Early diagnosis of orthopedic implant failure using macromolecular imaging agents.

PubMed

Ren, Ke; Dusad, Anand; Zhang, Yijia; Purdue, P Edward; Fehringer, Edward V; Garvin, Kevin L; Goldring, Steven R; Wang, Dong

2014-08-01

To develop and evaluate diagnostic tools for early detection of wear particle-induced orthopaedic implant loosening. N-(2-Hydroxypropyl)methacrylamide (HPMA) copolymer was tagged with a near infrared dye and used to detect the inflammation induced by polymethylmethacrylate (PMMA) particles in a murine peri-implant osteolysis model. It was established by inserting an implant into the distal femur and challenging with routine PMMA particles infusion. The osteolysis was evaluated by micro-CT and histological analysis at different time points. Significant peri-implant osteolysis was found 3-month post PMMA particle challenge by micro-CT and histological analysis. At 1-month post challenge, when there was no significant peri-implant bone loss, the HPMA copolymer-near infrared dye conjugate was found to specifically target the femur with PMMA particles deposition, but not the contralateral control femur with phosphate buffered saline (PBS) infusion. The results from this study demonstrate the feasibility of utilizing the macromolecular diagnostic agent to detect particle-induced peri-implant inflammation prior to the development of detectable osteolysis. Recognition of this early pathological event would provide the window of opportunity for prevention of peri-implant osteolysis and subsequent orthopaedic implant failure.

Transcriptional profile of human macrophages stimulated by ultra-high molecular weight polyethylene particulate debris of orthopedic implants uncovers a common gene expression signature of rheumatoid arthritis.

PubMed

Terkawi, Mohamad Alaa; Hamasaki, Masanari; Takahashi, Daisuke; Ota, Masahiro; Kadoya, Ken; Yutani, Tomoyo; Uetsuki, Keita; Asano, Tsuyoshi; Irie, Tohru; Arai, Ryuta; Onodera, Tomohiro; Takahata, Masahiko; Iwasaki, Norimasa

2018-01-01

Osteolysis is a serious postoperative complication of total joint arthroplasty that leads to aseptic loosening and surgical revision. Osteolysis is a chronic destructive process that occurs when host macrophages recognize implant particles and release inflammatory mediators that increase bone-resorbing osteoclastic activity and attenuate bone-formation osteoblastic activity. Although much progress has been made in understanding the molecular responses of macrophages to implant particles, the pathways/signals that initiate osteolysis remain poorly characterized. Transcriptomics and gene-expression profiling of these macrophages may unravel key mechanisms in the pathogenesis of osteolysis and aid the identification of molecular candidates for therapeutic intervention. To this end, we analyzed the transcriptional profiling of macrophages exposed to ultra-high molecular weight polyethylene (UHMWPE) particles, the most common components used in bearing materials of orthopedic implants. Regulated genes in stimulated macrophages were involved in cytokine, chemokine, growth factor and receptor activities. Gene enrichment analysis suggested that stimulated macrophages elicited common gene expression signatures for inflammation and rheumatoid arthritis. Among the regulated genes, tumor necrosis factor superfamily member 15 (TNFSF15) and chemokine ligand 20 (CCL20) were further characterized as molecular targets involved in the pathogenesis of osteolysis. Treatment of monocyte cultures with TNFSF15 and CCL20 resulted in an increase in osteoclastogenesis and bone-resorbing osteoclastic activity, suggesting their potential contribution to loosening between implants and bone tissues. Implant loosening due to osteolysis is the most common mode of arthroplasty failure and represents a great challenge to orthopedic surgeons and a significant economic burden for patients and healthcare services worldwide. Bone loss secondary to a local inflammatory response initiated by particulate debris from implants is considered the principal feature of the pathogenesis of osteolysis. In the present study, we analyzed the transcriptional profiling of human macrophages exposed to UHMWPE particles and identified a large number of inflammatory genes that were not identified previously in macrophage responses to wear particles. Our data provide a new insight into the molecular pathogenesis of osteolysis and highlights a number of molecular targets with prognostic and therapeutic implications. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Phelligridin D-loaded oral nanotube titanium implant enhances osseointegration and prevents osteolysis in rat mandible.

PubMed

Kim, Ji-Eun; Takanche, Jyoti Shrestha; Kim, Jeong-Seok; Lee, Min-Ho; Jeon, Jae-Gyu; Park, Il-Song; Yi, Ho-Keun

2018-04-12

Poor bone quality and osteolysis are the major causes of implant failure in dentistry. Here, this study tested the effect of phelligridin D-loaded nanotubes titanium (Ti) for bone formation around the dental implants. The purpose of this study was to enhance osseointegration of phelligridin D-loaded implant into the bone for bone formation and prevention of osteolysis. Cell viability, crystal violet staining, Western blot, alizarin red S staining, alkaline phosphatase activity, tartrate-resistant acid phosphatase staining, micro-computed tromography (μ-CT), hematoxylin and eosin (H&E) and immunohistochemical staining were used in vitro and in vivo to test the biocompatibility of phelligridin D. Phelligridin D enhanced osteoblast differentiation and mineralization by increasing bone morphogenic protein-2/7 (BMP-2/7), Osterix, Runx-2, osteoprotegerin (OPG), alkaline phosphatase and inhibited osteoclast differentiation by decreasing receptor activator of nuclear factor kappa-B ligand (RANKL) in MC-3T3 E1 cells. Further, phelligridin D promoted bone regeneration around nanotube Ti implant surface by increasing the levels of BMP-2/7 and OPG in a rat model. Phelligridin D also inhibited osteolysis by suppressing the expression of RANKL. These findings strongly suggest that phelligridin D is a new compound representing a potential therapeutic candidate for implant failure caused by osteolysis and poor bone quality of teeth.

What experimental approaches (eg, in vivo, in vitro, tissue retrieval) are effective in investigating the biologic effects of particles?

PubMed Central

Bostrom, Mathias; O'Keefe, Regis

2009-01-01

Understanding the complex cellular and tissue mechanisms and interactions resulting in periprosthetic osteolysis requires a number of experimental approaches, each of which has its own set of advantages and limitations. In vitro models allow for the isolation of individual cell populations and have furthered our understanding of particle-cell interactions; however, they are limited because they do not mimic the complex tissue environment in which multiple cell interactions occur. In vivo animal models investigate the tissue interactions associated with periprosthetic osteolysis, but the choice of species and whether the implant system is subjected to mechanical load or to unloaded conditions are critical in assessing whether these models can be extrapolated to the clinical condition. Rigid analysis of retrieved tissue from clinical cases of osteolysis offers a different approach to studying the biologic process of osteolysis, but it is limited in that the tissue analyzed represents the end-stage of this process and, thus, may not reflect this process adequately. PMID:18612016

What experimental approaches (eg, in vivo, in vitro, tissue retrieval) are effective in investigating the biologic effects of particles?

PubMed

Bostrom, Mathias; O'Keefe, Regis

2008-01-01

Understanding the complex cellular and tissue mechanisms and interactions resulting in periprosthetic osteolysis requires a number of experimental approaches, each of which has its own set of advantages and limitations. In vitro models allow for the isolation of individual cell populations and have furthered our understanding of particle-cell interactions; however, they are limited because they do not mimic the complex tissue environment in which multiple cell interactions occur. In vivo animal models investigate the tissue interactions associated with periprosthetic osteolysis, but the choice of species and whether the implant system is subjected to mechanical load or to unloaded conditions are critical in assessing whether these models can be extrapolated to the clinical condition. Rigid analysis of retrieved tissue from clinical cases of osteolysis offers a different approach to studying the biologic process of osteolysis, but it is limited in that the tissue analyzed represents the end-stage of this process and, thus, may not reflect this process adequately.

Rifampin suppresses osteoclastogenesis and titanium particle-induced osteolysis via modulating RANKL signaling pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Liang; Shanghai Key Laboratory for Bone and Joint Diseases, Shanghai Institute of Orthopaedics and Traumatology, Shanghai Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai; Kang, Hui

Wear particles liberated from the surface of prostheses are considered to be main reason for osteoclast bone resorption and that extensive osteoclastogenesis leads to peri-implant osteolysis and subsequent prosthetic loosening. The aim of this study was to assess the effect of rifampin on osteoclastogenesis and titanium (Ti) particle-induced osteolysis. The Ti particle-induced osteolysis mouse calvarial model and bone marrow-derived macrophages (BMMs) were used. Rifampin, at dose of 10 or 50 mg/kg/day, was respectively given intraperitoneally for 14 days in vivo. The calvariae were removed and processed for Further histological analysis. In vitro, osteoclasts were generated from mouse BMMs with receptor activator of nuclearmore » factor-κB ligand (RANKL) and the macrophage colony stimulating factor. Rifampin at different concentrations was added to the medium. The cell viability, tartrate-resistant acid phosphatase (TRAP) staining, TRAP activity and resorption on bone slices were analysis. Osteoclast-specific genes and RANKL-induced MAPKs signaling were tested for further study of the mechanism. Rifampin inhibited Ti-induced osteolysis and osteoclastogenesis in vivo. In vitro data indicated that rifampin suppressed osteoclast differentiation and bone resorption in a dose-dependent manner. Moreover, rifampin significantly reduced the expression of osteoclast-specific markers, including TRAP, cathepsin K, V-ATPase d2, V-ATPase a3, c-Fos, and nuclear factor of activated T cells (NFAT) c1. Further investigation revealed that rifampin inhibited osteoclast formation by specifically abrogating RANKL-induced p38 and NF-κB signaling. Rifampin had significant potential for the treatment of particle-induced peri-implant osteolysis and other diseases caused by excessive osteoclast formation and function. - Highlights: • Rifampin inhibited Ti-induced osteolysis and osteoclastogenesis in vivo. • Rifampin suppressed osteoclast differentiation and bone resorption in a dose-dependent manner. • Rifampin significantly reduced the expression of osteoclast-specific markers in vitro. • RANKL-induced p38 and NF-κB signaling may be involved behind the effects of rifampin treatment on osteoclastogenesis.« less

Mechanical instability and titanium particles induce similar transcriptomic changes in a rat model for periprosthetic osteolysis and aseptic loosening.

PubMed

Amirhosseini, Mehdi; Andersson, Göran; Aspenberg, Per; Fahlgren, Anna

2017-12-01

Wear debris particles released from prosthetic bearing surfaces and mechanical instability of implants are two main causes of periprosthetic osteolysis. While particle-induced loosening has been studied extensively, mechanisms through which mechanical factors lead to implant loosening have been less investigated. This study compares the transcriptional profiles associated with osteolysis in a rat model for aseptic loosening, induced by either mechanical instability or titanium particles. Rats were exposed to mechanical instability or titanium particles. After 15 min, 3, 48 or 120 h from start of the stimulation, gene expression changes in periprosthetic bone tissue was determined by microarray analysis. Microarray data were analyzed by PANTHER Gene List Analysis tool and Ingenuity Pathway Analysis (IPA). Both types of osteolytic stimulation led to gene regulation in comparison to unstimulated controls after 3, 48 or 120 h. However, when mechanical instability was compared to titanium particles, no gene showed a statistically significant difference (fold change ≥ ± 1.5 and adjusted p-value ≤ 0.05) at any time point. There was a remarkable similarity in numbers and functional classification of regulated genes. Pathway analysis showed several inflammatory pathways activated by both stimuli, including Acute Phase Response signaling, IL-6 signaling and Oncostatin M signaling. Quantitative PCR confirmed the changes in expression of key genes involved in osteolysis observed by global transcriptomics. Inflammatory mediators including interleukin (IL)-6, IL-1β, chemokine (C-C motif) ligand (CCL)2, prostaglandin-endoperoxide synthase (Ptgs)2 and leukemia inhibitory factor (LIF) showed strong upregulation, as assessed by both microarray and qPCR. By investigating genome-wide expression changes we show that, despite the different nature of mechanical implant instability and titanium particles, osteolysis seems to be induced through similar biological and signaling pathways in this rat model for aseptic loosening. Pathways associated to the innate inflammatory response appear to be a major driver for osteolysis. Our findings implicate early restriction of inflammation to be critical to prevent or mitigate osteolysis and aseptic loosening of orthopedic implants.

OSTEOLYSIS FOLLOWING RADIATION INDUCED FRACTURE OF THE CLAVICLE (in German)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kolar, J.

1961-04-01

A case is described in which osteolysis of the lateral half of the clavicle was observed following a radiation induced fracture. No previous observation of a similar complication following irradiation of bone has been described. The phenomenon may be compared with the spontaneous absorption of bone following fractures in this region. (auth)

Medium term follow-up of the AES ankle prosthesis: High rate of asymptomatic osteolysis.

PubMed

Rodriguez, Dante; Bevernage, Bernhard Devos; Maldague, Pierre; Deleu, Paul-André; Tribak, Karim; Leemrijse, Thibaut

2010-06-01

The AES (Ankle Evolutive System) is a cobalt-chromium three-component ankle prosthesis with a hydroxyapatite coating, similar to the Buechel-Pappas ankle prosthesis, but with some modifications. Our objective was to assess its medium term follow-up results as well as its complications. 21 patients (mean age of 57.6 years) were operated by a total ankle arthroplasty (TAA), using the AES implant, according to the standard technique. Only 18 patients were included. The other three patients were excluded from the study: two had been revised for avascular talar necrosis and one patient was happy with her outcome but could not present for logistic reasons at the last follow-up. Indications for surgery included posttraumatic osteoarthritis, primary osteoarthritis, hemochromatosis, rheumatic arthritis and osteoarthritis as a sequel of ankle instability. All patients were analyzed clinically and radiologically. Special attention was given to the presence or not of areas of osteolysis around the implants as well on conventional radiography as on CT-scan imaging, according to a specific protocol. The mean follow-up was 39.4 months. Average American Orthopaedic Foot and Ankle Society (AOFAS) ankle-hindfoot score improved from 52.2 preoperatively to 86.6 postoperatively. No intra-operative complications or early complications have been noted. Delayed complications were the following: one valgus malalignment, one recurrent painful anterior heterotrophic bone formation. Above all, we noted on conventional X-ray the presence of osteolysis in 77% (14) of our patients, with a size of 0.5-1cm or greater on conventional X-ray. The most vulnerable area seemed to be the posterior tibial plafond. The four remaining patients did not show any cyst formation on X-ray but did also, just as the other 14 patients, on the CT-scan. CT-scan, on the contrary, found more osteolysis in the body of the talus, underneath the implant, an area masked on conventional X-ray. Only one patient was revised with allograft bone filling of a symptomatic osteolysis, without the need for implant removal. This retrospective study shows a high frequency of delayed appearance of osteolysis (77%) in 18 AES total ankle arthroplasties. Fortunately at this moment and considering one revision, this considerable amount of asymptomatic osteolysis could not warrant a durable uncomplicated outcome. Copyright 2009 European Foot and Ankle Society. Published by Elsevier Ltd. All rights reserved.

The fibroblast expression of RANKL in CoCrMo-particle-induced osteolysis is mediated by ER stress and XBP1s.

PubMed

Wang, Zhenheng; Huang, Zhen; Gan, Jingjing; Liu, Naicheng; Zhou, Gang; Shi, Tongguo; Wang, Zhenzhen; Wang, Rui; Bao, Nirong; Guo, Ting; Chen, Jiangning; Zhang, Junfeng; Dong, Lei; Zhao, Jianning

2015-09-01

Particle-induced osteolysis is a major cause of aseptic loosening, which is the most common reason for total hip arthroplasty (THA) failure and revision surgery. Although existing studies suggest that synovial fibroblasts present in the interfacial membrane are important targets of wear particles during bone resorption, the interaction mechanisms between the particles and fibroblasts remains elusive. In the present study, we investigated the effect of ER stress induced by CoCrMo particles (CoPs) in fibroblasts, calvarial resorption animal models and aseptic loosening clinical samples and its role in the stimulation of the RANKL expression. Our study further demonstrated that CoPs could induce significant ER stress in fibroblasts. Blocking ER stress with a specific inhibitor dramatically reduced the particle-induced expression of RANKL in vitro and in vivo. Furthermore, in fibroblasts, downregulation of the expression of XBP1s, a signaling molecule of ER stress, significantly reduced the expression of RANKL induced by wear particles. Moreover, inhibition of ER stress or XBP1s both ameliorated the CoPs-induced osteolysis in animal models. Collectively, these results suggested that in particle-induced osteolysis, CoPs could stimulate fibroblasts to secret RANKL through ER stress and the signaling molecule XBP1s. Therefore, downregulating ER stress or the signaling molecule XBP1s of fibroblasts represents a potential therapeutic approach for treating particle-induced peri-implant osteolysis. For the first time, our study demonstrated that ER stress mediated the induction of RANKL expression by CoPs in fibroblasts and promoted particle-induced osteolysis. Furthermore, the upregulation of RANKL by CoPs in fibroblasts was mediated by the ER stress signaling molecule XBP1s. Both blocking ER stress and inhibiting the protein XBP1s by specific inhibitors resulted in downregulation of the expression of RANKL and amelioration of osteolysis induced by the implanted particles. Collectively, these findings suggest a possible mechanism underlying the RANKL expression induced by wear particles in fibroblasts, and downregulating ER stress and the XBP1s expression of fibroblasts represents a potential therapeutic approach for treating aseptic loosening. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

[Epidermal cyst and osteolysis of the cranial vault].

PubMed

Guillaud, V; Rémond, J; Balme, B; Moulin, G

1992-01-01

In a 40-year old man undergoing, under local anaesthesia, excision of an epidermal cyst located in the frontal region, at the border of the scalp, the operator had difficulties in removing the deep part of the cyst and perceived an underlying bone depression. The depression was caused by a 2 x 1.3 cm wide lacuna in the calvarium, which was subsequently treated by neurosurgeons. Histology showed only fragments of a simple epidermal cyst wall and no evidence of dermoid cyst. The causes of osteolysis associated with congenital or acquired skin lesions are reviewed. In this case, the old age and volume of the cyst may explain the osteolysis by mechanical compression. This case is exceptional since we were unable to find other examples in the literature, apart from dermoid and trichilemmal cysts.

The degree of peri-implant osteolysis induced by PEEK, CoCrMo, and HXLPE wear particles: a study based on a porous Ti6Al4V implant in a rabbit model.

PubMed

Du, Zhe; Zhu, Zhonglin; Wang, You

2018-01-31

Polyether-ether-ketone (PEEK), cobalt-chromium-molybdenum (CoCrMo), and highly cross-linked polyethylene (HXLPE) are biomaterials used in orthopedic implants; their wear particles are considered to induce peri-implant osteolysis. We examined whether different particle types induce the same degree of peri-implant osteolysis. Forty female rabbits were randomly divided into four groups-the control group (n = 10), which received implantation operation and sham operation at 1 month postoperation; three experimental groups (n = 10 in each group), which received implantation operation along with administration of 0.1 mL of particle suspension (approximately 1.0 × 10 8 PEEK, CoCrMo, or HXLPE wear particles) into the knee joint at 1 month postoperation. All rabbits were sacrificed at 2 months postoperation. The synovium was removed and histologically assessed. The distal femurs with the implants were analyzed via micro-computed tomography (CT) and hard tissue biopsy. The average size of almost 90% of the particles was < 5 μm, indicating no significant difference in the three particle types. IL-1β, IL-8, TNFα, RANKL, and MCP-1 expression in PEEK and CoCrMo groups was high, while that in the HXLPE group was low. The bone density (BD) and bone volume/total volume (BV/TV) of the porous structures (part of the implants in all groups) in experimental groups did not decrease markedly (p > 0.05), while BD in the peripheral regions in experimental groups decreased markedly compared to control groups (p < 0.05). BV/TV in the peripheral regions was significantly decreased in PEEK and CoCrMo groups when compared to control group (p < 0.05), while no significant difference was noted between HXLPE and control groups (p > 0.05). The changes in BV observed in the hard tissue sections were consistent with those noted in the micro-CT findings. PEEK, CoCrMo, and HXLPE wear particles (approximately having the same size and doses) induce peri-implant osteolysis to a different degree: HXLPE particles induce peri-implant osteolysis to a mild degree, while PEEK and CoCrMo particles caused significant peri-implant osteolysis. In case of a porous implant, osteolysis occurred primarily in the peripheral region, rather than in the porous structures. Our findings would be helpful for implant designers to choose friction pairs in orthopedic components.

The effect of poly sterilization on wear, osteolysis and survivorship of a press-fit cup at 10-year followup.

PubMed

Engh, Charles A; Powers, Cara C; Ho, Henry; Beykirch-Padgett, Sarah E; Hopper, Robert H; Engh, C Anderson

2012-02-01

During the mid-1990s when our institution was using a press-fit porous-coated cup without supplemental initial fixation for primary THA, the manufacturer transitioned from gamma irradiation to gas plasma for the terminal sterilization of their polyethylene liners. At minimum 10-year followup, we asked whether the fixation achieved by solely relying on a press-fit would be durable and how different liner sterilization methods affected radiographic wear, osteolysis, and survivorship. We retrospectively reviewed 373 patients who underwent 398 primary THAs with a press-fit porous-coated cup between March 1995 and December 1996. Mean age at time of surgery was 61.5 ± 13.3 years and mean followup was 10.4 ± 3.7 years. We determined reasons for revision, survivorship, femoral head penetration, osteolysis, and wear-related complications. Among 20 revisions involving any component, seven were associated with wear and osteolysis. Kaplan-Meier survivorship, using component revision for any reason as an end point, was 95.7% (95% confidence interval, 93.6%-97.9%) at 10 years. Noncrosslinked liners sterilized with gas plasma demonstrated a mean head penetration rate of 0.20 ± 0.09 mm/year compared with 0.13 ± 0.07 mm/year for liners sterilized with gamma irradiation in air and 0.09 ± 0.04 mm/year for liners sterilized with gamma-irradiation with barrier packaging without oxygen. THAs with increased volumetric wear tended to demonstrate larger osteolytic lesions (r = 0.40) and there tended to be less osteolysis among the liners sterilized with gamma-irradiation with barrier packaging without oxygen. However, there was no difference in survivorship among the sterilization groups and there has been no cup or stem loosening associated with osteolysis. Durable biologic fixation through 10-year followup can be achieved by solely relying on an initial press-fit. Noncrosslinking gas plasma for terminal sterilization of the polyethylene liners was associated with greater head penetration rate than gamma irradiation. Level IV, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

A single intraperitoneal injection of bovine fetuin-A attenuates bone resorption in a murine calvarial model of particle-induced osteolysis.

PubMed

Jablonski, Heidrun; Polan, Christina; Wedemeyer, Christian; Hilken, Gero; Schlepper, Rüdiger; Bachmann, Hagen Sjard; Grabellus, Florian; Dudda, Marcel; Jäger, Marcus; Kauther, Max Daniel

2017-12-01

Particle-induced osteolysis, which by definition is an aseptic inflammatory reaction to implant-derived wear debris eventually leading to local bone destruction, remains the major reason for long-term failure of orthopedic endoprostheses. Fetuin-A, a 66kDa glycoprotein with diverse functions, is found to be enriched in bone. Besides being an important inhibitor of ectopic calcification, it has been described to influence the production of mediators of inflammation. Furthermore, a regulatory role in bone metabolism has been assigned. In the present study, the influence of a single dose of bovine fetuin-A, intraperitoneally injected in mice subjected to particle-induced osteolysis of the calvaria, was analyzed. Twenty-eight male C57BL/6 mice, twelve weeks of age, were randomly divided into four groups. Groups 2 and 4 were subjected to ultra-high molecular weight polyethylene (UHMWPE) particles placed on their calvariae while groups 1 and 3 were sham-operated. Furthermore, groups 3 and 4 received a single intraperitoneal injection of 20mg bovine fetuin-A while groups 1 and 2 were treated with physiologic saline. After 14days calvarial bone was qualitatively and quantitatively assessed using microcomputed tomography (μCT) and histomorphometrical approaches. Application of fetuin-A led to a reduction of particle-induced osteolysis in terms of visible osteolytic lesions and eroded bone surface. The reduction of bone thickness and bone volume, as elicited by UHMWPE, was alleviated by fetuin-A. In conclusion, fetuin-A was found to exert an anti-resorptive effect on particle-induced osteolysis in-vivo. Thus, fetuin-A could play a potentially osteoprotective role in the treatment of bone metabolic disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

Polyubiquitination events mediate polymethylmethacrylate (PMMA) particle activation of NF-kappaB pathway.

PubMed

Yamanaka, Yasuhiro; Karuppaiah, Kannan; Abu-Amer, Yousef

2011-07-08

The pathologic response to implant wear-debris constitutes a major component of inflammatory osteolysis and remains under intense investigation. Polymethylmethacrylate (PMMA) particles, which are released during implant wear and loosening, constitute a major culprit by virtue of inducing inflammatory and osteolytic responses by macrophages and osteoclasts, respectively. Recent work by several groups has identified important cellular entities and secreted factors that contribute to inflammatory osteolysis. In previous work, we have shown that PMMA particles contribute to inflammatory osteolysis through stimulation of major pathways in monocytes/macrophages, primarily NF-κB and MAP kinases. The former pathway requires assembly of large IKK complex encompassing IKK1, IKK2, and IKKγ/NEMO. We have shown recently that interfering with the NF-κB and MAPK activation pathways, through introduction of inhibitors and decoy molecules, impedes PMMA-induced inflammation and osteolysis in mouse models of experimental calvarial osteolysis and inflammatory arthritis. In this study, we report that PMMA particles activate the upstream transforming growth factor β-activated kinase-1 (TAK1), which is a key regulator of signal transduction cascades leading to activation of NF-κB and AP-1 factors. More importantly, we found that PMMA particles induce TAK1 binding to NEMO and UBC13. In addition, we show that PMMA particles induce TRAF6 and UBC13 binding to NEMO and that lack of TRAF6 significantly attenuates NEMO ubiquitination. Altogether, these observations suggest that PMMA particles induce ubiquitination of NEMO, an event likely mediated by TRAF6, TAK1, and UBC13. Our findings provide important information for better understanding of the mechanisms underlying PMMA particle-induced inflammatory responses.

Periprosthetic wear particle migration and distribution modelling and the implication for osteolysis in cementless total hip replacement.

PubMed

Alidousti, Hamidreza; Taylor, Mark; Bressloff, Neil W

2014-04-01

In total hip replacement (THR), wear particles play a significant role in osteolysis and have been observed in locations as remote as the tip of femoral stem. However, there is no clear understanding of the factors and mechanisms causing, or contributing to particle migration to the periprosthetic tissue. Interfacial gaps provide a route for particle laden joint fluid to transport wear particles to the periprosthetic tissue and cause osteolysis. It is likely that capsular pressure, gap dimensions and micromotion of the gap during cyclic loading of an implant, play defining roles to facilitate particle migration. In order to obtain a better understanding of the above mechanisms and factors, transient two-dimensional computational fluid dynamic simulations have been performed for the flow in the lateral side of a cementless stem-femur system including the joint capsule, a gap in communication with the capsule and the surrounding bone. A discrete phase model to describe particle motion has been employed. Key findings from these simulations include: (1) Particles were shown to enter the periprosthetic tissue along the entire length of the gap but with higher concentrations at both proximal and distal ends of the gap and a maximum rate of particle accumulation in the distal regions. (2) High capsular pressure, rather than gap micromotion, has been shown to be the main driving force for particle migration to periprosthetic tissue. (3) Implant micromotion was shown to pump out rather than draw in particles to the interfacial gaps. (4) Particle concentrations are consistent with known distributions of (i) focal osteolysis at the distal end of the gap and (ii) linear osteolysis along the entire gap length. Copyright © 2014 Elsevier Ltd. All rights reserved.

CoCrMo alloy vs. UHMWPE Particulate Implant Debris Induces Sex Dependent Aseptic Osteolysis Responses In Vivo using a Murine Model

PubMed Central

Landgraeber, Stefan; Samelko, Lauryn; McAllister, Kyron; Putz, Sebastian; Jacobs, Joshua.J.; Hallab, Nadim James

2018-01-01

Background: The rate of revision for some designs of total hip replacements due to idiopathic aseptic loosening has been reported as higher for women. However, whether this is environmental or inherently sex-related is not clear. Objective: Can particle induced osteolysis be sex dependent? And if so, is this dependent on the type of implant debris (e.g. metal vs polymer)? The objective of this study was to test for material dependent inflammatory osteolysis that may be linked to sex using CoCrMo and implant grade conventional polyethylene (UHMWPE), using an in vivo murine calvaria model. Methods: Healthy 12 week old female and male C57BL/6J mice were treated with UHMWPE (1.0um ECD) or CoCrMo particles (0.9um ECD) or received sham surgery. Bone resorption was assessed by micro-computed tomography, histology and histomorphometry on day 12 post challenge. Results: Female mice that received CoCrMo particles showed significantly more inflammatory osteolysis and bone destruction compared to the females who received UHMWPE implant debris. Moreover, females challenged with CoCrMo particles exhibited 120% more inflammatory bone loss compared to males (p<0.01) challenged with CoCrMo implant debris (but this was not the case for UHMWPE particles). Conclusion: We demonstrated sex-specific differences in the amount of osteolysis resulting from CoCrMo particle challenge. This suggests osteo-immune responses to metal debris are preferentially higher in female compared to male mice, and supports the contention that there may be inherent sex related susceptibility to some types of implant debris. PMID:29785221

Suppression of osteogenic activity by regulation of WNT and BMP signaling during titanium particle induced osteolysis.

PubMed

Nam, Ju-Suk; Sharma, Ashish Ranjan; Jagga, Supriya; Lee, Dong-Hyun; Sharma, Garima; Nguyen, Lich Thi; Lee, Yeon Hee; Chang, Jun-Dong; Chakraborty, Chiranjib; Lee, Sang-Soo

2017-03-01

Periprosthetic osteolysis remains the leading obstacle for total joint replacements. Primarily, it was thought that aseptic loosening is mainly caused by macrophage mediated inflammatory process arising from production of wear debris. The role of osteoclasts and its sequential bone resorption ability has been extensively studied, but little is known about impaired osteogenesis during osteolysis. In the current study, we have tried to delineate the regulatory mechanism of osteogenic signals by Ti particles in osteoprogenitor cells as well its participatory role in wear debris induced osteolysis. Implantation of Ti particles on mice calvaria induced pro-inflammatory response, elevated expression of COX2 and reduced the expression of Osterix. Treatment of Ti particles to MC3T3 E-1 cells displayed decreased osteogenic activity including ALP activity, mineralization and mRNA levels several osteogenic genes. Moreover, the basal activity of WNT and BMP signaling pathways was suppressed in MC3T3 E-1 cells treated with Ti particles. As an early response to Ti particles, MC3T3 E-1 cells showed activation of ERK and JNK. Co-inhibition of ERK and JNK with their specific inhibitors resulted in partial recovery of WNT and BMP signaling activity as well as ALP activity and collagen synthesis. Finally, LiCl mediated activation of WNT signaling pathway demonstrated rescue of Ti particle facilitated suppression of Osterix expression in mice calvaria. Our results provide evidences that WNT signaling pathway is regulated by ERK, JNK, and BMP signaling pathway during wear debris induced inflammatory osteolysis and may be considered as suitable therapeutic targets for the treatment. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 912-926, 2017. © 2017 Wiley Periodicals, Inc.

Differential effects of biologic versus bisphosphonate inhibition of wear debris-induced osteolysis assessed by longitudinal micro-CT.

PubMed

Tsutsumi, Ryosuke; Hock, Colleen; Bechtold, C Dustin; Proulx, Steven T; Bukata, Susan V; Ito, Hiromu; Awad, Hani A; Nakamura, Takashi; O'Keefe, Regis J; Schwarz, Edward M

2008-10-01

Aseptic loosening of total joint replacements is caused by wear debris-induced osteoclastic bone resorption, for which bisphosphonates (BPs) and RANK antagonists have been developed. Although BPs are effective in preventing metabolic bone loss, they are less effective for inflammatory bone loss. Because this difference has been attributed to the antiapoptotic inflammatory signals that protect osteoclasts from BP-induced apoptosis, but not RANK antagonists, we tested the hypothesis that osteoprotegerin (OPG) is more effective in preventing wear debris-induced osteolysis than zoledronic acid (ZA) or alendronate (Aln) in the murine calvaria model using in vivo micro-CT and traditional histology. Although micro-CT proved to be incompatible with titanium (Ti) particles, we were able to demonstrate a 3.2-fold increase in osteolytic volume over 10 days induced by polyethylene (PE) particles versus sham controls (0.49 +/- 0.23 mm(3) versus 0.15 +/- 0.067 mm(3); p < 0.01). Although OPG and high-dose ZA completely inhibited this PE-induced osteolysis (p < 0.001), pharmacological doses of ZA and Aln were less effective but still reached statistical significance (p < 0.05). Traditional histomorphometry of the sagital suture area of calvaria from both Ti and PE-treated mice confirmed the remarkable suppression of resorption by OPG (p < 0.001) versus the lack of effect by physiological BPs. The differences in drug effects on osteolysis were largely explained by the significant difference in osteoclast numbers observed between OPG versus BPs in both Ti- and PE-treated calvaria; and linear regression analyses that demonstrated a highly significant correlation between osteolysis volume and sagittal suture area versus osteoclast numbers (p < 0.001). (c) 2008 Orthopaedic Research Society.

Massive osteolysis of the right clavicle developing after radiation therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skinner, W.L.; Buzdar, A.U.; Libshitz, H.I.

1988-07-15

This report describes an unusual case of clavicular osteolysis, a late complication of radiation therapy for breast cancer, and demonstrates the diagnostic implications that radiotherapy changes can pose. Radiotherapy to the chest wall produces a spectrum of alterations in bone over time, ranging from early roentgenographic findings of osteoporosis and trabecular thickening to spontaneous fractures and changes that may be confused with metastatic disease or postirradiation sarcoma.

Inhibition of particulate debris-induced osteolysis by alendronate in a rat model.

PubMed

Thadani, Peter J; Waxman, Bryan; Sladek, Eduard; Barmada, Riad; Gonzalez, Mark H

2002-01-01

A rat model was used to study the efficacy of alendronate therapy in inhibition of particle-induced periprosthetic osteolysis. A prosthesis was simulated by inserting a cylindrical polymethylmethacrylate plug into the distal femur of 24 rats allowing the plug to communicate with the joint space. Intra-articular injections of irregularly-shaped ultra-high molecular weight polyethylene particles of 20-200 pm in diameter were administered at 2-week intervals. The rats were randomized into two groups (n=12 each). Group A rats received twice weekly subcutaneous injections of alendronate sodium while group B rats received injections of saline vehicle only. At 10 weeks all rats were sacrificed. The distal femurs were harvested and axial sections were prepared for histologic analysis. Each section was graded on a scale of 1-4, quantifying the degree of osteolysis surrounding the polymethylmethacrylate plug. Microscopic examination showed a significant (P<.0001) difference in the amount of periprosthetic bone. Femurs from group A treated with alendronate demonstrated mostly normal or near-normal periprosthetic trabeculations, whereas femurs from group B treated with saline showed extensive bone resorption. There was no qualitative difference in the inflammatory cellular response between the groups. This study established the ability of alendronate to inhibit the osteoclastic-mediated osteolysis around joint implants.

Scaling of titanium implants entrains inflammation-induced osteolysis

PubMed Central

Eger, Michal; Sterer, Nir; Liron, Tamar; Kohavi, David; Gabet, Yankel

2017-01-01

With millions of new dental and orthopedic implants inserted annually, periprosthetic osteolysis becomes a major concern. In dentistry, peri-implantitis management includes cleaning using ultrasonic scaling. We examined whether ultrasonic scaling releases titanium particles and induces inflammation and osteolysis. Titanium discs with machined, sandblasted/acid-etched and sandblasted surfaces were subjected to ultrasonic scaling and we physically and chemically characterized the released particles. These particles induced a severe inflammatory response in macrophages and stimulated osteoclastogenesis. The number of released particles and their chemical composition and nanotopography had a significant effect on the inflammatory response. Sandblasted surfaces released the highest number of particles with the greatest nanoroughness properties. Particles from sandblasted/acid-etched discs induced a milder inflammatory response than those from sandblasted discs but a stronger inflammatory response than those from machined discs. Titanium particles were then embedded in fibrin membranes placed on mouse calvariae for 5 weeks. Using micro-CT, we observed that particles from sandblasted discs induced more osteolysis than those from sandblasted/acid-etched discs. In summary, ultrasonic scaling of titanium implants releases particles in a surface type-dependent manner and may aggravate peri-implantitis. Future studies should assess whether surface roughening affects the extent of released wear particles and aseptic loosening of orthopedic implants. PMID:28059080

Melatonin attenuates titanium particle-induced osteolysis via activation of Wnt/β-catenin signaling pathway.

PubMed

Ping, Zichuan; Hu, Xuanyang; Wang, Liangliang; Shi, Jiawei; Tao, Yunxia; Wu, Xiexing; Hou, Zhenyang; Guo, Xiaobin; Zhang, Wen; Yang, Huilin; Xu, Yaozeng; Wang, Zhirong; Geng, Dechun

2017-03-15

Wear debris-induced inhibition of bone regeneration and extensive bone resorption were common features in peri-prosthetic osteolysis (PPO). Here, we investigated the effect of melatonin on titanium particle-stimulated osteolysis in a murine calvariae model and mouse-mesenchymal-stem cells (mMSCs) culture system. Melatonin inhibited titanium particle-induced osteolysis and increased bone formation at osteolytic sites, confirmed by radiological and histomorphometric data. Furthermore, osteoclast numbers decreased dramatically in the low- and high-melatonin administration mice, as respectively, compared with the untreated animals. Melatonin alleviated titanium particle-induced depression of osteoblastic differentiation and mineralization in mMSCs. Mechanistically, melatonin was found to reduce the degradation of β-catenin, levels of which were decreased in presence of titanium particles both in vivo and in vitro. To further ensure whether the protective effect of melatonin was mediated by the Wnt/β-catenin signaling pathway, ICG-001, a selective β-catenin inhibitor, was added to the melatonin-treated groups and was found to attenuate the effect of melatonin on mMSC mineralization. We also demonstrated that melatonin modulated the balance between receptor activator of nuclear factor kappa-B ligand and osteoprotegerin via activation of Wnt/β-catenin signaling pathway. These findings strongly suggest that melatonin represents a promising candidate in the treatment of PPO. Peri-prosthetic osteolysis, initiated by wear debris-induced inhibition of bone regeneration and extensive bone resorption, is the leading cause for implant failure and reason for revision surgery. In the current study, we demonstrated for the first time that melatonin can induce bone regeneration and reduce bone resorption at osteolytic sites caused by titanium-particle stimulation. These effects might be mediated by activating Wnt/β-catenin signaling pathway and enhancing osteogenic differentiation. Meanwhile, the ability of melatonin to modulate the balance between receptor activator of nuclear factor kappa-B ligand and osteoprotegerin mediated by Wnt/β-catenin signaling pathway, thereby suppressing osteoclastogenesis, may be implicated in the protective effects of melatonin on titanium-particle-induced bone resorption. These results suggested that melatonin can be considered as a promising therapeutic agent for the prevention and treatment of peri-prosthetic osteolysis. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Biological response to prosthetic debris

PubMed Central

Bitar, Diana; Parvizi, Javad

2015-01-01

Joint arthroplasty had revolutionized the outcome of orthopaedic surgery. Extensive and collaborative work of many innovator surgeons had led to the development of durable bearing surfaces, yet no single material is considered absolutely perfect. Generation of wear debris from any part of the prosthesis is unavoidable. Implant loosening secondary to osteolysis is the most common mode of failure of arthroplasty. Osteolysis is the resultant of complex contribution of the generated wear debris and the mechanical instability of the prosthetic components. Roughly speaking, all orthopedic biomaterials may induce a universal biologic host response to generated wear débris with little specific characteristics for each material; but some debris has been shown to be more cytotoxic than others. Prosthetic wear debris induces an extensive biological cascade of adverse cellular responses, where macrophages are the main cellular type involved in this hostile inflammatory process. Macrophages cause osteolysis indirectly by releasing numerous chemotactic inflammatory mediators, and directly by resorbing bone with their membrane microstructures. The bio-reactivity of wear particles depends on two major elements: particle characteristics (size, concentration and composition) and host characteristics. While any particle type may enhance hostile cellular reaction, cytological examination demonstrated that more than 70% of the debris burden is constituted of polyethylene particles. Comprehensive understanding of the intricate process of osteolysis is of utmost importance for future development of therapeutic modalities that may delay or prevent the disease progression. PMID:25793158

Distal clavicular osteolysis: a review of the literature.

PubMed

Schwarzkopf, Ran; Ishak, Charbel; Elman, Michael; Gelber, Jonathan; Strauss, David N; Jazrawi, Laith M

2008-01-01

Acute distal clavicular osteolysis was first described in 1936. Since then, distal clavicular osteolysis (DCO) has been separated into traumatic and atraumatic pathogeneses. In 1982 the first series of male weight trainers who developed ADCO was reported. The association of weightlifting and ADCO is especially important considering how routine a component weights are to the male athlete's training. The pathogenesis of DCO has often been debated. The most widely accepted etiology involves a connection between microfractures of the subchondral bone and subsequent attempts at repair, which is consistent with repetitive microtrauma. Symptoms usually begin with an insidious aching pain in the AC region that is exacerbated by weight training. On examination, patients have point tenderness over the affected AC joint and pain with a cross-body adduction maneuver. Although DCO may seem like an easy and quick diagnosis, one must rule out other possibilities. Avoidance of provocative maneuvers, modification of weight training techniques, ice massage, and nonsteroidal anti-inflammatory drugs (NSAID) constitute the basis of initial treatment. Much of the literature supports the same general indications for surgery. These include point tenderness of the AC joint, evident abnormal signs with AC joint scintigraphy and AC radiographs, lack of response to conservative treatment, and an unwillingness to give up or modify weight training or manual labor. Distal clavicle resection has provided good results. Distal clavicle osteolysis is a unique disease most likely due to an overuse phenomenon.

Wear particles and ions from cemented and uncemented titanium-based hip prostheses—A histological and chemical analysis of retrieval material

PubMed Central

Grosse, Susann; Haugland, Hans Kristian; Lilleng, Peer; Ellison, Peter; Hallan, Geir; Høl, Paul Johan

2015-01-01

Wear debris-induced inflammation is considered to be the main cause for periprosthetic osteolysis in total hip replacements (THR). The objective of this retrieval study was to examine the tissue reactions and exposure to metal ions and wear particles in periprosthetic tissues and blood samples from patients with titanium (Ti)-based hip prostheses that were revised due to wear, osteolysis, and/or aseptic loosening. Semiquantitative, histological tissue evaluations in 30 THR-patients revealed numerous wear debris-loaded macrophages, inflammatory cells, and necrosis in both groups. Particle load was highest in tissues adjacent to loosened cemented Ti stems that contained mainly submicron zirconium (Zr) dioxide particles. Particles containing pure Ti and Ti alloy elements were most abundant in tissues near retrieved uncemented cups. Polyethylene particles were also detected, but accounted only for a small portion of the total particle number. The blood concentrations of Ti and Zr were highly elevated in cases with high abrasive wear and osteolysis. Our findings indicate that wear particles of different chemical composition induced similar inflammatory responses, which suggests that particle size and load might be more important than the wear particle composition in periprosthetic inflammation and osteolysis. © 2014 The Authors. Journal of Biomedical Materials Research Part B: Applied Biomaterials Published by Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 103B:709–717, 2015. PMID:25051953

Diagnosis and Management of Distal Clavicle Osteolysis.

PubMed

DeFroda, Steven F; Nacca, Christopher; Waryasz, Gregory R; Owens, Brett D

2017-03-01

Distal clavicle osteolysis is an uncommon condition that most commonly affects weight lifters and other athletes who perform repetitive overhead activity. Although this condition most commonly presents in young active men, it is becoming increasing more common in women with the rise in popularity of body building and extreme athletics. Distal clavicle osteolysis can be debilitating, especially in those with rigorous training regimens, preventing exercise because of pain with activities such as bench presses and chest flies. Aside from a careful history and physical examination, radiographic evaluation is essential in distinguishing isolated distal clavicle osteolysis from acromioclavicular joint pathology, despite a potentially similar presentation of the 2 conditions. Nonoperative therapy that includes activity modification, nonsteroidal anti-inflammatory drugs, and cortisone injections is the first-line management for this condition. Patients whose conditions are refractory to nonoperative modalities may benefit from distal clavicle resection via either open or arthroscopic techniques. Arthroscopic techniques typically are favored because of improved cosmesis and the added benefit of the ability to assess the glenohumeral joint during surgery to rule out concomitant pathology. There are varying operative techniques even within arthroscopic management, with pros and cons of a direct and an indirect surgical approach. Patients often do well after such procedures and are able to return to their preinjury level of participation in a relatively short period. [Orthopedics. 2017; 40(2):119-124.]. Copyright 2016, SLACK Incorporated.

Intermittent Administration of Parathyroid Hormone [1-34] Prevents Particle-Induced Periprosthetic Osteolysis in a Rat Model.

PubMed

Bi, Fanggang; Shi, Zhongli; Zhou, Chenhe; Liu, An; Shen, Yue; Yan, Shigui

2015-01-01

We examined whether intermittent administration of parathyroid hormone [1-34] (PTH[1-34]; 60 μg/kg/day) can prevent the negative effects of titanium (Ti) particles on implant fixation and periprosthetic osteolysis in a rat model. Eighteen adult male rats (12 weeks old, bones still growing) received intramedullary Ti implants in their bilateral femurs; 6 rats from the blank group received vehicle injections, and 12 rats from the control group and PTH treatment group received Ti particle injections at the time of operation and intra-articular injections 2 and 4 weeks postoperatively. Six of the rats that received Ti particles from the PTH group also received PTH[1-34] treatment. Six weeks postoperatively, all specimens were collected for assessment by X-ray, micro-CT, biomechanical, scanning electron microscopy (SEM), and dynamic histomorphometry. A lower BMD, BV/TV, Tb.N, maximal fixation strength, and mineral apposition rate were observed in the control group compared to the blank group, demonstrating that a periprosthetic osteolysis model had been successfully established. Administration of PTH[1-34] significantly increased the bone mineral density of the distal femur, BV/TV, Tb.N, Tb.Th, Tb.Sp, Con.D, SMI, and maximal fixation strength in the PTH group compared to that in the control group. SEM revealed higher bone-implant contact, thicker lamellar bone, and larger trabecular bone area in the PTH group than in the control group. A higher mineral apposition rate was observed in the PTH group compared to both the blank and control groups. These findings imply that intermittent administration of PTH[1-34] prevents periprosthetic osteolysis by promoting bone formation. The effects of PTH[1-34] were evaluated at a suprapharmacological dosage to the human equivalent in rats; therefore, additional studies are required to demonstrate its therapeutic potential in periprosthetic osteolysis.

Expression of XBP1s in fibroblasts is critical for TiAl6 V4 particle-induced RANKL expression and osteolysis.

PubMed

Wang, Zhenheng; Liu, Naicheng; Zhou, Gang; Shi, Tongguo; Wang, Zhenzhen; Gan, Jingjing; Wang, Rui; Qian, Hongbo; Bao, Nirong; Guo, Ting; Zhao, Jianning

2017-04-01

Wear particle-induced osteolysis is a major cause of aseptic loosening, which is one of the most common reasons for total hip arthroplasty (THA) failure. Previous studies have shown that the expression of Receptor activation of nuclear factor (NF)-kB (RANKL) by fibroblasts in periprosthetic membrane played a crucial role in wear particle-induced osteolysis. However, the underlying mechanism of RANKL expression remains largely unknown. In the present study, we investigated the effect of TiAl 6 V 4 particle (TiPs)-induced XBP1s (spliced form of X-box binding protein 1) on RANKL expression and osteoclastogenesis both in vitro and in vivo. The levels of XBP1s in peri-implant membrane, animal models, and TiPs-stimulated fibroblasts were determined by western blots. To assess the effect of XBP1s on RANKL expression, fibroblasts were treated with both a small interfering RNA (siRNA) and an inhibitor of XBP1 prior to exposure to TiPs. The effect of XBP1s on osteoclasts formation was determined by tartrate-resistant acid phosphatase (TRAP) staining in vitro osteoclastogenesis assay and in animal models. The resorption of bone was assessed by micro-computed tomography (micro-CT) with three-dimensional reconstruction. Our results demonstrated that XBP1s was activated in periprosthetic membrane, mouse calvaria models, and TiPs-stimulated human synovial fibroblasts. Further, inhibition of XBP1s decreased the expression of RANKL and osteoclasts formation in vitro. In mouse calvaria models, both of the osteoclastogenesis and osteolysis were inhibited XBP1s inhibitor. Our results suggested that XBP1s mediated TiPs-induced of RANKL expression in fibroblasts, and down regulating XBP1s may represent a potential therapy for wear particle-induced osteolysis. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:752-759, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

DHA is a more potent inhibitor of breast cancer metastasis to bone and related osteolysis than EPA

PubMed Central

Rahman, M.; Veigas, Maria; Williams, Paul J.; Fernandes, Gabriel

2013-01-01

Breast cancer patients often develop bone metastasis evidenced by osteolytic lesions, leading to severe pain and bone fracture. Attenuation of breast cancer metastasis to bone and associated osteolysis by fish oil (FO), rich in EPA and DHA, has been demonstrated previously. However, it was not known whether EPA and DHA differentially or similarly affect breast cancer bone metastasis and associated osteolysis. In vitro culture of parental and luciferase gene encoded MDA-MB-231 human breast cancer cell lines treated with EPA and DHA revealed that DHA inhibits proliferation and invasion of breast cancer cells more potently than EPA. Intra-cardiac injection of parental and luciferase gene encoded MDA-MB-231 cells to athymic NCr nu/nu mice demonstrated that DHA treated mice had significantly less breast cancer cell burden in bone, and also significantly less osteolytic lesions than EPA treated mice. In vivo cell migration assay as measured by luciferase intensity revealed that DHA attenuated cell migration specifically to the bone. Moreover, the DHA treated group showed reduced levels of CD44 and TRAP positive area in bone compared to EPA treated group. Breast cancer cell burden and osteolytic lesions were also examined in intra-tibially breast cancer cell injected mice and found less breast cancer cell growth and associated osteolysis in DHA treated mice as compared to EPA treated mice. Finally, doxorubicin resistant MCF-7 (MCF-7dox) human breast cancer cell line was used to examine if DHA can improve sensitization of MCF-7dox cells to doxorubicin. DHA improved the inhibitory effect of doxorubicin on proliferation and invasion of MCF-7dox cells. Interestingly, drug resistance gene P-gp was also down-regulated in DHA plus doxorubicin treated cells. In conclusion, DHA attenuates breast cancer bone metastasis and associated osteolysis more potently than EPA, possibly by inhibiting migration of breast cancer cell to the bone as well as by inhibiting osteoclastic bone resorption. PMID:24062211

[Multiple myeloma with significant multifocal osteolysis in a dog without a detectible gammopathy].

PubMed

Souchon, F; Koch, A; Sohns, A

2013-01-01

Description of a variant of multiple myeloma in a dog lacking the gammopathy normally associated with this type of neoplasm. A Border Collie mongrel was presented with symptoms of progressive hind-leg weakness, lethargy and tiredness, which had started to appear 6 weeks previously. Radiographic examination showed small osteolytic areas in the spinal column, but also diffuse small areas of increased opacity as well as evidence of decreased bone density in the pelvis and of both femoral necks. Moderate regenerative anaemia, hypogammopathy and hypercalcaemia were diagnosed. Computed tomography scans displayed multifocal osteolysis and bone destruction in the skull, spinal column, scapulae, proximal humeri, pelvis and femoral necks. H&E staining of the biopsies showed bone destruction and monomorphic plasmacyotid cell populations, causing infiltrative bone marrow lesions and osteolysis. In many areas neoplastic plasma cell infiltration of the bone marrow was 70% and in some areas reached 100%. The diagnosis was non-secretory multiple myeloma without apparent secretion of paraproteins into the blood.

Alteration of the RANKL/RANK/OPG System in Periprosthetic Osteolysis with Septic Loosening.

PubMed

Wang, Long; Dai, Zixun; Xie, Jie; Liao, Hao; Lv, Cheng; Hu, Yihe

2016-02-01

The pathogenesis of periprosthetic osteolysis with septic loosening remains incompletely understood. The purpose of this study was to investigate whether expression of the RANKL/RANK/OPG system is altered in septic interface membranes (SIMs). Seventeen cases with a SIM, 26 cases with an aseptic interface membrane (AIM), and 12 cases with a normal synovium (NS) were assessed. Scanning and transmission electron microscopy (SEM and TEM, respectively) were used to observe the microscopic morphology of three tissue conditions. Differences in RANKL, RANK, and OPG expression at the mRNA level were assessed by real-time quantitative PCR, and differences at the protein level were assessed by immunohistochemical staining and Western blotting. SEM showed wear debris widely distributed on the AIM surface, and TEM showed Bacillus activity in the SIM. RANKL expression and the RANKL/OPG ratio were significantly increased in SIMs. Imbalance in the RANKL/RANK/OPG system is related to periprosthetic osteolysis with septic loosening but is not the only possible pathogenic mechanism.

Osteolysis of the femur: principles of management.

PubMed

Dunbar, M J; Blackley, H R; Bourne, R B

2001-01-01

Femoral osteolysis is and will remain an important cause of THA failures. The presentation is initially radiographic and patients may or may not become symptomatic. If so, pain is the most common symptom. Infection is the most common differential diagnosis and must be excluded. Osteolysis is usually progressive and may eventually lead to loss of implant fixation, implant fracture, or periprosthetic fracture. Multiple factors influence the decision to revise a femoral component, including the degree and type of bone loss, the rate at which it is progressing, the potential for fracture, the degree of symptoms, especially pain, and the activity level and general health of the patient. There are many options for revising failed femoral stems, each with varying degrees of success. The choice of technique and prosthesis used in the revision can be guided by a simple bone defect classification presented in this chapter. Revision of femoral components in these patients can be fraught with complications and poor results; hence, the importance of preoperative planning cannot be overemphasized.

Cementless total hip arthroplasty with ceramic-on-ceramic bearing in patients younger than 45 years with femoral-head osteonecrosis

PubMed Central

Choi, Yoowang; Kim, Jun-Shik

2009-01-01

Despite improvements in the quality of alumina ceramics, osteolysis has been reported anecdotally after total hip arthroplasty (THA) with use of a contemporary alumina-on-alumina ceramic bearing. The purpose of this study was to evaluate the clinical and radiographic outcomes of THA using alumina-on-alumina ceramic bearing and to determine osteolysis using radiographs and computed tomographic (CT) scans in young patients. Consecutive primary cementless THA using alumina-on-alumina ceramic bearing were performed in 64 patients (93 hips) who were younger than 45 years of age with femoral-head osteonecrosis. There were 55 men (84 hips) and nine women (nine hips). Average age was 38.2 (range 24–45) years. Average follow-up was 11.1 (range 10–13) years. Preoperative Harris Hip Score was 52.9 (range 22–58) points, which improved to 96 (range 85−100) points at the final follow-up examination. Two of 93 hips (2%) had clicking or squeaking sound. No hip had revision or aseptic loosening. Radiographs and CT scans demonstrated that no acetabular or femoral osteolysis was detected in any hip at the latest follow-up. Contemporary cementless acetabular and femoral components with alumina-on-alumina ceramic bearing couples function well with no osteolysis at a ten year minimum and average of 11.1-year follow-up in this series of young patients with femoral-head osteonecrosis. PMID:19784647

LncRNA PRNCR1 regulates osteogenic differentiation in osteolysis after hip replacement by targeting miR-211-5p.

PubMed

Gong, Zong-Ming; Tang, Zhen-Yu; Sun, Xiao-Liang

2018-05-11

Background Osteogenic differentiation and osteolysis after hip replacement are both associated with bone metabolism. Interaction between the long non-coding RNA (lncRNA) prostate cancer non-coding RNA 1 (PRNCR1) and miR-211-5p was analyzed to illuminate their roles in osteogenic differentiation and osteolysis. Methods The expression of PRNCR1, miR-211-5p and C-X-C chemokine receptor-4 (CXCR4) protein in tissues and mesenchymal stem cells (MSCs) were determined by qRT-PCR and western blot, separately. The osteogenic differentiation was assessed with Alkaline phosphatase (ALP) activity detection and ARS staining. The endogenous expressions of genes were modulated by recombinant plasmid and cell transfection. Combination condition and interaction between RNA and protein were determined with RIP and RNA pull-down assay, respectively. Interaction between miR-211-5p and CXCR4 was examined with Dual luciferase reporter assay. Results PRNCR1 and CXCR4 were up-regulated in wear particles around prosthesis and in MSCs incubated with Polymethylmethacrylate (PMMA), while miR-211-5p was down-regulated. Repression of PRNCR1 weakened the inhibitory effect of wear particles on osteogenic differentiation. PRNCR1 positively regulated CXCR4 through inhibiting miR-211-5p. Wear particles regulated CXCR4 level through miR-211-5p to affect osteogenic differentiation of MSCs. Wear particles regulated the miR-211-5p level through PRNCR1 to affect osteogenic differentiation of MSCs. Conclusion LncRNA PRNCR1 up-regulates CXCR4 through inhibiting miR-211-5p, which inhibits osteogenic differentiation and thereby leading to osteolysis after hip replacement. ©2018 The Author(s).

Close-wedge osteotomy for bony locking stiffness of the elbow in Gorham disease patients: a case report.

PubMed

Wang, Hsien-Chung; Lin, Gau-Tyan

2004-05-01

Gorham disease is a so-called massive idiopathic osteolysis or vanishing bone disorder. Massive osteolysis remains an enigmatic condition that involves various skeletal locations and is caused by endothelial proliferation. The diagnosis is difficult and is established via the association of clinical, radiologic and histologic pictures. Treatment modalities yield variable results. We report a case of vanishing bone in the elbow joint and carpal bones following trauma. This 13-year-old boy complained of severe restricted motion and deformity of the right elbow. We managed the problem using arthroplasty with close-wedge osteotomy on the lateral condyle of the humerus.

Blockade of NF-κB and MAPK pathways by ulinastatin attenuates wear particle-stimulated osteoclast differentiation in vitro and in vivo

PubMed Central

Ru, Jiang-Ying; Xu, Hai-Dong; Shi, Dai; Pan, Jun-Bo; Pan, Xiao-Jin; Wang, Yan-Fen

2016-01-01

Ulinastatin, a urinary trypsin inhibitor (UTI), is widely used to clinically treat lipopolysaccharide (LPS)-related inflammatory disorders recently. Adherent pathogen-associated molecular patterns (PAMPs), of which LPS is the best-studied and classical endotoxin produced by Gram-negative bacteria, act to increase the biological activity of osteopedic wear particles such as polymethyl-methacrylate (PMMA) and titanium particles in cell culture and animal models of implant loosening. The present study was designed to explore the inhibitory effect of UTI on osteoclastogenesis and inflammatory osteolysis in LPS/PMMA-mediated Raw264.7 cells and murine osteolysis models, and investigate the potential mechanism. The in vitro study was divided into the control group, LPS-induced group, PMMA-stimulated group and UTI-pretreated group. UTI (500 or 5000 units/ml) pretreatment was followed by PMMA (0.5 mg/ml) with adherent LPS. The levels of inflammatory mediators including tumour necrosis factor-α (TNF-α), matrixmetallo-proteinases-9 (MMP-9) and interleukin-6 (IL-6), receptor activation of nuclear factor NF-κB (RANK), and cathepsin K were examined and the amounts of phosphorylated I-κB, MEK, JNK and p38 were measured. In vivo study, murine osteolysis models were divided into the control group, PMMA-induced group and UTI-treated group. UTI (500 or 5000 units/kg per day) was injected intraperitoneally followed by PMMA suspension with adherent LPS (2×108 particles/25 μl) in the UTI-treated group. The thickness of interfacial membrane and the number of infiltrated inflammatory cells around the implants were assessed, and bone mineral density (BMD), trabecular number (Tb.N.), trabecular thickness (Tb.Th.), trabecular separation (Tb.Sp.), relative bone volume over total volume (BV/TV) of distal femur around the implants were calculated. Our results showed that UTI pretreatment suppressed the secretion of proinflammatory cytokines including MMP-9, IL-6, TNF-α, RANK and cathepsin K through down-regulating the activity of nuclear factor kappa B (NF-κB) and MAPKs partly in LPS/PMMA-mediated Raw264.7 cells. Finally, UTI treatment decreased the inflammatory osteolysis reaction in PMMA-induced murine osteolysis models. In conclusion, these results confirm the anti-inflammatory potential of UTI in the prevention of particle disease. PMID:27638499

Blockade of NF-κB and MAPK pathways by ulinastatin attenuates wear particle-stimulated osteoclast differentiation in vitro and in vivo.

