RDR), Dicer-like (DCL), and Argonaute (AGO) families. Together these enzymes are required for production and activity of Pol IV-dependent (p4-)siRNAs, which trigger RNA-directed DNA methylation (RdDM) at homologous sequences. p4-siRNAs accumulate highlymore » in developing endosperm, a specialized tissue found only in flowering plants, and are rare in nonflowering plants, suggesting that the evolution of flowers might coincide with the emergence of specialized RdDM machinery. Through comprehensive identification of RdDM genes from species representing the breadth of the land plant phylogeny, we describe the ancient origin of Pol IV and Pol V, suggesting that a nearly complete and functional RdDM pathway could have existed in the earliest land plants. We also uncover innovations in these enzymes that are coincident with the emergence of seed plants and flowering plants, and recent duplications that might indicate additional subfunctionalization. Phylogenetic analysis reveals rapid evolution of Pol IV and Pol V subunits relative to their Pol II counterparts and suggests that duplicates were retained and subfunctionalized through Escape from Adaptive Conflict. Finally, evolution within the carboxy-terminal domain of the Pol V largest subunit is particularly striking, where illegitimate recombination facilitated extreme sequence divergence.« less

  13. A founder mutation in PET100 causes isolated complex IV deficiency in Lebanese individuals with Leigh syndrome.

    PubMed

    Lim, Sze Chern; Smith, Katherine R; Stroud, David A; Compton, Alison G; Tucker, Elena J; Dasvarma, Ayan; Gandolfo, Luke C; Marum, Justine E; McKenzie, Matthew; Peters, Heidi L; Mowat, David; Procopis, Peter G; Wilcken, Bridget; Christodoulou, John; Brown, Garry K; Ryan, Michael T; Bahlo, Melanie; Thorburn, David R

    2014-02-06

    Leigh syndrome (LS) is a severe neurodegenerative disorder with characteristic bilateral lesions, typically in the brainstem and basal ganglia. It usually presents in infancy and is genetically heterogeneous, but most individuals with mitochondrial complex IV (or cytochrome c oxidase) deficiency have mutations in the biogenesis factor SURF1. We studied eight complex IV-deficient LS individuals from six families of Lebanese origin. They differed from individuals with SURF1 mutations in having seizures as a prominent feature. Complementation analysis suggested they had mutation(s) in the same gene but targeted massively parallel sequencing (MPS) of 1,034 genes encoding known mitochondrial proteins failed to identify a likely candidate. Linkage and haplotype analyses mapped the location of the gene to chromosome 19 and targeted MPS of the linkage region identified a homozygous c.3G>C (p.Met1?) mutation in C19orf79. Abolishing the initiation codon could potentially still allow initiation at a downstream methionine residue but we showed that this would not result in a functional protein. We confirmed that mutation of this gene was causative by lentiviral-mediated phenotypic correction. C19orf79 was recently renamed PET100 and predicted to encode a complex IV biogenesis factor. We showed that it is located in the mitochondrial inner membrane and forms a ∼300 kDa subcomplex with complex IV subunits. Previous proteomic analyses of mitochondria had overlooked PET100 because its small size was below the cutoff for annotating bona fide proteins. The mutation was estimated to have arisen at least 520 years ago, explaining how the families could have different religions and different geographic origins within Lebanon. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. 34 CFR 668.26 - End of an institution's participation in the Title IV, HEA programs.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... institution's students; (2) The institution loses its institutional eligibility under 34 CFR part 600; (3) The...) All financial, performance, and other reports required by appropriate Title IV, HEA program... Aid Report to the institution or when an institution has received a valid institutional student...

  15. 12 CFR Appendix A to Part 1720 - Policy Guidance; Minimum Safety and Soundness Requirements

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... effectively and to model the effect of differing interest rate scenarios on the Enterprise's financial... liquidity under varying scenarios. IV. Information technology. An Enterprise should establish and implement... functions; iv. Adequate testing and review of audited areas together with adequate documentation of findings...

  16. Title IV Indian Education Program Evaluation 1986-87.

    ERIC Educational Resources Information Center

    Albuquerque Public Schools, NM. Planning, Research and Accountability.

    Albuquerque (New Mexico) public schools used a Title IV Part A grant to improve academic and behavioral functioning of American Indian elementary and secondary school students. The program's focus was tutoring provided to 899 Indian students from Canoncito Navajo Reservation, the Isleta Pueblo, and the city. A project coordinator, a resource…

  17. Title IV Indian Education Program Evaluation, 1985-86.

    ERIC Educational Resources Information Center

    Albuquerque Public Schools, NM. Planning, Research and Accountability.

    Public schools in Albuquerque, New Mexico, used a Title IV Part A grant to assist American Indian elementary and secondary school students in receiving passing grades and improving school-related behaviors. Canoncito Navajo Reservation, the Isleta Pueblo, and urban Indian students in Albuquerque participated in the program. Personnel consisted of…

  18. 14 CFR 61.5 - Certificates and ratings issued under this part.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... (iii) Glider. (iv) Lighter-than-air. (v) Powered-lift. (vi) Powered parachute. (vii) Weight-shift...—Airplane. (ii) Instrument—Helicopter. (iii) Instrument—Powered-lift. (c) The following ratings are placed.... (iii) Glider. (iv) Powered-lift. (2) Airplane class ratings— (i) Single-engine. (ii) Multiengine. (3...

  19. 14 CFR 61.5 - Certificates and ratings issued under this part.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    .... (iii) Glider. (iv) Lighter-than-air. (v) Powered-lift. (vi) Powered parachute. (vii) Weight-shift...—Airplane. (ii) Instrument—Helicopter. (iii) Instrument—Powered-lift. (c) The following ratings are placed.... (iii) Glider. (iv) Powered-lift. (2) Airplane class ratings— (i) Single-engine. (ii) Multiengine. (3...

  20. 45 CFR 309.01 - What does this part cover?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... Public Welfare Regulations Relating to Public Welfare OFFICE OF CHILD SUPPORT ENFORCEMENT (CHILD SUPPORT... CHILD SUPPORT ENFORCEMENT (IV-D) PROGRAM Tribal IV-D Program: General Provisions § 309.01 What does this... Social Security Act. Section 455(f) of the Act authorizes direct grants to Indian Tribes and Tribal...

  1. Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

    PubMed

    Wang, Yaqiong; Ma, Hong

    2015-09-01

    Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  2. Mental health symptoms in Iraqi refugees: posttraumatic stress disorder, anxiety, and depression.

    PubMed

    Jamil, Hikmet; Farrag, Mohamed; Hakim-Larson, Julie; Kafaji, Talib; Abdulkhaleq, Husam; Hammad, Adnan

    2007-01-01

    Refugees suffer from a higher rate of mental health symptoms than the general population since they have experienced extreme suffering and the accumulated effects of trauma. Because of the diversity of regions from which refugees originate, there is a need to understand some of the unique experiences that are specific to each sub-groups of immigrants. The purpose of the present study was to explore mental health symptoms in Iraqi refugee clients who immigrated to the United States after the Gulf War of the early 1990's. As part of a larger study, 116 adult Iraqi immigrants to the United States (46 male, 70 females) who were seeking mental health services completed measures of anxiety, depression, and posttraumatic stress disorder. As expected, the majority of refugees reported intense anxiety and depression, and many met the DSM IV criteria for posttraumatic stress disorder. Like refugees from other countries-of-origin, Iraqi refugees are in need of culturally sensitive assessment and mental health treatment. The results are discussed in light of the treatment needs of Iraqi refugee clients, their resilience and motivation for a better life, and the ways that health professionals can assist in optimizing their adjustment.

  3. Characteristic differences in essential oil composition of six Zanthoxylum bungeanum Maxim. (Rutaceae) cultivars and their biological significance.

    PubMed

    Liu, Shu-Ming; Wang, Shi-Jun; Song, Si-Yao; Zou, Yong; Wang, Jun-Ru; Sun, Bing-Yin

    Great variations have been found in composition and content of the essential oil of Zanthoxylum bungeanum Maxim. (Rutaceae), resulting from various factors such as harvest time, drying and extraction methods (Huang et al., 2006; Shao et al., 2013), solvent and herbal parts used (Zhang, 1996; Cao and Zhang, 2010; Wang et al., 2011). However, in terms of artificial introduction and cultivation, there is little research on the chemical composition of essential oil extracted from Z. bungeanum Maxim. cultivars, which have been introduced from different origins. In this study, the composition and content of essential oil from six cultivars (I-VI) have been investigated. They were introduced and cultivated for 11 years in the same cultivation conditions. Cultivars were as followings: Qin'an (I) cultivar originally introduced from Qin'an City in Gansu Province; Dahongpao A (II) from She County in Hebei Province; Dahongpao B (III) from Fuping County; Dahongpao C (IV) from Tongchuan City; Meifengjiao (V) from Feng County; and, Shizitou (VI) from Hancheng City, in Shaanxi Province, China. This research is expected to provide a theoretical basis for further introduction, cultivation, and commercial development of Z. bungeanum Maxim.

  4. Inhibitors of Glioma Growth that Reveal the Tumour to the Immune System

    PubMed Central

    Nieto-Sampedro, Manuel; Valle-Argos, Beatriz; Gómez-Nicola, Diego; Fernández-Mayoralas, Alfonso; Nieto-Díaz, Manuel

    2011-01-01

    Treated glioblastoma patients survive from 6 to 14 months. In the first part of this review, we describe glioma origins, cancer stem cells and the genomic alterations that generate dysregulated cell division, with enhanced proliferation and diverse response to radiation and chemotherapy. We review the pathways that mediate tumour cell proliferation, neo-angiogenesis, tumor cell invasion, as well as necrotic and apoptotic cell death. Then, we examine the ability of gliomas to evade and suppress the host immune system, exhibited at the levels of antigen recognition and immune activation, limiting the effective signaling between glioma and host immune cells. The second part of the review presents current therapies and their drawbacks. This is followed by a summary of the work of our laboratory during the past 20 years, on oligosaccharide and glycosphingolipid inhibitors of astroblast and astrocytoma division. Neurostatins, the O-acetylated forms of gangliosides GD1b and GT1b naturally present in mammalian brain, are cytostatic for normal astroblasts, but cytotoxic for rat C6 glioma cells and human astrocytoma grades III and IV, with ID50 values ranging from 200 to 450 nM. The inhibitors do not affect neurons or fibroblasts up to concentrations of 4 μM or higher. At least four different neurostatin-activated, cell-mediated antitumoral processes, lead to tumor destruction: (i) inhibition of tumor neovascularization; (ii) activation of microglia; (iii) activation of natural killer (NK) cells; (iv) activation of cytotoxic lymphocytes (CTL). The enhanced antigenicity of neurostatin-treated glioma cells, could be related to their increased expression of connexin 43. Because neurostatins and their analogues show specific activity and no toxicity for normal cells, a clinical trial would be the logical next step. PMID:22084619

  5. Theory of Holors

    NASA Astrophysics Data System (ADS)

    Hiram Moon, Parry; Eberle Spencer, Domina

    2005-09-01

    Preface; Nomenclature; Historical introduction; Part I. Holors: 1. Index notation; 2. Holor algebra; 3. Gamma products; Part II. Transformations: 4. Tensors; 5. Akinetors; 6. Geometric spaces; Part III. Holor Calculus: 7. The linear connection; 8. The Riemann-Christoffel tensors; Part IV. Space Structure: 9. Non-Riemannian spaces; 10. Riemannian space; 11. Euclidean space; References; Index.

  6. Behavioral, Neurophysiological, and Synaptic Impairment in a Transgenic Neuregulin1 (NRG1-IV) Murine Schizophrenia Model

    PubMed Central

    Papaleo, Francesco; Yang, Feng; Paterson, Clare; Palumbo, Sara; Carr, Gregory V.; Wang, Yanhong; Floyd, Kirsten; Huang, Wenwei; Thomas, Craig J.; Chen, Jingshan; Weinberger, Daniel R.

    2016-01-01

    Schizophrenia is a chronic, disabling neuropsychiatric disorder with complex genetic origins. The development of strategies for genome manipulation in rodents provides a platform for understanding the pathogenic role of genes and for testing novel therapeutic agents. Neuregulin 1 (NRG1), a critical developmental neurotrophin, is associated with schizophrenia. The NRG1 gene undergoes extensive alternative splicing and, to date, little is known about the neurobiology of a novel NRG1 isoform, NRG1-IV, which is increased in the brains of individuals with schizophrenia and associated with genetic risk variation. Here, we developed a transgenic mouse model (NRG1-IV/NSE-tTA) in which human NRG1-IV is selectively overexpressed in a neuronal specific manner. Using a combination of molecular, biochemical, electrophysiological, and behavioral analyses, we demonstrate that NRG1-IV/NSE-tTA mice exhibit abnormal behaviors relevant to schizophrenia, including impaired sensorimotor gating, discrimination memory, and social behaviors. These neurobehavioral phenotypes are accompanied by increases in cortical expression of the NRG1 receptor, ErbB4 and the downstream signaling target, PIK3-p110δ, along with disrupted dendritic development, synaptic pathology, and altered prefrontal cortical excitatory–inhibitory balance. Pharmacological inhibition of p110δ reversed sensorimotor gating and cognitive deficits. These data demonstrate a novel role for NRG1-IV in learning, memory, and neural circuit formation and a potential neurobiological mechanism for schizophrenia risk; show that deficits are pharmacologically reversible in adulthood; and further highlight p110δ as a target for antipsychotic drug development. SIGNIFICANCE STATEMENT Schizophrenia is a disabling psychiatric disorder with neurodevelopmental origins. Genes that increase risk for schizophrenia have been identified. Understanding how these genes affect brain development and function is necessary. This work is the first report of a newly generated humanized transgenic mouse model engineered to express human NRG1-IV, an isoform of the NRG1 (Neuregulin 1) gene that is increased in the brains of patients with schizophrenia in association with genetic risk. Using behavioral neuroscience, molecular biology, electrophysiology, and pharmacology, we identify a role for NRG1-IV in learning, memory, and cognition and determine that this relates to brain excitatory–inhibitory balance and changes in ErbB4/PI3K/AKT signaling. Moreover, the study further highlights the potential of targeting the PI3K pathway for the treatment of schizophrenia. PMID:27122041

  7. 30 CFR 20.14 - Instructions for handling future changes in lamp design.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., 765 Technology Drive, Triadelphia, WV 26059, requesting an extension of the original approval and... that are critical to the safety of the product; and (iv) All documentation, including drawings and...

  8. Single Crystal Diffractometry

    NASA Astrophysics Data System (ADS)

    Arndt, U. W.; Willis, B. T. M.

    2009-06-01

    Preface; Acknowledgements; Part I. Introduction; Part II. Diffraction Geometry; Part III. The Design of Diffractometers; Part IV. Detectors; Part V. Electronic Circuits; Part VI. The Production of the Primary Beam (X-rays); Part VII. The Production of the Primary Beam (Neutrons); Part VIII. The Background; Part IX. Systematic Errors in Measuring Relative Integrated Intensities; Part X. Procedure for Measuring Integrated Intensities; Part XI. Derivation and Accuracy of Structure Factors; Part XII. Computer Programs and On-line Control; Appendix; References; Index.

  9. [The effects of lesions in the compact part of the substantia nigra on glutamate and GABA release in the pedunculopontine nucleus].

    PubMed

    Blanco-Lezcano, L; Rocha-Arrieta, L L; Alvarez-González, L; Martínez-Martí, L; Pavón-Fuentes, N; González-Fraguela, M E; Bauzá-Calderín, Y; Coro-Grave de Peralta, Y

    The pedunculopontine nucleus (PPN), co-localized with the mesencephalic locomotor region, has been proposed as a key structure in the physiopathology of Parkinson's disease. The goal of the present study was to assess if the aminoacid neurotransmitter release in the PPN is modified by the degeneration of dopaminergic cells, from substantia nigra pars compacta in 6-hydroxidopamine (6-OHDA)-lesioned rats. In addition, it was studied the aminoacid neurotransmitter release in the PPN of rats with lesion of the subthalamic nucleus by quinolinic acid (QUIN) (100 nmol) intracerebral injection. Rats were assigned to five groups: untreated rats (I) (n = 13), 6-OHDA lesion (II) (n = 11), 6-OHDA + QUIN lesion (III) (n = 9), sham-operated (IV) (n = 10), QUIN, STN (V) lesioned (n = 9). The extracellular concentrations of glutamic acid (GLU) and gamma-aminobutyric acid (GABA) were determined by brain microdialysis and high performance liquid chromatography (HPLC). RESULTS. GLU released in PPN from 6-OHDA lesioned rats (group II), was significantly increased in comparison with the others groups (F(4, 47) = 18.21, p < 0.001). GABA released shows significant differences between experimental groups (F(4, 45) = 12.75, p < 0.001). It was detected a higher valour (p < 0.05) in-group II. The groups III and IV exhibited intermeddle valour (p < 0.001) and groups I and IV (p < 0.001) showed the lower GABA extracellular concentrations. The infusion of artificial cerebrospinal fluid with higher potassium (100 mmol) induced an increase in the GLU and GABA released in all groups, which confirm the neuronal origin of the extracellular content. These results are in agreement with the current model of basal ganglia functioning and suggest the role of STN-PPN projection in the physiopathology of Parkinson's disease.

  10. The hallucinogen DOI reduces low-frequency oscillations in rat prefrontal cortex: reversal by antipsychotic drugs.

    PubMed

    Celada, Pau; Puig, M Victoria; Díaz-Mataix, Llorenç; Artigas, Francesc

    2008-09-01

    Perceptual and psychic alterations and thought disorder are fundamental elements of schizophrenia symptoms, a pathology associated with an abnormal macro- and microcircuitry of several brain areas including the prefrontal cortex (PFC). Alterations in information processing in PFC may partly underlie schizophrenia symptoms. The 5-HT(2A/2C) agonist DOI and antipsychotic drugs were administered to anesthetized rats. Single unit and local field potential (LFP) extracellular recordings were made in medial PFC (mPFC). Electrolytic lesions were performed in the thalamic nuclei. DOI markedly disrupts cellular and network activity in rat PFC. DOI altered pyramidal discharge in mPFC (39% excited, 27% inhibited, 34% unaffected; n = 51). In all instances, DOI concurrently reduced low-frequency oscillations (.3-4 Hz; power spectrum: .25 +/- .02 and .14 +/- .01 microV(2) in basal conditions and after 50-300 microg/kg intravenous (i.v.) DOI, respectively; n = 51). Moreover, DOI disrupted the temporal association between the active phase of LFP and pyramidal discharge. Both effects were reversed by M100907 (5-HT(2A) receptor antagonist) and were not attenuated by thalamic lesions, supporting an intracortical origin of the effects of DOI. The reduction in low-frequency oscillations induced by DOI was significantly reversed by the antipsychotic drugs haloperidol (.1-.2 mg/kg i.v.) and clozapine (1 mg/kg i.v.). DOI disorganizes network activity in PFC, reducing low-frequency oscillations and desynchronizing pyramidal discharge from active phases of LFP. These effects may underlie DOI's psychotomimetic action. The reversal by clozapine and haloperidol indicates that antipsychotic drugs may reduce psychotic symptoms by normalizing an altered PFC function.

  11. Structure and U-Pb zircon geochronology of an Alpine nappe stack telescoped by extensional detachment faulting (Kulidzhik area, Eastern Rhodopes, Bulgaria)

    NASA Astrophysics Data System (ADS)

    Georgiev, Neven; Froitzheim, Nikolaus; Cherneva, Zlatka; Frei, Dirk; Grozdev, Valentin; Jahn-Awe, Silke; Nagel, Thorsten J.

    2016-10-01

    The Rhodope Metamorphic Complex is a stack of allochthons assembled during obduction, subduction, and collision processes from Jurassic to Paleogene and overprinted by extensional detachment faults since Middle Eocene. In the study area, the following nappes occur in superposition (from base to top): an orthogneiss-dominated unit (Unit I), garnet-bearing schist with amphibolite and serpentinite lenses (Unit II), greenschist, phyllite, and calcschist with reported Jurassic microfossils (Unit III), and muscovite-rich orthogneiss (Unit IV). U-Pb dating of zircons from a K-feldspar augengneiss (Unit I) yielded a protolith age of ca. 300 Ma. Garnet-bearing metasediment from Unit II yielded an age spectrum with distinct populations between 310 and 250 Ma (detrital), ca. 150 Ma, and ca. 69 Ma (the last two of high-grade metamorphic origin). An orthogneiss from Unit IV yielded a wide spectrum of ages. The youngest population gives a concordia age of 581 ± 5 Ma, interpreted as the age of the granitic protolith. Unit I represents the Lower Allochthon (Byala Reka-Kechros Dome), Unit II the Upper Allochthon (Krumovitsa-Kimi Unit), Unit III the Uppermost Allochthon (Circum-Rhodope Belt), and Unit IV a still higher, far-travelled unit of unknown provenance. Telescoping of the entire Rhodope nappe stack to a thickness of only a few 100 m is due to Late Eocene north directed extensional shearing along the newly defined Kulidzhik Detachment which is part of a major detachment system along the northern border of the Rhodopes. Older top-to-the south mylonites in Unit I indicate that Tertiary extension evolved from asymmetric (top-to-the-south) to symmetric (top-to-the-south and top-to-the-north), bivergent unroofing.

  12. Impacts of fragmented accretion streams onto classical T Tauri stars: UV and X-ray emission lines

    NASA Astrophysics Data System (ADS)

    Colombo, S.; Orlando, S.; Peres, G.; Argiroffi, C.; Reale, F.

    2016-10-01

    Context. The accretion process in classical T Tauri stars (CTTSs) can be studied through the analysis of some UV and X-ray emission lines which trace hot gas flows and act as diagnostics of the post-shock downfalling plasma. In the UV-band, where higher spectral resolution is available, these lines are characterized by rather complex profiles whose origin is still not clear. Aims: We investigate the origin of UV and X-ray emission at impact regions of density structured (fragmented) accretion streams. We study if and how the stream fragmentation and the resulting structure of the post-shock region determine the observed profiles of UV and X-ray emission lines. Methods: We modeled the impact of an accretion stream consisting of a series of dense blobs onto the chromosphere of a CTTS through two-dimensional (2D) magnetohydrodynamic (MHD) simulations. We explored different levels of stream fragmentation and accretion rates. From the model results, we synthesize C IV (1550 Å) and O VIII (18.97 Å) line profiles. Results: The impacts of accreting blobs onto the stellar chromosphere produce reverse shocks propagating through the blobs and shocked upflows. These upflows, in turn, hit and shock the subsequent downfalling fragments. As a result, several plasma components differing for the downfalling velocity, density, and temperature are present altoghether. The profiles of C IV doublet are characterized by two main components: one narrow and redshifted to speed ≈ 50 km s-1 and the other broader and consisting of subcomponents with redshift to speed in the range 200-400 km s-1. The profiles of O VIII lines appear more symmetric than C IV and are redshifted to speed ≈ 150 km s-1. Conclusions: Our model predicts profiles of C IV line remarkably similar to those observed and explains their origin in a natural way as due to stream fragmentation. Movies are available at http://www.aanda.org

  13. On the Origin of Wind Line Variability in O Stars

    NASA Astrophysics Data System (ADS)

    Massa, D.; Prinja, R. K.

    2015-08-01

    We analyze 10 UV time series for five stars that fulfill specific sampling and spectral criteria to constrain the origin of large-scale wind structure in O stars. We argue that excited state lines must arise close to the stellar surface and are an excellent diagnostic complement to resonance lines which, due to radiative transfer effects, rarely show variability at low velocity. Consequently, we splice dynamic spectra of the excited state line N iv λ1718 at low velocity with those of Si iv λ λ 1400 at high velocity in order to examine the temporal evolution of wind line features. These spliced time series reveal that nearly all of the features observed in the time series originate at or very near the stellar surface. Furthermore, we positively identify the observational signature of equatorial corotating interaction regions in two of the five stars and possibly two others. In addition, we see no evidence of features originating further out in the wind. We use our results to confirm the fact that the features seen in dynamic spectra must be huge in order to remain in the line of sight for days, persisting to very large velocity, and that the photospheric footprint of the features must also be quite large, ˜15%-20% of the stellar diameter.

  14. Quantum Field Theory in Curved Spacetime

    NASA Astrophysics Data System (ADS)

    Reynolds, Sally C.; Gallagher, Andrew

    2012-03-01

    List of contributors; Foreword J. T. Francis Thackeray; 1. African genesis: an evolving paradigm Sally C. Reynolds; 2. Academic genealogy Peter Ungar and Phillip V. Tobias; Part I. In Search of Origins: Evolutionary Theory, New Species, and Paths into the Past: 3. Speciation in hominin evolution Colin Groves; 4. Searching for a new paradigm for hominid origins in Chad (Central Africa) Michel Brunet; 5. From hominoid arboreality to hominid bipedalism Brigitte Senut; 6. Orrorin and the African ape/hominid dichotomy Martin Pickford; 7. A brief history and results of 40 years of Sterkfontein excavations Ronald J. Clarke; Part II. Hominin Morphology Through Time: Brains, Bodies and Teeth: 8. Hominin brain evolution, 1925-2011: an emerging overview Dean Falk; 9. The issue of brain reorganisation in Australopithecus and early hominids: Dart had it right Ralph L. Holloway; 10. The mass of the human brain: is it a spandrel? Paul R. Manger, Jason Hemingway, Muhammad Spocter and Andrew Gallagher; 11. Origin and diversity of early hominin bipedalism Henry M. McHenry; 12. Forelimb adaptations in Australopithecus afarensis Michelle S. M. Drapeau; 13. Hominin proximal femur morphology from the Tugen Hills to Flores Brian G. Richmond and William L. Jungers; 14. Daily rates of dentine formation and root extension rates in Paranthropus boisei, KNM-ER 1817, from Koobi Fora, Kenya M. Christopher Dean; 15. On the evolutionary development of early hominid molar teeth and the Gondolin Paranthropus molar Kevin L. Kuykendall; 16. Digital South African fossils: morphological studies using reference-based reconstruction and electronic preparation Gerhard W. Weber, Philipp Gunz, Simon Neubauer, Philipp Mitteroecker and Fred L. Bookstein; Part III. Modern Human Origins: Patterns, and Processes: 17. Body size in African Middle Pleistocene Homo Steven E. Churchill, Lee R. Berger, Adam Hartstone-Rose and Headman Zondo; 18. The African origin of recent humanity Milford H. Wolpoff and Sang-Hee Lee; 19. Assimilation and modern human origins in the African peripheries Fred H. Smith, Vance T. Hutchinson and Ivor Janković; 20. Patterns of Middle Pleistocene hominin evolution in Africa and the emergence of modern humans Emma Mbua and Günter Bräuer; 21. Integration of the genetic, anatomical, and archaeological data for the African origin of modern humans: problems and prospects Osbjorn M. Pearson; Part IV. In Search of Context: Hominin Environments, Behaviour and Lithic Cultures: 22. Animal palaeocommunity variability and habitat preference of robust australopiths in South Africa Darryl J. de Ruiter, Matt Sponheimer and Julia Lee-Thorp; 23. Impacts of environmental change and community ecology on the composition and diversity of the southern African monkey fauna from the Plio-Pleistocene to the present Sarah Elton; 24. African genesis revisited: reflections on Raymond Dart and the 'Predatory Transition from Ape(-Man) to Man' Travis R. Pickering; 25. Shared intention in early artefacts: an exploration of deep structure and implications for communication and language John A. J. Gowlett; 26. Sibudu Cave: recent archaeological work on the Middle Stone Age Lyn Wadley; 27. The oldest burials and their significance Avraham Ronen; Index.

  15. Preliminary Results of Altitude-Wind-Tunnel Investigation of X24C-4B Turbojet Engine. IV - Performance of Modified Compressor. Part 4; Performance of Modified Compressor

    NASA Technical Reports Server (NTRS)

    Thorman, H. Carl; Dupree, David T.

    1947-01-01

    The performance of the 11-stage axial-flow compressor, modified to improve the compressor-outlet velocity, in a revised X24C-4B turbojet engine is presented and compared with the performance of the compressor in the original engine. Performance data were obtained from an investigation of the revised engine in the MACA Cleveland altitude wind tunnel. Compressor performance data were obtained for engine operation with four exhaust nozzles of different outlet area at simulated altitudes from 15,OOO to 45,000 feet, simulated flight Mach numbers from 0.24 to 1.07, and engine speeds from 4000 to 12,500 rpm. The data cover a range of corrected engine speeds from 4100 to 13,500 rpm, which correspond to compressor Mach numbers from 0.30 to 1.00.

  16. Sanity check for NN bound states in lattice QCD with Lüscher's finite volume formula - Disclosing Symptoms of Fake Plateaux -

    NASA Astrophysics Data System (ADS)

    Aoki, Sinya; Doi, Takumi; Iritani, Takumi

    2018-03-01

    The sanity check is to rule out certain classes of obviously false results, not to catch every possible error. After reviewing such a sanity check for NN bound states with the Lüscher's finite volume formula [1-3], we give further evidences for the operator dependence of plateaux, a symptom of the fake plateau problem, against the claim [4]. We then present our critical comments on [5] by NPLQCD: (i) Operator dependences of plateaux in NPL2013 [6, 7] exist with the P value of 4-5%. (ii) The volume independence of plateaux in NPL2013 does not prove their correctness. (iii) Effective range expansions (EREs) in NPL2013 violate the physical pole condition. (iv) Their comment is partly based on new data and analysis different from the original ones. (v) Their new ERE does not satisfy the Lüscher's finite volume formula.

  17. Virological Surveillance of Influenza A Subtypes Isolated in 2014 from Clinical Outbreaks in Canadian Swine

    PubMed Central

    Grgić, Helena; Gallant, Jackie; Poljak, Zvonimir

    2017-01-01

    Influenza A viruses (IAVs) are respiratory pathogens associated with an acute respiratory disease that occurs year-round in swine production. It is currently one of the most important pathogens in swine populations, with the potential to infect other host species including humans. Ongoing research indicates that the three major subtypes of IAV—H1N1, H1N2, and H3N2—continue to expand in their genetic and antigenic diversity. In this study, we conducted a comprehensive genomic analysis of 16 IAVs isolated from different clinical outbreaks in Alberta, Manitoba, Ontario, and Saskatchewan in 2014. We also examined the genetic basis for probable antigenic differences among sequenced viruses. On the basis of phylogenetic analysis, all 13 Canadian H3N2 viruses belonged to cluster IV, eight H3N2 viruses were part of the IV-C cluster, and one virus belonged to the IV-B and one to the IV-D cluster. Based on standards used in this study, three H3N2 viruses could not be clearly classified into any currently established group within cluster IV (A to F). Three H1N2 viruses were part of the H1α cluster. PMID:28335552

  18. 45 CFR 305.61 - Penalty for failure to meet IV-D requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... HEALTH AND HUMAN SERVICES PROGRAM PERFORMANCE MEASURES, STANDARDS, FINANCIAL INCENTIVES, AND PENALTIES § 305.61 Penalty for failure to meet IV-D requirements. (a) A State will be subject to a financial... order establishment and current collections performance measures as set forth in § 305.40 of this part...

  19. 20 CFR 410.702 - Definitions and terms.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black... shall apply with regard to review under this subpart G. (a) Denied claim defined. Denied claim means: (1) Any claim that was filed with the Social Security Administration under part B of title IV of the Act...

  20. 20 CFR 410.702 - Definitions and terms.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black... shall apply with regard to review under this subpart G. (a) Denied claim defined. Denied claim means: (1) Any claim that was filed with the Social Security Administration under part B of title IV of the Act...

  1. The Planning of Change. Third Edition.

    ERIC Educational Resources Information Center

    Bennis, Warren G., Ed.; And Others

    This collection of essays discusses some of the models employed in the analysis of change processes. Part I provides a history of strategies for social change. Part II explores the meaning and use of systems models used to diagnose change situations. Part III deals with the intervention modes, and Part IV explores the dilemmas confronted by agents…

  2. Neurons of human nucleus accumbens.

    PubMed

    Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

    2011-08-01

    Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

  3. Assessing the Impact of Drug Use on Hospital Costs

    PubMed Central

    Stuart, Bruce C; Doshi, Jalpa A; Terza, Joseph V

    2009-01-01

    Objective To assess whether outpatient prescription drug utilization produces offsets in the cost of hospitalization for Medicare beneficiaries. Data Sources/Study Setting The study analyzed a sample (N=3,101) of community-dwelling fee-for-service U.S. Medicare beneficiaries drawn from the 1999 and 2000 Medicare Current Beneficiary Surveys. Study Design Using a two-part model specification, we regressed any hospital admission (part 1: probit) and hospital spending by those with one or more admissions (part 2: nonlinear least squares regression) on drug use in a standard model with strong covariate controls and a residual inclusion instrumental variable (IV) model using an exogenous measure of drug coverage as the instrument. Principal Findings The covariate control model predicted that each additional prescription drug used (mean=30) raised hospital spending by $16 (p<.001). The residual inclusion IV model prediction was that each additional prescription fill reduced hospital spending by $104 (p<.001). Conclusions The findings indicate that drug use is associated with cost offsets in hospitalization among Medicare beneficiaries, once omitted variable bias is corrected using an IV technique appropriate for nonlinear applications. PMID:18783453

  4. Photographic copy of circa, 1934 black and white photograph. Loose ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of circa, 1934 black and white photograph. Loose in oversized box located at the National Museum of American History, Smithsonian Institution, Archives Center, Work and Industry Division, Washington, D.C. Original Photographer unknown. VIEW FROM EAST BANK LOOKING SOUTH TOWARD WEST BANK AT BRIDGE UNDER CONSTRUCTION SHOWING COMPLETED THROUGH TRUSS SPAN BETWEEN PIER III AND IV AND THE UNCOMPLETED DECK TRUSS SPAN BETWEEN PIER IV AND V. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  5. Validation of a Spanish-language version of the ADHD Rating Scale IV in a Spanish sample.

    PubMed

    Vallejo-Valdivielso, M; Soutullo, C A; de Castro-Manglano, P; Marín-Méndez, J J; Díez-Suárez, A

    2017-07-14

    The purpose of this study is to validate a Spanish-language version of the 18-item ADHD Rating Scale-IV (ADHD-RS-IV.es) in a Spanish sample. From a total sample of 652 children and adolescents aged 6 to 17 years (mean age was 11.14±3.27), we included 518 who met the DSM-IV-TR criteria for ADHD and 134 healthy controls. To evaluate the factorial structure, validity, and reliability of the scale, we performed a confirmatory factor analysis (CFA) using structural equation modelling on a polychoric correlation matrix and maximum likelihood estimation. The scale's discriminant validity and predictive value were estimated using ROC (receiver operating characteristics) curve analysis. Both the full scale and the subscales of the Spanish-language version of the ADHD-RS-IV showed good internal consistency. Cronbach's alpha was 0.94 for the full scale and ≥ 0.90 for the subscales, and ordinal alpha was 0.95 and ≥ 0.90, respectively. CFA showed that a two-factor model (inattention and hyperactivity/impulsivity) provided the best fit for the data. ADHD-RS-IV.es offered good discriminant ability to distinguish between patients with ADHD and controls (AUC=0.97). The two-factor structure of the Spanish-language version of the ADHD-RS-IV (ADHD-RS-IV.es) is consistent with those of the DSM-IV-TR and DSM-5 as well as with the model proposed by the author of the original scale. Furthermore, it has good discriminant ability. ADHD-RS-IV.es is therefore a valid and reliable tool for determining presence and severity of ADHD symptoms in the Spanish population. Copyright © 2017 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  6. Clinical and Electrocardiographic Characteristics of Electrical Storms Due to Monomorphic Ventricular Tachycardia Refractory to Intravenous Amiodarone.

    PubMed

    Murata, Hiroshige; Miyauchi, Yasushi; Hayashi, Meiso; Iwasaki, Yu-Ki; Yodogawa, Kenji; Ueno, Akira; Hayashi, Hiroshi; Tsuboi, Ippei; Uetake, Shunsuke; Takahashi, Kenta; Yamamoto, Teppei; Maruyama, Mitsunori; Akutsu, Koichi; Yamamoto, Takeshi; Kobayashi, Yoshinori; Tanaka, Keiji; Atarashi, Hirotsugu; Katoh, Takao; Shimizu, Wataru

    2015-01-01

    Few reports are available on the characteristics of electrical storms of ventricular tachycardia (VT storm) refractory to intravenous (IV) amiodarone. IV-amiodarone was administered to 60 patients with ventricular tachyarrhythmia between 2007 and 2012. VT storms, defined as 3 or more episodes of VT within 24 h, occurred in 30 patients (68±12 years, 7 female), with 12 having ischemic and 18 non-ischemic heart disease. We compared the clinical and electrocardiographic characteristics of the patients with VT storms suppressed by IV-amiodarone (Effective group) to those of patients not affected by the treatment (Refractory group). IV-amiodarone could not control recurrence of VT in 9 patients (30%). The Refractory group comprised 5 patients with acute myocardial infarctions. Although there was no difference in the VT cycle length, the QRS duration of both the VT and premature ventricular contractions (PVCs) followed by VT was narrower in the Refractory group than in the Effective group (140±30 vs. 178±25 ms, P<0.01; 121±14 vs. 179±22 ms, P<0.01). In the Refractory group, additional administration of IV-mexiletine and/or Purkinje potential-guided catheter ablation was effective. IV-amiodarone-refractory VT exhibited a relatively narrow QRS tachycardia. The narrow triggering PVCs, suggesting a Purkinje fiber origin, may be treated by additional IV-mexiletine and endocardial catheter ablation.

  7. Approximate entropy of human respiratory movement during eye-closed waking and different sleep stages.

    PubMed

    Burioka, Naoto; Cornélissen, Germaine; Halberg, Franz; Kaplan, Daniel T; Suyama, Hisashi; Sako, Takanori; Shimizu, Eiji

    2003-01-01

    The breath-to-breath variability of respiratory parameters changes with sleep stage. This study investigates any alteration in the approximate entropy (ApEn) of respiratory movement as a gauge of complexity in respiration, by stage of consciousness, in the light of putative brain interactions. Eight healthy men, who were between the ages of 23 and 29 years, were investigated. The signals of chest wall movement and EEG were recorded from 10:30 PM to 6:00 AM. After analog-to-digital conversion, the ApEn of respiratory movement (3 min) and EEG (20 s) were computed. Surrogate data were tested for nonlinearity in the original time series. The most impressive reduction in the ApEn of respiratory movement was associated with stage IV sleep, when the ApEn of the EEG was also statistically significantly decreased. A statistically significant linear relation is found between the ApEn of both variables. Surrogate data indicated that respiratory movement had nonlinear properties during all stages of consciousness that were investigated. Respiratory movement and EEG signals are more regular during stage IV sleep than during other stages of consciousness. The change in complexity described by the ApEn of respiration depends in part on the ApEn of the EEG, suggesting the involvement of nonlinear dynamic processes in the coordination between brain and lungs.

  8. 48 CFR 47.303-5 - F.o.b. origin, with differentials.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ..., within reach of the ship's loading tackle, when the shipping point is within a port area having water transportation service) or the carrier's freight station; (iii) To a U.S. Postal Service facility; or (iv) If...

  9. 48 CFR 47.303-5 - F.o.b. origin, with differentials.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ..., within reach of the ship's loading tackle, when the shipping point is within a port area having water transportation service) or the carrier's freight station; (iii) To a U.S. Postal Service facility; or (iv) If...

  10. 48 CFR 47.303-5 - F.o.b. origin, with differentials.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ..., within reach of the ship's loading tackle, when the shipping point is within a port area having water transportation service) or the carrier's freight station; (iii) To a U.S. Postal Service facility; or (iv) If...

  11. 48 CFR 47.303-5 - F.o.b. origin, with differentials.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ..., within reach of the ship's loading tackle, when the shipping point is within a port area having water transportation service) or the carrier's freight station; (iii) To a U.S. Postal Service facility; or (iv) If...

  12. 45 CFR 301.0 - Scope and applicability of this part.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    .... This part deals with the administration of title IV-D of the Social Security Act by the Federal... under the approved plan; review and audit of State and local expenditures; and reconsideration of...

  13. Ideas for Refining Children's Savings Account Proposals. Creating a Financial Stake in College: Report IV of IV

    ERIC Educational Resources Information Center

    Elliott, William, III

    2012-01-01

    "Creating a Financial Stake in College" is a four-part series of reports that focuses on the relationship between children's savings and improving college success. This series examines: (1) why policymakers should care about savings, (2) the relationship between inequality and bank account ownership, (3) the connections between savings…

  14. 45 CFR 309.145 - What costs are allowable for Tribal IV-D programs carried out under § 309.65(a) of this part?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    .... (h) Automated data processing computer systems, including: (1) Planning efforts in the identification, evaluation, and selection of an automated data processing computer system solution meeting the program... existing automated data processing computer system to support Tribal IV-D program operations, and...

  15. 45 CFR 309.145 - What costs are allowable for Tribal IV-D programs carried out under § 309.65(a) of this part?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    .... (h) Automated data processing computer systems, including: (1) Planning efforts in the identification, evaluation, and selection of an automated data processing computer system solution meeting the program... existing automated data processing computer system to support Tribal IV-D program operations, and...

  16. 45 CFR 309.145 - What costs are allowable for Tribal IV-D programs carried out under § 309.65(a) of this part?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    .... (h) Automated data processing computer systems, including: (1) Planning efforts in the identification, evaluation, and selection of an automated data processing computer system solution meeting the program... existing automated data processing computer system to support Tribal IV-D program operations, and...

  17. 45 CFR 309.145 - What costs are allowable for Tribal IV-D programs carried out under § 309.65(a) of this part?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    .... (h) Automated data processing computer systems, including: (1) Planning efforts in the identification, evaluation, and selection of an automated data processing computer system solution meeting the program... existing automated data processing computer system to support Tribal IV-D program operations, and...

  18. 45 CFR 309.145 - What costs are allowable for Tribal IV-D programs carried out under § 309.65(a) of this part?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    .... (h) Automated data processing computer systems, including: (1) Planning efforts in the identification, evaluation, and selection of an automated data processing computer system solution meeting the program... existing automated data processing computer system to support Tribal IV-D program operations, and...

  19. 14 CFR Appendix A to Part 43 - Major Alterations, Major Repairs, and Preventive Maintenance

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... hub design. (iii) Changes in the governor or control design. (iv) Installation of a propeller governor.... (iv) Engine mounts. (v) Control system. (vi) Landing gear. (vii) Hull or floats. (viii) Elements of an... of gravity limits of the aircraft. (xii) Changes to the basic design of the fuel, oil, cooling...

  20. Printed-Circuit-Board Soldering Training for Group IV Personnel.

    ERIC Educational Resources Information Center

    Hooprich, E. A.; Matlock, E. W.

    As part of a larger program to determine which Navy skills can be learned by lower aptitude personnel, and which methods and techniques would be most effective, an experimental course in printed circuit board soldering was given to 186 Group IV students in 13 classes. Two different training approaches--one stressing instructor guidance and the…

  1. Feature Extraction and Classification of Magnetic and EMI Data, Camp Beale, CA

    DTIC Science & Technology

    2012-05-01

    and non-specialists. However, as part of ESTCP 1004 we are presently working on transitioning our inversion algorithms to an API that will be...10 0 Time (ms) Cell 663 - Target 1965 - Model 1 (SOI) ISO IVS 0.001 0.005 10 0 Time (ms) Cell 1104 - Target 2532 - Model 1 (SOI) ISO IVS...0.0 1 0.005 10 0 Time (ms) Cell 663 - Target 1965 - Model 1 (SOI) ISO IVS 0.0 1 0.005 10 0 Time (ms) Cell 1104 - Target 2532 - Model 1 (SOI

  2. A Deep Search for Faint Galaxies Associated with Very Low Redshift C IV Absorbers. III. The Mass- and Environment-dependent Circumgalactic Medium

    NASA Astrophysics Data System (ADS)

    Burchett, Joseph N.; Tripp, Todd M.; Bordoloi, Rongmon; Werk, Jessica K.; Prochaska, J. Xavier; Tumlinson, Jason; Willmer, C. N. A.; O'Meara, John; Katz, Neal

    2016-12-01

    Using Hubble Space Telescope Cosmic Origins Spectrograph observations of 89 QSO sightlines through the Sloan Digital Sky Survey footprint, we study the relationships between C IV absorption systems and the properties of nearby galaxies, as well as the large-scale environment. To maintain sensitivity to very faint galaxies, we restrict our sample to 0.0015\\lt z\\lt 0.015, which defines a complete galaxy survey to L≳ 0.01 L\\ast or stellar mass {M}* ≳ {10}8 {M}⊙ . We report two principal findings. First, for galaxies with impact parameter ρ \\lt 1 {r}{vir}, C IV detection strongly depends on the luminosity/stellar mass of the nearby galaxy. C IV is preferentially associated with galaxies with {M}* \\gt {10}9.5 {M}⊙ ; lower-mass galaxies rarely exhibit significant C IV absorption (covering fraction {f}C={9}-6+12 % for 11 galaxies with {M}* \\lt {10}9.5 {M}⊙ ). Second, C IV detection within the {M}* \\gt {10}9.5 {M}⊙ population depends on environment. Using a fixed-aperture environmental density metric for galaxies with ρ < 160 kpc at z\\lt 0.055, we find that {57}-13+12 % (8/14) of galaxies in low-density regions (regions with fewer than seven L\\gt 0.15 L\\ast galaxies within 1.5 Mpc) have affiliated C IV absorption; however, none (0/7) of the galaxies in denser regions show C IV. Similarly, the C IV detection rate is lower for galaxies residing in groups with dark matter halo masses of {M}{halo}\\gt {10}12.5 {M}⊙ . In contrast to C IV, H I is pervasive in the circumgalactic medium without regard to mass or environment. These results indicate that C IV absorbers with {log} N({{C}} {{IV}})≳ 13.5 {{cm}}-2 trace the halos of {M}* \\gt {10}9.5 {M}⊙ galaxies but also reflect larger-scale environmental conditions.

  3. A Global Photoionization Response to Prompt Emission and Outliers: Different Origin of Long Gamma-ray Bursts?

    NASA Astrophysics Data System (ADS)

    Wang, J.; Xin, L. P.; Qiu, Y. L.; Xu, D. W.; Wei, J. Y.

    2018-03-01

    By using the line ratio C IV λ1549/C II λ1335 as a tracer of the ionization ratio of the interstellar medium (ISM) illuminated by a long gamma-ray burst (LGRB), we identify a global photoionization response of the ionization ratio to the photon luminosity of the prompt emission assessed by either L iso/E peak or {L}iso}/{E}peak}2. The ionization ratio increases with both L iso/E peak and L iso/E 2 peak for a majority of the LGRBs in our sample, although there are a few outliers. The identified dependence of C IV/C II on {L}iso}/{E}peak}2 suggests that the scatter of the widely accepted Amati relation is related to the ionization ratio in the ISM. The outliers tend to have relatively high C IV/C II values as well as relatively high C IV λ1549/Si IV λ1403 ratios, which suggests an existence of Wolf–Rayet stars in the environment of these LGRBs. We finally argue that the outliers and the LGRBs following the identified C IV/C II‑L iso/E peak ({L}iso}/{E}peak}2) correlation might come from different progenitors with different local environments.

  4. Primary Education in Pakistan. Part IV. Annexes to the Analysis.

    ERIC Educational Resources Information Center

    Development Associates, Inc., Arlington, VA.

    The fourth part of a four-part analysis and assessment of Pakistan's system of primary education presents annexes to the analysis that was reported in the second part of the overall report. Five annexes are included: (A) Acronyms; (B) Scope of Work; (C) Persons Interviewed; (D) Chapter Annexes; and (E) Bibliography. A number of charts and diagrams…

  5. Electron transport characteristics of silicon nanowires by metal-assisted chemical etching

    NASA Astrophysics Data System (ADS)

    Qi, Yangyang; Wang, Zhen; Zhang, Mingliang; Wang, Xiaodong; Ji, An; Yang, Fuhua

    2014-03-01

    The electron transport characteristics of silicon nanowires (SiNWs) fabricated by metal-assisted chemical etching with different doping concentrations were studied. By increasing the doping concentration of the starting Si wafer, the resulting SiNWs were prone to have a rough surface, which had important effects on the contact and the electron transport. A metal-semiconductor-metal model and a thermionic field emission theory were used to analyse the current-voltage (I-V) characteristics. Asymmetric, rectifying and symmetric I-V curves were obtained. The diversity of the I-V curves originated from the different barrier heights at the two sides of the SiNWs. For heavily doped SiNWs, the critical voltage was one order of magnitude larger than that of the lightly doped, and the resistance obtained by differentiating the I-V curves at large bias was also higher. These were attributed to the lower electron tunnelling possibility and higher contact barrier, due to the rough surface and the reduced doping concentration during the etching process.

  6. Going Digital - The Transition from Mark IV to DBBC at Onsala

    NASA Astrophysics Data System (ADS)

    Kareinen, Niko; Haas, Rüdiger; La Porta, Laura; Bertarini, Alessandra

    2014-12-01

    The Onsala Space Observatory is currently equipped with both a VLBI Mark IV rack and a digital BBC (DBBC). The Mark IV rack at Onsala has been used operationally for both astronomical and geodetic VLBI for more than 40 years. In 2011, Onsala purchased a DBBC and we started to test it and to gain experience with the new device, both for astronomical and geodetic VLBI. The DBBC was upgraded several times and the Field System (FS) interface was implemented. We did parallel recordings, with both the old Mark IV/Mark 5A system and the new DBBC/Mark 5B+ system, during numerous geodetic VLBI sessions. Several R1, T2, and Euro sessions were correlated during the last two years by the Bonn correlator with Onsala being included both as an analog station (two-letter code On) and as a digital station (two-letter code Od). We present results from these parallel sessions, both results from the original correlation and results from the analysis of the corresponding databases.

  7. Contribution of alpha3(IV)alpha4(IV)alpha5(IV) Collagen IV to the Mechanical Properties of the Glomerular Basement Membrane

    NASA Astrophysics Data System (ADS)

    Gyoneva, Lazarina

    The glomerular basement membrane (GBM) is a vital part of the blood-urine filtration barrier in the kidneys. In healthy GBMs, the main tension-resisting component is alpha3(IV)alpha4(IV)alpha5(IV) type IV collagen, but in some diseases it is replaced by other collagen IV isoforms. As a result, the GBM becomes leaky and disorganized, ultimately resulting in kidney failure. Our goal is to understanding the biomechanical aspects of the alpha3(IV)alpha4(IV)alpha5(IV) chains and how their absence could be responsible for (1) the initial injury to the GBM and (2) progression to kidney failure. A combination of experiments and computational models were designed for that purpose. A model basement membrane was used to compare experimentally the distensibility of tissues with the alpha3(IV)alpha4(IV)alpha5(IV) chains present and missing. The experiments showed basement membranes containing alpha3(IV)alpha4(IV)alpha5(IV) chains were less distensible. It has been postulated that the higher level of lateral cross-linking (supercoiling) in the alpha3(IV)alpha4(IV)alpha5(IV) networks contributes additional strength/stability to basement membranes. In a computational model of supercoiled networks, we found that supercoiling greatly increased the stiffness of collagen IV networks but only minimally decreased the permeability, which is well suited for the needs of the GBM. It is also known that the alpha3(IV)alpha4(IV)alpha5(IV) networks are more protected from enzymatic degradation, and we explored their significance in GBM remodeling. Our simulations showed that the more protected network was needed to prevent the system from entering a dangerous feedback cycle due to autoregulation mechanisms in the kidneys. Overall, the work adds to the evidence of biomechanical differences between the alpha3(IV)alpha4(IV)alpha5(IV) networks and other collagen IV networks, points to supercoiling as the main source of biomechanical differences, discusses the suitability of alpha3(IV)alpha4(IV)alpha5(IV) networks to meet the mechanics and permeability needs of the GBM, and explores the role of biomechanics and enzymatic digestion in GBM remodeling.

  8. Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

    PubMed

    Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

    2013-04-01

    Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

  9. Partial validation of a French version of the ADHD-rating scale IV on a French population of children with ADHD and epilepsy. Factorial structure, reliability, and responsiveness.

    PubMed

    Mercier, Catherine; Roche, Sylvain; Gaillard, Ségolène; Kassai, Behrouz; Arzimanoglou, Alexis; Herbillon, Vania; Roy, Pascal; Rheims, Sylvain

    2016-05-01

    Attention deficit hyperactivity disorder (ADHD) is a well-known comorbidity in children with epilepsy. In English-speaking countries, the scores of the original ADHD-rating scale IV are currently used as main outcomes in various clinical trials in children with epilepsy. In French-speaking countries, several French versions are in use though none has been fully validated yet. We sought here for a partial validation of a French version of the ADHD-RS IV regarding construct validity, internal consistency (i.e., scale reliability), item reliability, and responsiveness in a group of French children with ADHD and epilepsy. The study involved 167 children aged 6-15years in 10 French neuropediatric units. The factorial structure and item reliability were assessed with a confirmatory factorial analysis for ordered categorical variables. The dimensions' internal consistency was assessed with Guttman's lambda 6 coefficient. The responsiveness was assessed by the change in score under methylphenidate and in comparison with a control group. The results confirmed the original two-dimensional factorial structure (inattention, hyperactivity/impulsivity) and showed a satisfactory reliability of most items, a good dimension internal consistency, and a good responsiveness of the total score and the two subscores. The studied French version of the ADHD-RS IV is thus validated regarding construct validity, reliability, and responsiveness. It can now be used in French-speaking countries in clinical trials of treatments involving children with ADHD and epilepsy. The full validation requires further investigations. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. 40 CFR 63.11494 - What are the applicability requirements and compliance dates?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Copolymers Production, subject to subpart DDDDDD of this part. (iv) Acrylic and Modacrylic Fibers Production, subject to subpart LLLLLL of this part. (v) Carbon Black Production, subject to subpart MMMMMM of this...