PubMed

Ru, Jiang-Ying; Xu, Hai-Dong; Shi, Dai; Pan, Jun-Bo; Pan, Xiao-Jin; Wang, Yan-Fen

2016-10-01

Ulinastatin, a urinary trypsin inhibitor (UTI), is widely used to clinically treat lipopolysaccharide (LPS)-related inflammatory disorders recently. Adherent pathogen-associated molecular patterns (PAMPs), of which LPS is the best-studied and classical endotoxin produced by Gram-negative bacteria, act to increase the biological activity of osteopedic wear particles such as polymethyl-methacrylate (PMMA) and titanium particles in cell culture and animal models of implant loosening. The present study was designed to explore the inhibitory effect of UTI on osteoclastogenesis and inflammatory osteolysis in LPS/PMMA-mediated Raw264.7 cells and murine osteolysis models, and investigate the potential mechanism. The in vitro study was divided into the control group, LPS-induced group, PMMA-stimulated group and UTI-pretreated group. UTI (500 or 5000 units/ml) pretreatment was followed by PMMA (0.5 mg/ml) with adherent LPS. The levels of inflammatory mediators including tumour necrosis factor-α (TNF-α), matrixmetallo-proteinases-9 (MMP-9) and interleukin-6 (IL-6), receptor activation of nuclear factor NF-κB (RANK), and cathepsin K were examined and the amounts of phosphorylated I-κB, MEK, JNK and p38 were measured. In vivo study, murine osteolysis models were divided into the control group, PMMA-induced group and UTI-treated group. UTI (500 or 5000 units/kg per day) was injected intraperitoneally followed by PMMA suspension with adherent LPS (2×10 8 particles/25 μl) in the UTI-treated group. The thickness of interfacial membrane and the number of infiltrated inflammatory cells around the implants were assessed, and bone mineral density (BMD), trabecular number (Tb.N.), trabecular thickness (Tb.Th.), trabecular separation (Tb.Sp.), relative bone volume over total volume (BV/TV) of distal femur around the implants were calculated. Our results showed that UTI pretreatment suppressed the secretion of proinflammatory cytokines including MMP-9, IL-6, TNF-α, RANK and cathepsin K through down-regulating the activity of nuclear factor kappa B (NF-κB) and MAPKs partly in LPS/PMMA-mediated Raw264.7 cells. Finally, UTI treatment decreased the inflammatory osteolysis reaction in PMMA-induced murine osteolysis models. In conclusion, these results confirm the anti-inflammatory potential of UTI in the prevention of particle disease. © 2016 The Author(s).

Knee arthrodesis in failed total knee arthroplasty with severe osteolysis and ipsilateral long-stem total hip arthroplasty.

PubMed

Sim, Jae Ang; Lee, Beom Koo; Kwak, Ji Hoon; Moon, Sung Hoon

2009-02-01

We report a case of knee fusion after a failed total knee arthroplasty (TKA) with severe osteolysis including the epicondyle and ipsilateral total hip arthroplasty (THA) with long Wagner revision stem (Sulzer Orthopedics, Baar, Switzerland). The conventional devices for arthrodesis were unavailable in this case because of the long Wagner revision stem and poor bone stock. A connector was made between the long Wagner revision stem and an intramedullary nail (IM nail; Solco, Seoul, Korea). The custom-made connector was coupled with a femoral stem by cylindrical taper fit with additional cement augmentation and an intramedullary nail by screws. Osseous fusion was achieved without pain or instability.

Periprosthetic osteolysis: characterizing the innate immune response to titanium wear-particles.

PubMed

St Pierre, Christine A; Chan, Melvin; Iwakura, Yoichiro; Ayers, David C; Kurt-Jones, Evelyn A; Finberg, Robert W

2010-11-01

Osteolysis of bone following total hip replacement is a major clinical problem. Examination of the areas surrounding failed implants has indicated an increase in the bone-resorption-inducing cytokine, interleukin 1β (IL-1β). NALP3, a NOD-like receptor protein located in the cytosol of macrophages, signals the cleavage of pro-IL-1β into its mature, secreted form, IL-1β. Here we showed that titanium particles stimulate the NALP3 inflammasome. We demonstrated that titanium induces IL-1β secretion from macrophages. This response depended on the expression of components of the NALP3 inflammasome, including NALP3, ASC, and Caspase-1. We also showed that titanium particles trigger the recruitment of neutrophils and that this acute inflammatory response depends on the expression of the IL-1 receptor and IL-1α/β. Moreover, administration of the IL-1 receptor antagonist (IL-1Ra) diminished neutrophil recruitment in response to titanium particles. Together, these results suggest that titanium particle-induced acute inflammation is due to activation of the NALP3 inflammasome, which leads to increased IL-1β secretion and IL-1-associated signaling, including neutrophil recruitment. Efficacy of IL-1Ra treatment introduces the potential for antagonist-based therapies for implant osteolysis. © 2010 Orthopaedic Research Society.

Serial MRI evaluation following arthroscopic rotator cuff repair in double-row technique.

PubMed

Stahnke, Katharina; Nikulka, Constanze; Diederichs, Gerd; Haneveld, Hendrik; Scheibel, Markus; Gerhardt, Christian

2016-05-01

So far, recurrent rotator cuff defects are described to occur in the early postoperative period after arthroscopic repair. The aim of this study was to evaluate the musculotendinous structure of the supraspinatus, as well as bone marrow edema or osteolysis after arthroscopic double-row repair. Therefore, magnetic resonance (MR) images were performed at defined intervals up to 2 years postoperatively. Case series; Level of evidence, 3. MR imaging was performed within 7 days, 3, 6, 12, 26, 52 and 108 weeks after surgery. All patients were operated using an arthroscopic modified suture bridge technique. Tendon integrity, tendon retraction ["foot-print-coverage" (FPC)], muscular atrophy and fatty infiltration (signal intensity analysis) were measured at all time points. Furthermore, postoperative bone marrow edema and signs of osteolysis were assessed. MR images of 13 non-consecutive patients (6f/7m, ∅ age 61.05 ± 7.7 years) could be evaluated at all time points until ∅ 108 weeks postoperatively. 5/6 patients with recurrent defect at final follow-up displayed a time of failure between 12 and 24 months after surgery. Predominant mode of failure was medial cuff failures in 4/6 cases. The initial FPC increased significantly up to 2 years follow-up (p = 0.004). Evaluations of muscular atrophy or fatty infiltration were not significant different comparing the results of all time points (p > 0.05). Postoperative bone marrow edema disappeared completely at 6 months after surgery, whereas signs of osteolysis appeared at 3 months follow-up and increased to final follow-up. Recurrent defects after arthroscopic reconstruction of supraspinatus tears in modified suture bridge technique seem to occur between 12 and 24 months after surgery. Serial MRI evaluation shows good muscle structure at all time points. Postoperative bone marrow edema disappears completely several months after surgery. Signs of osteolysis seem to appear caused by bio-absorbable anchor implantations.

Particle-induced SIRT1 downregulation promotes osteoclastogenesis and osteolysis through ER stress regulation.

PubMed

Zhang, Liang; Bao, Dongmei; Li, Peng; Lu, Zhidong; Pang, Long; Chen, Zhirong; Guo, Haohui; Gao, Zhihui; Jin, Qunhua

2018-08-01

Sirtuin 1 (SIRT1) downregulation has been found to be induced by wear particles in aseptic prosthesis loosening (APL). Osteoclastogenesis and osteoclast activation are the main pathological factors associated with APL. However, whether SIRT1 downregulation contributes to the formation and activation of osteoclasts through the induction of endoplasmic reticulum (ER) stress is unclear. To address this, an osteolysis mouse model was used in which animals were treated with the SIRT1 activator, resveratrol (RES), or an ER stress inhibitor, 4-PBA, for two weeks. Osteolysis, osteoclastogenesis, and morphologic alteration of calvariae were observed by toluidine blue, TRAP, and H&E staining. SIRT1 expression and ER stress were evaluated by western blot analysis. In vitro, mouse macrophage RAW 264.7 cells were treated with polyethylene (PE) particles alone or combined with either RES or 4-PBA, and SIRT1 expression and ER stress were measured using western blot assays. Osteoclast differentiation was determined through TRAP staining. Osteoclast activation was evaluated by culturing osteoclast cells on bone slices followed by toluidine blue staining. Mechanistically, osteoclastogenesis-related MAPK activation, NFATc1 and c-Fos expression, and NF-κB translocation were determined. Both in vivo and in vitro experimental results indicated that PE particles induced SIRT1 downregulation and enhanced ER stress. SIRT1 activator RES and ER stress inhibitor 4-PBA significantly suppressed PE particle-induced osteoclast differentiation and osteolysis. In vitro experimental results showed that 4-PBA suppressed PE particle-induced ERK1/2, p38, and JNK activation, NFATc1 and c-Fos upregulation, as well as NF-κB p65 nucleus translocation. PE particle-induced downregulation of SIRT1 enhances ER stress and promotes osteoclast proliferation and bone resorption through regulation of c-Fos, NFATc1, and the MAPK and NF-κB signaling pathways. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Inhibitory effects of melatonin on titanium particle-induced inflammatory bone resorption and osteoclastogenesis via suppression of NF-κB signaling.

PubMed

Ping, Zichuan; Wang, Zhirong; Shi, Jiawei; Wang, Liangliang; Guo, Xiaobin; Zhou, Wei; Hu, Xuanyang; Wu, Xiexing; Liu, Yu; Zhang, Wen; Yang, Huilin; Xu, Yaozeng; Gu, Ye; Geng, Dechun

2017-10-15

Wear debris-induced peri-implant osteolysis challenges the longevity of implants. The host response to wear debris causes chronic inflammation, promotes bone resorption, and impairs bone formation. We previously demonstrated that melatonin enhances bone formation and attenuates wear debris-induced bone loss in vivo. However, whether melatonin inhibits chronic inflammation and bone resorption at sites of wear debris-induced osteolysis remains unclear. In this study, we examined the potential inhibitory effects of melatonin on titanium particle-induced inflammatory osteolysis in a murine calvarial model and on RANKL-induced osteoclastic formation in bone marrow-derived macrophages. We found that the exogenous administration of melatonin significantly inhibited wear debris-induced bone resorption and the expression of inflammatory cytokines in vivo. Additionally, melatonin inhibited RANKL-induced osteoclast differentiation, F-actin ring formation, and osteoclastic resorption in a concentration-dependent manner in vitro. We also showed that melatonin blocked the phosphorylation of IκB-α and p65, but not IKKα, and significantly inhibited the expression of NFATc1 and c-Fos. However, melatonin had no effect on MAPK or PI3K/AKT signaling pathways. These results provide novel mechanistic insight into the anti-inflammatory and anti-bone resorptive effects of melatonin on wear debris-induced bone loss and provide an evidence-based rationale for the protective effects of melatonin as a treatment for peri-implant osteolysis. Wear debris-induced chronic inflammation, osteoclastic activation and osteoblastic inhibition have been identified as critical factors of peri-implant bone loss. We previously demonstrated that melatonin, a bioactive indolamine secreted mainly by the pineal gland, activates Wnt/β-catenin signaling pathway and enhances bone regeneration at osteolytic site in vivo. In the current study, we further demonstrated that melatonin significantly suppresses wear debris-induced bone resorption and inflammatory cytokine expression in vivo. In addition, melatonin inhibits receptor activator of nuclear factor kappa-B ligand induced osteoclast formation and osteoclastic bone resorption in vitro. Meanwhile, we found that melatonin mediates its anti-inflammation and anti-bone resorption effects by abrogating nuclear factor kappa-B activation. These results further support the protective effects of melatonin on wear debris-induced peri-implant bone loss, and strongly suggest that melatonin could be considered as a potential candidate for the prevention and treatment of wear debris-induced osteolysis and subsequent aseptic loosening. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

A subperiosteal maxillary implant causing severe osteolysis.

PubMed

Maï, Nguyen Tan; Jean-Baptiste, Caruhel; Hossein, Khonsari Roman

2018-06-22

Subperiosteal implant denture therapy was initially introduced in 1942 in Sweden and was then used worldwide for the treatment of fully edentulous maxillary or mandibular arches with advanced bone atrophy. Most authors describe decent success rates for mandibular subperiosteal implants in cases with major bone atrophy but follow-up studies for maxillary subperiosteal implants are not available. Here, we report a case of severe maxillary osteolysis secondary to the placement of a subperiosteal in-house implant. Subperiosteal implants are rarely used today but patients still carrying these devices with severe complications can be challenging to manage. New technical advances, including the use of surgical planification and additive manufacturing, may lead to a new interest in subperiosteal implants. Copyright © 2018. Published by Elsevier Masson SAS.

Gorham's disease of the proximal tibia successfully treated with local administration of OK-432, followed by reconstruction with distraction osteogenesis: a case report.

PubMed

Yamagishi, Eiki; Takeda, Akira; Konno, Shinichi; Takeda, Koichiro; Hagino, Seita; Hakozaki, Michiyuki

2016-01-01

Gorham's disease (GD) is a rare and intractable disease characterized by marked progression of osteolysis associated with lymphangioma and/or hemangioma. Here, we describe a case of GD of the proximal tibia occurring in a 10-year-old boy. Although we could not correctly diagnose it at first, we finally diagnosed him as having GD. Progression of osteolysis of the tibia stopped 3 months after the local administration of OK-432. Thereafter, the huge bone defect with varus and extension deformity was reconstructed successfully by distraction osteogenesis using the Ilizarov method. The present case suggests that local administration of OK-432, followed by distraction osteogenesis is a treatment option for GD.

Complications with the use of Artelon in thumb CMC joint arthritis.

PubMed

Clarke, Sylvan; Hagberg, William; Kaufmann, Robert A; Grand, Aaron; Wollstein, Ronit

2011-09-01

Complications with the use of the Artelon spacer in thumb carpometacarpal (CMC) joint arthritis include inflammation, osteolysis, and persistent pain. We evaluated our short-term results and complications. A retrospective review of 29 patients was performed. Pre- and postoperative radiographs, operative techniques, complications, and subsequent surgeries were analyzed. Pearson's and chi-squared testing was used to identify associations between complications and surgical technique or preoperative radiographic criteria. The average age was age 51 ± 7.7 (34-66), average follow-up was 8 months (1-26). Twelve patients sustained complications. Nine patients displayed postoperative osteolysis. Four patients underwent conversion to CMC suspensionplasty due to persistent pain. The rate of revision surgery and radiographic postoperative osteolysis were not significantly associated with preoperative arthritis grade, metacarpal subluxation, or surgical techniques: fixation method, the bony surface(s) involved in the osteotomy, or spacer modifications. Our study found a significant short-term complication rate following Artelon spacer arthroplasty of the CMC joint. This is higher than previously described. We could not identify any factors that were significantly associated with the complications. It is possible that the inherent instability of the joint or the material of the spacer is involved in implant failure. Further study is necessary to better define the indications for use and specific techniques for the use of the implant.

Suppression of wear particle induced pro-inflammatory cytokine and chemokine production in macrophages via NF-κB decoy oligodeoxynucleotide: A preliminary report

PubMed Central

Lin, Tzu-hua; Yao, Zhenyu; Sato, Taishi; Keeney, Michael; Li, Chenguang; Pajarinen, Jukka; Yang, Fan; Egashira, Kensuke; Goodman, Stuart B.

2014-01-01

Total joint replacement (TJR) is a very cost-effective surgery for end-stage arthritis. One important goal is to decrease the revision rate especially because TJR has been extended to younger patients. Continuous production of ultra-high molecular weight polyethylene (UHMWPE) wear particles induces macrophage infiltration and chronic inflammation, which can lead to peri-prosthetic osteolysis. Targeting individual pro-inflammatory cytokines directly has not reversed the osteolytic process in clinical trials, due to compensatory upregulation of other pro-inflammatory factors. We hypothesized that targeting the important transcription factor NF-κB could mitigate the inflammatory response to wear particles, potentially diminishing osteolysis. In the current study, we suppressed NF-κB activity in mouse RAW264.7 and human THP1 macrophage cell lines, as well as primary mouse and human macrophages, via competitive binding with double strand decoy oligodeoxynucleotide (ODN) containing an NF-κB binding element. We found that macrophage exposure to UHMWPE particles induced multiple pro-inflammatory cytokine and chemokine expression including TNF-α, MCP1, MIP1α and others. Importantly, the decoy ODN significantly suppressed the induced cytokine and chemokine expression in both murine and human macrophages, and resulted in suppression of macrophage recruitment. The strategic use of decoy NF-κB ODN, delivered locally, could potentially diminish particle-induced peri-prosthetic osteolysis. PMID:24814879

Focal osteolysis at the junctions of a modular stainless-steel femoral intramedullary nail.

PubMed

Jones, D M; Marsh, J L; Nepola, J V; Jacobs, J J; Skipor, A K; Urban, R M; Gilbert, J L; Buckwalter, J A

2001-04-01

During routine follow-up of patients treated with a three-piece stainless-steel modular femoral nail, osteolysis and periosteal reaction around the modular junctions of some of the nails were noted on radiographs. The purpose of this study was to evaluate the prevalence, etiology, and clinical relevance of these radiographic findings. Forty-four femoral fractures or nonunions in forty-two patients were treated with a modular stainless-steel femoral intramedullary nail. Seventeen nails were excluded, leaving twenty-seven intramedullary nails in twenty-seven patients for this study. All patients had had a femoral diaphyseal fracture; nineteen had had an acute fracture and eight, a nonunion. These twenty-seven patients returned for radiographs, a physical examination, assessment of functional outcomes, assessment of thigh pain with a visual analog scale, determination of serum chromium levels, and nail removal if desired. A control group of sixteen patients treated with a one-piece stainless-steel femoral intramedullary nail was evaluated with use of the same outcome measures and was compared with the group treated with the modular femoral nail with regard to prevalence of thigh pain and serum chromium levels. Twelve modular femoral nails were removed according to the study protocol. The modular nail junctions were analyzed for corrosion products, and histopathologic analysis of tissue specimens from the femoral canal was performed. The twenty-seven patients were seen at a mean of twenty-one months after fracture fixation; twenty-six of the twenty-seven fractures healed. Twenty-three femora had at least one of three types of abnormalities-osteolysis, periosteal reaction, or cortical thickening--localized to one or both modular junctions. Eighteen patients had severe reactions, defined as osteolysis of > or =2 mm, cortical thickening of > or =5 mm, and/or a periosteal reaction (group 1). Nine patients had mild or no reactions (group 2). Serum chromium levels in group 1 (mean, 1.27 ng/ mL; range, 0.34 to 3.12 ng/mL) were twice as high as those in group 2 (mean, 0.53 ng/mL; range, 0.12 to 1.26 ng/mL). However, this difference did not reach significance with the numbers available. The differences in serum chromium levels between group 1 and the control group with a one-piece nail (mean, 0.26 ng/mL; range, 0.015 to 1.25 ng/mL) (p<0.01) and a control group without an implant (mean, 0.05 ng/mL; range, 0.015 to 0.25 ng/ mL) (p<0.01) were significant. The level of thigh pain recorded on the visual analog scale was also significantly different between group 1 and the control group with a one-piece implant (p = 0.03). Retrieved modular nails had signs of fretting corrosion as well as stainless-steel corrosion products adherent to the junction where the osteolysis occurred. Histologic and spectrographic analysis revealed two types of corrosion products that were consistent with stainless-steel within the peri-implant tissue and were associated with a foreign-body granulomatous response. The presence of corrosion products at the taper junctions suggests that particulate debris was a major factor in the etiology of the radiographic findings of osteolysis, periosteal reaction, and cortical thickening. Serum chromium levels were substantially elevated in the patients with a modular femoral nail, and such levels may serve as a marker of fretting corrosion of these devices.

A Novel Murine Model of Established Staphylococcal Bone Infection in the Presence of a Fracture Fixation Plate to Study Therapies Utilizing Antibiotic-laden Spacers after Revision Surgery

PubMed Central

Inzana, Jason A.; Schwarz, Edward M.; Kates, Stephen L.; Awad, Hani A.

2014-01-01

Mice are the small animal model of choice in biomedical research due to the low cost and availability of genetically engineered lines. However, the devices utilized in current mouse models of implant-associated bone infection have been limited to intramedullary or trans-cortical pins, which are not amenable to treatments involving extensive debridement of a full-thickness bone loss and placement of a segmental antibiotic spacer. To overcome these limitations, we developed a clinically faithful model that utilizes a locking fracture fixation plate to enable debridement of an infected segmental bone defect (full-thickness osteotomy) during a revision surgery, and investigated the therapeutic effects of placing an antibiotic-laden spacer in the segmental bone defect. To first determine the ideal time point for revision following infection, a 0.7 mm osteotomy in the femoral mid-shaft was stabilized with a radiolucent PEEK fixation plate. The defect was inoculated with bioluminescent Staphylococcus aureus, and the infection was monitored over 14 days by bioluminescent imaging (BLI). Osteolysis and reactive bone formation were assessed by X-ray and micro-computed tomography (micro-CT). The active bacterial infection peaked by 5 days post-inoculation, however the stability of the implant fixation became compromised by 10–14 days post-inoculation due to osteolysis around the screws. Thus, day 7 was defined as the ideal time point to perform the revision surgery. During the revision surgery, the infected tissue was debrided and the osteotomy was widened to 3 mm to place a poly-methyl methacrylate spacer, with or without vancomycin. Half of the groups also received systemic vancomycin for the remaining 21 days of the study. The viable bacteria remaining at the end of the study were measured using colony forming unit assays. Volumetric bone changes (osteolysis and reactive bone formation) were directly measured using micro-CT image analysis. Mice that were treated with local or systemic vancomycin did not display gross pathology at the end of the study. While localized vancomycin delivery alone tended to decrease the bacterial burden and osteolysis, these effects were only significant when combined with systemic antibiotic therapy. This novel mouse model replicates key features of implant-associated osteomyelitis that make treatment extremely difficult, such as biofilm formation and osteolysis, and imitates the clinical practice of placing an antibiotic-laden spacer after infected tissue debridement. In addition, the model demonstrates the limitations of current PMMA spacers and could be an invaluable tool for evaluating alternative antimicrobial treatments for implant-associated bone infection. PMID:25459073

Highly Crosslinked-remelted versus Less-crosslinked Polyethylene in Posterior Cruciate-retaining TKAs in the Same Patients.

PubMed

Kim, Young-Hoo; Park, Jang-Won; Kim, Jun-Shik; Lee, June-Hyung

2015-11-01

Concern regarding osteolysis attributable to polyethylene wear after TKA, particularly in younger patients, has prompted the introduction of highly crosslinked-remelted polyethylene (HXLPE) for TKAs. However, few in vivo comparative results of TKAs using HXLPE and less-crosslinked polyethylene inserts in the same patients are available, regarding fracture or failure of the locking mechanism of tibial polyethylene inserts or of osteolysis in patients younger than 60 years. We wanted to determine whether (1) survivorship free from aseptic loosening in knees with HXLPE inserts was different from survivorship in knees with less-crosslinked polyethylene inserts, (2) the prevalence of fracture or failure of the locking mechanism of the tibial polyethylene insert was greater in knees with HXLPE than in those with less-crosslinked polyethylene, and (3) the proportion of patients who had osteolysis develop was greater with HXLPE than with less-crosslinked polyethylene inserts. One hundred seventy-one patients with a mean age of 58 ± 8 years (range, 35-59 years) received posterior cruciate-retaining prostheses with a less-crosslinked polyethylene tibial insert in one knee and a HXLPE tibial insert in the contralateral knee. From January 2007 to January 2010, we performed 366 same-day bilateral simultaneous sequential posterior cruciate-retaining TKAs in 183 patients, of whom 171 (93%) participated in this study. All patients during this study period underwent posterior cruciate-retaining TKAs regardless of deformity of the knees and we did not perform posterior-stabilized TKAs during the same period. Patients who had bilateral end-stage osteoarthritis and were younger than 60 years were selected for inclusion. Six patients (4%) were lost to followup before 5 years. Twenty-six patients were males and 145 were females. The mean duration of followup was 6 years (range, 5-8 years). At each followup, patients were assessed for loosening of the components, fracture or failure of the locking mechanism of the polyethylene inserts, or osteolysis. The survival rate of the knee prosthesis at a mean of 5.8 years after surgery was 100% (95% CI, 0.95-1.00) in both groups for the endpoint aseptic loosening and 99.4% (95% CI, 0.95-1.00) in both groups for the endpoint revision. No knee in either group had fracture or failure of the locking mechanism of the tibial polyethylene insert, and none had osteolysis. With the numbers available, we found no clinically important differences between HXLPE and less-crosslinked polyethylene inserts in posterior cruciate-retaining TKAs. Given that HXLPE is newer, as-yet unproven, and more expensive than the proven technology (less-crosslinked polyethylene), we suggest not adopting HXLPE for clinical use until it shows superiority. Level I, therapeutic study.

Evaluation of a bisphosphonate enriched ultra-high molecular weight polyethylene for enhanced total joint replacement bearing surface functionality

NASA Astrophysics Data System (ADS)

Wright-Walker, Cassandra Jane

Each year in the United States there is an increasing trend of patients receiving total joint replacement (TJR) procedures. Approximately a half million total knee replacements (TKRs) are performed annually in the United States with increasing prevalence attributed to baby-boomers, obesity, older, and younger patients. This trend is also seen for total hip replacements (THRs) as well. The use of ultra high molecular weight polyethylene (UHMWPE) inserts in TJRs results in wear particle-induced osteolysis, which is the predominant cause for prosthesis failure and revision surgery. Sub-micron size particle generation is inevitable despite the numerous efforts in improving this bearing material. Work by others has shown that the use of oral and intravenous systemic bisphosphonates (BP) can significantly minimize periprosthetic osteolysis. However, the systemic delivery and the high solubility of BPs results in a predominant portion of the drug being excreted via the kidney without reaching its target, bone. This doctoral research project is focused on the development and evaluation of a novel method to administer BPs locally using the inherent wear of UHMWPE for possible use as an anti-osteolysis treatment. For new materials to be considered, they must be mechanically and tribologically comparable to the current gold standard, UHMWPE. In order to evaluate this material, mechanical, drug elution and tribological experiments were performed to allow assessment of material properties. Tensile tests showed comparable yield stress and pin-on-disk testing showed comparable wear to standard virgin UHMWPE. Further, drug elution tests have shown that BP was released from the enriched material both in static and dynamic conditions. Additionally, an aggressive 2 million cycle total knee simulator experiment has shown statistically similar wear results for the two materials. Overall, this research has provided the groundwork for further characterization and development of a new potential material for total joint replacements as an enhancement to standard UHMWPE. This material shows significant potential as an alternative bearing material to indirectly increase TJR longevity by addressing osteolysis related issues.

Performance of Non-Cemented, Hemispherical, Rim-Fit, Hydroxyapatite Coated Acetabular Component.

PubMed

John, Thomas K; Ghosh, Gaurav; Ranawat, Chitranjan S; Ranawat, Amar S; Meftah, Morteza

2015-12-01

The purpose of this study was to assess the durability of a non-cemented, hemispherical rim-fit, hydroxyapatite coated cup with a highly cross-linked polyethylene in 223 total hip arthroplasties. At 6-years follow-up (range, 5-9), there were no cup revisions for osteolysis or loosening. Radiologic evidence of osseointegration was based on presence of Stress Induced Reactive Cancellous Bone and radial trabeculae, seen in 47% and 93% of cups, respectively; both were most prevalent in Zone 1. There was no interference demarcation in any zones. Two cups were revised (0.9%): one for dislocation and another for infection. The Kaplan-Meier survivorship for cup revision for any failure (infection, dislocation) was 99% and for mechanical failure (osteolysis, loosening) was 100%. This design has excellent safety, efficacy and durability. Copyright © 2015 Elsevier Inc. All rights reserved.

Cross-linked compared with historical polyethylene in THA: an 8-year clinical study.

PubMed

Geerdink, Carel H; Grimm, Bernd; Vencken, Wendy; Heyligers, Ide C; Tonino, Alphons J

2009-04-01

Wear particle-induced osteolysis is a major cause of aseptic loosening in THA. Increasing wear resistance of polyethylene (PE) occurs by increasing the cross-link density and early reports document low wear rates with such implants. To confirm longer-term reductions in wear we compared cross-linked polyethylene (irradiation in nitrogen, annealing) with historical polyethylene (irradiation in air) in a prospective, randomized clinical study involving 48 patients who underwent THAs with a minimum followup of 7 years (mean, 8 years; range, 7-9 years). The insert material was the only variable. The Harris hip score, radiographic signs of osteolysis, and polyethylene wear were recorded annually. Twenty-three historical and 17 moderately cross-linked polyethylene inserts were analyzed (five patients died, three were lost to followup). At 8 years, the wear rate was lower for cross-linked polyethylene (0.088 +/- 0.03 mm/year) than for the historical polyethylene (0.142 +/- 0.07 mm/year). This reduction (38%) did not diminish with time (33% at 5 years). Acetabular cyst formation was less frequent (39% versus 12%), affected fewer DeLee and Charnley zones (17% versus 4%), and was less severe for the cross-linked polyethylene. The only revision was for an aseptically loose cup in the historical polyethylene group. Moderately cross-linked polyethylene maintained its wear advantage with time and produced less osteolysis, showing no signs of aging at mid-term followup. Level I, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

Dual targeting c-met and VEGFR2 in osteoblasts suppresses growth and osteolysis of prostate cancer bone metastasis.

PubMed

Lee, Changki; Whang, Young Mi; Campbell, Preston; Mulcrone, Patrick L; Elefteriou, Florent; Cho, Sun Wook; Park, Serk In

2018-02-01

Prostate cancer characteristically induces osteoblastic bone metastasis, for which no therapies are available. A dual kinase inhibitor of c-Met and VEGFR-2 (cabozantinib) was shown to reduce prostate cancer growth in bone, with evidence for suppressing osteoblastic activity. However, c-Met and VEGFR2 signaling in osteoblasts in the context of bone metastasis remain unclear. Here we show using cultured osteoblasts that hepatocyte growth factor (HGF) and VEGF-A increased receptor activator of NFκB ligand (RANKL) and M-CSF, two essential factors for osteoclastogenesis. Insulin-like growth factor-1 (IGF1) also increased RANKL and M-CSF via c-Met transactivation. The conditioned media from IGF1-, HGF-, or VEGFA-treated osteoblasts promoted osteoclastogenesis that was reversed by inhibiting c-Met and/or VEGFR2 in osteoblasts. In vivo experiments used cabozantinib-resistant prostate cancer cells (PC-3 and C4-2B) to test the effects of c-Met/VEGFR2 inhibition specifically in osteoblasts. Cabozantinib (60 mg/kg, 3 weeks) suppressed tumor growth in bone and reduced expression of RANKL and M-CSF and subsequent tumor-induced osteolysis. Collectively, inhibition of c-Met and VEGFR2 in osteoblasts reduced RANKL and M-CSF expression, and associated with reduction of tumor-induced osteolysis, suggesting that c-Met and VEGFR2 are promising therapeutic targets in bone metastasis. Copyright © 2017 Elsevier B.V. All rights reserved.

NF-κB Decoy Oligodeoxynucleotide Enhanced Osteogenesis in Mesenchymal Stem Cells Exposed to Polyethylene Particle

PubMed Central

Lin, Tzu-Hua; Sato, Taishi; Barcay, Katherine R.; Waters, Heather; Loi, Florence; Zhang, Ruth; Pajarinen, Jukka; Egashira, Kensuke; Yao, Zhenyu

2015-01-01

Excessive generation of wear particles after total joint replacement may lead to local inflammation and periprosthetic osteolysis. Modulation of the key transcription factor NF-κB in immune cells could potentially mitigate the osteolytic process. We previously showed that local delivery of ultrahigh-molecular-weight polyethylene (UHMWPE) particles recruited osteoprogenitor cells and reduced osteolysis. However, the biological effects of modulating the NF-κB signaling pathway on osteoprogenitor/mesenchymal stem cells (MSCs) remain unclear. Here we showed that decoy oligodeoxynucleotide (ODN) increased cell viability when primary murine MSCs were exposed to UHMWPE particles, but had no effects on cellular apoptosis. Decoy ODN increased transforming growth factor-beta 1 (TGF-β1) and osteoprotegerin (OPG) in MSCs exposed to UHMWPE particles. Mechanistic studies showed that decoy ODN upregulated OPG expression through a TGF-β1-dependent pathway. By measuring the alkaline phosphatase activity, osteocalcin levels, Runx2 and osteopontin expression, and performing a bone mineralization assay, we found that decoy ODN increased MSC osteogenic ability when the cells were exposed to UHMWPE particles. Furthermore, the cellular response to decoy ODN and UHMWPE particles with regard to cell phenotype, cell viability, and osteogenic ability was confirmed using primary human MSCs. Our results suggest that modulation of wear particle-induced inflammation by NF-κB decoy ODN had no adverse effects on MSCs and may potentially further mitigate periprosthetic osteolysis by protecting MSC viability and osteogenic ability. PMID:25518013

Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

MedlinePlus

... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

The tribology of metal-on-metal total hip replacements.

PubMed

Scholes, S C; Unsworth, A

2006-02-01

Total hip surgery is an effective way of alleviating the pain and discomfort caused by diseased or damaged joints. However, in the majority of cases, these joints have a finite life. The main reason for failure is osteolysis (bone resorption). It is well documented that an important cause of osteolysis, and therefore the subsequent loosening and failure of conventional metal- or ceramic-on-ultra-high molecular weight polyethylene joints, is the body's immunological response to the polyethylene wear particles. To avoid this, interest has been renewed in metal-on-metal joints. The intention of this paper is to review the studies that have taken place within different laboratories to determine the tribological performance of new-generation metal-on-metal total hip replacements. These types of joint offer a potential solution to enhance the longevity of prosthetic hip systems; however, problems may arise owing to the effects of metal ion release, which are, as yet, not fully understood.

IL-20 bone diseases involvement and therapeutic target potential.

PubMed

Wang, Hsiao-Hsuan; Hsu, Yu-Hsiang; Chang, Ming-Shi

2018-04-24

Millions of people around the world suffer from bone disorders, likes osteoporosis, rheumatoid arthritis (RA), and cancer-induced osteolysis. In general, the bone remodeling balance is determined by osteoclasts and osteoblasts, respectively responsible for bone resorption and bone formation. Excessive inflammation disturbs the activities of these two kinds of cells, typically resulting in the bone loss. IL-20 is emerging as a potent angiogenic, chemotactic, and proinflammatory cytokine related to several chronic inflammatory disorders likes psoriasis, atherosclerosis, cancer, liver fibrosis, and RA. IL-20 has an important role in the regulation of osteoclastogenesis and osteoblastogenesis and is upregulated in several bone-related diseases. The anti-IL-20 monoclonal antibody treatment has a therapeutic potential in several experimental disease models including ovariectomy-induced osteoporosis, cancer-induced osteolysis, and bone fracture. This review article provides an overview describing the IL-20's biological functions in the common bone disorders and thus providing a novel therapeutic strategy in the future.

Fluorescence and UV-vis Spectroscopy of Synovial Fluids

NASA Astrophysics Data System (ADS)

Pinti, Marie J.; Stojilovic, Nenad; Kovacik, Mark W.

2009-10-01

Total joint arthroplasty involves replacing the worn cartilaginous surfaces of the joint with man-made materials that are designed to be biocompatible and to withstand mechanical stresses. Commonly these bearing materials consist of metallic alloys (TiAlV or CoCrMo) and UHMWPE. Following joint arthroplasty, the normal generation of micro-metallic wear debris particles that dislodge from the prosthesis has been shown to cause inflammatory aseptic osteolysis (bone loss) that ultimately results in the failure of the implant. Here we report our results on the novel use of Fluorescence and UV-vis spectroscopy to investigate the metallic content of synovial fluid specimens taken from postoperative total knee arthroplasties. Preliminary finding showed presence of alumina and chromium is some specimens. The ability to detect and monitor the wear rate of these implants could have far reaching implications in the prevention of metallic wear-debris induced osteolysis and impending implant failure.

The potential role of the osteoblast in the development of periprosthetic osteolysis: review of in vitro osteoblast responses to wear debris, corrosion products, and cytokines and growth factors.

PubMed

Vermes, C; Glant, T T; Hallab, N J; Fritz, E A; Roebuck, K A; Jacobs, J J

2001-12-01

Limited information is available on the responses of osteoblasts to wear debris, corrosion products, and cytokines and on the roles of altered osteoblast functions in the development of periprosthetic bone loss. Wear debris-challenged osteoblasts exhibit altered functions resulting in the loss of their capacity to produce bone matrix and to replace the resorbed bone. Also, osteoblasts may secrete cytokines, which act in a paracrine fashion to recruit inflammatory cells into the periprosthetic space and to stimulate osteoclastic bone resorption. These effects may be mediated in part by ionic metal dissolution products. We review the mechanisms by which altered osteoblast functions, in response to particulate wear debris, corrosion products, and cytokines and growth factors, may contribute to the development and the progression of periprosthetic osteolysis.

The transport of wear particles in the prosthetic hip joint: a computational fluid dynamics investigation.

PubMed

Hölzer, Andreas; Schröder, Christian; Woiczinski, Matthias; Sadoghi, Patrick; Müller, Peter E; Jansson, Volkmar

2012-02-02

The joint fluid mechanics and transport of wear particles in the prosthetic hip joint were analyzed for subluxation and flexion motion using computational fluid dynamics (CFD). The entire joint space including a moving capsule boundary was considered. It was found that particles suspended in the joint space are drawn into the joint gap between prosthesis cup and head during subluxation, which was also documented by Lundberg et al. (2007; Journal of Biomechanics 40, 1676-1685), however, wear particles remain in the joint gap. Wear particles leave the joint gap during flexion and can finally migrate to the proximal boundaries including the acetabular bone, where the particle deposition can cause osteolysis according to the established literature. Thus, the present study supports the theory of polyethylene wear particle induced osteolysis of the acetabular bone as a major factor in the loosening of hip prosthesis cups. Copyright © 2011 Elsevier Ltd. All rights reserved.

Toward a core nutraceutical program for cancer management.

PubMed

McCarty, Mark F; Block, Keith I

2006-06-01

As previously suggested, it may be feasible to impede tumorevoked angiogenesis with a nutraceutical program composed of glycine, fish oil, epigallocatechin-3-gallate, selenium, and silymarin, complemented by a low-fat vegan diet, exercise training, and, if feasible, a salicylate and the drug tetrathiomolybdate. It is now proposed that the scope of this program be expanded to address additional common needs of cancer patients: blocking the process of metastasis; boosting the cytotoxic capacity of innate immune defenses (natural killer [NK] cells); preventing cachexia, thromboembolism, and tumor-induced osteolysis; and maintaining optimal micronutrient status. Modified citrus pectin, a galectin-3 antagonist, has impressive antimetastatic potential. Mushroombeta-glucans and probiotic lactobacilli can amplify NK activity via stimulatory effects on macrophages. Selenium, beta-carotene, and glutamine can also increase the number and/or cytotoxic activity of NK cells. Cachectic loss of muscle mass can be opposed by fish oil, glutamine, and beta-hydroxy-beta-methylbutyrate. Fish oil, policosanol, and vitamin D may have potential for control of osteolysis. High-dose aspirin or salicylates, by preventing NF-B activation, can be expected to aid prevention of metastasis and cachexia while down-regulating osteolysis, but their impacts on innate immune defenses will not be entirely favorable. A nutritional insurance formula crafted for the special needs of cancer patients can be included in this regimen. To minimize patient inconvenience, this complex core nutraceutical program could be configured as an oil product, a powder, and a capsule product, with the nutritional insurance formula provided in tablets. It would be of interest to test this program in nude mouse xenograft models.

Osteoprotegerin in bone metastases: mathematical solution to the puzzle.

PubMed

Ryser, Marc D; Qu, Yiding; Komarova, Svetlana V

2012-01-01

Bone is a common site for cancer metastasis. To create space for their growth, cancer cells stimulate bone resorbing osteoclasts. Cytokine RANKL is a key osteoclast activator, while osteoprotegerin (OPG) is a RANKL decoy receptor and an inhibitor of osteoclastogenesis. Consistently, systemic application of OPG decreases metastatic tumor burden in bone. However, OPG produced locally by cancer cells was shown to enhance osteolysis and tumor growth. We propose that OPG produced by cancer cells causes a local reduction in RANKL levels, inducing a steeper RANKL gradient away from the tumor and towards the bone tissue, resulting in faster resorption and tumor expansion. We tested this hypothesis using a mathematical model of nonlinear partial differential equations describing the spatial dynamics of OPG, RANKL, PTHrP, osteoclasts, tumor and bone mass. We demonstrate that at lower expression rates, tumor-derived OPG enhances the chemotactic RANKL gradient and osteolysis, whereas at higher expression rates OPG broadly inhibits RANKL and decreases osteolysis and tumor burden. Moreover, tumor expression of a soluble mediator inducing RANKL in the host tissue, such as PTHrP, is important for correct orientation of the RANKL gradient. A meta-analysis of OPG, RANKL and PTHrP expression in normal prostate, carcinoma and metastatic tissues demonstrated an increase in expression of OPG, but not RANKL, in metastatic prostate cancer, and positive correlation between OPG and PTHrP in metastatic prostate cancer. The proposed mechanism highlights the importance of the spatial distribution of receptors, decoys and ligands, and can be applied to other systems involving regulation of spatially anisotropic processes.

Expression of receptor activator of nuclear factor kappa-B ligand (RANKL) in neoplasms of dogs and cats.

PubMed

Barger, Anne M; Fan, Timothy M; de Lorimier, Louis-Philippe; Sprandel, Ian T; O'Dell-Anderson, Kristen

2007-01-01

Receptor activator of nuclear factor kappa-B (RANK), RANK-ligand (RANKL), and the soluble decoy receptor osteoprotegerin (OPG) form a key axis modulating osteoclastogenesis. In health, RANKL-expressing bone stromal cells and osteoblasts activate osteoclasts through RANK ligation, resulting in homeostatic bone resorption. Skeletal tumors of dogs and cats, whether primary or metastatic, may express RANKL and directly induce malignant osteolysis. Bone malignancies of dogs and cats may express RANKL, thereby contributing to pathologic bone resorption and pain. Furthermore, relative RANKL expression in bone tumors may correlate with radiographic characteristics of bone pathology. Forty-two dogs and 6 cats with spontaneously-occurring tumors involving bones or soft tissues were evaluated. A polyclonal anti-human RANKL antibody was validated for use in canine and feline cells by flow cytometry and immunocytochemistry. Fifty cytologic specimens were collected from bone and soft tissue tumors of 48 tumor-bearing animals and assessed for RANKL expression. In 15 canine osteosarcoma (OSA) samples, relative RANKL expression was correlated with radiographic characteristics of bone pathology. Expression of RANKL by neoplastic cells was identified in 32/44 canine and 5/6 feline tumor samples. In 15 dogs with OSA, relative RANKL expression did not correlate with either radiographic osteolysis or bone mineral density as assessed by dual energy x-ray absorptiometry. In dogs and cats, tumors classically involving bone and causing pain, often may express RANKL. Confirming RANKL expression in tumors is a necessary step toward the rational institution of novel therapies targeting malignant osteolysis via RANKL antagonism.

Histologic study of periprosthetic osteolytic lesions after AES total ankle replacement. A 22 case series.

PubMed

Dalat, F; Barnoud, R; Fessy, M-H; Besse, J-L

2013-10-01

Medium-term results for total ankle replacement (TAR) are in general satisfactory, but there is a high redo rate for periprosthetic osteolysis associated with the AES implant. Comparing radioclinical findings and histologic analysis of implant revision procedure specimens can account for the elevated rate of osteolysis associated with the AES TAR implant. In a prospective series of 84 AES TAR implants (2003-2008), 25 underwent revision for osteolysis (including three undergoing revision twice) at a mean 59.8 months. Eight patients had hydroxyapatite (HA) coated models and the others had titanium-hydroxyapatite (Ti-HA) coatings. Radiographs were systematically analyzed on Besse's protocol and evolution was monitored on AOFAS scores. The 94 specimens taken for histologic analysis during revision were re-examined, focusing specifically on foreign bodies. Macroscopically, no metallosis or polyethylene wear was found at revision. AOFAS global and pain scores fell respectively from 89.7/100 at 1 year postoperatively to 72.9 before revision and from 32.5/40 to 20.6/40, although global scores were unchanged in 25% of patients. Radiologically, all patients showed tibial and talar osteolytic lesions, 45% showed cortical lysis and in 25% the implant had collapsed into the cysts. All specimens showed macrophagic granulomatous inflammatory reactions in contact with a foreign body; the cysts showed necrotic remodeling. Some of the foreign bodies could be identified on optical histologic examination with polyethylene in 95% of the specimens and metal in 60% (100% of HA-coated models and 33.3% of Ti-HA-coated models). Unidentifiable material was associated: a brownish pigment in Ti-HA-coated models (33.3%) and flakey bodies in 44.4% of the HA-coated models and 18.2% of the Ti-HA-coated models. The phenomenon of periprosthetic osteolysis is still poorly understood, although implant wear debris seems to be implicated. All the patients with HA-coated implants with modular tibial stem had metal particles in the tissue around the implant, although their exact nature could not be determined. The double-layer Ti-HA coating may induce delamination by fretting while the biological bone anchorage is forming. Prospective cohort study - Level IV. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Does hydroxyapatite coating have no advantage over porous coating in primary total hip arthroplasty? A meta-analysis.

PubMed

Chen, Yun-Lin; Lin, Tiao; Liu, An; Shi, Ming-Min; Hu, Bin; Shi, Zhong-Li; Yan, Shi-Gui

2015-01-28

There are some arguments between the use of hydroxyapatite and porous coating. Some studies have shown that there is no difference between these two coatings in total hip arthroplasty (THA), while several other studies have shown that hydroxyapatite has advantages over the porous one. We have collected the studies in Pubmed, MEDLINE, EMBASE, and the Cochrane library from the earliest possible years to present, with the search strategy of "(HA OR hydroxyapatite) AND ((total hip arthroplasty) OR (total hip replacement)) AND (RCT* OR randomiz* OR control* OR compar* OR trial*)". The randomized controlled trials and comparative observation trials that evaluated the clinical and radiographic effects between hydroxyapatite coating and porous coating were included. Our main outcome measurements were Harris hip score (HHS) and survival, while the secondary outcome measurements were osteolysis, radiolucent lines, and polyethylene wear. Twelve RCTs and 9 comparative observation trials were included. Hydroxyapatite coating could improve the HHS (p < 0.01), reduce the incidence of thigh pain (p = 0.01), and reduce the incidence of femoral osteolysis (p = 0.01), but hydroxyapatite coating had no advantages on survival (p = 0.32), polyethylene wear (p = 0.08), and radiolucent lines (p = 0.78). Hydroxyapatite coating has shown to have an advantage over porous coating. The HHS and survival was duration-dependent-if given the sufficient duration of follow-up, hydroxyapatite coating would be better than porous coating for the survival. The properties of hydroxyapatite and the implant design had influence on thigh pain incidence, femoral osteolysis, and polyethylene wear. Thickness of 50 to 80 μm and purity larger than 90% increased the thigh pain incidence. Anatomic design had less polyethylene wear.

Effects of pulsed electromagnetic fields and platelet rich plasma in preventing osteoclastogenesis in an in vitro model of osteolysis.

PubMed

Tschon, Matilde; Veronesi, Francesca; Contartese, Deyanira; Sartori, Maria; Martini, Lucia; Vincenzi, Fabrizio; Ravani, Annalisa; Varani, Katia; Fini, Milena

2018-03-01

Osteolysis is the main limiting cause for the survival of an orthopedic prosthesis and is accompanied by an enhancement in osteoclastogenesis and inflammation, due by wear debris formation. Unfortunately therapeutic treatments, besides revision surgery, are not available. The aim of the present study was to evaluate the effects of Pulsed Electro Magnetic Fields (PEMFs) and platelet rich plasma (PRP), alone or in combination, in an in vitro model of osteolysis. Rats peripheral blood mononuclear cells were cultured on Ultra High Molecular Weight Polyethylene particles and divided into four groups of treatments: (1) PEMF stimulation (12 hr/day, 2.5 mT, 75 Hz, 1.3 ms pulse duration); (2) 10% PRP; (3) combination of PEMFs, and PRP; (4) no treatment. Treatments were performed for 3 days and cell viability, osteoclast number, expression of genes related to osteoclastogenesis and inflammation and production of pro-inflammatory cytokines were assessed up to 14 days. PEMF stimulation exerted best results because it increased cell viability at early time points and counteracted osteoclastogenesis at 14 days. On the contrary, PRP increased osteoclastogenesis and reduced cell viability in comparison to PEMFs alone. The combination of PEMFs and PRP increased cell viability over time and reduced osteoclastogenesis in comparison to PRP alone. However, these positive results did not exceed the level achieved by PEMF alone. At longer time points PEMF could not counteract osteoclastogenesis increased by PRP. Regarding inflammation, all treatments maintained the production of pro-inflammatory cytokines at low level, although PRP increased the level of interleukin 1 beta. © 2017 Wiley Periodicals, Inc.

Thirteen-Year Evaluation of Highly Cross-Linked Polyethylene Articulating With Either 28-mm or 36-mm Femoral Heads Using Radiostereometric Analysis and Computerized Tomography.

PubMed

Nebergall, Audrey K; Greene, Meridith E; Rubash, Harry; Malchau, Henrik; Troelsen, Anders; Rolfson, Ola

2016-09-01

The objective of this 13-year prospective evaluation of highly cross-linked ultra high molecular weight polyethylene (HXLPE) was to (1) assess the long-term wear of HXLPE articulating with 2 femoral head sizes using radiostereometric analysis (RSA) and to (2) determine if osteolysis is a concern with this material through the use of plain radiographs and computerized tomography (CT). All patients received a Longevity HXLPE liner with tantalum beads and either a 28-mm or 36-mm femoral head. Twelve patients (6 in each head size group) agreed to return for 13-year RSA, plain radiograph, and CT follow-up. The 1-year and 13-year plain radiographs as well as the CT scans were analyzed for the presence of osteolysis. The 13-year mean ± standard error steady-state wear was 0.05 ± 0.02 mm with no significant increase over time or between the 2 head size groups. Two patients' CT scans showed radiolucent regions in the acetabulum of 4.51 cm(3) and 11.25 cm(3), respectively. In one patient, this area corresponded to a partially healed degenerative cyst treated with autograft during surgery. The second patient had an acetabular protrusio treated with autograft, and the CT scan revealed areas of remodeling of this graft. One patient's 13-year plain radiographs showed evidence of cup loosening and linear radiolucencies in zones 2 and 3. There was no evidence of significant wear over time using RSA. The CT scans did not show evidence of osteolysis due to wear particles. These results suggest that this material has reduced wear compared to conventional polyethylene, irrespective of head size. Copyright © 2016 Elsevier Inc. All rights reserved.

Therapeutic potentials of naringin on polymethylmethacrylate induced osteoclastogenesis and osteolysis, in vitro and in vivo assessments

PubMed Central

Li, Nianhu; Xu, Zhanwang; Wooley, Paul H; Zhang, Jianxin; Yang, Shang-You

2014-01-01

Wear debris associated periprosthetic osteolysis represents a major pathological process associated with the aseptic loosening of joint prostheses. Naringin is a major flavonoid identified in grapefruit. Studies have shown that naringin possesses many pharmacological properties including effects on bone metabolism. The current study evaluated the influence of naringin on wear debris induced osteoclastic bone resorption both in vitro and in vivo. The osteoclast precursor cell line RAW 264.7 was cultured and stimulated with polymethylmethacrylate (PMMA) particles followed by treatment with naringin at several doses. Tartrate resistant acid phosphatase (TRAP), calcium release, and gene expression profiles of TRAP, cathepsin K, and receptor activator of nuclear factor-kappa B were sequentially evaluated. PMMA challenged murine air pouch and the load bearing tibia titanium pin-implantation mouse models were used to evaluate the effects of naringin in controlling PMMA induced bone resorption. Histological analyses and biomechanical pullout tests were performed following the animal experimentation. The in vitro data clearly demonstrated the inhibitory effects of naringin in PMMA induced osteoclastogenesis. The naringin dose of 10 μg/mL exhibited the most significant influence on the suppression of TRAP activities. Naringin treatment also markedly decreased calcium release in the stimulated cell culture medium. The short-term air pouch mouse study revealed that local injection of naringin ameliorated the PMMA induced inflammatory tissue response and subsequent bone resorption. The long-term tibia pin-implantation mouse model study suggested that daily oral gavage of naringin at 300 mg/kg dosage for 30 days significantly alleviated the periprosthetic bone resorption. A significant increase of periprosthetic bone volume and regaining of the pin stability were found in naringin treated mice. Overall, this study suggests that naringin may serve as a potential therapeutic agent to treat wear debris associated osteolysis. PMID:24376342

Cross-sectional imaging of metal-on-metal hip arthroplasties. Can we substitute MARS MRI with CT?

PubMed

Robinson, Elizabeth; Henckel, Johann; Sabah, Shiraz; Satchithananda, Keshthra; Skinner, John; Hart, Alister

2014-12-01

Metal artifact reduction sequence (MARS) MRI is widely advocated for surveillance of metal-on-metal hip arthroplasties (MOM-HAs). However, its use is limited by susceptibility artifact at the prosthesis-bone interface, local availability, patient compliance, and cost (Hayter et al. 2011a). We wanted to determine whether CT is a suitable substitute for MARS MRI in evaluation of the painful MOM-HA. 50 MOM-HA patients (30 female) with unexplained painful prostheses underwent MARS MRI and CT imaging. 2 observers who were blind regarding the clinical data objectively reported the following outcomes: soft tissue lesions (pseudotumors), muscle atrophy, and acetabular and femoral osteolysis. Diagnostic test characteristics were calculated. Pseudotumor was diagnosed in 25 of 50 hips by MARS MRI and in 11 of 50 by CT. Pseudotumors were classified as type 1 (n=2), type 2A (n=17), type 2B (n=4), and type 3 (n=2) by MARS MRI. CT did not permit pseudotumor classification. The sensitivity of CT for diagnosis of pseudotumor was 44% (95% CI: 25-65). CT had "slight" agreement with MARS MRI for quantification of muscle atrophy (κ=0.23, CI: 0.16-0.29; p<0.01). Osteolysis was identified in 15 of 50 patients by CT. 4 of these lesions were identified by MARS MRI. CT was found to be superior to MRI for detection of osteolysis adjacent to MOM-HA, and should be incorporated into diagnostic algorithms. CT was unable to classify and failed to detect many pseudotumors, and it was unreliable for assessment of muscle atrophy. Where MARS MRI is contraindicated or unavailable, CT would be an unsuitable substitute and other modalities such as ultrasound should be considered.

Incidence of Ceramic Liner Malseating After Ceramic-on-Ceramic Total Hip Arthroplasty Associated With Osteolysis: A 5- to 15-Year Follow-Up Study.

PubMed

Higuchi, Yoshitoshi; Hasegawa, Yukiharu; Komatsu, Daigo; Seki, Taisuke; Ishiguro, Naoki

2017-05-01

The aim of our study was to evaluate the clinical and radiographic outcomes of malseating of the acetabular liner in ceramic-on-ceramic total hip arthroplasty (THA). Outcomes for 160 ceramic-on-ceramic THAs, contributed by 116 women and 39 men, were evaluated. Clinical and radiographic measurements were obtained over a 5- to 15-year follow-up for analysis. Liner malseating was identified in 20% of cases. Outcomes for 32 cases with liner malseating (group A) were compared to outcomes for 128 joints with correct liner seating (group B). The Harris hip score at the last follow-up was 90.1 for group A and 89.6 for group B. Osteolysis was identified in 5 cases in group A (15.6%), compared to 3 cases in group B (P < .001). No significant between-group differences were identified with regard to ceramic fracture, audible squeaking, loosening of components, and revision THA. The mean annual liner wear rate was comparable between groups, 0.0045 mm/y for group A and 0.0039 mm/y for group B. The 10-year Kaplan-Meier survivorship, based on an end point of revision THA, was 100% for group A and 99.0% for group B. Over a moderate-length follow-up of 5-15 years, malseating of the acetabular liner was not associated with negative clinical outcomes or THA survivorship. Malseating did increase the incidence of osteolysis, a risk factor for adverse effects. Long-term follow-up studies are needed to fully quantify the effects of malseating of the acetabular liner. Copyright © 2016 Elsevier Inc. All rights reserved.

Schisantherin A suppresses osteoclast formation and wear particle-induced osteolysis via modulating RANKL signaling pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Yi; Zhang, Qing; Shen, Yi

Highlights: • Schisantherin A suppresses osteoclasts formation and function in vitro. • Schisantherin A impairs RANKL signaling pathway. • Schisantherin A suppresses osteolysis in vivo. • Schisantherin A may be used for treating osteoclast related diseases. - Abstract: Receptor activator of NF-κB ligand (RANKL) plays critical role in osteoclastogenesis. Targeting RANKL signaling pathways has been a promising strategy for treating osteoclast related bone diseases such as osteoporosis and aseptic prosthetic loosening. Schisantherin A (SA), a dibenzocyclooctadiene lignan isolated from the fruit of Schisandra sphenanthera, has been used as an antitussive, tonic, and sedative agent, but its effect on osteoclasts hasmore » been hitherto unknown. In the present study, SA was found to inhibit RANKL-induced osteoclast formation and bone resorption. The osteoclastic specific marker genes induced by RANKL including c-Src, SA inhibited OSCAR, cathepsin K and TRAP in a dose dependent manner. Further signal transduction studies revealed that SA down-regulate RANKL-induced nuclear factor-kappaB (NF-κB) signaling activation by suppressing the phosphorylation and degradation of IκBα, and subsequently preventing the NF-κB transcriptional activity. Moreover, SA also decreased the RANKL-induced MAPKs signaling pathway, including JNK and ERK1/2 posphorylation while had no obvious effects on p38 activation. Finally, SA suppressed the NF-κB and MAPKs subsequent gene expression of NFATc1 and c-Fos. In vivo studies, SA inhibited osteoclast function and exhibited bone protection effect in wear-particle-induced bone erosion model. Taken together, SA could attenuate osteoclast formation and wear particle-induced osteolysis by mediating RANKL signaling pathways. These data indicated that SA is a promising therapeutic natural compound for the treatment of osteoclast-related prosthesis loosening.« less

Early polyethylene wear and osteolysis with ABG acetabular cups (7- to 12-year follow-up).

PubMed

Badhe, Sachin; Livesley, Peter

2006-02-01

We reviewed 81 consecutive ABG I primary total hip replacements implanted in 72 patients between January 1993 and December 1998. The mean follow-up was 8.2 (range 7-12) years. There was significant polyethylene wear and osteolysis associated with the acetabular cup . The cumulative survival of the cup with revision being the end point at 8.2 years was 95.1% (95% CI: 92-97.6%). However, the cumulative survival of the cup with revision and aseptic loosening together was 72% (95% CI: 61-78%) and survival of the acetabular liner for wear was 62% (95% CI: 48-74%). Stem survival with revision being the end point was 100%. In spite of significant radiological failures of the cups, most patients remained asymptomatic. Though results of the ABG stems in this series were good, we advocate a regular follow-up of all these hips in view of the poor outcome of the cups.

Early polyethylene wear and osteolysis with ABG acetabular cups (7- to 12-year follow-up)

PubMed Central

Livesley, Peter

2005-01-01

We reviewed 81 consecutive ABG I primary total hip replacements implanted in 72 patients between January 1993 and December 1998. The mean follow-up was 8.2 (range 7–12) years. There was significant polyethylene wear and osteolysis associated with the acetabular cup .The cumulative survival of the cup with revision being the end point at 8.2 years was 95.1% (95% CI: 92–97.6%). However, the cumulative survival of the cup with revision and aseptic loosening together was 72% (95% CI: 61–78%) and survival of the acetabular liner for wear was 62% (95% CI: 48–74%). Stem survival with revision being the end point was 100%. In spite of significant radiological failures of the cups, most patients remained asymptomatic. Though results of the ABG stems in this series were good, we advocate a regular follow-up of all these hips in view of the poor outcome of the cups. PMID:16283307

Use of a constrained tripolar acetabular liner to treat intraoperative instability and postoperative dislocation after total hip arthroplasty: a review of our experience.

PubMed

Callaghan, John J; O'Rourke, Michael R; Goetz, Devon D; Lewallen, David G; Johnston, Richard C; Capello, William N

2004-12-01

Constrained acetabular components have been used to treat certain cases of intraoperative instability and postoperative dislocation after total hip arthroplasty. We report our experience with a tripolar constrained component used in these situations since 1988. The outcomes of the cases where this component was used were analyzed for component failure, component loosening, and osteolysis. At average 10-year followup, for cases treated for intraoperative instability (2 cases) or postoperative dislocation (4 cases), the component failure rate was 6% (6 of 101 hips in 5 patients). For cases where the constrained liner was cemented into a fixed cementless acetabular shell, the failure rate was 7% (2 of 31 hips in 2 patients) at 3.9-year average followup. Use of a constrained liner was not associated with an increased osteolysis or aseptic loosening rate. This tripolar constrained acetabular liner provided total hip arthroplasty construct stability in most cases in which it was used for intraoperative instability or postoperative dislocation.