  11. 40 CFR 63.11494 - What are the applicability requirements and compliance dates?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Copolymers Production, subject to subpart DDDDDD of this part. (iv) Acrylic and Modacrylic Fibers Production, subject to subpart LLLLLL of this part. (v) Carbon Black Production, subject to subpart MMMMMM of this...

  12. 40 CFR 261.6 - Requirements for recyclable materials.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... CFR part 266, subpart F); (iv) Spent lead-acid batteries that are being reclaimed (40 CFR part 266... recycling process itself is exempt from regulation except as provided in § 261.6(d).) (2) Owners or...

  13. 40 CFR 261.6 - Requirements for recyclable materials.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... CFR part 266, subpart F); (iv) Spent lead-acid batteries that are being reclaimed (40 CFR part 266... recycling process itself is exempt from regulation except as provided in § 261.6(d).) (2) Owners or...

  14. Integration Of Launch Vehicle Simulation/Analysis Tools And Lunar Cargo Lander Design. Part 2/2

    NASA Technical Reports Server (NTRS)

    DeJean, George Brian; Shiue, Yeu-Sheng Paul; King, Jeffrey

    2005-01-01

    Part 2, which will be discussed in this report, will discuss the development of a Lunar Cargo Lander (unmanned launch vehicle) that will transport usable payload from Trans- Lunar Injection to the moon. The Delta IV-Heavy was originally used to transport the Lunar Cargo Lander to TLI, but other launch vehicles have been studied. In order to uncover how much payload is possible to land on the moon, research was needed in order to design the sub-systems of the spacecraft. The report will discuss and compare the use of a hypergolic and cryogenic system for its main propulsion system. The guidance, navigation, control, telecommunications, thermal, propulsion, structure, mechanisms, landing gear, command, data handling, and electrical power sub-systems were designed by scaling off other flown orbiters and moon landers. Once all data was collected, an excel spreadsheet was created to accurately calculate the usable payload that will land on the moon along with detailed mass and volume estimating relations. As designed, The Lunar Cargo Lander can plant 5,400 lbm of usable payload on the moon using a hypergolic system and 7,400 lbm of usable payload on the moon using a cryogenic system.

  15. Chromogenic Detection of Dipeptidyl Peptidase IV (DPP-IV) Activity using Peptide-Functionalized Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Abul-Huda, Yasin Mohammad

    Metal nanoparticles offer a useful platform for a wide range of biological applications especially for biosensing, bioimaging and drug delivery. This thesis presents a body of original research describing the synthesis, characterisation and development of a novel and convenient biosensing assay for detection of dipeptidyl peptidase IV (DPP-IV) enzyme activity using peptide functionalized gold nanoparticles. The distinctive optical and physical properties of gold nanoparticles (Au NP) were harnessed for the development of a colorimetric assay for rapid sensing of DPP-IV activities and screening DPP-IV inhbitors. The citrate reduction method for Au NPs synthesis was optimised and several potential peptide substrates (GPDC, VP-EN-DC, C/G dipeptide, GPG-EN-PEG4-LA, GPDCALNNC) were designed to provide substrates that mimic the DPP-IV natural substrates. The performances of the substrate functionalized Au NPs were assessed for their appropriateness for the detection of the enzyme activity. Addition of DPP-IV to the solutions containing the functionalized Au NPs resulted in cleavage of the substrate and thus causing the aggregation of the Au NPs which in turn led to a shift of the surface plasmon peak toward longer wavelengths, and a change of the colour of the colloidal suspension from red to blue. Overall, real-time detection of DPP-IV activity over a broader range (0-40 U/L) with high selectivity and stability was obtained, thus providing a method that can be used to determine the levels of DPP-IV/CD26 in biological fluids such as serum and plasma. Further assay developments were conducted to overcome limitations encountered with the original Au NP assay, especially the narrow dynamic linear range and stability in high ionic strength solutions. Validation and comparison of the Au NP assay developed has revealed that this method is highly correlated to the gold standard chromogenic Gly-Pro-pNA method for detection of enzyme activity in biological samples. Very good recoveries (in the range 83.6 -114.9%) were obtained in spiked serum samples, which indicate that this assay could provide a suitable alternative for enzyme activity detection with the naked eye and without the need for sophisticated instruments. Investigations into the effects of incorporating different stabilizers in order to improve the stability of the peptide functionalized Au NP in high ionic strength solutions were also investigated. Gold nanoparticles have different shapes and structures and an alternative approach for detection of DPP-IV activity using gold nanorods due to their higher refractive index sensitivities was explored. As a conclusion, three out of five approaches, all utilising Au NP-ligand conjugates were demonstrated useful for the detection of the DPP-IV activity. The system developed here is portable and would permit on-site analysis of samples, which offers a real alternative approach from traditional assays and reduces the need for laboratory testing. The logical next step in this research would be the continuation of experiments to transform this test into a point of care testing device that could offer an early detection tool for disease management.

  16. Lupin alkaloids Part IV. The influence of some structural factors on the conformational equilibrium in bis-quinolizidine systems

    NASA Astrophysics Data System (ADS)

    Wysocka, Waleria; Brukwicki, Tadeusz

    1992-01-01

    13C NMR and IR spectra of minor alkaloids of Lupinus albus such as multiflorine ( I), 13α-hydroxymultiflorine ( IV) and their monoperchlorates, 13α-hydroxy-5-dehydromultiflorine ( V) and 5-dehydromultiflorine ( VI) were taken. I and IV in CDCl 3, their monoperchlorates in CD 3CN and V in CD 3OD solution occur in conformational equilibrium. The share of the conformation with a boat ring C in I is about 74%, in IV 67%, in I · HClO 4 20%, in IV·HClO 43% and in V 3%. The change in conformational preference results mainly from a decreasing destabilization of the conformation with a chair ring C caused by an increase in the distance between the interacting hydrogen atom pairs 5α-17α, 8β-12β, 12β-17β and 14β-17β, due to protonation induced lengthening of the N (16)-C α bonds. VI and most of the molecules of V remain in solution in conformation with a chair ring C. This conformation in V and VI is less destabilized than in I and IV because of a lower steric hindrance for the chair ring C, as a consequence of the planarity of ring A and a part of fragment B and because of the absence of the 5α-17α interaction.

  17. An Application of the PMI Model at the Project Level Evaluation of ESEA Title IV-C Projects.

    ERIC Educational Resources Information Center

    McBeath, Marcia

    All of the papers presented as part of a symposium concerned the application of the Planning, Monitoring, and Implementation Model (PMI) to the evaluation of the District of Columbia Public Schools' programs supported by the Elementary Secondary Education Act (ESEA) Title IV-C. PMI was developed to provide a model for systematic evaluation of…

  18. The Development and Evaluation of Training Methods for Group IV Personnel. 1. Orientation and Implementation of the Training Methods Development School (TMDS).

    ERIC Educational Resources Information Center

    Steinemann, John H.

    The investigation is part of continuing Navy research on the Trainability of Group IV (low ability) personnel intended to maximize the utilization and integration of marginal personnel in the fleet. An experimental Training Methods Development School (TMDS) was initiated to provide an experimental training program, with research controls, for…

  19. Beyond the Classroom: International Education and the Community College. Volume IV. Working with Local Business To Enhance Asian-Pacific Understanding.

    ERIC Educational Resources Information Center

    Franco, Robert W., Ed.; Shimabukuro, James N., Ed.

    Part of a four-volume set in which community college educators discuss their efforts to internationalize the educational experience of the students and communities they serve, volume IV in this series focuses on the growing importance of community colleges in providing short-term, intensive training in international business and intercultural…

  20. Rapid ionization of the environment of SN 1987A

    NASA Technical Reports Server (NTRS)

    Raga, A. C.

    1987-01-01

    It has been suggested by some authors that IUE observations of the supernova SN 1987A show the presence of a strong component of the interstellar C IV 1550 and Si IV 1393 absorption lines at a velocity that approximately corresponds to the velocity of the LMC. It is possible that this component might come from originally neutral (or at least not very highly ionized) gas which has been photoionized by the initially very strong ionizing radiation field of the supernova. Theoretical considerations of this scenario lead to the study of fast (with velocities of about c) ionization fronts. It is shown that for reasonable model parameters it is possible to obtain considerably large C IV column densities, in agreement with the IUE observations. On the other hand, the models do not so easily predict the large Si IV column densities that are also obtained from the IUE observations. It is found that only models in which the interstellar medium surrounding SN 1987A is initially composed of already ionized hydrogen and helium predict substantial Si IV column densities. This result provides an interesting prediction of the ionization state of the environment of the presupernova star.

  1. 49 CFR Appendix E to Part 227 - Use of Insert Earphones for Audiometric Testing

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... audiometer. IV. Background Noise Levels Testing shall be conducted in a room where the background ambient noise octave-band sound pressures levels meet appendix D to this part. V. Conversion From Supra Aural...

  2. Precambrian uranium-bearing quartz-pebble conglomerates: exploration model and United States resource potential

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Houston, R.S.; Karlstrom, K.E.

    1979-11-01

    Uranium has been discovered in fluvial quartz-pebble conglomerates in most of the Precambrian shield areas of the world, including the Canadian, African, South American, Indian, Baltic, and Australian shields. Occurrences in these and other areas are shown. Two of these occurrences, the Huronian supergroup of Canada and the Witwatersrand deposit of South Africa contain 20 to 30 percent of the planet's known uranium reserves. Thus it is critical that we understand the origin of these deposits and develop exploration models that can aid in finding new deposits. Inasmuch as these uranium-bearing conglomerates are confined almost entirely to rocks of Precambrianmore » age, Part I of this review begins with a discussion of Precambrian geology as it applies to the conglomerates. This is followed by a discussion of genetic concepts, a discussion of unresolved problems, and finally a suggested exploration model. Part II summarizes known and potential occurrences of Precambrian fossil placers in the world and evaluates them in terms of the suggested exploration model. Part III discusses the potential for important Precambrian fossil-placer uranium deposits in the United States and includes suggestions that may be helpful in establishing an exploration program in this country. Part III also brings together new (1975-1978) data on uranium occurrences in the Precambrian of the Wyoming Province. Part IV is a complete bibliography of Precambrian fossil placers, divided according to geographical areas. In total, this paper is designed to be a comprehensive review of Precambrian uranium-bearing fossil placers which will be of use to uranium explorationists and to students of Precambrian geology.« less

  3. The MDS-UPDRS tracks motor and non-motor improvement due to subthalamic nucleus deep brain stimulation in Parkinson disease.

    PubMed

    Chou, Kelvin L; Taylor, Jennifer L; Patil, Parag G

    2013-11-01

    The Movement Disorders Society revision of the Unified Parkinson Disease Rating Scale (MDS-UPDRS) improves upon the original UPDRS by adding more non-motor items, making it a more robust tool to evaluate the severity of motor and non-motor symptoms of Parkinson disease. Previous studies on deep brain stimulation have not used the MDS-UPDRS. To determine if the MDS-UPDRS could detect improvement in both motor and non-motor symptoms after bilateral subthalamic nucleus deep brain stimulation for Parkinson disease. We compared scores on the entire MDS-UPDRS prior to surgery (baseline) and approximately six months following the initial programming visit in twenty subjects (12M/8F) with Parkinson disease undergoing bilateral subthalamic nucleus deep brain stimulation. STN DBS significantly improved the scores for every section of the MDS-UPDRS at the 6 month follow-up. Part I improved by 3.1 points (22%), Part II by 5.3 points (29%), Part III by 13.1 points (29%) with stimulation alone, and Part IV by 7.1 points (74%). Individual non-motor items in Part I that improved significantly were constipation, light-headedness, and fatigue. Both motor and non-motor symptoms, as assessed by the MDS-UPDRS, improve with bilateral subthalamic nucleus stimulation six months after the stimulator is turned on. We recommend that the MDS-UPDRS be utilized in future deep brain stimulation studies because of the advantage of detecting change in non-motor symptoms. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. I-V Curves from Photovoltaic Modules Deployed in Tucson

    NASA Astrophysics Data System (ADS)

    Kopp, Emily; Brooks, Adria; Lonij, Vincent; Cronin, Alex

    2011-10-01

    More than 30 Mega Watts of photo-voltaic (PV) modules are connected to the electric power grid in Tucson, AZ. However, predictions of PV system electrical yields are uncertain, in part because PV modules degrade at various rates (observed typically in the range 0% to 3 %/yr). We present I-V curves (PV output current as a function of PV output voltage) as a means to study PV module efficiency, de-ratings, and degradation. A student-made I-V curve tracer for 100-Watt modules will be described. We present I-V curves for several different PV technologies operated at an outdoor test yard, and we compare new modules to modules that have been operated in the field for 10 years.

  5. FY 2002 Report on Software Visualization Techniques for IV and V

    NASA Technical Reports Server (NTRS)

    Fotta, Michael E.

    2002-01-01

    One of the major challenges software engineers often face in performing IV&V is developing an understanding of a system created by a development team they have not been part of. As budgets shrink and software increases in complexity, this challenge will become even greater as these software engineers face increased time and resource constraints. This research will determine which current aspects of providing this understanding (e.g., code inspections, use of control graphs, use of adjacency matrices, requirements traceability) are critical to the performing IV&V and amenable to visualization techniques. We will then develop state-of-the-art software visualization techniques to facilitate the use of these aspects to understand software and perform IV&V.

  6. Evidence that 50% of BALQSO Outflows Are Situated at Least 100 pc from the Central Source

    NASA Astrophysics Data System (ADS)

    Arav, Nahum; Liu, Guilin; Xu, Xinfeng; Stidham, James; Benn, Chris; Chamberlain, Carter

    2018-04-01

    The most robust way for determining the distance of quasar absorption outflows is the use of troughs from ionic excited states. The column density ratio between the excited and resonance states yields the outflow number density. Combined with a knowledge of the outflow’s ionization parameter, a distance from the central source (R) can be determined. Here we report results from two surveys targeting outflows that show troughs from S IV. One survey includes 1091 SDSS and BOSS quasar spectra, and the other includes higher-quality spectra of 13 quasars observed with the Very Large Telescope. Our S IV samples include 38 broad absorption line (BAL) outflows and four mini-BAL outflows. The S IV is formed in the same physical region of the outflow as the canonical outflow-identifying species C IV. Our results show that S IV absorption is only detected in 25% of C IV BAL outflows. The smaller detection fraction is due to the higher total column density (N H) needed to detect S IV absorption. Since R empirically anticorrelates with N H, the results of these surveys can be extrapolated to C IV quasar outflows with lower N H as well. We find that at least 50% of quasar outflows are at distances larger than 100 pc from the central source, and at least 12% are at distances larger than 1000 pc. These results have profound implications for the study of the origin and acceleration mechanism of quasar outflows and their effects on the host galaxy.

  7. Land-Grant College Education 1910 to 1920 Part IV: Engineering and Mechanic Arts. Bulletin, 1925, No. 5

    ERIC Educational Resources Information Center

    Walton, C. John, Ed.

    1925-01-01

    This is the fourth part of a 5-part survey of land-grant college education. Other parts are: (1) History and Educational Objectives of Land-Grant College Education; (2) The Liberal Arts and Sciences and Miscellaneous Subjects in Land-Grant Colleges (3) Agricultural Education in Land-Grant Colleges (including agricultural engineering)(4); and Home…

  8. 40 CFR 1039.610 - What provisions apply to vehicles certified under the motor-vehicle program?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... temperatures or heat rejection rates are outside the original vehicle manufacturer's specified ranges. (iv) Add... 1068.101(a)(1). (f) Data submission. We may require you to send us emission test data on any applicable...

  9. 40 CFR 1039.610 - What provisions apply to vehicles certified under the motor-vehicle program?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... temperatures or heat rejection rates are outside the original vehicle manufacturer's specified ranges. (iv) Add... 1068.101(a)(1). (f) Data submission. We may require you to send us emission test data on any applicable...

  10. 40 CFR 1039.610 - What provisions apply to vehicles certified under the motor-vehicle program?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... temperatures or heat rejection rates are outside the original vehicle manufacturer's specified ranges. (iv) Add... 1068.101(a)(1). (f) Data submission. We may require you to send us emission test data on any applicable...

  11. 40 CFR 1039.610 - What provisions apply to vehicles certified under the motor-vehicle program?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... temperatures or heat rejection rates are outside the original vehicle manufacturer's specified ranges. (iv) Add... 1068.101(a)(1). (f) Data submission. We may require you to send us emission test data on any applicable...

  12. Title IV Cash Management Life Cycle Training. Participant's Guide.

    ERIC Educational Resources Information Center

    Department of Education, Washington, DC.

    This participant's guide includes: "Introduction: Welcome to Cash Management Life Cycle Training"; "Module 1: Review of Cash Management Principles" (cash management overview and activity); "Module 2: Common Origination and Disbursement (COD) System Overview" (e.g., full participants and phase-in participants, COD…

  13. Widespread occurrence of Sinorhizobium meliloti strains with a type IV secretion system

    USDA-ARS?s Scientific Manuscript database

    Improvement in symbiotic nitrogen fixation would reduce reliance on nitrogen fertilizers but is hampered by poor establishment of introduced strains due to competition by indigenous symbiotic strains. This study investigated the origins, diversity, and competitiveness of Sinorhizobium meliloti (now ...

  14. Small potent ligands to the insulin-regulated aminopeptidase (IRAP)/AT(4) receptor.

    PubMed

    Axén, Andreas; Andersson, Hanna; Lindeberg, Gunnar; Rönnholm, Harriet; Kortesmaa, Jarkko; Demaegdt, Heidi; Vauquelin, Georges; Karlén, Anders; Hallberg, Mathias

    2007-07-01

    Angiotensin IV analogs encompassing aromatic scaffolds replacing parts of the backbone of angiotensin IV have been synthesized and evaluated in biological assays. Several of the ligands displayed high affinities to the insulin-regulated aminopeptidase (IRAP)/AT(4) receptor. Displacement of the C-terminal of angiotensin IV with an o-substituted aryl acetic acid derivative delivered the ligand 4, which exhibited the highest binding affinity (K(i) = 1.9 nM). The high affinity of this ligand provides support to the hypothesis that angiotensin IV adopts a gamma-turn in the C-terminal of its bioactive conformation. Ligand (4) inhibits both human IRAP and aminopeptidase N-activity and induces proliferation of adult neural stem cells at low concentrations. Furthermore, ligand 4 is degraded considerably more slowly in membrane preparations than angiotensin IV. Hence, it might constitute a suitable research tool for biological studies of the (IRAP)/AT(4) receptor.

  15. 12 CFR Appendix C to Part 707 - Official Staff Interpretations

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Messages promoting an account that are provided along with information about the member's existing account... account. iv. For purposes of § 707.8(b) of this part through § 707.8(e) of this part, information given to... automatically renewable time account sent before renewal. v. Information about a particular transaction in an...

  16. Curriculum Development--Post-Secondary Electro-Mechanical Technology. Parts I-IV.

    ERIC Educational Resources Information Center

    Texas State Technical Inst., Sweetwater.

    This curriculum guide consists of materials for use in teaching a four-part course in electromechanical technical technology. The first part contains nine units dealing with hydraulics and nine units on pneumatics. Addressed in the individual units are the following topics: an introduction to hydraulics; control of hydraulic energy; check valves…

  17. Pregnant Guppy in Flight

    NASA Technical Reports Server (NTRS)

    1960-01-01

    The Pregnant Guppy is a modified Boeing B-377 Stratocruiser used to transport the S-IV (second) stage for the Saturn I launch vehicle between manufacturing facilities on the West coast, and testing and launch facilities in the Southeast. The fuselage of the B-377 was lengthened to accommodate the S-IV stage and the plane's cabin section was enlarged to approximately double its normal volume. The idea was originated by John M. Conroy of Aero Spaceliners, Incorporated, in Van Nuys, California. The former Stratocruiser became a B-377 PG: the Pregnant Guppy. This photograph depicts the Pregnant Guppy in flight.

  18. Electroformed silicon nitride based light emitting memory device

    NASA Astrophysics Data System (ADS)

    Anutgan, Tamila; Anutgan, Mustafa; Atilgan, Ismail; Katircioglu, Bayram

    2017-07-01

    The resistive memory switching effect of an electroformed nanocrystal silicon nitride thin film light emitting diode (LED) is demonstrated. For this purpose, current-voltage (I-V) characteristics of the diode were systematically scanned, paying particular attention to the sequence of the measurements. It was found that when the voltage polarity was changed from reverse to forward, the previously measured reverse I-V behavior was remembered until some critical forward bias voltage. Beyond this critical voltage, the I-V curve returns to its original state instantaneously, and light emission switches from the OFF state to the ON state. The kinetics of this switching mechanism was studied for different forward bias stresses by measuring the corresponding time at which the switching occurs. Finally, the switching of resistance and light emission states was discussed via energy band structure of the electroformed LED.

  19. Lessons from Amphioxus Bauplan About Origin of Cranial Nerves of Vertebrates That Innervates Extrinsic Eye Muscles.

    PubMed

    Ferran, José Luis; Puelles, Luis

    2018-04-16

    Amphioxus is the living chordate closest to the ancestral form of vertebrates, and in a key position to reveal essential aspects of the evolution of the brain Bauplan of vertebrates. The dorsal neural cord of this species at the larval stage is characterized by a small cerebral vesicle at its anterior end and a large posterior region. The latter is comparable in some aspects to the hindbrain and spinal cord regions of vertebrates. The rostral end of the cerebral vesicle contains a median pigment spot and associated rows of photoreceptor and other nerve cells; this complex is known as "the frontal eye." However, this is not a complete eye in the sense that it has neither eye muscles nor lens (only a primitive retina-like tissue). Cranial nerves III, IV, and VI take part in the motor control of eye muscles in all vertebrates. Using a recent model that postulates distinct molecularly characterized hypothalamo-prethalamic and mesodiencephalic domains in the early cerebral vesicle of amphioxus, we analyze here possible scenarios for the origin from the common ancestor of cephalochordates and vertebrates of the cranial nerves related with extrinsic eye muscle innervations. Anat Rec, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  20. Genetics and biology of human ovarian teratomas. I. Cytogenetic analysis and mechanism of origin.

    PubMed Central

    Surti, U; Hoffner, L; Chakravarti, A; Ferrell, R E

    1990-01-01

    One hundred and two benign, mature ovarian teratomas and two immature, malignant teratomas were karyotyped and scored for centromeric heteromorphisms as part of an ongoing project to determine the chromosomal karyotype and the genetic origin of ovarian teratomas and to assess their utility for gene-centromere mapping. Karyotypic analysis of the benign cases revealed 95 46,XX teratomas and 7 chromosomally abnormal teratomas (47,XXX, 47,XX,+8 [two cases], 47,XX,+15, 48,XX,+7,+12 91,XXXX,-13 [mosaic], 47,XX,-15,+21,+mar). Our study reports on the first cases of tetraploidy and structural rearrangement in benign ovarian teratomas. The two immature cases had modal chromosome numbers of 78 and 49. Centromeric heteromorphisms that were heterozygous in the host were homozygous in 65.2% (n = 58) of the benign teratomas and heterozygous in the remaining 34.8% (n = 31). Chromosome 13 heteromorphisms were the most informative, with 72.7% heterozygosity in hosts. The cytogenetic data indicate that 65% of teratomas are derived from a single germ cell after meiosis I and failure of meiosis II (type II) or endoreduplication of a mature ovum (type III); 35% arise by failure of meiosis I (type I) or mitotic division of premeiotic germ cells (type IV). Images Figure 1 PMID:2220805

  1. Hydrogeochemical processes in the Plio-Quaternary Remila aquifer (Khenchela, Algeria)

    NASA Astrophysics Data System (ADS)

    Aouidane, Laiche; Belhamra, Mohamed

    2017-06-01

    The Remila Plain is a synclinal structure in northeast Algeria, situated within a semi-arid climate zone and composed of Mio-Pliocene-Quaternary deposits. Within the syncline, the Plio-Quaternary aquifer is the main source of drinking water for cattle and for agricultural irrigation water. This work aims to investigate the origin of groundwater mineralization and to identify the primary hydrogeochemical processes controlling groundwater evolution in the Remila aquifer. A total of 86 water samples from boreholes were analyzed for major, minor and stable isotopes (18O, 2H) over three seasons: first during low water levels in 2013, second during high water levels in 2014 and third for stable isotopes during low water levels in 2015. The analysis showed that the aquifer is controlled by five principal geochemical processes: (I) the dissolution of evaporite rocks, (II) cation exchange and reverse exchange reactions, (III) congruent dissolution of carbonates (calcite, dolomite) coupled with the dissolution of gypsum and calcite precipitation, (IV) sulfate reduction under anaerobic conditions, and (V) saltwater intrusion in the northeastern Sabkha plains. The 18O and deuterium concentrations in groundwater are very low, indicating that the aquifer is recharged by evaporated rainfall originating from the north slope of the Aurès Mountains which confirms that the aquifer is recharged in the southern part of the plain.

  2. Dielectric Constant and Loss Data. Part 4

    DTIC Science & Technology

    1980-12-01

    Fluorinated ethers, Organic Chemicals Dept., P.R.-194Dow Chemical "Dowtherm" A, P.R.-194 T ORg C a p - Dew Corning Corp., IV-26, 27, 41, 42, "HVITON...Esso "Teresso" oil, V-78; P.R.-195 and MFl16, V-15 "Estawax", IV-57 "Eccosorb" MFll7, V-15, 242 Ethers, fluorinated , P.R.-194 Eggwhite. P.R.-202 "Ethocel...PPG, 8-20 Flourglas laminate, 9-33 "Gafite" cast polymer, IV-34 Fluorinated ethers, P.R.-194 Gasoline, aviation, 100 and 91 octane, Fluorcarbon

  3. A Genetic Selection for dinB Mutants Reveals an Interaction between DNA Polymerase IV and the Replicative Polymerase That Is Required for Translesion Synthesis.

    PubMed

    Scotland, Michelle K; Heltzel, Justin M H; Kath, James E; Choi, Jung-Suk; Berdis, Anthony J; Loparo, Joseph J; Sutton, Mark D

    2015-09-01

    Translesion DNA synthesis (TLS) by specialized DNA polymerases (Pols) is a conserved mechanism for tolerating replication blocking DNA lesions. The actions of TLS Pols are managed in part by ring-shaped sliding clamp proteins. In addition to catalyzing TLS, altered expression of TLS Pols impedes cellular growth. The goal of this study was to define the relationship between the physiological function of Escherichia coli Pol IV in TLS and its ability to impede growth when overproduced. To this end, 13 novel Pol IV mutants were identified that failed to impede growth. Subsequent analysis of these mutants suggest that overproduced levels of Pol IV inhibit E. coli growth by gaining inappropriate access to the replication fork via a Pol III-Pol IV switch that is mechanistically similar to that used under physiological conditions to coordinate Pol IV-catalyzed TLS with Pol III-catalyzed replication. Detailed analysis of one mutant, Pol IV-T120P, and two previously described Pol IV mutants impaired for interaction with either the rim (Pol IVR) or the cleft (Pol IVC) of the β sliding clamp revealed novel insights into the mechanism of the Pol III-Pol IV switch. Specifically, Pol IV-T120P retained complete catalytic activity in vitro but, like Pol IVR and Pol IVC, failed to support Pol IV TLS function in vivo. Notably, the T120P mutation abrogated a biochemical interaction of Pol IV with Pol III that was required for Pol III-Pol IV switching. Taken together, these results support a model in which Pol III-Pol IV switching involves interaction of Pol IV with Pol III, as well as the β clamp rim and cleft. Moreover, they provide strong support for the view that Pol III-Pol IV switching represents a vitally important mechanism for regulating TLS in vivo by managing access of Pol IV to the DNA.

  4. Isidore of Seville on the origins and meanings of medical terms.

    PubMed

    Dirckx, John H

    2007-12-01

    Early in the 7th century of our era, the prelate and scholar Isidore of Seville compiled a Latin encyclopedia of classical learning that retained its popularity throughout the Middle Ages and into early modern times. This work, called Origines seu Etymologiae, treats many of its topics by tracing (often fancifully and incorrectly) the histories of their terms. From Book IV, which deals with medicine, 3 chapters containing glossaries of acute, chronic, and cutaneous diseases are here translated.

  5. 24 CFR 982.202 - How applicants are selected: General requirements.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... members of the family are unwed parents, recipients of public assistance, or children born out of wedlock; (ii) Discrimination because a family includes children (familial status discrimination); (iii) Discrimination because of age, race, color, religion, sex, or national origin; (iv) Discrimination because of...

  6. 24 CFR 200.1520 - Termination of MAP privileges.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... the traditional application processing (TAP) procedure. HUD will completely reprocess all stages of... it normally performs for TAP processing. (iv) The original lender may service a transferred loan once... lender status as a result of termination, the lender's status to process transactions using TAP is...

  7. Potential Aquifer Vulnerability in Regions Down-Gradient from Uranium In Situ Recovery (ISR) Sites

    EPA Science Inventory

    Sandstone-hosted roll-front uranium ore deposits originate when U(VI) dissolved in groundwater is reduced and precipitated as insoluble U(IV) minerals. Groundwater redox geochemistry, aqueous complexation, and solute migration are instrumental in leaching uranium from source rock...

  8. 33 CFR Appendix B to Part 155 - Determining and Evaluating Required Response Resources for Vessel Response Plans

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and the geographic area(s) in... type of petroleum oil carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and... Petroleum Oil Cargo Groups Non-persistent oil 72 G: Group I 1.0 Persistent oil: Group II 1.8 Group III 2.0...

  9. 33 CFR Appendix B to Part 155 - Determining and Evaluating Required Response Resources for Vessel Response Plans

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and the geographic area(s) in... type of petroleum oil carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and... Petroleum Oil Cargo Groups Non-persistent oil 72 G: Group I 1.0 Persistent oil: Group II 1.8 Group III 2.0...

  10. 33 CFR Appendix B to Part 155 - Determining and Evaluating Required Response Resources for Vessel Response Plans

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and the geographic area(s) in... type of petroleum oil carried [persistent (groups II, III, and IV) or non-persistent (group I)]; and... Petroleum Oil Cargo Groups Non-persistent oil 72 G: Group I 1.0 Persistent oil: Group II 1.8 Group III 2.0...

  11. [Maintenance of Pure Lines and Hybridization.] Student Materials. V.A. III. [IV-A-1 through IV-A-2].

    ERIC Educational Resources Information Center

    Texas A and M Univ., College Station. Vocational Instructional Services.

    Part of a series of eight student learning modules in vocational agriculture, this booklet deals with plant reproduction. Topics covered include the pure line theory and its history, pure line selection, the effect of inbreeding on vitality, the definition of and reasons for hybridization in plants, and techniques for producing hybirds; a list of…

  12. Auxiliary subprograms for calculating the navigational parameters of artificial Earth satellites. FORTRAN IV

    NASA Technical Reports Server (NTRS)

    Prokhorenko, V. I.

    1981-01-01

    Subprograms for transforming coordinates and time, for determining the position of the Moon and Sun, and for calculating the atmosphere and disturbances, which are specified by anomalies of the Earth's gravitational field are described. The subprograms are written in FORTRAN IV and form a major part of the package of applied programs for calculating the navigational parameters of artificial Earth satellites.

  13. Student Perceptions of Elementary School Climates in the Louisiana School Effectiveness Study: A Comparison of Phase III and Phase IV.

    ERIC Educational Resources Information Center

    Roberts, Sharon Pol; Heroman, Deborah S.

    A 5-year study examined third-graders' perceptions of school climate in 16 Louisiana schools. Part of the Louisiana School Effectiveness Study (LSES), Phase III and IV examined student perceptions in 1984-85 and 1989-90, respectively, and also gathered demographic data and multiple measures of student outcomes through student surveys and classroom…

  14. Origins of magnetospheric physics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Allen, J.A.

    1983-01-01

    The history of the scientific investigation of the earth magnetosphere during the period 1946-1960 is reviewed, with a focus on satellite missions leading to the discovery of the inner and outer radiation belts. Chapters are devoted to ground-based studies of the earth magnetic field through the 1930s, the first U.S. rocket flights carrying scientific instruments, the rockoon flights from the polar regions (1952-1957), U.S. planning for scientific use of artificial satellites (1956), the launch of Sputnik I (1957), the discovery of the inner belt by Explorers I and III (1958), the Argus high-altitude atomic-explosion tests (1958), the confirmation of themore » inner belt and discovery of the outer belt by Explorer IV and Pioneers I-V, related studies by Sputniks II and III and Luniks I-III, and the observational and theoretical advances of 1959-1961. Photographs, drawings, diagrams, graphs, and copies of original notes and research proposals are provided. 227 references.« less

  15. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. JULY 16, 1934 PHOTOGRAPH NO. 179 OF CONTRACT NO. 3 SHOWING MAIN BRIDGE DREDGING PIER IV. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  16. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. SEPTEMBER 24, 1934 PHOTOGRAPH NO. 189 OF CONTRACT NO. 3 SHOWING MAIN SETTING GRANITE AT PIER IV. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  17. 19 CFR 10.537 - Accessories, spare parts, or tools.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... parts, or tools will be taken into account as originating or non-originating materials, as the case may... 19 Customs Duties 1 2010-04-01 2010-04-01 false Accessories, spare parts, or tools. 10.537 Section... Free Trade Agreement Rules of Origin § 10.537 Accessories, spare parts, or tools. Accessories, spare...

  18. 22 CFR 129.7 - Prior approval (license).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...; (ii) Nuclear weapons strategic delivery systems and all components, parts, accessories, attachments specifically designed for such systems and associated equipment; (iii) Nuclear weapons design and test equipment of a nature described by Category XVI of Part 121; (iv) Naval nuclear propulsion equipment of a...

  19. 22 CFR 129.7 - Prior approval (license).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...; (ii) Nuclear weapons strategic delivery systems and all components, parts, accessories, attachments specifically designed for such systems and associated equipment; (iii) Nuclear weapons design and test equipment of a nature described by Category XVI of part 121; (iv) Naval nuclear propulsion equipment of a...

  20. 75 FR 82489 - Process for Submissions for Review of Security-Based Swaps for Mandatory Clearing and Notice...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-30

    ... Part IV Securities and Exchange Commission 17 CFR Parts 240 and 249 Process for Submissions for Review of Security-Based Swaps for Mandatory Clearing and Notice Filing Requirements for Clearing...;#0; [[Page 82490

  1. Elasto-dynamic analysis of a gear pump-Part IV: Improvement in the pressure distribution modelling

    NASA Astrophysics Data System (ADS)

    Mucchi, E.; Dalpiaz, G.; Fernàndez del Rincòn, A.

    2015-01-01

    This work concerns external gear pumps for automotive applications, which operate at high speed and low pressure. In previous works of the authors (Part I and II, [1,2]), a non-linear lumped-parameter kineto-elastodynamic model for the prediction of the dynamic behaviour of external gear pumps was presented. It takes into account the most important phenomena involved in the operation of this kind of machine. The two main sources of noise and vibration are considered: pressure pulsation and gear meshing. The model has been used in order to foresee the influence of working conditions and design modifications on vibration generation. The model experimental validation is a difficult task. Thus, Part III proposes a novel methodology for the validation carried out by the comparison of simulations and experimental results concerning forces and moments: it deals with the external and inertial components acting on the gears, estimated by the model, and the reactions and inertial components on the pump casing and the test plate, obtained by measurements. The validation is carried out by comparing the level of the time synchronous average in the time domain and the waterfall maps in the frequency domain, with particular attention to identify system resonances. The validation results are satisfactory global, but discrepancies are still present. Moreover, the assessed model has been properly modified for the application to a new virtual pump prototype with helical gears in order to foresee gear accelerations and dynamic forces. Part IV is focused on improvements in the modelling and analysis of the phenomena bound to the pressure distribution around the gears in order to achieve results closer to the measured values. As a matter of fact, the simulation results have shown that a variable meshing stiffness has a notable contribution on the dynamic behaviour of the pump but this is not as important as the pressure phenomena. As a consequence, the original model was modified with the aim at improving the calculation of pressure forces and torques. The improved pressure formulation includes several phenomena not considered in the previous one, such as the variable pressure evolution at input and output ports, as well as an accurate description of the trapped volume and its connections with high and low pressure chambers. The importance of these improvements are highlighted by comparison with experimental results, showing satisfactory matching.

  2. Protection of pigs against pandemic swine origin H1N1 influenza A virus infection by hemagglutinin- or neuraminidase-expressing attenuated pseudorabies virus recombinants.

    PubMed

    Klingbeil, Katharina; Lange, Elke; Blohm, Ulrike; Teifke, Jens P; Mettenleiter, Thomas C; Fuchs, Walter

    2015-03-02

    Influenza is an important respiratory disease of pigs, and may lead to novel human pathogens like the 2009 pandemic H1N1 swine-origin influenza virus (SoIV). Therefore, improved influenza vaccines for pigs are required. Recently, we demonstrated that single intranasal immunization with a hemagglutinin (HA)-expressing pseudorabies virus recombinant of vaccine strain Bartha (PrV-Ba) protected pigs from H1N1 SoIV challenge (Klingbeil et al., 2014). Now we investigated enhancement of efficacy by prime-boost vaccination and/or intramuscular administration. Furthermore, a novel PrV-Ba recombinant expressing codon-optimized N1 neuraminidase (NA) was included. In vitro replication of this virus was only slightly affected compared to parental virus. Unlike HA, the abundantly expressed NA was efficiently incorporated into PrV particles. Immunization of pigs with the two PrV recombinants, either singly or in combination, induced B cell proliferation and the expected SoIV-specific antibodies, whose titers increased substantially after boost vaccination. After immunization of animals with either PrV recombinant H1N1 SoIV challenge virus replication was significantly reduced compared to PrV-Ba vaccinated or naïve controls. Protective efficacy of HA-expressing PrV was higher than of NA-expressing PrV, and not significantly enhanced by combination. Despite higher serum antibody titers obtained after intramuscular immunization, transmission of challenge virus to naïve contact animals was only prevented after intranasal prime-boost vaccination with HA-expressing PrV-Ba. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  4. Reaction of tin(iv) phthalocyanine dichloride with decamethylmetallocenes (M = CrII and CoII). Strong magnetic coupling of spins in (Cp*2Co+){SnIVCl2(Pc˙3-)}˙-·2C6H4Cl2.

    PubMed

    Konarev, Dmitri V; Troyanov, Sergey I; Shestakov, Alexander F; Yudanova, Evgeniya I; Otsuka, Akihiro; Yamochi, Hideki; Kitagawa, Hiroshi; Lyubovskaya, Rimma N

    2018-01-23

    The reaction of tin(iv) phthalocyanine dichloride {Sn IV Cl 2 (Pc 2- )} with decamethylmetallocenes (Cp* 2 M, M = Co, Cr) has been studied. Decamethylcobaltocene reduces Sn IV Cl 2 (Pc 2- ) to form the (Cp* 2 Co + ){Sn IV Cl 2 (Pc˙ 3- )}˙ - ·2C 6 H 4 Cl 2 (1) complex. The negative charge of {Sn IV Cl 2 (Pc˙ 3- )}˙ - is delocalized over the Pc macrocycle providing the alternation of the C-N(imine) bonds, the appearance of new bands in the NIR range and a strong blue shift of both the Soret and Q-bands in the spectrum of 1. The magnetic moment of 1 is equal to 1.68μ B at 300 K, indicating the contribution of one S = 1/2 spin of the Pc˙ 3- macrocycles. These macrocycles form closely packed double stacks in 1 with effective π-π interactions providing strong antiferromagnetic coupling of spins at a Weiss temperature of -80 K. Decamethylchromocene initially also reduces Sn IV Cl 2 (Pc 2- ) to form the [(Cp* 2 Cr + ){Sn VI Cl 2 (Pc˙ 3- )}˙ - complex but further reaction between the ions is observed. This reaction is accompanied by the substitution of one Cp* ligand of Cp* 2 Cr by chloride anions originating from {Sn IV Cl 2 (Pc˙ 3- )}˙ - to form the complex {(Cp*CrCl 2 )(Sn IV (μ-Cl)(Pc 2- ))}·C 6 H 4 Cl 2 (2) in which the (Cp*CrCl 2 ) and {Sn IV (Pc 2- )} species are bonded through the μ-bridged Cl - anion. According to the DFT calculations, this reaction proceeds via an intermediate [(Cp* 2 CrCl)(SnClPc)] complex.

  5. The 10/66 Dementia Research Group's fully operationalised DSM-IV dementia computerized diagnostic algorithm, compared with the 10/66 dementia algorithm and a clinician diagnosis: a population validation study

    PubMed Central

    Prince, Martin J; de Rodriguez, Juan Llibre; Noriega, L; Lopez, A; Acosta, Daisy; Albanese, Emiliano; Arizaga, Raul; Copeland, John RM; Dewey, Michael; Ferri, Cleusa P; Guerra, Mariella; Huang, Yueqin; Jacob, KS; Krishnamoorthy, ES; McKeigue, Paul; Sousa, Renata; Stewart, Robert J; Salas, Aquiles; Sosa, Ana Luisa; Uwakwa, Richard

    2008-01-01

    Background The criterion for dementia implicit in DSM-IV is widely used in research but not fully operationalised. The 10/66 Dementia Research Group sought to do this using assessments from their one phase dementia diagnostic research interview, and to validate the resulting algorithm in a population-based study in Cuba. Methods The criterion was operationalised as a computerised algorithm, applying clinical principles, based upon the 10/66 cognitive tests, clinical interview and informant reports; the Community Screening Instrument for Dementia, the CERAD 10 word list learning and animal naming tests, the Geriatric Mental State, and the History and Aetiology Schedule – Dementia Diagnosis and Subtype. This was validated in Cuba against a local clinician DSM-IV diagnosis and the 10/66 dementia diagnosis (originally calibrated probabilistically against clinician DSM-IV diagnoses in the 10/66 pilot study). Results The DSM-IV sub-criteria were plausibly distributed among clinically diagnosed dementia cases and controls. The clinician diagnoses agreed better with 10/66 dementia diagnosis than with the more conservative computerized DSM-IV algorithm. The DSM-IV algorithm was particularly likely to miss less severe dementia cases. Those with a 10/66 dementia diagnosis who did not meet the DSM-IV criterion were less cognitively and functionally impaired compared with the DSMIV confirmed cases, but still grossly impaired compared with those free of dementia. Conclusion The DSM-IV criterion, strictly applied, defines a narrow category of unambiguous dementia characterized by marked impairment. It may be specific but incompletely sensitive to clinically relevant cases. The 10/66 dementia diagnosis defines a broader category that may be more sensitive, identifying genuine cases beyond those defined by our DSM-IV algorithm, with relevance to the estimation of the population burden of this disorder. PMID:18577205

  6. 45 CFR Appendix B to Part 1356 - NYTD Youth Outcome Survey

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false NYTD Youth Outcome Survey B Appendix B to Part... APPLICABLE TO TITLE IV-E Pt. 1356, App. B Appendix B to Part 1356—NYTD Youth Outcome Survey Topic/element # Question to youth and response options Definition INFORMATION TO COLLECT FROM ALL YOUTH SURVEYED FOR...

  7. 45 CFR Appendix B to Part 1356 - NYTD Youth Outcome Survey

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 4 2011-10-01 2011-10-01 false NYTD Youth Outcome Survey B Appendix B to Part... APPLICABLE TO TITLE IV-E Pt. 1356, App. B Appendix B to Part 1356—NYTD Youth Outcome Survey Topic/element # Question to youth and response options Definition INFORMATION TO COLLECT FROM ALL YOUTH SURVEYED FOR...

  8. Selenoamino Acid-Enriched Green Pea as a Value-Added Plant Protein Source for Humans and Livestock.

    PubMed

    Garousi, Farzaneh; Domokos-Szabolcsy, Éva; Jánószky, Mihály; Kovács, Andrea Balláné; Veres, Szilvia; Soós, Áron; Kovács, Béla

    2017-06-01

    Selenium deficiency in various degrees affects around 15% of the world's population, contributing to a variety of health problems. In this study, we examined the accumulation and biotransformation of soil applied Se-supplementation (sodium selenite and sodium selenate forms) at different concentrations, along with growth and yield formation of green pea, in a greenhouse experiment. Biotransformation of inorganic Se was evaluated using HPLC-ICP-MS for Se-species separation in the above ground parts of green pea. Results showed 3 mg kg -1 Se IV increased green pea growth biomarkers and also caused an increase in protein content in leaves by 17%. Selenomethionine represented 65% of the total selenium content in shoots, but was lower in pods and seeds (54 and 38%, respectively). Selenomethionine was the major species in all plant parts and the only organic selenium form in the lower Se IV concentration range. Elevating the dose of Se IV (≥30 mg kg -1 ) triggered detrimental effects on growth and protein content and caused higher accumulation of inorganic Se in forms of Se VI and Se IV . Selenocysteine, another organic form of proteinogenic amino acid, was determined when Se IV (≥10 mg kg -1 ) was applied in higher concentrations. Thus, agronomic biofortification using the appropriate chemical form and concentration of Se will have positive effects on green pea growth and its enriched shoots and seeds provide a value-added protein source for livestock and humans with significant increased selenomethionine.

  9. How the 2SLS/IV estimator can handle equality constraints in structural equation models: a system-of-equations approach.

    PubMed

    Nestler, Steffen

    2014-05-01

    Parameters in structural equation models are typically estimated using the maximum likelihood (ML) approach. Bollen (1996) proposed an alternative non-iterative, equation-by-equation estimator that uses instrumental variables. Although this two-stage least squares/instrumental variables (2SLS/IV) estimator has good statistical properties, one problem with its application is that parameter equality constraints cannot be imposed. This paper presents a mathematical solution to this problem that is based on an extension of the 2SLS/IV approach to a system of equations. We present an example in which our approach was used to examine strong longitudinal measurement invariance. We also investigated the new approach in a simulation study that compared it with ML in the examination of the equality of two latent regression coefficients and strong measurement invariance. Overall, the results show that the suggested approach is a useful extension of the original 2SLS/IV estimator and allows for the effective handling of equality constraints in structural equation models. © 2013 The British Psychological Society.

  10. EPR and IR spectral investigations on some leafy vegetables of Indian origin

    NASA Astrophysics Data System (ADS)

    Prasuna, C. P. Lakshmi; Chakradhar, R. P. S.; Rao, J. L.; Gopal, N. O.

    2009-09-01

    EPR spectral investigations have been carried out on four edible leafy vegetables of India, which are used as dietary component in day to day life. In Rumex vesicarius leaf sample, EPR spectral investigations at different temperatures indicate the presence of anti-ferromagnetically coupled Mn(IV)-Mn(IV) complexes. EPR spectra of Trigonella foenum graecum show the presence of Mn ions in multivalent state and Fe 3+ ions in rhombic symmetry. EPR spectra of Basella rubra indicate the presence of Mn(IV)-O-Mn(IV) type complexes. The EPR spectra of Basella rubra have been studied at different temperatures. It is found that the spin population for the resonance signal at g = 2.06 obeys the Boltzmann distribution law. The EPR spectra of Moringa oliefera leaves show the presence of Mn 2+ ions. Radiation induced changes in free radical of this sample have also been studied. The FT-IR spectra of Basella rubra and Moringa oliefera leaves show the evidences for the protein matrix bands and those corresponding to carboxylic C dbnd O bonds.

  11. The Kubo-Greenwood spin-dependent electrical conductivity of 2D transition-metal dichalcogenides and group-IV materials: A Green's function study

    NASA Astrophysics Data System (ADS)

    Hoi, Bui Dinh; Yarmohammadi, Mohsen

    2018-04-01

    The spin-dependent electrical conductivity of counterparts of graphene, transition-metal dichalcogenides (TMDs) and group-IV nanosheets, have investigated by a magnetic exchange field (MEF)-induction to gain the electronic transport properties of charge carriers. We have implemented a k.p Hamiltonian model through the Kubo-Greenwood formalism in order to address the dynamical behavior of correlated Dirac fermions. Tuning the MEF enables one to control the effective mass of carriers in group-IV and TMDs, differently. We have found the Dirac-like points in a new quantum anomalous Hall (QAH) state at strong MEFs for both structures. For both cases, a broad peak in electrical conductivity originated from the scattering rate and entropy is observed. Spin degeneracy at some critical MEFs is another remarkable point. We have found that in the limit of zero or uniform MEFs with respect to the spin-orbit interaction, the large resulting electrical conductivity depends on the spin sub-bands in group-IV and MLDs. Featuring spin-dependent electronic transport properties, one can provide a new scenario for future possible applications.

  12. User Centered, Application Independent Visualization of National Airspace Data

    NASA Technical Reports Server (NTRS)

    Murphy, James R.; Hinton, Susan E.

    2011-01-01

    This paper describes an application independent software tool, IV4D, built to visualize animated and still 3D National Airspace System (NAS) data specifically for aeronautics engineers who research aggregate, as well as single, flight efficiencies and behavior. IV4D was origin ally developed in a joint effort between the National Aeronautics and Space Administration (NASA) and the Air Force Research Laboratory (A FRL) to support the visualization of air traffic data from the Airspa ce Concept Evaluation System (ACES) simulation program. The three mai n challenges tackled by IV4D developers were: 1) determining how to d istill multiple NASA data formats into a few minimal dataset types; 2 ) creating an environment, consisting of a user interface, heuristic algorithms, and retained metadata, that facilitates easy setup and fa st visualization; and 3) maximizing the user?s ability to utilize the extended range of visualization available with AFRL?s existing 3D te chnologies. IV4D is currently being used by air traffic management re searchers at NASA?s Ames and Langley Research Centers to support data visualizations.

  13. Factor Structure of the Wechsler Intelligence Scale for Children: Fourth Edition in Children with ADHD.

    PubMed

    Thaler, Nicholas S; Barchard, Kimberly A; Parke, Elyse; Jones, W Paul; Etcoff, Lewis M; Allen, Daniel N

    2015-12-01

    Recent evidence suggests that the factor structure of the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) is better explained by a five-factor model rather than the four-factor model in the standardization sample. The current study examined the WISC-IV's factor structure in a sample of children with ADHD. Participants included 314 children and adolescents who were diagnosed with ADHD. Confirmatory factor analysis was conducted on the 10 core subtests of the WISC-IV, and three models were examined including two based on Cattell-Horn-Carroll (CHC) theory. A five-factor model consisting of Gc, Gf, Gv, Gsm, and Gs factors provided the best fit for the data. The Perceptual Reasoning factor identified in the original four-factor model split into the two CHC factors, Gf and Gv, and cross-loaded the Symbol Search subtest onto the Gv factor. A five-factor model based on CHC theory provided superior fit for the WISC-IV in children with ADHD, as has been found with the standardization sample. © The Author(s) 2012.

  14. 14 CFR 406.113 - Filing documents with the Docket Management System (DMS) and sending documents to the...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... white paper. (ii) On paper not larger than 81/2 by 11 inches. (iii) In black ink. (iv) Text double... 1 inch on each side. (vii) The original not bound or hole-punched, only held together with removable...

  15. 14 CFR 406.113 - Filing documents with the Docket Management System (DMS) and sending documents to the...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... white paper. (ii) On paper not larger than 81/2 by 11 inches. (iii) In black ink. (iv) Text double... 1 inch on each side. (vii) The original not bound or hole-punched, only held together with removable...

  16. Information Protection

    DTIC Science & Technology

    1987-07-01

    changes for title page and front matter Version 1.1 (April 1987) slight cosmetic changes Version 1.0 (September 1986) original version iv SEI-CM-5-1.2...ramifications. The subject/object matrix is introduced as a method for understanding Fenton73 protection systems, and it is noteworthy that this Fenton , J

  17. 34 CFR 685.402 - Criteria for schools to originate loans.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... severe performance deficiencies for any of the programs under title IV of the Act, including deficiencies... performance standards established by the Secretary, including but not limited to— (A) Eligibility under... fails to meet the criteria and performance standards established by the Secretary, including but not...

  18. 12 CFR 1282.14 - Special Affordable Housing Goal.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...”) Insurance Program, 12 U.S.C. 1715z-20; mortgages guaranteed under the Rural Housing Service's Single Family...-going, sustainable efforts to ensure that additional loans that meet the goal are originated. (iv... of the Community Support Program; or (B) Community development credit unions; community development...

  19. Ion channel recordings on an injection-molded polymer chip.

    PubMed

    Tanzi, Simone; Matteucci, Marco; Christiansen, Thomas Lehrmann; Friis, Søren; Christensen, Mette Thylstrup; Garnaes, Joergen; Wilson, Sandra; Kutchinsky, Jonatan; Taboryski, Rafael

    2013-12-21

    In this paper, we demonstrate recordings of the ion channel activity across the cell membrane in a biological cell by employing the so-called patch clamping technique on an injection-molded polymer microfluidic device. The findings will allow direct recordings of ion channel activity to be made using the cheapest materials and production platform to date and with the potential for very high throughput. The employment of cornered apertures for cell capture allowed the fabrication of devices without through holes and via a scheme comprising master origination by dry etching in a silicon substrate, electroplating in nickel and injection molding of the final part. The most critical device parameters were identified as the length of the patching capillary and the very low surface roughness on the inside of the capillary. The cross-sectional shape of the orifice was found to be less critical, as both rectangular and semicircular profiles seemed to have almost the same ability to form tight seals with cells with negligible leak currents. The devices were functionally tested using human embryonic kidney cells expressing voltage-gated sodium channels (Nav1.7) and benchmarked against a commercial state-of-the-art system for automated ion channel recordings. These experiments considered current-voltage (IV) relationships for activation and inactivation of the Nav1.7 channels and their sensitivity to a local anesthetic, lidocaine. Both IVs and lidocaine dose-response curves obtained from the injection-molded polymer device were in good agreement with data obtained from the commercial system.

  20. Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, K. R.

    1994-01-01

    Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

  1. Age 60 study, part IV : experimental evaluation of pilot performance.

    DOT National Transportation Integrated Search

    1994-10-01

    This document is one of four products completed as a part of the Age 60 Rule Research Contract monitored by Pam Della Rocco, Civil Aerospace Medical Institute. This report was a deliverable from the research contract with Hilton Systems, Inc. on the ...