Quantitative histochemistry of rat lumbar vertebrae following spaceflight

NASA Technical Reports Server (NTRS)

Eurell, J. A.; Kazarian, L. E.

1983-01-01

The histochemical effects of the return to gravity immediately and 6 and 29 days following spaceflight on the bone of rat vertebral bodies were investigated. No significant change in the calcium salt content of the vertebrae was found immediately postflight, although 6 days later it was significantly decreased. The calcium content was found to have returned to normal by 29 days postflight. While postflight collagen content was not significantly altered, keratosulfate was found to be significantly higher in trabecular bone of rats immediately postflight and 6 days postflight. In addition, chondroitin sulfate was found to be increased in vertebral bone on days 6 and 29 postflight. These findings indicate that bone turnover slows in vertebrae during spaceflight allowing bone aging, which support the contention that a form of osteolysis begins immediately upon return to gravity to remove components of old bone at which time mineral levels decrease and levels of chondroitin and keratkosulfates shift. It was found that the osteolysis phase was quickly followed by new bone replacement which was completed before 29 days postspaceflight.

Streptococcal Arthritis, Osteolysis, Myositis, and Spinal Meningitis in Channel Catfish Ictalurus punctatus Broodstock

USDA-ARS?s Scientific Manuscript database

This report details findings of an investigation into complaints by commercial fingerling producers of low-grade mortalities, poor reproductive success, emaciation, skin lesions, and severely arched backs among broodstock of channel catfish Ictalurus punctatus. Gross lesions involved the jaw, fin ba...

Cemented total hip replacement cable debris and acetabular construct durability.

PubMed

Altenburg, Aaron J; Callaghan, John J; Yehyawi, Tameem M; Pedersen, Douglas R; Liu, Steve S; Leinen, Jessica A; Dahl, Kevin A; Goetz, Devon D; Brown, Thomas D; Johnston, Richard C

2009-07-01

Third-body wear can adversely affect the outcome of total hip arthroplasty by causing increased polyethylene wear, osteolysis, and component loosening. We hypothesized that there would be greater generation and migration of metal debris to the bearing surfaces in hips in which cobalt-chromium cables were used to reattach the osteotomized greater trochanter when compared with hips in which stainless steel wires were used. Between June 1981 and December 1983, 196 consecutive total hip arthroplasties were performed with use of an Iowa stem and a titanium-backed cemented acetabular component, with cobalt-chromium cable trochanteric reattachment. After nineteen to twenty years of follow-up, the patients were evaluated with regard to the depth of head penetration into the polyethylene (as a surrogate for wear), osteolysis, loosening, and the need for revision. The results were compared with those for a series of 304 total hip arthroplasties that were performed by the same surgeon from January 1984 to December 1985 with use of the same components and the same surgical technique, but with stainless steel wire trochanteric reattachment. The two groups had a comparable nineteen to twenty-year follow-up. All living patients (fifty-nine hips in the cable group and ninety-two hips in the wire group) had minimum ten-year follow-up radiographs. The polyethylene wear rate was 0.101 mm/yr for the cable group and 0.082 mm/yr for the wire group (p = 0.039). For the living patients, the rate of revision of the acetabular component because of aseptic loosening was 37.3% (twenty-two hips) for the cable group and 20.7% (nineteen hips) for the wire group (p = 0.025). The rate of acetabular osteolysis was 44% (twenty-six hips) for the cable group and 26% (twenty-four hips) for the wire group (p = 0.022). Kaplan-Meier analysis with revision of the acetabular component because of aseptic loosening as the end point demonstrated survival rates of 73.7% +/- 9% and 83% +/- 7% for the cable and wire groups, respectively, at twenty years (p = 0.03). Because cable trochanteric attachment led to significantly greater polyethylene wear, osteolysis, acetabular loosening, and acetabular revision, presumably due to third-body metallic debris generation in this cemented total hip replacement construct, surgeons should be aware of the deleterious effects of third-body debris and avoid the use of potential debris generators in the total hip arthroplasty construct. If cable is used and fretting is recognized, especially with intra-articular migration of metallic material or nonunion of the greater trochanter, consideration should be given to cable removal.

The use of differential scintigraphy in the clinical diagnosis of osseous and soft tissue changes affecting the diabetic foot

DOE Office of Scientific and Technical Information (OSTI.GOV)

Visser, H.J.; Jacobs, A.M.; Oloff, L.

Prompt recognition of cellulitis, osteomyelitis, diabetic osteolysis, Charcot neuroarthropathy, septic synovitis, and deep plantar abscesses in the diabetic foot is essential because the therapy is drastically different. Differential diagnosis has been greatly facilitated by recently developed scanning techniques.

Effect of component design in retrieved bipolar hip hemiarthroplasty systems.

PubMed

Hess, Matthew D; Baker, Erin A; Salisbury, Meagan R; Kaplan, Lige M; Greene, Ryan T; Greene, Perry W

2013-09-01

Primary articulation of bipolar hemiarthroplasty systems is at the femoral head-liner interface. The purpose of this study was to compare observed damage modes on 36 retrieved bipolar systems with implant, demographic, intraoperative, and radiographic data to elucidate the effects of component design, specifically locking mechanism, on clinical performance. Retrieved bipolar hip hemiarthroplasty systems of 3 different design types were obtained, disassembled, and evaluated macro- and microscopically for varying modes of wear, including abrasion, burnishing, embedding, scratching, and pitting. Clinical record review and radiographic analysis were performed by a senior orthopedic surgery resident. Average bipolar hip hemiarthroplasty system term of service was 46 months (range, 0.27-187 months). All devices contained wear debris captured within the articulating space between the femoral head and liner. In 31% of patients without infection, lucency was observed on immediate prerevision radiographs. The system with a leaf locking mechanism showed significantly increased radiographically observed osteolysis (P=.03) compared with a system with a stopper ring locking mechanism. In addition, implant design and observed damage modes, including pitting and third-body particle embedding, were significantly associated with radiographically observed osteolysis. Copyright 2013, SLACK Incorporated.

MAFB Determines Human Macrophage Anti-Inflammatory Polarization: Relevance for the Pathogenic Mechanisms Operating in Multicentric Carpotarsal Osteolysis.

PubMed

Cuevas, Víctor D; Anta, Laura; Samaniego, Rafael; Orta-Zavalza, Emmanuel; Vladimir de la Rosa, Juan; Baujat, Geneviève; Domínguez-Soto, Ángeles; Sánchez-Mateos, Paloma; Escribese, María M; Castrillo, Antonio; Cormier-Daire, Valérie; Vega, Miguel A; Corbí, Ángel L

2017-03-01

Macrophage phenotypic and functional heterogeneity derives from tissue-specific transcriptional signatures shaped by the local microenvironment. Most studies addressing the molecular basis for macrophage heterogeneity have focused on murine cells, whereas the factors controlling the functional specialization of human macrophages are less known. M-CSF drives the generation of human monocyte-derived macrophages with a potent anti-inflammatory activity upon stimulation. We now report that knockdown of MAFB impairs the acquisition of the anti-inflammatory profile of human macrophages, identify the MAFB-dependent gene signature in human macrophages and illustrate the coexpression of MAFB and MAFB-target genes in CD163 + tissue-resident and tumor-associated macrophages. The contribution of MAFB to the homeostatic/anti-inflammatory macrophage profile is further supported by the skewed polarization of monocyte-derived macrophages from multicentric carpotarsal osteolysis (Online Mendelian Inheritance in Man #166300), a pathology caused by mutations in the MAFB gene. Our results demonstrate that MAFB critically determines the acquisition of the anti-inflammatory transcriptional and functional profiles of human macrophages. Copyright © 2017 by The American Association of Immunologists, Inc.

A case of pathological rib fractures: focal osteolysis or osteoporosis?

PubMed

Vrbanić, T S L; Novak, S; Sestan, B; Tudor, A; Gulan, G

2008-03-01

This paper reports on a unique, previously unreported, successful outcome in the case of a patient with focal osteolytic lesions of the ribs as a first sign of osteoporosis. The lesions were detected by chance after acute cough-induced rib fractures were seen on plain chest radiographs. The diagnosis had to be approached as a diagnosis of exclusion since known causes of the osteolytic process had to be eliminated. The authors describe multiple focal osteolytic lesions with rib fractures appearing in a pattern that could be confused with metastases. Laboratory results were normal. Final diagnosis was based on plain radiography, bone scan and bone densitometry. Pharmacomedical treatments for osteoporosis were applied. The patient was observed between the year 2000 and 2005. Five years later radiological and bone scintigraphy revealed resolution of the lesion. We conclude that osteoporosis should be included in the differential diagnosis of asymptomatic focal osteolysis of the ribs with rib fractures as a complication of acute cough. The case suggests that focal osteolytic lesions of the ribs may regress over time and become scintigraphically inactive.

Risk factors for accelerated polyethylene wear and osteolysis in ABG I total hip arthroplasty

PubMed Central

Havranek, Vitezslav; Zapletalova, Jana

2009-01-01

We analysed data from 155 revisions of identical cementless hip prostheses to determine the influence of patient-, implant- and surgery-related factors on the polyethylene wear rate and size of periprosthetic osteolysis (OL). This was calculated by logistic regression analysis. Factors associated with an increased/decreased wear rate included position of the cup relative to Kohler’s line, increase in abduction angle of the cup, traumatic and inflammatory arthritis as a primary diagnosis, and patient height. Severe acetabular bone defects were predicted by an increased wear rate (odds ratio, OR = 5.782 for wear rate above 200 mm3/y), and increased height of the patient (OR = 0.905 per each centimetre). Predictors of severe bone defects in the femur were the increased wear rate (OR = 3.479 for wear rate above 200 mm3/y) and placement of the cup outside of the true acetabulum (OR = 3.292). Variables related to surgical technique were the most predictive of polyethylene wear rate. PMID:19214506

Apo2L/TRAIL Inhibits Tumor Growth and Bone Destruction in a Murine Model of Multiple Myeloma

PubMed Central

Labrinidis, Agatha; Diamond, Peter; Martin, Sally; Hay, Shelley; Liapis, Vasilios; Zinonos, Irene; Sims, Natalie A.; Atkins, Gerald J.; Vincent, Cristina; Ponomarev, Vladimir; Findlay, David M.; Zannettino, Andrew C.W.; Evdokiou, Andreas

2017-01-01

Purpose Multiple myeloma is an incurable disease, for which the development of new therapeutic approaches is required. Here, we report on the efficacy of recombinant soluble Apo2L/tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) to inhibit tumor progression and bone destruction in a xenogeneic model of human multiple myeloma. Experimental Design We established a mouse model of myeloma, in which Apo2L/TRAIL-sensitive RPMI-8226 or KMS-11 cells, tagged with a triple reporter gene construct (NES-HSV-TK/GFP/Luc), were transplanted directly into the tibial marrow cavity of nude mice. Tumor burden was monitored progressively by bioluminescence imaging and the development of myeloma-induced osteolysis was measured using high resolution in vivo micro-computed tomography. Results Tumor burden increased progressively in the tibial marrow cavity of mice transplanted with Apo2L/TRAIL-sensitive RPMI-8226 or KMS-11 cells associated with extensive osteolysis directly in the area of cancer cell transplantation. Treatment of mice with recombinant soluble Apo2L/TRAIL reduced myeloma burden in the bone marrow cavity and significantly protected against myeloma-induced osteolysis. The protective effects of Apo2L/TRAIL treatment on bone were mediated by the direct apoptotic actions of Apo2L/TRAIL on myeloma cells within the bone microenvironment. Conclusions This is the first in vivo study that investigates the efficacy of recombinant Apo2L/TRAIL on myeloma burden within the bone microenvironment and associated myeloma-induced bone destruction. Our findings that recombinant soluble Apo2L/TRAIL reduces myeloma burden within the bone microenvironment and protects the bone from myeloma-induced bone destruction argue against an inhibitory role of osteoprotegerin in Apo2L/TRAIL-induced apoptosis in vivo and highlight the need to clinically evaluate Apo2L/TRAIL in patients with multiple myeloma. PMID:19276263

Microbial osteolysis in an Early Pleistocene hominin (Paranthropus robustus) from Swartkrans, South Africa.

PubMed

Grine, Frederick E; Bromage, Timothy G; Daegling, David J; Burr, David B; Brain, Charles K

2015-08-01

Microbiological degradation is one of the most important factors responsible for the destruction of bone in archaeological contexts. Microscopic focal destruction (MFD) is the most prevalent form of microbial tunneling and is encountered very commonly in human bones from archaeological sites, whereas animal bones from these same sites show significantly better preservation if they were deposited in a fragmentary (e.g., butchered) state. Similarly, most fossils show either no evidence or only minor traces of bacterial osteolysis. These observations and experimental evidence point to an endogenous origin for osteolytic bacteria, suggesting that bone bioerosion could potentially aid in reconstructing early taphonomic events. We here report extensive MFD in the mandibular corpus of a small (presumptive female) individual of the hominin Paranthropus robustus from the Early Pleistocene site of Swartkrans, South Africa. The specimen (SKX 5013) derives in situ from the Member 2 deposit, which is dated to ca. 1.5-1.0 Ma. Examination of sections from the corpus by backscattered electron microscopy reveals numerous small linear longitudinal and budded tunneling cavities, which tend to be concentrated around Haversian canals and are more abundant closer to the endosteal aspect of the section. The taphonomy of Swartkrans has been the subject of intense investigation, and given the possibility that different agents of accumulation may have been responsible for the faunal and hominin fossils in the different members at the site, the observation that a specimen of P. robustus from Member 2 displays significant microbial osteolysis is of potential interest. A study of the prevalence of this process in adequately large samples of the animal bones from these units may yield novel insights and provide refinement of our understanding of their taphonomic histories. Such observations might well reveal differences among the various members that could provide another valuable source of osteoarchaeological information for the site. Copyright © 2015 Elsevier Ltd. All rights reserved.

Highly Cross-Linked Polyethylene Reduces Osteolysis Incidence and Wear-Related Reoperation Rate in Cementless Total Hip Arthroplasty Compared With Conventional Polyethylene at a Mean 12-Year Follow-Up.

PubMed

Tsukamoto, Manabu; Mori, Toshiharu; Ohnishi, Hideo; Uchida, Soshi; Sakai, Akinori

2017-12-01

A number of studies on total hip arthroplasty have compared highly cross-linked polyethylene (HXLPE) with conventional polyethylene (CPE) liners beyond 10 years. However, the impact of HXLPE on the wear-related reoperation rate is unclear. The purpose of this study was to evaluate the clinical advantage of using a single manufacturer's HXLPE in terms of reducing the reoperation rate. The study was a follow-up retrospective cohort study over a mean of 12 years that examined patients aged 45-70 years with cementless total hip arthroplasty using a 26-mm-diameter cobalt-chromium head. Sixty-seven patients (79 hips; HXLPE group = 41 hips, CPE group = 38 hips) were evaluated for a minimum 10-year follow-up. Kaplan-Meier survival analysis was performed, with wear-related reoperations and radiographic osteolysis serving as the end points. The polyethylene wear rate was also assessed. The mean 12-year follow-up rates of survivorship that were evaluated using wear-related reoperations as the end point were 100% and 91.4% in the HXLPE and CPE groups, respectively (P = .007), and the mean 12-year follow-up rates of survivorship with osteolysis as the end point were 100% and 36.2%, respectively (P < .001). Compared with the CPE group, the HXLPE group presented a significantly reduced wear rate (HXLPE group, 0.035 mm/y; CPE group, 0.118 mm/y). A unique strength of this study is that we assessed a single manufacturer's HXLPE while keeping most other implant parameters uniform. This study reveals the clinical advantage of using a single manufacturer's HXLPE in terms of a reduced wear-related reoperation rate at a mean 12-year follow-up. Copyright © 2017 Elsevier Inc. All rights reserved.

Effects of hook plate on shoulder function after treatment of acromioclavicular joint dislocation.

PubMed

Chen, Chang-Hong; Dong, Qi-Rong; Zhou, Rong-Kui; Zhen, Hua-Qing; Jiao, Ya-Jun

2014-01-01

Internal fixation with hook plate has been used to treat acromioclavicular joint dislocation. This study aims to evaluate the effect of its use on shoulder function, to further analyze the contributing factors, and provide a basis for selection and design of improved internal fixation treatment of the acromioclavicular joint dislocation in the future. A retrospective analysis was performed on patients treated with a hook plate for acromioclavicular joint dislocation in our hospital from January 2010 to February 2013. There were 33 cases in total, including 25 males and 8 females, with mean age of 48.27 ± 8.7 years. There were 29 cases of Rockwood type III acromioclavicular dislocation, 4 cases of type V. The Constant-Murley shoulder function scoring system was used to evaluate the shoulder function recovery status after surgery. Anteroposterior shoulder X-ray was used to assess the position of the hook plate, status of acromioclavicular joint reduction and the occurrence of postoperative complications. According to the Constant-Murley shoulder function scoring system, the average scores were 78 ± 6 points 8 to 12 months after the surgery and before the removal of the hook plate, the average scores were 89 ± 5 minutes two months after the removal of hook plate. Postoperative X-ray imaging showed osteolysis in 10 cases (30.3%), osteoarthritis in six cases (18.1%), osteolysis associated with osteoarthritis in four cases(12.1%), and steel hook broken in one case (3%). The use of hook plate on open reduction and internal fixation of the acromioclavicular joint dislocation had little adverse effect on shoulder function and is an effective method for the treatment of acromioclavicular joint dislocation. Osteoarthritis and osteolysis are the two common complications after hook plate use, which are associated with the impairment of shoulder function. Shoulder function will be improved after removal of the hook plate.

Agarose gel electrophoresis of joint fluid using Hyrys-Hydrasys SEBIA system as a new prognostic tool for periprosthetic osteolysisin revision arthroplasty

PubMed Central

Chiva, A

2013-01-01

Rationale. Prevention of wear-mediated osteolysis, the most common complication in total joint arthroplasty, is a great challenge for orthopedic surgery. Despite the diversity of current biomarkers of periprosthetic osteolysis (products of wear, bone turnover and inflammatory biomarkers), the major interferences and the great amount of sample necessary for analysis limit their use in clinical practice. Objective. The aim of this paper is to present three new electrophoretic methods using Hyrys-Hydrasys SEBIA system that have been used for the first time in Electrophoresis Laboratory of our hospital in the analysis of joint fluid for the prevention of periprosthetic osteolysis in revision arthroplasty. Methods and results. Analytical aspects of agarose gel electrophoresis of joint fluid proteins and lipoproteins as well as SDS-agarose gel electrophoresis of joint fluid proteins, their performances and clinical value are presented. The decreased level of albumin and increased level of alpha1 and alpha2 globulins were frequent changes detected on SEBIA electropherograms and good indicator for the presence of an inflammatory reaction generated by particle debris. In addition, a slightly increase of LDL mobility could provide good information about a high oxidative stress. Moreover, the Ig G assessed by using SDS-agarose gel electrophoresis could be a potential biomarker for an immunological reaction towards orthopedic implants. Discussion. Electrophoresis of joint fluid using Hyrys-Hydrasys SEBIA France system is a new analytical technique able to remove the most of current biomarkers disadvantages due to the determination of particular proteins (acute phase proteins, albumin, lipoproteins, and immunoglobulins) by using minimal amounts of joint fluid with minor interferences, minimal cost and rapid results. Abbreviations CTX, crosslinked C-telopeptide; IL- interleukins; Ig G, immunoglobulin G; LDL, low density lipoprotein; NTX, crosslinked N-telopeptide; PICP, procollagen I C – terminal extension peptide; SDS, sodium dodecyl sulphate PMID:24146682

Effects of hook plate on shoulder function after treatment of acromioclavicular joint dislocation

PubMed Central

Chen, Chang-Hong; Dong, Qi-Rong; Zhou, Rong-Kui; Zhen, Hua-Qing; Jiao, Ya-Jun

2014-01-01

Introduction: Internal fixation with hook plate has been used to treat acromioclavicular joint dislocation. This study aims to evaluate the effect of its use on shoulder function, to further analyze the contributing factors, and provide a basis for selection and design of improved internal fixation treatment of the acromioclavicular joint dislocation in the future. Methods: A retrospective analysis was performed on patients treated with a hook plate for acromioclavicular joint dislocation in our hospital from January 2010 to February 2013. There were 33 cases in total, including 25 males and 8 females, with mean age of 48.27 ± 8.7 years. There were 29 cases of Rockwood type III acromioclavicular dislocation, 4 cases of type V. The Constant-Murley shoulder function scoring system was used to evaluate the shoulder function recovery status after surgery. Anteroposterior shoulder X-ray was used to assess the position of the hook plate, status of acromioclavicular joint reduction and the occurrence of postoperative complications. Results: According to the Constant-Murley shoulder function scoring system, the average scores were 78 ± 6 points 8 to 12 months after the surgery and before the removal of the hook plate, the average scores were 89 ± 5 minutes two months after the removal of hook plate. Postoperative X-ray imaging showed osteolysis in 10 cases (30.3%), osteoarthritis in six cases (18.1%), osteolysis associated with osteoarthritis in four cases(12.1%), and steel hook broken in one case (3%). Conclusion: The use of hook plate on open reduction and internal fixation of the acromioclavicular joint dislocation had little adverse effect on shoulder function and is an effective method for the treatment of acromioclavicular joint dislocation. Osteoarthritis and osteolysis are the two common complications after hook plate use, which are associated with the impairment of shoulder function. Shoulder function will be improved after removal of the hook plate. PMID:25356110

Cemented Total Hip Replacement Cable Debris and Acetabular Construct Durability

PubMed Central

Altenburg, Aaron J.; Callaghan, John J.; Yehyawi, Tameem M.; Pedersen, Douglas R.; Liu, Steve S.; Leinen, Jessica A.; Dahl, Kevin A.; Goetz, Devon D.; Brown, Thomas D.; Johnston, Richard C.

2009-01-01

Background: Third-body wear can adversely affect the outcome of total hip arthroplasty by causing increased polyethylene wear, osteolysis, and component loosening. We hypothesized that there would be greater generation and migration of metal debris to the bearing surfaces in hips in which cobalt-chromium cables were used to reattach the osteotomized greater trochanter when compared with hips in which stainless steel wires were used. Methods: Between June 1981 and December 1983, 196 consecutive total hip arthroplasties were performed with use of an Iowa stem and a titanium-backed cemented acetabular component, with cobalt-chromium cable trochanteric reattachment. After nineteen to twenty years of follow-up, the patients were evaluated with regard to the depth of head penetration into the polyethylene (as a surrogate for wear), osteolysis, loosening, and the need for revision. The results were compared with those for a series of 304 total hip arthroplasties that were performed by the same surgeon from January 1984 to December 1985 with use of the same components and the same surgical technique, but with stainless steel wire trochanteric reattachment. The two groups had a comparable nineteen to twenty-year follow-up. All living patients (fifty-nine hips in the cable group and ninety-two hips in the wire group) had minimum ten-year follow-up radiographs. Results: The polyethylene wear rate was 0.101 mm/yr for the cable group and 0.082 mm/yr for the wire group (p = 0.039). For the living patients, the rate of revision of the acetabular component because of aseptic loosening was 37.3% (twenty-two hips) for the cable group and 20.7% (nineteen hips) for the wire group (p = 0.025). The rate of acetabular osteolysis was 44% (twenty-six hips) for the cable group and 26% (twenty-four hips) for the wire group (p = 0.022). Kaplan-Meier analysis with revision of the acetabular component because of aseptic loosening as the end point demonstrated survival rates of 73.7% ± 9% and 83% ± 7% for the cable and wire groups, respectively, at twenty years (p = 0.03). Conclusions: Because cable trochanteric attachment led to significantly greater polyethylene wear, osteolysis, acetabular loosening, and acetabular revision, presumably due to third-body metallic debris generation in this cemented total hip replacement construct, surgeons should be aware of the deleterious effects of third-body debris and avoid the use of potential debris generators in the total hip arthroplasty construct. If cable is used and fretting is recognized, especially with intra-articular migration of metallic material or nonunion of the greater trochanter, consideration should be given to cable removal. Level of Evidence: Therapeutic Level III. See Instructions to Authors for a complete description of levels of evidence. PMID:19571089

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Foreign-body reaction and the course of osteolysis after polyglycolide implants for fracture fixation: experimental study in sheep.

PubMed

Weiler, A; Helling, H J; Kirch, U; Zirbes, T K; Rehm, K E

1996-05-01

Foreign-body reaction to polyglycolide (PGA) implants has been described in man. Many animal experiments have verified the mechanical properties of fixation devices made from PGA, but a significant foreign-body reaction has not been described. We studied the effect of PGA rods in 12 sheep with standardised osteochondral fractures of the medial femoral condyle fixed with uncoloured, self-reinforced PGA rods (Biofix). Radiographs were taken at intervals ranging from two weeks to two years, and the sheep were killed at intervals ranging from six to 24 months. All knees were examined histologically. Eleven of the 12 fractures healed radiologically and histologically. Moderate to severe osteolysis was seen at four to six weeks with maximum changes at 12 weeks in ten animals. Six knees showed fistula-like connections between the implant site and the joint space. Three developed synovitis, one with inflammatory changes involving the whole cartilage and one with destruction of the medial condyle. Although in our study osteochondral fractures fixed with PGA rods healed reliably, there were frequent, significant foreign-body reactions. Caution is needed when considering the use of PGA fixation devices in vulnerable regions such as the knee.

The Role of TLR and Chemokine in Wear Particle-Induced Aseptic Loosening

PubMed Central

Gu, Qiaoli; Shi, Qin; Yang, Huilin

2012-01-01

Wear particle-induced periprosthetic osteolysis remains the principal cause of aseptic loosening of orthopaedic implants. Monocytes/macrophages phagocytose wear particles and release cytokines that induce inflammatory response. This response promotes osteoclast differentiation and osteolysis. The precise mechanisms by which wear particles are recognized and induce the accumulation of inflammatory cells in the periprosthetic tissue have not been fully elucidated. Recent studies have shown that toll-like receptors (TLRs) contribute to the cellular interaction with wear particles. Wear particles are recognized by monocytes/macrophages through TLRs coupled with the adaptor protein MyD88. After the initial interaction, wear particles induce both local and systemic migration of monocytes/macrophages to the periprosthetic region. The cellular migration is mediated through chemokines including interleukin-8, macrophage chemotactic protein-1, and macrophage inhibitory protein-1 in the periprosthetic tissues. Interfering with chemokine-receptor axis can inhibit cellular migration and inflammatory response. This paper highlights recent advances in TLR, and chemokine participated in the pathogenesis of aseptic loosening. A comprehensive understanding of the recognition and migration mechanism is critical to the development of measures that prevent wear particle-induced aseptic loosening of orthopaedic implants. PMID:23193363

Novel biological strategies for treatment of wear particle-induced periprosthetic osteolysis of orthopaedic implants for joint replacement

PubMed Central

Goodman, S. B.; Gibon, E.; Pajarinen, J.; Lin, T.-H.; Keeney, M.; Ren, P.-G.; Nich, C.; Yao, Z.; Egashira, K.; Yang, F.; Konttinen, Y. T.

2014-01-01

Wear particles and by-products from joint replacements and other orthopaedic implants may result in a local chronic inflammatory and foreign body reaction. This may lead to persistent synovitis resulting in joint pain and swelling, periprosthetic osteolysis, implant loosening and pathologic fracture. Strategies to modulate the adverse effects of wear debris may improve the function and longevity of joint replacements and other orthopaedic implants, potentially delaying or avoiding complex revision surgical procedures. Three novel biological strategies to mitigate the chronic inflammatory reaction to orthopaedic wear particles are reported. These include (i) interference with systemic macrophage trafficking to the local implant site, (ii) modulation of macrophages from an M1 (pro-inflammatory) to an M2 (anti-inflammatory, pro-tissue healing) phenotype in the periprosthetic tissues, and (iii) local inhibition of the transcription factor nuclear factor kappa B (NF-κB) by delivery of an NF-κB decoy oligodeoxynucleotide, thereby interfering with the production of pro-inflammatory mediators. These three approaches have been shown to be viable strategies for mitigating the undesirable effects of wear particles in preclinical studies. Targeted local delivery of specific biologics may potentially extend the lifetime of orthopaedic implants. PMID:24478281

Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

DTIC Science & Technology

2011-10-01

GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

Fibrosarcoma in the distal radius and carpus of a four-year-old Persian.

PubMed

Cook, J L; Turk, J R; Tomlinson, J L; Corwin, L A; Shaw, D C

1998-01-01

A four-year-old Persian was presented for evaluation of a nonweight-bearing, left forelimb lameness. Radioulnar and pancarpal osteolysis with minimal periosteal reaction were seen on radiographs of the antebrachium. Cytological examinations of fine-needle aspirates and impression smears were suggestive of sarcoma. After forequarter amputation, histopathological examination provided a diagnosis of fibrosarcoma with axillary lymph-node metastasis.

Regenerative Stem Cell Therapy for Breast Cancer Bone Metastasis

DTIC Science & Technology

2014-09-01

13. SUPPLEMENTARY NOTES 14. ABSTRACT Bone is the most common site of metastasis for human breast cancer (BCa), which results in significant...to all major bones as in human patients. 15. SUBJECT TERMS Bone metastasis; osteolysis; osteoprotegerin 16. SECURITY CLASSIFICATION OF: 17...metastasis for human breast cancer (BCa), which results in significant morbidity and mortality in patients with advanced disease. A vicious cycle

Evaluation of a new baseplate in reverse total shoulder arthroplasty - comparison of biomechanical testing of stability with roentgenological follow up criteria.

PubMed

Irlenbusch, U; Kohut, G

2015-04-01

To minimize notching problem associated with reversed prostheses, inferior positioning of base plate is recommended. This reduces the risk of notching, but does not eliminate it completely. Both polyethylene/PE-induced osteolysis and implant-to-bone or implant-to-implant contact may still occur, contributing to the risk of screw-breakage and resulting long-term failure. Therefore, the stability and integration of a newly developed base plate without inferior screw and inversion of bearing materials was investigated. Biomechanical assessment of primary stability of the two types of glenoid baseplate (1- and 2-pegged) was carried out according to ASTM F-2028-02 (American Society for Testing and Materials). Patients with a follow-up period of at least 2 years were clinically (n=78) and for most of them radiologically (n=61) examined. The X-rays were evaluated for loosening and scapular notching. The mean values of micromotions after 100,000 cycles showed no relevant differences between the 2-peg and the 1-peg base plates (47 μm for the 2-peg design and 43 μm for the 1-peg design), i.e. both were below the borderline for secure Osseointegration of 150 μm. Radiologically, no signs of loosening or radiolucent lines/RLL were found for both base plates. The mean incidence of inferior scapular notching was 23.6% (42 mm glenoid sphere: 15.8%). Only grade 1 and grade 2 notching was observed. Additionally as result of absence of PE-induced osteolysis shape, size, borderline and location of notching differed from those observed with conventional reverse total shoulder arthroplasty bearing materials. In combination with modified inferior operating technique, the newly designed implant has the potential to reduce the incidence of scapular notching and to avoid both PE-induced osteolysis and metal-screw contact. The new design did not compromise stability of the base plate in any way during the investigation period, as demonstrated both by the data from the biomechanical investigation and also by the radiological follow-up. Level III, case-control study. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Evaluation of a possible association between a history of dentoalveolar injury and the shape and size of the nasopalatine canal.

PubMed

Suter, Valerie G A; Jacobs, Reinhilde; Brücker, Marcia R; Furher, Alberto; Frank, Jim; von Arx, Thomas; Bornstein, Michael M

2016-04-01

Maxillary incisors (MI) are often affected by dentoalveolar injury resulting in tooth devitalization and apical periodontitis. The aim of the present study was to analyze any association between a history of dentoalveolar injury and the shape and size of the nasopalatine canal (NC) using cone beam computed tomography (CBCT). Patients were allocated to the trauma group if they had a history of dentoalveolar injury and a root filling in at least one MI and/or one missing MI. As controls, 100 matched-controlled (age and gender) patients were selected. NC dimensions including length, width at midway, and diameter of incisal and nasal foramen were measured in sagittal and axial CBCT planes. Furthermore, an evaluation of NC bulging signs, apical osteolysis of MI, and its fusion with NC was performed. In the trauma group (n = 96), 31.3 % had at least one missing MI, and 95.8 % had a root filling in a MI. The antero-posterior dimension of the incisive foramen (p = 0.02) and of the NC at midway (p = 0.04) was significantly larger in the trauma group. Significantly more cases with a bulging sign were found in the trauma (n = 19) than in the control group (n = 3, p = 0.001). An apical osteolysis was identified in 5.1 % of MI, and 12/38 did show a fusion with the NC. Wider dimensions of the NC and a bulging sign may suggest a former dentoalveolar injury to the anterior maxilla. Periapical osteolysis of central MI over 5 mm in diameter tends to fuse with the NC. In patients with a history of dentoalveolar injury and/or apical periodontitis, the NC should be evaluated on available CBCT images. Any inflammatory processes in the neighboring teeth should be recognized and eliminated as they may initiate bulging of the NC and/or the formation of a nasopalatine duct cyst (NPDC). NC with bulging signs should be monitored clinically and radiographically to diagnose a NPDC in an early stage.

Parascapular mass revealing primary tuberculosis of the posterior arch

PubMed Central

Arbault, Anais; Ornetti, Paul; Chevallier, Olivier; Avril, Julien; Pottecher, Pierre

2016-01-01

We report the case of a parascapular abscess revealing primary tuberculosis of the posterior arch in a 31-year-old man. Sectional imaging is essential in order to detect the different lesions of this atypical spinal tuberculosis as osteolysis of the posterior arch extendible to vertebral body, osteocondensation, epidural extension which is common in this location, and high specificity of a zygapophysial, costo-vertebral or transverse arthritis. PMID:27709081

[Sarcoidosis of the skeleton. Review of the literature and case report. (author's transl)].

PubMed

Uehlinger, E; Wurm, K

1976-08-01

The frequency of sarcoidosis in the skeleton varies between 3 and 36%. Skeletal sarcoidosis is rare in early stages (Löfgren-syndrom), relatively frequent in late stages. The initial phase is characterized by the formation of miliary non-caseating epitheloid-cell granulomas in the bone marrow. The invasion of the bone marrow may either be tolerated by the bone tissue or it initiates a perifocal osteosclerosis or a osteolysis. Correspondingly the X-ray of the skeleton shows normal structure or focal osteosclerosis or osteolysis. Therefore in the first case the sarcoidosis cannot be identified by X-ray. Most frequent locations are the phalanges of the fingers and toes, less common the stem skelton (skull, vertebrae, pelvis) and very rare the long tubular bones. In most cases the skeletal sarcoidosis is well tolerated. Report of a case of osteosclerotic sarcoidosis of the pelvis of a 39-years old woman with generalized sarcoidosis which was diagnozed four years earlier. The X-rays of the phalanges were normal. The biopsy of the iliac crest shows miliary sarcoid granuloma of the bone marrow and accretion of lamellar bone on the surface of the bone trabeculi with a distinct mosaic pattern. Treatment with steroids during the following five years was ineffective.

The mean seven years' results of the use of poly-L/D-lactic acid (PLDLA) interposition implant and bone packing in revision metacarpophalangeal arthroplasty: a prospective cohort study.

PubMed

Tiihonen, R; Honkanen, P B; Belt, E A; Ikävalko, M; Skyttä, E T

2012-01-01

Revision arthroplasty of metacarpophalangeal (MCP) joints in chronic inflammatory arthritis patients after silicone implants is challenging due of severe bone loss and soft tissue deficiencies. The aim of this study was to evaluate the outcome of revision MCP arthroplasty using poly-L/D-lactic acid 96:4 (PLDLA) interposition implant and morcelised allograft or autograft bone packing in patients with failed MCP arthroplasties and severe osteolysis. The study group consisted of 15 patients (15 hands and 36 joints) at a mean follow-up of seven years (range 5-10 years). The radiographs were reviewed for osteolysis and incorporation of the grafted bone. The clinical assessments included active range of motion, evaluation of pain, subjective outcome and assessment of grip power. PLDLA interposition arthroplasty combined with bone packing provided satisfactory pain relief, but function was limited. Radiographic analysis showed complete incorporation of the grafted bone to the diaphyseal portion of the host metacarpal and phalangeal bones in 30 of the 36 joints. All the patients had very limited grip strength, both on the operated and non-operated side. Due to soft tissue deficiencies long-term function and alignment problems can not be resolved with PLDLA interposition implant.

Particle size and morphology of UHMWPE wear debris in failed total knee arthroplasties--a comparison between mobile bearing and fixed bearing knees.

PubMed

Huang, Chun-Hsiung; Ho, Fang-Yuan; Ma, Hon-Ming; Yang, Chan-Tsung; Liau, Jiann-Jong; Kao, Hung-Chan; Young, Tai-Horng; Cheng, Cheng-Kung

2002-09-01

Osteolysis induced by ultrahigh molecular weight polyethylene wear debris has been recognized as the major cause of long-term failure in total joint arthroplasties. In a previous study, the prevalence of intraoperatively identified osteolysis during primary revision surgery was much higher in mobile bearing knee replacements (47%) than in fixed bearing knee replacements (13%). We postulated that mobile bearing knee implants tend to produce smaller sized particles. In our current study, we compared the particle size and morphology of polyethylene wear debris between failed mobile bearing and fixed bearing knees. Tissue specimens from interfacial and lytic regions were extracted during revision surgery of 10 mobile bearing knees (all of the low contact stress (LCS) design) and 17 fixed bearing knees (10 of the porous-coated anatomic (PCA) and 7 of the Miller/Galante design). Polyethylene particles were isolated from the tissue specimens and examined using both scanning electron microscopy and light-scattering analyses. The LCS mobile bearing knees produced smaller particulate debris (mean equivalent spherical diameter: 0.58 microm in LCS, 1.17 microm in PCA and 5.23 microm in M/G) and more granular debris (mean value: 93% in LCS, 77% in PCA and 15% in M/G).

Autoinflammation Around AES Total Ankle Replacement Implants.

PubMed

Koivu, Helka; Takakubo, Yuya; Mackiewicz, Zygmunt; Al-Samadi, Ahmed; Soininen, Antti; Peled, Nitai; Kukis, Modestas; Trokovic, Nina; Konttinen, Yrjö T

2015-12-01

Failure of total ankle replacement (TAR) can be characterized by early peri-implant osteolysis even in the presence of very modest numbers of wear particles. The hypothesis of the study was that this reaction is in part mediated by autoinflammatory responses mediated via damage-associated molecular patterns (DAMPs, danger signals) and pattern-recognizing danger signal receptors (PRRs). Peri-implant tissue and control samples from 10 patients with AES implants were immunostained for hypoxia inducible factor-1α (HIF-1α), activated caspase-3, high-mobility group box 1 (HMGB1), receptor for advanced glycation end product (RAGE), and toll-like receptors TLR2 and TLR4. Results were evaluated on a 0 to 4 scale (from 0% to >50% stained area). Peri-implant tissue around failed TAR implants had a relatively high mean HIF-1α score of 3 on a scale, which however was similar in control samples. HMGB1 (a DAMP) was seen to be mobilized from nuclei to cellular cytoplasm, and the active caspase-3(+) cells were increased. All PRRs were increased in revision samples. Increased expression of HMGB1 and other danger signals together with increased PRR-dependent responsiveness could contribute to autoinflammatory peri-implantitis, multilocular cyst formation, and osteolysis in failed TAR implants. Level IV, case series. © The Author(s) 2015.

Cerebrospinal fluid leakage and Chiari I malformation with Gorham's disease of the skull base: A case report.

PubMed

Nagashima, Hiroaki; Mizukawa, Katsu; Taniguchi, Masaaki; Yamamoto, Yusuke; Kohmura, Eiji

Gorham's syndrome is a rare bone disorder characterized by massive osteolysis of unknown etiology. There are no reports of comorbidity involving cerebrospinal fluid (CSF) leakage and Chiari I malformation with Gorham's syndrome. Here, we report an unusual case of an acute presyrinx state complicated by bacterial meningitis due to CSF leakage and Chiari I malformation associated with Gorham's disease of the skull base. A 25-year-old woman with Chiari I malformation associated with Gorham's syndrome presented with aggressive paresthesia following bacterial meningitis. Axial magnetic resonance imaging (MRI) and computed tomography (CT) cisternography revealed CSF leakage in the right petrous apex. A presyrinx state was diagnosed based on the clinical symptoms and MRI findings. With resolution of the bacterial meningitis, the spinal edema and tonsillar ectopia also improved. Surgical repair of the CSF leakage was performed by an endoscopic endonasal transsphenoidal approach to prevent recurrence of meningitis. The postoperative course was uneventful. Skull base osteolysis in Gorham's syndrome may induce Chiari I malformation and CSF leakage. We should pay attention to acute progression of clinical symptoms because Gorham's syndrome may predispose to development of Chiari I malformation and may be complicated by CSF leakage. Copyright © 2017 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

[Synovial fluid from aseptically failed total hip or knee arthroplasty is not toxic to osteoblasts].

PubMed

Gallo, J; Zdařilová, A; Rajnochová Svobodová, A; Ulrichová, J; Radová, L; Smižanský, M

2010-10-01

A failure of total hip or knee artroplasty is associated with an increased production of joint fluid. This contains wear particles and host cells and proteins, and is assumed to be involved in the pathogenesis of aseptic loosening and periprosthetic osteolysis. This study investigated the effect of synovial fluid from patients with aseptically failed joint prostheses on osteoblast cultures. Synovial fluid samples were obtained from patients with failed total joint prostheses (TJP; n=36) and from control patient groups (n = 16) involving cases without TJP and osteoarthritis, without TJP but with osteoarthritis, and with stable TJP. The samples were treated in the standard manner and then cultured with the SaOS-2 cell line which shows the characteristics and behaviour of osteoblasts. Each fluid sample was also examined for the content of proteins, cells and selected cytokines (IL-1ß, TNF-α, IL-6, RANKL and OPG detected by ELISA). We tested the hypothesis assuming that the fluids from failed joints would show higher cytotoxicity to osteoblast culture and we also expected higher levels of IL-1ß, TNF-α, IL-6, and RANKL in patients with TJP failure and/ or with more severe bone loss. The statistical methods used included the Kruskal-Wallis ANOVA and Mann-Whitney U test. The fluids from failed TJPs showed the highest RANKL and the lowest OPG levels resulting in the highest RANKL/OPG ratio. However, there was no evidence suggesting that the joint fluids from failed TJPs would be more toxic to osteoblast culture than the fluids from control groups. In addition, no correlation was found between the fluid levels of molecules promoting inflammation and osteoclastic activity and the extent of bone loss in the hip (in terms of Saleh's classification) or the knee (AORI classification). In fact, the fluids from failed TJPs had higher protein levels in comparison with the controls, but the difference was not significant. The finding of high RANKL levels and low OPG concentrations is in agreement with the theory of aseptic loosening and periprosthetic osteolysis. The other cytokines, particularly TNF-α and IL-1ß, were found in low levels. This can be explained by the stage of particle disease at which the samples were taken for ELISA analysis. It is probable that the level of signal molecules reflects osteolytic process activity and is therefore not constant. The reason for no correlation found between cytokine levels and the extent of bone loss may also lie in the use of therapeutic classifications of bone defects that is apparently less sensitive to the biological activity of aseptic loosening and/or periprosthetic osteolysis. Synovial fluids from failed total hip or knee joint prostheses are not toxic to osteoblast cultures. Cytotoxicity indicators and levels of pro-inflammatory and pro-osteoclastic cytokines (IL-1ß, TNF-α, IL-6, RANKL and OPG) do not correlate well with the extent of periprosthetic bone loss. Key words: total joint replacement, arthroplasty, aseptic loosening, periprosthetic osteolysis, joint fluid, SaOS-2 cell line, cytotoxicity, cytokines, RANKL, OPG.

Breast Cancer Stimulation of Osteolysis

DTIC Science & Technology

2000-09-01

essential medium supplemented with 10% fetal bovine serum (Hyclone, Logan, UT) and antibiotic/antimycotic solution (Sigma, St. Louis, MO) in 5% CO2 at...grown to confluence in alpha-modified minimum essential medium (Sigma) supplemented with 10% fetal bovine serum (Hyclone) at 37°C, 5% CO 2. ST2 cells...phenol red -free minimum essential medium supplemented with 10% FBS, and 50 ng/ml ascorbic acid. 1, 25-dihydroxyvitamin D3 and dexamethasone were

Bruton tyrosine kinase inhibition is a novel therapeutic strategy targeting tumor in the bone marrow microenvironment in multiple myeloma

PubMed Central

Chang, Betty Y.; Kong, Sun-Young; Fulciniti, Mariateresa; Yang, Guang; Calle, Yolanda; Hu, Yiguo; Lin, Jianhong; Zhao, Jian-Jun; Cagnetta, Antonia; Cea, Michele; Sellitto, Michael A.; Zhong, Mike Y.; Wang, Qiuju; Acharya, Chirag; Carrasco, Daniel R.; Buggy, Joseph J.; Elias, Laurence; Treon, Steven P.; Matsui, William; Richardson, Paul; Munshi, Nikhil C.; Anderson, Kenneth C.

2012-01-01

Bruton tyrosine kinase (Btk) has a well-defined role in B-cell development, whereas its expression in osteoclasts (OCs) further suggests a role in osteoclastogenesis. Here we investigated effects of PCI-32765, an oral and selective Btk inhibitor, on osteoclastogenesis as well as on multiple myeloma (MM) growth within the BM microenvironment. PCI-32765 blocked RANKL/M-CSF–induced phosphorylation of Btk and downstream PLC-γ2 in OCs, resulting in diminished TRAP5b (ED50 = 17nM) and bone resorption activity. PCI-32765 also inhibited secretion of multiple cytokines and chemokines from OC and BM stromal cell cultures from both normal donors (ED50 = 0.5nM) and MM patients. It decreased SDF-1–induced migration of MM cells, and down-regulated MIP1-α/CCL3 in MM cells. It also blocked MM cell growth and survival triggered by IL-6 or coculture with BM stromal cells or OCs in vitro. Importantly, PCI-32765 treatment significantly inhibits in vivo MM cell growth (P < .03) and MM cell–induced osteolysis of implanted human bone chips in SCID mice. Moreover, PCI-32765 prevents in vitro colony formation by stem-like cells from MM patients. Together, these results delineate functional sequelae of Btk activation mediating osteolysis and growth of MM cells, supporting evaluation of PCI-32765 as a novel therapeutic in MM. PMID:22689860

Tribological assessment of a flexible carbon-fibre-reinforced poly(ether-ether-ketone) acetabular cup articulating against an alumina femoral head.

PubMed

Scholes, S C; Inman, I A; Unsworth, A; Jones, E

2008-04-01

New material combinations have been introduced as the bearing surfaces of hip prostheses in an attempt to prolong their life by overcoming the problems of failure due to wear-particle-induced osteolysis. This will hopefully reduce the need for revision surgery. The study detailed here used a hip simulator to assess the volumetric wear rates of large-diameter carbon-fibre-reinforced pitch-based poly(ether-ether-ketone) (CFR-PEEK) acetabular cups articulating against alumina femoral heads. The joints were tested for 25 x 10(6) cycles. Friction tests were also performed on these joints to determine the lubrication regime under which they operate. The average volumetric wear rate of the CFR-PEEK acetabular component of 54 mm diameter was 1.16 mm(3)/10(6) cycles, compared with 38.6 mm(3)/10(6) cycles for an ultra-high-molecular-weight polyethylene acetabular component of 28 mm diameter worn against a ceramic head. This extremely low wear rate was sustained over 25 x 10(6) cycles (the equivalent of up to approximately 25 years in vivo). The frictional studies showed that the joints worked under the mixed-boundary lubrication regime. The low wear produced by these joints showed that this novel joint couple offers low wear rates and therefore may be an alternative material choice for the reduction of osteolysis.

Role of free radicals in aseptic loosening of hip arthroplasty.

PubMed

Kinov, Plamen; Leithner, Andreas; Radl, Roman; Bodo, Koppany; Khoschsorur, Gholam-Ali; Schauenstein, Konrad; Windhager, Reinhard

2006-01-01

Fibrous pseudocapsule around hip implants is an invariable finding at revision operations and is believed to release inflammatory mediators that stimulate bone resorption. Reactive oxygen species have been proposed to be causative factors in various disorders with tissue fibrosis. We were interested in investigating whether aseptic loosening is connected with high oxidative stress, and in showing the underlying mechanism of periprosthetic fibrosis and its role in loosening. Levels of oxidative stress markers reduced (GSH) and oxidized (GSSG) gluthatione and malondialdehyde (MDA) were assayed in 28 loose hips and in 12 stable hips revised for high rate of wear and osteolysis. Collagen in the periprosthetic tissues was measured as hydroxyproline content. Osteolysis and polyethylene wear were graded. Increased oxidative stress measured by low GSH/GSSG ratio as well as by increased MDA level was established in patients compared to controls. Oxidative stress markers intercorrelated significantly. MDA and both GSH and GSSG levels correlated significantly with hydroxyproline level. Levels of GSSG and MDA were higher in hips with greater polyethylene wear. The results suggest that high oxidative stress may play a role in formation of a fibrous membrane observed at revision of loose hips. The fibrous pseudocapsule is probably related to high intraarticular pressure and expansion of the effective joint space. This study may elicit some aspects of the pathogenesis of aseptic hip loosening and aid in future investigations aiming at prevention of this complication.

Plain radiologic findings and chronological changes of incipient phase osteosarcoma overlooked by primary physicians.

PubMed

Song, Won Seok; Jeon, Dae-Geun; Cho, Wan Hyeong; Kong, Chang-Bae; Cho, Sang Hyun; Lee, Jung Wook; Lee, Soo-Yong

2014-06-01

We assessed the plain radiographic characteristics of 10 cases of osteosarcomas during the initial painful period that had been overlooked by a primary physician. In addition, we evaluated chronologic changes in radiographic findings from initial symptomatic period to the time of accurate diagnosis. The clinical records were reviewed for clinical parameters including age, sex, location, presenting symptoms, initial diagnosis, duration from initial symptoms to definite diagnosis, and initial and follow-up plain radiographic findings of the lesion. Initial clinical diagnoses included a sprain in 6, growing pain in 2, stress fracture in 1, and infection in 1 patient. Initial plain radiographic findings were trabecular destruction (100%), cortical disruption (60%), periosteal reaction (60%), and soft tissue mass (10%). Intramedullary matrix changes were osteosclerosis in 6 and osteolysis in 4 patients. On progression, 4 cases with minimal sclerosis changed to osteoblastic lesion in 3 patients and osteolytic lesion in 1. Four cases with faint osteolytic foci transformed into osteolytic lesion in 3 and mixed pattern in 1. Notable plain radiologic findings of incipient-stage osteosarcoma include trabecular disruption along with faint osteosclerosis or osteolysis. In symptomatic patients with trabecular destruction, additional imaging study including magnetic resonance imaging should be performed to exclude osteosarcoma in the incipient phase, even without radiologic findings suggesting malignant tumor, such as cortical destruction or periosteal reaction.

Persistent inflammation with pedal osteolysis 1 Year after Charcot neuropathic osteoarthropathy

PubMed Central

Sinacore, David R.; Bohnert, Kathryn L.; Smith, Kirk E.; Hastings, Mary K.; Commean, Paul K.; Gutekunst, David J.; Johnson, Jeffrey E.; Prior, Fred W.

2017-01-01

Structured Abstract Aims To determine local and systemic markers of inflammation and bone mineral density (BMD) in the foot and central sites in participants with diabetes mellitus and peripheral neuropathy (DMPN) with and without acute Charcot neuropathic osteoarthropathy (CN). Methods Eighteen participants with DMPN and CN and 19 participants without CN had foot temperature assessments, serum markers of inflammation [C-reactive protein, (CRP) and erythrocyte sedimentation rate, (ESR)] and BMD of the foot, hip and lumbar spine at baseline and 1 year follow-up. Results CN foot temperature difference was higher compared to DMPN controls at baseline (4.2 ± 1.9 °F vs. 1.2 ± 0.9 °F, P < 0.01) and after 1 year (2.9 ± 3.2 °F vs. 0.9 ± 1.1 °F, P < 0.01). Serum inflammatory markers in the CN group were greater at baseline and remained elevated 1 year later compared to DMPN controls (CRP, P =0.02, ESR, P = 0.03). All pedal bones’ BMD decreased an average of 3% in the CN foot with no changes in hip or lumbar spine. DMPN controls’ foot, hip and lumbar spine BMD remained unchanged. Conclusions Local and systemic inflammation persists1 year after CN with an accompanying pedal osteolysis that may contribute to mid foot deformity which is the hallmark of the chronic Charcot foot. PMID:28254346

Mutant CCL2 Protein Coating Mitigates Wear Particle-Induced Bone Loss in a Murine Continuous Polyethylene Infusion Model

PubMed Central

Nabeshima, Akira; Pajarinen, Jukka; Lin, Tzu-hua; Jiang, Xinyi; Gibon, Emmanuel; Córdova, Luis A.; Loi, Florence; Lu, Laura; Jämsen, Eemeli; Egashira, Kensuke; Yang, Fan; Yao, Zhenyu; Goodman, Stuart B

2016-01-01

Wear particle-induced osteolysis limits the long-term survivorship of total joint replacement (TJR). Monocyte/macrophages are the key cells of this adverse reaction. Monocyte Chemoattractant Protein-1 (MCP-1/CCL2) is the most important chemokine regulating trafficking of monocyte/macrophages in particle-induced inflammation. 7ND recombinant protein is a mutant of CCL2 that inhibits CCL2 signaling. We have recently developed a layer-by-layer (LBL) coating platform on implant surfaces that can release biologically active 7ND. In this study, we investigated the effect of 7ND on wear particle-induced bone loss using the murine continuous polyethylene (PE) particle infusion model with 7ND coating of a titanium rod as a local drug delivery device. PE particles were infused into hollow titanium rods with or without 7ND coating implanted in the distal femur for 4 weeks. Specific groups were also injected with RAW 264.7 as the reporter macrophages. Wear particle-induced bone loss and the effects of 7ND were evaluated by microCT, immunohistochemical staining, and bioluminescence imaging. Local delivery of 7ND using the LBL coating decreased systemic macrophage recruitment, the number of osteoclasts and wear particle-induced bone loss. The development of a novel orthopaedic implant coating with anti-CCL2 protein may be a promising strategy to mitigate peri-prosthetic osteolysis. PMID:27918885

[Chronic recurrent multifocal osteomyelitis of the mandible: report of three cases].

PubMed

Paim, Luciana B; Liphaus, Bernadete Lourdes; Rocha, André C; Castellanos, Aura Ligia Z; Silva, Clovis Artur A

2003-01-01

To report three cases of chronic recurrent multifocal osteomyelitis of the mandible, an inflammatory disease affecting one or more bones with absence of isolated microorganisms in affected areas. The first case is a 13 year-old female presenting with pain and fever after dental treatment. The patient received antibiotic treatment for osteomyelitis, but developed progressive enlargement of the mandible and palmoplantar pustulosis. Bone scintigraphy showed intense and diffuse uptake in the mandible. The swelling decreased after indomethacin and hyperbaric oxygen therapy. Case 2 is a 9 year-old female patient with recurrent pain and edema of the right mandible for three years. The diagnosis of osteomyelitis was established and amoxicillin introduced. After three months, tomography showed diffuse mandible osteolysis. Indomethacin and hyperbaric oxygen therapy were introduced, however the patient presented a relapse and was treated with prednisone, rofecoxib and methotrexate. Patient 3, a 10 year-old male, had palmoplantar pustulosis and recurrent enlargement of the mandible. Tomography showed diffuse mandible osteolysis and scintigraphy revealed intense and diffuse uptake in the mandible. The patient was treated with prednisone. Rofecoxib was replaced after two relapses. Chronic recurrent multifocal osteomyelitis of the mandible is often associated with prolonged pain periods and periods of activity and remission of the inflammatory process. Its recognition is important to prevent the patient from being submitted to prolonged antibiotic therapy and unnecessary invasive procedures.

Use of a 3D Skull Model to Improve Accuracy in Cranioplasty for Autologous Flap Resorption in a 3-Year-Old Child.

PubMed

Maduri, Rodolfo; Viaroli, Edoardo; Levivier, Marc; Daniel, Roy T; Messerer, Mahmoud

2017-01-01

Cranioplasty is considered a simple reconstructive procedure, usually performed in a single stage. In some clinical conditions, such as in children with multifocal flap osteolysis, it could represent a surgical challenge. In these patients, the partially resorbed autologous flap should be removed and replaced with a precustomed prosthesis which should perfectly match the expected bone defect. We describe the technique used for a navigated cranioplasty in a 3-year-old child with multifocal autologous flap osteolysis. We decided to perform a cranioplasty using a custom-made hydroxyapatite porous ceramic flap. The prosthesis was produced with an epoxy resin 3D skull model of the patient, which included a removable flap corresponding to the planned cranioplasty. Preoperatively, a CT scan of the 3D skull model was performed without the removable flap. The CT scan images of the 3D skull model were merged with the preoperative 3D CT scan of the patient and navigated during the cranioplasty to define with precision the cranioplasty margins. After removal of the autologous resorbed flap, the hydroxyapatite prosthesis matched perfectly with the skull defect. The anatomical result was excellent. Thus, the implementation of cranioplasty with image merge navigation of a 3D skull model may improve cranioplasty accuracy, allowing precise anatomic reconstruction in complex skull defect cases. © 2017 S. Karger AG, Basel.

Comparative study of open and arthroscopic coracoid transfer for shoulder anterior instability (Latarjet)-computed tomography evaluation at a short term follow-up. Part II.

PubMed

Kordasiewicz, Bartłomiej; Kicinski, Maciej; Małachowski, Konrad; Wieczorek, Janusz; Chaberek, Sławomir; Pomianowski, Stanisław

2018-05-01

The aim of this study was to evaluate and to compare the radiological parameters after arthroscopic and open Latarjet technique via evaluation of computed tomography (CT) scans. Our hypothesis was that the radiological results after arthroscopic stabilisation remained in the proximity of those results achieved after open stabilisation. CT scan evaluation results of patients after primary Latarjet procedure were analysed. Patients operated on between 2006 and 2011 using an open technique composed the OPEN group and patients operated on arthroscopically between 2011 and 2013 composed the ARTHRO group. Forty-three out of 55 shoulders (78.2%) in OPEN and 62 out of 64 shoulders (95.3%) in ARTHRO were available for CT scan evaluation. The average age at surgery was 28 years in OPEN and 26 years in ARTHRO. The mean follow-up was 54.2 months in OPEN and 23.4 months in ARTHRO. CT scan evaluation was used to assess graft fusion and osteolysis. Bone block position and screw orientation were assessed in the axial and the sagittal views. The subscapularis muscle fatty infiltration was evaluated according to Goutallier classification. The non-union rate was significantly higher in OPEN than in ARTHRO: 5 (11.9%) versus 1 (1.7%) (p < 0.05). The total graft osteolysis was significantly higher in the OPEN group: five cases (11.9%) versus zero in ARTHRO (p < 0.05). Graft fracture incidence was comparable in both groups: in two patients in ARTHRO (3.3%) and one case (2.4%) in the OPEN group (p > 0.05). These results should be evaluated very carefully due to significant difference in the follow-up of both groups. A significantly higher rate of partial graft osteolysis at the level of the superior screw was reported in ARTHRO with 32 patients (53.3%) versus 10 (23.8%) in OPEN (p < 0.05). In the axial view, 78.4% of patients in ARTHRO and 80.5% in OPEN had the coracoid bone block in an acceptable position (between 4 mm medially and 2 mm laterally). In the sagittal plane, the bone block was in an acceptable position between 2 and 5 o'clock in 86.7% of patients in ARTHRO and 90.2% in OPEN (p > 0.05). However, in the position between 3 and 5 o'clock there were 56.7% of the grafts in ARTHRO versus 87.8% in OPEN (p < 0.05). The screws were more parallel to the glenoid surface in ARTHRO-the angles were 12.3° for the inferior screw and 12.6° for the superior one. These angles in the OPEN group were respectively 15° and 17° (p < 0.05 and for the superior screw). There was no significant difference in the presence of fatty infiltration of the subscapularis muscle. Arthroscopic Latarjet stabilisation showed satisfactory radiographic results, comparable to the open procedure, however the short-term follow-up can bias this evaluation. Graft healing rate was very high in the arthroscopic technique, but yet osteolysis of the superior part of the graft and more superior graft position in the sagittal view were significantly different when compared to the open technique. The screw position was slightly more parallel to the glenoid via the arthroscopic technique. We recommend both further investigation and development of the arthroscopic technique. III.

Headache of a diagnosis: frontotemporal pain and inflammation associated with osteolysis.

PubMed

Tacon, Lyndal J; Parkinson, Jonathon F; Hudson, Bernard J; Brewer, Janice M; Little, Nicholas S; Clifton-Bligh, Roderick J

2008-11-17

A 62-year-old woman presented with left frontotemporal pain, scalp tenderness and raised levels of inflammatory markers. Temporal arteritis was considered likely, and symptoms resolved with prednisone therapy. This delayed diagnostic bone biopsy until a soft tissue abscess formed, and Pott's puffy tumour associated with Prevotella osteomyelitis of the frontal bone was diagnosed. This case highlights the value of early histopathological examination, and is a reminder of a condition seen frequently in the pre-antibiotic era.

GORHAM-STOUT SYNDROME: PHANTOM BONE DISEASE

PubMed Central

El-Kouba, Gabriel; de Araújo Santos, Romilton; Pilluski, Paulo César; Severo, Antonio; Lech, Osvandré

2015-01-01

Gorham-Stout syndrome is a disease that presents idiopathic osteolysis of a bone or closely contiguous area. The etiology is unknown. It is a rare condition that is difficult to diagnose, and its treatment is controversial. It affects individuals irrespective of age or sex. In this study, we conducted a bibliographic review of the disease, specifically focusing on the differential diagnosis, and we demonstrated the follow-up on a patient with this syndrome from the time of its diagnosis, through treatment, to its current state of evolution. PMID:27026974

Compressive cervical pannus formation in a patient after 2-level disc arthroplasty: a rare complication treated with posterior instrumented fusion.

PubMed

Brophy, Carl M; Hoh, Daniel J

2018-06-01

Cervical disc arthroplasty (CDA) has received widespread attention as an alternative to anterior fusion due to its similar neurological and functional improvement, with the advantage of preservation of segmental motion. As CDA becomes more widely implemented, the potential for unexpected device-related adverse events may be identified. The authors report on a 48-year-old man who presented with progressive neurological deficits 3 years after 2-level CDA was performed. Imaging demonstrated periprosthetic osteolysis of the vertebral endplates at the CDA levels, with a heterogeneously enhancing ventral epidural mass compressing the spinal cord. Diagnostic workup for infectious and neoplastic processes was negative. The presumptive diagnosis was an inflammatory pannus formation secondary to abnormal motion at the CDA levels. Posterior cervical decompression and instrumented fusion was performed without removal of the arthroplasty devices or the ventral epidural mass. Postoperative imaging at 2 months demonstrated complete resolution of the compressive pannus, with associated improvement in clinical symptoms. Follow-up MRI at > 6 months showed no recurrence of the pannus. At 1 year postoperatively, CT scanning revealed improvement in periprosthetic osteolysis. Inflammatory pannus formation may be an unexpected complication of abnormal segmental motion after CDA. This rare etiology of an epidural mass associated with an arthroplasty device should be considered, in addition to workup for other potential infectious or neoplastic mass lesions. In symptomatic individuals, compressive pannus lesions can be effectively treated with fusion across the involved segment without removal of the device.

Hook plate fixation of acute displaced lateral clavicle fractures: mid-term results and a brief literature overview

PubMed Central

2012-01-01

Background The clavicle hook plate achieves like most other operative techniques, a high percentage of union and a low percentage of complications however concerns about long term complications still exist, particularly the involvement of the acromioclavicular joint. Methods To evaluate the results and long term effects in use of this plate we performed a retrospective analysis with a mean follow up of 65 months (5.4 years) of 28 consecutive patients with acute displaced lateral clavicle fractures, treated with the clavicle hook plate. Results Short term functional results in all patients were good to excellent. All but one patient had a united fracture (96%). Nine patients (32%) developed impingement symptoms and in 7 patients (25%) subacromial osteolysis was found. These findings resolved after plate removal. Twenty-four patients were re-evaluated at a mean follow-up period of 5.4 years. The Constant-Murley score was 97 and the DASH score was 3.5. Four patients (14%) developed acromioclavicular joint arthrosis of which one was symptomatic. Three patients (11%) had extra articular ossifications of which one was symptomatic. There was no relation between the impingement symptoms, subacromial osteolysis and development of acromioclavicular joint arthrosis or extra articular ossifications. Conclusions The clavicle hook plate is a good primary treatment option for the acute displaced lateral clavicle fracture with few complications. At mid term the results are excellent and no long term complications can be addressed to the use of the plate. PMID:22236647

Orthopaedic wear particle-induced bone loss and exogenous macrophage infiltration is mitigated by local infusion of NF-κB decoy oligodeoxynucleotide.

PubMed

Lin, Tzuhua; Pajarinen, Jukka; Nabeshima, Akira; Córdova, Luis A; Loi, Florence; Gibon, Emmanuel; Lu, Laura; Nathan, Karthik; Jämsen, Eemeli; Yao, Zhenyu; Goodman, Stuart B

2017-11-01

Excessive production of wear particles from total joint replacements induces chronic inflammation, macrophage infiltration, and consequent bone loss (periprosthetic osteolysis). This inflammation and bone remodeling are critically regulated by the transcription factor NF-κB. We previously demonstrated that inhibition of NF-κB signaling by using the decoy oligodeoxynucleotide (ODN) mitigates polyethylene wear particle-induced bone loss using in vitro and in vivo models. However, the mechanisms of NF-κB decoy ODN action, and in particular its impact on systemic macrophage recruitment, remain unknown. In the current study, this systemic macrophage infiltration was examined in our established murine femoral continuous particle infusion model. RAW264.7 murine macrophages expressing a luciferase reporter gene were injected into the systemic circulation. Quantification of bioluminescence showed that NF-κB decoy ODN reduced the homing of these reporter macrophages into the distal femurs exposed to continuous particle delivery. Particle-induced reduction in bone mineral density at the distal diaphysis of the femur was also mitigated by infusion of decoy ODN. Histological staining showed that the decoy ODN infusion decreased osteoclast and macrophage numbers, but had no significant effects on osteoblasts. Local infusion of NF-κB decoy ODN reduced systemic macrophage infiltration and mitigated particle-induced bone loss, thus providing a potential strategy to treat periprosthetic osteolysis. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 3169-3175, 2017. © 2017 Wiley Periodicals, Inc.

[Calcifying tendinitis of the rotator cuff with focal umeral osteolysis. Imaging features].

PubMed

Mascarenhas, V V; Morais, F; Marques, H; Guerra, A; Carpinteiro, E; Gaspar, A

2015-01-01

Calcifying tendinitis occurs most commonly in the rotator cuff tendons, particularly involving the supraspinatus tendon insertion, and is often asymptomatic. Cortical erosion secondary to calcifying tendinitis has been reported in multiple locations, including in the rotator cuff tendons. The authors report two cases of symptomatic calcifying tendinitis involving the infraspinatus tendon with cortical erosion with correlative radiographic, and MR findings. The importance of considering this diagnosis when evaluating lytic lesions of the humerus and the imaging differential diagnosis of calcifying tendinitis and cortical erosion are discussed.

[Slow-release recombinant human bone morphogenetic protein-2 suppresses chromium wear particle-induced osteolysis in rats].

PubMed

Li, Gan; Li, Qi; Lin, Li-Jun; Duan, Xin; Zhang, Xi-Qi

2012-03-01

To observe the effect of a slow-release recombinant human bone morphogenetic protein-2 (rhBMP-2) formulation on the expressions of receptor activator of nuclear factor-κB ligand (RANKL) and osteoprotegerin (OPG) in a murine air pouch model of bone implantation. A cranial bone allograft was implanted in the air pouch induced on the back of the recipients. The rat models were then randomized into 5 groups, including a blank control group, chromium particle group, and 3 rhBMP-2 groups receiving 50, 100 or 200 µg/L slow-release rhBMP-2 in addition to chromium particles. Three weeks later, the expressions of RANKL and OPG in the air pouch was detected using Western blotting and RT-PCR, and the positively stained area for osteoclasts in the bone graft was determined with TRAP staining for drug effect assessment. RANKL and OPG expressions were found in the air pouches in all the 5 groups. RANKL and OPG protein and mRNA expressions, RANKL/OPG ratio and osteoclast staining area in the bone graft were the highest in chromium particle group (P<0.05), but were significantly decreased by treatment with the slow-release rhBMP-2 formulation (P<0.05); the measurements showed no significant differences between the blank control group and 200 µg/L rhBMP-2 group (P>0.05). Chromium particles can cause osteolysis by increasing the RANKL/OPG ratio in rats, and intervention with slow-release rhBMP-2 can significantly promote bone formation and suppress bone resorption by decreasing RANKL/OPG ratio.

Particulate wear debris activates protein tyrosine kinases and nuclear factor kappaB, which down-regulates type I collagen synthesis in human osteoblasts.

PubMed

Vermes, C; Roebuck, K A; Chandrasekaran, R; Dobai, J G; Jacobs, J J; Glant, T T

2000-09-01

Particulate wear debris generated mechanically from prosthetic materials is phagocytosed by a variety of cell types within the periprosthetic space including osteoblasts, which cells with an altered function may contribute to periprosthetic osteolysis. Exposure of osteoblast-like osteosarcoma cells or bone marrow-derived primary osteoblasts to either metallic or polymeric particles of phagocytosable sizes resulted in a marked decrease in the steady-state messenger RNA (mRNA) levels of procollagen alpha1[I] and procollagen alpha1[III]. In contrast, no significant effect was observed for the osteoblast-specific genes, such as osteonectin and osteocalcin (OC). In kinetic studies, particles once phagocytosed, maintained a significant suppressive effect on collagen gene expression and type I collagen synthesis for up to five passages. Large particles of a size that cannot be phagocytosed also down-regulated collagen gene expression suggesting that an initial contact between cells and particles can generate gene responsive signals independently of the phagocytosis process. Concerning such signaling, titanium particles rapidly increased protein tyrosine phosphorylation and nuclear transcription factor kappaB (NF-kappaB) binding activity before the phagocytosis of particles. Protein tyrosine kinase (PTK) inhibitors such as genistein and the NF-kappaB inhibitor pyrrolidine dithiocarbamate (PDTC) significantly reduced the suppressive effect of titanium on collagen gene expression suggesting particles suppress collagen gene expression through the NF-kappaB signaling pathway. These results provide a mechanism by which particulate wear debris can antagonize the transcription of the procollagen alpha1[I] gene in osteoblasts, which may contribute to reduced bone formation and progressive periprosthetic osteolysis.

The Morscher Press-Fit Acetabular Component: An Independent Long-Term Review at 18-22 Years.

PubMed

Gwynne-Jones, David P; Lash, Heath W R; James, Andrew W; Iosua, Ella E; Matheson, John A

2017-08-01

There are relatively few 20-year results of uncemented acetabular components, and most of these are modular designs. This study reports the 20-year results of a monoblock press-fit acetabular component. A total of 122 total hip arthroplasties (111 patients) using the Morscher cup were reviewed at a mean of 19.7 years. The average age at implantation was 57.3 years (range, 36-74 years), and 81 (66%) were men. Twenty-two patients (25 hips) had died. Seven hips were revised, including 5 acetabular revisions. Six patients (6 hips) declined to participate but were known not to have been revised. The mean Oxford hip score was 41.1 (range, 22-48), and the mean reduced Western Ontario and McMaster Universities Osteoarthritis Index score was 5.7/48 (range, 0-24). Eccentric wear was seen in 13 (15.7%) and major osteolysis in 14 (17%) of 82 surviving hips with radiographs. The all-cause revision rate was 0.32 per 100 observed component years (95% confidence interval [CI], 0.13-0.66). The 20-year Kaplan-Meier survival was 93.4% (CI, 86.6-96.8) for all-cause revisions, 95.5% (CI, 89.4-98.1) for any acetabular revision, and 97.1% (CI, 91.2-99.1) for acetabular aseptic loosening, wear, or osteolysis. The Morscher acetabular component has continued to perform well at 20 years despite using conventional polyethylene with results that match or surpass other cementless acetabulae. Copyright © 2017 Elsevier Inc. All rights reserved.

10-year results of the uncemented Allofit press-fit cup in young patients.

PubMed

Streit, Marcus R; Weiss, Stefan; Andreas, Franziska; Bruckner, Thomas; Walker, Tilman; Kretzer, J Philippe; Ewerbeck, Volker; Merle, Christian

2014-08-01

Uncemented acetabular components in primary total hip arthroplasty (THA) are commonly used today, but few studies have evaluated their survival into the second decade in young and active patients. We report on a minimum 10-year follow-up of an uncemented press-fit acetabular component that is still in clinical use. We examined the clinical and radiographic results of our first 121 consecutive cementless THAs using a cementless, grit-blasted, non-porous, titanium alloy press-fit cup (Allofit; Zimmer Inc., Warsaw, IN) without additional screw fixation in 116 patients. Mean age at surgery was 51 (21-60) years. Mean time of follow-up evaluation was 11 (10-12) years. At final follow-up, 8 patients had died (8 hips), and 1 patient (1 hip) was lost to follow-up. 3 hips in 3 patients had undergone acetabular revision, 2 for deep infection and 1 for aseptic acetabular loosening. There were no impending revisions at the most recent follow-up. We did not detect periacetabular osteolysis or loosening on plain radiographs in those hips that were evaluated radiographically (n = 90; 83% of the hips available at a minimum of 10 years). Kaplan-Meier survival analysis using revision of the acetabular component for any reason (including isolated inlay revisions) as endpoint estimated the 11-year survival rate at 98% (95% CI: 92-99). Uncemented acetabular fixation using the Allofit press-fit cup without additional screws was excellent into early in the second decade in this young and active patient cohort. The rate of complications related to the liner and to osteolysis was low.

Comparison of the outcome following the fixation of osteotomies or fractures associated with total hip replacement using cables or wires: the results at five years.

PubMed

Berton, C; Puskas, G J; Christofilopoulos, P; Stern, R; Hoffmeyer, P; Lübbeke, A

2012-11-01

There are no recent studies comparing cable with wire for the fixation of osteotomies or fractures in total hip replacement (THR). Our objective was to evaluate the five-year clinical and radiological outcomes and complication rates of the two techniques. We undertook a review including all primary and revision THRs performed in one hospital between 1996 and 2005 using cable or wire fixation. Clinical and radiological evaluation was performed five years post-operatively. Cables were used in 51 THRs and wires in 126, and of these, 36 THRs with cable (71%) and 101 with wire (80%) were evaluated at follow-up. The five-year radiographs available for 33 cable and 91 wire THRs revealed rates of breakage of fixation of 12 of 33 (36%) and 42 of 91 (46%), respectively. With cable there was a significantly higher risk of metal debris (68% vs. 9%; adjusted relative risk (RR) 6.6; 95% confidence interval (CI) 3.0 to 14.1), nonunion (36% vs. 21%; adjusted RR 2.0; 95% CI 1.0 to 3.9) and osteolysis around the material, acetabulum or femur (61% vs 19%; adjusted RR 3.9; 95% CI 2.3 to 6.5). Cable breakage increased the risk of osteolysis to 83%. There was a trend towards foreign-body reaction and increased infection with cables. Clinical results did not differ between the groups. In conclusion, we found a higher incidence of complications and a trend towards increased infection and foreign-body reaction with the use of cables.

Apomab, a fully human agonistic antibody to DR5, exhibits potent antitumor activity against primary and metastatic breast cancer

PubMed Central

Zinonos, Irene; Labrinidis, Agatha; Lee, Michelle; Liapis, Vasilios; Hay, Shelley; Ponomarev, Vladimir; Diamond, Peter; Zannettino, Andrew C.W.; Findlay, David M.; Evdokiou, Andreas

2017-01-01

Apomab, a fully human agonistic DR5 monoclonal antibody, triggers apoptosis through activation of the extrinsic apoptotic signaling pathway. In this study, we assessed the cytotoxic effect of Apomab in vitro and evaluated its antitumor activity in murine models of breast cancer development and progression. MDA-MB-231-TXSA breast cancer cells were transplanted into the mammary fat pad or directly into the tibial marrow cavity of nude mice. Apomab was administered early, postcancer cell transplantation, or after tumors progressed to an advanced stage. Tumor burden was monitored progressively using bioluminescence imaging, and the development of breast cancer–induced osteolysis was measured using micro-computed tomography. In vitro, Apomab treatment induced apoptosis in a panel of breast cancer cell lines but was without effect on normal human primary osteoblasts, fibroblasts, or mammary epithelial cells. In vivo, Apomab exerted remarkable tumor suppressive activity leading to complete regression of well-advanced mammary tumors. All animals transplanted with breast cancer cells directly into their tibiae developed large osteolytic lesions that eroded the cortical bone. In contrast, treatment with Apomab following an early treatment protocol inhibited both intraosseous and extraosseous tumor growth and prevented breast cancer–induced osteolysis. In the delayed treatment protocol, Apomab treatment resulted in the complete regression of advanced tibial tumors with progressive restoration of both trabecular and cortical bone leading to full resolution of osteolytic lesions. Apomab represents a potent immunotherapeutic agent with strong activity against the development and progression of breast cancer and should be evaluated in patients with primary and metastatic disease. PMID:19808976

Raman spectroscopy of bone metastasis

NASA Astrophysics Data System (ADS)

Esmonde-White, Karen A.; Sottnik, Joseph; Morris, Michael; Keller, Evan

2012-02-01

Raman spectroscopy of bone has been used to characterize chemical changes occurring in diseases such as osteoporosis, osteoarthritis and osteomyelitis. Metastasis of cancer into bone causes changes to bone quality that are similar to those observed in osteoporosis, such as decreased bone strength, but with an accelerated timeframe. In particular, osteolytic (bone degrading) lesions in bone metastasis have a marked effect on patient quality of life because of increased risk of fractures, pain, and hypercalcemia. We use Raman spectroscopy to examine bone from two different mouse models of osteolytic bone metastasis. Raman spectroscopy measures physicochemical information which cannot be obtained through standard biochemical and histological measurements. This study was reviewed and approved by the University of Michigan University Committee on the Care and Use of Animals. Two mouse models of prostate cancer bone metastasis, RM1 (n=3) and PC3-luc (n=4) were examined. Tibiae were injected with RM1 or PC3-luc cancer cells, while the contralateral tibiae received a placebo injection for use as controls. After 2 weeks of incubation, the mice were sacrificed and the tibiae were examined by Raman microspectroscopy (λ=785 nm). Spectroscopic markers corresponding to mineral stoichiometry, bone mineralization, and mineral crystallinity were compared in spectra from the cancerous and control tibiae. X-ray imaging of the tibia confirmed extensive osteolysis in the RM1 mice, with tumor invasion into adjoining soft tissue and moderate osteolysis in the PC3-luc mice. Raman spectroscopic markers indicate that osteolytic lesions are less mineralized than normal bone tissue, with an altered mineral stoichiometry and crystallinity.

Magnetic resonance imaging features of esthesioneuroblastoma in three dogs and one cat.

PubMed

Söffler, Charlotte; Hartmann, Antje; Gorgas, Daniela; Ludewig, Eberhard; von Pückler, Kerstin; Kramer, Martin; Schmidt, Martin J

2016-10-12

Esthesioneuroblastoma is a rare malignant intranasal tumor that originates from the olfactory neuroepithelium of the upper nasal cavity, and can destroy the cribriform plate and expand into the neurocranium. Descriptions of the magnetic resonance features of esthesioneuroblastomas in animals are scarce. The objectives of this study were to report the magnetic resonance imaging features of esthesioneuroblastomas in order to determine distinct imaging characteristics that may help distinguish it from other intracranial tumor types. Magnetic resonance images of four patients with confirmed esthesioneuroblastomas were reviewed and compared with previously reported cases. The esthesioneuroblastomas appeared as oval-shaped, solitary lesions in the caudal nasal cavity that caused osteolysis of the cribriform plate and extended into the brain in all cases. Signal intensity was variable. Contrast enhancement was mild and varied from homogeneous to heterogeneous. A peripheral cystic component was found in two patients and was reported in only one previous case. Mass effect and white matter edema were marked to severe. Osteolysis of facial bones and extension into the facial soft tissues or retrobulbar space were not present in any of the cases, although this has been reported in the literature. A definitive diagnosis of esthesioneuroblastoma based on signal intensity or contrast behavior was not possible. Nevertheless, the presence of a mass in the caudal nasal cavity with extension into the neurocranium seems to be a feature highly suspicious of esthesioneuroblastoma. In contrast to other extra-cranial lesions, the extra-cranial mass was relatively small and destruction of facial bones seems to be rare.

Why total knees fail-A modern perspective review.

PubMed

Lum, Zachary C; Shieh, Alvin K; Dorr, Lawrence D

2018-04-18

Historically, the most common mechanism of total knee arthroplasty (TKA) failures included aseptic loosening, instability and malalignment. As polyethylene production improved, modes of failure from polyethylene wear and subsequent osteolysis became less prevalent. Newer longitudinal studies report that infection has become the primary acute cause of failure with loosening and instability remaining as the overall greatest reasons for revision. Clinical database and worldwide national registries confirm these reports. With an increasing amount of TKA operations performed in the United States, and with focus on value-based healthcare, it is imperative to understand why total knees fail.

Infectious or Noninfectious? Ruptured, Thrombosed Inflammatory Aortic Aneurysm with Spondylolysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stefanczyk, Ludomir; Elgalal, Marcin, E-mail: telgalal@yahoo.co.uk; Papiewski, Andrzej

Osteolysis of vertebrae due to inflammatory aortic aneurysm is rarely observed. However, it is estimated that up to 10 % of infectious aneurysms coexist with bone tissue destruction, most commonly the vertebrae. Inflammatory aneurysms with no identified infection factor, along with infiltration of adjacent muscle and in particular extensive destruction of bone tissue have rarely been described in the literature. A case of inflammatory aneurysm with posterior wall rupture and inflammatory infiltration of the iliopsoas muscle and spine, together with extensive vertebral body destruction, is presented. The aneurysm was successfully treated with endovascular aneurysm repair EVAR.

Computer Assisted Surgery and Current Trends in Orthopaedics Research and Total Joint Replacements

NASA Astrophysics Data System (ADS)

Amirouche, Farid

2008-06-01

Musculoskeletal research has brought about revolutionary changes in our ability to perform high precision surgery in joint replacement procedures. Recent advances in computer assisted surgery as well better materials have lead to reduced wear and greatly enhanced the quality of life of patients. The new surgical techniques to reduce the size of the incision and damage to underlying structures have been the primary advance toward this goal. These new techniques are known as MIS or Minimally Invasive Surgery. Total hip and knee Arthoplasties are at all time high reaching 1.2 million surgeries per year in the USA. Primary joint failures are usually due to osteoarthristis, rheumatoid arthritis, osteocronis and other inflammatory arthritis conditions. The methods for THR and TKA are critical to initial stability and longevity of the prostheses. This research aims at understanding the fundamental mechanics of the joint Arthoplasty and providing an insight into current challenges in patient specific fitting, fixing, and stability. Both experimental and analytical work will be presented. We will examine Cementless total hip arthroplasty success in the last 10 years and how computer assisted navigation is playing in the follow up studies. Cementless total hip arthroplasty attains permanent fixation by the ingrowth of bone into a porous coated surface. Loosening of an ingrown total hip arthroplasty occurs as a result of osteolysis of the periprosthetic bone and degradation of the bone prosthetic interface. The osteolytic process occurs as a result of polyethylene wear particles produced by the metal polyethylene articulation of the prosthesis. The total hip arthroplasty is a congruent joint and the submicron wear particles produced are phagocytized by macrophages initiating an inflammatory cascade. This cascade produces cytokines ultimately implicated in osteolysis. Resulting bone loss both on the acetabular and femoral sides eventually leads to component instability. As patients are living longer and total hip arthroplasty is performed in younger patients the risks of osteolysis associated with cumulative wear is increased. Computer-assisted surgery is based on sensing feedback; vision and imaging that help surgeons align the patient's joints during total knee or hip replacement with a degree of accuracy not possible with the naked eye. For the first time, the computer feedback is essential for ligament balancing and longevity of the implants. The computers navigation systems also help surgeons to use smaller incisions instead of the traditional larger openings. Small-incision surgery offers the potential for faster recovery, less bleeding and less pain for patients. The development of SESCAN imaging technique to create a patient based model of a 3D joint will be presented to show the effective solution of complex geometry of joints.

Wear of a 5 megarad cross-linked polyethylene liner: a 6-year RSA study.

PubMed

Callary, Stuart A; Campbell, David G; Mercer, Graham; Nilsson, Kjell G; Field, John R

2013-07-01

One cross-linked polyethylene (XLPE) liner is manufactured using a lower dose of radiation, 5 Mrad, which may result in less cross-linking. The reported in vivo wear rate of this XLPE liner in patients undergoing THA has varied, and has included some patients in each reported cohort who had greater than 0.1 mm/year of wear, which is an historical threshold for osteolysis. Previous studies have measured wear on plain radiographs, an approach that has limited sensitivity. We therefore measured the amount and direction of wear at 6 years using Radiostereometric analysis (RSA) in patients who had THAs that included a cross-linked polyethylene liner manufactured using 5 Mrad radiation. We prospectively reviewed wear in 30 patients who underwent primary THAs with the same design of cross-linked acetabular liner and a 28-mm articulation. Tantalum markers were inserted during surgery and all patients had RSA radiographic examinations at 1 week, 6 months, 1, 2, and 6 years postoperatively. The mean proximal, two-dimensional (2-D) and three-dimensional (3-D) wear rates calculated between 1 year and 6 years were 0.014, 0.014, and 0.018 mm/per year, respectively. The direction of the head penetration recorded between 1 week and 6 years was in a proximal direction for all patients, proximolateral for 16 of 24 patients, and proximomedial for eight of 24 patients. The proximal, 2-D and 3-D wear of a XLPE liner produced using 5 Mrad of radiation was low but measurable by RSA after 6 years. No patients had proximal 2-D or 3-D wear rates exceeding 0.1 mm/year. Further followup is needed to evaluate the effect of XLPE wear particles on the development of long-term osteolysis.

Stereomicroscopic evaluation of the joint cartilage and bone tissue in osteoporosis

NASA Astrophysics Data System (ADS)

Vasile, Liliana; Torok, Rodica; Deleanu, Bogdan; Marchese, Cristian; Valeanu, Adina; Bodea, Rodica

2012-06-01

Aim of the study. Assessment by stereomicroscopy of the severity of lesions in osteoporotic bone at both sexes and to correlate micro-and macro-bone fracture due to low bone density values with the disease evolution. Material and method: The study material consists of fragments of bone from the femoral head, vertebral bone, costal and iliac crest biopsy obtained from patients aged over 70 years, female and male, treated in the County Hospital of Timisoara, Department of Orthopedics. For the purpose of studying the samples in stereomicroscopy and trough polarized light it has been used the Olympus Microscope SZ ×7 and an Olympus camera with 2,5 × digital zoom and a 3× optical zoom in the Vest Politechnic Univesity. Results and discussions: Subchondral bone presents osteolysis associated with a osteoporotic bone transformation. Pseudocystic chondrolisis was noted in the osteoarticular cartilage, in addition with areas of hemorrhagic postfractural necrosis. The osteoporotic bone exhibits ischemic necrosis and focal hemorrhagic necrosis adjacent fracture. Microporosity pattern of the bone observed by stereomicroscopy correspond to the spongy bone osteoporosis images. Morphometry of the bone spiculi reveals length of 154.88 and 498.32 μ. In men we found a greater thickness of bone trabeculi compared with bone texture porosity in women. The subchondral bone supports and fulfills an important role in transmitting forces from the overlying articular cartilage inducing the bone resorbtion. The femoral head fracture may be the final event of many accumulated bone microcracks. Conclusions: Bone fragility depends not only of the spongy bone but also of the cortical bone properties. Osteolysis produced by loss of balance in the process of remodeling in favor of bone resorption leads to the thinning of the subchondral bone at both sexes.

Early Experience with a Short, Tapered Titanium Porous Plasma Sprayed Stem with Updated Design.

PubMed

Lombardi, Adolph V; Manocchio, Antonio G; Berend, Keith R; Morris, Michael J; Adams, Joanne B

2018-06-01

Short stem femoral components in primary total hip arthroplasty (THA) have increased in popularity since the advent of minimally invasive surgical techniques. The concept of a short stem is particularly compatible with tapered designs where the goal is to offload forces proximally in the femur. The purpose of this retrospective review was to review our early experience with a short, tapered titanium femoral component with updated design features. Beginning in November 2011 through February 2012, 92 consented patients (93 hips), at a single center, were treated with primary cementless THA using a short stem, tapered femoral component (Taperloc® Complete Microplasty; Zimmer Biomet, Warsaw, Indiana) and were available for review with a minimum two-year follow-up. Mean patient age at surgery was 63.2 years and body mass index (BMI) was 30.8 kg/m2. Mean stem length used was 110.3mm (range, 95-125). Mean follow-up was 4.5 years (2-6). Harris hip scores improved from 52.5 preoperatively to 84.7 at most recent. One stem was revised the same day for periprosthetic fracture. One patient with early infection was treated with single-stage exchange followed by recurrence that was treated successfully with two-stage exchange. A non-healing wound in one patient was treated with incision and debridement. Radiographic assessment demonstrated no evidence of loosening, osteolysis, distal hypertrophy, or pedestal formation in any hip, and all components appeared well fixed and in appropriate alignment. In this series of patients treated with primary THA using a short, tapered titanium porous plasma-sprayed femoral component with updated design features, good results were achieved with a low incidence of complications and revision. No aseptic loosening or osteolysis has occurred. Radiographic assessment was excellent for all patients.

Radiographic changes and clinical outcomes associated with an adjustable diaphyseal press-fit humeral stem in primary reverse shoulder arthroplasty.

PubMed

Harmsen, Samuel M; Norris, Tom R

2017-09-01

Press-fit humeral fixation in reverse shoulder arthroplasty (RSA) has become increasingly popular; however, radiographic analysis of these stems is limited. We aimed to evaluate the radiographic and clinical outcomes of an adjustable diaphyseal press-fit humeral stem in primary RSA. We conducted a retrospective review of 232 primary RSAs in 219 patients performed by a single surgeon using this system. Radiographic outcomes were evaluated in patients with at least 2 years of radiographic follow-up. Standardized postoperative digital radiographs were analyzed for loosening, osteolysis, and stress shielding. Clinical outcomes in patients who also had complete clinical data sets were evaluated at the most recent follow-up. Radiographic evidence of loosening was identified in 1 RSA (0.4%) associated with deep infection. Aseptic loosening was not observed. No stems were identified as being at high risk for loosening. Internal stress shielding was observed proximal to the coated diaphyseal component in 226 shoulders (97.4%). This finding was often visible at 3 months (92.7%) and predictably progressed on subsequent radiographs. Progression beyond the 2-year period was rarely seen (4.4%). No external stress shielding or osteolysis was observed. Thirty-six complications occurred in 33 patients (15.1%). At an average follow-up of 36.6 months, significant improvements were identified in all measured clinical outcomes (P < .001). Predictable fixation is achieved using an adjustable diaphyseal press-fit humeral system in primary RSA. Internal stress shielding is commonly observed but does not appear to compromise quality of fixation or clinical outcomes. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Radiographic changes differ between two different short press-fit humeral stem designs in total shoulder arthroplasty.

PubMed

Denard, Patrick J; Noyes, Matthew P; Walker, J Brock; Shishani, Yousef; Gobezie, Reuben; Romeo, Anthony A; Lederman, Evan

2018-02-01

The purpose of this study was to compare the radiographic changes of the humerus in the short term after total shoulder arthroplasty with two different short-stem humeral components. The hypothesis was that there would be no difference in radiographic changes or functional outcome based on component type. A retrospective review was conducted of primary total shoulder arthroplasties performed with a short press-fit humeral component. Group A included a collarless humeral stem with an oval geometry and curved stem (Ascend or Ascend Flex; Wright Medical, Memphis, TN, USA). Group B included a humeral stem with a metaphyseal collar, rectangular geometry, and straight stem (Apex; Arthrex, Inc., Naples, FL, USA). Radiographic changes and functional outcome were evaluated at a minimum of 2 years postoperatively. There were 42 patients in group A and 35 patients in group B available for analysis. There was no difference in functional outcome between the groups. In group A, the mean total radiographic change score of the humerus was 3.9, with changes classified as low in 38% and high in 62%. In group B, the mean total radiographic change score of the humerus was 2.5, with changes classified as low in 77% and high in 23% (P < .001). Medial calcar osteolysis was present in 71% of group A compared with 28.5% of group B (P < .001). At short-term follow-up, there is no difference in functional outcome or revision between 2 different humeral stem designs. However, bone adaptive changes and the rate of medial calcar osteolysis are significantly different. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Effects of letrozole on breast cancer micro-metastatic tumor growth in bone and lung in mice inoculated with murine 4T1 cells.

PubMed

Wang, Wendan; Belosay, Aashvini; Yang, Xujuan; Hartman, James A; Song, Huaxin; Iwaniec, Urszula T; Turner, Russell T; Churchwell, Mona I; Doerge, Daniel R; Helferich, William G

2016-06-01

Breast cancer (BC) is the leading cancer in women worldwide. Metastasis occurs in stage IV BC with bone and lung being common metastatic sites. Here we evaluate the effects of the aromatase inhibitor letrozole on BC micro-metastatic tumor growth in bone and lung metastasis in intact and ovariectomized (OVX) mice with murine estrogen receptor negative (ER-) BC cells inoculated in tibia. Forty-eight BALB/c mice were randomly assigned to one of four groups: OVX, OVX + Letrozole, Intact, and Intact + Letrozole, and injected with 4T1 cells intra-tibially. Letrozole was subcutaneously injected daily for 23 days at a dose of 1.75 µg/g body weight. Tumor progression was monitored by bioluminescence imaging (BLI). Following necropsy, inoculated tibiae were scanned via µCT and bone response to tumor was scored from 0 (no ectopic mineralization/osteolysis) to 5 (extensive ectopic mineralization/osteolysis). OVX mice had higher tibial pathology scores indicative of more extensive bone destruction than intact mice, irrespective of letrozole treatment. Letrozole decreased serum estradiol levels and reduced lung surface tumor numbers in intact animals. Furthermore, mice receiving letrozole had significantly fewer tumor colonies and fewer proliferative cells in the lung than OVX and intact controls based on H&E and Ki-67 staining, respectively. In conclusion, BC-inoculated OVX animals had higher tibia pathology scores than BC-inoculated intact animals and letrozole reduced BC metastases to lungs. These findings suggest that, by lowering systemic estrogen level and/or by interacting with the host organ, the aromatase inhibitor letrozole has the potential to reduce ER- BC metastasis to lung.

Application of biodegradable plates for treating pediatric mandibular fractures.

PubMed

An, Jingang; Jia, Pengcheng; Zhang, Yi; Gong, Xi; Han, Xiaodong; He, Yang

2015-05-01

We assessed the clinical results of a biodegradable plate system for the internal fixation of mandibular fractures in children, and observed the imaging features of fracture healing and bone changes around the biodegradable plates and screws during follow-up. We enrolled 39 patients (22 male, 17 female, average age 4 years 10 months) with different mandibular fractures. We used 2.0-mm resorbable plates to repair the fractures. Postoperative follow-up ranged from 6 months to 5 years; average follow-up was 1 year 2 months. The outcome measures identified and assessed included facial symmetry, mouth opening, occlusal relationship, infection, nonunion, malunion, and plate dehiscence. We fixed 42 fractures with 43 resorbable plates; the fracture site of one patient (aged 11 years 3 months) was fixed with two plates. Two patients developed small fistulas at the intraoral incision 2 months after surgery; the fistulas healed after 1 month without special treatment. In the other patients, the incision healed well, there was facial symmetry, mouth opening was >35 mm, and occlusion was good. Follow-up computed tomography examination data were available for 20 cases, and revealed different degrees of radiolucency indicating that osteolysis had occurred. Radiolucency was observed around the resorbable plates 1 month after the surgery. The extent and depth of the radiolucent region were obvious within 1 year of surgery. In the second year, there were obvious repairs, with the bony defect areas becoming shallower. After 2 years, the bony defect areas had almost disappeared. Biodegradable fixation devices are safe and efficient for treating pediatric mandibular fractures. Osteolysis commonly follows biodegradable fixation of pediatric mandibular fractures, and has no adverse effect on fracture healing. Copyright © 2015 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Peculiarities of the bone tissue resorption under microgravity conditions

NASA Astrophysics Data System (ADS)

Rodionova, N.; Oganov, V.; Polkovenko, O.; Nitsevich, T.

The actual problem - peculiarities of resorptive processes in the spongiose of thingbones - we studied with the use of tranmissive electron microscopy in experiments on rats (American space station SLS-2) and on monkeys Macaca mulatt? (BION-11). Animals were onboard during 2 weeks. There was established, that the resorption happen with osteoclasts participation. They can create groups of cells. In the osteoclasts population we indicated not typical for the control (ground experiment) "giant" cells, which have on ultrathin sections 5-6 nuclei, many lysosomes, well developed "light" zone and "brush-border". The destruction of minera lized matrix in bone lacunas also happens by the way of osteolytic activity of osteocytes. Lysosome ferments of osteocytes are secreted by the eczocytosis. The osteocytic osteolysis, as well as the osteoclastic one can be seen as a physiological, gormon-dependent mechanism of resorption. The presence of a considerable number of neutrophiles, which enter in some zones of resorption is also typical. When these neutrophiles destruct, they release lysosomic ferments that dissolve the bone matrix. In some zones of resorption we noted the presence of the row from collagen fibrils, which loosed crystals , on mineralized matrix borders. The cell detritus is noted in zones of surface dissolving among crystallic conglomerates. It certificates the processes of osteogenic cells destruction that happen here. So, under the microgravity conditions in zones of adaptive remodeling of the spongiose the processes of the bone tissue resorption happen by some ways, namely: by the functional activization of osteoclasts; by the osteocytic osteolysis increasing; as a result of hydrolytic activity of neutrophiles, entering in these zones, and also by the local demineralization and further destruction of bone matrix surface zones.

Calcitonin: discovery, development, and clinical application.

PubMed

Copp, D H

1994-06-01

In 1954, when I gave a talk on calcium homeostasis at the first Gordon Conference on Bones and Teeth, it was recognized that the level of ionic calcium in the plasma and body fluids must be maintained with precision, since it is critically important for a number of vital processes. However, very little was known of the mechanisms involved and I decided to make this the focus of my research career. With the assistance of a number of first-year medical students working during the summer, we developed a precise method for measuring calcium, demonstrated the remarkable constancy of plasma calcium in normal human subjects, and found that normal calcium levels were restored quickly after being artificially raised or lowered. We focussed on parathyroid hormone (PTH), which plays a key role in controlling hypocalcemia by stimulating osteolysis. While studying the control of its secretion in 1961, we discovered a second calcium-regulating hormone (calcitonin) which was released by hypercalcemia and lowered plasma calcium by inhibiting osteolysis. It is a straight-chain peptide with 32 amino acids and a 7-membered disulfide ring at the N terminal. It is produced by C cells which arise from the neural crest and is considered a neuropeptide hormone. It is produced in the thyroid of mammals and the ultimobranchial glands of lower vertebrates. We were involved in the isolation of salmon calcitonin, which is the form most widely used in therapy because of its high potency. In addition to inhibiting bone resorption, it is a powerful analgesic agent with a potency in certain circumstances which is 30-50 times that of morphine. It is widely used clinically for the treatment of Paget's disease, hypercalcemia, osteoporosis, and relief of bone pain. World sales in 1992 exceeded US$900 million, of which 85% was for osteoporosis.

[Endoprosthesis failure in the ankle joint : Histopathological diagnostics and classification].

PubMed

Müller, S; Walther, M; Röser, A; Krenn, V

2017-03-01

Endoprostheses of the ankle joint show higher revision rates of 3.29 revisions per 100 component years. The aims of this study were the application and modification of the consensus classification of the synovia-like interface membrane (SLIM) for periprosthetic failure of the ankle joint, the etiological clarification of periprosthetic pseudocysts and a detailed measurement of proliferative activity (Ki67) in the region of osteolysis. Tissue samples from 159 patients were examined according to the criteria of the standardized consensus classification. Of these, 117 cases were derived from periprosthetic membranes of the ankle. The control group included 42 tissue specimens from the hip and knee joints. Particle identification and characterization were carried out using the particle algorithm. An immunohistochemical examination with Ki67 proliferation was performed in all cases of ankle pseudocysts and 19 control cases. The consensus classification of SLIM is transferrable to endoprosthetic failure of the ankle joint. Periprosthetic pseudocysts with the histopathological characteristics of the appropriate SLIM subtype were detectable in 39 cases of ankle joint endoprostheses (33.3%). The mean value of the Ki67 index was 14% and showed an increased proliferation rate in periprosthetic pseudocysts of the ankle (p-value 0.02037). In periprosthetic pseudocysts an above average higher detection rate of type 1 SLIM induced by abrasion (51.3%) with an increased Ki67 proliferation fraction (p-value 0.02037) was found, which can be interpreted as local destructive intraosseus synovialitis. This can be the reason for formation of pseudocystic osteolysis caused by high mechanical stress in ankle endoprostheses. A simplified diagnostic classification scoring system of dysfunctional endoprostheses of the ankle is proposed for collation of periprosthetic pseudocysts, ossifications and the Ki67 proliferation fraction.

[New biodegradable polylactide implants (Polypin-C) in therapy for radial head fractures].

PubMed

Prokop, A; Jubel, A; Helling, H J; Udomkaewkanjana, C; Brochhagen, H G; Rehm, K E

2002-10-01

Dislocated radial head fractures of the type Mason II are usually treated with screws and buttress plates. The implants are generally removed at a later date. Biodegradable implants can be applied successfully for the reduction of small radial head fractures subject to shearing forces and slight loads. The implants are completely absorbed once the fracture has healed, making a second operation for the removal of the implant unnecessary. The Polypin C-Pin is made of poly(L, DL-lactide) mixed with 10% beta-tricalcium phosphate to ensure controlled, slow degradation with no significant side effects. This new Polypin C fixation pin was clinically tested on 35 patients with radial head fractures (CCF 21B2.1 and 21B2.2) from 31.10.1996 until 1.4.2002. A total of 34 of the patients (97.1%) underwent a clinical and conventional radiological follow-up examination after an average of 38.2 months. In 29 cases a CT was also carried out. Between 18 and 24 months, two cases of grade 1 osteolysis were observed around the pin head. No trace of osteolysis was observed at the final examination in either case. According to the Broberg score, an average of 96 out of a possible 100 points were attained at the final examination (31 excellent, 2 good, 1 unsatisfactory). After a period of 24 months, the pins were no longer visible on a conventional x-ray. A CT evaluation showed a density similar to that of spongioid bone in the original pin cavities after 3 years. These excellent clinical results prove that the Polypin C is a good method to treat dislocated radial head fractures.

Efficacy of infliximab on MRI-determined bone oedema in psoriatic arthritis.

PubMed

Marzo-Ortega, Helena; McGonagle, Dennis; Rhodes, Laura A; Tan, Ai Lyn; Conaghan, Philip G; O'Connor, Philip; Tanner, Steven F; Fraser, Alexander; Veale, Douglas; Emery, Paul

2007-06-01

Psoriatic arthritis (PsA) is commonly associated with bone pathology, including entheseal new bone formation and osteolysis. On MRI, areas of active clinical involvement are represented by bone oedema and synovitis. To assess the impact of infliximab on bone oedema in PsA as shown by MRI. 18 patients with joint swelling, psoriasis and seronegativity for rheumatoid factor received four infusions of infliximab, 3 mg/kg, in combination with methotrexate. MRI of the affected hand (12 patients) or knee joints (6 patients) was performed before and after treatment. The primary outcome was the assessment of bone oedema and synovitis at 20 weeks as shown by MRI. Secondary outcomes included the American College of Rheumatology (ACR) response criteria, psoriasis skin scores (Psoriasis Area and Severity Index (PASI)) and a quality of life measure (Psoriatic Arthritis Quality of Life (PsAQoL)). At baseline, bone oedema was seen in 50% of patients (seven hands and two knees) in 30% of scanned joints, and this improved or resolved in all cases in the hand joints (p = 0.018) and in one knee joint at 20 weeks. Synovitis was found to be reduced in 90% of cases on MRI. Likewise, a significant improvement in all clinical outcomes, including PASI (p = 0.003) and PsAQoL (p = 0.006) was seen at week 20. 65% (n = 11) of the patients achieved an ACR response, of whom 45% had ACR70 or above and 54% had ACR20 or ACR50. Infliximab treatment is associated with dramatic improvements in MRI-determined bone oedema in PsA in the short term. It remains to be determined whether infliiximib treatment is the cause for prevention of new bone formation, bone fusion or osteolysis in PsA as shown by radiography.

The clavicle hook plate for Neer type II lateral clavicle fractures.

PubMed

Renger, R J; Roukema, G R; Reurings, J C; Raams, P M; Font, J; Verleisdonk, E J M M

2009-09-01

To evaluate functional and radiologic outcome in patients with a Neer type II lateral clavicle fracture treated with the clavicle hook plate. Multicenter retrospective study. Five level I and II trauma centers. Forty-four patients, average age 38.4 years (18-66 years), with a Neer type II lateral clavicle fracture treated with the clavicle hook plate between January 1, 2003, and December 31, 2006. Open reduction and internal fixation with the clavicle hook plate. Removal of all 44 implants after consolidation at a mean of 8.4 months (2-33 months) postoperatively. At an average follow-up of 27.4 months (13-48 months), functional outcome was assessed with the Constant-Murley scoring system. Radiographs were taken to evaluate consolidation and to determine the distance between the coracoid process and the clavicle. The average Constant score was 92.4 (74-100). The average distance between the coracoid process and the clavicle was 9.8 mm (7.3-14.8 mm) compared with 9.4 mm (6.9-14.3 mm) on the contralateral nonoperative side. We observed 1 dislocation of an implant (2.2%), 2 cases of pseudarthrosis (4.5%), 2 superficial wound infections (4.5%), 2 patients with hypertrophic scar tissue (4.5%), and 3 times an acromial osteolysis (6.8%). Thirty patients (68%) reported discomfort due to the implant. These implant-related complaints and the acromial osteolysis disappeared after removal of the hook plate. With all the patients, direct functional aftercare was possible. The clavicle hook plate is a suitable implant for Neer type II clavicle fractures. The advantage of this osteosynthesis is the possibility of immediate functional aftercare. We observed a high percentage of discomfort due to the implant; therefore, we advise to remove the implant as soon as consolidation has taken place.

OSTEOLYSIS AROUND TOTAL KNEE ARTHOPLASTY: A REVIEW OF PATHOGENETIC MECHANISMS

PubMed Central

Gallo, Jiri; Goodman, Stuart B.; Konttinen, Yrjö T.; Wimmer, Markus A.; Holinka, Martin

2014-01-01

Aseptic loosening and other wear-related complications are one of the most frequent late reasons for revision of total knee arthroplasty (TKA). Periprosthetic osteolysis (PPOL) predates aseptic loosening in many cases indicating the clinical significance of this pathogenic mechanism. A variety of implant-, surgery-, and host-related factors have been delineated to explain the development of PPOL. These factors influence the development of PPOL due to changes in mechanical stresses within the vicinity of the prosthetic device, excessive wear of the polyethylene liner, and joint fluid pressure and flow acting on the peri-implant bone. The process of aseptic loosening is initially governed by factors such as implant/limb alignment, device fixation quality, and muscle coordination/strength. Later large numbers of wear particles detached from TKAs trigger and perpetuate particle disease, as highlighted by progressive growth of inflammatory/granulomatous tissue around the joint cavity. An increased accumulation of osteoclasts at the bone-implant interface, an impairment of osteoblast function, mechanical stresses, and an increased production of joint fluid contribute to bone resorption and subsequent loosening of the implant. In addition, hypersensitivity and adverse reactions to metal debris may contribute to aseptic TKA failure but should be determined more precisely. Patient activity level appears to be the most important factor when the long-term development of PPOL is considered. Surgical technique, implant design, and material factors are the most important preventative factors because they influence both the generation of wear debris and excessive mechanical stresses. New generations of bearing surfaces and designs for TKA should carefully address these important issues in extensive preclinical studies. Currently, there is little evidence that PPOL can be prevented with pharmacological interventions. PMID:23669623

Pathophysiological aspects and therapeutic approaches of tumoral osteolysis and hypercalcemia.

PubMed

Bonjour, J P; Rizzoli, R

1989-01-01

Malignant tumors can affect the integrity of the skeletal tissue and the homeostasis of the two main components of bone mineral, calcium (Ca) and inorganic phosphate (Pi). Various tumoral cell products can increase bone resorption by influencing the number of osteoclasts and/or their activity. These tumoral products could act either directly on bone cells of the osteoblastic or osteoclastic lineages, or indirectly by influencing cells secreting osteotropic factors, such as interleukin-1, tumor necrosis factors, transforming growth factors, and colony-stimulating factor. Among the classical calciotropic hormones, 1,25-dihydroxyvitamin D3 could be implicated in lymphoma. In hypercalcemia of malignancy, an increase in bone resorption is observed in most patients. However, in many cases an increased tubular reabsorption of Ca has been documented as well. This phenomenon when present after adequate rehydration is probably due to the secretion by the tumoral cells of a parathyroid hormone-related peptide (PTHrP). This factor has been recently identified as a protein containing 141 amino acids. This protein or some very close analogs have been shown to be secreted by lung, kidney and also breast carcinoma. Besides increasing bone resorption and stimulating tubular reabsorption of Ca, PTHrP also selectively decreases the tubular reabsorption of Pi, an action that may explain the hypophosphatemia observed in some types of neoplasm. Therapeutically, administration of antiresorbing agents such as clodronate or other bisphosphonates can normalize the increased osteolysis and, if present, the associated elevation in the plasma level of Ca in most cancer patients. However in some cases, wherein the prevailing hypercalcemic mechanism is due to an enhancement in the tubular reabsorption of Ca, other therapeutic means should be associated with the antiosteolytic bisphosphonate therapy.

Short stature Revealing a Pycnodysostosis: A Case Report

PubMed Central

Aynaou, Hayat; Skiker, Imane; Latrech, Hanane

2016-01-01

Introduction: Pycnodysostosis is a rare genetic disease characterized by osteosclerosis and bone fragility. The clinical aspects are varied including short stature, acro-osteolysis of distal phalanges, and dysplasia of the clavicles. Oral and maxillofacial manifestations of this disease are very clear. The head is usually large, a beaked nose, obtuse mandibular angle, and both maxilla and mandible are hypoplastic. Dental abnormalities are common. We report a case with the typical clinical and radiological characteristics of the Pycnodysostosis associated with a conductive hearing loss, an association rarely reported. Case Presentation: A 12-year-female was admitted in our institute for short stature with a dysmorphic facies for evaluation. The patient reported a history of multiple fractures of the long bones after a trivial fall. On physical examination, she had the following features: short stature, limited mouth opening, short hands and feet with dysplastic nails; frontal and occipital bossing; and hypoplasia of the maxilla and mandible. Examination of the mouth: grooved palate, caries of the teeth, impacted and malposed teeth, persistent deciduous teeth and missing teeth. Laboratory investigations were normal. The radiographic examination showed a generalized increase in the bone density, slight condensation of the skull base and a very open mandibular angle. X-rays showed tapered phalanges with acro-osteolysis of the distal phalanges. A symptomatic treatment was proposed based on fracture prevention, oral hygiene, frequent dental visits and psychiatric support. Conclusion: The clinical and radiological features are the bases for the diagnosis of this disease. It is important to make the diagnosis as early as possible in order to plan the treatment and to provide a better life quality to the patients. PMID:27703936

Role of the Toll-like receptor pathway in the recognition of orthopedic implant wear-debris particles.

PubMed

Pearl, Jeremy I; Ma, Ting; Irani, Afraaz R; Huang, Zhinong; Robinson, William H; Smith, Robert L; Goodman, Stuart B

2011-08-01

The inflammatory response to prosthetic implant-derived wear particles is the primary cause of bone loss and aseptic loosening of implants, but the mechanisms by which macrophages recognize and respond to particles remain unknown. Studies of innate immunity demonstrate that Toll-like receptors (TLRs) recognize pathogen-associated molecular patterns (PAMPs) and danger-associated molecular patterns (DAMPS). All TLRs signal through myeloid differentiation factor 88 (MyD88), except TLR3 which signals through TIR domain containing adapter inducing interferon-beta (TRIF), and TLR4 which signals through both MyD88 and TRIF. We hypothesized that wear-debris particles may act as PAMPs/DAMPs and activate macrophages via TLRs. To test this hypothesis, we first demonstrated that inhibition of MyD88 decreases polymethylmethacrylate (PMMA) particle-induced production of TNF-α in RAW 264.7 macrophages. Next we compared particle-induced production of TNF-α among MyD88 knockout (MyD88(-/-)), TRIF knockout (TRIF(-/-)), and wild type (WT) murine macrophages. Relative to WT, disruption of MyD88 signaling diminished, and disruption of TRIF amplified the particle-induced production of TNF-α. Gene expression data indicated that this latter increase in TNF-α was due to a compensatory increase in expression of MyD88 associated components of the TLR pathway. Finally, using an in vivo model, MyD88(-/-) mice developed less particle-induced osteolysis than WT mice. These results indicate that the response to PMMA particles is partly dependent on MyD88, presumably as part of TLR signaling; MyD88 may represent a therapeutic target for prevention of wear debris-induced periprosthetic osteolysis. Copyright © 2011 Elsevier Ltd. All rights reserved.

Autocrine inhibition of the c-fms proto-oncogene reduces breast cancer bone metastasis assessed with in vivo dual-modality imaging.

PubMed

Jeffery, Justin J; Lux, Katie; Vogel, John S; Herrera, Wynetta D; Greco, Stephen; Woo, Ho-Hyung; AbuShahin, Nisreen; Pagel, Mark D; Chambers, Setsuko K

2014-04-01

Breast cancer cells preferentially home to the bone microenvironment, which provides a unique niche with a network of multiple bidirectional communications between host and tumor, promoting survival and growth of bone metastases. In the bone microenvironment, the c-fms proto-oncogene that encodes for the CSF-1 receptor, along with CSF-1, serves as one critical cytokine/receptor pair, functioning in paracrine and autocrine fashion. Previous studies concentrated on the effect of inhibition of host (mouse) c-fms on bone metastasis, with resulting decrease in osteolysis and bone metastases as a paracrine effect. In this report, we assessed the role of c-fms inhibition within the tumor cells (autocrine effect) in the early establishment of breast cancer cells in bone and the effects of this early c-fms inhibition on subsequent bone metastases and destruction. This study exploited a multidisciplinary approach by employing two non-invasive, in vivo imaging methods to assess the progression of bone metastases and bone destruction, in addition to ex vivo analyses using RT-PCR and histopathology. Using a mouse model of bone homing human breast cancer cells, we showed that an early one-time application of anti-human c-fms antibody delayed growth of bone metastases and bone destruction for at least 31 days as quantitatively measured by bioluminescence imaging and computed tomography, compared to controls. Thus, neutralizing human c-fms in the breast cancer cell alone decreases extent of subsequent bone metastasis formation and osteolysis. Furthermore, we are the first to show that anti-c-fms antibodies can impact early establishment of breast cancer cells in bone.

Pro-tumorigenic effects of transforming growth factor beta 1 in canine osteosarcoma.

PubMed

Portela, R F; Fadl-Alla, B A; Pondenis, H C; Byrum, M L; Garrett, L D; Wycislo, K L; Borst, L B; Fan, T M

2014-01-01

Transforming growth factor beta 1 (TGFβ1) is a pleiotropic cytokine that contributes to reparative skeletal remodeling by inducing osteoblast proliferation, migration, and angiogenesis. Organic bone matrix is the largest bodily reservoir for latent TGFβ1, and active osteoblasts express cognate receptors for TGFβ1 (TGFβRI and TGFβRII). During malignant osteolysis, TGFβ1 is liberated from eroded bone matrix and promotes local progression of osteotropic solid tumors by its mitogenic and prosurvival activities. Canine osteosarcoma (OS) cells will possess TGFβ1 signaling machinery. Blockade of TGFβ1 signaling will attenuate pro-tumorigenic activities in OS cells. Naturally occurring primary OS samples will express cognate TGFβ1 receptors; and in dogs with OS, focal malignant osteolysis will contribute to circulating TGFβ1 concentrations. Thirty-three dogs with appendicular OS. Expression of TGFβ1 and its cognate receptors, as well as the biologic effects of TGFβ1 blockade, was characterized in OS cells. Ten spontaneous OS samples were characterized for TGFβRI/II expressions by immunohistochemistry. In 33 dogs with OS, plasma TGFβ1 concentrations were quantified and correlated with bone resorption. Canine OS cells secrete TGFβ1, express cognate receptors, and TGFβ1 signaling blockade decreases proliferation, migration, and vascular endothelial growth factor secretion. Naturally occurring OS samples abundantly and uniformly express TGFβRI/II, and in OS-bearing dogs, circulating TGFβ1 concentrations correlate with urine N-telopeptide excretion. Canine OS cells possess TGFβ1 signaling machinery, potentially allowing for the establishment of an autocrine and paracrine pro-tumorigenic signaling loop. As such, TGFβ1 inhibitors might impede localized OS progression in dogs. Copyright © 2014 by the American College of Veterinary Internal Medicine.

Does vitamin E-blended polyethylene reduce wear in primary total hip arthroplasty: a blinded randomised clinical trial.

PubMed

Scemama, Caroline; Anract, Philippe; Dumaine, Valérie; Babinet, Antoine; Courpied, Jean Pierre; Hamadouche, Moussa

2017-06-01

Some data indicate that first-generation highly cross-linked polyethylene (HXLPE) can oxidise in vivo and is associated with reduced mechanical properties. To overcome these limitations, a natural anti-oxidant vitamin E has been added to HXLPE to preserve the mechanical properties and decrease oxidative degradation whilst conserving high wear resistance. We hypothesised that after a minimal three years of follow-up the use of vitamin E-blended HXLPE would result in lower radiographic wear when compared with ultra-high molecular weight polyethylene (UHMWPE). One hundred patients were randomised to receive hybrid total hip arthroplasty (THA) using a monoblock cementless acetabular component made either of UHMWPE or vitamin E-blended HXLPE. All other parameters were identical in both groups. Complete follow-up was available for 74 of these patients. Femoral head penetration was measured using a validated computer-assisted method. The median creep measured 0.111 mm (range, -0.576 - +0.444 mm) in the vitamin E-blended group versus 0.170 mm (range, -0.861 - +0.884 mm) in the UHMWPE group (difference of medians, 0.059; p = 0.046). The median steady state penetration rate was -0.008 mm/year (range, -0.88 - +0.64 mm/year) in the vitamin E-blended group versus 0.133 mm/year (range, -0.84 - +0.85 mm/year) in the UHMWPE group (difference of medians 0.141, p = 0.043). This study demonstrated that femoral head penetration was lower when using vitamin E-blended HXLPE when compared with UHMWPE, with a steady-state penetration rate far below the osteolysis threshold. Longer-term follow-up is needed to warrant whether wear reduction will generate less occurrence of osteolysis and aseptic loosening.

Proximal femoral osteosarcoma: Diagnostic challenges translate into delayed and inappropriate management.

PubMed

Dahan, M; Anract, P; Babinet, A; Larousserie, F; Biau, D

2017-11-01

The proximal femuris is an uncommon site of osteosarcoma. The unusual manifestations at this site may lead to diagnostic and therapeutic mistakes. We therefore performed a retrospective study to estimate the proportions of patients with imaging study findings and/or clinical manifestations typical for osteosarcoma and/or inappropriate treatment decisions. Proximal femoral osteosarcoma often produces atypical clinical and radiological presentations. Consecutive patients who underwent surgery at our center to treat proximal femoral osteosarcoma were included. For each patient, we collected the epidemiological characteristics, clinical symptoms, imaging study findings, treatment, and tumor outcome. Proportions were computed with their confidence intervals. Twelve patients had surgery for proximal femoral osteosarcoma between 1986 and 2015. Imaging findings were typical in 1 (8%) patient; they consisted of ill-defined osteolysis in 11/12 (92%) patients, a periosteal reaction in 1/12 (8%) patient, soft tissue involvement in 7/12 (58%) patients, and immature osteoid matrix in 11/12 (92%) patients. No patient had the typical combination of pain with a soft tissue swelling. Management was inappropriate in 2/12 (17%) patients, who did not undergo all the recommended imaging studies before surgery and were treated in another center before the correct diagnosis was established. At last follow-up, 4 patients had died (after a mean of 7 years) and 8 were alive (after a mean of 4 years). Proximal femoral osteosarcoma is uncommon and rarely produces the typical clinical and imaging study findings. The atypical presentation often results in diagnostic errors and inappropriate treatments. Ill-defined osteolysis on standard radiographs should prompt computed tomography or magnetic resonance imaging of the proximal femur. Treatment in a specialized center is imperative. IV, retrospective study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Cystic fibrous dysplasia in the long bone.