  2. Structural study of VO {sub x} doped aluminium fluoride and aluminium oxide catalysts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scheurell, Kerstin; Scholz, Gudrun; Kemnitz, Erhard

    The structural properties of vanadium doped aluminium oxyfluorides and aluminium oxides, prepared by a modified sol-gel synthesis route, were thoroughly investigated. The influence of the preparation technique and the calcination temperature on the coordination of vanadium, aluminium and fluorine was analysed by different spectroscopic methods such as Raman, MAS NMR and ESR spectroscopy. In all samples calcined at low temperatures (350 deg. C), vanadium coexists in two oxidation states V{sup IV} and V{sup V}, with V{sup IV} as dominating species in the vanadium doped aluminium oxyfluorides. In the fluoride containing solids aluminium as well as vanadium are coordinated by fluorinemore » and oxygen. Thermal annealing of 800 deg. C leads to an extensive reorganisation of the original matrices and to the oxidation of V{sup IV} to V{sup V} in both systems. - Graphical abstract: Structure model for VO {sub x} doped aluminium oxide.« less

  3. Spectral synthesis in the ultraviolet. II - Stellar populations and star formation in blue compact galaxies

    NASA Technical Reports Server (NTRS)

    Fanelli, Michael N.; O'Connell, Robert W.; Thuan, Trinh X.

    1988-01-01

    An initial attempt to apply optimizing spectral synthesis techniques to the far-UV spectra of blue compact galaxies (BCGs) is presented. The far-UV absorption-line spectra of the galaxies are clearly composite, with the signatures of the main-sequence types between O3 and mid-A. Most of the low-ionization absorption lines have a stellar origin. The Si IV and C IV features in several objects have P Cygni profiles. In Haro I the strength of Si IV indicates a significant blue supergiant population. The metal-poor blue compact dwarf Mrk 209 displays weak absorption lines, evidence that the stellar component has the same low metallicity as observed in the ionized gas. Good fits to the data are obtained the technique of optimizing population synthesis. The solutions yield stellar luminosity functions which display large discontinuities, indicative of discrete star formation episodes or bursts. The amount of UV extinction is low.

  4. KSC00padig072

    NASA Image and Video Library

    2000-11-02

    Center Director Roy Bridges addresses the audience at the commissioning of a new high-pressure helium pipeline at Kennedy Space Center that will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS); Col. Samuel Dick, representative of the 45th Space Wing; Ramon Lugo, acting executive director, JPMO; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS

  5. KSC-00padig072

    NASA Image and Video Library

    2000-11-02

    Center Director Roy Bridges addresses the audience at the commissioning of a new high-pressure helium pipeline at Kennedy Space Center that will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS); Col. Samuel Dick, representative of the 45th Space Wing; Ramon Lugo, acting executive director, JPMO; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS

  6. KSC-00padig073

    NASA Image and Video Library

    2000-11-02

    Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS) presents an award of appreciation to H.T. Everett, KSC Propellants manager, at the commissioning of a new high-pressure helium pipeline at Kennedy Space Center. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Center Director Roy Bridges;); Col. Samuel Dick, representative of the 45th Space Wing; Ramon Lugo, acting executive director, JPMO; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS

  7. KSC-00padig071

    NASA Image and Video Library

    2000-11-02

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, Ramon Lugo, acting executive director, JPMO , presents a plaque to Center Director Roy Bridges. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS); Col. Samuel Dick, representative of the 45th Space Wing; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad

  8. KSC-00padig070

    NASA Image and Video Library

    2000-11-02

    Jerry Jorgensen welcomes the audience to the commissioning of a new high-pressure helium pipeline at Kennedy Space Center. Jorgensen, with Space Gateway Support (SGS), is the pipeline project manager. To the right is Ramon Lugo, acting executive director, JPMO. Others at the ceremony were Center Director Roy Bridges; Col. Samuel Dick, representative of the 45th Space Wing; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad

  9. KSC00padig071

    NASA Image and Video Library

    2000-11-02

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, Ramon Lugo, acting executive director, JPMO , presents a plaque to Center Director Roy Bridges. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS); Col. Samuel Dick, representative of the 45th Space Wing; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad

  10. KSC00padig073

    NASA Image and Video Library

    2000-11-02

    Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS) presents an award of appreciation to H.T. Everett, KSC Propellants manager, at the commissioning of a new high-pressure helium pipeline at Kennedy Space Center. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Center Director Roy Bridges;); Col. Samuel Dick, representative of the 45th Space Wing; Ramon Lugo, acting executive director, JPMO; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS

  11. Commissioning of a new helium pipeline

    NASA Technical Reports Server (NTRS)

    2000-01-01

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, Ramon Lugo, acting executive director, JPMO , presents a plaque to Center Director Roy Bridges. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS); Col. Samuel Dick, representative of the 45th Space Wing; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch's worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad.

  12. Commissioning of a new helium pipeline

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS) presents an award of appreciation to H.T. Everett, KSC Propellants manager, at the commissioning of a new high-pressure helium pipeline at Kennedy Space Center. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch's worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Center Director Roy Bridges;); Col. Samuel Dick, representative of the 45th Space Wing; Ramon Lugo, acting executive director, JPMO; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS.

  13. Commissioning of a new helium pipeline

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Jerry Jorgensen welcomes the audience to the commissioning of a new high-pressure helium pipeline at Kennedy Space Center. Jorgensen, with Space Gateway Support (SGS), is the pipeline project manager. To the right is Ramon Lugo, acting executive director, JPMO. Others at the ceremony were Center Director Roy Bridges; Col. Samuel Dick, representative of the 45th Space Wing; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS. The pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile-long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch's worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad.

  14. Commissioning of a new helium pipeline

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Center Director Roy Bridges addresses the audience at the commissioning of a new high-pressure helium pipeline at Kennedy Space Center that will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. The nine-mile- long buried pipeline will also serve as a backup helium resource for Shuttle launches. Nearly one launch's worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS); Col. Samuel Dick, representative of the 45th Space Wing; Ramon Lugo, acting executive director, JPMO; David Herst, director, Delta IV Launch Sites; Pierre Dufour, president and CEO, Air Liquide America Corporation; and Michael Butchko, president, SGS.

  15. Hunting grounds for Jacobi transitions and hyperdeformations

    DOE PAGES

    Herskind, B.; Benzoni, G.; Wilson, J. N.; ...

    2003-04-01

    In recent attempts to search for exotic shapes, hyperdeformation (HD), and Jacobi transitions in Hf, Ba, Xe, Sn and Nd nuclei, ridge structures presumably originating from nuclei of very elongated shapes have been observed in 126Ba, with Gammasphere (GS) and in 126Xe, with Euroball-IV (EB-IV). After the promising results from GS, a second experiment in 126Ba followed at EB-IV, taking advantage of the use of the BGO Inner Ball (IB) for selecting the highest spins. The decay of the Giant Dipole Resonances (GDR) is also studied, and the analysis in progress. The Quasi-continuum transitions in the Jacobi region, show amore » significant decrease in energy for both 126Ba and 126Xe, compared to the Thomas-Fermi- and the LSD model predictions. Similar effects were recently found for other nuclei by Ward et al.« less

  16. Microbial oxidation of elemental selenium in soil slurries and bacterial cultures

    USGS Publications Warehouse

    Dowdle, P.R.; Oremland, R.S.

    1998-01-01

    The microbial oxidation of elemental selenium [Se(O)] was studied by employing 75Se(O) as a tracer. Live, oxic soil slurries demonstrated a linear production of mostly Se(IV), with the formation of smaller quantities of Se(VI). Production of both Se(IV) and Se(VI) was inhibited by autoclaving, formalin, antibiotics, azide, and 2,4-dinitrophenol, thereby indicating the involvement of microbes. Oxidation of Se(O) in slurries was enhanced by addition of acetate, glucose, or sulfide, which implied involvement of chemoheterotrophs as well as chemoautotrophic thiobacilli. Cultures of Thiobacillus ASN-1, Leptothrix MnB1, and a heterotrophic soil enrichment all oxidized Se(O) with Se(VI) observed as the major product rather than Se(IV). This indicated that microbial oxidation in soils is partly constrained by the adsorption of Se(IV) onto soil surfaces. Rate constants for unamended soil slurry Se(O) oxidation ranged from 0.0009 to 0.0117 day-1 which were 3-4 orders of magnitude lower than those reported for dissimilatory Se(VI) reduction in organic-rich, anoxic sediments.The microbial oxidation of elemental selenium [Se(0)] was studied by employing 75Se(0) as a tracer. Live, oxic soil slurries demonstrated a linear production of mostly Se(IV), with the formation of smaller quantities of Se(VI). Production of both Se(IV) and Se(VI) was inhibited by autoclaving, formalin, antibiotics, azide, and 2,4-dinitrophenol, thereby indicating the involvement of microbes. Oxidation of Se(O) in slurries was enhanced by addition of acetate, glucose, or sulfide, which implied involvement of chemoheterotrophs as well as chemoautotrophic thiobacilli. Cultures of Thiobacillus ASN-1, Leptothrix MnB1, and a heterotrophic soil enrichment all oxidized Se(O) with Se(VI) observed as the major product rather than Se(IV). This indicated that microbial oxidation in soils is partly constrained by the adsorption of Se(IV) onto soil surfaces. Rate constants for unamended soil slurry Se(O) oxidation ranged from 0.0009 to 0.0117 day-1 which were 3-4 orders of magnitude lower than those reported for dissimilatory Se(VI) reduction in organic-rich, anoxic sediments.

  17. 46 CFR 160.151-21 - Equipment required for SOLAS A and SOLAS B inflatable liferafts.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...), Chapter IV/4.1.5.1.7 and ISO 18813). Each sharp part of a tin-opener must have a guard. (h) First-aid kit... approval series 160.061. (r) Food rations (IMO LSA Code, as amended by Resolution MSC.293(87), Chapter IV/4.1.5.1.18) The food rations must be approved by the Commandant under approval series 160.046. (s...

  18. 46 CFR 160.151-21 - Equipment required for SOLAS A and SOLAS B inflatable liferafts.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...), Chapter IV/4.1.5.1.7 and ISO 18813). Each sharp part of a tin-opener must have a guard. (h) First-aid kit... approval series 160.061. (r) Food rations (IMO LSA Code, as amended by Resolution MSC.293(87), Chapter IV/4.1.5.1.18) The food rations must be approved by the Commandant under approval series 160.046. (s...

  19. 46 CFR 160.151-21 - Equipment required for SOLAS A and SOLAS B inflatable liferafts.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...), Chapter IV/4.1.5.1.7 and ISO 18813). Each sharp part of a tin-opener must have a guard. (h) First-aid kit... approval series 160.061. (r) Food rations (IMO LSA Code, as amended by Resolution MSC.293(87), Chapter IV/4.1.5.1.18) The food rations must be approved by the Commandant under approval series 160.046. (s...

  20. Gen IV Materials Handbook Beta Release for Structural and Functional Evaluation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Weiju; Luttrell, Claire

    2006-09-12

    Development of the Gen IV Materials Handbook is briefly summarized up to date. Current status of the Handbook website construction is described. The developed Handbook components and access control of the beta version are discussed for the present evaluation release. Detailed instructions and examples are given to provide guidance for evaluators to browse the constructed parts and use all the currently developed functionalities of the Handbook in evaluation.

  1. A simpler definition of major depressive disorder.

    PubMed

    Zimmerman, M; Galione, J N; Chelminski, I; McGlinchey, J B; Young, D; Dalrymple, K; Ruggero, C J; Witt, C Francione

    2010-03-01

    The DSM-IV symptom criteria for major depressive disorder (MDD) are somewhat lengthy, with many studies showing that treatment providers have difficulty recalling all nine symptoms. Moreover, the criteria include somatic symptoms that are difficult to apply in patients with medical illnesses. In a previous report, we developed a briefer definition of MDD that was composed of the mood and cognitive symptoms of the DSM-IV criteria, and found high levels of agreement between the simplified and full DSM-IV definitions. The goal of the present study was to replicate these findings in another large sample of psychiatric out-patients and to extend the findings to other patient samples. We interviewed 1100 psychiatric out-patients and 210 pathological gamblers presenting for treatment and 1200 candidates for bariatric surgery. All patients were interviewed by a diagnostic rater who administered a semi-structured interview. We inquired about all symptoms of depression for all patients. In all three samples high levels of agreement were found between the DSM-IV and the simpler definition of MDD. Summing across all 2510 patients, the level of agreement between the two definitions was 95.5% and the kappa coefficient was 0.87. After eliminating the four somatic criteria from the DSM-IV definition of MDD, a high level of concordance was found between this simpler definition and the original DSM-IV classification. This new definition offers two advantages over the current DSM-IV definition--it is briefer and it is easier to apply with medically ill patients because it is free of somatic symptoms.

  2. Method for separating actinides. [Patent application; stripping of Np from organic extractant

    DOEpatents

    Friedman, H.A.; Toth, L.M.

    1980-11-10

    An organic solution used for processing spent nuclear reactor fuels is contacted with an aqueous nitric acid solution to strip Np(VI), U(VI), and Pu(IV) from the organic solution into the acid solution. The acid solution is exposed to ultraviolet light, which reduces Np(VI) to Np(V) without reducing U(VI) and Pu(IV). Since the solubility of Np(V) in the organic solution is much lower than that of Np(VI), U(VI), and Pu(IV), a major part of the Np is stripped from the organic solution while leaving most of the U and Pu therein.

  3. Synthesis of Unsupported d(1)-d(x) Oxido-Bridged Heterobimetallic Complexes Containing V(IV): A New Direction for Metal-to-Metal Charge Transfer.

    PubMed

    Wu, Xinyuan; Huang, Tao; Lekich, Travis T; Sommer, Roger D; Weare, Walter W

    2015-06-01

    Heterobimetallic complexes composed only of first-row transition metals [(TMTAA)V(IV)═O→M(II)Py5Me2](OTf)2 (TMTAA = 7,16-dihydro-6,8,15,17-tetramethyldibenzo[b,i][1,4,8,11]tetraazacyclotetradecine; Py5Me2 = 2,6-bis(1,1-bis(2-pyridyl)ethyl)pyridine; M = Mn(II), Fe(II), Co(II), Ni(II), Cu(II); OTf = trifluoromethanesulfonate) have been synthesized through a dative interaction between a terminal oxido and M(II) metal centers. This is the first series of V(IV)═O→M(II) heterobimetallic complexes containing an unsupported oxido bridge. Among these five complexes, only V(IV)═O→Fe(II) (3b) has a clear new absorption band upon formation of the dinuclear species (502 nm, ε = 1700 M(-1) cm(-1)). This feature is assigned to a metal-to-metal charge transfer (MMCT) transition from V(IV) to Fe(II), which forms a V(V)-O-Fe(I) excited state. This assignment is supported by electrochemical data, electronic absorption profiles, and resonance Raman spectroscopy and represents the first report of visible-light induced MMCT in a heterobimetallic oxido-bridged molecule where the electron originates on a d(1) metal center.

  4. The First Detection of [O IV] from an Ultraluminous X-ray Source with Spitzer. II. Evidence for High Luminosity in Holmberg II ULX

    NASA Technical Reports Server (NTRS)

    Berghea, C. T.; Dudik, R. P.; Weaver, K. A.; Kallman, T. R.

    2009-01-01

    This is the second of two papers examining Spitzer Infrared Spectrograph (IRS) observations of the ultraluminous X-ray source (ULX) in Holmberg II. Here we perform detailed photoionization modeling of they infrared lines. Our analysis suggests that the luminosity and morphology of the [O IV] 25.89 micron emission line is consistent with photoionization by the soft X-ray and far ultraviolet (FUV) radiation from the accretion disk of the binary system and inconsistent with narrow beaming. We show that the emission nebula is matter-bounded both in the line of sight direction and to the east, and probably radiation-bounded to the west. A bolometric luminosity in excess of 1040 erg per second would be needed to produce the measured [O IV] flux. We use modeling and previously published studies to conclude that shacks likely contribute very little, if at all, to the high excitation line fluxes observed in the Holmberg II ULX. Additionally, we find that the spectral type of the companion star has a surprisingly strong effect on they predicted strength of the [O IV] emission. This finding could explain the origin of [O IV] hi some starburst systems containing black hole binaries.

  5. The First Detection of [O IV] from an Ultraluminous X-ray Source with Spitzer. 2; Evidence for High Luminosity in Holmberg II ULX

    NASA Technical Reports Server (NTRS)

    Berghea, C. T.; Dudik, R. P.; Weaver, K. A.; Kallman, T. R.

    2009-01-01

    This is the second of two papers examining Spitzer Infrared Spectrograph (IRS) observations of the ultraluminous X-ray source (ULX) in Holmberg II. Here we perform detailed photoionization modeling of the infrared lines. Our analysis suggests that the luminosity and morphology of the [O IV] 25.89 micron emission line is consistent with photoionization by the soft X-ray and far ultraviolet (FUV) radiation from the accretion disk of the binary system and inconsistent with narrow beaming. We show that the emission nebula is matter-bounded both in the line of sight direction and to the east, and probably radiation-bounded to the west. A bolometric luminosity in excess of 10(exp 40) erg/s would be needed to produce the measured [O IV] flux. We use modeling and previously published studies to conclude that shocks likely contribute very little, if at all, to the high-excitation line fluxes observed in the Holmberg II ULX. Additionally, we find that the spectral type of the companion star has a surprisingly strong effect on the predicted strength of the [O IV] emission. This finding could explain the origin of [O IV] in some starburst systems containing black hole binaries.

  6. A MASSIVE RUNAWAY STAR FROM 30 DORADUS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Evans, C. J.; Walborn, N. R.; Massa, D.

    2010-06-01

    We present the first ultraviolet (UV) and multi-epoch optical spectroscopy of 30 Dor 016, a massive O2-type star on the periphery of 30 Doradus in the Large Magellanic Cloud. The UV data were obtained with the Cosmic Origins Spectrograph on the Hubble Space Telescope as part of the Servicing Mission Observatory Verification program after Servicing Mission 4, and reveal no. 016 to have one of the fastest stellar winds known. From analysis of the C IV {lambda}{lambda}1548-51 doublet we find a terminal velocity, v {sub {infinity}} = 3450 {+-} 50 km s{sup -1}. Optical spectroscopy is from the VLT-FLAMES Tarantulamore » Survey, from which we rule out a massive companion (with 2 days < P < 1 yr) to a confidence of 98%. The radial velocity of no. 016 is offset from the systemic value by -85 km s{sup -1}, suggesting that the star has traveled the 120 pc from the core of 30 Doradus as a runaway, ejected via dynamical interactions.« less

  7. Decomposing the permeability spectra of nanocrystalline finemet core

    NASA Astrophysics Data System (ADS)

    Varga, Lajos K.; Kovac, Jozef

    2018-04-01

    In this paper we present a theoretical and experimental investigation on the magnetization contributions to permeability spectra of normal annealed Finemet core with round type hysteresis curve. Real and imaginary parts of the permeability were determined as a function of exciting magnetic field (HAC) between 40 Hz -110 MHz using an Agilent 4294A type Precision Impedance Analyzer. The amplitude of the exciting field was below and around the coercive field of the sample. The spectra were decomposed using the Levenberg-Marquardt algorithm running under Origin 9 software in four contributions: i) eddy current; ii) Debye relaxation of magnetization rotation, iii) Debye relaxation of damped domain wall motion and iv) resonant type DW motion. For small exciting amplitudes the first two components dominate. The last two contributions connected to the DW appear for relative large HAC only, around the coercive force. All the contributions will be discussed in detail accentuating the role of eddy current that is not negligible even for the smallest applied exciting field.

  8. Results of the IRIS UV Burst Survey, Part I: Active Regions Tracked Limb to Limb

    NASA Astrophysics Data System (ADS)

    Madsen, C. A.; DeLuca, E.

    2017-12-01

    We present results from the first phase of an effort to thoroughly characterize UV bursts within the Interface Region Imaging Spectrograph (IRIS) data catalogue. The observational signatures of these phenomena include dramatically intensified and broadened NUV/FUV emission line profiles with absorption features from cool metallic ions. These properties suggest that UV bursts originate from plasma at transition region temperatures (≥ 80,000 K) which is deeply embedded in the cool lower chromosphere ( 5,000 K). Rigorously characterizing the energetic and dynamical properties of UV bursts is crucial since they have considerable potential to heat active region chromospheres and could provide critical constraints for models of magnetic reconnection in these regions. The survey first focuses on IRIS observations of active regions tracked from limb to limb. All observations consist of large field-of-view raster scans of 320 or 400 steps each, which allow for widespread detection of many burst profiles at the expense of having limited short-term time evolution information. We detect bursts efficiently by applying a semi-automated single-Gaussian fitting technique to Si IV 1393.8 Å emission profiles that isolates the distinct burst population in a 4-D parameter space. The robust sample of NUV/FUV burst spectra allows for precise constraints of properties critical for modeling reconnection in the chromosphere, including outflow kinetic energy, density estimates from intensity ratios of Si IV 1402.8 Å and O IV 1401.2 Å emission lines, and coincident measures of emission in other wavelengths. We also track burst properties throughout the lifetimes of their host active regions, noting changes in detection rate and preferential location as the active regions evolve. Finally, the tracked active region observations provide a unique opportunity to investigate line-of-sight effects on observed UV burst spectral properties, particularly the strength of Ni II 1393.3 Å absorption, a feature that may be important in identifying the upward conduction of burst thermal energy through the chromosphere.

  9. 24 CFR 982.202 - How applicants are selected: General requirements.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... residency preference (see § 982.207). (2) Where family will live. Admission to the program may not be based... preference system may provide a preference for admission of families with certain characteristics from the...) Discrimination because of age, race, color, religion, sex, or national origin; (iv) Discrimination because of...

  10. 46 CFR 388.3 - Application and fee.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ..., including geographic region of intended operation and trade. (iv) Date and place of construction and (if applicable) rebuilding. (If applicant is unable to document the origin of the vessel, foreign construction will be assumed). (v) Name, address, and telephone number of the vessel owner. (vi) A statement on the...

  11. 75 FR 6673 - Expert Meeting on Measurement Criteria for Children's Health Insurance Program; Reauthorization...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-10

    ... on Measurement Criteria for Children's Health Insurance Program; Reauthorization Act Pediatric... enacted in the Children's Health Insurance Program Reauthorization Act (CHIPRA). DATES: The meeting will...) reauthorized the Child Health Insurance Program (CHIP) originally established in 1997, and in Title IV of the...

  12. 12 CFR 1282.1 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... for unoccupied units may be the market rent for similar units in the neighborhood as determined by the..., Pakistan, the Philippine Islands, Thailand, and Vietnam; (iii) Black or African American—a person having origins in any of the black racial groups of Africa; (iv) Hispanic or Latino—a person of Cuban, Mexican...

  13. 12 CFR 1282.1 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... for unoccupied units may be the market rent for similar units in the neighborhood as determined by the..., Japan, Korea, Malaysia, Pakistan, the Philippine Islands, Thailand, and Vietnam; (iii) Black or African American—a person having origins in any of the black racial groups of Africa; (iv) Hispanic or Latino—a...

  14. 12 CFR 1282.1 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... for unoccupied units may be the market rent for similar units in the neighborhood as determined by the..., Japan, Korea, Malaysia, Pakistan, the Philippine Islands, Thailand, and Vietnam; (iii) Black or African American—a person having origins in any of the black racial groups of Africa; (iv) Hispanic or Latino—a...

  15. 12 CFR 1282.1 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... for unoccupied units may be the market rent for similar units in the neighborhood as determined by the..., Japan, Korea, Malaysia, Pakistan, the Philippine Islands, Thailand, and Vietnam; (iii) Black or African American—a person having origins in any of the black racial groups of Africa; (iv) Hispanic or Latino—a...

  16. 75 FR 57029 - Agency Information Collection Activities: Proposed Collection; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-17

    ... major initiative designed to: (1) Prevent the onset and reduce the progression of substance abuse... IV evaluation have necessitated some streamlining of the original evaluation design. Since the... implementation and change in the NOMs. Information for both surveys will be gathered by the grantees' evaluators...

  17. 24 CFR 983.57 - Site selection standards.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... families and in relation to the racial mix of the locality's population. (iv) Units may be considered... constructed or rehabilitated in the past 10 years, relative to the racial mix of the eligible population. (C... discrimination on the basis of race, color, religion, sex, national origin, age, familial status, or disability...

  18. 24 CFR 983.57 - Site selection standards.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... families and in relation to the racial mix of the locality's population. (iv) Units may be considered... constructed or rehabilitated in the past 10 years, relative to the racial mix of the eligible population. (C... discrimination on the basis of race, color, religion, sex, national origin, age, familial status, or disability...

  19. 24 CFR 983.57 - Site selection standards.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... families and in relation to the racial mix of the locality's population. (iv) Units may be considered... constructed or rehabilitated in the past 10 years, relative to the racial mix of the eligible population. (C... discrimination on the basis of race, color, religion, sex, national origin, age, familial status, or disability...

  20. 45 CFR Appendix B to Part 1356 - NYTD Youth Outcome Survey

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 45 Public Welfare 4 2014-10-01 2014-10-01 false NYTD Youth Outcome Survey B Appendix B to Part... APPLICABLE TO TITLE IV-E Pt. 1356, App. B Appendix B to Part 1356—NYTD Youth Outcome Survey Topic/element No. Question to youth and response options Definition INFORMATION TO COLLECT FROM ALL YOUTH SURVEYED FOR...

  1. 45 CFR Appendix B to Part 1356 - NYTD Youth Outcome Survey

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 4 2012-10-01 2012-10-01 false NYTD Youth Outcome Survey B Appendix B to Part... APPLICABLE TO TITLE IV-E Pt. 1356, App. B Appendix B to Part 1356—NYTD Youth Outcome Survey Topic/element No. Question to youth and response options Definition INFORMATION TO COLLECT FROM ALL YOUTH SURVEYED FOR...

  2. 45 CFR Appendix B to Part 1356 - NYTD Youth Outcome Survey

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 45 Public Welfare 4 2013-10-01 2013-10-01 false NYTD Youth Outcome Survey B Appendix B to Part... APPLICABLE TO TITLE IV-E Pt. 1356, App. B Appendix B to Part 1356—NYTD Youth Outcome Survey Topic/element No. Question to youth and response options Definition INFORMATION TO COLLECT FROM ALL YOUTH SURVEYED FOR...

  3. Pilot Judgment Training and Evaluation. Volume 3.

    DTIC Science & Technology

    1982-06-01

    Information Manual. 3-1 8. Flight computer . _ 9. Basic navigation: aeronautical charts (sectional and world 4- aeronautical charts); airspace... clouds , traffic, etc., when you needed to and still maintained the course. 4-13 I___________________ -- -I ~ =~- I- -- INSTRUCTOR LESSON PLAN PART I...maintain basic VFR. PART III Observable Behavior Sought: The student will make proper diversions from clouds to maintain basic VFR. PART IV Reinforcements

  4. 45 CFR Appendix C to Part 1356 - Calculating Sample Size for NYTD Follow-Up Populations

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 45 Public Welfare 4 2013-10-01 2013-10-01 false Calculating Sample Size for NYTD Follow-Up Populations C Appendix C to Part 1356 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE... REQUIREMENTS APPLICABLE TO TITLE IV-E Pt. 1356, App. C Appendix C to Part 1356—Calculating Sample Size for NYTD...