PubMed

Bahk, Won-Jong; Kang, Yong-Koo; Rhee, Seung-Koo; Chung, Yang-Guk; Lee, An-Hee; Bahk, Yong-Whee

2007-10-01

Prominent osteolysis associated with "ground glass" density of fibrous dysplasia may indicate cystic change or sarcomatous transformation. This complication has been reported only sporadically in the long bones. This article presents clinical, radiographic, and pathologic findings, and outcome of simple curettage and bone graft observed in a series of 8 patients with prominent cystic fibrous dysplasia of the long bone. Magnetic resonance imaging features provide a basis for separation of benign cystic change from malignant transformation. However, biopsy is necessary to distinguish nonspecific cystic degeneration from secondary aneurysmal bone cyst. Simple curettage with allo-chip-bone graft is an effective treatment for cystic fibrous dysplasia.

Shoulder Acromioclavicular and Coracoclavicular Ligament Injuries: Common Problems and Solutions.

PubMed

Wylie, James D; Johnson, Jeremiah D; DiVenere, Jessica; Mazzocca, Augustus D

2018-04-01

Injuries to the acromioclavicular joint and coracoclavicular ligaments are common. Many of these injuries heal with nonoperative management. However, more severe injuries may lead to continued pain and shoulder dysfunction. In these patients, surgical techniques have been described to reconstruct the function of the coracoclavicular ligaments to provide stable relationship between the clavicle and scapula. These surgeries have been fraught with high complication rates including clavicle and coracoid fractures, infection, loss of reduction and fixation, hardware migration, and osteolysis. This article reviews common acromioclavicular and coracoclavicular repair and reconstruction techniques and associated complications, and provides recommendations for prevention and management. Copyright © 2018 Elsevier Inc. All rights reserved.

Endocrine causes of calcium disorders.

PubMed

Greco, Deborah S

2012-11-01

Endocrine diseases that may cause hypercalcemia and hypocalcemia include hyperparathyroidism, hypoparathyroidism, thyroid disorders, hyperadrenocorticism, hypoadrenocorticism, and less commonly pheochromocytoma and multiple endocrine neoplasias. The differential diagnosis of hypercalcemia may include malignancy (lymphoma, anal sac carcinoma, and squamous cell carcinoma), hyperparathyroidism, vitamin D intoxication, chronic renal disease, hypoadrenocorticism, granulomatous disorders, osteolysis, or spurious causes. Hypocalcemia may be caused by puerperal tetany, pancreatitis, intestinal malabsorption, ethlyene glycol intoxication, acute renal failure, hypopararthyroidism, hypovitaminosis D, hypomagnesemia, and low albumin. This article focuses on the endocrine causes of calcium imbalance and provides diagnostic and therapeutic guidelines for identifying the cause of hypercalcemia and hypocalcemia in veterinary patients. Copyright © 2012 Elsevier Inc. All rights reserved.

[Local foreign body reactions to biodegradable implants. A classification].

PubMed

Hoffmann, R; Weller, A; Helling, H J; Krettek, C; Rehm, K E

1997-08-01

Biodegradable implants are increasingly used in orthopedic and trauma surgery. Many different implants consisting of different biodegradable polymers are currently available. Different factors contribute to the biocompatibility of these implants, and local foreign-body reactions remain a matter of concern. Therefore, it is mandatory to document and compare the tissue reactions caused by various biodegradable implants in experimental or clinical studies. We have developed a standardized system of classification based on our previous experimental and clinical observations. Foreign-body reactions are differentiated into osteolysis (0-0 to 0-4), extra-articular (EA-0 to EA-4) and intraarticular (IA-0 to A-4) soft-tissue reactions.

Pilot Study of Bovine Interdigital Cassetteless Computed Radiography

PubMed Central

EL-SHAFAEY, El-Sayed Ahmed Awad; AOKI, Takahiro; ISHII, Mitsuo; YAMADA, Kazutaka

2013-01-01

ABSTRACT Twenty-one limbs of bovine cadavers (42 digits) were exposed to interdigital cassetteless imaging plate using computed radiography. The radiographic findings included exostosis, a rough planta surface, osteolysis of the apex of the distal phalanx and widening of the laminar zone between the distal phalanx and the hoof wall. All these findings were confirmed by computed tomography. The hindlimbs (19 digits) showed more changes than the forelimbs (10 digits), particularly in the lateral distal phalanx. The cassetteless computed radiography technique is expected to be an easily applicable method for the distal phalanx rather than a conventional cassette-plate and/or the film-screen cassetteless methods. PMID:23782542

Minimum ten-year results of primary bipolar hip arthroplasty for degenerative arthritis of the hip.

PubMed

Pellegrini, Vincent D; Heiges, Bradley A; Bixler, Brian; Lehman, Erik B; Davis, Charles M

2006-08-01

Bipolar hip arthroplasty has been advocated by some as an alternative to total hip arthroplasty for the treatment of degenerative arthritis of the hip. We sought to assess the results of this procedure at our institution after a minimum duration of follow-up of ten years. We retrospectively reviewed a consecutive series of 152 patients (173 hips) who underwent primary bipolar hemiarthroplasty for the treatment of symptomatic degenerative arthritis of the hip with a cementless femoral component between 1983 and 1987. Of the original cohort of 152 patients, ninety-two patients (104 hips) were available for clinical and radiographic review at a mean of 12.2 years postoperatively. At the time of the latest follow-up, self-administered Harris hip questionnaires were used to assess pain, mobility, activity level, and overall satisfaction with the procedure. Biplanar hip radiographs were made to evaluate bipolar shell migration, osteolysis, and femoral stem fixation. At the time of the latest follow-up, nineteen patients (nineteen hips) had undergone revision to total hip arthroplasty because of mechanical failure, and three patients (three hips) were awaiting revision because of symptomatic radiographic mechanical failure. Twelve acetabular revisions were performed or scheduled for the treatment of pelvic osteolysis or protrusio acetabuli secondary to component migration. Acetabular reconstruction required bone-grafting, an oversized shell, and/or a pelvic reconstruction ring. The overall rate of mechanical failure was 21.2% (twenty-two of 104 hips), with 91% (twenty) of the twenty-two failures involving the acetabular component. Reaming of the acetabulum at the time of the index arthroplasty was associated with a 6.4-fold greater risk of revision. The rate of implant survival, with revision because of mechanical failure as the end point, was 94.2% for femoral components and 80.8% for acetabular components at a mean of 12.2 years. Of the remaining sixty-nine patients (eighty-one hips) in whom the original prosthesis was retained, seventeen patients (24.6%) rated the pain as moderate to severe. Nearly 30% of patients with an intact prosthesis required analgesics on a regular basis. Radiographs were available for fifty-eight hips (including all of the hips with moderate to severe pain) after a minimum duration of follow-up of ten years; twenty-eight of these fifty-eight hips had radiographic evidence of acetabular component migration. This bipolar cup, when used for hemiarthroplasty in patients with symptomatic arthritis of the hip, was associated with unacceptably high rates of pain, migration, osteolysis, and the need for revision to total hip arthroplasty, especially when the acetabulum had been reamed. To the extent that these findings can be generalized to similar implant designs with conventional polyethylene, we do not recommend bipolar hemiarthroplasty as the primary operative treatment for degenerative arthritis of the hip.

How Does Wear Rate Compare in Well-functioning Total Hip and Knee Replacements? A Postmortem Polyethylene Liner Study.

PubMed

Pourzal, Robin; Knowlton, Christopher B; Hall, Deborah J; Laurent, Michel P; Urban, Robert M; Wimmer, Markus A

2016-08-01

The longevity of total hip (THR) and knee replacements (TKR) that used historical bearing materials of gamma-in-air sterilized UHMWPE was affected more by osteolysis in THRs than in TKRs, although osteolysis remains a concern in TKRs. Therefore, the study of polyethylene wear is still of interest for the knee, particularly because few studies have investigated volumetric material loss in tibial knee inserts. For this study, a unique collection of autopsy-retrieved TKR and THR components that were well-functioning at the time of retrieval was used to compare volumetric wear differences between hip and knee polyethylene components made from identical material. The following questions were addressed: (1) How much did the hip liners wear and what wear patterns did they exhibit? (2) How much did the knee inserts wear and what wear patterns did they exhibit? (3) What is the ratio between TKR and THR wear after controlling for implantation time and patient age? We compared 23 THR components (Harris-Galante [HG] and HG II) and 20 TKR components (Miller-Galante [MG II]) that were retrieved postmortem. The components were made from the same polyethylene formulation and with similar manufacturing and sterilization (gamma-in-air) processes. Twenty-one patients (12 males, nine females) had THRs and 16 (four males, 12 females) had TKRs. Patients who had TKRs had an older (p = 0.001) average age than patients who had THRs (age, 75 years; SD, 10, versus 66 years; SD, 12, respectively). Only well-functioning components were included in this study. Therefore, implants retrieved postmortem from physically active patients and implanted for at least 2 years were considered. In addition, only normally wearing TKR components were considered, ie, those with fatigue wear (delamination) were excluded. The wear volume of each component was measured using metrology. For the tibial inserts an autonomous mathematic reconstruction method was used for quantification. The acetabular liners of the THR group had a wear rate of 38 mm(3) per year (95% CI, 29-47 mm(3)/year). Excluding patients with low-activity, the wear rate was 47 mm(3) per year (95% CI, 37-56 mm(3)/year). The wear rate of normally wearing tibial inserts was 17 mm(3) per year (95% CI, -6 to 40 mm(3)/year). After controlling for the relevant confounding variable of age, we found a TKR/THR wear rate ratio of 0.5 (95% CI, 0.29-0.77) at 70 years of age with a slightly increasing difference with increasing age. Excluding delamination, TKRs exhibited lower articular wear rates than THRs for historical polyethylene in these two unique cohorts of postmortem retrievals. The lower TKR wear rate is in line with the lower incidence of osteolysis in TKRs compared with THRs.

Single absorbable polydioxanone pin fixation for distal chevron bunion osteotomies.

PubMed

Deorio, J K; Ware, A W

2001-10-01

The distal chevron osteotomy is a well-established technique for correction of symptomatic mild to moderate metatarsus primus varus with hallux valgus deformity. Fixation of the osteotomy ranges from none to bone pegs, Kirschner wires, screws, or absorbable pins. We evaluated one surgeon's (J.K.D.) results of distal chevron osteotomy fixation with a single, nonpredrilled, 1.3-mm poly-p-dioxanone pin and analyzed any differences in patients with unilateral or bilateral symptomatic metatarsus primus varus with hallux valgus deformities. All osteotomies healed without evidence of infection, osteolysis, nonunion, or necrosis. Equal correction was achieved in unilateral and bilateral procedures. The technique is quick and easy, and adequate fixation is achieved.

Prostaglandin PGE2: a possible mechanism for bone destruction in calcinosis circumscripta.

PubMed

Caniggia, A; Gennari, C; Vattimo, A; Runci, F; Bombardieri, S

1978-02-28

A patient showed evident osteolysis in phalanges and heavy periarticular calcium deposits of the fingers, wrists and toes which avidly took up 47Ca. The dense, white, tooth-paste like fluid contained in the periarticular calcium deposits has been studied by two different X-ray diffraction methods, by Ubatuba's bioassay for prostaglandin, by thin layer chromatography and by mass spectrometry. The calcium deposits were hydroxyapatite and prostaglandin PGE2 was detected in them. The bone resorption stimulating activity of PGE2 would be expected to result in increased bone destruction with release of calcium salts and this could be a working hypothesis of the pathogenesis of calcinosis circumscripta.

Osteolysis of the clavicle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahmad, A.

1988-12-02

A letter to the editor and reply from the author are presented dealing with a radiology case-of-the-month. The superficial location of the clavicle makes it more prone to radiation effects only if low-energy roentgen rays or an electron beam is used. Since the case history does not describe the equipment used. The letter writer was not certain if the superficial location of the clavicle was a factor. If high-energy roentgen rays are used, the superficial location of the clavicle was a factor. If high-energy roentgen rays are used, the superficial location of the clavicle is advantageous since it will absorbmore » a lesser dose compared with the deeper tissues.« less

Lactation-Induced Changes in the Volume of Osteocyte Lacunar-Canalicular Space Alter Mechanical Properties in Cortical Bone Tissue.

PubMed

Kaya, Serra; Basta-Pljakic, Jelena; Seref-Ferlengez, Zeynep; Majeska, Robert J; Cardoso, Luis; Bromage, Timothy G; Zhang, Qihong; Flach, Carol R; Mendelsohn, Richard; Yakar, Shoshana; Fritton, Susannah P; Schaffler, Mitchell B

2017-04-01

Osteocytes can remove and remodel small amounts of their surrounding bone matrix through osteocytic osteolysis, which results in increased volume occupied by lacunar and canalicular space (LCS). It is well established that cortical bone stiffness and strength are strongly and inversely correlated with vascular porosity, but whether changes in LCS volume caused by osteocytic osteolysis are large enough to affect bone mechanical properties is not known. In the current studies we tested the hypotheses that (1) lactation and postlactation recovery in mice alter the elastic modulus of bone tissue, and (2) such local changes in mechanical properties are related predominantly to alterations in lacunar and canalicular volume rather than bone matrix composition. Mechanical testing was performed using microindentation to measure modulus in regions containing solely osteocytes and no vascular porosity. Lactation caused a significant (∼13%) reduction in bone tissue-level elastic modulus (p < 0.001). After 1 week postweaning (recovery), bone modulus levels returned to control levels and did not change further after 4 weeks of recovery. LCS porosity tracked inversely with changes in cortical bone modulus. Lacunar and canalicular void space increased 7% and 15% with lactation, respectively (p < 0.05), then returned to control levels at 1 week after weaning. Neither bone mineralization (assessed by high-resolution backscattered scanning electron microscopy) nor mineral/matrix ratio or crystallinity (assessed by Raman microspectroscopy) changed with lactation. Thus, changes in bone mechanical properties induced by lactation and recovery appear to depend predominantly on changes in osteocyte LCS dimensions. Moreover, this study demonstrates that tissue-level cortical bone mechanical properties are rapidly and reversibly modulated by osteocytes in response to physiological challenge. These data point to a hitherto unappreciated role for osteocytes in modulating and maintaining local bone mechanical properties. © 2016 American Society for Bone and Mineral Research. © 2016 American Society for Bone and Mineral Research.

Primary cementless total hip arthroplasty with second-generation metal-on-metal bearings: a concise follow-up, at a minimum of seventeen years, of a previous report.

PubMed

Lass, R; Grübl, A; Kolb, A; Domayer, S; Csuk, C; Kubista, B; Giurea, A; Windhager, R

2014-03-05

Second-generation, metal-on-metal bearings were introduced in 1988, to reduce wear and avoid polyethylene particle-induced osteolysis from total hip arthroplasty. In 2007, we reported the long-term results of ninety-eight patients (105 hips) who underwent primary cementless total hip arthroplasty involving the use of a prosthesis with a high-carbide-concentration, metal-on-metal articulating surface between November 1992 and May 1994. The present study gives an update on this patient cohort. At a minimum of seventeen years postoperatively, forty-nine patients (fifty-two hips) were available for follow-up examination. We retrospectively evaluated clinical and radiographic results as well as serum metal concentration. The mean patient age at the time of the index arthroplasty was fifty-six years. Three cups (6% of the hips) and one stem (2% of the hips) were revised because of aseptic loosening of the implants combined with focal osteolysis. At the time of the latest follow-up evaluation, the mean Harris hip score was 88.8 points, and the mean University of California Los Angeles (UCLA) activity score was 6.7 points. The cumulative rate of implant survival, with aseptic failure as the end point, was 93.0% at 18.8 years. The median serum cobalt concentration in patients whose hip implant was the only source of cobalt was 0.70 μg/L (range, 0.4 to 5.1 μg/L), showing no increase in the value as noted at a minimum of ten years of follow-up. The clinical and radiographic results of our study, which, to our knowledge, represent the longest duration of follow-up for a series of cementless total hip arthroplasties with use of a 28-mm metal-on-metal bearing, continue to be comparable with the results observed for other hard-on-hard bearings.

Periprosthetic osteolysis after AES total ankle replacement: Conventional radiography versus CT-scan.

PubMed

Viste, Anthony; Al Zahrani, Nader; Brito, Nuno; Lienhart, Christophe; Fessy, Michel Henri; Besse, Jean-Luc

2015-09-01

The aim of this study was to compare conventional X-rays and CT-scan in detecting peri-prosthetic osteolytic lesions, a major concern after total ankle replacement (TAR). We prospectively assessed 50 patients (mean age 56 years), consecutively operated on by the same senior surgeon, between 2003 and 2006 and with a mean follow-up period of 4 years (range, 2-6.2). The component used was AES total ankle replacement. The etiologies for total ankle arthroplasty were: posttraumatic in 50%, osteoarthritis secondary to instability in 36%. Plain radiographs were analyzed by 4 independent observers, using a 10-zone protocol (location) and 5 size categories. At 4-year follow-up, all patients had been CT-scan assessed with the same protocol by 2 independent observers. Plain radiographs showed dramatic progression of severe periprosthetic lyses (>10mm): from 14% to 36% of interface cysts for the tibial component respectively at 2 and 4-year follow-up and from 4% to 30% for the talar implant. The talar component was more accurately assessed by CT-scan (mean frontal and sagittal talar lesion: from 270 mm2 to 288 mm2 for CT-scan versus 133 mm2 to 174 mm2 for X-rays). For tibial cysts, axial views showed larger lesions (313 mm2 than frontal (194 mm2) or sagittal (213.5 mm2) views. At 4-year follow-up, 24% of patients had revision with curetage or arthrodesis, and at 7 years follow-up 38% were revised. These results are similar to recent AES series, justifying withdrawal of this device. CT-scan was more accurate than X-rays for detecting and quantifying periprosthetic osteolysis. We recommend a yearly radiological control and CT-scan in case of lesion on X-rays. Copyright © 2014 European Foot and Ankle Society. Published by Elsevier Ltd. All rights reserved.

Lymphatic Endothelial Cells Produce M-CSF, Causing Massive Bone Loss in Mice.

PubMed

Wang, Wensheng; Wang, Hua; Zhou, Xichao; Li, Xing; Sun, Wen; Dellinger, Michael; Boyce, Brendan F; Xing, Lianping

2017-05-01

Gorham-Stout disease (GSD) is a rare bone disorder characterized by aggressive osteolysis associated with lymphatic vessel invasion within bone marrow cavities. The etiology of GSD is not known, and there is no effective therapy or animal model for the disease. Here, we investigated if lymphatic endothelial cells (LECs) affect osteoclasts (OCs) to cause a GSD osteolytic phenotype in mice. We examined the effect of a mouse LEC line on osteoclastogenesis in co-cultures. LECs significantly increased receptor activator of NF-κB ligand (RANKL)-mediated OC formation and bone resorption. LECs expressed high levels of macrophage colony-stimulating factor (M-CSF), but not RANKL, interleukin-6 (IL-6), and tumor necrosis factor (TNF). LEC-mediated OC formation and bone resorption were blocked by an M-CSF neutralizing antibody or Ki20227, an inhibitor of the M-CSF receptor, c-Fms. We injected LECs into the tibias of wild-type (WT) mice and observed massive osteolysis on X-ray and micro-CT scans. Histology showed that LEC-injected tibias had significant trabecular and cortical bone loss and increased OC numbers. M-CSF protein levels were significantly higher in serum and bone marrow plasma of mice given intra-tibial LEC injections. Immunofluorescence staining showed extensive replacement of bone and marrow by podoplanin+ LECs. Treatment of LEC-injected mice with Ki20227 significantly decreased tibial bone destruction. In addition, lymphatic vessels in a GSD bone sample were stained positively for M-CSF. Thus, LECs cause bone destruction in vivo in mice by secreting M-CSF, which promotes OC formation and activation. Blocking M-CSF signaling may represent a new therapeutic approach for treatment of patients with GSD. Furthermore, tibial injection of LECs is a useful mouse model to study GSD. © 2017 American Society for Bone and Mineral Research. © 2017 American Society for Bone and Mineral Research.

Are periprosthetic tissue reactions observed after revision of total disc replacement comparable to the reactions observed after total hip or knee revision surgery?

PubMed Central

Punt, Ilona M.; Austen, Shennah; Cleutjens, Jack P.M.; Kurtz, Steven M.; ten Broeke, René H.M.; van Rhijn, Lodewijk W.; Willems, Paul C.; van Ooij, André

2011-01-01

Study design Comparative study. Objective To compare periprosthetic tissue reactions observed after total disc replacement (TDR), total hip arthroplasty (THA) and total knee arthroplasty (TKA) revision surgery. Summary of background data Prosthetic wear debris leading to particle disease, followed by osteolysis, is often observed after THA and TKA. Although the presence of polyethylene (PE) particles and periprosthetic inflammation after TDR has been proven recently, osteolysis is rarely observed. The clinical relevance of PE wear debris in the spine remains poorly understood. Methods Number, size and shape of PE particles, as well as quantity and type of inflammatory cells in periprosthetic tissue retrieved during Charité TDR (n=22), THA (n=10) and TKA (n=4) revision surgery were compared. Tissue samples were stained with hematoxylin/eosin and examined by using light microscopy with bright field and polarized light. Results After THA, large numbers of PE particles <6 µm were observed, which were mainly phagocytosed by macrophages. The TKA group had a broad size range with many larger PE particles and more giant cells. In TDR, the size range was similar to that observed in TKA. However, the smallest particles were the most prevalent with 75% of the particles being <6 µm, as seen in revision THA. In TDR, both macrophages and giant cells were present with a higher number of macrophages. Conclusions Both small and large PE particles are present after TDR revision surgery compatible with both THA and TKA wear patterns. The similarities between periprosthetic tissue reactions in the different groups may give more insight in the clinical relevance of PE particles and inflammatory cells in the lumbar spine. The current findings may help to improve TDR design as applied from technologies previously developed in THA and TKA with the goal of a longer survival of TDR. PMID:21336235

The effect of TNFα secreted from macrophages activated by titanium particles on osteogenic activity regulated by WNT/BMP signaling in osteoprogenitor cells.

PubMed

Lee, Sang-Soo; Sharma, Ashish R; Choi, Byung-Soo; Jung, Jun-Sub; Chang, Jun-Dong; Park, Seonghun; Salvati, Eduardo A; Purdue, Edward P; Song, Dong-Keun; Nam, Ju-Suk

2012-06-01

Wear particles are the major cause of osteolysis associated with failure of implant following total joint replacement. During this pathologic process, activated macrophages mediate inflammatory responses to increase osteoclastogenesis, leading to enhanced bone resorption. In osteolysis caused by wear particles, osteoprogenitors present along with macrophages at the implant interface may play significant roles in bone regeneration and implant osteointegration. Although the direct effects of wear particles on osteoblasts have been addressed recently, the role of activated macrophages in regulation of osteogenic activity of osteoblasts has scarcely been studied. In the present study, we examined the molecular communication between macrophages and osteoprogenitor cells that may explain the effect of wear particles on impaired bone forming activity in inflammatory bone diseases. It has been demonstrated that conditioned medium of macrophages challenged with titanium particles (Ti CM) suppresses early and late differentiation markers of osteoprogenitors, including alkaline phosphatase (ALP) activity, collagen synthesis, matrix mineralization and expression of osteocalcin and Runx2. Moreover, bone forming signals such as WNT and BMP signaling pathways were inhibited by Ti CM. Interestingly, TNFα was identified as a predominant factor in Ti CM to suppress osteogenic activity as well as WNT and BMP signaling activity. Furthermore, Ti CM or TNFα induces the expression of sclerostin (SOST) which is able to inhibit WNT and BMP signaling pathways. It was determined that over-expression of SOST suppressed ALP activity, whereas the inhibition of SOST by siRNA partially restored the effect of Ti CM on ALP activity. This study highlights the role of activated macrophages in regulation of impaired osteogenic activity seen in inflammatory conditions and provides a potential mechanism for autocrine regulation of WNT and BMP signaling mediated by TNFα via induction of SOST in osteprogenitor cells. Copyright © 2012 Elsevier Ltd. All rights reserved.

Optical 3D methods for measurement of prosthetic wear of total hip arthroplasty: principles, verification and results.

PubMed

Rossler, Tomas; Mandat, Dusan; Gallo, Jiri; Hrabovsky, Miroslav; Pochmon, Michal; Havranek, Vitezslav

2009-07-20

Total hip arthroplasty (THA) significantly improves the quality of life in majority of patients with severe osteoarthritis. However, long-term outcomes of THAs are compromised by aseptic loosening and periprosthetic osteolysis which needs revision surgery. Both of these are causally linked to a prosthetic wear deliberated from the prosthetic articulating surfaces. As a result, there is a need to measure the mode and magnitude of wear. The paper evaluates three optical methods proposed for construction of a device for the non-contact prosthetic wear measurement. Of them, the scanning profilometry achieved promising combination of accuracy and repeatability. Simultaneously, it is time efficient to enable the development of a sensor for wear measurement.

Appearance of osteolysis with melorheostosis: redefining the disease or a new disorder? A novel case report with multimodality imaging.

PubMed

Osher, Lawrence S; Blazer, Marie Mantini; Bumpus, Kelly

2013-01-01

We present a case report of melorheostosis with the novel radiographic finding of underlying cortical resorption. A number of radiographic patterns of melorheostosis have been described; however, the combination of new bone formation and resorption of the original cortex appears unique. Although the presence of underlying lysis has been postulated in published studies, direct radiographic evidence of bony resorption in melorheostosis has not been reported. These findings can be subtle and might go unnoticed using standard imaging. An in-depth review of the radiographic features is presented, including multimodality imaging with magnetic resonance imaging and computed tomography. Copyright © 2013 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Beneficial silver: antibacterial nanocomposite Ag-DLC coating to reduce osteolysis of orthopaedic implants

NASA Astrophysics Data System (ADS)

Endrino, J. L.; Sánchez-López, J. C.; Escobar Galindo, R.; Horwat, D.; Anders, A.

2010-11-01

Silver-containing diamond-like-carbon (DLC) is a promising material for biomedical implants due to its excellent combination of antibacterial and mechanical properties. In this work, a dual-cathode pulsed filtered cathodic arc source containing silver and graphite rods was employed in order to obtain DLC samples with various silver contents. Chemical composition of the samples was analyzed by acquiring their compositional depth-profiles using radio-frequency Glow Discharge Optical Emission Spectroscopy (rf-GDOES), while the microstructural properties were analyzed by X-ray diffraction and Raman spectroscopy. Tribological studies carried out against UHMWPE balls in fetal bovine serum indicate that the presence of silver in DLC could be beneficial to reduce the wear of the polymeric surfaces.

A critical assessment of proximal macrotexturing on cemented femoral components.

PubMed

Duffy, G P; Muratoglu, O K; Biggs, S A; Larson, S L; Lozynsky, A J; Harris, W H

2001-12-01

We analyzed the cement-metal interface of 3 different types of femoral components that had proximal macrotexturing after in vitro insertion and after fatigue testing designed to produce debonding and micromotion. These components were compared with clinical retrieval specimens. The cement did not flow into the macrotexturing; rather, hollow, brittle volcanoes or calderas were formed. These fragile protrusions of cement become worn down or abraded by debonded components. This abrasion of cement may contribute to the early and aggressive osteolysis seen in some of these early failures with proximal macrotextured components. The formation of these volcanos and calderas can be aborted by placing bone-cement onto the macrotexturing before stem insertion. This simple technique allows the macrotexturing to be filled with cement.

Radiographic methods of wear analysis in total hip arthroplasty.

PubMed

Rahman, Luthfur; Cobb, Justin; Muirhead-Allwood, Sarah

2012-12-01

Polyethylene wear is an important factor in failure of total hip arthroplasty (THA). With increasing numbers of THAs being performed worldwide, particularly in younger patients, the burden of failure and revision arthroplasty is increasing, as well, along with associated costs and workload. Various radiographic methods of measuring polyethylene wear have been developed to assist in deciding when to monitor patients more closely and when to consider revision surgery. Radiographic methods that have been developed to measure polyethylene wear include manual and computer-assisted plain radiography, two- and three-dimensional techniques, and radiostereometric analysis. Some of these methods are important in both clinical and research settings. CT has the potential to provide additional information on component orientation and enables assessment of periprosthetic osteolysis, which is an important consequence of polyethylene wear.

14-year median follow-up using the press-fit condylar sigma design for total knee arthroplasty.

PubMed

Patil, Shantanu S; Branovacki, George; Martin, Mersadies R; Pulido, Pamela A; Levy, Yadin D; Colwell, Clifford W

2013-09-01

Median 14-year follow-up (mean 11.8 years) of a cemented primary posterior cruciate-retaining total knee arthroplasty (TKA) utilizing the Press-Fit Condylar (PFC) Sigma design was evaluated in 77 patients (79 TKA). Follow-up assessment included implant survivorship, x-rays, Knee Society rating system, and clinical evaluation. Radiographic analysis demonstrated minor non-progressive osteolysis in 40% (10/25) knees. Two revisions, one for instability at 4 years and one for polyethylene wear at 10 years were performed. Survivorship of the PFC Sigma knee implant was 97% using revision for any reason and 100% using aseptic loosening as endpoints. The PFC Sigma had excellent survivorship at 14 years, the longest clinical follow-up reported. Copyright © 2013 Elsevier Inc. All rights reserved.

IMAGING DIAGNOSIS: COMPUTED TOMOGRAPHIC FINDINGS IN A CASE OF ADENOSQUAMOUS CARCINOMA OF THE HEAD AND NECK IN A CAT.

PubMed

Chow, Kathleen Ella; Krockenberger, Mark; Collins, David

2016-01-01

A 15-year-old female spayed domestic long-haired cat was referred for trismus, hypersalivation, and bilateral ocular discharge. On examination, the cat showed pain on palpation of the left zygomatic arch, palpable crepitus of the frontal region, and limited retropulsion of both globes. A contrast-enhanced sinonasal computed tomographic study was performed, showing facial distortion and extensive osteolysis of the skull, extending beyond the confines of the sinonasal and paranasal cavities. Additionally, soft tissue and fluid accumulation were observed in the nasal cavities and paranasal sinuses. Postmortem biopsy samples acquired from the calvarium yielded a histologic diagnosis of sinonasal adenosquamous carcinoma, a rare and particularly aggressive neoplasm previously only reported in the esophagus of one cat. © 2015 American College of Veterinary Radiology.

Cement arthroplasty for ankle joint destruction.

PubMed

Lee, Ho-Seong; Ahn, Ji-Yong; Lee, Jong-Seok; Lee, Jun-Young; Jeong, Jae-Jung; Choi, Young Rak

2014-09-03

The aim of this study was to investigate the outcomes of cement arthroplasty used as a primary salvage procedure to treat ankle joint destruction. This study included sixteen patients who underwent primary cement arthroplasty from May 2004 to March 2012 because of an ankle disorder, including intractable infection, nonunion, or a large bone defect or tumor. The mean age of the patients was fifty-seven years (range, twenty-three to seventy-four years), and the mean follow-up period was thirty-nine months (range, fourteen to 100 months). The cement spacer position, cement breakage, osteolysis around the inserted cement, and alignment of the joint were evaluated radiographically. American Orthopaedic Foot & Ankle Society (AOFAS) scores and visual analogue scale (VAS) pain scores were recorded preoperatively and at the time of final follow-up. Functional questionnaires were used to assess the duration for which the patient could walk continuously, use of walking aids, sports activity, consumption of pain medication, and the patient's subjective assessment of the percentage of overall improvement compared with before the cement arthroplasty. The cement spacer was retained without breakage for a mean of thirty-nine months (range, fourteen to 100 months). Osteolysis around the cement was observed in one patient at seventy-eight months, and subluxation developed in one patient. The mean AOFAS and VAS pain scores improved from 39 (range, 11 to 71) preoperatively to 70 (range, 47 to 88) postoperatively (p = 0.001) and from 8 (range, 4 to 9) to 3 (range, 1 to 7) (p = 0.001), respectively. At the final follow-up evaluation, nine of the sixteen patients did not require walking aids, ten used no pain medication, and nine were able to walk continuously for more than an hour. One patient complained of persistent pain and was considered to have had a failure of the procedure. Primary cement arthroplasty might be a treatment option for advanced ankle destruction in elderly and less active patients. Therapeutic Level IV. See Instructions for Authors for a complete description of levels of evidence. Copyright © 2014 by The Journal of Bone and Joint Surgery, Incorporated.

A c-fms tyrosine kinase inhibitor, Ki20227, suppresses osteoclast differentiation and osteolytic bone destruction in a bone metastasis model.

PubMed

Ohno, Hiroaki; Kubo, Kazuo; Murooka, Hideko; Kobayashi, Yoshiko; Nishitoba, Tsuyoshi; Shibuya, Masabumi; Yoneda, Toshiyuki; Isoe, Toshiyuki

2006-11-01

In bone metastatic lesions, osteoclasts play a key role in the development of osteolysis. Previous studies have shown that macrophage colony-stimulating factor (M-CSF) is important for the differentiation of osteoclasts. In this study, we investigated whether an inhibitor of M-CSF receptor (c-Fms) suppresses osteoclast-dependent osteolysis in bone metastatic lesions. We developed small molecule inhibitors against ligand-dependent phosphorylation of c-Fms and examined the effects of these compounds on osteolytic bone destruction in a bone metastasis model. We discovered a novel quinoline-urea derivative, Ki20227 (N-{4-[(6,7-dimethoxy-4-quinolyl)oxy]-2-methoxyphenyl}-N'-[1-(1,3-thiazole-2-yl)ethyl]urea), which is a c-Fms tyrosine kinase inhibitor. The IC(50)s of Ki20227 to inhibit c-Fms, vascular endothelial growth factor receptor-2 (KDR), stem cell factor receptor (c-Kit), and platelet-derived growth factor receptor beta were found to be 2, 12, 451, and 217 nmol/L, respectively. Ki20227 did not inhibit other kinases tested, such as fms-like tyrosine kinase-3, epidermal growth factor receptor, or c-Src (c-src proto-oncogene product). Ki20227 was also found to inhibit the M-CSF-dependent growth of M-NFS-60 cells but not the M-CSF-independent growth of A375 human melanoma cells in vitro. Furthermore, in an osteoclast-like cell formation assay using mouse bone marrow cells, Ki20227 inhibited the development of tartrate-resistant acid phosphatase-positive osteoclast-like cells in a dose-dependent manner. In in vivo studies, oral administration of Ki20227 suppressed osteoclast-like cell accumulation and bone resorption induced by metastatic tumor cells in nude rats following intracardiac injection of A375 cells. Moreover, Ki20227 decreased the number of tartrate-resistant acid phosphatase-positive osteoclast-like cells on bone surfaces in ovariectomized (ovx) rats. These findings suggest that Ki20227 inhibits osteolytic bone destruction through the suppression of M-CSF-induced osteoclast accumulation in vivo. Therefore, Ki20227 may be a useful therapeutic agent for osteolytic disease associated with bone metastasis and other bone diseases.

Cobalt Alloy Implant Debris Induces Inflammation and Bone Loss Primarily through Danger Signaling, Not TLR4 Activation: Implications for DAMP-ening Implant Related Inflammation

PubMed Central

Samelko, Lauryn; Landgraeber, Stefan; McAllister, Kyron; Jacobs, Joshua; Hallab, Nadim James

2016-01-01

Cobalt alloy debris has been implicated as causative in the early failure of some designs of current total joint implants. The ability of implant debris to cause excessive inflammation via danger signaling (NLRP3 inflammasome) vs. pathogen associated pattern recognition receptors (e.g. Toll-like receptors; TLRs) remains controversial. Recently, specific non-conserved histidines on human TLR4 have been shown activated by cobalt and nickel ions in solution. However, whether this TLR activation is directly or indirectly an effect of metals or secondary endogenous alarmins (danger-associated molecular patterns, DAMPs) elicited by danger signaling, remains unknown and contentious. Our study indicates that in both a human macrophage cell line (THP-1) and primary human macrophages, as well as an in vivo murine model of inflammatory osteolysis, that Cobalt-alloy particle induced NLRP3 inflammasome danger signaling inflammatory responses were highly dominant relative to TLR4 activation, as measured respectively by IL-1β or TNF-α, IL-6, IL-10, tissue histology and quantitative bone loss measurement. Despite the lack of metal binding histidines H456 and H458 in murine TLR4, murine calvaria challenge with Cobalt alloy particles induced significant macrophage driven in vivo inflammation and bone loss inflammatory osteolysis, whereas LPS calvaria challenge alone did not. Additionally, no significant increase (p<0.05) in inflammation and inflammatory bone loss by LPS co-challenge with Cobalt vs. Cobalt alone was evident, even at high levels of LPS (i.e. levels commiserate with hematogenous levels in fatal sepsis, >500pg/mL). Therefore, not only do the results of this investigation support Cobalt alloy danger signaling induced inflammation, but under normal homeostasis low levels of hematogenous PAMPs (<2pg/mL) from Gram-negative bacteria, seem to have negligible contribution to the danger signaling responses elicited by Cobalt alloy metal implant debris. This suggests the unique nature of Cobalt alloy particle bioreactivity is strong enough to illicit danger signaling that secondarily activate concomitant TLR activation, and may in part explain Cobalt particulate associated inflammatory and toxicity-like reactions of specific orthopedic implants. PMID:27467577

Complex single step skull reconstruction in Gorham's disease - a technical report and review of the literature.

PubMed

Ohla, Victoria; Bayoumi, Ahmed B; Hefty, Markus; Anderson, Matthew; Kasper, Ekkehard M

2015-03-11

Gorham's disease is a rare osteolytic disorder characterized by progressive resorption of bone and replacement of osseous matrix by a proliferative non-neoplastic vascular or lymphatic tissue. A standardized treatment protocol has not yet been defined due to the unpredictable natural history of the disease and variable clinical presentations. No single treatment has proven to be superior in arresting the course of the disease. Trials have included surgery, radiation and medical therapies using drugs such as calcium salts, vitamin D supplements and hormones. We report on our advantageous experience in the management of this osteolyic disorder in a case when it affected only the skull vault. A brief review of pertinent literature about Gorham's disease with skull involvement is provided. A 25-year-old Caucasian male presented with a skull depression over the left fronto-temporal region. He noticed progressive enlargement of the skull defect associated with local pain and mild headache. Physical examination revealed a tender palpable depression of the fronto-temporal convexity. Conventional X-ray of the skull showed widespread loss of bone substance. Subsequent CT scans showed features of patchy erosions indicative of an underlying osteolysis. MRI also revealed marginal enhancement at the site of the defect. The patient was in need of a pathological diagnosis as well as complex reconstruction of the afflicted area. A density graded CT scan was done to determine the variable degrees of osteolysis and a custom made allograft was designed for cranioplasty preoperatively to allow for a single step excisional craniectomy with synchronous skull repair. Gorham's disease was diagnosed based on histopathological examination. No neurological deficit or wound complications were reported postoperatively. Over a two-year follow up period, the patient had no evidence of local recurrence or other systemic involvement. A single step excisional craniectomy and cranioplasty can be an effective treatment for patients with Gorham's disease affecting the skull vault only. Preoperative planning by a density graded CT aids to design a synthetic bone flap and is beneficial in skull reconstruction. Systemic involvement is variable in this patient's population.

Acetabular revisions using porous tantalum components: A retrospective study with 5-10 years follow-up

PubMed Central

Evola, Francesco Roberto; Costarella, Luciano; Evola, Giuseppe; Barchitta, Martina; Agodi, Antonella; Sessa, Giuseppe

2017-01-01

AIM To evaluate the clinical and X-ray results of acetabular components and tantalum augments in prosthetic hip revisions. METHODS Fifty-eight hip prostheses with primary failure of the acetabular component were reviewed with tantalum implants. The clinical records and X-rays of these cases were retrospectively reviewed. Bone defect evaluations were based on preoperative CT scans and classified according to Paprosky criteria of Radiolucent lines and periprosthetic gaps; implant mobilization and osteolysis were evaluated by X-ray. An ad hoc database was created and statistical analyses were performed with SPSS software (IBM SPSS Statistics for Windows, version 23.0). Statistical analyses were carried out using the Student’s t test for independent and paired samples. A P value of < 0.05 was considered statistically significant and cumulative survival was calculated by the Kaplan-Meier method. RESULTS The mean follow-up was 87.6 ± 25.6 mo (range 3-120 mo). 25 cases (43.1%) were classified as minor defects, and 33 cases (56.9%) as major defects. The preoperative HHS rating improved significantly from a mean of 40.7 ± 6.1 (range: 29-53) before revision, to a mean of 85.8 ± 6.1 (range: 70-94) at the end of the follow-up (Student’s t test for paired samples: P < 0.001). Considering HHS only at the end of follow-up, no statistically significant difference was observed between patients with a major or minor defect (Student’s t test for independent samples: P > 0.05). Radiolucent lines were found in 4 implants (6.9%). Postoperative acetabular gaps were observed in 5 hips (8.6%). No signs of implant mobilization or areas of periprosthetic osteolysis were found in the x-rays at the final follow-up. Only 3 implants failed: 1 case of infection and 2 cases of instability. Defined as the end-point, cumulative survival at 10 years was 95% (for all reasons) and 100% for aseptic loosening of the acetabular component. CONCLUSION The medium-term use of prosthetic tantalum components in prosthetic hip revisions is safe and effective in a wide variety of acetabular bone defects. PMID:28808626

Acetabular revisions using porous tantalum components: A retrospective study with 5-10 years follow-up.

PubMed

Evola, Francesco Roberto; Costarella, Luciano; Evola, Giuseppe; Barchitta, Martina; Agodi, Antonella; Sessa, Giuseppe

2017-07-18

To evaluate the clinical and X-ray results of acetabular components and tantalum augments in prosthetic hip revisions. Fifty-eight hip prostheses with primary failure of the acetabular component were reviewed with tantalum implants. The clinical records and X-rays of these cases were retrospectively reviewed. Bone defect evaluations were based on preoperative CT scans and classified according to Paprosky criteria of Radiolucent lines and periprosthetic gaps; implant mobilization and osteolysis were evaluated by X-ray. An ad hoc database was created and statistical analyses were performed with SPSS software (IBM SPSS Statistics for Windows, version 23.0). Statistical analyses were carried out using the Student's t test for independent and paired samples. A P value of < 0.05 was considered statistically significant and cumulative survival was calculated by the Kaplan-Meier method. The mean follow-up was 87.6 ± 25.6 mo (range 3-120 mo). 25 cases (43.1%) were classified as minor defects, and 33 cases (56.9%) as major defects. The preoperative HHS rating improved significantly from a mean of 40.7 ± 6.1 (range: 29-53) before revision, to a mean of 85.8 ± 6.1 (range: 70-94) at the end of the follow-up (Student's t test for paired samples: P < 0.001). Considering HHS only at the end of follow-up, no statistically significant difference was observed between patients with a major or minor defect (Student's t test for independent samples: P > 0.05). Radiolucent lines were found in 4 implants (6.9%). Postoperative acetabular gaps were observed in 5 hips (8.6%). No signs of implant mobilization or areas of periprosthetic osteolysis were found in the x-rays at the final follow-up. Only 3 implants failed: 1 case of infection and 2 cases of instability. Defined as the end-point, cumulative survival at 10 years was 95% (for all reasons) and 100% for aseptic loosening of the acetabular component. The medium-term use of prosthetic tantalum components in prosthetic hip revisions is safe and effective in a wide variety of acetabular bone defects.

Material Science in Cervical Total Disc Replacement.

PubMed

Pham, Martin H; Mehta, Vivek A; Tuchman, Alexander; Hsieh, Patrick C

2015-01-01

Current cervical total disc replacement (TDR) designs incorporate a variety of different biomaterials including polyethylene, stainless steel, titanium (Ti), and cobalt-chrome (CoCr). These materials are most important in their utilization as bearing surfaces which allow for articular motion at the disc space. Long-term biological effects of implanted materials include wear debris, host inflammatory immune reactions, and osteolysis resulting in implant failure. We review here the most common materials used in cervical TDR prosthetic devices, examine their bearing surfaces, describe the construction of the seven current cervical TDR devices that are approved for use in the United States, and discuss known adverse biological effects associated with long-term implantation of these materials. It is important to appreciate and understand the variety of biomaterials available in the design and construction of these prosthetics and the considerations which guide their implementation.

Material Science in Cervical Total Disc Replacement

PubMed Central

Pham, Martin H.; Mehta, Vivek A.; Tuchman, Alexander; Hsieh, Patrick C.

2015-01-01

Current cervical total disc replacement (TDR) designs incorporate a variety of different biomaterials including polyethylene, stainless steel, titanium (Ti), and cobalt-chrome (CoCr). These materials are most important in their utilization as bearing surfaces which allow for articular motion at the disc space. Long-term biological effects of implanted materials include wear debris, host inflammatory immune reactions, and osteolysis resulting in implant failure. We review here the most common materials used in cervical TDR prosthetic devices, examine their bearing surfaces, describe the construction of the seven current cervical TDR devices that are approved for use in the United States, and discuss known adverse biological effects associated with long-term implantation of these materials. It is important to appreciate and understand the variety of biomaterials available in the design and construction of these prosthetics and the considerations which guide their implementation. PMID:26523281

[Thoracic ultrasound: the pneumologist's new stethoscope].

PubMed

Heinen, V; Duysinx, B; Corhay, J L; Louis, R

2012-10-01

We now have access to a large library of publications validating transparietal thoracic echography in various clinical situations. Parietal lesions, including osteolysis, can be detected and biopsied during the thoracic ultrasound (TUS) examination. To evaluate the parietal extension of lung cancers, TUS has proved superior to tomodensitometry. Pleural effusions can be easily diagnosed and aspirated. Pneumothoraces can be detected using well defined lung artifacts with a high frequency probe. Pleural and peripheral lung nodules can be detected and biopsied with real time visualization; the procedure is safe and accurate. Lung consolidations with a pleural contact can be diagnosed; this is particularly useful for pregnant women. In conclusion, TUS is a precious diagnostic tool for chosen applications, and can help to guide interventional procedures. The portable devices are also very useful for bedridden patients or for out of hospital use.

Stability of Uncemented Cups - Long-Term Effect of Screws, Pegs and HA Coating: A 14-Year RSA Follow-Up of Total Hip Arthroplasty.

PubMed

Otten, Volker T C; Crnalic, Sead; Röhrl, Stephan M; Nivbrant, Bo; Nilsson, Kjell G

2016-01-01

Screws, pegs and hydroxyapatite-coating are used to enhance the primary stability of uncemented cups. We present a 14-year follow-up of 48 hips randomized to four groups: press-fit only, press-fit plus screws, press-fit plus pegs and hydroxyapatite-coated cups. Radiostereometric migration measurements showed equally good stability regardless cup augmentation. The mean wear rate was high, 0.21 mm/year, with no differences between the groups. Seven hips had radiographical osteolysis but only in hips with augmented cups. Cups without screw-holes compared with cups with screw-holes resulted in better clinical outcome at the 14-year follow-up. Thus, augmentation of uncemented cups with screws, pegs, or hydroxyapatite did not appear to improve the long-term stability compared with press-fit only. Copyright © 2016 Elsevier Inc. All rights reserved.

Minimum five-year follow-up wear measurement of longevity highly cross-linked polyethylene cup against cobalt-chromium or zirconia heads.

PubMed

Nakahara, Ichiro; Nakamura, Nobuo; Nishii, Takashi; Miki, Hidenobu; Sakai, Takashi; Sugano, Nobuhiko

2010-12-01

We investigated the efficacy of combining highly cross-linked polyethylene with ceramic heads on further reduction in polyethylene wear compared with the combination with cobalt-chromium heads via PolyWare computer-assisted method. A prospective cohort study was performed on 102 cementless total hip arthroplasties using Longevity (Zimmer, Warsaw, Ind) highly cross-linked polyethylene liners. Either 26-mm zirconia heads or 26-mm cobalt-chromium heads were randomly used in 51 hips each. At a mean follow-up of 6.7 years, no significant differences were identified between the groups for total penetration rate and steady-state wear rate. Osteolysis was not observed in any hips in either group. In conclusion, no advantage was seen for the 26-mm zirconia head compared with the 26-mm cobalt-chromium head in this period. Copyright © 2010 Elsevier Inc. All rights reserved.

Established role of bisphosphonate therapy for prevention of skeletal complications from myeloma bone disease.

PubMed

Terpos, Evangelos; Dimopoulos, Meletios A; Berenson, James

2011-02-01

Patients with advanced multiple myeloma (MM) often have increased osteolytic activity of osteoclasts and impaired osteogenesis by osteoblasts, resulting in osteolytic bone lesions that increase the risk of skeletal-related events (SREs) including pathologic fracture, the need for radiotherapy or surgery to bone, and spinal cord compression. Such SREs are potentially life-limiting, and can reduce patients' functional independence and quality of life. Bisphosphonates (e.g., oral clodronate and intravenous pamidronate and zoledronic acid) can inhibit osteoclast-mediated osteolysis, thereby reducing the risk of SREs, ameliorating bone pain, and potentially prolonging survival in patients with MM. Extensive clinical experience demonstrates that bisphosphonates are generally well tolerated, and common adverse events are typically mild and manageable. Studies are ongoing to optimize the timing and duration of bisphosphonate therapy in patients with bone lesions from MM. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

[Diagnosis and therapy of particle disease in total hip arthroplasty].

PubMed

Müller, M; Wassilew, G; Perka, C

2015-04-01

Particle disease is caused by periarticular accumulation of attrition particles and the inflammatory reaction of the body's tissue. This process may result in osteolysis or soft tissue transformation which presents itself symptomless in the beginning and can proceed to aseptic implant loosening, fracture, implant breaking as a result of the inappropriate osseous support and to algetic and destructive soft tissue reactions as well. Attrition particles originate from tribological pairing, and the extent of the attrition or the particle concentration depend on different factors as there are the tribological pairing's material, the head size, the patient's level of activity, and the implant position. Attrition particles can also be found in the range of any modular connection. Particle disease and its resulting morphological alterations of the tribological pairing is one of the most frequent reasons for re-operation in hip endoprosthetics. Georg Thieme Verlag KG Stuttgart · New York.

The Biology of Bone Metastasis.

PubMed

Esposito, Mark; Guise, Theresa; Kang, Yibin

2018-06-01

Bone metastasis, or the development of secondary tumors within the bone of cancer patients, is a debilitating and incurable disease. Despite its morbidity, the biology of bone metastasis represents one of the most complex and intriguing of all oncogenic processes. This complexity derives from the intricately organized bone microenvironment in which the various stages of hematopoiesis, osteogenesis, and osteolysis are jointly regulated but spatially restricted. Disseminated tumor cells (DTCs) from various common malignancies such as breast, prostate, lung, and kidney cancers or myeloma are uniquely primed to subvert these endogenous bone stromal elements to grow into pathological osteolytic or osteoblastic lesions. This colonization process can be separated into three key steps: seeding, dormancy, and outgrowth. Targeting the processes of dormancy and initial outgrowth offers the most therapeutic promise. Here, we discuss the concepts of the bone metastasis niche, from controlling tumor-cell survival to growth into clinically detectable disease. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

Simultaneous mobile- and fixed-bearing total knee replacement in the same patients. A prospective comparison of mid-term outcomes using a similar design of prosthesis.

PubMed

Kim, Y-H; Kim, D-Y; Kim, J-S

2007-07-01

We conducted a randomised prospective study to evaluate the clinical and radiological results of a mobile- and fixed-bearing total knee replacement of similar design in 174 patients who had bilateral simultaneous knee replacement. The mean follow-up was for 5.6 years (5.2 to 6.1). The total knee score, pain score, functional score and range of movement were not statistically different (p > 0.05) between the two groups. Osteolysis was not seen in any knee in either group. Two knees (1%) in the mobile-bearing group required revision because of infection; none in the fixed-bearing group needed revision. Excellent results can be achieved with both mobile- and fixed-bearing prostheses of similar design at mid-term follow-up. We could demonstrate no significant clinical advantage for a mobile bearing.

The Multifaceted Osteoclast; Far and Beyond Bone Resorption.

PubMed

Drissi, Hicham; Sanjay, Archana

2016-08-01

The accepted function of the bone resorbing cell, osteoclast, has been linked to bone remodeling and pathological osteolysis. Emerging evidence points to novel functions of osteoclasts in controlling bone formation and angiogenesis. Thus, while the concept of a "clastokine" with the potential to regulate osteogenesis during remodeling did not come as a surprise, new evidence provided unique insight into the mechanisms underlying osteoclastic control of bone formation. The question still remains as to whether osteoclast precursors or a unique trap positive mononuclear cell, can govern any aspect of bone formation. The novel paradigm eloquently proposed by leaders in the field brings together the concept of clastokines and osteoclast precursor-mediated bone formation, potentially though enhanced angiogenesis. These fascinating advances in osteoclast biology have motivated this short review, in which we discuss these new roles of osteoclasts. J. Cell. Biochem. 117: 1753-1756, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

In vivo evaluation of teicoplanin- and calcium sulfate-loaded PMMA bone cement in preventing implant-related osteomyelitis in rats.

PubMed

Tuzuner, T; Sencan, I; Ozdemir, D; Alper, M; Duman, S; Yavuz, T; Yildirim, M

2006-12-01

The objective of this study was to evaluate the efficacy of teicoplanin- and calcium sulphate-loaded polymethylmethacrylate (PMMA) bone cements in preventing experimental implant-related osteomyelitis in rats. Four groups of antibiotic-loaded rods were prepared and were implanted into the lateral condylus of the rat femur after inoculation of Staphylococcus aureus. The effectiveness of these were assessed microbiologically, radiographically, and histopathologically. Radiographic evaluation revealed a significant reduction of periostal reaction and osteolysis in rats that received calcium sulphate- and teicoplanin-loaded rods. Histopathological evaluation confirmed these results. Acute infection and bone necrosis were found to be significantly lower in rats that had received calcium sulphate- and teicoplanin-loaded rods. The addition of calcium sulfate to teicoplanin-loaded PMMA bone cement appeared satisfactory as an antibiotic-carrying system for prophylaxis of experimental implant-related osteomyelitis, but further investigations are needed to reach definitive statements for clinical applications.

Osteogenic Activity of Locally Applied Small Molecule Drugs in a Rat Femur Defect Model

PubMed Central

Cottrell, Jessica A.; Vales, Francis M.; Schachter, Deborah; Wadsworth, Scott; Gundlapalli, Rama; Kapadia, Rasesh; O'Connor, J. Patrick

2010-01-01

The long-term success of arthroplastic joints is dependent on the stabilization of the implant within the skeletal site. Movement of the arthroplastic implant within the bone can stimulate osteolysis, and therefore methods which promote rigid fixation or bone growth are expected to enhance implant stability and the long-term success of joint arthroplasty. In the present study, we used a simple bilateral bone defect model to analyze the osteogenic activity of three small-molecule drug implants via microcomputerized tomography (micro-CT) and histomorphometry. In this study, we show that local delivery of alendronate, but not lovastatin or omeprazole, led to significant new bone formation at the defect site. Since alendronate impedes osteoclast-development, it is theorized that alendronate treatment results in a net increase in bone formation by preventing osteoclast mediated remodeling of the newly formed bone and upregulating osteoblasts. PMID:20625499

Third-generation pure alumina and alumina matrix composites in total hip arthroplasty

PubMed Central

Hannouche, Didier; Zingg, Matthieu; Miozzari, Hermes; Nizard, Remy; Lübbeke, Anne

2018-01-01

Wear, corrosion and periprosthetic osteolysis are important causes of failure in joint arthroplasty, especially in young patients. Ceramic bearings, developed 40 years ago, are an increasingly popular choice in hip arthroplasty. New manufacturing procedures have increased the strength and reliability of ceramic materials and reduced the risk of complications. In recent decades, ceramics made of pure alumina have continuously improved, resulting in a surgical-grade material that fulfills clinical requirements. Despite the track record of safety and long-term results, third-generation pure alumina ceramics are being replaced in clinical practice by alumina matrix composites, which are composed of alumina and zirconium. In this review, the characteristics of both materials are discussed, and the long-term results with third-generation alumina-on-alumina bearings and the associated complications are compared with those of other available ceramics. Cite this article: EFORT Open Rev 2018;3:7-14. DOI: 10.1302/2058-5241.3.170034 PMID:29657840

Long-Term Results of Total Hip Arthroplasty with 28 millimeter Cobalt-Chromium Femoral Heads on Highly Cross-linked Polyethylene in Patients 50 years and Less

PubMed Central

Stambough, Jeffrey B.; Pashos, Gail; Bohnenkamp, Frank C.; Maloney, William J.; Martell, John M.; Clohisy, John C.

2016-01-01

Highly cross-linked polyethylene (HXLPE) is the most commonly used bearing surface in total hip arthroplasty (THA) because of its superior wear properties, but long-term results in young patients are limited. We report on the clinical outcome, radiographic wear patterns and survivorship of 72 patients ≤50 years old who had a 28-millimeter cobalt-chromium femoral head on HXLPE acetabular liner. Mean and median true linear wear rates at average ten-year follow-up were 0.0104 and 0.016 mm per year +/− 0.07 mm. Mean and median two-dimensional volumetric wear rates were 12.79 mm3 and 5.834 mm3 per year +/− 26.1mm3 as determined by Martell analysis. As a result of the minimal wear profile, there was no evidence of radiographic osteolysis and no wear-related revisions. PMID:26260785

Locally infiltrative ameloblastic fibroma in a rhesus macaque (Macaca mulatta) with characterizations of its proliferating activity and biological behavior

PubMed Central

Liu, David X.; Doyle, Lara A.; Bouljihad, Mostafa T.; Didier, Peter J.; Gilbert, Margaret H.; Wang, Xiaolei; Pahar, Bapi; Bohm, Rudolf P.; Veazey, Ronald S.; Lackner, Andrew A.

2014-01-01

An 8-year-old male rhesus macaque (Macaca mulatta) presented with unilateral enlargement of the left mandible. Radiographs revealed a marked expansion of the left mandible with a multilocular radiolucent mass with abundant osteolysis. The mass was grossly firm, fleshy, and gelatinous on the cut surface. Histologically, the mass was locally infiltrative and composed of neoplastic epithelial and mesenchymal components that stained positive for cytokeratin and vimentin, respectively. Occasional densely spherical condensations of fibroblasts resembling the cap stage of odontogenesis were present in the mesenchyma. Immunohistochemical staining with Ki-67, S-100, and CD34 indicated that both epithelial and mesenchymal components of the neoplasm had low proliferation. Alcian blue, periodic acid–Schiff, and trichrome stains showed an immature stromal component with no collagen formation. Based on the clinical, histologic, and immunophenotypic features, the tumor was identified as a locally infiltrative ameloblastic fibroma. PMID:22529141

Imaging of connective tissue diseases of the head and neck

PubMed Central

2016-01-01

We review the imaging appearance of connective tissue diseases of the head and neck. Bilateral sialadenitis and dacryoadenitis are seen in Sjögren’s syndrome; ankylosis of the temporo-mandibular joint with sclerosis of the crico-arytenoid joint are reported in rheumatoid arthritis and lupus panniculitis with atypical infection are reported in patients with systemic lupus erythematosus. Relapsing polychondritis shows subglottic stenosis, prominent ear and saddle nose; progressive systemic sclerosis shows osteolysis of the mandible, fibrosis of the masseter muscle with calcinosis of the subcutaneous tissue and dermatomyositis/polymyositis shows condylar erosions and autoimmune thyroiditis. Vascular thrombosis is reported in antiphospholipid antibodies syndrome; cervical lymphadenopathy is seen in adult-onset Still’s disease, and neuropathy with thyroiditis reported in mixed connective tissue disorder. Imaging is important to detect associated malignancy with connective tissue disorders. Correlation of the imaging findings with demographic data and clinical findings are important for the diagnosis of connective tissue disorders. PMID:26988082

Biodegradable Magnesium Alloys Developed as Bone Repair Materials: A Review

PubMed Central

Liu, Chen; Ren, Zheng; Xu, Yongdong; Pang, Song; Zhao, Xinbing

2018-01-01

Bone repair materials are rapidly becoming a hot topic in the field of biomedical materials due to being an important means of repairing human bony deficiencies and replacing hard tissue. Magnesium (Mg) alloys are potentially biocompatible, osteoconductive, and biodegradable metallic materials that can be used in bone repair due to their in situ degradation in the body, mechanical properties similar to those of bones, and ability to positively stimulate the formation of new bones. However, rapid degradation of these materials in physiological environments may lead to gas cavities, hemolysis, and osteolysis and thus, hinder their clinical orthopedic applications. This paper reviews recent work on the use of Mg alloy implants in bone repair. Research to date on alloy design, surface modification, and biological performance of Mg alloys is comprehensively summarized. Future challenges for and developments in biomedical Mg alloys for use in bone repair are also discussed. PMID:29725492

MicroRNA Transfer Between Bone Marrow Adipose and Multiple Myeloma Cells.

PubMed

Soley, Luna; Falank, Carolyne; Reagan, Michaela R

2017-06-01

Multiple myeloma remains an incurable disease, largely due to the tumor-supportive role of the bone marrow microenvironment. Bone marrow adipose tissue (BMAT) is one component of the fertile microenvironment which is believed to contribute to myeloma progression and drug resistance, as well as participate in a vicious cycle of osteolysis and tumor growth. MicroRNAs (miRNAs) have recently emerged as instrumental regulators of cellular processes that enable the development and dissemination of cancer. This review highlights the intersection between two emerging research fields and pursues the scientific and clinical implications of miRNA transfer between BMAT and myeloma cells. This review provides a concise and provocative summary of the evidence to support exosome-mediated transfer of tumor-supportive miRNAs. The work may prompt researchers to better elucidate the mechanisms by which this novel means of genetic communication between tumor cells and their environment could someday yield targeted therapeutics.

[Complications of treatment of acromioclavicular joint dislocation and unstable distal clavicular fracture with clavicular hook plate].

PubMed

Zhu, Yi-Yong; Cui, Heng-Yan; Jiang, Pan-Qiang; Wang, Jian-Liang

2013-11-01

To investigate the causes and prevention of the complications about treatment of acromioclavicular joint dislocation (Tossy III) and unstable distal clavicular fracture (Neer II) with clavicular hook plate. From January 2001 to December 2011, 246 patients with acromioclavicular joint dislocation (Tossy III) and 222 patients with unstable distal clavicular fracture (Neer II) were treated with acromioclvicular hook plate fixation,including 348 males and 120 females with an average age of 45.4 years old ranging from 21 to 80 years old. The mean time from injury to operation was 30.8 hours (ranged from 1 h to 15 d). All patients had normal shoulder function before injury. According to Karlsson evaluation standard, the cases with excellent and good function of the shoulder joint were regarded as the normal group, and the cases with poor function of shoulder joint as the abnormal group. The comparison of the range of forward flexion,backward stretch, adduction, abduction and elevation of shoulder joints between two groups was performed. The data of impingement, subacromial osteolysis, acromioclavicular arthritis, clavicular stress fracture, downward acromioclavicular joint subluxation, hook cut-out and hook break were summarized. All patients were followed up from 8 to 48 months with an average of 12.5 months. The results were excellent in 308 cases,good in 76,and poor in 84 according to Karlsson evaluation. The excellent and good rate was 82.1%. The difference of the range of forward flexion, backward stretch, adduction, abduction and elevation of shoulder joints between two groups had a statistically significant difference (P < 0.01). Among 84 poor cases, there were 41 (8.76%) in acromial impingement or inadequate place of plate hook, 12 (2.56%) with subacromial osteolysis or/and bursitis, 10 (2.14%) with acromioclavicular arthritis or painful shoulder caused by delayed dirigation,7 (1.50%) with clavicular stress fracture or interal plate upward, 6 (1.28%) with downward acromioclavicular joint subluxation, 5 (1.07%) with hook cut -out and 3 (0.64%) in hook break. The clavicular hook plate is useful for the treatment of acromioclavicular joint dislocation (Tossy III) and unstable distal clavicular fracture (Neer II). The correct place and suitable preflex of plate hook,the restoration of fiber structure around the acromioclavicular joint and the advisable dirigation contribute to the modified rate of complications.

[Distal fixation prosthesis for unstable intertrochanteric fractures in elderly patients: a mid-term follow-up study].

PubMed

Zhang, Zhan-feng; Min, Ji-kang; Zhong, Jian-ming; Wang, Dan

2016-06-01

To explore mid-term follow up results of distal fixation prosthesis in treating unstable intertrochanteric fractures in elderly patients. From May 2008 to March 2014,58 elderly patients with unstable intertrochanteric were treated with distal fixation prosthesis, among them, there were 15 males and 43 females aged from 75 to 87 years old with an average of 83.2 years old. Fracture were classified according to Evans classification, 39 cases were type I c and 19 cases were type I d. Surgical risk was evaluated before operation, 9 patients were performed total hip arthroplasty and 49 patients were performed prosthetic replacement hip joint function of patients with different age period, Evans classificaton, prothesis type, fixation method were evaluated respectively by using Harris score. Fifty-six patients were followed up from 13 to 36 months with an average of 21.6 months. Harris score was 83.51 ± 6.40, 5 cases got excellent results, 38 cases good and 13 cases moderate. Harris score of patients aged from 75 to 80 years old was 88.64 ± 2.35, 81.64 ± 6.40 in patients aged more than 80 years old, and had significant differences between two groups; Harris score in patients with type Evans I c was 83.64 ± 6.53, and 83.11 ± 6.08 in type Evans I d, while there was no significant differences between two groups. There was no obvious meaning in Harris score between patients with tension band (83.63 ± 6.15) and without tension band (82.41 ± 6.57). There was no significant meaning in Harris score between patients with normal distal fixation prosthesis (83.34 ± 6.43) and femoral moment reconstruction distal fixation prosthesis (83.92 ± 6.51). There was 1 patient occurred hip joint dislocation on the operative side and re-dislocation after manual reduction, then received open reduction. Two patients occurred femoral osteolysis without clinical symptoms, and treated conservative treatment. Artificial joint replacement for unstable intertrochanteric fractures in elderly patients, hip joint function in patients aged more than 80 years old is worse, while there was no obvious market effect in fracture classification, whether to use tension band and type of distal fixation prosthesis, moreover, proximal femoral osteolysis should be focused on.

Comparison of the osteogenesis and fusion rates between activin A/BMP-2 chimera (AB204) and rhBMP-2 in a beagle's posterolateral lumbar spine model.

PubMed

Zheng, Guang Bin; Yoon, Byung-Hak; Lee, Jae Hyup

2017-10-01

Activin A/BMP-2 chimera (AB204) could promote bone healing more effectively than recombinant bone morphogenetic protein 2 (rhBMP-2) with much lower dose in a rodent model, but there is no report about the effectiveness of AB204 in a large animal model. The purpose of this study was to compare the osteogenesis and fusion rate between AB204 and rhBMP-2 using biphasic calcium phosphate (BCP) as a carrier in a beagle's posterolateral lumbar fusion model. This is a randomized control animal study. Seventeen male beagle dogs were included. Bilateral posterolateral fusion was performed at the L1-L2 and L4-L5 levels. Biphasic calcium phosphate (2 cc), rhBMP-2 (50 µg)+BCP (2 cc), or AB204 (50 µg)+BCP (2 cc) were implanted into the intertransverse space randomly. X-ray was performed at 4 and 8 weeks. After 8 weeks, the animals were sacrificed, and new bone formation and fusion rate were evaluated by manual palpation, computed tomography (CT), and undecalcified histology. The AB204 group showed significantly higher fusion rate (90%) than the rhBMP-2 group (15%) or the Osteon group (6.3%) by manual palpation. On x-ray and CT assessment, fusion rate and the volume of newly formed bone were also significantly higher in AB204 group than other groups. In contrast, more osteolysis was found in rhBMP-2 group (40%) than in AB204 group (10%) on CT study. In histologic results, new bone formation was sufficient between transverse processes in AB204 group, and obvious trabeculation and bone remodeling were observed. But in rhBMP-2 group, new bone formation was less than AB204 group and osteolysis was observed between the intertransverse spaces. A low dose of AB204 with BCP as a carrier significantly promotes the fusion rate in a large animal model when compared with the rhBMP-2. These findings demonstrate that AB204 could be an alternative to rhBMP-2 to improve fusion rate. Copyright © 2017 Elsevier Inc. All rights reserved.

Oxidized zirconium head on crosslinked polyethylene liner in total hip arthroplasty: a 7- to 12-year in vivo comparative wear study.

PubMed

Karidakis, George K; Karachalios, Theofilos

2015-12-01

Osteolysis resulting from wear debris production from the bearing surfaces is a major factor limiting long-term survival of hip implants. Oxidized zirconium head on crosslinked polyethylene (XLPE) is a modern bearing coupling. However, midterm in vivo wear data of this coupling are not known. The purpose of this study was to investigate in vivo whether the combination of an oxidized zirconium femoral head on XLPE produces less wear than a ceramic head on XLPE or a ceramic head on conventional polyethylene (CPE) couplings and whether any of these bearing combinations results in higher hip scores. Between 2003 and 2007, we performed 356 total hip arthroplasties in 288 patients; of those, 199 (69.1%) patients (199 hips) were enrolled in what began as a randomized trial. Unfortunately, after the 57(th) patient, the randomization process was halted because of patients' preference for the oxidized zirconium bearing instead of the ceramic after (as they were informed by the consent form), and after that, alternate allocation to the study groups was performed. Hips were allocated into four groups: in Group A, a 28-mm ceramic head on CPE was used; in Group B, a 28-mm ceramic head on XLPE; in Group C, a 28-mm Oxinium head on XLPE; and in Group D, a 32-mm Oxinium head on XLPE. The authors prospectively collected in vivo wear data (linear wear, linear wear rate, volumetric wear, and volumetric wear rate) using PolyWare software. Preoperative and postoperative clinical data, including Harris and Oxford hip scores, were also collected at regular intervals. Of those patients enrolled, 188 (95%) were available for final followup at a minimum of 7 years (mean, 9 years; range, 7-12 years). All bearing surfaces showed a varying high bedding-in effect (plastic deformation of the liner) up to the second postoperative year. At 5 years both oxidized zirconium on XLPE groups showed lower (p < 0.01) volumetric wear (mean ± SD mm(3)) and volumetric wear rates (mean ± SD mm(3)/year) (Group C: 310 ± 55-206 ± 55 mm(3)/year, Group D: 320 ± 58-205 ± 61 mm(3)/year) when compared with ceramic on CPE (Group A: 791 ± 124-306 ± 85 mm(3)/year) and ceramic on XLPE (Group B: 1420 ± 223-366 ± 88 mm(3)/year) groups. For those patients who had completed 10 years of followup (20 patients [44.5%] of Group A, 21 [45.7%] of Group B, 23 [47.9%] of Group C, and 22 [44.9%] of Group D), at 10 years, both oxidized zirconium on XLPE groups also showed lower (p < 0.01) volumetric wear (mean ± SD mm(3)) and volumetric wear rates (mean ± SD mm(3)/year) (Group C: 356 ± 64 to 215 ± 54 mm(3)/year, Group D: 354 ± 50 to 210 ± 64 mm(3)/year) when compared with ceramic on CPE (Group A: 895 ± 131 to 380 ± 80 mm(3)/year) and ceramic on XLPE (Group B: 1625 ± 253 to 480 ± 101 mm(3)/year) groups. When wear rates of both oxidized zirconium groups were compared, no differences were found at any time interval with the numbers available. Two hips (one from Group A and one from Group B) are scheduled for revision as a result of wear and osteolysis. There were no differences in hip scores among the groups with the numbers available. In this study, in vivo wear parameters were lower when the combination of an oxidized zirconium head on XLPE liner was used at an average of 9 years (range, 7-12 years) followup. Further larger-scale clinical studies should confirm these findings and evaluate osteolysis and revision rates in association with the use of this bearing coupling. Level II, therapeutic study.

Do the Reasons for Ceramic-on-ceramic Revisions Differ From Other Bearings in Total Hip Arthroplasty?

PubMed

Migaud, Henri; Putman, Sophie; Kern, Grégory; Isida, Ronald; Girard, Julien; Ramdane, Nassima; Delaunay, Christian P; Hamadouche, Moussa

2016-10-01

Despite widespread use of ceramic-on-ceramic (CoC) in total hip arthroplasty (THA) during the past 10 years, little is known about why revisions are performed in hips with this bearing or the time elapsed before revision. The purposes of this study were: (1) Do the reasons for first revision differ between CoC bearings and other bearing couples? (2) Does the time to revision differ between CoC and other bearing couples? (3) Are there unique reasons for revisions of CoC bearings? All members of the Société Française de Chirurgie Orthopédique et Traumatologique (SoFCOT) who performed ≥ 30 revisions per year were invited to participate in this multicenter, prospective, observational study. Our data represent 12% of the revision procedures performed in France. A total of 2107 first revisions of THA (from January 2010 to December 2011) were done in 2107 patients (1201 females [57%] and 906 males [43%]; median age, 73 years; age range, 17-104 years) at the time of surgery after a median of 11 years (range, 0 day-42 years) after the primary THA. There were 238 of 2107 (11%) CoC, 148 of 2107 (7%) metal-on-metal (MoM), and 1721 of 2017 (82%) metal-on-polyethylene (MoP) bearings. The reasons for reoperation differed according to the bearing component: (1) for the MoP reference bearing (odds ratio [OR]; 95% confidence interval), cup loosening occurred in 698 of 1721 hips (41%), periprosthetic fracture in 220 of 1721 hips (13%), and osteolysis in 213 of 1721 hips (12%); (2) for CoC, cup loosening occurred in 41 of 238 hips (17%) (OR, 0.31 [0.22-0.43; p < 0.001), infection in 39 of 238 hips (16%) (OR, 1.63 [1.12-2.37]; p = 0.01), and dislocation in 23 of 238 hips (10%) (OR, 0.9 [0.57-1.42]; p = 0.9); (3) for MoM, cup loosening occurred in 28 of 148 hips (19%) (OR, 0.34 [0.22-0.52]; p < 0.001), adverse reaction to metallic debris in 26 of 148 hips (18%) (OR, 18.12 [9.84-33.4]; p < 0.001), and infection in 16 of 148 hips (11%) (OR, 1 [0.59-1.73]; p = 0.9). In comparison with MoP, osteolysis was rarely the reason for revision in CoC (four of 238 hips [2%]; OR, 0.12 [0.05-0.33]; p < 0.001), but this bearing was frequently revised because of iliopsoas irritation (18 of 238 hips [8%]; OR, 4.9 [2.7-9]; p < 0.001). The time elapsed before revision differed between bearings: median of 3 years (range, 3 days to 28 years) for CoC and 4 years (range, 14 days to 37 years) for MoM versus a median 13 years (range, 0 day to 42 years) for MoP (p < 0.001). Thirty-seven of the 238 revisions (16%) were directly related to ceramic use (ceramic breakage [n = 23], squeaking [n = 6], impingement [n = 7], incorrect ceramic insert insertion [n = 1]). No factors were identified that contributed to breakage of the 12 bulk ceramic components (eight heads, four inserts, four of 12 Delta ceramic). No factors were associated with squeaking, iliopsoas irritation, or impingement, but component orientation was not assessed. The reasons and time to first revision differed between CoC and other bearings. CoC THAs are revised earlier and are sensitive to mechanical problems such as impingement, squeaking, and ceramic rupture that did not disappear with introduction of Delta ceramics and large-diameter (≥ 36 mm) bearings. CoC was rarely revised for osteolysis, but a high rate of iliopsoas irritation requires further investigation. Level III, therapeutic study.

Bone remodelling around HA-coated acetabular cups

PubMed Central

Nielsen, P. T.; Søballe, K.

2006-01-01

This study was designed to investigate bone remodelling around the cup in cementless THA. Previous studies indicate an advantage of better sealing of the bone-prosthesis interface by HA/TCP coating of implants, inhibiting polyethylene-induced osteolysis. One hundred patients gave informed consent to participate in a controlled randomized study between porous coated Trilogy versus Trilogy Calcicoat (HA/TCP coated). The cup was inserted in press-fit fixation. The femoral component was a cementless porous coated titanium alloy stem (Bi-Metric), with a modular 28-mm CrCo head. The Harris Hip Score (HHS) and bone mineral density (BMD) determined by DEXA scanning were used to study the effect. Measurements revealed no difference between the two groups after 3 years either in the clinical outcome or in terms of periprosthetic bone density. Patients with a body mass index above normal regained more bone mineral than patients with normal weight. This finding supports the assumption that load is beneficial to bone remodelling. PMID:16761153

Bisphosphonate-induced osteonecrosis of the jaws: clinical, imaging, and histopathology findings.

PubMed

Franco-Pretto, Elias; Pacheco, Maikel; Moreno, Andrey; Messa, Oscar; Gnecco, Juan

2014-10-01

To assess the main clinical, radiographic, and histopathologic features of patients with bisphosphonate-induced osteonecrosis of the jaws (BIONJ). Patients with BIONJ diagnosed and treated at the Head and Neck Department, Instituto Nacional de Cancerología, Bogotá, DC, Colombia, between January 2012 and February 2014 were retrospectively included. Patients treated with sequestrectomy or curettage were excluded. Specimens from selected patients were reexamined under a light microscope. Clinical and imaging findings and sociodemographic variables were also reviewed. Five stage 3 BIONJ cases were included. Imaging found massive osteolysis. Histopathology found devitalized trabecular bone, an absence of osteoblastic rimming, osteoclastic necrosis, and viable periosteum. Actinomyces spp colonies were limited to superficial layers. BIONJ histopathology is different from that of other necrotizing and inflammatory bone diseases. This relates to the known antiresorptive mechanism of bisphosphonates, which is the basis of their therapeutic action. Nevertheless, further study with larger series should be accomplished. Copyright © 2014 Elsevier Inc. All rights reserved.

Bisphosphonates and oral pathology II. Osteonecrosis of the jaws: review of the literature before 2005.

PubMed

Estefanía Fresco, Ruth; Ponte Fernández, Ruth; Aguirre Urizar, José Manuel

2006-11-01

Bisphosphonates are bone-turnover modulating drugs which are used in the management of a number of bone diseases ranging from osteoporosis to neoplasic pathology-associated osteolysis. In the last years a number of cases of osteonecrosis of the jaws associated with these drugs have been reported. In this review we analyze the cases published in the literature indexed from 2003 to December 2005. During this period 246 cases were reported, being more frequently associated with women in the sixth decade of life. More frequently associated bisphosphonates were the nitrogenated bisphosphonates (pamidronate, zolendronic acid) and the most common oral antecedent was a dental extraction. Nevertheless more than 25% of the cases were spontaneous. The most frequent site was the mandible and most of the cases presented clinical evidence of bone exposure and pain. Different treatments have been proposed with different antibiotic therapies with or without surgery, showing in general terms an uncertain prognosis with low healing rates.

Long-Term Results of Total Hip Arthroplasty with 28-Millimeter Cobalt-Chromium Femoral Heads on Highly Cross-Linked Polyethylene in Patients 50 Years and Less.

PubMed

Stambough, Jeffrey B; Pashos, Gail; Bohnenkamp, Frank C; Maloney, William J; Martell, John M; Clohisy, John C

2016-01-01

Highly cross-linked polyethylene (HXLPE) is the most commonly used bearing surface in total hip arthroplasty (THA) because of its superior wear properties, but long-term results in young patients are limited. We report on the clinical outcome, radiographic wear patterns and survivorship of 72 patients ≤50 years old who had a 28-millimeter cobalt-chromium femoral head on HXLPE acetabular liner. Mean and median true linear wear rates at average ten-year follow-up were 0.0104 and 0.01 mm per year ± 0.07 mm. Mean and median two-dimensional volumetric wear rates were 12.79 mm(3) and 5.834 mm(3) per year ± 26.1mm(3) as determined by Martell analysis. As a result of the minimal wear profile, there was no evidence of radiographic osteolysis and no wear-related revisions. Copyright © 2016 Elsevier Inc. All rights reserved.

Bioabsorbable poly-L/D-lactide (96/4) scaffold arthroplasty (RegJoint™) for trapeziometacarpal osteoarthritis: a 3-year follow-up study.

PubMed

Mattila, Simo; Ainola, Mari; Waris, Eero

2018-05-01

The poly-L/D-lactide joint scaffold (RegJoint™) has recently been associated with adverse tissue reactions and osteolysis after partial trapeziectomy for trapeziometacarpal osteoarthritis. Twenty-two of 23 patients previously operated on with this scaffold were re-examined at a mean follow-up of 3.3 years (range 36-53 months). Overall, the results showed an unacceptably high rate of adverse tissue reactions related to the degradation process of the implant, resulting in a revision procedure in three patients. At final follow-up, at which point the implant had completely degraded, there were no signs of ongoing adverse tissue reactions. There was a significant decrease in pain, increase in strength and subjective improvement in function at final follow-up compared with the pre-operative results in patients who had not undergone revision surgery. However, owing to the high incidence of adverse tissue reactions, the use of the implant has been discontinued in the treatment of trapeziometacarpal osteoarthritis. IV.

Unfavourable short-term outcomes of a poly-L/D-lactide scaffold for thumb trapeziometacarpal arthroplasty.

PubMed

Mattila, S; Waris, E

2016-03-01

The bioabsorbable poly-L-D-lactide joint scaffold arthroplasty is a recent attempt in the reconstruction of small joints in rheumatoid patients. In this study, we analysed the 1-year clinical, functional and radiologic results of partial trapeziectomy with the poly-L-D-lactide (96/4) joint scaffold in 23 patients with isolated trapeziometacarpal osteoarthritis. The results showed that the procedure provided pain relief and improvement in overall function according to the Quick Disabilities of the Arm, Shoulder and Hand score in most patients. However, radiographs demonstrated a high frequency of osteolysis around the implant. Seven patients developed clinically manifested foreign-body reactions 6 months to 1 year after surgery. The reason for the unexpected tissue reactions may relate to excessive mechanical cyclic loading of the implant. The outcomes of this implant in our patients have not been sufficiently beneficial and we have discontinued use of this implant in isolated trapeziometacarpal osteoarthritis. © The Author(s) 2015.

Mandibuloacral dysplasia: A premature ageing disease with aspects of physiological ageing.

PubMed

Cenni, Vittoria; D'Apice, Maria Rosaria; Garagnani, Paolo; Columbaro, Marta; Novelli, Giuseppe; Franceschi, Claudio; Lattanzi, Giovanna

2018-03-01

Mandibuloacral dysplasia (MAD) is a rare genetic condition characterized by bone abnormalities including localized osteolysis and generalized osteoporosis, skin pigmentation, lipodystrophic signs and mildly accelerated ageing. The molecular defects associated with MAD are mutations in LMNA or ZMPSTE24 (FACE1) gene, causing type A or type B MAD, respectively. Downstream of LMNA or ZMPSTE24 mutations, the lamin A precursor, prelamin A, is accumulated in cells and affects chromatin dynamics and stress response. A new form of mandibuloacral dysplasia has been recently associated with mutations in POLD1 gene, encoding DNA polymerase delta, a major player in DNA replication. Of note, involvement of prelamin A in chromatin dynamics and recruitment of DNA repair factors has been also determined under physiological conditions, at the border between stress response and cellular senescence. Here, we review current knowledge on MAD clinical and pathogenetic aspects and highlight aspects typical of physiological ageing. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Management bone loss of the proximal femur in revision hip arthroplasty: Update on reconstructive options

PubMed Central

Sakellariou, Vasileios I; Babis, George C

2014-01-01

The number of revision total hip arthroplasties is expected to rise as the indications for arthroplasty will expand due to the aging population. The prevalence of extensive proximal femoral bone loss is expected to increase subsequently. The etiology of bone loss from the proximal femur after total hip arthroplasty is multifactorial. Stress shielding, massive osteolysis, extensive loosening and history of multiple surgeries consist the most common etiologies. Reconstruction of extensive bone loss of the proximal femur during a revision hip arthroplasty is a major challenge for even the most experienced orthopaedic surgeon. The amount of femoral bone loss and the bone quality of the remaining metaphyseal and diaphyseal bone dictate the selection of appropriate reconstructive option. These include the use of impaction allografting, distal press-fit fixation, allograft-prosthesis composites and tumor megaprostheses. This review article is a concise review of the current literature and provides an algorithmic approach for reconstruction of different types of proximal femoral bone defects. PMID:25405090

The use of a tripolar articulation in revision total hip arthroplasty: a minimum of 24 months' follow-up.

PubMed

Levine, Brett R; Della Valle, Craig J; Deirmengian, Carl A; Breien, Kristoffer M; Weeden, Steven H; Sporer, Scott M; Paprosky, Wayne G

2008-12-01

A retrospective cohort study of 31 hips revised with a tripolar articular construct was performed. Patient demographics and preoperative and postoperative information were recorded. Indications for a tripolar construct were recurrent dislocation and the inability to attain intraoperative stability during hip revision. Nine patients (29%) were revised to the tripolar construct after failure of a constrained liner. Twenty patients (65%) had at least one episode of instability before the most recent revision. At a mean follow-up of 38 months, modified Postel scores improved from a mean of 5.28 to 9.64 (P < .01). Radiographic follow-up revealed no evidence of component loosening/migration, osteolysis, or polyethylene wear. Two patients (7%) required further revision surgery for recurrent instability. A tripolar construct was effective in eliminating or preventing instability in 93% of the complex cases treated. These early results support the use of a tripolar construct in treating recurrent instability or instability encountered at the time of revision hip arthroplasty.

Clinical and radiological mid-term results of the thrust plate prosthesis

PubMed Central

v.d. Daele, R.; Simon, U.; Goetze, C.

2009-01-01

The purpose of this study was to perform an objective clinical and radiological assessment of the thrust plate prosthesis (TPP). Fifty-three prostheses were evaluated clinically using the Harris hip score (HHS), visual analog scale (VAS), and radiographically before surgery, at the time of discharge, and postoperatively after on average of 8.09 (range 4.61–9.93) years. The average HHS significantly (p ≤ 0.05) improved from 48 (range 18–77) points to 95 (range 46–100) points. The VAS revealed significant (p ≤ 0.05) reduction of pain at rest and under load. Radiographic analysis showed a considerable potential for osteolysis under the thrust plate. Sixteen prostheses revealed signs of radiolucent zones. In general, there was a good clinical outcome with no major limitations in function. Radiographic changes under the thrust plate indicate an adaptation processes resulting from changed biomechanics. This study suggests that the TPP could be a good alternative in total hip replacement in younger patients. PMID:19184010

Revision of Articular Surface Replacement (ASR) Total Hip Arthroplasty: Correlation of Perioperative Data and Early Post-Revision Outcome Results.

PubMed

Cip, Johannes; Bach, Christian; Widemschek, Mark; Luegmair, Matthias; Martin, Arno

2015-09-01

The articular surface replacement (ASR) total hip arthroplasty (THA) showed accelerated failure rates due to adverse-reaction to metal debris (ARMD). Literature correlating preoperative with intraoperative revision findings respectively post-revision outcome results are rare. 30 of 99 available ASR THA were revised due to ARMD. Mean post-revision follow-up term was 2.3 years. In part, preoperative data did not correlate with intraoperative revision findings. ARMD was even found in asymptomatic patients with non-elevated ion levels. Postoperative pain and metal ions decreased significantly (P ≤ 0.016). Cobalt decreased faster than chrome. Patients with intraoperative pseudotumors, osteolysis or bilateral THA did not have higher pre- or postoperative ion values (P ≥ 0.053). Females showed higher postoperative chrome levels (P=0.031). One major post-revision complication (femoral nerve palsy) and one re-revision (late onset infection) occurred. Copyright © 2015 Elsevier Inc. All rights reserved.

Cytotoxicity and genotoxicity property of hydroxyapatite-mullite eluates.

PubMed

Kalmodia, Sushma; Sharma, Vyom; Pandey, Alok K; Dhawan, Alok; Basu, Bikramjit

2011-02-01

Long-term biomedical applications of implant materials may cause osteolysis, aseptic losing and toxicity. Therefore, we investigated the cytotoxic and genotoxic potential of hydroxyapatite (HA) mullite eluates in L929 mouse fibroblast cells. The spark plasma sintered HA-20% mullite biocomposite (HA20M) were ground using mortar and pestle as well as ball milling. The cells were exposed for 6 h to varying concentrations (10, 25, 50, 75 and 100%) of the eluates of HA-20% mullite (87 nm), HA (171 nm) and mullite (154 nm). The scanning electron microscopy and MTT assay revealed the concentration dependent toxicity of H20M eluate at and above 50%. The analysis of the DNA damaging potential of HA, mullite and HA20M eluates using Comet assay demonstrated a significant DNA damage by HA20M which was largely related to the presence of mullite. The results collectively demonstrate the cytotoxic and genotoxic potential of HA20M eluate in L929 cells is dependent on particle size, concentration and composition.

Innate Immunity Sensors Participating in Pathophysiology of Joint Diseases: A Brief Overview

PubMed Central

Gallo, Jiri; Raska, Milan; Konttinen, Yrjö T.; Nich, Christophe; Goodman, Stuart B.

2015-01-01

The innate immune system consists of functionally specialized “modules” that are activated in response to a particular set of stimuli via sensors located on the surface or inside the tissue cells. These cells screen tissues for a wide range of exogenous and endogenous danger/damage-induced signals with the aim to reject or tolerate them and maintain tissue integrity. In this line of thinking, inflammation evolved as an adaptive tool for restoring tissue homeostasis. A number of diseases are mediated by a maladaptation of the innate immune response, perpetuating chronic inflammation and tissue damage. Here, we review recent evidence on the cross talk between innate immune sensors and development of rheumatoid arthritis, osteoarthritis, and aseptic loosening of total joint replacements. In relation to the latter topic, there is a growing body of evidence that aseptic loosening and periprosthetic osteolysis results from long-term maladaptation of periprosthetic tissues to the presence of by-products continuously released from an artificial joint. PMID:25747032

Arthroscopic trans-osseous rotator cuff repair

PubMed Central

Chillemi, Claudio; Mantovani, Matteo

2017-01-01

Summary Background: Mechanical factors are at the basis of any tendon healing process, being pressure an aspect able to positively influence it. For this reason transosseous rotator cuff repair represents the gold standard procedure for patients affected by a cuff tear, maximizing the tendon footprint contact area and reducing motion at the tendon to bone interface. Methods: The Authors present an all arthroscopic suture bridge-like transosseous repair with the preparation of a single transosseous tunnel perfor med thanks to a precise dedicated instrument (Compasso®) and one implant (Elite-SPK®) with the use of only 3 suture wires. In addition this technique permits to accurately prepare the bony side of the lesion without any risk or complication, such as anchor pull-out and greater tuberosity bone osteolysis. Conclusions: However, even if this technique seems less demanding, the arthroscopic transosseous repair is still an advanced procedure, and should be performed only by well prepared arthroscopic shoulder surgeons. Level of evidence: V. PMID:28717607

Interactions between bone cells and biomaterials: An update.

PubMed

Beauvais, Sabrina; Drevelle, Olivier; Jann, Jessica; Lauzon, Marc-Antoine; Foruzanmehr, Mohammadreza; Grenier, Guillaume; Roux, Sophie; Faucheux, Nathalie

2016-06-01

As the populations of the Western world become older, they will suffer more and more from bone defects related to osteoporosis (non-union fractures, vertebral damages), cancers (malignant osteolysis) and infections (osteomyelitis). Autografts are usually used to fill these defects, but they have several drawbacks such as morbidity at the donor site and the amount and quality of bone that can be harvested. Recent scientific milestones made in biomaterials development were shown to be promising to overcome these limitations. Cell interactions with biomaterials can be improved by adding at their surface functional groups such as adhesive peptides and/or growth factors. The development of such biomimetic materials able to control bone cell responses can only proceed if it is based on a sound understanding of bone cell behavior and regulation. This review focuses on bone physiology and the regulation of bone cell differentiation and function, and how the latest advances in biomimetic materials can be translated within promising clinical outcomes.

Third-generation pure alumina and alumina matrix composites in total hip arthroplasty: What is the evidence?

PubMed

Hannouche, Didier; Zingg, Matthieu; Miozzari, Hermes; Nizard, Remy; Lübbeke, Anne

2018-01-01

Wear, corrosion and periprosthetic osteolysis are important causes of failure in joint arthroplasty, especially in young patients.Ceramic bearings, developed 40 years ago, are an increasingly popular choice in hip arthroplasty. New manufacturing procedures have increased the strength and reliability of ceramic materials and reduced the risk of complications.In recent decades, ceramics made of pure alumina have continuously improved, resulting in a surgical-grade material that fulfills clinical requirements.Despite the track record of safety and long-term results, third-generation pure alumina ceramics are being replaced in clinical practice by alumina matrix composites, which are composed of alumina and zirconium.In this review, the characteristics of both materials are discussed, and the long-term results with third-generation alumina-on-alumina bearings and the associated complications are compared with those of other available ceramics. Cite this article: EFORT Open Rev 2018;3:7-14. DOI: 10.1302/2058-5241.3.170034.

The 5-year Results of an Oxidized Zirconium Femoral Component for TKA

PubMed Central

Innocenti, Massimo; Carulli, Christian; Matassi, Fabrizio; Villano, Marco

2009-01-01

Osteolysis secondary to polyethylene wear is one of the major factors limiting long-term performance of TKA. Oxidized zirconium is a new material that combines the strength of a metal with the wear properties of a ceramic. It remains unknown whether implants with a zirconium femoral component can be used safely in TKA. To answer that question, we reviewed, at a minimum of 5 years, the clinical outcome and survivorship of a ceramic-surfaced oxidized zirconium femoral component implanted during 98 primary TKAs between April 2001 and December 2003. Survivorship was 98.7% at 7 years postoperatively. No revision was necessary and only one component failed because of aseptic loosening. Mean Knee Society score improved from 36 to 89. No adverse events were observed clinically or radiologically. These results justify pursuing the use of oxidized zirconium as an alternative bearing surface for a femoral component in TKA. Level of Evidence: Level IV, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence. PMID:19798541

Inflammation, Fracture and Bone Repair

PubMed Central

Loi, Florence; Córdova, Luis A.; Pajarinen, Jukka; Lin, Tzu-hua; Yao, Zhenyu; Goodman, Stuart B.

2016-01-01

The reconstitution of lost bone is a subject that is germane to many orthopaedic conditions including fractures and non-unions, infection, inflammatory arthritis, osteoporosis, osteonecrosis, metabolic bone disease, tumors, and periprosthetic particle-associated osteolysis. In this regard, the processes of acute and chronic inflammation play an integral role. Acute inflammation is initiated by endogenous or exogenous adverse stimuli, and can become chronic in nature if not resolved by normal homeostatic mechanisms. Dysregulated inflammation leads to increased bone resorption and suppressed bone formation. Crosstalk amongst inflammatory cells (polymorphonuclear leukocytes and cells of the monocyte-macrophage-osteoclast lineage) and cells related to bone healing (cells of the mesenchymal stem cell-osteoblast lineage and vascular lineage) is essential to the formation, repair and remodeling of bone. In this review, the authors provide a comprehensive summary of the literature related to inflammation and bone repair. Special emphasis is placed on the underlying cellular and molecular mechanisms, and potential interventions that can favorably modulate the outcome of clinical conditions that involve bone repair. PMID:26946132

MicroRNA Transfer between Bone Marrow Adipose and Multiple Myeloma Cells

PubMed Central

Soley, Luna; Falank, Carolyne; Reagan, Michaela R.

2017-01-01

Purpose of Review Multiple myeloma remains an incurable disease, largely due to the tumor-supportive role of the bone marrow microenvironment. Bone marrow adipose tissue (BMAT) is one component of the fertile microenvironment which is believed to contribute to myeloma progression and drug resistance, as well as participate in a vicious cycle of osteolysis and tumor growth. Recent Findings MicroRNAs (miRNAs) have recently emerged as instrumental regulators of cellular processes that enable the development and dissemination of cancer. This review highlights the intersection between two emerging research fields and pursues the scientific and clinical implications of miRNA transfer between BMAT and myeloma cells. Summary This review provides a concise and provocative summary of the evidence to support exosome-mediated transfer of tumor-supportive miRNAs. The work may prompt researchers to better elucidate the mechanisms by which this novel means of genetic communication between tumor cells and their environment could someday yield targeted therapeutics. PMID:28432594

Digital ulcers and cutaneous subsets of systemic sclerosis: Clinical, immunological, nailfold capillaroscopy, and survival differences in the Spanish RESCLE Registry.

PubMed

Tolosa-Vilella, Carles; Morera-Morales, Maria Lluisa; Simeón-Aznar, Carmen Pilar; Marí-Alfonso, Begoña; Colunga-Arguelles, Dolores; Callejas Rubio, José Luis; Rubio-Rivas, Manuel; Freire-Dapena, Maika; Guillén-Del Castillo, Alfredo; Iniesta-Arandia, Nerea; Castillo-Palma, Maria Jesús; Egurbide-Arberas, Marivi; Trapiellla-Martínez, Luis; Vargas-Hitos, José A; Todolí-Parra, José Antonio; Rodriguez-Carballeira, Mónica; Marin-Ballvé, Adela; Pla-Salas, Xavier; Rios-Blanco, Juan José; Fonollosa-Pla, Vicent

2016-10-01

Digital ulcers (DU) are the most common vascular complication of systemic sclerosis (SSc). We compared the characteristics between patients with prior or current DU with those never affected and evaluated whether a history of DU may be a predictor of vascular, organ involvement, and/or death in patients with SSc. Data from SSc patients with or without prior or current DU were collected by 19 referral centers in an ongoing registry of Spanish SSc patients, named Registro de ESCLErodermia (RESCLE). Demographics, organ involvement, autoimmunity features, nailfold capillary pattern, survival time, and causes of death were analyzed to identify DU related characteristics and survival of the entire series and according to the following cutaneous subsets-diffuse cutaneous SSc (dcSSc), limited cutaneous SSc (lcSSc), and SSc sine scleroderma (ssSSc). Out of 1326, 552 patients enrolled in the RESCLE registry had prior or current DU, 88% were women, the mean age was 50 ± 16 years, and the mean disease duration from first SSc symptom was 7.6 ± 9.6 years. Many significant differences were observed in the univariate analysis between patients with and without prior/current DU. Multivariate analysis identified that history of prior/current DU in patients with SSc was independently associated to younger age at SSc diagnosis, diffuse cutaneous SSc, peripheral vascular manifestations such Raynaud's phenomenon, telangiectasia, and acro-osteolysis but no other vascular features such as pulmonary arterial hypertension or scleroderma renal crisis. DU was also associated to calcinosis cutis, interstitial lung disease, as well as worse survival. Multivariate analysis performed in the cutaneous subsets showed that prior/current DU were independently associated: (1) in dcSSc, to younger age at SSc diagnosis, presence of telangiectasia and calcinosis and rarely a non-SSc pattern on nailfold capillaroscopy; (2) in lcSSc, to younger age at SSc diagnosis, presence of Raynaud's phenomenon as well as calcinosis cutis, interstitial lung disease, and higher incidence of death from all causes; and (3) in ssSSc, to younger age at first SSc symptom and greater incidence of death from all causes. Digital ulcers develop in patients with SSc younger at diagnosis, mainly in patients with dcSSc and lcSSc, and they are associated to other peripheral vascular manifestations such as Raynaud's phenomenon, telangiectasia, and acro-osteolysis but also to calcinosis, and interstitial lung disease. History of DU in SSc leads to worse survival, also noticeable for lcSSc and ssSSc subsets but not for dcSSc patients. Copyright © 2016 Elsevier Inc. All rights reserved.

Long-term clinical outcomes and survivorship of press-fit condylar sigma fixed-bearing and mobile-bearing total knee prostheses in the same patients.

PubMed

Kim, Young-Hoo; Park, Jang-Won; Kim, Jun-Shik; Kulkarni, Sourabh S; Kim, Yoon-Hong

2014-10-01

We are aware of no study that has compared press-fit condylar Sigma fixed-bearing and mobile-bearing total knee prostheses in the same patients after more than ten years of follow-up. The purpose of the current study was to compare these two implants with respect to the functional and radiographic results, prevalence of osteolysis, and overall revision rates at a mean of 12.1 years of follow-up. The study consisted of a consecutive series of 444 patients (mean age [and standard deviation], 66.5 ± 7.4 years) who underwent simultaneous bilateral total knee arthroplasty, with one side treated immediately after the other. All of the patients received a press-fit condylar Sigma mobile-bearing prosthesis on one side and a press-fit condylar Sigma fixed-bearing prosthesis on the contralateral side. The minimum duration of follow-up was ten years (mean, 12.1 years; range, ten to thirteen years). At the time of each follow-up visit, the patients were assessed clinically and radiographically. Postoperative total knee scores (95 and 94 points), Western Ontario and McMaster Universities Osteoarthritis Index (19 and 18 points), University of California, Los Angeles activity score (both prostheses, 5 points), range of motion (129° ± 6.3° and 127° ± 6.8°), and radiographic findings did not differ significantly between the press-fit condylar Sigma mobile and fixed-bearing designs at the final follow-up. The prevalence of aseptic loosening (1.4% and 1.8%) did not differ significantly between the mobile and fixed-bearing implant designs. No knee in either group had osteolysis. The estimated survival rate with revision as the end point was 98.2% (95% confidence interval, 91% to 99%) and 97.5% (95% confidence interval, 91% to 99%) at 12.1 years for the mobile and fixed-bearing implant groups, respectively. The results of the present long-term clinical study suggest that excellent clinical and radiographic results were achieved with both the press-fit condylar Sigma mobile and fixed-bearing cruciate-retaining total knee designs. We found no significant clinical advantage for a mobile-bearing over a fixed-bearing total knee prosthesis. Therapeutic Level II. See Instructions for Authors for a complete description of levels of evidence. Copyright © 2014 by The Journal of Bone and Joint Surgery, Incorporated.

A femoral component inserted without cement in total hip arthroplasty. A study of the Tri-Lock component with an average ten-year duration of follow-up.

PubMed

Burt, C F; Garvin, K L; Otterberg, E T; Jardon, O M

1998-07-01

Seventy-four total hip arthroplasties in sixty-six patients were performed, between 1983 and 1986, with use of a Tri-Lock femoral component inserted without cement. This tapered cobalt-chromium component has a fixed head and a circumferential proximal porous coating. Follow-up was conducted with use of a questionnaire, physical examination, and radiographic analysis. At the time of the latest follow-up, fifteen patients (eighteen hips) had died, three patients (four hips) had been lost to follow-up, and one patient (one hip) had refused to participate in the follow-up study; however, the status of fifteen hips at the time of death could be verified. Thus, clinical follow-up data were available for sixty-six of the original seventy-four hips. The average age at the time of the operation was sixty-two years (range, seventeen to eighty-four years), and the average interval between the operation and the latest follow-up evaluation was 10.0 years (range, 8.3 to 11.6 years). The Harris hip score was determined for forty-three hips (forty-one patients) in which the prosthesis was in situ at the time of the latest follow-up. The score was good for thirteen hips and excellent for twenty-eight, so the rate of clinical success was 95 per cent. Two patients had a fair result. One of them had persistent pain and the other had limited motion, but neither had radiographic evidence of loosening of the femoral or acetabular component. All forty-one patients were satisfied with the result. The probability (with standard error) of survival of the femoral component at ten years, with revision as the end point, was 0.95 +/- 0.03. The rate of revision of the femoral component because of aseptic loosening was one (2 per cent) of sixty-six. The overall rate of aseptic loosening of the femoral component in the hips that were followed radiographically was two (4 per cent) of forty-seven. Only one (2 per cent) of the forty-seven acetabular cups had evidence of aseptic loosening. There was no radiographic evidence of distal osteolysis around the prostheses that were well fixed. Proximal osteolysis was present in five (11 per cent) of forty-seven hips, but none of the lesions compromised the stability of the prosthesis or the bone and there were no associated fractures. At an average of ten years postoperatively, the Tri-Lock femoral component functioned well overall and patient satisfaction was high.

Haemangiosarcoma of the os penis in a dog: The most common neoplasm of the canine penis.

PubMed

Burchell, Richard K; Kirberger, Robert M; Janse van Rensberg, Drienie D Didi

2014-08-21

A castrated 9-year-old intact male boerboel cross-breed dog was presented with a month-long history of stranguria. On physical examination, a mass was noted at the caudal extremity of the os penis. Haematology, serum chemistry and urinalysis were all unremarkable. Abdominal and urethral ultrasound demonstrated an enlarged bladder and a dilated urethra, which was followed to the caudal extremity of the os penis. A hyperechoic, roughly spherical,vascularised mass was noted at the caudal os penis, which resulted in obstruction of the penile urethra. Radiographs demonstrated a soft tissue mass with osteolysis of the os penis. Cytology suggested an osteosarcoma. Treatment included amputation of the penis and adjuvant doxorubicin with carboplatin. Histopathology of the penis confirmed a haemangiosarcoma. The patient survived for 20 months. This is only the second published case report describing a penile haemangiosarcoma, and the first published report demonstrating the treatment and outcome of a case of haemangiosarcoma of the os penis. Based on published and unpublished reports, haemangiosarcoma appears to be the most common neoplasm of the canine penis.

Prosthetic liner wear in total hip replacement: a longitudinal 13-year study with computed tomography.

PubMed

Weidenhielm, Lars; Olivecrona, Henrik; Maguire, Gerald Q; Noz, Marilyn E

2018-06-01

This case report follows a woman who had a total hip replacement in 1992 when she was 45 years old. Six serial computed tomography (CT) examinations over a period of 13 years provided information that allowed her revision surgery to be limited to liner replacement as opposed to replacement of the entire prosthesis. Additionally, they provided data that ruled out the presence of osteolysis and indeed none was found at surgery. In 2004, when the first CT was performed, the 3D distance the femoral head had penetrated into the cup was determined to be 2.6 mm. By 2017, femoral head penetration had progressed to 5.0 mm. The extracted liner showed wear at the thinnest part to be 5.5 mm, as measured with a micrometer. The use of modern CT techniques can identify problems, while still correctable without major surgery. Furthermore, the ability of CT to assess the direction of wear revealed that the liner wear changed from the cranial to dorsal direction.

Metal-on-metal hip resurfacing: correlation between clinical and radiological assessment, metal ions and ultrasound findings.

PubMed

Scaglione, M; Fabbri, L; Bianchi, N; Dell'Omo, D; Guido, G

2015-04-01

We report the clinical, radiological and wear analysis of 52 consecutive MoM hip resurfacings (performed on 49 younger patients) to a mean follow-up of 9.2 years. Every patient underwent X-ray and clinical evaluation (HHS). Ultrasonography of the hip was performed in all patients in order to identify possible cystic or solid mass in periprosthetic tissue. In case of mass >20 mm, further MRI was performed to better analyse the characteristics of lesion. Five patients (five hips) had a revision. The overall survival rate was 90.38 %. The average HHS at follow-up examination was 95.5 points. No progressive radiolucent areas and no sclerosis or osteolysis around the implants were found. The US and RMI imaging showed a pseudotumour formation in two patients (correlated with high metal ion levels in blood and urine), both asymptomatic. A significant positive correlation between inclination of the acetabular component and serum metal ion levels was found (r = 0.64 and r = 0.62 for cobalt and chromium, respectively).

Nasal Granuloma Caused by Scedosporium apiospermum in a Dog

PubMed Central

Cabañes, F. J.; Roura, X.; García, F.; Domingo, M.; Abarca, M. L.; Pastor, J.

1998-01-01

A 10-month-old male American Staffordshire terrier was presented to the Autonomous University of Barcelona Veterinary Teaching Hospital because of a 6-month history of a mucopurulent bilateral nasal discharge. The dog had not responded to antibiotics. A follow-up X ray revealed a mixed pattern of osteolysis and increased radiodensity confined to the nasal cavity. Histologic sections of the biopsy specimens revealed the presence of granules containing numerous septate hyphae that were hyaline to pale brown and smooth, one-celled, subspherical-to-elongate conidia that were hyaline to brownish green, and bacteria. Cultures yielded numerous colonies belonging to Scedosporium apiospermum. Susceptibility tests were performed on the isolated strain. The isolate was sensitive to ketoconazole, intermediate to clotrimazole, and resistant to amphotericin B, 5-fluorocytosine, fluconazole, and itraconazole. The dog was treated with oral ketoconazole. During the treatment a general improvement in the lesions was observed. To our knowledge, S. apiospermum has not been implicated previously as an etiologic agent of nasal disease in dogs. This report provides its first description as such. PMID:9705431

Klippel-Trenaunay syndrome in a Border collie.

PubMed

de Cock, H; Mols, N; van Roy, M R; Ducatelle, R; Simoens, P

1996-10-01

A Border collie was presented at the age of 9 weeks with several lesions of the right forelimb, including a reddish-blue haemangiomatous macula in the medio-dorsal part of the elbow, multiple, scattered small cavernous haemangioma-like lesions at the plantar part of the foot and a general hypertrophy of the limb. X-rays of the limb showed osteolysis. On skin biopsy, telangiectatic veins were observed. The rest of the body did not show any skin lesions or hypertrophy. The dog was otherwise healthy. Due to the extension of the lesions and worsening of the limb swelling, it was decided to amputate the affected limb. The dog remained healthy for 2 weeks, but then passed through episodes of anaemia, and finally died suddenly with signs of shock. Dissection of the limb after amputation revealed hypoplasia and aplasia of the deep venous system in the lower part of the leg. No arterio-venous shunts were noticed. ln man, this syndrome, characterised by an insufficiently developed deep venous system associated with local overgrowth of the limb and cutaneous telangiectasia, is known as Klippel-Trenaunay syndrome.

Acro-osteolysis as an indicator of severity in systemic sclerosis.

PubMed

Arana-Ruiz, Juan Carlos; Amezcua-Guerra, Luis Manuel

2016-01-01

Systemic sclerosis is a rare disease that predominantly affects women. The Medsger severity scale has been used to assess the severity, but it requires expensive and poorly accessible studies and it does not include complications such acrosteolysis, calcinosis, pericardial disease or hypothyroidism that occur on a relatively frequent basis in this disease. There is no study that considers if comorbidities, such as primary biliary cirrhosis, are related to gravity. To determine the correlation between severity and the presence of such complications. 40 patients with systemic sclerosis, dividing them into tertiles according to severity were studied. Dichotomous variables were described using percentages, while dimensional by averages+SD. Statistical inference was performed using chi square test or Kruskal-Wallis test with Dunn post-test, as appropriate. A significance at P<.05 was set. Of all the complications studied there were only differences in severity with acrosteolysis. Within comorbidities, primary biliary cirrhosis is not associated with gravity. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

Interventional radiology in bone metastases.

PubMed

Chiras, J; Shotar, E; Cormier, E; Clarençon, F

2017-11-01

Interventional radiology plays a significant role in the treatment of bone metastases by various techniques, percutaneous or endovascular. Vertebroplasty is the most well-studied technique for stabilisation of spine metastases as it induces satisfactory stabilisation of the vertebra and offers clear improvement of the quality of life. Due to the success of this technique cementoplasty of other bones, mainly pelvic girdle, has been largely developed. The development of reinforced cementoplasty allows treatment of pre-fractural osteolysis of some long bones. The heat due to the polymerisation of the cement induces carcinolytic effect but this effect is not as important as that which results from radiofrequency destruction. This last technique appears currently as the most important development to definitively destroy bone metastases and is progressively replacing percutaneous alcoholic destruction of such lesions. Angiographic techniques, such as endovascular embolisation, can also be very useful to reduce the risk of surgical treatment of hyper vascular metastases. Chemoembolisation is currently developed to associate pain relief induced by Endovascular embolisation and the carcinolytic effect obtained by local endovascular chemotherapy. All these techniques should develop largely during the next years. © 2017 John Wiley & Sons Ltd.

The use of osteochondral allograft with bone marrow-derived mesenchymal cells and hinge joint distraction in the treatment of post-collapse stage of osteonecrosis of the femoral head.

PubMed

Gagala, J; Tarczynska, M; Gaweda, K; Matuszewski, L

2014-09-01

Osteonecrosis of the femoral head is an entity which occurs mainly in young and active patients aged between 20 and 50. The success of hip joint preserving treatments ranges from 15% to 50% depending on the stage and amount of osteonecrotic lesion. Total hip replacement is indicated in late post-collapse hips but it has unsatisfactory survival because of the wear and osteolysis in young and active patients. Osteochondral allografts have been reported in the treatment of large articular lesions with defects in underlying bone in knee, talus and shoulder. By combining osteoconductive properties of osteochondral allograft with osteogenic abilities of bone marrow-derived mesenchymal cells it has a potential to be an alternative to an autologous graft. The adjunct of hinged joint distraction should minimize stresses in subchondral bone to promote creeping substitution and prevent femoral head collapse. Unlike current treatment modalities, it would provide both structural support and allow bony and articular substitution. Copyright © 2014 Elsevier Ltd. All rights reserved.

Gravimetric wear analysis and particulate characterization of bilateral facet-augmentation system--PercuDyn™.

PubMed

Bhattacharya, Sanghita; Nayak, Aniruddh; Goel, Vijay K; Warren, Chris; Schlaegle, Steve; Ferrara, Lisa

2010-01-01

Dynamic stabilization systems are emerging as an alternative to fusion instrumentation. However, cyclic loading and micro-motion at various interfaces may produce wear debris leading to adverse tissue reactions such as osteolysis. Ten million cycles of wear test was performed for PercuDyn™ in axial rotation and the wear profile and the wear rate was mapped. A validation study was undertaken to assess the efficiency of wear debris collection which accounted for experimental errors. The mean wear debris measured at the end of 10 million cycles was 4.01 mg, based on the worst-case recovery rate of 68.2%. Approximately 40% of the particulates were less than 5 μm; 92% less than 10 μm. About 43% of particulates were spherical in shape, 27% particulates were ellipsoidal and the remaining particles were of irregular shapes. The PercuDyn™ exhibited an average polymeric wear rate of 0.4 mg/million cycles; substantially less than the literature derived studies for other motion preservation devices like the Bryan disc and Charité disc. Wear debris size and shape were also similar to these devices.

Long term survival of an hydroxyapatite-coated threaded cup in the presence of a high polythene wear rate.

PubMed

Datir, Sandeep P; Angus, Peter D

2010-01-01

We describe the long term clinical results and polythene wear rate measurement of 144 uncemented total hip arthroplasties in 118 patients (Male: Female-65: 53, Mean age: 52.8 years (range 21-78 years) performed between 1988 and 2000 using the Furlong HAC coated threaded acetabular cup. The mean follow-up for the group was 10.2 years (range: 5-17.5, median: 9.7). One femoral stem and two acetabular shells were revised due to aseptic loosening. The mean polythene wear rate was 0.24 mm/year. Ten-year survival for the acetabular and femoral components with radiological evidence of aseptic loosening as an end point was 99.15 (CI: 98.3-99.9) and 99.28 (CI: 98.5-99.9). There was no evidence of osteolysis around the femoral or acetabular components in spite of a relatively high polythene wear rate (0.24 mm/year). Our study demonstrates excellent survival of threaded HAC coated acetabular sockets at 10 years in spite of a relatively high polythene wear rate.

Bearing-Foreign Material Deposition on Retrieved Co-Cr Femoral Heads: Composition and Morphology

PubMed Central

Tikekar, Nishant M.; Heiner, Anneliese D.; Baer, Thomas E.; Kruger, Karen M.; Callaghan, John J.; Brown, Thomas D.; Lannutti, John J.

2015-01-01

Bearing-foreign material deposition onto a femoral head can occur from contact with an acetabular shell due to dislocation, reduction, or subluxation. The purpose of this study was to comprehensively characterize deposit regions on retrieved cobalt-chrome femoral heads from metal-on-polyethylene total hip arthroplasties that had experienced such adverse events. The morphology, topography, and composition of deposition regions were characterized using macrophotography, optical profilometry, scanning electron microscopy, energy dispersive spectroscopy, and X-ray photoelectron spectroscopy. The deposit areas were relatively large, they were much rougher than the surrounding undamaged clean areas, and they displayed several distinct morphologies. Titanium alloy elements were the predominant constituents. Calcium and phosphorous were also detected within the deposit areas, in a composition that could nucleate abrasive hydroxyapatite. In addition, tungsten-rich particles, likely present as tungsten carbide, were observed on top of the titanium deposits. The increased roughness associated with these deposition features would be expected to accelerate damage and wear of the opposing liner and hence accelerate the development of osteolysis. PMID:26236744

The biological response to orthopedic implants for joint replacement. II: Polyethylene, ceramics, PMMA, and the foreign body reaction

PubMed Central

Gibon, Emmanuel; Córdova, Luis A.; Lu, Laura; Lin, Tzu-Hua; Yao, Zhenyu; Hamadouche, Moussa; Goodman, Stuart B.

2017-01-01

Novel evidence-based prosthetic designs and biomaterials facilitate the performance of highly successful joint replacement (JR) procedures. To achieve this goal, constructs must be durable, biomechanically sound, and avoid adverse local tissue reactions. Different biomaterials such as metals and their alloys, polymers, ceramics, and composites are currently used for JR implants. This review focuses on (1) the biological response to the different biomaterials used for TJR and (2) the chronic inflammatory and foreign-body response induced by byproducts of these biomaterials. A homeostatic state of bone and surrounding soft tissue with current biomaterials for JR can be achieved with mechanically stable, infection free and intact (as opposed to the release of particulate or ionic byproducts) implants. Adverse local tissue reactions (an acute/chronic inflammatory reaction, periprosthetic osteolysis, loosening and subsequent mechanical failure) may evolve when the latter conditions are not met. This article (Part 2 of 2) summarizes the biological response to the non-metallic materials commonly used for joint replacement including polyethylene, ceramics, and polymethylmethacrylate (PMMA), as well as the foreign body reaction to byproducts of these materials. PMID:27080740

Unusual presentation of a metastatic uveal melanoma in a cat.

PubMed

Planellas, Marta; Pastor, Josep; Torres, Ma Dolores; Peña, Teresa; Leiva, Marta

2010-11-01

A 10 year-old, spayed female Domestic Short-Haired (DSH) cat was diagnosed with a large primary uveal melanoma and exenteration was recommended. Thoracic radiographs, abdominal ultrasonography, and complete blood count and serum biochemistry panel did not reveal any abnormality compatible with metastatic disease and surgery was performed. Histopathologic study of the eye confirmed a diffuse iris melanoma. Five months later, the cat presented with a lameness of the right anterior extremity. On physical exam the right elbow was swollen and painful. Radiographs showed a severe osteolysis of the radial head and proximal diaphysis. Fine needle aspiration of the radius head identified a round cell neoplasm with scattered cells containing intracytoplasmatic pigmented granules, compatible with metastatic melanoma. The owners decided not to treat the patient with chemotherapy and declined a biopsy. Two months later, the cat died and necropsy was performed confirming bone metastasis of the uveal melanoma. A diagnosis of generalized metastasis from primary diffuse iris melanoma was made. This report describes, for the first time, long bone metastasis from an uveal melanoma in a cat. © 2010 American College of Veterinary Ophthalmologists.

Anterior knee symptoms after S-ROM hinge implantation.

PubMed

Deehan, David J; Gangadharan, Rajkumar; Malviya, Ajay; Sutherland, Alasdair; Holland, James P

2014-01-01

To evaluate the performance of a canal filling hinge device for complex knee arthroplasty. Thirty-seven (4 primary hinge implantation and 33 revision cases) patients who had undergone arthroplasty with the S-ROM third generation hinge device for a combination of massive bone loss or ligamentous insufficiency were prospectively examined with a minimum of 5-year follow-up. Median age at surgery was 72 years (range: 43 to 87 years). Principal indications included aseptic loosening or massive osteolysis (24 cases), infection (8 cases) and periprosthetic fracture (4 cases). All patients exhibited either grade 2 (N = 12) or grade 3 (N = 25) AORI bone loss or a grade 3 medial ligament deficiency. One patient experienced implant failure (71 months), and one patient suffered late deep infection (36 months). Mean WOMAC score improved from 27 to 62. Four patients required patellar resurfacing for persistent pain. The 5-year survivorship was 86%. While the S-ROM device may offer satisfactory medium term outcome for complex end stage knee disease, we report a high rate of debilitating anterior knee symptoms.

Comparison of fusion rate and clinical results between CaO-SiO2-P2O5-B2O3 bioactive glass ceramics spacer with titanium cages in posterior lumbar interbody fusion.