  5. Ultraviolet continuum absorption /less than about 1000 A/ above the quiet sun transition region

    NASA Technical Reports Server (NTRS)

    Doschek, G. A.; Feldman, U.

    1982-01-01

    Lyman continuum absorption shortward of 912 A in the quiet sun solar transition region is investigated by combining spectra obtained from the Apollo Telescope Mount experiments on Skylab. The most recent atomic data are used to compute line intensities for lines that fall on both sides of the Lyman limit. Lines of O III, O IV, O V, and S IV are considered. The computed intensity ratios of most lines from O IV, O V, and S IV agree with the experimental ratios to within a factor of 2. However, the discrepancies show no apparent wavelength dependence. From this fact, it is concluded that at least part of the discrepancy between theory and observation for lines of these ions can be accounted for by uncertainties in instrumental calibration and atomic data. However, difficulties remain in reconciling observation and theory, particularly for lines of O III, and one line of S IV. The other recent results of Schmahl and Orrall (1979) are also discussed in terms of newer atomic data.

  6. 48 CFR 252.246-7003 - Notification of Potential Safety Issues.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    .... Critical safety item means a part, subassembly, assembly, subsystem, installation equipment, or support... impact for systems, or subsystems, assemblies, subassemblies, or parts integral to a system, acquired by... the extent known at the time of notification; (iv) A point of contact to coordinate problem analysis...

  7. 48 CFR 252.246-7003 - Notification of Potential Safety Issues.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    .... Critical safety item means a part, subassembly, assembly, subsystem, installation equipment, or support... impact for systems, or subsystems, assemblies, subassemblies, or parts integral to a system, acquired by... the extent known at the time of notification; (iv) A point of contact to coordinate problem analysis...

  8. 48 CFR 252.246-7003 - Notification of Potential Safety Issues.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    .... Critical safety item means a part, subassembly, assembly, subsystem, installation equipment, or support... impact for systems, or subsystems, assemblies, subassemblies, or parts integral to a system, acquired by... the extent known at the time of notification; (iv) A point of contact to coordinate problem analysis...

  9. 48 CFR 252.246-7003 - Notification of Potential Safety Issues.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    .... Critical safety item means a part, subassembly, assembly, subsystem, installation equipment, or support... impact for systems, or subsystems, assemblies, subassemblies, or parts integral to a system, acquired by... the extent known at the time of notification; (iv) A point of contact to coordinate problem analysis...

  10. 48 CFR 252.246-7003 - Notification of Potential Safety Issues.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    .... Critical safety item means a part, subassembly, assembly, subsystem, installation equipment, or support... impact for systems, or subsystems, assemblies, subassemblies, or parts integral to a system, acquired by... the extent known at the time of notification; (iv) A point of contact to coordinate problem analysis...

  11. 45 CFR 286.35 - What are proper uses of Tribal Family Assistance Grant funds?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... AND HUMAN SERVICES TRIBAL TANF PROVISIONS Tribal TANF Funding § 286.35 What are proper uses of Tribal... State plans for Parts A or F of title IV of the Social Security Act, as such parts were in effect on...

  12. 45 CFR 286.35 - What are proper uses of Tribal Family Assistance Grant funds?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... AND HUMAN SERVICES TRIBAL TANF PROVISIONS Tribal TANF Funding § 286.35 What are proper uses of Tribal... State plans for Parts A or F of title IV of the Social Security Act, as such parts were in effect on...

  13. 76 FR 34541 - Child and Adult Care Food Program Improving Management and Program Integrity

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-13

    ... Vol. 76 Monday, No. 113 June 13, 2011 Part IV Department of Agriculture Food and Nutrition Service 7 CFR Parts 210, 215, 220 et al. Child and Adult Care Food Program Improving Management and Program... Regulations#0;#0; [[Page 34542

  14. 48 CFR 1436.270-5 - Part IV-Representations and instructions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... for award. Identify all factors that will be considered in awarding the contract (See, for example... THE INTERIOR SPECIAL CATEGORIES OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Special Aspects of Contracting for Construction 1436.270-5 Part IV—Representations and instructions. The CO shall...

  15. 48 CFR 1436.270-5 - Part IV-Representations and instructions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... for award. Identify all factors that will be considered in awarding the contract (See, for example... THE INTERIOR SPECIAL CATEGORIES OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Special Aspects of Contracting for Construction 1436.270-5 Part IV—Representations and instructions. The CO shall...

  16. (Docket A-93-02) Category IV-G: Post-Hearing Comments

    EPA Pesticide Factsheets

    This Index lists comments received after scheduled hearings related to the decision to certify that the Department of Energy had met the compliance criteria established by EPA in 40 CFR Part 194 and the disposal regulations set by EPA in 40 CFR Part 191.

  17. Considerations of Alloy 617 Application in the Gen IV Nuclear Reactor Systems - Part II: Metallurgical Property Challenges

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Weiju

    2010-01-01

    Alloy 617 is currently considered as a leading candidate material for high temperature components in the Gen IV Nuclear Reactor Systems. Because of the unprecedented severe working conditions beyond its commercial service experience required by the Gen IV systems, the alloy faces various challenges in both mechanical and metallurgical properties. Following a previous paper discussing the mechanical property challenges, this paper is focused on the challenges and issues in metallurgical properties of the alloy for the intended nuclear application. Considerations are given in details about its metallurgical stability and aging evolution, aging effects on mechanical properties, potential Co hazard, andmore » internal oxidation. Some research and development activities are suggested with discussions on viability to satisfy the Gen IV Nuclear Reactor System needs.« less

  18. From Matter to Life

    NASA Astrophysics Data System (ADS)

    Imari Walker, Sara; Davies, Paul C. W.; Ellis, George F. R.

    2017-02-01

    1. Introduction Sara Imari Walker, Paul C. W. Davies and F. R. Ellis; Part I. Physics and Life: 2. The 'hard problem' of life Sara Imari Walker and Paul C. W. Davies; 3. Beyond initial conditions and laws of motion: constructor theory of information and life Chiara Marletto; Part II. Bio from Bit: 4. (How) did information emerge? Anne-Marie Grisogono; 5. On the emerging codes for chemical evolution Jillian E. Smith-Carpenter, Sha Li, Jay T. Goodwin, Anil K. Mehta and David G. Lynn; 6. Digital and analogue information in organisms Denis Noble; 7. From entropy to information: biased typewriters and the origin of life Christoph Adami and Thomas Labar; Part III. Life's Hidden Information: 8. Cryptographic nature David Krakauer; 9. Noise and function Steven Weinstein and Theodore Pavlic; 10. The many faces of state space compression David Wolpert, Eric Libby, Joshua Grochow and Simon DeDeo; 11. Causality, information and biological computation: an algorithmic software approach to life, disease and the immune system Hector Zenil, Angelika Schmidt and Jesper Tegnér; Part IV. Complexity and Causality: 12. Life's information hierarchy Jessica Flack; 13. Living through downward causation: from molecules to ecosystems Keith D. Farnsworth, George F. R. Ellis and Luc Jaeger; 14. Automata and animats: from dynamics to cause-effect structures Larissa Albantakis and Giulio Tononi; 15. Biological information, causality and specificity - an intimate relationship Karola Stotz and Paul Griffiths; Part V. From Matter to Mind: 16. Major transitions in political order Simon DeDeo; 17. Bits from biology for computational intelligence Michael Wibral, Joseph Lizier and Viola Priesemann; 18. Machine learning and the questions it raises G. Andrew D. Briggs and Dawid Potgieter.

  19. Alport syndrome and thin glomerular basement membrane nephropathy: a practical approach to diagnosis.

    PubMed

    Haas, Mark

    2009-02-01

    Alport syndrome and thin glomerular basement membrane nephropathy (TBMN) are genetically heterogeneous conditions characterized by structural abnormalities in the glomerular basement membrane and an initial presentation that usually involves hematuria. Approximately 40% of patients with TBMN are heterozygous carriers for autosomal recessive Alport syndrome, with mutations at the genetic locus encoding type IV collagen alpha(3) [alpha(3)(IV)] and alpha(4) chains. However, although the clinical course of TBMN is usually benign, Alport syndrome, particularly the X-linked form with mutations in the locus encoding the alpha(5) chain of type IV collagen [alpha(5)(IV)], typically results in end-stage renal disease. Electron microscopy is essential to diagnosis of TBMN and Alport syndrome on renal biopsy, although electron microscopy alone is of limited value in distinguishing between TBMN, the heterozygous carrier state of X-linked Alport syndrome, autosomal recessive Alport syndrome, and even early stages of X-linked Alport syndrome. To review diagnostic pathologic features of each of the above conditions, emphasizing the need for immunohistology for alpha(3)(IV) and alpha(5)(IV) in addition to electron microscopy to resolve this differential diagnosis on a renal biopsy. The diagnostic value of immunofluorescence studies for alpha(5)(IV) on a skin biopsy in family members of patients with Alport syndrome also is reviewed. Original and comprehensive review articles on the diagnosis of Alport syndrome and TBMN from the past 35 years, primarily the past 2 decades, and experience in our own renal pathology laboratory. Although Alport syndrome variants and TBMN do not show characteristic light microscopic findings and can be difficult to differentiate from each other even by electron microscopy, using a combination of electron microscopy and immunohistology for alpha(3)(IV) and alpha(5)(IV) enables pathologists to definitively diagnose these disorders on renal biopsy in most cases.

  20. Clinical utility of the Wechsler Memory Scale--Fourth Edition (WMS-IV) in predicting laterality of temporal lobe epilepsy among surgical candidates.

    PubMed

    Soble, Jason R; Eichstaedt, Katie E; Waseem, Hena; Mattingly, Michelle L; Benbadis, Selim R; Bozorg, Ali M; Vale, Fernando L; Schoenberg, Mike R

    2014-12-01

    This study evaluated the accuracy of the Wechsler Memory Scale--Fourth Edition (WMS-IV) in identifying functional cognitive deficits associated with seizure laterality in localization-related temporal lobe epilepsy (TLE) relative to a previously established measure, the Rey Auditory Verbal Learning Test (RAVLT). Emerging WMS-IV studies have highlighted psychometric improvements that may enhance its ability to identify lateralized memory deficits. Data from 57 patients with video-EEG-confirmed unilateral TLE who were administered the WMS-IV and RAVLT as part of a comprehensive presurgical neuropsychological evaluation for temporal resection were retrospectively reviewed. We examined the predictive accuracy of the WMS-IV not only in terms of verbal versus visual composite scores but also using individual subtests. A series of hierarchal logistic regression models were developed, including the RAVLT, WMS-IV delayed subtests (Logical Memory, Verbal Paired Associates, Designs, Visual Reproduction), and a WMS-IV verbal-visual memory difference score. Analyses showed that the RAVLT significantly predicted laterality with overall classification rates of 69.6% to 70.2%, whereas neither the individual WMS-IV subtests nor the verbal-visual memory difference score accounted for additional significant variance. Similar to previous versions of the WMS, findings cast doubt as to whether the WMS-IV offers significant incremental validity in discriminating seizure laterality in TLE beyond what can be obtained from the RAVLT. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. U.S. Level III and IV Ecoregions (U.S. EPA)

    EPA Pesticide Factsheets

    This map service displays Level III and Level IV Ecoregions of the United States and was created from ecoregion data obtained from the U.S. Environmental Protection Agency Office of Research and Development's Western Ecology Division. The original ecoregion data was projected from Albers to Web Mercator for this map service. To download shapefiles of ecoregion data (in Albers), please go to: ftp://newftp.epa.gov/EPADataCommons/ORD/Ecoregions/. IMPORTANT NOTE ABOUT LEVEL IV POLYGON LEGEND DISPLAY IN ARCMAP: Due to the limitations of Graphical Device Interface (GDI) resources per application on Windows, ArcMap does not display the legend in the Table of Contents for the ArcGIS Server service layer if the legend has more than 100 items. As of December 2011, there are 968 unique legend items in the Level IV Ecoregion Polygon legend. Follow this link (http://support.esri.com/en/knowledgebase/techarticles/detail/33741) for instructions about how to increase the maximum number of ArcGIS Server service layer legend items allowed for display in ArcMap. Note the instructions at this link provide a slightly incorrect path to Maximum Legend Count. The correct path is HKEY_CURRENT_USER > Software > ESRI > ArcMap > Server > MapServerLayer > Maximum Legend Count. When editing the Maximum Legend Count, update the field, Value data to 1000. To download a PDF version of the Level IV ecoregion map and legend, go to ftp://newftp.epa.gov/EPADataCommons/ORD/Ecoregions/us/Eco_Level_IV

  2. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. MAY 28, 1934 PHOTOGRAPH NO. 162 OF CONTRACT NO. 3 SHOWING MAIN BRIDGE GENERAL VIEW OF PIERS A TO IV. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  3. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5”archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. OCTOBER 23, 1934 PHOTOGRAPH NO. 193 OF CONTRACT NO. 3 SHOWING MAIN BRIDGE – CONCRETE PLANT AT PIER IV. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  4. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. MARCH 12, 1934 PHOTOGRAPH NO. 130 OF CONTRACT NO. 3 SHOWING MAIN BRIDGE DRIVING FALSEWORK PILES AT PIER IV. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  5. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. OCTOBER 29, 1934 PHOTOGRAPH NO. 194 OF CONTRACT NO. 3 SHOWING MAIN BRIDGE ERECTING SHAFT FORMS AT PIER IV. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  6. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. APRIL 23, 1934 PHOTOGRAPH NO. 8 OF CONTRACT NO. 4 SHOWING BRIDGE SUPERSTRUCTURE FALSEWORK BENT THAT WAS SCOURED OUT BETWEEN PIER IV AND V. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  7. 8” x 10” black and white photographic print made from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8” x 10” black and white photographic print made from original 1933, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. AUGUST 28, 1933 PHOTOGRAPH NO. 29 OF CONTRACT NO. 3 SHOWING MAIN BRIDGE PLACING OF WELL FORMS AT PIER NO. IV. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  8. Interactive Macroeconomics

    NASA Astrophysics Data System (ADS)

    Di Guilmi, Corrado; Gallegati, Mauro; Landini, Simone

    2017-04-01

    Preface; List of tables; List of figures, 1. Introduction; Part I. Methodological Notes and Tools: 2. The state space notion; 3. The master equation; Part II. Applications to HIA Based Models: 4. Financial fragility and macroeconomic dynamics I: heterogeneity and interaction; 5. Financial fragility and macroeconomic Dynamics II: learning; Part III. Conclusions: 6. Conclusive remarks; Part IV. Appendices and Complements: Appendix A: Complements to Chapter 3; Appendix B: Solving the ME to solve the ABM; Appendix C: Specifying transition rates; Index.

  9. Blazhko modulation in the infrared

    NASA Astrophysics Data System (ADS)

    Jurcsik, J.; Hajdu, G.; Dékány, I.; Nuspl, J.; Catelan, M.; Grebel, E. K.

    2018-04-01

    We present first direct evidence of modulation in the K band of Blazhko-type RR Lyrae stars that are identified by their secular modulations in the I-band data of Optical Gravitational Lensing Experiment-IV. A method has been developed to decompose the K-band light variation into two parts originating from the temperature and the radius changes using synthetic data of atmosphere-model grids. The amplitudes of the temperature and the radius variations derived from the method for non-Blazhko RRab stars are in very good agreement with the results of the Baade-Wesselink analysis of RRab stars in the M3 globular cluster confirming the applicability and correctness of the method. It has been found that the Blazhko modulation is primarily driven by the change in the temperature variation. The radius variation plays a marginal part, moreover it has an opposite sign as if the Blazhko effect was caused by the radii variations. This result reinforces the previous finding based on the Baade-Wesselink analysis of M3 (NGC 5272) RR Lyrae, that significant modulation of the radius variations can only be detected in radial-velocity measurements, which relies on spectral lines that form in the uppermost atmospheric layers. Our result gives the first insight into the energetics and dynamics of the Blazhko phenomenon, hence it puts strong constraints on its possible physical explanations.

  10. Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

    PubMed Central

    Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

    2007-01-01

    Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

  11. Cargo Movement Operations System (CMOS). Final Software Design Document

    DTIC Science & Technology

    1990-09-27

    NO [ ] COMMENT DISPOSITION: COMMENT STATUS: OPEN [ ] CLOSED [ ] ORIGINATOR CONTROL NUMBER: SDDI-0002 PROGRAM OFFICE CONTROL NUMBER: DATA ITEM DISCREPANCY WORKSHEET CDRL NUMBER: A006-03 DATE: 09/27/90 ORIGINATOR NAME: Patrick L. Combs OFFICE SYMBOL: SAIC TELEPHONE NUMBER: 272-2999 SUBSTANTIVE: X EDITORIAL: PAGE NUMBER: iv PARA NUMBER: 4.18.2 COMMENT OR RECOMMENDED CHANGE: Delete Ř.18.2". RATIONALE: The paragraph number is incorrect and was called forward to be placed in the Table of Contents. The number should read Ř.18.1.2" and

  12. 5 CFR 890.805 - Application time limitations.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... REGULATIONS (CONTINUED) FEDERAL EMPLOYEES HEALTH BENEFITS PROGRAM Benefits for Former Spouses § 890.805...) and (v) of this part, former spouses must apply for health benefits coverage— (1) Within 60 days after... spouses who meet the requirements in § 890.803(a)(3)(iv) of this part must apply for health benefits...

  13. 5 CFR 890.805 - Application time limitations.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... REGULATIONS (CONTINUED) FEDERAL EMPLOYEES HEALTH BENEFITS PROGRAM Benefits for Former Spouses § 890.805...) and (v) of this part, former spouses must apply for health benefits coverage— (1) Within 60 days after... spouses who meet the requirements in § 890.803(a)(3)(iv) of this part must apply for health benefits...

  14. 5 CFR 890.805 - Application time limitations.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... REGULATIONS (CONTINUED) FEDERAL EMPLOYEES HEALTH BENEFITS PROGRAM Benefits for Former Spouses § 890.805...) and (v) of this part, former spouses must apply for health benefits coverage— (1) Within 60 days after... spouses who meet the requirements in § 890.803(a)(3)(iv) of this part must apply for health benefits...

  15. 5 CFR 890.805 - Application time limitations.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... REGULATIONS (CONTINUED) FEDERAL EMPLOYEES HEALTH BENEFITS PROGRAM Benefits for Former Spouses § 890.805...) and (v) of this part, former spouses must apply for health benefits coverage— (1) Within 60 days after... spouses who meet the requirements in § 890.803(a)(3)(iv) of this part must apply for health benefits...

  16. 48 CFR 315.204-5 - Part IV-Representations and instructions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... submit them to the Contracting Officer as part of the acquisition plan or other acquisition request...) Only a formal amendment to a solicitation can change the evaluation factors. Evaluation of proposals... Contracting Officer shall review evaluation factors to ensure they are consistent with the SOW/PWS. This...

  17. 48 CFR 315.204-5 - Part IV-Representations and instructions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... submit them to the Contracting Officer as part of the acquisition plan or other acquisition request...) Only a formal amendment to a solicitation can change the evaluation factors. Evaluation of proposals... Contracting Officer shall review evaluation factors to ensure they are consistent with the SOW/PWS. This...

  18. 46 CFR 164.019-7 - Non-standard components; acceptance criteria and procedures.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...) Inner Envelope Fabric; (iv) Closure (including zippers) or Adjustment Hardware; (v) Body Strap; (vi... in detail and including the unique style, part, or model number, the identification data required by the applicable subpart of this part, and any other manufacturer's identifying data. No two components...

  19. 46 CFR 164.019-7 - Non-standard components; acceptance criteria and procedures.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...) Inner Envelope Fabric; (iv) Closure (including zippers) or Adjustment Hardware; (v) Body Strap; (vi... in detail and including the unique style, part, or model number, the identification data required by the applicable subpart of this part, and any other manufacturer's identifying data. No two components...

  20. 46 CFR 164.019-7 - Non-standard components; acceptance criteria and procedures.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...) Inner Envelope Fabric; (iv) Closure (including zippers) or Adjustment Hardware; (v) Body Strap; (vi... in detail and including the unique style, part, or model number, the identification data required by the applicable subpart of this part, and any other manufacturer's identifying data. No two components...

  1. Basic Electricity. Part 2.

    ERIC Educational Resources Information Center

    Kilmer, Donald C.

    This guide, the second (part 2) in a set of four guides, is designed for the student interested in a vocation in electrical work, and includes two units: Unit IV--Electrical Theory, covering thirteen lessons (matter, the atom, electrical charges in the atom, rules of electric charges, electricity, atoms in an electrical conductor, electrical…

  2. 76 FR 1213 - Core Principles and Other Requirements for Swap Execution Facilities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-07

    ... Part II Commodity Futures Trading Commission 17 CFR Part 37 Core Principles and Other Requirements... RIN Number 3038-AD18 Core Principles and Other Requirements for Swap Execution Facilities AGENCY... Compliance With the Core Principles III. Effective Date and Transition Period IV. Related Matters A...

  3. 45 CFR 301.0 - Scope and applicability of this part.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Section 301.0 Public Welfare Regulations Relating to Public Welfare OFFICE OF CHILD SUPPORT ENFORCEMENT (CHILD SUPPORT ENFORCEMENT PROGRAM), ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND.... This part deals with the administration of title IV-D of the Social Security Act by the Federal...

  4. Investigation of Two Insect Species for Control of Eurasian Watermilfoil.

    DTIC Science & Technology

    1981-02-01

    accidentally introduced European moth, Agnt~J.g nivea . (Olivier), whose larvae feed on the leaves and stems. The biology of J1. leycogaster was studied... nivea (Olivier) .................... 15 PART ILI: RESULTS AND DISCUSSION ............................. 19 Studies with Litodactylus leucogaster...19 Studies with Acentria nivea .............................. 38 PART IV: CONCLUSIONS ......................................... 47

  5. Validity of the WISC-IV Spanish for a clinically referred sample of Hispanic children.

    PubMed

    San Miguel Montes, Liza E; Allen, Daniel N; Puente, Antonio E; Neblina, Cris

    2010-06-01

    The Wechsler Intelligence Scale for Children (WISC) is the most commonly used intelligence test for children. Five years ago, a Spanish version of the WISC-IV was published (WISC-IV Spanish; Wechsler, 2005), but a limited amount of published information is available regarding its utility when assessing clinical samples. The current study included 107 children who were Spanish speaking and of Puerto Rican descent that had been administered the WISC-IV Spanish. They were subdivided into a clinical sample of 35 children with diagnoses of various forms of brain dysfunction (primarily learning disability, attention-deficit/hyperactivity disorder, and epilepsy) and a comparison group made up of 72 normal children who were part of the WISC-IV Spanish version standardization sample. Comparisons between these groups and the standardization sample were performed for the WISC-IV Spanish index and subtest scores. Results indicated that the clinical sample performed worse than the comparison samples on the Working Memory and Processing Speed Indexes, although findings varied to some extent depending on whether the clinical group was compared with the normal comparison group or the standardization sample. These findings provide support for the criterion validity of the WISC-IV Spanish when it is used to assess a clinically referred sample with brain dysfunction.

  6. Student Assistance General Provisions; Federal Pell Grant Program; Academic Competitiveness Grant Program; and National Science and Mathematics Access to Retain Talent Grant Program. Final Rule. Federal Register, Part IV, Department of Education, 34 CFR Parts 668, 690, and 691

    ERIC Educational Resources Information Center

    National Archives and Records Administration, 2006

    2006-01-01

    The Secretary is adopting as final, with changes, interim final regulations in: 34 CFR part 691 for the Academic Competitiveness Grant (ACG) and National Science and Mathematics Access to Retain Talent Grant (National SMART Grant) programs; 34 CFR part 668 (Student Assistance General Provisions); and 34 CFR part 690 (Federal Pell Grant Program).…

  7. Geographic Origins of Students, Fall 1991. Volume II.

    ERIC Educational Resources Information Center

    State Univ. of New York, Albany. Central Staff Office of Institutional Research.

    This volume (second of three) contains statistical tables displaying origin or origin grouping of credit course students attending the State University of New York System. The volume contains six parts: Part 1 contains separate tables for each New York State county; Part 2 displays the permanent residence of students from outside of New York State…

  8. Expansion of the Real-time Sport-land Information System for NOAA/National Weather Service Situational Awareness and Local Modeling Applications

    NASA Technical Reports Server (NTRS)

    Case, Jonathan L.

    2014-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has been running a real-time version of the Land Information System (LIS) since summer 2010 (hereafter, SPoRTLIS). The real-time SPoRT-LIS runs the Noah land surface model (LSM) in an offline capacity apart from a numerical weather prediction model, using input atmospheric and precipitation analyses (i.e., "forcings") to drive the Noah LSM integration at 3-km resolution. Its objectives are to (1) produce local-scale information about the soil state for NOAA/National Weather Service (NWS) situational awareness applications such as drought monitoring and assessing flood potential, and (2) provide land surface initialization fields for local modeling initiatives. The current domain extent has been limited by the input atmospheric analyses that drive the Noah LSM integration within SPoRT-LIS, specifically the National Centers for Environmental Prediction (NCEP) Stage IV precipitation analyses. Due to the nature of the geographical edges of the Stage IV precipitation grid and its limitations in the western U.S., the SPoRT-LIS was originally confined to a domain fully nested within the Stage IV grid, over the southeastern half of the Conterminous United States (CONUS). In order to expand the real-time SPoRT-LIS to a full CONUS domain, alternative precipitation forcing datasets were explored in year-long, offline comparison runs of the Noah LSM. Based on results of these comparison simulations, we chose to implement the radar/gauge-based precipitation analyses from the National Severe Storms Laboratory as a replacement to the Stage IV product. The Multi-Radar Multi-Sensor (MRMS; formerly known as the National Mosaic and multi-sensor Quantitative precipitation estimate) product has full CONUS coverage at higher-resolution, thereby providing better coverage and greater detail than that of the Stage IV product. This paper will describe the expanded/upgraded SPoRT-LIS, present comparisons between the original and upgraded SPoRT-LIS, and discuss the path forward for future collaboration opportunities with SPoRT partners in the NWS.

  9. Part H of the Individuals with Disabilities Education Act (IDEA) for Infants, Toddlers, and Their Families Annual Performance Report, Year IV (1990-1992).