PubMed

Lee, Jae Hyup; Kong, Chang-Bae; Yang, Jae Jun; Shim, Hee-Jong; Koo, Ki-Hyoung; Kim, Jeehyoung; Lee, Choon-Ki; Chang, Bong-Soon

2016-11-01

The CaO-SiO 2 -P 2 O 5 -B 2 O 3 glass ceramics spacer generates chemical bonding to adjacent bones with high mechanical stability to produce a union with the end plate, and ultimately stability. The authors aimed to compare the clinical efficacy and safety of CaO-SiO 2 -P 2 O 5 -B 2 O 3 glass ceramics with a titanium cage that is widely used for posterior lumbar interbody fusion (PLIF) surgery in the clinical field. This is a prospective, stratified randomized, multicenter, single-blinded, comparator-controlled non-inferiority trial. The present study was conducted in four hospitals and enrolled a total of 86 patients between 30 and 80 years of age who required one-level PLIF due to severe spinal stenosis, spondylolisthesis, or huge disc herniation. The Oswestry Disability Index (ODI), Short Form-36 Health Survey (SF-36), and pain visual analog scale (VAS) were assessed before surgery and at 3, 6, and 12 months after surgery. The spinal fusion rate was assessed at 6 and 12 months after surgery. The spinal fusion rate and the area of fusion, subsidence of each CaO-SiO 2 -P 2 O 5 -B 2 O 3 glass ceramics and titanium cage, and the extent of osteolysis were evaluated using a dynamic plain radiography and a three-dimensional computed tomography at 12 months after surgery. The present study was supported by BioAlpha, and some authors (JHL, C-KL, and B-SC) have stock ownership (<10,000 US dollars). From the plain radiography results, the 6-month fusion rates for the bioactive glass ceramics group and the titanium group were 89.7% and 91.4%, respectively. In addition, the 12-month fusion rates based on CT scan were 89.7% and 91.2%, respectively, showing no significant difference. However, the bone fusion area directly attached to the end plate of either bioactive glass ceramics or the titanium cage was significantly higher in the bioactive glass ceramics group than in the titanium group. The ODI, SF-36, back pain, and lower limb pain in both groups significantly improved after surgery, with no significant differences between the groups. No significant differences between the two groups were observed in the extent of subsidence and osteolysis. In lumbar posterior interbody fusion surgery, CaO-SiO 2 -P 2 O 5 -B 2 O 3 glass ceramics spacer showed a similar fusion rates and clinical outcomes compared with titanium cage. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Comparison of Hydroxyapatite-coated stems in total hip arthroplasty after a minimum 10-years follow-up.

PubMed

Gallo, J; Landor, I; Cechová, I; Jahoda, D

2008-10-01

PURPOSE OF THE STUDY Hydroxypatite coating (HAC) was introduced into total hip arthroplasty (THA) practice to improve the fixation interface between bone and prosthesis. To test this assumption however, long-term follow-up investigations are needed. In this study, we present data for two consecutive series of THA stems with HAC and a minimum ten-year follow-up. MATERIAL Overall, 249 patients (271 hips) were included in the study, of these 122 (135 hips) had Walter hip arthroplasty (WHA group) with a two-layered TiO2/HAC at the proximal part of the stem and 127 (136 hips) had ABG I prostheses (ABG I group) with a single-layered HAC at the proximal part of the stem. Mean length of follow-up was 11.4 years (0.8-13) and 9.8 years (4-12) in WHA and ABG I groups, respectively. Mean age at the time of surgery was 62 years (23-79) and 47 years (21-65) in WHA and ABG I groups, respectively. METHODS Probabilities of implant survival were estimated using the Kaplan-Meier method. Radiographic data were included to construct the worst-case scenario. Differences in survival curves were evaluated by Gehan's Wilcoxon test. Harris hip score was used to compare preoperative status with that of final follow-up. RESULTS The overall survival of WHA was significantly better than the ABG I (0.85 versus 0.66; p < 0.05). The main reason for a high revision rate in ABG I was periprosthetic osteolysis followed by aseptic loosening. With regard to stems, the survivorship curve for the Walter stem was significantly better than for the ABG I stem even when radiographic results were included (p = 0.0002). In the WHA group, two stems (1.5%) were revised due to sepsis, in contrast to thirty-one stems (23.5%) revised in the ABG I group due to osteolysis and aseptic loosening (p < 0.05). Significant improvement was achieved in both groups under study in terms of Harris hip score. DISCUSSION Data presented here appear surprising at first glance because the differences between the stems under study are only minor. The failure in ABG I was most probably caused by poor polyethylene quality and poor locking mechanism of polyethylene liner in the metallic shell. In addition, HAC used in ABG I prosthesis was not able to prevent the development of polyethylene disease stimulated by high wear rate. CONCLUSION This study revealed excellent survivorship for WHA stems after a minimum ten-year survival and significantly poorer survivorship for the ABG I stems.This may be explained at least particularly by combined two-layered HAC used in WHA stems which provide simultaneously endurable bone interlocking and effective barrier against expansion of polyethylene disease.

Comparative study of open and arthroscopic coracoid transfer for shoulder anterior instability (Latarjet)-clinical results at short term follow-up.

PubMed

Kordasiewicz, Bartłomiej; Małachowski, Konrad; Kicinski, Maciej; Chaberek, Sławomir; Pomianowski, Stanisław

2017-05-01

The aim of this study was to compare early clinical results after open and arthroscopic Latarjet stabilisation in anterior shoulder instability. Our hypothesis was the results of arthroscopic stabilisation were comparable with the results of open procedure. The clinical results of the patients after primary Latarjet procedure were analysed. Patients operated on between 2006 and 2011 using an open technique composed the OPEN group and patients operated on arthroscopically between 2011 and 2013 composed the ARTHRO group; 48 out of 55 shoulders (87%) in OPEN and 62 out of 64 shoulders (97%) in ARTHRO were available to follow-up. The average age at surgery was 28 years in OPEN and 26 years in ARTHRO. The mean follow-up was 54.2 months in OPEN and 23.4 months in ARTHRO. Intra-operative data were analysed regarding time of surgery, concomitant lesions and complications. Patient results were assessed with Walch-Duplay, Rowe, VAS scores and subjective self-evaluation of satisfaction and shoulder function. Computed tomography scan evaluation was used to assess the graft healing. Average time of surgery was significantly shorter in ARTHRO than OPEN: respectively 110 and 120 minutes. The number of intra-operative complications was six (12.5%) in OPEN and five (8.1%) in ARTHRO. The results were comparable in both groups, with no significant difference between OPEN and ARTHRO group: satisfaction rate - 96.8% and 91.9%, shoulder function - 92.2% and 90%, Walch-Duplay score - 83.9 and 76.7 respecively. A significant difference was reported in Rowe score: 87.8 in OPEN and 78.9 in ARTHRO. Another significant difference was found in the presence of "subjective apprehension"-a term referring to the subjective perception of instability with no signs of instability at clinical examination - 28.7% in OPEN and 50% in ARTHRO. Range of motion in both groups were comparable, however patients in OPEN had significantly lower loss of external rotation in adduction to the side comparing to the contralateral shoulder: 7° versus 14° in ARTHRO. Recurrence was reported in three cases in each group: 6.2% in OPEN and 4.8% in ARTHRO. A revision surgery was performed in four patients (9.3%) in OPEN and six (9.7%) in ARTHRO. Radiographic evaluation showed a significantly lower rate (5%) of graft healing problems (fracture, non-union and osteolysis) after arthroscopic stabilisation, however a partial osteolysis of the proximal part of the bone block was significantly more frequent (53.5%). The arthroscopic Latarjet stabilisation showed satisfactory and comparable results to open procedure. We recommend further investigation and development of arthroscopic technique. III.

Clinical and Radiographic Outcomes of the Simpliciti Canal-Sparing Shoulder Arthroplasty System: A Prospective Two-Year Multicenter Study.

PubMed

Churchill, R Sean; Chuinard, Christopher; Wiater, J Michael; Friedman, Richard; Freehill, Michael; Jacobson, Scott; Spencer, Edwin; Holloway, G Brian; Wittstein, Jocelyn; Lassiter, Tally; Smith, Matthew; Blaine, Theodore; Nicholson, Gregory P

2016-04-06

Stemmed humeral components have been used since the 1950s; canal-sparing (also known as stemless) humeral components became commercially available in Europe in 2004. The Simpliciti total shoulder system (Wright Medical, formerly Tornier) is a press-fit, porous-coated, canal-sparing humeral implant that relies on metaphyseal fixation only. This prospective, single-arm, multicenter study was performed to evaluate the two-year clinical and radiographic results of the Simpliciti prosthesis in the U.S. One hundred and fifty-seven patients with glenohumeral arthritis were enrolled at fourteen U.S. sites between July 2011 and November 2012 in a U.S. Food and Drug Administration (FDA) Investigational Device Exemption (IDE)-approved protocol. Their range of motion, strength, pain level, Constant score, Simple Shoulder Test (SST) score, and American Shoulder and Elbow Surgeons (ASES) score were compared between the preoperative and two-year postoperative evaluations. Statistical analyses were performed with the Student t test with 95% confidence intervals. Radiographic evaluation was performed at two weeks and one and two years postoperatively. One hundred and forty-nine of the 157 patients were followed for a minimum of two years. The mean age and sex-adjusted Constant, SST, and ASES scores improved from 56% preoperatively to 104% at two years (p < 0.0001), from 4 points preoperatively to 11 points at two years (p < 0.0001), and from 38 points preoperatively to 92 points at two years (p < 0.0001), respectively. The mean forward elevation improved from 103° ± 27° to 147° ± 24° (p < 0.0001) and the mean external rotation, from 31° ± 20° to 56° ± 15° (p < 0.0001). The mean strength in elevation, as recorded with a dynamometer, improved from 12.5 to 15.7 lb (5.7 to 7.1 kg) (p < 0.0001), and the mean pain level, as measured with a visual analog scale, decreased from 5.9 to 0.5 (p < 0.0001). There were three postoperative complications that resulted in revision surgery: infection, glenoid component loosening, and failure of a subscapularis repair. There was no evidence of migration, subsidence, osteolysis, or loosening of the humeral components or surviving glenoid components. The study demonstrated good results at a minimum of two years following use of the Simpliciti canal-sparing humeral component. Clinical results including the range of motion and the Constant, SST, and ASES scores improved significantly, and radiographic analysis showed no signs of loosening, osteolysis, or subsidence of the humeral components or surviving glenoid components. Therapeutic Level IV. See Instructions for Authors for a complete description of levels of evidence. Copyright © 2016 by The Journal of Bone and Joint Surgery, Incorporated.

Gorham-Stout syndrome of the facial bones: a review of pathogenesis and treatment modalities and report of a case with a rare cutaneous manifestations.

PubMed

Al-Jamali, Jamil; Glaum, Ricarda; Kassem, Ahmed; Voss, Pit Jacob; Schmelzeisen, Rainer; Schön, Ralf

2012-12-01

Gorham disease is a very rare condition associated with spontaneous destruction and resorption of 1 or more bones anywhere in the body. Many authors have suggested and/or implicated trauma as the initiating factor in the majority of the reported cases. It can affect almost all bones, and a combination of bones has been reported. In the maxillofacial skeleton, the first facial case was reported by Romer in 1928. Until now, only a few cases of Gorham disease affecting the maxillofacial bones, including this case report, have been reported. We present a brief review of the pathogenesis and treatment modalities of the disease and report a very rare clinical picture of the disease affecting a young and otherwise healthy patient with massive osteolysis of the mandibular bone and extensive involvement of the mouth floor and skin of the chin, which to our knowledge, is the only case report with skin manifestation affecting the maxillofacial region. Such skin manifestations play an important role for the diagnosis and add a clue for management of such condition. Copyright © 2012 Elsevier Inc. All rights reserved.

DLC1-dependent parathyroid hormone-like hormone inhibition suppresses breast cancer bone metastasis.

PubMed

Wang, Yufeng; Lei, Rong; Zhuang, Xueqian; Zhang, Ning; Pan, Hong; Li, Gang; Hu, Jing; Pan, Xiaoqi; Tao, Qian; Fu, Da; Xiao, Jianru; Chin, Y Eugene; Kang, Yibin; Yang, Qifeng; Hu, Guohong

2014-04-01

Bone metastasis is a frequent complication of breast cancer that is often accelerated by TGF-β signaling; however, little is known about how the TGF-β pathway is regulated during bone metastasis. Here we report that deleted in liver cancer 1 (DLC1) is an important regulator of TGF-β responses and osteolytic metastasis of breast cancer cells. In murine models, breast cancer cells lacking DLC1 expression exhibited enhanced capabilities of bone metastasis. Knockdown of DLC1 in cancer cells promoted bone metastasis, leading to manifested osteolysis and accelerated death in mice, while DLC1 overexpression suppressed bone metastasis. Activation of Rho-ROCK signaling in the absence of DLC1 mediated SMAD3 linker region phosphorylation and TGF-β-induced expression of parathyroid hormone-like hormone (PTHLH), leading to osteoclast maturation for osteolytic colonization. Furthermore, pharmacological inhibition of Rho-ROCK effectively reduced PTHLH production and breast cancer bone metastasis in vitro and in vivo. Evaluation of clinical breast tumor samples revealed that reduced DLC1 expression was linked to elevated PTHLH expression and organ-specific metastasis to bone. Overall, our findings define a stroma-dependent paradigm of Rho signaling in cancer and implicate Rho-TGF-β crosstalk in osteolytic bone metastasis.

Cellular Mechanisms of Multiple Myeloma Bone Disease

PubMed Central

Oranger, Angela; Carbone, Claudia; Izzo, Maddalena; Grano, Maria

2013-01-01

Multiple myeloma (MM) is a hematologic malignancy of differentiated plasma cells that accumulates and proliferates in the bone marrow. MM patients often develop bone disease that results in severe bone pain, osteolytic lesions, and pathologic fractures. These skeletal complications have not only a negative impact on quality of life but also a possible effect in overall survival. MM osteolytic bone lesions arise from the altered bone remodeling due to both increased osteoclast activation and decreased osteoblast differentiation. A dysregulated production of numerous cytokines that can contribute to the uncoupling of bone cell activity is well documented in the bone marrow microenvironment of MM patients. These molecules are produced not only by malignant plasma cells, that directly contribute to MM bone disease, but also by bone, immune, and stromal cells interacting with each other in the bone microenvironment. This review focuses on the current knowledge of MM bone disease biology, with particular regard on the role of bone and immune cells in producing cytokines critical for malignant plasma cell proliferation as well as in osteolysis development. Therefore, the understanding of MM pathogenesis could be useful to the discovery of novel agents that will be able to both restore bone remodelling and reduce tumor burden. PMID:23818912

Trochantoplasty for Total Hip Arthroplasty in Patients With Coxa Vara Deformity.

PubMed

Yoo, Jun-Il; Parvizi, Javad; Song, Ji-Ung; Ha, Yong-Chan; Lee, Young-Kyun; Koo, Kyung-Hoi

2017-07-01

In total hip arthroplasty (THA) of hips with coxa vara, the femoral stems might be inserted in a varus alignment. To avoid varus insertion, we designed a technique, which we termed "trochantoplasty." In this procedure, the medial half of the greater trochanter was removed during THA. We evaluated 30 patients (31 hips) who had coxa vara deformity and underwent THA using trochantoplasty at the mean follow-up of 5 years (range, 3-9 years). All stems were inserted in the neutral position. One Vancouver type 1 periprosthetic femoral fracture occurred after a fall at postoperative 2 months. At the latest follow-up, the mean power of abductor was 4.3 (range, 3-5). Four patients had moderate limp whereas 26 patients had slight limp. The abduction at 90° flexion ranged from 15° to 45° (mean, 35°). There was no revision. All prostheses had bone-ingrown stability without any detectable wear or osteolysis. The mean Harris hip score was improved from 66.9 to 89.4 points. Trochantoplasty can be used to avoid varus insertion of the femoral stem while performing THA in patients with coxa vara deformity without compromising the abductor mechanism. Copyright © 2017 Elsevier Inc. All rights reserved.

Medium-term outcome in patients treated with total hip arthroplasty using a modular femoral stem.

PubMed

Dagnino, Augusto; Grappiolo, Guido; Benazzo, Franco M; Learmonth, Ian D; Spotorno, Lorenzo; Portinaro, Nicola

2012-01-01

The clinical, radiographic and quality of life results of total hip arthroplasty using the MODULUS cementless modular femoral stem were reviewed. 48 patients who had a total hip arthroplasty using the MODULUS femoral stem were identified. Six had bilateral procedures, resulting in 60 hips with complete clinical and radiographic data. Mean age at implantation was 50 years (range 33 to 82). Mean follow-up was 59 months (range 50 months to 73). There were two early post-operative dislocations (within 2 days). One patient required further surgery to remove heterotopic bone. Mean Harris Hip Score increased from 37 points preoperatively (range, 7 to 66) to 89 points at final review (range, 65 to 100 points). Radiographic evaluation revealed that all implants were stable without evidence of osteolysis but three patients (5%) exhibited heterotopic ossification. Quality of life was evaluated with the SF36. The physical component increased from 29.2 points (range, 18.5 to 46.0) to 51.7 points (range 42.9 to 60.6) and the mental component from 375 points (range, 19.5 to 50.0) to 50 points (range 32,8 to 62.0).

Gamabufotalin triggers c-Myc degradation via induction of WWP2 in multiple myeloma cells.

PubMed

Yu, Zhenlong; Li, Tao; Wang, Chao; Deng, Sa; Zhang, Baojing; Huo, Xiaokui; Zhang, Bo; Wang, Xiaobo; Zhong, Yuping; Ma, Xiaochi

2016-03-29

Deciding appropriate therapy for multiple myeloma (MM) is challenging because of the occurrence of multiple chromosomal changes and the fatal nature of the disease. In the current study, gamabufotalin (GBT) was isolated from toad venom, and its tumor-specific cytotoxicity was investigated in human MM cells. We found GBT inhibited cell growth and induced apoptosis with the IC50 values <50 nM. Mechanistic studies using functional approaches identified GBT as an inhibitor of c-Myc. Further analysis showed that GBT especially evoked the ubiquitination and degradation of c-Myc protein, thereby globally repressing the expression of c-Myc target genes. GBT treatment inhibited ERK and AKT signals, while stimulating the activation of JNK cascade. An E3 ubiquitin-protein ligase, WWP2, was upregulated following JNK activation and played an important role in c-Myc ubiquitination and degradation through direct protein-protein interaction. The antitumor effect of GBT was validated in a xenograft mouse model and the suppression of MM-induced osteolysis was verified in a SCID-hu model in vivo. Taken together, our study identified the potential of GBT as a promising therapeutic agent in the treatment of MM.

Micro X-Ray Computed Tomography Mass Loss Assessment of Different UHMWPE: A Hip Joint Simulator Study on Standard vs. Cross-Linked Polyethylene

PubMed Central

Zanini, Filippo; Carmignato, Simone

2017-01-01

More than 60.000 hip arthroplasty are performed every year in Italy. Although Ultra-High-Molecular-Weight-Polyethylene remains the most used material as acetabular cup, wear of this material induces over time in vivo a foreign-body response and consequently osteolysis, pain, and the need of implant revision. Furthermore, oxidative wear of the polyethylene provoke several and severe failures. To solve these problems, highly cross-linked polyethylene and Vitamin-E-stabilized polyethylene were introduced in the last years. In in vitro experiments, various efforts have been made to compare the wear behavior of standard PE and vitamin-E infused liners. In this study we compared the in vitro wear behavior of two different configurations of cross-linked polyethylene (with and without the add of Vitamin E) vs. the standard polyethylene acetabular cups. The aim of the present study was to validate a micro X-ray computed tomography technique to assess the wear of different commercially available, polyethylene’s acetabular cups after wear simulation; in particular, the gravimetric method was used to provide reference wear values. The agreement between the two methods is documented in this paper. PMID:28107468

Adverse Biological Effect of TiO2 and Hydroxyapatite Nanoparticles Used in Bone Repair and Replacement

PubMed Central

Wang, Jiangxue; Wang, Liting; Fan, Yubo

2016-01-01

The adverse biological effect of nanoparticles is an unavoidable scientific problem because of their small size and high surface activity. In this review, we focus on nano-hydroxyapatite and TiO2 nanoparticles (NPs) to clarify the potential systemic toxicological effect and cytotoxic response of wear nanoparticles because they are attractive materials for bone implants and are widely investigated to promote the repair and reconstruction of bone. The wear nanoparticles would be prone to binding with proteins to form protein-particle complexes, to interacting with visible components in the blood including erythrocytes, leukocytes, and platelets, and to being phagocytosed by macrophages or fibroblasts to deposit in the local tissue, leading to the formation of fibrous local pseudocapsules. These particles would also be translocated to and disseminated into the main organs such as the lung, liver and spleen via blood circulation. The inflammatory response, oxidative stress, and signaling pathway are elaborated to analyze the potential toxicological mechanism. Inhibition of the oxidative stress response and signaling transduction may be a new therapeutic strategy for wear debris–mediated osteolysis. Developing biomimetic materials with better biocompatibility is our goal for orthopedic implants. PMID:27231896

[Which hip articulation bearing for which patient? : Tribology of the future].

PubMed

Morlock, M M; Bishop, N; Kaddick, C

2011-12-01

Replacement of the hip joint has become an exceptionally successful procedure since the inauguration of the low friction principle by Charnley. Aseptic osteolysis and joint dislocation have been addressed by the development of wear-optimized materials and the introduction of larger heads. As an increase in head diameter against polyethylene causes wear increase, larger hard-on-hard bearings were introduced, which exhibit reduced wear and reduced dislocation risk with increasing head diameter. These findings were derived from standard simulator testing, not sufficiently considering the risk of fluid film breakdown under adverse conditions, which can cause a dramatic increase in wear and friction proportional to the head diameter. Such adverse conditions can occur clinically in patients due to several factors and have caused the presently observed unexpected problems with these new designs. Standardized preclinical testing has to be viewed as a minimum requirement but certainly not as a guarantee for the clinical success of new materials and designs even if the testing is adapted to the current patient requirements, which is presently not the case. The future of tribology lies in the prevention of adverse conditions in patients, the improvement and optimized use of proven existing materials and not in the use of new materials.

Pitavastatin attenuates monocyte activation in response to orthopedic implant-derived wear particles by suppressing the NF-κB signaling pathway.

PubMed

Zhang, Zehua; Dai, Fei; Cheng, Peng; Luo, Fei; Hou, Tianyong; Zhou, Qiang; Xie, Zhao; Deng, Moyuan; Xu, Jian-Zhong

2015-11-01

Aseptic loosening secondary to particle‑induced periprosthetic osteolysis is considered to be the primary cause of long‑term implant failure in orthopedic surgery. Implant‑derived wear particles activate and recruit macrophages and osteoclasts, which cause a persistent inflammatory response with bone destruction that is followed by a loosening of the implant. Thus, strategies for inhibiting macrophage and osteoclast function may provide a therapeutic benefit for preventing aseptic loosening. The aim of the present study was to determine the effects of pitavastatin on the activation and cytokine response of polymethyl methacrylate (PMMA) particle‑induced monocytes. Peripheral blood monocytes were obtained and treated with PMMA and pitavastatin. ELISA demonstrated that pitavastatin inhibited mRNA and protein expression of interleukin (IL)‑1β, IL‑6 and tumor necrosis factor‑α. Western blot analysis and immunofluorescence staining demonstrated that pitavastatin downregulated inhibitor of κB phosphorylation and degradation, and nuclear factor κ‑light‑chain‑enhancer of activated B cells (NF‑κB) p65 translocation. Together, these results indicate that pitavastatin may attenuate monocyte activation in response to orthopedic implant wear particles by suppression of the NF‑κB signaling pathway.

Multiple myeloma: a clinical overview.

PubMed

Anderson, Kenneth C

2011-11-15

Multiple myeloma (MM) is the second most common hematologic malignancy in the United States, affecting slightly more men than women and twice as many African Americans as Caucasians. Older age is the primary risk factor for MM, but obesity also increases risk. MM is incurable, but treatment advances in the past decade have more than doubled the duration of survival. MM is a progressive plasma cell tumor in which an initially stable clone becomes malignant via a multistep process. Causative factors implicated in this process include radiation, environmental toxins, chronic antigen stimulation, and genetics. The malignant plasma cells interact with other hematopoietic and stromal cells within the bone marrow microenvironment to disrupt homeostasis among cells and within the extracellular matrix. These tumor-host interactions lead to MM cell proliferation and migration, angiogenesis, osteolysis, immunodeficiency, and anemia. As a result, patients often present with osteolytic bone lesions, recurrent infections, renal insufficiency, and fatigue. The Durie-Salmon and International Staging Systems are used to stage MM, with the latter providing prognostic information based on readily available laboratory data. However, a number of cytogenetic markers are emerging as prognostic indicators, introducing the possibility of more refined disease staging systems and tailored treatment strategies based on genetic profiles.

Sensor of total hip arthoplasty wear designed on principle of scanning profilometry

NASA Astrophysics Data System (ADS)

Rössler, Tomas; Mandat, Dusan; Gallo, Jiri; Hrabovsky, Miroslav; Pochmon, Michal; Havranek, Vitezslav

2008-12-01

Total hip arthroplasty significantly improves the quality of life in majority of patients with osteoarthritis. However, prosthetic wear is a problem because of inducing the development of aseptic loosening and periprosthetic osteolysis which needs the revision surgery. Thus, the polyethylene wear measurement is the central to contemporary orthopaedics and this interesting has encouraged the development and improvement of both radiologic (in vivo) and non-radiologic (in vitro) methods for polyethylene wear quantification. The principles of polyethylene liner wear measurements are predominantly geometric; nevertheless, the realization of individual types of in vivo measurements brings with it the necessity of many simplifications and compromising steps to acquire approximately accurate values. In fact, the volumetric wear can be obtained by mathematical conversion based on the most linear shift of femoral head in the cup. However, such approach is understood to be somewhat insufficient. Our ongoing research pointed to the development of optical non-contact method for wear measurement and its results are introduced in this paper including the methodology designed for the usability validation of the method for the given purpose and the description of sensor, its principle, technical realization, design and parameters.

Osteomalacia in a patient with Paget's bone disease treated with long-term etidronate.

PubMed

Hoppé, E; Masson, C; Laffitte, A; Chappard, D; Audran, M

2012-08-01

A 93 year-old woman with Paget's disease of bone had been treated with etidronate without interruption during 20 years. The daily dose was usual (5mg/kg/day) but this prescription had never been stopped by her physicians. Two fractures had already occurred in pagetic (right tibia) and non pagetic bones (right fibula) within the last 2 years, and she presented rib fractures, another right tibia fracture and right femur fracture during hospitalization time. X-rays films showed major osteolysis of left ulna and right tibia. Blood samples and technetium bone scan brought no evidence for sarcoma or lytic evolution of the disease. A transiliac bone biopsy on non pagetic bone site confirmed the diagnosis of osteomalacia (increased osteoid parameters), with secondary hyperparathyroidism (hook resorption). In Paget's disease of bone, continuous treatment by etidronate may induce generalized osteomalacia, and increase the risk of fracture in both pagetic and non-pagetic bones. Whereas physicians and pharmaceutical industry try to improve the observance of those drugs, this striking observation also points out that a prescription always needs to be updated. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Nanoceramics on osteoblast proliferation and differentiation in bone tissue engineering.

PubMed

Sethu, Sai Nievethitha; Namashivayam, Subhapradha; Devendran, Saravanan; Nagarajan, Selvamurugan; Tsai, Wei-Bor; Narashiman, Srinivasan; Ramachandran, Murugesan; Ambigapathi, Moorthi

2017-05-01

Bone, a highly dynamic connective tissue, consist of a bioorganic phase comprising osteogenic cells and proteins which lies over an inorganic phase predominantly made of CaPO 4 (biological apatite). Injury to bone can be due to mechanical, metabolic or inflammatory agents also owing pathological conditions like fractures, osteomyelitis, osteolysis or cysts may arise in enameloid, chondroid, cementum, or chondroid bone which forms the intermediate tissues of the body. Bone tissue engineering (BTE) applies bioactive scaffolds, host cells and osteogenic signals for restoring damaged or diseased tissues. Various bioceramics used in BTE can be bioactive (like glass ceramics and hydroxyapatite bioactive glass), bioresorbable (like tricalcium phosphates) or bioinert (like zirconia and alumina). Limiting the size of these materials to nano-scale has resulted in a higher surface area to volume ratio thereby improving multi-functionality, solubility, surface catalytic activity, high heat and electrical conductivity. Nanoceramics have been found to induce osteoconduction, osteointegration, osteogenesis and osteoinduction. The present review aims at summarizing the interactions of nanoceramics and osteoblast/stem cells for promoting the proliferation and differentiation of the osteoblast cells by nanoceramics as superior bone substitutes in bone tissue engineering applications. Copyright © 2017 Elsevier B.V. All rights reserved.

ABL kinases promote breast cancer osteolytic metastasis by modulating tumor-bone interactions through TAZ and STAT5 signaling

PubMed Central

Wang, Jun; Rouse, Clay; Jasper, Jeff S.; Pendergast, Ann Marie

2016-01-01

Bone metastases occur in up to 70% of advanced breast cancer. For most patients with breast cancer, bone metastases are predominantly osteolytic. Interactions between tumor cells and stromal cells in the bone microenvironment drive osteolytic bone metastasis, a process that requires the activation of osteoclasts, cells that break down bone. Here, we report that ABL kinases promoted metastasis of breast cancer cells to bone by regulating the crosstalk between tumor and the bone microenvironment. ABL kinases protected tumor cells from apoptosis induced by TRAIL (TNF-related apoptosis-inducing ligand), activated the transcription factor STAT5, and promoted osteolysis through the STAT5-dependent expression of genes encoding the osteoclast activating factors interleukin 6 (IL6) and matrix metalloproteinase-1 (MMP1). Furthermore, ABL kinases increased the abundance of the Hippo pathway mediator TAZ and the expression of TAZ-dependent target genes that promote bone metastasis. Knockdown of ABL kinases or treatment with ABL-specific allosteric inhibitor impaired osteolytic metastasis of breast cancer cells in mice. These findings revealed a role for ABL kinases in regulating tumor-bone interactions and provide a rationale for targeting both tumor and the bone microenvironment with ABL-specific inhibitors. PMID:26838548

Matrix Metalloproteinases in Bone Resorption, Remodeling, and Repair.

PubMed

Paiva, Katiucia B S; Granjeiro, José M

2017-01-01

Matrix metalloproteinases (MMPs) are the major protease family responsible for the cleavage of the matrisome (global composition of the extracellular matrix (ECM) proteome) and proteins unrelated to the ECM, generating bioactive molecules. These proteins drive ECM remodeling, in association with tissue-specific and cell-anchored inhibitors (TIMPs and RECK, respectively). In the bone, the ECM mediates cell adhesion, mechanotransduction, nucleation of mineralization, and the immobilization of growth factors to protect them from damage or degradation. Since the first description of an MMP in bone tissue, many other MMPs have been identified, as well as their inhibitors. Numerous functions have been assigned to these proteins, including osteoblast/osteocyte differentiation, bone formation, solubilization of the osteoid during bone resorption, osteoclast recruitment and migration, and as a coupling factor in bone remodeling under physiological conditions. In turn, a number of pathologies, associated with imbalanced bone remodeling, arise mainly from MMP overexpression and abnormalities of the ECM, leading to bone osteolysis or bone formation. In this review, we will discuss the functions of MMPs and their inhibitors in bone cells, during bone remodeling, pathological bone resorption (osteoporosis and bone metastasis), bone repair/regeneration, and emergent roles in bone bioengineering. © 2017 Elsevier Inc. All rights reserved.

State of the art of palliative therapy.

PubMed

Seregni, E; Padovano, B; Coliva, A; Zecca, E; Bombardieri, E

2011-08-01

Bone pain in advanced stages of cancer significantly decreases the patient's quality of life having a great impact on physical, physiological and social functioning. About 65% of patients with prostate or breast cancer will experience symptomatic skeletal metastases. Bone pain sustained by osseous metastases represents the most frequent kind of pain and its clinical presentation and characteristics differ from other type of neoplastic pain (i.e., neuropathic or visceral ones). Pathophysiology of bone pain is not yet completely understood but a general mechanism including infiltration of bone tissue associated with osteolysis and release of biological active molecules able to stimulate peripheral nervous terminals, seems to be principally involved. In oncological practice, painful skeletal metastases are managed by different multidisciplinary modalities which include the use of systemic analgesics (i.e., bisphosphonates), antineoplastic agents (i.e., hormones and chemotherapeutics), external beam radiotherapy, interventional radiology and radiopharmaceuticals. In this review we will discuss the state of the art of palliative therapy of bone pain with particular emphasis to the current approved radiopharmaceuticals, focusing on indications, patient selection, efficacy and toxicity. Some remarks on new or under developing strategies in systemic metabolic radiopharmaceutical therapy will be reported.

Do oxidized zirconium femoral heads reduce polyethylene wear in cemented THAs? A blinded randomized clinical trial.

PubMed

Zaoui, Amine; Hage, Samer El; Langlois, Jean; Scemama, Caroline; Courpied, Jean Pierre; Hamadouche, Moussa

2015-12-01

Charnley low-friction torque total hip arthroplasty (THA) remains the gold standard in THA. The main cause for failure is wear of the socket. Highly crosslinked polyethylene (HXLPE) has been associated with reduced wear rates. Also, oxidized zirconium has shown in vitro reduced wear rates. However, to our knowledge, there are no data comparing oxidized zirconium femoral heads with metal heads against HXLPE or ultrahigh-molecular-weight polyethylene (UHMWPE) when 22.25-mm bearings were used, which was the same size that performed so well in Charnley-type THAs. We hypothesized that after a minimal 4-year followup (1) use of HXLPE would result in lower radiographic wear than UHMWPE when articulating with a stainless steel head or with an oxidized zirconium head; (2) use of oxidized zirconium would result in lower radiographic wear than stainless steel when articulating with UHMWPE and HXLPE; and (3) there would be no difference in terms of Merle d'Aubigné scores between the bearing couple combinations. One hundred patients were randomized to receive cemented THA with either oxidized zirconium or a stainless steel femoral head. UHMWPE was used in the first 50 patients, whereas HXLPE was used in the next 50 patients. There were 25 patients in each of the four bearing couple combinations. All other parameters were identical in both groups. Complete followup was available in 86 of these patients. Femoral head penetration was measured using a validated computer-assisted method dedicated to all-polyethylene sockets. Clinical results were compared between the groups using the Merle d'Aubigné score. In the UHMWPE series, the median steady-state penetration rate from 1 year onward was 0.03 mm/year (range, 0.003-0.25 mm/year) in the oxidized zirconium group versus 0.11 mm/year (range, 0.03-0.29 mm/year) in the metal group (difference of medians 0.08, p < 0.001). In the HXLPE series, the median steady-state penetration rate from 1 year onward was 0.02 mm/year (range, -0.32 to 0.07 mm/year) in the oxidized zirconium group versus 0.05 mm/year (range, -0.39 to 0.11 mm/year) in the metal group (difference of medians 0.03, p < 0.001). The Merle d'Aubigné scores were no different between the groups with a median of 18 in each of the groups (range, 16-18). This study demonstrated femoral head penetration was reduced by oxidized zirconium when compared with metal on both UHMWPE and HXLPE. However, apart the metal-UHMWE group, all other groups had a steady-state penetration rate well below the osteolysis threshold with a low difference between groups that might not be clinically important at this point. Longer-term followup is needed to warrant whether wear reduction will generate less occurrence of osteolysis and aseptic loosening. Level II, therapeutic study.

DLC1-dependent parathyroid hormone–like hormone inhibition suppresses breast cancer bone metastasis

PubMed Central

Wang, Yufeng; Lei, Rong; Zhuang, Xueqian; Zhang, Ning; Pan, Hong; Li, Gang; Hu, Jing; Pan, Xiaoqi; Tao, Qian; Fu, Da; Xiao, Jianru; Chin, Y. Eugene; Kang, Yibin; Yang, Qifeng; Hu, Guohong

2014-01-01

Bone metastasis is a frequent complication of breast cancer that is often accelerated by TGF-β signaling; however, little is known about how the TGF-β pathway is regulated during bone metastasis. Here we report that deleted in liver cancer 1 (DLC1) is an important regulator of TGF-β responses and osteolytic metastasis of breast cancer cells. In murine models, breast cancer cells lacking DLC1 expression exhibited enhanced capabilities of bone metastasis. Knockdown of DLC1 in cancer cells promoted bone metastasis, leading to manifested osteolysis and accelerated death in mice, while DLC1 overexpression suppressed bone metastasis. Activation of Rho-ROCK signaling in the absence of DLC1 mediated SMAD3 linker region phosphorylation and TGF-β–induced expression of parathyroid hormone–like hormone (PTHLH), leading to osteoclast maturation for osteolytic colonization. Furthermore, pharmacological inhibition of Rho-ROCK effectively reduced PTHLH production and breast cancer bone metastasis in vitro and in vivo. Evaluation of clinical breast tumor samples revealed that reduced DLC1 expression was linked to elevated PTHLH expression and organ-specific metastasis to bone. Overall, our findings define a stroma-dependent paradigm of Rho signaling in cancer and implicate Rho–TGF-β crosstalk in osteolytic bone metastasis. PMID:24590291

Early experience with dual mobility acetabular systems featuring highly cross-linked polyethylene liners for primary hip arthroplasty in patients under fifty five years of age: an international multi-centre preliminary study.

PubMed

Epinette, Jean-Alain; Harwin, Steven F; Rowan, Fiachra E; Tracol, Philippe; Mont, Michael A; Chughtai, Morad; Westrich, Geoffrey H

2017-03-01

To evaluate early performance of contemporary dual mobility acetabular systems with second generation annealed highly cross-linked polyethylene for primary hip arthroplasty of patients under 55 years of age. A prospective observational five years study across five centers in Europe and the USA of 321 patients with a mean age of 48.1 years was performed. Patients were assessed for causes of revision, hip instability, intra-prosthetic dissociation, Harris hip score and radiological signs of osteolysis. There were no dislocations and no intra-prosthetic dissociations. Kaplan Meier analysis demonstrated 97.51% survivorship for all cause revision and 99.68% survivorship for acetabular component revision at five years. Mean Harris hip score was 93.6. Two acetabular shells were revised for neck-rim implant impingement without dislocation and ten femoral stems were revised for causes unrelated to dual mobility implants. Contemporary highly cross-linked polyethylene dual mobility systems demonstrate excellent early clinical, radiological, and survivorship results in a cohort of patients that demand high performance from their implants. It is envisaged that DM and second generation annealed HXLPE may reduce THA instability and wear, the two most common causes of THA revision in hip arthroplasty.

[Osteosynthesis-associated infections : Epidemiology, definition and diagnosis].

PubMed

Renz, N; Feihl, S; Dlaska, C E; Schütz, M A; Trampuz, A

2017-06-01

Osteosynthesis-associated infections occur in 1-5% after closed and in up to 30% after open fractures. There are three different descriptions of implant-associated infections after fracture fixation, which are crucial for the selection of the adequate treatment strategy; temporal appearance from the index surgery (early versus late), pathogenesis of the infection (exogenous, hematogenous and contiguous from an adjacent focus), duration of infection symptoms (acute versus chronic). Diagnosis of osteosynthesis-associated infection is challenging, as chronic low-grade infections often present only with unspecific and subtle clinical symptoms. History, clinical evaluation, imaging, histopathlogical and microbiological examination build the cornerstones of diagnostics in implant-associated infections. A new onset of rest pain, early loosening of the prosthesis or mechanically unexplained, nonunion should raise suspicion for infection and prompt further evaluation. Percutaneous sinus tracts, purulent wound secretion and skin erosions with visibility of the implant confirm the implant-associated infection. Elevated C‑reactive protein value in blood is a supportive argument for infection, but is neither sensitive nor specific for infection. Imaging plays a key role to detect nonunions, infectious callus, sequester, peri-implant osteolysis and extraosseous and intramedullary involvement. Through microbiological and histopathological examination of intraoperative tissue samples, as well as sonication of explanted implants the causative pathogen is identified in most cases.

Migration of polyethylene debris along well-fixed cemented implants.

PubMed

Massin, P; Viguier, E; Flautre, B; Hardouin, P; Astoin, E; Duponchel, B

2004-02-15

Implants, consisting of smooth Inox cylinders, were cemented into the lower femur and upper tibia of nine sheep to study the distal migration of polyethylene particles. Some implants had a titanium-bead porous coat at the proximal end. These were of three types: In the first type, the porous coat was covered with hydroxyapatite to obtain a bony seal; the second type was prepared for a polymethylmethacrylate seal; in the third type, the porous zone was surrounded by a 2-mm-thick space to allow the formation of a fibrous seal. Small polyethylene particles were injected into the knees once a week during the third and fourth months after implantation. The animals were euthanized 2 months later. Major longitudinal sections of the implants and the surrounding bone were examined under a polarized light microscope. Birefringent particles were counted at the cement-bone and cement-implant interfaces. Osteolysis was not observed. None of the seals significantly decreased the migration of particles around the cemented part of the implants. Particles were observed in cement fissures and vacuoles. They migrated at both interfaces and in the bone itself. They were visible in marrow spaces between bone trabeculae. Copyright 2003 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater 68B: 140-148, 2004

Stem cell engineered bone with calcium-phosphate coated porous titanium scaffold or silicon hydroxyapatite granules for revision total joint arthroplasty.

PubMed

García-Gareta, Elena; Hua, Jia; Rayan, Faizal; Blunn, Gordon W

2014-06-01

Aseptic loosening in total joint replacements (TJRs) is mainly caused by osteolysis which leads to a reduction of the bone stock necessary for implant fixation in revision TJRs. Our aim was to develop bone tissue-engineered constructs based on scaffolds of clinical relevance in revision TJRs to reconstitute the bone stock at revision operations by using a perfusion bioreactor system (PBRS). The hypothesis was that a PBRS will enhance mesenchymal stem cells (MSCs) proliferation and osteogenic differentiation and will provide an even distribution of MSCs throughout the scaffolds when compared to static cultures. A PBRS was designed and implemented. Scaffolds, silicon substituted hydroxyapatite granules and calcium-phosphate coated porous TiAl6V4 cylinders, were seeded with MSCs and cultured either in static conditions or in the PBRS at 0.75 mL/min. Statistically significant increased cell proliferation and alkaline phosphatase activity was found in samples cultured in the PBRS. Histology revealed a more even cell distribution in the perfused constructs. SEM showed that cells arranged in sheets. Long cytoplasmic processes attached the cells to the scaffolds. We conclude that a novel tissue engineering approach to address the issue of poor bone stock at revision operations is feasible by using a PBRS.

Backside Wear Analysis of Retrieved Acetabular Liners with a Press-Fit Locking Mechanism in Comparison to Wear Simulation In Vitro.

PubMed

Puente Reyna, Ana Laura; Jäger, Marcus; Floerkemeier, Thilo; Frecher, Sven; Delank, Karl-Stefan; Schilling, Christoph; Grupp, Thomas M

2016-01-01

Backside wear due to micromotion and poor conformity between the liner and its titanium alloy shell may contribute to the high rates of retroacetabular osteolysis and consequent aseptic loosening. The purpose of our study was to understand the wear process on the backside of polyethylene liners from two acetabular cup systems, whose locking mechanism is based on a press-fit cone in combination with a rough titanium conical inner surface on the fixation area. A direct comparison between in vitro wear simulator tests (equivalent to 3 years of use) and retrieved liners (average 13.1 months in situ) was done in order to evaluate the backside wear characteristics and behavior of these systems. Similar wear scores between in vitro tested and retrieved liners were observed. The results showed that this locking mechanism did not significantly produce wear marks at the backside of the polyethylene liners due to micromotion. In all the analyzed liners, the most common wear modes observed were small scratches at the cranial fixation zone directly below the rough titanium inner surface of the shell. It was concluded that most of the wear marks were produced during the insertion and removal of the liner, rather than during its time in situ.

In vitro wear assessment of the Charité Artificial Disc according to ASTM recommendations.

PubMed

Serhan, Hassan A; Dooris, Andrew P; Parsons, Matthew L; Ares, Paul J; Gabriel, Stefan M

2006-08-01

Biomechanical laboratory research. To evaluate the potential for Ultra High Molecular Weight Polyethylene (UHMWPE) wear debris from the Charité Artificial Disc. Cases of osteolysis from artificial discs are extremely rare, but hip and knee studies demonstrate the osteolytic potential and clinical concern of UHMWPE wear debris. Standards for testing artificial discs continue to evolve, and there are few detailed reports of artificial disc wear characterizations. Implant assemblies were tested to 10 million cycles of +/- 7.5 degrees flexion-extension or +/- 7.5 degrees left/right lateral bending, both with +/- 2 degrees axial rotation and 900 N to 1,850 N cyclic compression. Cores were weighed, measured, and photographed. Soak and loaded soak controls were used. Wear debris was analyzed via scanning electron microscopy and particle counters. The average total wear of the implants was 0.11 and 0.13 mg per million cycles, before and after accounting for serum absorption, respectively. Total height loss was approximately 0.2 mm. Wear debris ranged from submicron to > 10 microm in size. Under these test conditions, the Charité Artificial Disc produced minimal wear debris. Debris size and morphology tended to be similar to other CoCr-UHMWPE joints. More testing is necessary to evaluate the implants under a spectrum of loading conditions.

Biochemical and morphological changes associated with macrophages and osteoclasts when challenged with infection - biomed 2011.

PubMed

Wiggers, Erin Callie; Johnson, William; Tucci, Michelle; Benghuzzi, Hamed

2011-01-01

Osteomyelitis is a bacterial infection of the bone that occurs frequently as a complication of open fractures and various kinds of orthopedic surgery. This infection can often lead to more extensive surgeries and even death of the patient. In animal models of osteomyelitis, the site of infection by Staphylococcus aureus was observed to have high numbers of both macrophages and osteoclasts, both of which may contribute to large amounts of osteolysis and tissue damage. In order to evaluate the immune response in both types of cells, two cells lines, a macrophage cell line and a macrophage cell line stimulated to become osteoclasts by the addition of receptor activator of nuclear-factor B (RANKL), were exposed to lipopolysaccharides, opsonized S. aureus, and unopsonized S. aureus. The results showed that both cell types activated a biochemical cascade that included the release of cytokines and nitric oxide associated with cell damage and death in response to infection. However, macrophages and osteoclasts differed in response magnitude, most likely due to differences in cell-membrane receptors. This data supports the growing body of research that links the immune and skeletal systems. Further understanding of biochemical pathways shared by the two systems could lead to significant advances in the treatment of osteomyelitis and the success of prostheses.

Cemented total knee replacement in 24 dogs: surgical technique, clinical results, and complications.

PubMed

Allen, Matthew J; Leone, Kendall A; Lamonte, Kimberly; Townsend, Katy L; Mann, Kenneth A

2009-07-01

To characterize the performance of cemented total knee replacement (TKR) in dogs. Preclinical research study. Skeletally mature, male Hounds (25-30 kg; n=24) with no preexisting joint pathology. Dogs had unilateral cemented TKR and were evaluated at 6, 12, 26, or 52 weeks (6 dogs/time point) by radiography, bone density analysis, visual gait assessment, and direct measurement of thigh circumference and stifle joint range of motion as indicators of functional recovery. At study end, the stability of the cemented tibial component was determined by destructive mechanical testing. Joint stability was excellent in 16 dogs (67%) and good in 8 dogs. None of the tibial components had evidence of migration or periprosthetic osteolysis whereas 1 femoral component was loose at 52 weeks. There was an early and significant decrease in tibial bone density, likely because of disuse of the operated limb. Dogs returned to full activity by 12 weeks. The tibial cement-bone interface maintained its strength over 52 weeks. Cement provides stable fixation of the tibial component in canine TKR. Cemented TKR yields adequate clinical function and stifle joint excursion in the dog. Clinical studies are needed to determine the long-term fate of cemented TKR implants, to assess the influence of implant design on implant fixation and wear, and to obtain objective functional data.

In-situ electrochemical study of interaction of tribology and corrosion in artificial hip prosthesis simulators.

PubMed

Yan, Yu; Dowson, Duncan; Neville, Anne

2013-02-01

The second generation Metal-on-Metal (MoM) hip replacements have been considered as an alternative to commonly used Polyethylene-on-Metal (PoM) joint prostheses due to polyethylene wear debris induced osteolysis. However, the role of corrosion and the biofilm formed under tribological contact are still not fully understood. Enhanced metal ion concentrations have been reported widely from hair, blood and urine samples of patients who received metal hip replacements and in isolated cases when abnormally high levels have caused adverse local tissue reactions. An understanding of the origin of metal ions is really important in order to design alloys for reduced ion release. Reciprocating pin-on-plate wear tester is a standard instrument to assess the interaction of corrosion and wear. However, more realistic hip simulator can provide a better understanding of tribocorrosion process for hip implants. It is very important to instrument the conventional hip simulator to enable electrochemical measurements. In this study, simple reciprocating pin-on-plate wear tests and hip simulator tests were compared. It was found that metal ions originated from two sources: (a) a depassivation of the contacting surfaces due to tribology (rubbing) and (b) corrosion of nano-sized wear particles generated from the contacting surfaces. Copyright © 2012 Elsevier Ltd. All rights reserved.

Psoralidin suppresses osteoclastogenesis in BMMs and attenuates LPS-mediated osteolysis by inhibiting inflammatory cytokines.

PubMed

Kong, Lingbo; Ma, Rui; Yang, Xiaobin; Zhu, Ziqi; Guo, Hua; He, Baorong; Wang, Biao; Hao, Dingjun

2017-10-01

Psoralidin is a metabolic product from the seed of psoraleacorylifolia, possessed anti-inflammatory and immunomodulatory effects. We speculated that psoralidin might impact osteoclastogenesis and bone loss. By using both in vitro and in vivo studies, we observed psoralidin strongly inhibited RANKL induced osteoclast formation during preosteoclast cultures, suggesting that it acts on osteoclast precursors to inhibit RANKL/RANK signaling. At the molecular level, by using MAPKs specific inhibitors (U-0126, SB-203580 and SP-600125) we demonstrated that psoralidin markedly abrogated the phosphorylation of p38, ERK, JNK. Moreover, the RANKL induced NF-κB/p65 phosphorylation and I-κB degradation were significantly inhibited by psoralidin. Further, psoralidin significantly suppressed osteoclastogenesis marker genes of TRAP, Cathepsin K and OSCAR. These were accompanied by the decreased expression of c-Fos and NFATc1 transcription factors. Consistent with in vitro results, our in vivo and serologic studies showed psoralidin inhibited lipopolysaccharide induced bone resorption by suppressing the inflammatory cytokines: TNF-α and IL-6 expression, as well as the ratio of RNAKL : OPG. These results collectively suggested that psoralidin could represent a novel therapeutic strategy for osteoclast-related disorders, such as rheumatoid arthritis and postmenopausal osteoporosis. Copyright © 2017 Elsevier B.V. All rights reserved.

The Function of Naringin in Inducing Secretion of Osteoprotegerin and Inhibiting Formation of Osteoclasts

PubMed Central

Xu, Tong; Wang, Lu; Tao, You; Ji, Yan; Deng, Feng; Wu, Xiao-Hong

2016-01-01

Osteoporosis has become one of the most prevalent and costly diseases in the world. It is a metabolic disease characterized by reduction in bone mass due to an imbalance between bone formation and resorption. Osteoporosis causes fractures, prolongs bone healing, and impedes osseointegration of dental implants. Its pathological features include osteopenia, degradation of bone tissue microstructure, and increase of bone fragility. In traditional Chinese medicine, the herb Rhizoma Drynariae has been commonly used to treat osteoporosis and bone nonunion. However, the precise underlying mechanism is as yet unclear. Osteoprotegerin is a cytokine receptor shown to play an important role in osteoblast differentiation and bone formation. Hence, activators and ligands of osteoprotegerin are promising drug targets and have been the focus of studies on the development of therapeutics against osteoporosis. In the current study, we found that naringin could synergistically enhance the action of 1α,25-dihydroxyvitamin D3 in promoting the secretion of osteoprotegerin by osteoblasts in vitro. In addition, naringin can also influence the generation of osteoclasts and subsequently bone loss during organ culture. In conclusion, this study provides evidence that natural compounds such as naringin have the potential to be used as alternative medicines for the prevention and treatment of osteolysis. PMID:26884798

Use of a Dual Mobility Socket to Manage Total Hip Arthroplasty Instability

PubMed Central

Pibarot, Vincent; Vaz, Gualter; Chevillotte, Christophe; Béjui-Hugues, Jacques

2008-01-01

Unconstrained tripolar hip implants provide an additional bearing using a mobile polyethylene component between the prosthetic head and the outer metal shell. Such a design increases the effective head diameter and therefore is an attractive option in challenging situations of unstable total hip arthroplasties. We report our experience with 54 patients treated using this dual mobility implant in such situations. We ascertained its ability to restore and maintain stability, and examined component loosening and component failure. At a minimum followup of 2.2 years (mean, 4 years; range, 2.2–6.8 years), one hip had redislocated 2 months postoperatively and was managed successfully without reoperation by closed reduction with no additional dislocation. Two patients required revision of the implant because of dislocation at the inner bearing. Technical errors were responsible for these failures. Three patients had reoperations for deep infections. The postoperative radiographs at latest followup showed very satisfactory osseointegration of the acetabular component because no radiolucent line or osteolysis was reported. Use of this unconstrained tripolar design was successful in restoring and maintaining hip stability. We observed encouraging results at short-term followup regarding potential for loosening or mechanical failures. Level of Evidence: Level IV, therapeutic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18780135

The biological response to orthopedic implants for joint replacement. II: Polyethylene, ceramics, PMMA, and the foreign body reaction.

PubMed

Gibon, Emmanuel; Córdova, Luis A; Lu, Laura; Lin, Tzu-Hua; Yao, Zhenyu; Hamadouche, Moussa; Goodman, Stuart B

2017-08-01

Novel evidence-based prosthetic designs and biomaterials facilitate the performance of highly successful joint replacement (JR) procedures. To achieve this goal, constructs must be durable, biomechanically sound, and avoid adverse local tissue reactions. Different biomaterials such as metals and their alloys, polymers, ceramics, and composites are currently used for JR implants. This review focuses on (1) the biological response to the different biomaterials used for TJR and (2) the chronic inflammatory and foreign-body response induced by byproducts of these biomaterials. A homeostatic state of bone and surrounding soft tissue with current biomaterials for JR can be achieved with mechanically stable, infection free and intact (as opposed to the release of particulate or ionic byproducts) implants. Adverse local tissue reactions (an acute/chronic inflammatory reaction, periprosthetic osteolysis, loosening and subsequent mechanical failure) may evolve when the latter conditions are not met. This article (Part 2 of 2) summarizes the biological response to the non-metallic materials commonly used for joint replacement including polyethylene, ceramics, and polymethylmethacrylate (PMMA), as well as the foreign body reaction to byproducts of these materials. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1685-1691, 2017. © 2016 Wiley Periodicals, Inc.

Gallium and silicon synergistically promote osseointegration of dental implant in patients with osteoporosis.

PubMed

Liu, Jinsong; Wu, Zuosu; He, Hongli; Cai, Kaiyong; Zhang, Hualin; Xu, Lihua

2017-06-01

Over the last few decades, a wide variety of dental implants have been successfully placed in jaw bones to restore tooth function. But major challenges still remain in patients with osteoporosis involving compromised osseointegration, and the therapeutic methods is far from optimism. Gallium can directly inhibit bone osteolysis, prevent bone calcium release and augment bone mass, which makes Ga unique among the potential antiresorptive drugs. Silicon, as an indispensable modulator in bone formation, presents its bone anabolic effects, while reduces, at least doesn't increase, bone resorption. We hypothesize that the combination of bone anabolic effects of Si and antiresorptive effects of Ga will result in synergistic effects on the improvement of osteointegration under osteoporotic condition. In our strategy, in order to maximize the efficacy while minimize the side effects of ions, a novel titania mesoporous layer fabricated by electrochemical anodization on the surface of titanium implant will be employed as a promising local drug delivery system. The synergistic effects of Ga and Si on improving osseointegration will be verified by animal experiments, and be furthered by clinical trials. Our hypothesis could help to create an option to improve success rate of dental implants in osteoporotic patients. Copyright © 2017. Published by Elsevier Ltd.

Wear of ultra-high molecular weight polyethylene against damaged and undamaged stainless steel and diamond-like carbon-coated counterfaces.

PubMed

Firkins, P; Hailey, J L; Fisher, J; Lettington, A H; Butter, R

1998-10-01

The wear of ultra-high molecular weight polyethylene (UHMWPE) in artificial joints and the resulting wear debris-induced osteolysis remains a major clinical concern in the orthopaedic sector. Third-body damage of metallic femoral heads is often cited as a cause of accelerated polyethylene wear, and the use of ceramic femoral heads in the hip is gaining increasing favour. In the knee prostheses and for smaller diameter femoral heads, the application of hard surface coatings, such as diamond-like carbon, is receiving considerable attention. However, to date, there has been little or no investigation of the tribology of these coatings in simulated biological environments. In this study, diamond-like carbon (DLC) has been compared to stainless steel in its undamaged form and following simulated third-body damage. The wear of UHMWPE was found to be similar when sliding against undamaged DLC and stainless steel counterfaces. DLC was found to be much more damage resistant than DLC. Under test conditions that simulate third-body damage to the femoral head, the wear of UHMWPE was seven times lower against DLC than against stainless steel (P < 0.05). The study shows DLC has considerable potential as a femoral bearing surface in artificial joints.

Excessive dietary intake of vitamin A reduces skull bone thickness in mice

PubMed Central

Öhman, Caroline; Calounova, Gabriela; Rasmusson, Annica; Andersson, Göran; Pejler, Gunnar; Melhus, Håkan

2017-01-01

Calvarial thinning and skull bone defects have been reported in infants with hypervitaminosis A. These findings have also been described in humans, mice and zebrafish with loss-of-function mutations in the enzyme CYP26B1 that degrades retinoic acid (RA), the active metabolite of vitamin A, indicating that these effects are indeed caused by too high levels of vitamin A and that evolutionary conserved mechanisms are involved. To explore these mechanisms, we have fed young mice excessive doses of vitamin A for one week and then analyzed the skull bones using micro computed tomography, histomorphometry, histology and immunohistochemistry. In addition, we have examined the effect of RA on gene expression in osteoblasts in vitro. Compared to a standard diet, a high dietary intake of vitamin A resulted in a rapid and significant reduction in calvarial bone density and suture diastasis. The bone formation rate was almost halved. There was also increased staining of tartrate resistant acid phosphatase in osteocytes and an increased perilacunar matrix area, indicating osteocytic osteolysis. Consistent with this, RA induced genes associated with bone degradation in osteoblasts in vitro. Moreover, and in contrast to other known bone resorption stimulators, vitamin A induced osteoclastic bone resorption on the endocranial surfaces. PMID:28426756

Biomechanical analysis of clavicle hook plate implantation with different hook angles in the acromioclavicular joint.

PubMed

Hung, Li-Kun; Su, Kuo-Chih; Lu, Wen-Hsien; Lee, Cheng-Hung

2017-08-01

A clavicle hook plate is a simple and effective method for treating acromioclavicular dislocation and distal clavicle fractures. However, subacromial osteolysis and peri-implant fractures are complicated for surgeons to manage. This study uses finite element analysis (FEA) to investigate the post-implantation biomechanics of clavicle hook plates with different hook angles. This FEA study constructed a model with a clavicle, acromion, clavicle hook plate, and screws to simulate the implantation of clavicle hook plates at different hook angles (90°, 95°, 100°, 105°, and 110°) for treating acromioclavicular joint dislocations. This study investigated the biomechanics of the acromion, clavicle, hook plate, and screws. A smaller hook angle increases the stress on the middle third of the clavicle. A larger hook angle increases the force exerted by the clavicle hook plate on the acromion. The screw at the most medial position on the plate generated the highest stress. The highest stress on the implanted clavicle hook plate was on the turning corner of the hook. A clavicle hook plate with different hook angles may induce different biomechanical behaviors in the clavicle and acromion. Orthopedic surgeons must select a suitable clavicle hook plate based on the anatomical structure of each patient.

Biomechanical analysis of acromioclavicular joint dislocation treated with clavicle hook plates in different lengths.

PubMed

Shih, Cheng-Min; Huang, Kui-Chou; Pan, Chien-Chou; Lee, Cheng-Hung; Su, Kuo-Chih

2015-11-01

Clavicle hook plates are frequently used in clinical orthopaedics to treat acromioclavicular joint dislocation. However, patients often exhibit acromion osteolysis and per-implant fracture after undergoing hook plate fixation. With the intent of avoiding future complications or fixation failure after clavicle hook plate fixation, we used finite element analysis (FEA) to investigate the biomechanics of clavicle hook plates of different materials and sizes when used in treating acromioclavicular joint dislocation. Using finite element analysis, this study constructed a model comprising four parts: clavicle, acromion, clavicle hook plate and screws, and used the model to simulate implanting different types of clavicle hook plates in patients with acromioclavicular joint dislocation. Then, the biomechanics of stainless steel and titanium alloy clavicle hook plates containing either six or eight screw holes were investigated. The results indicated that using a longer clavicle hook plate decreased the stress value in the clavicle, and mitigated the force that clavicle hook plates exert on the acromion. Using a clavicle hook plate material characterized by a smaller Young's modulus caused a slight increase in the stress on the clavicle. However, the external force the material imposed on the acromion was less than the force exerted on the clavicle. The findings of this study can serve as a reference to help orthopaedic surgeons select clavicle hook plates.