    ERIC Educational Resources Information Center

    McNulty, Brian A.; And Others

    This report on the fourth year of Colorado's participation in Part H of the Individuals with Disabilities Education Act describes major accomplishments in preparing for full implementation of Part H in Year 5. Accomplishments in the following areas are discussed: state definition of developmental delay, central directory, timetables for serving…

  10. The six most essential questions in psychiatric diagnosis: a pluralogue part 3: issues of utility and alternative approaches in psychiatric diagnosis

    PubMed Central

    2012-01-01

    In face of the multiple controversies surrounding the DSM process in general and the development of DSM-5 in particular, we have organized a discussion around what we consider six essential questions in further work on the DSM. The six questions involve: 1) the nature of a mental disorder; 2) the definition of mental disorder; 3) the issue of whether, in the current state of psychiatric science, DSM-5 should assume a cautious, conservative posture or an assertive, transformative posture; 4) the role of pragmatic considerations in the construction of DSM-5; 5) the issue of utility of the DSM – whether DSM-III and IV have been designed more for clinicians or researchers, and how this conflict should be dealt with in the new manual; and 6) the possibility and advisability, given all the problems with DSM-III and IV, of designing a different diagnostic system. Part 1 of this article took up the first two questions. Part 2 took up the second two questions. Part 3 now deals with Questions 5 & 6. Question 5 confronts the issue of utility, whether the manual design of DSM-III and IV favors clinicians or researchers, and what that means for DSM-5. Our final question, Question 6, takes up a concluding issue, whether the acknowledged problems with the earlier DSMs warrants a significant overhaul of DSM-5 and future manuals. As in Parts 1 & 2 of this article, the general introduction, as well as the introductions and conclusions for the specific questions, are written by James Phillips, and the responses to commentaries are written by Allen Frances. PMID:22621419

  11. Impact of heavy soiling on the power output of PV modules

    NASA Astrophysics Data System (ADS)

    Schill, Christian; Brachmann, Stefan; Heck, Markus; Weiss, Karl-Anders; Koehl, Michael

    2011-09-01

    Fraunhofer ISE is running a PV-module outdoor testing set-up on the Gran Canaria island, one of the Canary Island located west of Morroco in the Atlantic Ocean. The performance of the modules is assessed by IV-curve monitoring every 10 minutes. The electronic set-up of the monitoring system - consisting of individual electronic loads for each module which go into an MPP-tracking mode between the IV-measurements - will be described in detail. Soiling of the exposed modules happened because of building constructions nearby. We decided not to clean the modules, but the radiation sensors and recorded the decrease of the power output and the efficiency over time. The efficiency dropped to 20 % within 5 months before a heavy rain and subsequently the service personnel on site cleaned the modules. A smaller rain-fall in between washed the dust partly away and accumulated it at the lower part of the module, what could be concluded from the shape of the IV-curves, which were similar to partial shading by hot-spot-tests and by partial snow cover.

  12. Tooth Tissue Engineering: The Importance of Blood Products as a Supplement in Tissue Culture Medium for Human Pulp Dental Stem Cells.

    PubMed

    Pisciolaro, Ricardo Luiz; Duailibi, Monica Talarico; Novo, Neil Ferreira; Juliano, Yara; Pallos, Debora; Yelick, Pamela Crotty; Vacanti, Joseph Phillip; Ferreira, Lydia Masako; Duailibi, Silvio Eduardo

    2015-11-01

    One of the goals in using cells for tissue engineering (TE) and cell therapy consists of optimizing the medium for cell culture. The present study compares three different blood product supplements for improved cell proliferation and protection against DNA damage in cultured human dental pulp stem cells for tooth TE applications. Human cells from dental pulp were first characterized as adult stem cells (ectomesenchymal mixed origin) by flow cytometry. Next, four different cell culture conditions were tested: I, supplement-free; II, supplemented with fetal bovine serum; III, allogeneic human serum; and IV, autologous human serum. Cultured cells were then characterized for cell proliferation, mineralized nodule formation, and colony-forming units (CFU) capability. After 28 days in culture, the comet assay was performed to assess possible damage in cellular DNA. Our results revealed that Protocol IV achieved higher cell proliferation than Protocol I (p = 0.0112). Protocols II and III resulted in higher cell proliferation than Protocol I, but no statistical differences were found relative to Protocol IV. The comet assay revealed less cell damage in cells cultured using Protocol IV as compared to Protocols II and III. The damage percentage observed on Protocol II was significantly higher than all other protocols. CFUs capability was highest using Protocol IV (p = 0.0018) and III, respectively, and the highest degree of mineralization was observed using Protocol IV as compared to Protocols II and III. Protocol IV resulted in significantly improved cell proliferation, and no cell damage was observed. These results demonstrate that human blood product supplements can be used as feasible supplements for culturing adult human dental stem cells.

  13. Newborn Auditory Brainstem Evoked Responses (ABRs): Prenatal and Contemporary Correlates.

    ERIC Educational Resources Information Center

    Murray, Ann D.

    1988-01-01

    Presented are a literature review and new data on correlates of newborn auditory brainstem evoked responses (ABRs). Concludes that disorders of the central components of the ABR may be more of prenatal than of postnatal origin. The I-V interval had low but reliable correlations with four of 11 Brazelton scale variables. (RH)

  14. 12 CFR Appendix A to Subpart B of... - Risk-Based Capital Stress Test

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Loan Number Ending Scheduled Balance Group Pre/Post Act Property State Product Type Origination Date... program assets post-1996 Act Swap balances; (iii) Farmer Mac I program assets pre-1996 Act; (iv) Farmer... stress test applies quarterly updates of the weighted average guarantee rates for post-1996 Farmer Mac I...

  15. 12 CFR Appendix A to Subpart B of... - Risk-Based Capital Stress Test

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Loan Number Ending Scheduled Balance Group Pre/Post Act Property State Product Type Origination Date... program assets post-1996 Act Swap balances; (iii) Farmer Mac I program assets pre-1996 Act; (iv) Farmer... stress test applies quarterly updates of the weighted average guarantee rates for post-1996 Farmer Mac I...

  16. 48 CFR 52.212-3 - Offeror Representations and Certifications-Commercial Items.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... that is to be used specifically— (i) To restrict the free flow of unbiased information in Iran; or (ii... End Products: Line Item No.: Country of Origin: (List as necessary) (3) The Government will evaluate... necessary) (iv) The Government will evaluate offers in accordance with the policies and procedures of FAR...

  17. 36 CFR 292.16 - Standards.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... on the property. Signs not to exceed 20 square feet in area, 6 feet in length and 15 feet maximum... and liquid waste originating on or resulting from use of the property. (4) All new utilities will be...-foot frontage on new building sites. (iv) All new buildings set in 10 feet from each side of property...

  18. Exporting Our Disorders

    ERIC Educational Resources Information Center

    Foltz, Robert

    2012-01-01

    In 2013, the American Psychiatric Association will release its newest Diagnostic and Statistical Manual, 5th Edition (DSM-5). This tome has evolved over the decades, originally including just 112 diagnoses across 128 pages. The upcoming edition is expected to eclipse the 943 pages, and 350+ disorders of the current DSM-IV-TR, offering a variety of…

  19. 78 FR 59710 - Golden Eagles; Programmatic Take Permit Application; Draft Environmental Assessment; Shiloh IV...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-27

    ...-megawatt (MW) commercial wind-energy facility, consisting of 50 wind turbines, each with a 2-MW generation... Kennetech wind turbines originally constructed in the late 1980s. The applicant submitted an ECP on August 3... Wind Project, Solano County, California AGENCY: Fish and Wildlife Service, Interior. ACTION: Notice of...

  20. 29 CFR 1910.180 - Crawler locomotive and truck cranes.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... readily available. (iv) No cranes shall be rerated in excess of the original load ratings unless such...) No crane shall be loaded beyond the rated load, except for test purposes as provided in paragraph (e... limited to freely suspended loads. Cranes shall not be used for dragging loads sideways. (v) No hoisting...

  1. 29 CFR 1910.180 - Crawler locomotive and truck cranes.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... readily available. (iv) No cranes shall be rerated in excess of the original load ratings unless such...) No crane shall be loaded beyond the rated load, except for test purposes as provided in paragraph (e... limited to freely suspended loads. Cranes shall not be used for dragging loads sideways. (v) No hoisting...

  2. 29 CFR 1910.180 - Crawler locomotive and truck cranes.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... readily available. (iv) No cranes shall be rerated in excess of the original load ratings unless such...) No crane shall be loaded beyond the rated load, except for test purposes as provided in paragraph (e... limited to freely suspended loads. Cranes shall not be used for dragging loads sideways. (v) No hoisting...

  3. 29 CFR 1910.180 - Crawler locomotive and truck cranes.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... readily available. (iv) No cranes shall be rerated in excess of the original load ratings unless such...) No crane shall be loaded beyond the rated load, except for test purposes as provided in paragraph (e... limited to freely suspended loads. Cranes shall not be used for dragging loads sideways. (v) No hoisting...

  4. 29 CFR 1910.180 - Crawler locomotive and truck cranes.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... readily available. (iv) No cranes shall be rerated in excess of the original load ratings unless such...) No crane shall be loaded beyond the rated load, except for test purposes as provided in paragraph (e... limited to freely suspended loads. Cranes shall not be used for dragging loads sideways. (v) No hoisting...

  5. Validating the Learning Disability Screening Questionnaire against the Weschler Adult Intelligence Scale, Fourth Edition

    ERIC Educational Resources Information Center

    McKenzie, Karen; Sharples, Phil; Murray, Aja L.

    2015-01-01

    The Learning Disability Screening Questionnaire (LDSQ), a brief screening tool for intellectual disability, was originally validated against the Weschler Adult Intelligence Scale, Third Edition (WAIS-III), which was superseded by the Weschler Adult Intelligence Scale, Fourth Edition (WAIS-IV) in the United Kingdom in 2010. This study examines the…

  6. A Study of Alternatives in American Education, Vol. IV: Family Choice in Schooling.

    ERIC Educational Resources Information Center

    Bridge, R. Gary; Blackman, Julie

    Originating in the Rand Corporation's evaluation of the voucher demonstration project in the Alum Rock Union School District (California), this study of family choice in schooling focuses on these questions: Are parents motivated and competent to make intelligent choices among competing educational alternatives? What kinds of schools do parents…

  7. Program Manual for Estimating Use and Related Statistics on Developed Recreation Sites

    Treesearch

    Gary L. Tyre; Gene R. Welch

    1972-01-01

    This manual includes documentation of four computer programs supporting subroutines for estimating use, visitor origin, patterns of use, and occupancy rates at developed recreation sites. The programs are written in Fortran IV and should be easily adapted to any computer arrangement have the capacity to compile this language.

  8. The Origins of Children's Career Aspirations: IV. Testing Hypotheses from Four Theories.

    ERIC Educational Resources Information Center

    Trice, Ashton D.; And Others

    1995-01-01

    A study of elementary students (n=949) revealed some support for each of the hypotheses of Ginzberg, Roe, and Havinghurst. Results indicate that interests play the major role in both the selection and rejection of careers throughout childhood, that family configuration influenced occupational choice/no choice, and that identification with a…

  9. Referring to Actions and Objects in Co-Speech Gesture Production

    ERIC Educational Resources Information Center

    Keily, Holly

    2017-01-01

    A number of theories exist to explain why people gesture when speaking, when they produce gesture, and the origin of their gestures. This dissertation focuses on four individual variables that can influence gesture: (i) familiarity, (ii) imageability, (iii) codability, and (iv) motor experience. Four experiments were designed to determine how each…

  10. 48 CFR 22.1003-6 - Repair distinguished from remanufacturing of equipment.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... overhauled are restored to original life expectancy, or nearly so. (vii) Such work is performed in a facility... replaced. (iii) The item or equipment is rebuilt or reassembled. (iv) The contract work results in the furnishing of a substantially modified item in a usable and serviceable condition. (v) The work is performed...

  11. The Star-grazing Bodies in the HD 172555 System

    NASA Astrophysics Data System (ADS)

    Grady, C. A.; Brown, Alexander; Welsh, Barry; Roberge, Aki; Kamp, Inga; Rivière Marichalar, P.

    2018-06-01

    Kiefer et al. reported the detection of infalling Ca II absorption in HD 172555, a member of the β Pictoris Moving Group (βPMG). We obtained HST Space Telescope Imaging Spectrograph and Cosmic Origins Spectrograph spectroscopy of this star at 2 epochs separated by a week, and we report the discovery of infalling gas in resonant transitions of Si III and IV, C II and IV, and neutral atomic oxygen. Variable absorption is seen in the C II transitions and is optically thick, with covering factors which range between 58% and 68%, similar to features seen in β Pictoris. The O I spectral profile resembles that of C II, showing a strong low-velocity absorption to +50 km s‑1 in the single spectral segment obtained during orbital night, as well as what may be higher-velocity absorption. Studies of the mid-IR spectrum of this system have suggested the presence of silica. The O I absorption differs from that seen in Si III, suggesting that the neutral atomic oxygen does not originate in SiO dissociation products but in a more volatile parent molecule such as CO.

  12. Quiet-Sun Connection between the C IV Resonance Lines and the Photospheric Magnetic Field

    NASA Astrophysics Data System (ADS)

    Brynildsen, Nils; Kjeldseth-Moe, Olav; Maltby, Per

    1996-05-01

    The quiet-Sun relation between the C iv resonance line parameters and the photospheric magnetic field is studied with a spatial resolution of 1" x 1". The material is ordered into groups according to the magnitude of the magnetic flux density, |B|, and conditional probabilities are calculated. We find that red shifted profiles with either high intensity, large Doppler shift, or large line broadening occupy an increasing fraction of the area when |B| increases. These results are contrasted by blueshifted profiles which indicate a slight decrease with increasing magnetic flux density. The similarity in the results obtained with magneto grams taken several hours before and after the UV data led us to suggest that the tendency for red shifted profiles to outnumber blueshifted profiles in quiet regions originates in the super-granular network. Suggestions regarding the origin of the redshift phenomenon are briefly confronted with the observations. It appears difficult to explain the observations with models based on continuous gas flows. However, a model containing Alfvén wave pulses traveling from the corona toward the transition region promises to be compatible with the observations.

  13. The effect of the European Clinical Trials Directive on published drug research in anaesthesia.

    PubMed

    Walker, E; Hankins, M C; White, S M

    2009-09-01

    The clinical indications for anaesthetic drugs are developed through peer-reviewed publication of clinical trials. We performed a bibliometric analysis of all human research papers reported in nine general anaesthesia journals over 6 years (n = 6489), to determine any effects of the 2004 European Clinical Trials Directive on reported drug research in anaesthesia originating from Europe and the United Kingdom. We found 89% studies involved patients and 11% volunteers. Of 3234 (50%) drug studies, 96% were phase IV (post-marketing) trials. Worldwide, the number of research papers fell by 3.6% (p < 0.004) in the 3 years following introduction of the European Clinical Trials Directive (5% Europe, 18% United Kingdom), and drug research papers fell by 12% (p < 0.001; 15% Europe, 29% United Kingdom). The introduction of the Clinical Trials Directive has therefore coincided with a decline in European drug research, particularly that originating from the United Kingdom. We suggest a number of measures researchers could take in response, and we propose a simplification of the application process for phase IV clinical trials, emphasising patient risk assessment.

  14. Bondonic effects in group-IV honeycomb nanoribbons with Stone-Wales topological defects.

    PubMed

    Putz, Mihai V; Ori, Ottorino

    2014-04-03

    This work advances the modeling of bondonic effects on graphenic and honeycomb structures, with an original two-fold generalization: (i) by employing the fourth order path integral bondonic formalism in considering the high order derivatives of the Wiener topological potential of those 1D systems; and (ii) by modeling a class of honeycomb defective structures starting from graphene, the carbon-based reference case, and then generalizing the treatment to Si (silicene), Ge (germanene), Sn (stannene) by using the fermionic two-degenerate statistical states function in terms of electronegativity. The honeycomb nanostructures present η-sized Stone-Wales topological defects, the isomeric dislocation dipoles originally called by authors Stone-Wales wave or SWw. For these defective nanoribbons the bondonic formalism foresees a specific phase-transition whose critical behavior shows typical bondonic fast critical time and bonding energies. The quantum transition of the ideal-to-defect structural transformations is fully described by computing the caloric capacities for nanostructures triggered by η-sized topological isomerisations. Present model may be easily applied to hetero-combinations of Group-IV elements like C-Si, C-Ge, C-Sn, Si-Ge, Si-Sn, Ge-Sn.

  15. An upper limit on interstellar C IV in the spectrum of gamma-2 Velorum

    NASA Technical Reports Server (NTRS)

    Lengyel-Frey, D.; Stecher, T. P.; West, D. K.

    1975-01-01

    An upper limit on the column density of C IV along the line of sight to gamma-2 Vel is derived from upper limits placed on the equivalent widths of the interstellar C IV doublet with rest wavelengths at 1548.20 A and 1550.77 A. A lower limit of 250,000 K is calculated for the electron temperature of O VI emitting regions by combining the C IV results with a measurement of the column density of interstellar O VI for the same star and using calculations for the relative ionization of some abundant elements as a function of electron temperature in a low-density plasma. Since gamma-2 Vel is in the central part of the Gum Nebula, the high temperature suggested by these results is shown to support the idea that a high-temperature phase of the interstellar medium, possibly maintained by supernova explosions, may exist.-

  16. An office model of outpatient parenteral antibiotic therapy.

    PubMed

    Tice, A D

    1991-01-01

    This office-based program for parenteral therapy began with the im administration of therapy to outpatients in 1981. Since then it has expanded in scope and staff and has provided more than 1,200 courses of i.v. antibiotics. The success of the program is dependent on patients' ability to provide i.v. medication to themselves. These patients are trained and cared for by a team consisting of a physician who specializes in infectious diseases, nurses trained in i.v. techniques, a pharmacist, and microbiologists who are all part of a practice of the subspecialty of infectious diseases. This office model has resulted in excellent quality of care for patients who have experienced few adverse effects or complications. The cost savings of an office program are significant compared to hospitalization for i.v. administration of antibiotics, but issues related to reimbursement are a constant issue.

  17. Indian Vacuum Society: The Indian Vacuum Society

    NASA Astrophysics Data System (ADS)

    Saha, T. K.

    2008-03-01

    The Indian Vacuum Society (IVS) was established in 1970. It has over 800 members including many from Industry and R & D Institutions spread throughout India. The society has an active chapter at Kolkata. The society was formed with the main aim to promote, encourage and develop the growth of Vacuum Science, Techniques and Applications in India. In order to achieve this aim it has conducted a number of short term courses at graduate and technician levels on vacuum science and technology on topics ranging from low vacuum to ultrahigh vacuum So far it has conducted 39 such courses at different parts of the country and imparted training to more than 1200 persons in the field. Some of these courses were in-plant training courses conducted on the premises of the establishment and designed to take care of the special needs of the establishment. IVS also regularly conducts national and international seminars and symposia on vacuum science and technology with special emphasis on some theme related to applications of vacuum. A large number of delegates from all over India take part in the deliberations of such seminars and symposia and present their work. IVS also arranges technical visits to different industries and research institutes. The society also helped in the UNESCO sponsored post-graduate level courses in vacuum science, technology and applications conducted by Mumbai University. The society has also designed a certificate and diploma course for graduate level students studying vacuum science and technology and has submitted a syllabus to the academic council of the University of Mumbai for their approval, we hope that some colleges affiliated to the university will start this course from the coming academic year. IVS extended its support in standardizing many of the vacuum instruments and played a vital role in helping to set up a Regional Testing Centre along with BARC. As part of the development of vacuum education, the society arranges the participation of expert members on the subject to deliver lectures and take part in devising courses in the universities. IVS publishes a quarterly called the `Bulletin of Indian Vacuum Society' since its inception, in which articles on vacuum and related topics are published. NIRVAT, news, announcements, and reports are the other features of the Bulletin. The articles in the Bulletin are internationally abstracted. The Bulletin is distributed free to all the members of the society. The society also publishes proceedings of national/international symposia and seminars, manuals, lecture notes etc. It has published a `Vacuum Directory' containing very useful information on vacuum technology. IVS has also set up its own website http://www.ivsnet.org in January 2002. The website contains information about IVS, list of members, list of EC members, events and news, abstracts of articles published in the `Bulletin of Indian Vacuum Society', utilities, announcements, reports, membership and other forms which can be completed online and also gives links to other vacuum societies. Our Society has been a member of the executive council of the International Union of Vacuum Science, Techniques and Applications (IUVSTA) and its various committees since 1970. In 1983 IVS conducted an International Symposium on Vacuum Technology and Nuclear Applications in BARC, Mumbai, under the sponsorship of IUVSTA. In 1987 IVS arranged the Triennial International Conference on Thin Films in New Delhi, where more than 200 foreign delegates participated. IVS also hosted the IUVSTA Executive Council Meeting along with the conference. The society organized yet again an International Conference on Vacuum Science and Technology and SRS Vacuum Systems at CAT, Indore in1995. IVS arranges the prestigious Professor Balakrishnan Memorial Lecture in memory of its founder vice-president. Leading scientists from India and abroad in the field are invited to deliver the talks. So far 23 lectures have been held in this series. IVS has instituted the `IVS- Professor D Y Phadke Memorial Prize' in memory of our founder president, the late Professor D Y Phadke at the University of Mumbai. The prize is given every year to the student ranked top in the MSc (PHY.) examination conducted by the university. The IVS Kolkata Chapter has established the Dr A S Divatia Memorial Trust with the objective of organizing the Dr A S Divatia Memorial Lecture and a seminar once a year and to set up a vacuum testing and calibration facility. IVS has instituted an award in memory of the late Shri C Ambasankaran, its past president and pioneer of vacuum technology in India. This award is given to one of the best papers presented in the national symposium conducted by IVS. One more best paper award `Smt. Shakuntalabai Vyawahare Memorial Prize' is established from a donation given by Shri Mohan R Vyawahare, a life member and a present EC member of the society, in memory of his mother. During the symposia, IVS felicitates two of its members, one from Industry and one from an R & D Institution for their lifetime contribution to vacuum science and technology. Dr A K Gupta, Ex BARC, Ex Generla Manager, IBP, Head, Energy Group, Shapoorji Pallonji & Co Ltd (Industry), and Dr S R Gowariker, Ex BARC, Ex Director, CSIO, Chandigarh, Director, Tolani Education Foundation (R & D) are being honoured this year. T K Saha Geneneral Secretary, IVS

  18. Kinetics of abiotic nitrous oxide production via oxidation of hydroxylamine by particulate metals in seawater

    NASA Astrophysics Data System (ADS)

    Cavazos, A. R.; Taillefert, M.; Glass, J. B.

    2016-12-01

    The oceans are a significant of nitrous oxide (N2O) to the atmosphere. Current models of global oceanic N2­O flux focus on microbial N2O cycling and often ignore abiotic reactions, such as the thermodynamically favorable oxidation of the nitrification intermediate hydroxylamine (NH2OH) by Mn(IV) or Fe(III). At circumneutral pH, NH2OH oxidation is more thermodynamically favorable via Mn(IV) than Fe(III) reduction. We characterized the kinetics of NH2OH oxidation in synthetic ocean water at pH 5.1-8.8 using microsensor electrodes to measure real-time N2O production. N2O production rates and yield were greater when NH2OH was oxidized by Mn(IV) than Fe(III). Accordingly, the reduction of Mn(IV) was first order with respect to NH2OH whereas the reduction of Fe(III) was zero order with respect to NH2OH. Interestingly, the order of the reaction with respect to Mn(IV) appears to be negative whereas the reaction is second order with respect to Fe(III). The inverse order with respect to Mn(IV) may be due to the aggregation of particles in seawater, which decreases their surface area and changes their reactivity. Finally, the reaction is first order with respect to protons with Fe(III) as the oxidant but zero order with Mn(IV). The stronger effect of the pH on the reaction with Fe(III) as the oxidant compared to Mn(IV) reflects the stoichiometry of these two reactions, as each mole of N2O produced by Fe(III) reduction consumes eight protons while each mole of N2O produced with Mn(IV) as the oxidant requires only four protons. Our data show that abiotic NH2OH oxidation by Mn(IV) or Fe(III) particles may represent a significant source of N2O in seawater. These findings suggest that abiotic N2O production in marine waters may be significant in areas of the oceans where particulate metals originating from aerosols, dust, or rivers may react with NH2OH released from ammonia-oxidizing microorganisms.

  19. High performance preconcentration of inorganic Se species by dispersive micro-solid phase extraction with a nanosilica-ionic liquid hybrid material

    NASA Astrophysics Data System (ADS)

    Llaver, Mauricio; Coronado, Eduardo A.; Wuilloud, Rodolfo G.

    2017-12-01

    A highly sensitive and efficient dispersive micro-solid phase extraction (D-μ-SPE) method was developed for inorganic Se speciation analysis. A novel ionic liquid (IL)-nanomaterial hybrid consisting of 1-dodecyl-3-methylimidazolium bromide-functionalized nanosilica was used for the efficient retention of Se(IV) complexed with ammonium pyrrolidine dithiocarbamate, followed by elution with an ethyl acetate/Triton X-114 mixture and determination by electrothermal atomic absorption spectroscopy. The Se(VI) species was selectively determined by difference between total inorganic Se and Se(IV) after pre-reduction. The IL-nanomaterial hybrid was characterized by Fourier transform infrared spectroscopy and transmission electronic microscopy. Likewise, Se(IV) sorption capacity of the retention material and maximum amount of IL loaded on its surface were determined. Several factors concerning the functionalization, extraction and elution steps were optimized, yielding a 100% extraction efficiency for Se(IV) under optimal conditions. A limit of detection of 1.1 ng L- 1, a relative standard deviation of 5.7% and a 110-fold enhancement factor were obtained. The D-μ-SPE method was successfully applied to several water samples from different origins and compositions, including rain, tap, underground, river and sea.

  20. Separation, preconcentration and inductively coupled plasma-mass spectrometric (ICP-MS) determination of thorium(IV), titanium(IV), iron(III), lead(II) and chromium(III) on 2-nitroso-1-naphthol impregnated MCI GEL CHP20P resin.

    PubMed

    Aydin, Funda Armagan; Soylak, Mustafa

    2010-01-15

    A simple and effective method is presented for the separation and preconcentration of Th(IV), Ti(IV), Fe(III), Pb(II) and Cr(III) by solid phase extraction on 2-nitroso-1-naphthol impregnated MCI GEL CHP20P resin prior to their inductively coupled plasma-mass spectrometric determinations. The influence of analytical parameters including pH of the aqueous solution, flow rates of sample and eluent solutions and sample volume on the quantitative recoveries of analyte ions was investigated. Matrix effects caused by the presence of alkali, earth alkali and some metal ions in the analyzed solutions were investigated. The presented solid phase extraction method was applied to BCR-144R Sewage Sludge (domestic origin), BCR-141R Calcareous Loam Soil, NIST 1568a Rice Flour and NIST 1577b Bovine Liver certified reference materials (CRMs) for the determination of analyte ions and the results were in good agreement with the certified values. The separation procedure presented was also applied to the various natural water samples collected from Turkey with satisfactory results.

  1. Observations of the May 1979 outburst of Centaurus X-4

    NASA Technical Reports Server (NTRS)

    Blair, W. P.; Raymand, J. C.; Dupree, A. K.

    1982-01-01

    The IUE spectra of the X-ray transient/X-ray burst source Cen X-4 at three intervals during the peak and decline of the May 1979 transient event were studied. The spectrum is characterized by a blue continuum and strong emission lines of N V lambda 1240, Si IV lambda 1398 and C IV lambda 1550. The origin of these emission components in the context of an X-ray dwarf nova model is investigated. It is suggested that an accretion disk plays a prominent role in the generation of the continuum emission and that X-ray heating of the accretion disk and the companion star may be important in the formation of the emission lines.

  2. A Low Spin Manganese(IV) Nitride Single Molecule Magnet

    PubMed Central

    Ding, Mei; Cutsail, George E.; Aravena, Daniel; Amoza, Martín; Rouzières, Mathieu; Dechambenoit, Pierre; Losovyj, Yaroslav; Pink, Maren

    2016-01-01

    Structural, spectroscopic and magnetic methods have been used to characterize the tris(carbene)borate compound PhB(MesIm)3Mn≡N as a four-coordinate manganese(IV) complex with a low spin (S = 1/2) configuration. The slow relaxation of the magnetization in this complex, i.e. its single-molecule magnet (SMM) properties, is revealed under an applied dc field. Multireference quantum mechanical calculations indicate that this SMM behavior originates from an anisotropic ground doublet stabilized by spin-orbit coupling. Consistent theoretical and experiment data show that the resulting magnetization dynamics in this system is dominated by ground state quantum tunneling, while its temperature dependence is influenced by Raman relaxation. PMID:27746891

  3. Aminoglycoside acetyltransferase 3-IV (aacC4) and hygromycin B 4-I phosphotransferase (hphB) in bacteria isolated from human and animal sources.

    PubMed

    Salauze, D; Otal, I; Gomez-Lus, R; Davies, J

    1990-10-01

    Members of the family Enterobacteriaceae harboring an enzyme of the aminoglycoside acetyltransferase 3 class (AAC-3-IV) (apramycin and gentamicin resistance) and hygromycin B phosphotransferase 4 (HPH-4-I) (hygromycin B resistance) have been isolated from human clinical sources in Europe. A cluster of genes containing IS140, aacC4, and hphB was found in these strains. We demonstrate by Southern hybridization that this cluster is identical to the operon found in animals that also contains insertion sequences belonging to the ISO family. This provides another example of presumptive transfer of antibiotic resistance genes between bacteria of animal and human origin.

  4. WATEQF; a FORTRAN IV version of WATEQ : a computer program for calculating chemical equilibrium of natural waters

    USGS Publications Warehouse

    Plummer, Niel; Jones, Blair F.; Truesdell, Alfred Hemingway

    1976-01-01

    WATEQF is a FORTRAN IV computer program that models the thermodynamic speciation of inorganic ions and complex species in solution for a given water analysis. The original version (WATEQ) was written in 1973 by A. H. Truesdell and B. F. Jones in Programming Language/one (PL/1.) With but a few exceptions, the thermochemical data, speciation, coefficients, and general calculation procedure of WATEQF is identical to the PL/1 version. This report notes the differences between WATEQF and WATEQ, demonstrates how to set up the input data to execute WATEQF, provides a test case for comparison, and makes available a listing of WATEQF. (Woodard-USGS)

  5. Dollar$ & $en$e. Part IV: Measuring the value of people, structural, and customer capital.

    PubMed

    Wilkinson, I

    2001-01-01

    In Part I of this series, I introduced the concept of memes (1). Memes are ideas or concepts, the information world equivalent of genes. The goal of this series of articles is to infect you with my memes, so that you will assimilate, translate, and express them. We discovered that no matter what our area of expertise or "-ology," we all are in the information business. Our goal is to be in the wisdom business. We saw that when we convert raw data into wisdom we are moving along a value chain. Each step in the chain adds a different amount of value to the final product: timely, relevant, accurate, and precise knowledge which can then be applied to create the ultimate product in the value chain: wisdom. In Part II of this series, I infected you with a set of memes for measuring the cost of adding value (2). In Part III of this series, I infected you with a new set of memes for measuring the added value of knowledge, i.e., intellectual capital (3). In Part IV of this series, I will infect you with memes for measuring the value of people, structural, and customer capital.

  6. Molecular basis of beta-thalassemia in the Maldives.

    PubMed

    Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

    1998-03-01

    We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

  7. The First Detection of [O IV] from an Ultraluminous X-ray Source with Spitzer: Evidence of High Unbeamed Luminosity in Holmberg II ULX

    NASA Technical Reports Server (NTRS)

    Berghea, C. T.; Dudik, R. P.; Weaver, K. A.; Kallman, T. R.

    2008-01-01

    We present the first Spitzer Infrared Spectrograph (IRS) observations of the [O IV] 25.89 micron emission line detected from the ultraluminous X-ray source (ULX) in Holmberg II. This line is a well established signature of high excitation, usually associated with AGN. Its detection suggests that the ULX has a strong impact on the surrounding gas. A Spitzer high resolution spectral map shows that the [O IV] is coincident with the X-ray position of the Holmberg II ULX. We find that the luminosity and the morphology of the line emission is consistent with photoionization by the soft X-ray and far ultraviolet (FUV) radiation from the accretion disk of the binary system and inconsistent with narrow beaming. We show that the emission nebula is radiation bounded both in the line of sight direction and to the west, and probably matter bounded to the east. Evidence for a massive black hole (BH) in this ULX is mounting. Detailed photoionization models favor an intermediate mass black hole of at least 85 Solar Mass as the ionization source for the [OIV] emission. We find that the spectral type of the companion star strongly affects the expected strength of the [O IV] emission. This finding could explain the origin of [O IV] in some starburst galaxies containing black hole binaries.

  8. Usefulness of high-dose intravenous human immunoglobulins treatment for refractory recurrent pericarditis.

    PubMed

    Moretti, Michele; Buiatti, Alessandra; Merlo, Marco; Massa, Laura; Fabris, Enrico; Pinamonti, Bruno; Sinagra, Gianfranco

    2013-11-01

    The management of refractory recurrent pericarditis is challenging. Previous clinical reports have noted a beneficial effect of high-dose intravenous human immunoglobulins (IvIgs) in isolated and systemic inflammatory disease-related forms. In this article, we analyzed retrospectively our clinical experience with IvIg therapy in a series of clinical cases of pericarditis refractory to conventional treatment. We retrospectively analyzed 9 patients (1994 to 2010) with refractory recurrent pericarditis, who received high-dose IvIg as a part of their medical treatment. Nonsteroidal anti-inflammatory drugs (NSAIDs), steroids, or colchicine treatment was not discontinued during IvIg treatment. No patients had a history of autoimmune or connective tissue diseases. During an average period of 11 months from the first recurrence, patients had experienced a mean of 5 relapses before the first IvIg treatment. In 4 cases, patients showed complete clinical remission with no further relapse after the first IvIg cycle. Two patients experienced a single minor relapse, responsive to short-term nonsteroidal anti-inflammatory drugs. In 2 patients, we performed a second cycle of IvIg after a recurrence of pericarditis, with subsequent complete remission. One patient did not respond to 3 cycles of IvIg and subsequently underwent pericardial window and long-term immunosuppressive treatment. No major adverse effect was observed in consequence of IvIg administration in all the cases. In conclusion, although IvIg mode of action is still poorly understood in this setting, this treatment can be considered as an option in patients with recurrent pericarditis refractory to conventional medical treatment and, in our small series, has proved to be effective in 8 of 9 cases. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

    1994-01-01

    High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

  10. 76 FR 38050 - Defense Federal Acquisition Regulation Supplement; Management of Manufacturing Risk in Major...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-29

    ...-readiness processes of potential contractors and subcontractors as a part of the source selection process... Supplement (DFARS) subpart 215.3, Source Selection. It amends DFARS 215.304(c) by adding paragraph (iv) to... and subcontractors shall be considered as a part of the source selection process for major defense...

  11. Executive Summary and Policy Recommendations. Part IV. The Work of Nets.

    ERIC Educational Resources Information Center

    Scherer, Jacqueline

    This summary, the last of a four-part study of social networks in Pontiac, Michigan, presents highlights from the three previous volumes and advocates the use of network research for understanding the dissemination process in educational innovation. Based on the conclusion that social networks provide a metaphor for understanding complex social…

  12. 42 CFR 431.625 - Coordination of Medicaid with Medicare part B.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...-living increases under title II of the Act; (iv) Beneficiaries of foster care maintenance payments or... 42 Public Health 4 2012-10-01 2012-10-01 false Coordination of Medicaid with Medicare part B. 431.625 Section 431.625 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND...

  13. 42 CFR 431.625 - Coordination of Medicaid with Medicare part B.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...-living increases under title II of the Act; (iv) Beneficiaries of foster care maintenance payments or... 42 Public Health 4 2014-10-01 2014-10-01 false Coordination of Medicaid with Medicare part B. 431.625 Section 431.625 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND...

  14. 42 CFR 431.625 - Coordination of Medicaid with Medicare part B.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...-living increases under title II of the Act; (iv) Beneficiaries of foster care maintenance payments or... 42 Public Health 4 2013-10-01 2013-10-01 false Coordination of Medicaid with Medicare part B. 431.625 Section 431.625 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND...

  15. AB 1725, IV: Part-Time Faculty.

    ERIC Educational Resources Information Center

    California Community Colleges, Sacramento. Board of Governors.

    An overview is provided of issues related to the use of part-time faculty in community colleges in California and elsewhere in the nation. First, background information is provided on the major relevant issues. This section: (1) lists the teaching functions which are best carried out by full-time instructors as argued by those who favor employing…

  16. 45 CFR 301.0 - Scope and applicability of this part.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 45 Public Welfare 2 2014-10-01 2012-10-01 true Scope and applicability of this part. 301.0 Section 301.0 Public Welfare Regulations Relating to Public Welfare OFFICE OF CHILD SUPPORT ENFORCEMENT (CHILD... deals with the administration of title IV-D of the Social Security Act by the Federal Government...

  17. 76 FR 39788 - Regulations Governing Fees for Services

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-07

    ... DEPARTMENT OF TRANSPORTATION Surface Transportation Board 49 CFR Part 1002 [Docket No. EP 542 (Sub... governing user fees for services performed, 49 CFR 1002.2(f), Part V, by lowering the fee for sub-item 56(iv... complaint to the Board. For example, over the past 10 years, our Rail Consumer and Public Assistance unit...

  18. 46 CFR 10.227 - Requirements for renewal.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... part 5 of this chapter or if facts that would render a renewal improper have come to the attention of... this part; (C) Complete an approved refresher training course; or (D) Present evidence of employment in... renewal of an officer endorsement as first-class pilot are contained in § 11.713 of this chapter. (iv) An...

  19. Environmental Sentinel Biomonitor (ESB) System Technology Assessment

    DTIC Science & Technology

    2007-02-01

    Andersson M, Barile FA, et al. 1996. MEIC evaluation of acute systemic toxicity Part I. Methodology of 68 in vitro toxicity assays used to test the first...30 reference chemicals. ATLA 24:251-272. Clemedson C, Andersson M, Aoki Y, Barile FA, et al. 1998. MEIC evaluation of acute systemic toxicity Part IV

  20. 75 FR 10121 - Milk in the Northeast and Other Marketing Areas; Final Decision on Proposed Amendments to...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-04

    ... Part IV Department of Agriculture Agricultural Marketing Service 7 CFR Parts 1000, 1001, 1005, et al. Milk in the Northeast and Other Marketing Areas; Final Decision on Proposed Amendments to Tentative Marketing Agreements and Orders; Proposed Rule #0;#0;Federal Register / Vol. 75, No. 42 / Thursday...

  1. Soviet Political Perspectives on Power Projection.

    DTIC Science & Technology

    1987-03-01

    justified by the recognition on the part of many Soviet economists that the traditional Soviet development model does not work. Rapid nationalization...37 Models of Economic Development................................43 IV. ARMED STRUGGLE AND REVOLUTIONARY CHANGE...Soviets always describe revolutionary change in ~.~ the Third World as merely the product of local social and political forces, part of an inevitable

  2. O-Pu-U (Oxygen-Plutonium-Uranium)

    NASA Astrophysics Data System (ADS)

    Materials Science International Team MSIT

    This document is part of Subvolume C4 'Non-Ferrous Metal Systems. Part 4: Selected Nuclear Materials and Engineering Systems' of Volume 11 'Ternary Alloy Systems - Phase Diagrams, Crystallographic and Thermodynamic Data critically evaluated by MSIT®' of Landolt-Börnstein - Group IV 'Physical Chemistry'. It provides data of the ternary system Oxygen-Plutonium-Uranium.

  3. Health physics division annual progress report for period ending June 30, 1977

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1978-07-01

    This annual progress report follows, as in the past, the organizational structure of the Health Physics Division. Each part is a report of work done by a section of the division: Assessment and Technology Section (Part I), headed by H.W. Dickson; Biological and Radiation Physics Section (Part II), H.A. Wright; Chemical Physics and Spectroscopy Section (Part III), W.R. Garrett; Emergency Technology Section (Part IV), C.V. Chester, Medical Physics and Internal Dosimetry Section (Part V), K.E. Cowser; and the Analytic Dosimetry and Education Group (Part VI), J.E. Turner.

  4. AGARD Index of Publications (1952-1970). Part III: Author Index, Part IV: Addendum to Part I,

    DTIC Science & Technology

    When the AGARD Index of Publications 1952-1970 was published in June 1972, no Author Index was provided. Experience with the basic document has...therefore contains both an Author Index of all publications and papers from 1952-1970 and, in addition, an Addendum containing a listing of the titles of all individual papers that were omitted from the basic document.

  5. Absorption spectroscopic studies of Np(IV) complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reed, D. T.

    2004-01-01

    The complexation of neptunium (IV) with selected inorganic and organic ligands was studied as part of an investigation to establish key subsurface interactions between neptunium and biological systems. The prevalence of reducing environments in most subsurface migation scenarios, which are in many cases induced by biological activity, has increased the role and importance of Np(IV) as a key subsurface neptunium oxidation state. The biodegradation of larger organics that often coexist with actinides in the subsurface leads to the formation of many organic acids as transient products that, by complexation, play a key role in defining the fate and speciation ofmore » neptunium in biologically active systems. These often compete with inorganic complexes e.g. hydrolysis and phosphate. Herein we report the results of a series of complexation studies based on new band formation of the characteristic 960 nm band for Np(IV). Formation constants for Np(IV) complexes with phosphate, hydrolysis, succinate, acetohydroxamic acid, and acetate were determined. These results show the 960 nm absorption band to be very amenable to these types of complexation studies.« less

  6. Molecular characterization and phenotypical study of β-thalassemia in Tucumán, Argentina.

    PubMed

    Lazarte, Sandra S; Mónaco, María E; Haro, Ana C; Jiménez, Cecilia L; Ledesma Achem, Myriam E; Issé, Blanca A

    2014-01-01

    The main hereditary hemoglobin (Hb) disorder in Argentina is β-thalassemia (β-thal). Molecular studies performed in the center of the country exhibited a marked prevalence of the codon 39 (C > T) and IVS-I-110 (G > A) mutations. The northwest region of Argentina has a different demographic history characterized by an important Spanish influx. Seventy-one β-thal carriers attending the Instituto de Bioquímica Aplicada, Tucumán, Argentina, were investigated for β-globin gene mutations by real-time polymerase chain reaction (RT-PCR). To examine the genotype-phenotype relationship, mean corpuscular volume (MCV), mean corpuscular Hb (MCH) and Hb A2 were measured. In order to recognize β-thal, Mentzer Index, Shine & Lal and Red Cell Distribution Width Index (RDWI), were calculated. The ethnic background of subjects revealed that 82.0% of the population was of Italian, Spanish and Arab origin. Seven mutations were detected: codon 39 (45.0%), IVS-I-1 (G > A) (22.5%), IVS-I-110 (16.3%), IVS-II-1 (G > A) (4.1%), IVS-I-1 (G > T) (2.0%), IVS-I-6 (T > C) (2.0%) and IVS-II-745 (G > C) (2.0%). In three families (6.1%), β-thal mutations were not determined. These results differed from other Argentinian studies because at present codon 39 and IVS-I-1 are the most prevalent; MCV, MCH and Hb A2 did not correlate with the type of mutation (β(0)/β(+)). Values of MCV (67.0 fL) and Hb A2 (4.85%) were unable to discriminate between them. Significant differences (p < 0.05) in MCV, MCH and Shine & Lal were observed between the undetermined group and the three most common mutations. These data show different patterns of β-thal mutations in the center and northwest regions of Argentina. Differences might represent the influence of Spanish immigration.

  7. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

    PubMed

    Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

    2002-06-01

    Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

  8. Inelastic cotunneling with energy-dependent contact transmission

    NASA Astrophysics Data System (ADS)

    Blok, S.; Agundez Mojarro, R. R.; Maduro, L. A.; Blaauboer, M.; Van Der Molen, S. J.

    2017-03-01

    We investigate inelastic cotunneling in a model system where the charging island is connected to the leads through molecules with energy-dependent transmission functions. To study this problem, we propose two different approaches. The first is a pragmatic approach that assumes Lorentzian-like transmission functions that determine the transmission probability to the island. Using this model, we calculate current versus voltage (IV) curves for increasing resonance level positions of the molecule. We find that shifting the resonance energy of the molecule away from the Fermi energy of the contacts leads to a decreased current at low bias, but as bias increases, this difference decreases and eventually inverses. This is markedly different from IV behavior outside the cotunneling regime. The second approach involves multiple cotunneling where also the molecules are considered to be in the Coulomb blockade regime. We find here that when Ec≫eV ,kBT , the IV behavior approaches the original cotunneling behavior proposed by Averin and Nazarov [Phys. Rev. Lett. 65, 2446-2449 (1990)].

  9. KSC-00padig074

    NASA Image and Video Library

    2000-11-02

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, participants cut the lines to helium-filled balloons. From left, they are Center Director Roy Bridges; Michael Butchko, president, SGS; Pierre Dufour, president and CEO, Air Liquide America Corporation; David Herst, director, Delta IV Launch Sites; Pamela Gillespie, executive administrator, office of Congressman Dave Weldon; and Col. Samuel Dick, representative of the 45th Space Wing. The nine-mile-long buried pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. It will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS), and Ramon Lugo, acting executive director, JPMO

  10. KSC-00padig075

    NASA Image and Video Library

    2000-11-02

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, participants watch as helium-filled balloons take to the sky after their lines were cut. From left, they are Center Director Roy Bridges; Michael Butchko, president, SGS; Pierre Dufour, president and CEO, Air Liquide America Corporation; David Herst, director, Delta IV Launch Sites; Pamela Gillespie, executive administrator, office of Congressman Dave Weldon; and Col. Samuel Dick, representative of the 45th Space Wing. The nine-mile-long buried pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. It will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS), and Ramon Lugo, acting executive director, JPMO

  11. KSC00padig075

    NASA Image and Video Library

    2000-11-02

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, participants watch as helium-filled balloons take to the sky after their lines were cut. From left, they are Center Director Roy Bridges; Michael Butchko, president, SGS; Pierre Dufour, president and CEO, Air Liquide America Corporation; David Herst, director, Delta IV Launch Sites; Pamela Gillespie, executive administrator, office of Congressman Dave Weldon; and Col. Samuel Dick, representative of the 45th Space Wing. The nine-mile-long buried pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. It will also serve as a backup helium resource for Shuttle launches. Nearly one launch’s worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS), and Ramon Lugo, acting executive director, JPMO

  12. Commissioning of a new helium pipeline

    NASA Technical Reports Server (NTRS)

    2000-01-01

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, participants cut the lines to helium-filled balloons. From left, they are Center Director Roy Bridges; Michael Butchko, president, SGS; Pierre Dufour, president and CEO, Air Liquide America Corporation; David Herst, director, Delta IV Launch Sites; Pamela Gillespie, executive administrator, office of Congressman Dave Weldon; and Col. Samuel Dick, representative of the 45th Space Wing. The nine-mile-long buried pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. It will also serve as a backup helium resource for Shuttle launches. Nearly one launch's worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS), and Ramon Lugo, acting executive director, JPMO.

  13. Commissioning of a new helium pipeline

    NASA Technical Reports Server (NTRS)

    2000-01-01

    At the commissioning of a new high-pressure helium pipeline at Kennedy Space Center, participants watch as helium-filled balloons take to the sky after their lines were cut. From left, they are Center Director Roy Bridges; Michael Butchko, president, SGS; Pierre Dufour, president and CEO, Air Liquide America Corporation; David Herst, director, Delta IV Launch Sites; Pamela Gillespie, executive administrator, office of Congressman Dave Weldon; and Col. Samuel Dick, representative of the 45th Space Wing. The nine-mile-long buried pipeline will service launch needs at the new Delta IV Complex 37 at Cape Canaveral Air Force Station. It will also serve as a backup helium resource for Shuttle launches. Nearly one launch's worth of helium will be available in the pipeline to support a Shuttle pad in an emergency. The line originates at the Helium Facility on KSC and terminates in a meter station at the perimeter of the Delta IV launch pad. Others at the ceremony were Jerry Jorgensen, pipeline project manager, Space Gateway Support (SGS), and Ramon Lugo, acting executive director, JPMO.

  14. Cumene oxidation by cis-[RuIV(bpy)2(py)(O)]2+, revisited.

    PubMed

    Bryant, Jasmine R; Matsuo, Takashi; Mayer, James M

    2004-02-23

    cis-[RuIV(bpy)2(py)(O)]2+ oxidizes cumene (2-phenylpropane) in acetonitrile solution primarily to cumyl alcohol (2-phenyl-2-propanol), alpha-methylstyrene, and acetophenone. Contrary to a prior report, the rate of the reaction is not accelerated by added nucleophiles. There is thus no evidence for the hydride transfer mechanism originally proposed. Instead, the results are consistent with a mechanism of initial hydrogen atom transfer from cumene to the ruthenium oxo group. This is indicated by the correlation of rate with C-H bond strength and by the various products observed. The formation of acetophenone, with one carbon less than cumene, is suggested to occur via a multistep pathway involving decarbonylation of the acyl radical from 2-phenylpropanal. An alternative mechanism involving beta-scission of cumyloxyl radical is deemed unlikely because of the difficulty of generating alkoxyl radicals under anaerobic conditions and the lack of rearranged products in the oxidation of triphenylmethane by cis-[RuIV(bpy)2(py)(O)]2+.

  15. Selection indices for quality evaluation in wheat breeding.

    PubMed

    Branlard, G; Pierre, J; Rousset, M

    1992-06-01

    From multilocation trials involving 125 cultivars of wheat of mainly French and European origin four tests - protein content, Pelshenke, modified Zeleny and the mixograph - were used to establish six selection indices. Three of these indices - IW1, IW2 and IW3 - were calculated in order to evaluate the genetic potentiality of the lines for dough strength as given by the Chopin alveograph. The indices IV1, IV2 and IV3 were established to evaluate loaf volume as measured by the French bread-making standard. A quality index IQ was calculated from the allelic effects of the high-molecular-weight (HMW) subunits of glutenin from 195 cultivars assessed by the Chopin alveograph and the Pelshenke test. Comparison of the relative efficiency of each of the six indices to the individual tests revealed the superiority of the indices over one or several technological parameters. The six selection indices and the quality index were compared using 30 very diverse F4 lines. Their ability to retain the good quality lines is discussed in particular.

  16. Methods of Contemporary Gauge Theory

    NASA Astrophysics Data System (ADS)

    Makeenko, Yuri

    2002-08-01

    Preface; Part I. Path Integrals: 1. Operator calculus; 2. Second quantization; 3. Quantum anomalies from path integral; 4. Instantons in quantum mechanics; Part II. Lattice Gauge Theories: 5. Observables in gauge theories; 6. Gauge fields on a lattice; 7. Lattice methods; 8. Fermions on a lattice; 9. Finite temperatures; Part III. 1/N Expansion: 10. O(N) vector models; 11. Multicolor QCD; 12. QCD in loop space; 13. Matrix models; Part IV. Reduced Models: 14. Eguchi-Kawai model; 15. Twisted reduced models; 16. Non-commutative gauge theories.

  17. Methods of Contemporary Gauge Theory

    NASA Astrophysics Data System (ADS)

    Makeenko, Yuri

    2005-11-01

    Preface; Part I. Path Integrals: 1. Operator calculus; 2. Second quantization; 3. Quantum anomalies from path integral; 4. Instantons in quantum mechanics; Part II. Lattice Gauge Theories: 5. Observables in gauge theories; 6. Gauge fields on a lattice; 7. Lattice methods; 8. Fermions on a lattice; 9. Finite temperatures; Part III. 1/N Expansion: 10. O(N) vector models; 11. Multicolor QCD; 12. QCD in loop space; 13. Matrix models; Part IV. Reduced Models: 14. Eguchi-Kawai model; 15. Twisted reduced models; 16. Non-commutative gauge theories.

  18. Incremental viscosity by non-equilibrium molecular dynamics and the Eyring model

    NASA Astrophysics Data System (ADS)

    Heyes, D. M.; Dini, D.; Smith, E. R.

    2018-05-01

    The viscoelastic behavior of sheared fluids is calculated by Non-Equilibrium Molecular Dynamics (NEMD) simulation, and complementary analytic solutions of a time-dependent extension of Eyring's model (EM) for shear thinning are derived. It is argued that an "incremental viscosity," ηi, or IV which is the derivative of the steady state stress with respect to the shear rate is a better measure of the physical state of the system than the conventional definition of the shear rate dependent viscosity (i.e., the shear stress divided by the strain rate). The stress relaxation function, Ci(t), associated with ηi is consistent with Boltzmann's superposition principle and is computed by NEMD and the EM. The IV of the Eyring model is shown to be a special case of the Carreau formula for shear thinning. An analytic solution for the transient time correlation function for the EM is derived. An extension of the EM to allow for significant local shear stress fluctuations on a molecular level, represented by a gaussian distribution, is shown to have the same analytic form as the original EM but with the EM stress replaced by its time and spatial average. Even at high shear rates and on small scales, the probability distribution function is almost gaussian (apart from in the wings) with the peak shifted by the shear. The Eyring formula approximately satisfies the Fluctuation Theorem, which may in part explain its success in representing the shear thinning curves of a wide range of different types of chemical systems.

  19. Arab oil: a bibliography of materials in the Library of Congress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Selim, G.M.

    1982-01-01

    This bibliography draws attention to materials on Arab oil in the collections of the Library of Congress that were available through 1980. It cites articles, books, dissertations, maps, papers, periodicals, reports, and audiovisual materials in Western languages that use the Roman alphabet. The bibliography is divided into four parts: Part I covers the Arab world and the Middle East as a whole; Part II covers political and geographical entities; Part III deals with OPEC; and Part IV lists dictionaries which relate to the Arab oil industry.

  20. Interactive Visualization of National Airspace Data in 4D (IV4D)

    DTIC Science & Technology

    2010-08-01

    Research Laboratory) JView graphics engine. All of the software, IV4D/Viewer/JView, is written in Java and is platform independent, meaning that it...both parts. 11 3.3.1.1 Airspace Volumes Once appropriate CSV or ACES XML airspace boundary files are selected from a standard Java File Chooser...persistence mechanism, Hibernate , was replaced with JDBC specific code and, over time, quite a bit of JDBC support code was added to the Viewer and to

Top