Macrophages – Key Cells in the Response to Wear Debris from Joint Replacements

PubMed Central

Nich, Christophe; Takakubo, Yuya; Pajarinen, Jukka; Ainola, Mari; Salem, Abdelhakim; Sillat, Tarvo; Rao, Allison J.; Raska, Milan; Tamaki, Yasunobu; Takagi, Michiaki; Konttinen, Yrjö T.; Goodman, Stuart B.; Gallo, Jiri

2013-01-01

The generation of wear debris is an inevitable result of normal usage of joint replacements. Wear debris particles stimulate local and systemic biological reactions resulting in chronic inflammation, periprosthetic bone destruction, and eventually, implant loosening and revision surgery. The latter may be indicated in up to 15% patients in the decade following the arthroplasty using conventional polyethylene. Macrophages play multiple roles in both inflammation and in maintaining tissue homeostasis. As sentinels of the innate immune system, they are central to the initiation of this inflammatory cascade, characterized by the release of pro-inflammatory and pro-osteoclastic factors. Similar to the response to pathogens, wear particles elicit a macrophage response, based on the unique properties of the cells belonging to this lineage, including sensing, chemotaxis, phagocytosis, and adaptive stimulation. The biological processes involved are complex, redundant, both local and systemic, and highly adaptive. Cells of the monocyte/macrophage lineage are implicated in this phenomenon, ultimately resulting in differentiation and activation of bone resorbing osteoclasts. Simultaneously, other distinct macrophage populations inhibit inflammation and protect the bone-implant interface from osteolysis. Here, the current knowledge about the physiology of monocyte/macrophage lineage cells is reviewed. In addition, the pattern and consequences of their interaction with wear debris and the recent developments in this field are presented. PMID:23568608

Virtual monochromatic spectral imaging with fast kilovoltage switching: reduction of metal artifacts at CT.

PubMed

Pessis, Eric; Campagna, Raphaël; Sverzut, Jean-Michel; Bach, Fabienne; Rodallec, Mathieu; Guerini, Henri; Feydy, Antoine; Drapé, Jean-Luc

2013-01-01

With arthroplasty being increasingly used to relieve joint pain, imaging of patients with metal implants can represent a significant part of the clinical work load in the radiologist's daily practice. Computed tomography (CT) plays an important role in the postoperative evaluation of patients who are suspected of having metal prosthesis-related problems such as aseptic loosening, bone resorption or osteolysis, infection, dislocation, metal hardware failure, or periprosthetic bone fracture. Despite advances in detector technology and computer software, artifacts from metal implants can seriously degrade the quality of CT images, sometimes to the point of making them diagnostically unusable. Several factors may help reduce the number and severity of artifacts at multidetector CT, including decreasing the detector collimation and pitch, increasing the kilovolt peak and tube charge, and using appropriate reconstruction algorithms and section thickness. More recently, dual-energy CT has been proposed as a means of reducing beam-hardening artifacts. The use of dual-energy CT scanners allows the synthesis of virtual monochromatic spectral (VMS) images. Monochromatic images depict how the imaged object would look if the x-ray source produced x-ray photons at only a single energy level. For this reason, VMS imaging is expected to provide improved image quality by reducing beam-hardening artifacts.

Jolkinolide B inhibits RANKL-induced osteoclastogenesis by suppressing the activation NF-κB and MAPK signaling pathways.

PubMed

Ma, Xiaojun; Liu, Yupeng; Zhang, Yao; Yu, Xiaobing; Wang, Weiming; Zhao, Dewei

2014-03-07

Osteoclasts together with osteoblasts play pivotal roles in bone remodeling. The unique function and ability of osteoclasts to resorb bone makes them critical in both normal bone homeostasis and pathologic bone diseases such as osteoporosis and rheumatoid arthritis. Thus, new compounds that may inhibit osteoclastogenesis and osteoclast function may be of great value in the treatment of osteoclast-related diseases. In the present study, we examined the effect of jolkinolide B (JB), isolated from the root of Euphorbia fischeriana Steud on receptor activator of NF-κB ligand (RANKL)-induced osteoclast formation. We found that JB inhibited RANKL-induced osteoclast differentiation from bone marrow macrophages (BMMs) without cytotoxicity. Furthermore, the expression of osteoclastic marker genes, such as tartrate-resistant acid phosphatase (TRAP), cathepsin K (CtsK), and calcitonin receptor (CTR), was significantly inhibited. JB inhibited RANKL-induced activation of NF-κB by suppressing RANKL-mediated IκBα degradation. Moreover, JB inhibited RANKL-induced phosphorylation of mitogen-activated protein kinases (p38, JNK, and ERK). This study thus identifies JB as an inhibitor of osteoclast formation and provides evidence that JB might be an alternative medicine for preventing and treating osteolysis. Copyright © 2014 Elsevier Inc. All rights reserved.

Total Hip Arthroplasty in Patients With Avascular Necrosis After Hematopoietic Stem Cell Transplantation.

PubMed

Vijapura, Anita; Levine, Harlan B; Donato, Michele; Hartzband, Mark A; Baker, Melissa; Klein, Gregg R

2018-03-01

The immunosuppressive regimens required for hematopoietic stem cell transplantation predispose recipients to complications, including avascular necrosis. Cancer-related comorbidities, immunosuppression, and poor bone quality theoretically increase the risk for perioperative medical complications, infection, and implant-related complications in total joint arthroplasty. This study reviewed 20 primary total hip arthroplasties for avascular necrosis in 14 patients. Outcomes were assessed at routine clinical visits and Harris hip scores were calculated. Follow-up radiographs were evaluated for component malposition, loosening, polyethylene wear, and osteolysis. Average follow-up was 44.5 months for all patients. Postoperative clinical follow-up revealed good to excellent outcomes, with significant improvement in functional outcome scores. There were no periprosthetic infections or revisions for aseptic loosening. There was 1 dislocation on postoperative day 40, which was treated successfully with a closed reduction. Two patients with a prior history of venous thromboembolism developed a pulmonary embolus on postoperative day 13 and 77, respectively. Four patients died several months to years after arthroplasty of complications unrelated to the surgical procedure. Total hip arthroplasty can both be safely performed and greatly improve quality of life in recipients of hematopoietic stem cell transplantation who develop avascular necrosis. However, prolonged venous thromboembolism prophylaxis should be carefully considered in this high-risk patient population. [Orthopedics. 2018; 41(2):e257-e261.]. Copyright 2018, SLACK Incorporated.

Time-of-flight secondary ion mass spectrometry study on the distribution of alendronate sodium in drug-loaded ultra-high molecular weight polyethylene.

PubMed

Liu, Xiaomin; Qu, Shuxin; Lu, Xiong; Ge, Xiang; Leng, Yang

2009-12-01

The aim of this study was to investigate the drug distribution in ultra-high molecular weight polyethylene (UHMWPE) loaded with alendronate sodium (ALN), which was developed to treat particle-induced osteolysis after artificial joint replacements, since the drug distribution in UHMWPE could play a key role in controlling drug release. A mixture of UHMWPE powder and ALN was dried and hot pressed to prepare UHMWPE loaded with ALN (UHMWPE-ALN). Fourier transform infrared spectroscopy analysis demonstrated that the hot press had no effect on the functional groups of ALN in UHMWPE-ALN. X-ray diffraction indicated that there was no phase change of the UHMWPE after hot pressing. Time-of-flight secondary ion mass spectrometry (ToF-SIMS) spectra revealed the existence of characteristic elements and functional groups from ALN in UHMWPE-ALN, such as Na+, C3H8N+, PO3(-) and PO3H(-). In addition, SIMS images suggested that ALN did not agglomerate in UHMWPE-ALN. A small punch test and hardness test were carried out and the results indicated that ALN did not affect the mechanical properties at the present content level. The present study demonstrated that it was feasible to fabricate the un-agglomerated distributed drug in UHMWPE with good mechanical properties. This ALN loaded UHMWPE would have potential application in clinics.

Stimulation of cannabinoid receptors by using Rubus coreanus extracts to control osteoporosis in aged male rats.

PubMed

Lim, Hae-Kyoung; Lee, Hye-Rim; Do, Sun Hee

2015-06-01

A substantial proportion of men with prostatic disease have an increased risk of bone loss. In the present study, we investigated the effects of Rubus coreanus Miquel (RCM) extracts on osteoporosis that occurs with N-methyl-N-nitrosourea (MNU)-induced prostatic hyperplasia. The rats used in this study were categorized into groups of healthy controls, rats treated with MNU, and rats treated with MNU and RCM. The rats were sacrificed after 10 weeks of RCM treatment, after which ultrasonography, serum biochemical tests, histopathological examinations, immunohistochemical analysis, and semi-quantitative reverse-transcription polymerase chain reaction analysis were performed. There were no marked differences in body weight gain and the size and weight of the prostate gland between the MNU group and the MNU and RCM group. However, treatment with RCM inhibited osteoclastic osteolysis and reduced dysplastic progress in the prostate gland, as observed by histopathological evaluation and by analyzing changes in the levels of bone regulatory factors. In addition, the group treated with MNU and RCM had higher expression levels of cannabinoid receptors-1, -2, and osteoprotegerin. These results indicate that the anti-osteoporotic effect of RCM in prostatic hyperplasia is attributable to the cannabinoid receptor-related upregulation of osteoblastogenesis and inhibition of prostatic hyperplasia. The results of the present study suggest that treatment with RCM may benefit osteoporotic patients with prostatic disease by simultaneously altering the activation of osteoblasts and osteoclasts.

Bio-corrosion of stainless steel by osteoclasts--in vitro evidence.

PubMed

Cadosch, Dieter; Chan, Erwin; Gautschi, Oliver P; Simmen, Hans-Peter; Filgueira, Luis

2009-07-01

Most metals in contact with biological systems undergo corrosion by an electrochemical process. This study investigated whether human osteoclasts (OC) are able to grow on stainless steel (SS) and directly corrode the metal alloy leading to the formation of corresponding metal ions, which may cause inflammatory reactions and activate the immune system. Scanning electron microscopy analysis demonstrated long-term viable OC cultures and evident resorption features on the surface of SS discs on which OC were cultured for 21 days. The findings were confirmed by atomic emission spectrometry investigations showing significantly increased levels of chromium, nickel, and manganese in the supernatant of OC cultures. Furthermore, significant levels of pro-inflammatory cytokines IL-1beta, IL-6, and TNF-alpha, which are considered to be major mediators of osteolysis, were revealed in the same cultures by cytometric bead array analysis. Within the present study, it was shown that human osteoclast precursors are able to grow and differentiate towards mature OC on SS. The mature cells are able to directly corrode the metal surface and release corresponding metal ions, which induce the secretion of pro-inflammatory cytokines that are known to enhance osteoclast differentiation, activation, and survival. Enhanced corrosion and the subsequently released metal ions may therefore result in enhanced osteolytic lesions in the peri-prosthetic bone, contributing to the aseptic loosening of the implant.

Relatively High Complication and Revision Rates of the Mayo® Metaphysical Conservative Femoral Stem in Young Patients.

PubMed

Rutenberg, Tal Frenkel; Warshevski, Yaniv; Gold, Aviram; Shasha, Nadav; Snir, Nimrod; Chechik, Ofir; Dolkart, Oleg; Eilig, Dynai; Herman, Amir; Rath, Ehud; Kramer, Moti; Drexler, Michael

2018-05-08

The Mayo metaphysical conservative femoral stem (Zimmer, Warsaw, Indiana) is a wedge-shaped implant designed to transfer loads proximally, reduce femoral destruction, and enable the preservation of bone stock in the proximal femur. Thus, it is a potentially preferred prosthesis for active, non-elderly patients who may require additional future surgeries. This retrospective case study analyzed the outcomes of consecutive patients who underwent total hip replacements with this stem between May 2001 and February 2013. All patients underwent clinical assessment, radiological evaluation for the presence and development of radiolucent lines, and functional assessment (numerical analog scale, Harris hip score, and Short Form-12 questionnaire). Ninety-five hips (79 patients) were available for analysis. The patients' mean age was 43 years (range, 18-64 years), and the mean follow-up was 97 months (range, 26.9-166 months). The postoperative clinical assessments and functional assessments revealed significant improvements. Sixteen patients (20.3%) had 18 orthopedic complications, the most common of which were an intraoperative femoral fracture and implant dislocation requiring revision surgeries in 10 hips (10.5%). Radiological analysis revealed evidence of femoral remodeling in 64 (67.4%) implants, spot welds (neocortex) in 35 (36.8%), and osteolysis in 3 (3.2%). These results suggest that the conservative hip femoral implant has an unacceptable complication rate for non-elderly patients. [Orthopedics. 201x; xx(x):xx-xx.]. Copyright 2018, SLACK Incorporated.

Arthroscopic-assisted Locking Compression Plate clavicular hook fixation for unstable fractures of the lateral end of the clavicle: a prospective study

PubMed Central

Lee, Kwang Won; Kim, Kap Jung; Kim, Yong In; Kwon, Won Cho; Choy, Won Sik

2009-01-01

The aim of this prospective study was to assess the clinical outcomes of an unstable fracture of the lateral end of the clavicle treated with an arthroscopic-assisted locking compressive plate (LCP) clavicular hook plate. Twenty-three patients underwent arthroscopic assisted LCP clavicular hook plate fixation for these fractures. All patients achieved clinical and radiological union over a mean of 4.2 months (range, 3.4–5 months). Four patients (17%) showed some degree of acromial osteolysis. Three patients (13%) showed radiological signs of arthrosis of the acromioclavicular joint. In one patient, a second fracture (stress) was observed between the medial two screws of the plate without an additional injury. Five patients (22%) showed subacromial bursitis on dynamic ultrasonography. The mean Constant and Murley score was 91 points (range, 81–98). The average level of pain in the shoulder at rest and on abduction was 1 (range, 0–2) and 2.4 (range, 0–4), respectively. Based on our experience, arthroscopic-assisted LCP hook plate fixation for the treatment of unstable fractures of the lateral end of the clavicle is not without complications. However, it is an acceptable alternative method that is easy to apply with good results. Furthermore, it prevents rotator cuff impingement, allows early mobilisation and maintains the acromioclavicular joint biomechanics. PMID:19998033

Hypercalcemia in dogs with adenocarcinoma derived from apocrine glands of the anal sac. Biochemical and histomorphometric investigations.

PubMed

Meuten, D J; Segre, G V; Capen, C C; Kociba, G J; Voelkel, E F; Levine, L; Tashjian, A H; Chew, D J; Nagode, L A

1983-04-01

Hypercalcemia, hypercalciuria, and hyperphosphaturia were present in female dogs with adenocarcinomas derived from apocrine glands of the anal sac (CA). Remission of hypercalcemia accompanied tumor excision in all six dogs undergoing surgery, whereas tumor recurrence or growth of metastases was associated with a return of hypercalcemia. Preoperatively, the plasma concentrations of immunoreactive parathyroid hormone in all dogs were undetectable or in the low normal range. Plasma concentrations of 13,14-dihydro-15-keto-prostaglandin E2 (PGE2M) and serum 1,25-dihydroxyvitamin D were not significantly different from control dogs. Urinary cyclic AMP and hydroxyproline were increased in dogs with CA. No immunoreactive parathyroid hormone was detected in extracts from tumor tissue, and parathyroid glands from dogs with CA had ultrastructural characteristics of secretory inactivity. Lumbar vertebrae from hypercalcemic dogs had decreased trabecular bone volume and increased osteoclastic bone resorption compared with age-matched control dogs. After tumor excision, serum total calcium returned to the normal range, whereas immunoreactive parathyroid hormone increased 2- to 20-fold and 1,25-dihydroxyvitamin D decreased 2- to 8-fold. Postoperative hypocalcemia was not observed. These results indicate that CA produces a hypercalcemic factor other than immunoreactive parathyroid hormone or prostaglandin E2 that increases osteoclastic osteolysis distant from the tumor and results in hypercalcemia, hypercalciuria, and hyperphosphaturia.

Constitutive activation of p38 MAPK in tumor cells contributes to osteolytic bone lesions in multiple myeloma

PubMed Central

Yang, Jing; He, Jin; Wang, Ji; Cao, Yabing; Ling, Jianhua; Qian, Jianfei; Lu, Yong; Li, Haiyan; Zheng, Yuhuan; Lan, Yongsheng; Hong, Sungyoul; Matthews, Jairo; Starbuck, Michael W; Navone, Nora M; Orlowski, Robert Z.; Lin, Pei; Kwak, Larry W.; Yi, Qing

2012-01-01

Bone destruction is a hallmark of multiple myeloma and affects more than 80% of patients. However, current therapy is unable to completely cure and/or prevent bone lesions. Although it is accepted that myeloma cells mediate bone destruction by inhibition of osteoblasts and activation of osteoclasts, the underlying mechanism is still poorly understood. This study demonstrates that constitutive activation of p38 mitogen-activated protein kinase in myeloma cells is responsible for myeloma-induced osteolysis. Our results show that p38 is constitutively activated in most myeloma cell lines and primary myeloma cells from patients. Myeloma cells with high/detectable p38 activity, but not those with low/undetectable p38 activity, injected into SCID or SCID-hu mice caused bone destruction. Inhibition or knockdown of p38 in human myeloma reduced or prevented myeloma-induced osteolytic bone lesions without affecting tumor growth, survival, or homing to bone. Mechanistic studies showed that myeloma cell p38 activity inhibited osteoblastogenesis and bone formation and activated osteoclastogenesis and bone resorption in myeloma-bearing SCID mice. This study elucidates a novel molecular mechanism—sactivation of p38 signaling in myeloma cells—by which myeloma cells induce osteolytic bone lesions and indicates that targeting myeloma cell p38 may be a viable approach to treating or preventing myeloma bone disease. PMID:22425892

MR Imaging of Knee Arthroplasty Implants

PubMed Central

Fritz, Jan; Lurie, Brett

2015-01-01

Primary total knee arthroplasty is a highly effective treatment that relieves pain and improves joint function in a large percentage of patients. Despite an initially satisfactory surgical outcome, pain, dysfunction, and implant failure can occur over time. Identifying the etiology of complications is vital for appropriate management and proper timing of revision. Due to the increasing number of knee arthroplasties performed and decreasing patient age at implantation, there is a demand for accurate diagnosis to determine appropriate treatment of symptomatic joints following knee arthroplasty, and for monitoring of patients at risk. Magnetic resonance (MR) imaging allows for comprehensive imaging evaluation of the tissues surrounding knee arthroplasty implants with metallic components, including the polyethylene components. Optimized conventional and advanced pulse sequences can result in substantial metallic artifact reduction and afford improved visualization of bone, implant-tissue interfaces, and periprosthetic soft tissue for the diagnosis of arthroplasty-related complications. In this review article, we discuss strategies for MR imaging around knee arthroplasty implants and illustrate the imaging appearances of common modes of failure, including aseptic loosening, polyethylene wear–induced synovitis and osteolysis, periprosthetic joint infections, fracture, patellar clunk syndrome, recurrent hemarthrosis, arthrofibrosis, component malalignment, extensor mechanism injury, and instability. A systematic approach is provided for evaluation of MR imaging of knee implants. MR imaging with optimized conventional pulse sequences and advanced metal artifact reduction techniques can contribute important information for diagnosis, prognosis, risk stratification, and surgical planning. ©RSNA, 2015 PMID:26295591

PMMA embolization to the left dorsal foot artery during percutaneous vertebroplasty for spinal metastases.

PubMed

Iliopoulos, Panagiotis; Panagiotis, Iliopoulos; Korovessis, Panagiotis; Panagiotis, Korovessis; Vitsas, Vasilios; Vasilios, Vitsas

2014-05-01

Distal arterial embolization to the foot with PMMA during vertebral augmentation has not been previously reported. We report a rare case of distal PMMA embolization to the dorsal foot artery during ipsilateral percutaneous lumbar vertebral augmentation in a patient with spinal osteolytic metastases. A 68-year-old woman was admitted because of severe disabling low back pain. Plain roentgenograms, MRI and CT-scan revealed osteolysis in the L4 and L5 vertebral bodies with prevertebral soft tissue involvement. Percutaneous vertebroplasty with PMMA was performed in L2 to L5 vertebrae under general anesthesia. Intraoperatively, leakage into the segmental vessels L3 and L5 was observed. Four hours after the procedure the clinical diagnosis of acute ischemia and drop foot on the left was made. CT-angiography justified linear cement leakage in the course of the left third lumbar vein and fifth lumbar artery, and to the ipsilateral common iliac artery. The patient was treated with low molecular heparin and the ischemia resolved without further sequelae 1 week postoperatively. PMMA leakage is a complication associated with vertebroplasty and kyphoplasty. Although the outcome of the PMMA embolization to the vessels resolved without sequelae, in our case spine surgeons and interventional radiologists should be aware on this rare complication in patients with osteolytic vertebral metastases even when contemporary cement containment techniques are used.

The response of macrophages to titanium particles is determined by macrophage polarization.

PubMed

Pajarinen, Jukka; Kouri, Vesa-Petteri; Jämsen, Eemeli; Li, Tian-Fang; Mandelin, Jami; Konttinen, Yrjö T

2013-11-01

Aseptic loosening of total joint replacements is driven by the reaction of macrophages to foreign body particles released from the implant. It was hypothesized that the macrophages' response to these particles is dependent, in addition to particle characteristics and contaminating biomolecules, on the state of macrophage polarization as determined by the local cytokine microenvironment. To test this hypothesis we differentiated M1 and M2 macrophages from human peripheral blood monocytes and compared their responses to titanium particles using genome-wide microarray analysis and a multiplex cytokine assay. In comparison to non-activated M0 macrophages, the overall chemotactic and inflammatory responses to titanium particles were greatly enhanced in M1 macrophages and effectively suppressed in M2 macrophages. In addition, the genome-wide approach revealed several novel, potentially osteolytic, particle-induced mediators, and signaling pathway analysis suggested the involvement of toll-like and nod-like receptor signaling in particle recognition. It is concluded that the magnitude of foreign body reaction caused by titanium particles is dependent on the state of macrophage polarization. Thus, by limiting the action of M1 polarizing factors, e.g. bacterial biofilm formation, in peri-implant tissues and promoting M2 macrophage polarization by biomaterial solutions or pharmacologically, it might be possible to restrict wear-particle-induced inflammation and osteolysis. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Osteoblast and osteocyte: games without frontiers.

PubMed

Capulli, Mattia; Paone, Riccardo; Rucci, Nadia

2014-11-01

The portrait of osteoblasts and osteocytes has been subjected to a revision, since a large body of evidence is attributing these cells amazing roles both inside and outside the bone. The osteoblast, long confined to its bone building function, is actually a very eclectic cell, actively regulating osteoclast formation and function as well as hematopoietic stem cells homeostasis. It is also an endocrine cell, affecting energy metabolism, male fertility and cognition through the release of osteocalcin, a perfect definition-fitting hormone in its uncarboxylated state. As for the osteocytes, many evidence shows that they do not merely represent the final destination of the osteoblasts, but they are instead very active cells that, besides a mechanosensorial function, actively contribute to the bone remodelling by regulating bone formation and resorption. The regulation is exerted by the production of sclerostin (SOST), which in turn inhibits osteoblast differentiation by blocking Wnt/beta-catenin pathway. At the same time, osteocytes influence bone resorption both indirectly, by producing RANKL, which stimulates osteoclastogenesis, and directly by means of a local osteolysis, which is observed especially under pathological conditions. The great versatility of both these cells reflects the complexity of the bone tissue, which has not only a structural role, but influences and is influenced by different organs, taking part in homeostatic and adaptive responses affecting the whole organism. Copyright © 2014. Published by Elsevier Inc.

Mastocytosis presenting as a skeletal disorder.

PubMed Central

Delsignore, J. L.; Dvoretsky, P. M.; Hicks, D. G.; O'Keefe, R. J.; Rosier, R. N.

1996-01-01

Mastocytosis is a rare disease of mast-cell proliferation with involvement of the reticuloendothelial systems including skin, bone, gastrointestinal tract, liver, lungs, spleen, and lymph nodes. Systemic mastocytosis is characterized by a combination of symptoms that relate to the mast cells' release of vasoactive substances, such as histamine. These symptoms include urticaria pigmentosa, flushing, syncope with hypotension, headaches, nausea, vomiting, diarrhea, and occasional bronchospasm. The diagnosis of mastocytosis is typically based on the presence of the characteristic extraosseus manifestations. A well recognized roentgenographic feature seen in 70-75% of patients with mastocytosis is diffuse osteolysis and osteosclerosis, affecting primarily the axial skeleton and the ends of the long bones. Rarely, the bony involvement consists of generalized osteoporosis, which may lead to pathologic fracture, or solitary lesions (mastocytomas) which may cause symptoms of localized pain. Four patients with previously diagnosed systemic mastocytosis had unusual skeletal lesions. Clinical and laboratory evaluation of these patients eventually led to the correct diagnosis of systemic mastocytosis. We report these four cases to emphasize the need for thorough evaluation of unusual musculoskeletal findings in association with extraosseus symptoms that are characteristic of mastocytosis. Knowledge of a wide differential diagnosis of unusual skeletal lesions should include systemic mastosytosis. Images Figure 1 Figure 2 Figure 3A Figure 3B Figure 4 Figure 5A Figure 5B-5C Figure 6 PMID:9129284

Hip resurfacing in patients under thirty years old: an attractive option for young and active patients.

PubMed

Krantz, Nicolas; Miletic, Bruno; Migaud, Henri; Girard, Julien

2012-09-01

Metal-on-metal hip resurfacing is offered as an alternative to traditional hip arthroplasty for young, active adults with advanced osteoarthritis. The concept of hip resurfacing is considered very attractive for this specific population (hard-on-hard bearing component with a large femoral head limiting the risk of dislocation, and allowing femoral bone stock preservation). A prospective clinical trial was designed to investigate the outcome of hip resurfacing in young patients (under 30 years old). We studied 24 hips in 22 patients. Mean age at operation was 24.9 years (range 17.1-29.9). No patient was lost to follow-up. There was no revision at average follow-up of 50.6 months (44-59). Mean UCLA activity score improved from 5.5 (1-9) pre-operatively to 7.6 (1-10) postoperatively (p < 0.001). Mean Harris hip score increased from 43.9 (19-67) to 89.3 (55-100) (p < 0.001). Radiological analysis discerned no osteolysis and no implant migration. The absence of short-term complications, such as mechanical failure or dislocation, is encouraging and leads us to think that mid-term results will be satisfactory. Moreover, the specific advantages of hip resurfacing (bone stock preservation, excellent stability, low risk of dislocation, large-diameter head) make the procedure a very attractive option for young subjects.

Lead arthritis and lead poisoning following bullet wounds: a clinicopathologic, ultrastructural, and microanalytic study of two cases.

PubMed

Slavin, R E; Swedo, J; Cartwright, J; Viegas, S; Custer, E M

1988-02-01

Bullet wounds causing lead synovitis in the wrist and knee are reported in two patients, one of whom also developed clinical plumbism. Very high lead levels in the synovial fluid are believed to be responsible for toxicity changes that occurred in the synovium and bone. Ultrastructurally, these alterations included the formation of nuclear lead inclusions, dilation, and degranulation of the rough endoplasmic reticulum and deposition of crystalline precipitates in the matrix of the mitochondria in macrophages, osteoclasts, and synoviocytes, as well as the development of cytoplasmic lead inclusions in osteoclasts. Energy-dispersive x-ray elemental analysis (EDXEA) indicated that the nuclear inclusions contained only lead, whereas precipitates within the mitochondria and elsewhere in the cytoplasm were composed of complexes containing lead, calcium, and phosphorus. Similarly constituted extracellular complexes were incorporated into newly formed trabecular bone laid down as a physiologic response to the bullet lodged within the wrist bones. This bone subsequently exhibited defects in bone resorption, which were characterized by depressed osteoclastic function and a unique lesion termed incomplete osteocytic osteolysis. The genesis of this latter lesion is uncertain. The sequestration of the partially degraded bone fragments containing lead complexes into the marrow and eventually into the joint spaces and synovium permitted the recycling of bone lead, and this may have played an important role in inducing clinical plumbism in one of the patients in this study.

Medication-related osteonecrosis of the jaw. Introduction of a new modified experimental model.

PubMed

Curra, Cláudia; Cardoso, Camila Lopes; Ferreira, Osny; Curi, Marcos Martins; Matsumoto, Mariza Akemi; Cavenago, Bruno Cavalini; Santos, Pâmela Letícia Dos; Santiago, Joel Ferreira

2016-05-01

To evaluate a modified experimental model for medication-related osteonecrosis of the jaw (MRONJ) through the upper right central incisor extraction followed by intravenous bisphosphonate administration. Forty five rats underwent the upper right central incisor tooth extraction were divided in 2 groups: Group I - experimental group, 30 rats received an intravenous administration protocol of zoledronic acid 35μg/kg into the tail vein every two weeks, totalizing four administrations, during eight weeks of administration, previously the extraction, and Group II - control group, 15 rats didn't received any medication before extraction. The groups were subdivided in postoperative periods: 14/28/42 days. Clinical analysis and microtomography were performed to verify the presence of osteonecrosis. In addition, descritive histological analysis of hematoxylin-eosin stained sections was performed to evaluate the presence of osteonecrosis or necrotic foci. Twelve (40%) rats, from experimental group, showed clinical signs of MRONJ (p=0.005), however, all samples showed imaginologic findings like osteolysis and loss of integrity of the cellular walls (p≤0.001). Microscopic evaluation revealed osteonecrosis areas with microbial colonies and inflammatory infiltrate (p≤0.001). In the control group, all animals presented the chronology of a normal wound healing. The presence of medication-related osteonecrosis of the jaw after maxillary central incisor extraction in rats. This new experimental model may be considered an option for the study of MRONJ.

[Alterations in expression of F-actin and DNA of fluid shear stress treated-mesenchymal stem cells affected by titanium particles loading].

PubMed

Wu, Jiang; Chen, Huiqing; Cao, Hui; Zhou, Jiang; Zhang, Li; Sung, K L

2004-02-01

Particulate wear debris within the bone-prosthesis microenvironment generated by normal wear and corrosion of orthopaedic implants is considered to be one of the main factors responsible for chronic aseptic inflammation and development of osteolysis in the long-term instability and failure of total joint arthroplasty. While the decrease in bone volume caused by wear debris-induced osteolysis could have been compensated by enough new bone matrix secreted by osteoblasts. Actually, the normal osteoblastic population depend on the regular differentiation and proliferation of their progenitor cells--bone marrow mesenchymal stem cells (MSCs). This study aims to investigate the potential mechanism for the rat MSCs cytotoxicity upon exposure to Titanium (Ti) particles. Rat mesenchymal stem cells (rMSCs) isolated from 3-month-old male Sprague-Dawley rats by Percoll intensity gradient method were cultured in DMEM medium (low glucose) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 micrograms/ml streptomycin in a humidified incubator with 5% CO2 at 37 degrees C. In order to gain the homogenous cell population, rMSCs were passaged to 3-4th subpassage which were used in all the experiment groups. Then rMSCs were seeded in the 6 well culture plates and exposed to three different circle diameters (mean size, TD1: 0.9 micron, TD2: 2.7 microns, TD3: 6.9 microns) with three different concentrations (0.1 wt%, 0.05 wt%, 0.01 wt%, W/V) at different durations (8 h, 16 h, 24 h,), respectively. Unexposed rMSCs were used as control. In the given periods of Ti loading, fluid shear stress (FSS) was applied to each group cells. The expression of F-actin and DNA of the rMSCs at the indicated time were determined with laser confocal scanning microscopy and image analysis software. The results showed that there was up-regulation expression of F-actin in the rMSCs without Ti particles loading but in the presence of FSS. Ti particles loading can suppress the expression of F-action and DNA of rMSCs, but this down-regulation response varied with the three circle diameter, concentrations and durations of Ti particles. Among three kinds of diametrically different Ti particles, submicron Ti particles (0.9 micron) had the greatest suppressive response on rMSCs, together with some apoptosis bodies. Under the same diameter condition, the inhibition induced by Ti particles loading was in a manner dependent on the particles concentration and exposure duration. The reductive effects produced from 0.1 wt% Ti was the greatest and earliest among the responses from Ti particles at three different concentrations; and the lower the concentration, the weaker the repressive influence. Furthermore, with the elongation of exposure to Ti particles, the expression of F-actin and DNA decreased gradually, the lowest level was at 32 h. These findings demonstrated that Ti particles loading can attenuate rMSCs' viability in a manner dependent on the circle diameter, particles concentration, treatment period, suggesting that a reduction in the number of viable MSCs together with a compromise of the their differentiation into functional osteoblast may exacerbate aseptic loosening of total joint implant. Further investigation into particles-mediated suppression of MCSs viability may reveal novel mechanism of implant loosening and aid in development and application of osteolytic drug therapy and the optimization of design and selection of future orthopaedic biomaterials, thereby improving long-term compatibility and stability for arthroplasty patients.

Immobilization and long-term recovery results in large changes in bone structure and strength but no corresponding alterations of osteocyte lacunar properties.

PubMed

Bach-Gansmo, Fiona Linnea; Wittig, Nina Kølln; Brüel, Annemarie; Thomsen, Jesper Skovhus; Birkedal, Henrik

2016-10-01

The ability of osteocytes to demineralize the perilacunar matrix, osteocytic osteolysis, and thereby participate directly in bone metabolism, is an aspect of osteocyte biology that has received increasing attention during the last couple of years. The aim of the present work was to investigate whether osteocyte lacunar properties change during immobilization and subsequent recovery. A rat cortical bone model with negligible Haversian remodeling effects was used, with temporary immobilization of one hindlimb induced by botulinum toxin. Several complementary techniques covering multiple length scales enabled correlation of osteocyte lacunar properties to changes observed on the organ and tissue level of femoral bone. Bone structural parameters measured by μCT and mechanical properties were compared to sub-micrometer resolution SR μCT data mapping an unprecedented number (1.85 million) of osteocyte lacunae. Immobilization induced a significant reduction in aBMD, bone volume, tissue volume, and load to fracture, as well as the muscle mass of rectus femoris. During the subsequent recovery period, the bone structural and mechanical properties were only partly regained in spite of a long-term (28weeks) study period. No significant changes in osteocyte lacunar volume, density, oblateness, stretch, or orientation were detected upon immobilization or subsequent recovery. In conclusion, the bone architecture and not osteocyte lacunar properties or bone material characteristics dominate the immobilization response as well as the subsequent recovery. Copyright © 2016 Elsevier Inc. All rights reserved.

Inhibition effects of total flavonoids from Scutellaria barbata D. Don on human breast carcinoma bone metastasis via downregulating PTHrP pathway

PubMed Central

Liu, Huihui; Guo, Shanyu

2018-01-01

It is abundantly clear that tumor-derived parathyroid hormone-related protein (PTHrP), receptor activator of nuclear factor-κB ligand (RANKL) and osteoprotegerin (OPG) are central contributors in promoting osteolytic process of breast carcinoma bone metastasis. Forcusing on this molecular basis, the study was undertaken to explore the inhibition effects of total flavonoids from Scutellaria barbata D. Don (TF-SB) on human breast carcinoma bone metastasis. MDA-MB-231 cells and nude mouse models of breast cancer bone metastasis were given TF-SB in different concentrations. The proliferation, migration and invasion potentials of MDA-MB-231 cells were respectively tested. The effects of TF-SB on tumor weights and bone destruction were investigated. The mRNA and protein expression of PTHrP, OPG and RANKL were assessed by qPCR and western blot analysis. In vitro, TF-SB inhibited the proliferation, migration and invasion of MDA-MB-231 cells in a dose-dependent manner. In vivo, TF-SB prevented bone metastasis of breast cancer by decreasing the number of osteoclast cells per field in a dose-dependent manner, but not affecting tumor growth or mouse survival. Molecular analysis revealed that TF-SB controled the secretion of osteolysis-related factors PTHrP and its downstream RANKL/OPG. Together, by controlling the expression of PTHrP and its downstream OPG/RANKL, TF-SB has significant inhibition effects on breast cancer bone metastasis, which indicates a new therapeutic method. PMID:29512770

The results of a proximally-coated cementless femoral component in total hip replacement: a five- to 12-year follow-up.

PubMed

Kim, Y-H

2008-03-01

This study reviewed the results of a cementless anatomical femoral component to give immediate post-operative stability, and with a narrow distal section in order not to contact the femoral cortex in the diaphysis, ensuring exclusively metaphyseal loading. A total of 471 patients (601 hips) who had a total hip replacement between March 1995 and February 2002 were included in the study. There were 297 men and 174 women. The mean age at the time of operation was 52.7 years (28 to 63). Clinical and radiological evaluation were performed at each follow-up. Bone densitometry was carried out on all patients two weeks after operation and at the final follow-up examination. The mean follow-up was 8.8 years (5 to 12). The mean pre-operative Harris hip score was 41 points (16 to 54), which improved to a mean of 96 (68 to 100) at the final follow-up. No patient complained of thigh pain at any stage. No acetabular or femoral osteolysis was observed and no hip required revision for aseptic loosening of either component. Deep infection occurred in two hips (0.3%) which required revision. One hip (0.2%) required revision of the acetabular component for recurrent dislocation. Bone mineral densitometry revealed a minimal bone loss in the proximal femur. This cementless anatomical femoral component with metaphyseal loading but without distal fixation produced satisfactory fixation and encourages proximal femoral loading.

Long-term Outcome of Unconstrained Primary Total Hip Arthroplasty in Ipsilateral Residual Poliomyelitis.

PubMed

Buttaro, Martín A; Slullitel, Pablo A; García Mansilla, Agustín M; Carlucci, Sofía; Comba, Fernando M; Zanotti, Gerardo; Piccaluga, Francisco

2017-03-01

Incapacitating articular sequelae in the hip joint have been described for patients with late effects of poliomyelitis. In these patients, total hip arthroplasty (THA) has been associated with a substantial rate of dislocation. This study was conducted to evaluate the long-term clinical and radiologic outcomes of unconstrained THA in this specific group of patients. The study included 6 patients with ipsilateral polio who underwent primary THA between 1985 and 2006. Patients with polio who underwent THA on the nonparalytic limb were excluded. Mean follow-up was 119.5 months (minimum, 84 months). Clinical outcomes were evaluated with the modified Harris Hip Score (mHHS) and the visual analog scale (VAS) pain score. Radiographs were examined to identify the cause of complications and determine the need for revision surgery. All patients showed significantly better functional results when preoperative and postoperative mHHS (67.58 vs 87.33, respectively; P=.002) and VAS pain score (7.66 vs 2, respectively; P=.0003) were compared. Although 2 cases of instability were diagnosed, only 1 patient needed acetabular revision as a result of component malpositioning. None of the patients had component loosening, osteolysis, or infection. Unconstrained THA in the affected limb of patients with poliomyelitis showed favorable long-term clinical results, with improved function and pain relief. Nevertheless, instability may be a more frequent complication in this group of patients compared with the general population. [Orthopedics. 2017; 40(2):e255-e261.]. Copyright 2016, SLACK Incorporated.

The Osteogenic Niche Promotes Early-Stage Bone Colonization of Disseminated Breast Cancer Cells

PubMed Central

Wang, Hai; Yu, Cuijuan; Gao, Xia; Welte, Thomas; Muscarella, Aaron M.; Tian, Lin; Zhao, Hong; Zhao, Zhen; Du, Shiyu; Tao, Jianning; Lee, Brendan; Westbrook, Thomas F.; Wong, Stephen T. C.; Jin, Xin; Rosen, Jeffrey M.; Osborne, C. Kent; Zhang, Xiang H.-F.

2014-01-01

Summary Breast cancer bone micrometastases can remain asymptomatic for years before progressing into overt lesions. The biology of this process, including the microenvironment niche and supporting pathways, is unclear. We find that bone micrometastases predominantly reside in a niche that exhibits features of osteogenesis. Niche interactions are mediated by heterotypic adherens junctions (hAJs) involving cancer-derived E-cadherin and osteogenic N-cadherin, the disruption of which abolishes niche-conferred advantages. We further elucidate that hAJ activates the mTOR pathway in cancer cells, which drives the progression from single cells to micrometastases. Human datasets analyses support the roles of AJ and the mTOR pathway in bone colonization. Our study illuminates the initiation of bone colonization, and provides potential therapeutic targets to block progression toward osteolytic metastases. Significance In advanced stages, breast cancer bone metastases are driven by paracrine crosstalk among cancer cells, osteoblasts, and osteoclasts, which constitute a vicious osteolytic cycle. Current therapies targeting this process limit tumor progression, but do not improve patient survival. On the other hand, bone micrometastases may remain indolent for years before activating the vicious cycle, providing a therapeutic opportunity to prevent macrometastases. Here, we show that bone colonization is initiated in a microenvironment niche exhibiting active osteogenesis. Cancer and osteogenic cells form heterotypic adherens junctions, which enhance mTOR activity and drive early-stage bone colonization prior to osteolysis. These results reveal a strong connection between osteogenesis and micrometastasis and suggest potential therapeutic targets to prevent bone macrometastases. PMID:25600338

Histologic characterization of the cat middle ear: in sickness and in health.

PubMed

Sula, M M; Njaa, B L; Payton, M E

2014-09-01

The purpose of this study was to establish microscopic normal in the middle ear of the cat while concurrently characterizing gross and microscopic lesions reflecting spontaneous otitis media. Both ears from 50 cats were examined grossly and processed for histologic examination of the external, middle, and internal ear on a single slide. Gross lesions of the middle ear were present in 14 of 100 (14%) and included turbid fluid, frank pus, hemorrhage, and fibrous thickening of the auricular mucoperiosteum. Histologically, 48 of 100 (48%) ears had evidence of ongoing or previous inflammatory middle ear disease, including proteinaceous fluid; vascular ectasia; expansion of the auricular mucoperiosteum by neutrophils, lymphocytes, and macrophages; cholesterol clefts; hemorrhage; fibrin; granulation tissue; membranous pseudo-glands; fibrosis; proliferation and/or osteolysis of the tympanic and septum bullae. Histologic lesions were identified in 34 of 100 ears (34%) lacking gross evidence of disease. Ears were classified histologically as either normal (52/100 [52%]) or diseased (48/100 [48%]). Diseased ears were further classified as mild to moderate (37/100 [37%]) or severely (11/100 [11%]) affected. Internal ear involvement was present in 11 of 100 (11%) ears. Histologic evidence of middle ear disease in cats is far greater than gross lesions or clinical literature suggests; further investigation and correlation of clinical and histologic disease are warranted. With minimal additional preparation, diagnostic specimens may be readily prepared and evaluated for this integral sensing organ. © The Author(s) 2013.

Preserving the posttrapeziectomy space with a human acellular dermal matrix spacer: a pilot case series of patients with thumb carpometacarpal joint arthritis.

PubMed

Yao, Caroline A; Ellis, Chandra V; Cohen, Myles J; Kulber, David A

2013-10-01

Advanced thumb carpometacarpal arthritis is widely treated with trapeziectomy and tendon interposition despite donor-site morbidities. Trapeziectomy alone leaves a postresection space, leading to proximal metacarpal migration and scaphoid/trapezoid impingement. Prosthetic implants have been unsuccessful due to particulate debris, silicone synovitis, osteolysis, and migration. Recent studies have shown successful use of allograft for interposition material in the posttrapeziectomy space both in animal and human models. To obviate the need for autologous tissue, maintain thumb length, and reduce the risk of scaphoid impingement, the senior author developed an interposition arthroplasty technique using a spacer constructed from human acellular dermal matrix (HADM). Sixteen patients with Eaton stage III-IV thumb carpometacarpal osteoarthritis received the above procedure from the 2 senior authors. HADM was imbricated to fill the posttrapeziectomy space and secured to the volar capsule and metacarpal base. Pre- and postoperative trapezial space on radiograph, pain scores, and grip strength were recorded. Six months postoperatively, radiographs showed an average joint space loss of 11%. Heights postoperatively were not significantly different from immediate postoperative heights (P ≥ 0.01). At 6 months, patients had improved pain and grip strength (P ≤ 0.01). No infections, foreign body reactions, or other complications occurred. HADM has been used extensively in other forms of reconstruction and has been shown to incorporate into surrounding tissues through neovascularization. Our early results illustrate that HADM can safely fill the dead space left by trapeziectomy.

Clinical and radiological results on the fixation of Neer type 2 distal clavicle fractures with a hook plate.

PubMed

Şükür, Erhan; Öztürkmen, Yusuf; Akman, Yunus Emre; Güngör, Mustafa

2016-10-01

The aim of this study was to analyze the clinical and functional results of hook plate fixation in Neer type 2 distal clavicle fractures. We retrospectively analyzed 16 patients (11 males, 5 females) who were diagnosed with Neer type 2 distal clavicle fractures and treated with hook plate fixation between 2013 and 2014. Mean age was 38 (range: 27-61), and mean follow-up time was 14.3 (range: 12-18) months. Complications seen on radiographs were implant failure and subacromial osteolysis. The clinical results were evaluated with modified UCLA (University of California Los Angeles) scoring system. Bone union was achieved in all patients at the end of the first 4 months. Mean modified UCLA score was 32.75 (range 31-35). In 12 patients (68%), the implants had to be removed due to complications. After removal, the complaints regressed and shoulders' range of motion increased. Clinical and radiological results on the fixation of Neer type 2 distal clavicle fractures with a hook plate are good in terms of fracture union and function. The major disadvantage of the method was the requirement of early implant removal due to the hardware related complications and good results can be achieved only after plate removal. Optimizing the length of hook plate may lower the rate of complications. Level IV, Therapeutic study. Copyright © 2016 Turkish Association of Orthopaedics and Traumatology. Production and hosting by Elsevier B.V. All rights reserved.

Carbon-Fibre-Reinforced SiC Composite (C/SiSiC) as an Alternative Material for Endoprosthesis: Fabrication, Mechanical and In-Vitro Biological Properties

PubMed Central

Reichert, Aline; Gadow, Rainer; Mayr, Hermann O.; Suedkamp, Norbert P.; Weichand, Partick; Bernstein, Anke

2018-01-01

Particle-induced periprosthetic osteolysis and subsequent aseptic implant loosening are a major cause of compromising the long-term results of total joint replacements. To date, no implant has been able to mirror radically the tribological factors (friction/lubrication/wear) of in vivo tribological pairings. Carbon-Fibre Reinforced SiC-Composites (C/SiSiC), a material primarily developed for brake technology, has the opportunity to fulfil this requirement. Until now, the material itself has not been used in medicine. The aim of this investigation was to test the suitability of C/SiSiC ceramics as a new material for bearing couples in endoprosthetics. After the preparation of the composites flexural strength was determined as well as the Young’s-modulus and the coefficient of friction. To investigate in vitro biological properties, MG 63 and primary human osteoblasts were cultured on C/SiSiC composites. To review the proliferation, the cytotoxicity standardized tests were used. The cell morphology was observed by light microscopy, ESEM, confocal and 3D-laserscanning microscopy. C/SiSiC possesses a high resistance to wear. Cells exhibited no significant alterations in morphology. Vitality was not impaired by contact with the ceramic composite. There was no higher cytotoxicity to observe. Regarding these results, C/SiSiC ceramics seem to be biologically and mechanically appropriate for orthopaedic applications. PMID:29470416

Adoptive transfer of ex vivo expanded Vγ9Vδ2 T cells in combination with zoledronic acid inhibits cancer growth and limits osteolysis in a murine model of osteolytic breast cancer.

PubMed

Zysk, Aneta; DeNichilo, Mark O; Panagopoulos, Vasilios; Zinonos, Irene; Liapis, Vasilios; Hay, Shelley; Ingman, Wendy; Ponomarev, Vladimir; Atkins, Gerald; Findlay, David; Zannettino, Andrew; Evdokiou, Andreas

2017-02-01

Bone metastases occur in over 75% of patients with advanced breast cancer and are responsible for high levels of morbidity and mortality. In this study, ex vivo expanded cytotoxic Vγ9Vδ2 T cells isolated from human peripheral blood were tested for their anti-cancer efficacy in combination with zoledronic acid (ZOL), using a mouse model of osteolytic breast cancer. In vitro, expanded Vγ9Vδ2 T cells were cytotoxic against a panel of human breast cancer cell lines, and ZOL pre-treatment further sensitised breast cancer cells to killing by Vγ9Vδ2 T cells. Vγ9Vδ2 T cells adoptively transferred into NOD/SCID mice localised to osteolytic breast cancer lesions in the bone, and multiple infusions of Vγ9Vδ2 T cells reduced tumour growth in the bone. ZOL pre-treatment potentiated the anti-cancer efficacy of Vγ9Vδ2 T cells, with mice showing further reductions in tumour burden. Mice treated with the combination also had reduced tumour burden of secondary pulmonary metastases, and decreased bone degradation. Our data suggests that adoptive transfer of Vγ9Vδ2 T cell in combination with ZOL may prove an effective immunotherapeutic approach for the treatment of breast cancer bone metastases. Copyright © 2016. Published by Elsevier Ireland Ltd.

Adipose, Bone and Myeloma: Contributions from the Microenvironment

PubMed Central

McDonald, Michelle; Fairfield, Heather; Falank, Carolyne; Reagan, Michaela R.

2017-01-01

Researchers globally are working towards finding a cure for multiple myeloma (MM), a destructive blood cancer diagnosed yearly in ~750,000 people worldwide [1]. Although MM targets multiple organ systems, it is the devastating skeletal destruction experienced by over 90% of patients that often most severely impacts patient morbidity, pain, and quality of life. Preventing bone disease is therefore a priority in MM treatment, and understanding how and why myeloma cells target the bone marrow (BM) is fundamental to this process. This review focuses on a key area of MM research: the contributions of the bone microenvironment to disease origins, progression, and drug resistance. We describe some of the key cell types in the BM niche: osteoclasts, osteoblasts, osteocytes, adipocytes and mesenchymal stem cells. We then focus on how these key cellular players are, or could be, regulating a range of disease-related processes spanning MM growth, drug resistance, and bone disease (including osteolysis, fracture, and hypercalcemia). We summarize the literature regarding MM-bone cell and MM-adipocyte relationships and subsequent phenotypic changes or adaptations in MM cells, with the aim of providing a deeper understanding of how myeloma cells grow in the skeleton to cause bone destruction. We identify avenues and therapies that intervene in these networks to stop tumor growth and/or induce bone regeneration. Overall, we aim to illustrate how novel therapeutic target molecules, proteins, and cellular mediators may offer new avenues to attack this disease while reviewing currently utilized therapies. PMID:27343063

Imaging features of orbital myxosarcoma in dogs.

PubMed

Dennis, Ruth

2008-01-01

Myxomas and myxosarcomas are infiltrative connective tissue tumors of fibroblastic origin that can be distinguished by the presence of abundant mucinous stroma. This paper describes the clinical and imaging features of orbital myxosarcoma in five dogs and suggests a predilection for the orbit. The main clinical signs were slowly progressive exophthalmos with soft swelling of the pterygopalatine fossa, and in two dogs, of the periorbital area. No pain was associated with the eye or orbit but one dog had pain on opening the mouth. The dogs were imaged using combinations of ultrasonography, radiography, and magnetic resonance imaging. In four dogs, extensive fluid-filled cavities in the orbit and fascial planes were seen and in the fifth dog, the tumor appeared more solid with small, peripheral cystic areas. In all dogs, the lesion extended along fascial planes to involve the temporomandibular joint, with osteolysis demonstrable in two dogs. Fluid aspirated from the cystic areas was viscous and sticky, mimicking that from a salivary mucocoele. Myxomas and myxosarcomas are known to be infiltrative and not readily amenable to surgical removal but their clinical course seems to be slow, with a reasonable survival time with palliative treatment. In humans, a juxta-articular form is recognized in which a prominent feature is the presence of dilated, cyst-like spaces filled with mucinous material. It is postulated that orbital myxosarcoma in dogs may be similar to the juxta-articular form in man, and may arise from the temporomandibular joint.

Curcumin reduces trabecular and cortical bone in naive and lewis lung carcinoma-bearing mice.

PubMed

Yan, Lin; Yee, John A; Cao, Jay

2013-08-01

The present study investigated the effects of curcumin on bone microstructure in non-tumor-bearing and Lewis lung carcinoma-(LLC)-bearing female C57BL/6 mice. Morphometric analysis showed that dietary supplementation with curcumin (2% or 4%) significantly reduced the bone volume to total volume ratio, connectivity density and trabecular number, and significantly increased the structure model index (an indicator of the plate- and rod-like geometry of trabecular structure) and trabecular separation in vertebral bodies compared to controls in both non-tumor-bearing and LLC-bearing mice. Similar changes in trabecular bone were observed in the femoral bone in curcumin-fed mice. Curcumin significantly reduced the cortical bone area to total area ratio and cortical thickness in femoral mid-shaft, but not in vertebral bodies, in both non-tumor-bearing and LLC-bearing mice. Curcumin feeding reduced plasma concentrations of osteocalcin and increased tartrate-resistant acid phosphate 5b in mice regardless of the presence of LLC, indicating that curcumin disrupts the balance of bone remodeling. Our results demonstrated that curcumin reduced the trabecular bone volume and cortical bone density. The skeleton is a favored site of metastasis for many types of cancers, and curcumin has been investigated in clinical trials in patients with cancer for its chemopreventive effects. Our results suggest the possibility of a combined effect of cancer-induced osteolysis and curcumin-stimulated bone loss in patients using curcumin. The assessment of bone structural changes should be considered for those who participate in curcumin clinical trials to determine its effects on skeleton health, particularly for those with advanced malignancies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hudson, Bryan D.; Hum, Nicholas R.; Thomas, Cynthia B.

Inhibitors of Wnt signaling have been shown to be involved in prostate cancer (PC) metastasis; however the role of Sclerostin (Sost) has not yet been explored. Here we show that elevated Wnt signaling derived from Sost deficient osteoblasts promotes PC invasion, while rhSOST has an inhibitory effect. In contrast, rhDKK1 promotes PC elongation and filopodia formation, morphological changes characteristic of an invasive phenotype. Furthermore, rhDKK1 was found to activate canonical Wnt signaling in PC3 cells, suggesting that SOST and DKK1 have opposing roles on Wnt signaling in this context. Gene expression analysis of PC3 cells co-cultured with OBs exhibiting varyingmore » amounts of Wnt signaling identified CRIM1 as one of the transcripts upregulated under highly invasive conditions. We found CRIM1 overexpression to also promote cell-invasion. These findings suggest that bone-derived Wnt signaling may enhance PC tropism by promoting CRIM1 expression and facilitating cancer cell invasion and adhesion to bone. We concluded that SOST and DKK1 have opposing effects on PC3 cell invasion and that bone-derived Wnt signaling positively contributes to the invasive phenotypes of PC3 cells by activating CRIM1 expression and facilitating PC-OB physical interaction. As such, we investigated the effects of high concentrations of SOST in vivo. In conclusion, we found that PC3-cells overexpressing SOST injected via the tail vein in NSG mice did not readily metastasize, and those injected intrafemorally had significantly reduced osteolysis, suggesting that targeting the molecular bone environment may influence bone metastatic prognosis in clinical settings.« less

Hip Resurfacing Using Highly Cross-linked Polyethylene: Prospective Study Results at 8.5 Years.

PubMed

Pritchett, James W

2016-10-01

Hip resurfacing is an option to consider when treating younger, more active patients. Advantages over total hip arthroplasty include a more normal gait and a lower incidence of thigh pain. In this prospective study, 190 hip resurfacing procedures (164 participants) were performed using a cobalt-chromium femoral component and a cementless acetabular cup with a 3.8-mm highly cross-linked polyethylene acetabular liner. The mean follow-up was 8.5 (range, 7-10) years. Two participants were lost to follow-up and 2 died. One participant underwent successful revision surgery for acetabular loosening. Four participants underwent successful revision to a total hip arthroplasty because of femoral neck fracture (2), femoral loosening, or infection. The Kaplan-Meier survivorship was 97%. Acetabular bone conservation was assessed using computed tomography by measuring the medial acetabular wall. The mean thickness was 9 mm. Femoral bone was well preserved with a mean head:neck ratio of 1.37. There were 4 (2%) osteolytic defects up to 0.9 cm(3) on computed tomography and no instances of impending polyethylene wear-through. Seven polyethylene retrievals had a measured wear rate of 0.05 mm/y. Hip resurfacing using a highly cross-linked polyethylene acetabular component is a reliable procedure. Both femoral and acetabular bones are reasonably preserved compared with prior resurfacing methods. The low incidence of osteolysis and the low rate of wear found on retrievals suggest that many years of use in highly active patients is possible. Copyright © 2016 Elsevier Inc. All rights reserved.

Pseudotumor Caused by Titanium Particles From a Total Hip Prosthesis.

PubMed

Sakamoto, Masaaki; Watanabe, Hitoshi; Higashi, Hidetaka; Kubosawa, Hitoshi

2016-01-01

A 77-year-old woman underwent metal-on-polyethylene total hip arthroplasty for osteoarthritis of the right hip at another institution. During surgery, the greater trochanter was broken and internal fixation was performed with a trochanteric cable grip reattachment. Although postoperative recovery was uneventful, approximately 6 years later, the patient had severe right hip pain with apparent swelling, and she was referred to the authors' institution. Plain radiographs showed evidence of severe osteolysis in the proximal femur and cable breakage; however, preoperative aspiration culture findings were negative for bacterial growth. Magnetic resonance imaging showed a well-circumscribed mass, presumed to be a pseudotumor. Serum cobalt and chromium levels were within normal limits, and the serum titanium level was high. During surgery, the mass was excised and removal of the cable system revealed a sharp deficit in the bare femoral stem. Gross surgical findings showed no obvious evidence of infection and no corrosion at the head-neck junction; therefore, all components were retained besides the cable system, which resulted in clinical recovery. All of the cultures from specimens were negative for bacterial growth, and histologic findings were compatible with a pseudotumor, such as histiocytes containing metal particles, abundant plasma cells, and CD8-positive cells. Quantitative analysis by inductively coupled plasma atomic emission spectrometry showed that the main source of metal debris in the pseudotumor was the femoral stem, which was made of titanium alloy, not the broken cable, which was made of cobalt-chromium alloy. The findings suggest that titanium particles can form symptomatic solid pseudotumors. Copyright 2016, SLACK Incorporated.

Differences in Femoral Head Penetration Between Highly Cross-Linked Polyethylene Cemented Sockets and Uncemented Liners.

PubMed

Morita, Daigo; Seki, Taisuke; Higuchi, Yoshitoshi; Takegami, Yasuhiko; Ishiguro, Naoki

2017-12-01

This study aimed at investigating differences in femoral head penetration between highly cross-linked polyethylene (HXLPE) cemented sockets and uncemented liners during 5 years postoperatively. Ninety-six patients (106 hips) with a mean age of 64.4 (range, 35-83) years underwent total hip arthroplasty using a HXLPE cemented socket or liner and were respectively divided into cemented (35 patients [37 hips]) and uncemented (61 patients [69 hips]) groups. Femoral head penetrations were evaluated on both anteroposterior (AP)-view and Lauenstein-view radiographs, and mean polyethylene (PE) wear rates were calculated based on femoral head penetration from 2 to 5 years. Multivariate analyses were performed to assess risk factors for PE wear. At 5 years postoperatively, the cemented and uncemented groups exhibited proximal direction femoral head penetrations of 0.103 mm and 0.124 mm (P = .226) and anterior direction penetrations of 0.090 mm and 0.151 mm (P = .002), respectively. The corresponding mean PE wear rates were 0.004 mm/y and 0.009 mm/y in the AP-view (P = .286) and 0.005 mm/y and 0.012 mm/y in the Lauenstein-view (P = .168), respectively. Left-side operation and high activity were independent risk factors for PE wear on AP-view. When HXLPE was used, all mean PE wear rates were very low and those of cemented sockets and uncemented liners were very similar. PE particle theory suggests that the occurrence of osteolysis and related aseptic loosening might consequently decrease. Copyright © 2017 Elsevier Inc. All rights reserved.

Opposite Effects of Soluble Factors Secreted by Adipose Tissue on Proliferating and Quiescent Osteosarcoma Cells.

PubMed

Avril, Pierre; Duteille, Franck; Ridel, Perrine; Heymann, Marie-Françoise; De Pinieux, Gonzague; Rédini, Françoise; Blanchard, Frédéric; Heymann, Dominique; Trichet, Valérie; Perrot, Pierre

2016-03-01

Autologous adipose tissue transfer may be performed for aesthetic needs following resection of osteosarcoma, the most frequent primary malignant tumor of bone, excluding myeloma. The safety of autologous adipose tissue transfer regarding the potential risk of cancer recurrence must be addressed. Adipose tissue injection was tested in a human osteosarcoma preclinical model induced by MNNG-HOS cells. Culture media without growth factors from fetal bovine serum were conditioned with adipose tissue samples and added to two osteosarcoma cell lines (MNNG-HOS and MG-63) that were cultured in monolayer or maintained in nonadherent spheres, favoring a proliferation or quiescent stage, respectively. Proliferation and cell cycle were analyzed. Adipose tissue injection increased local growth of osteosarcoma in mice but was not associated with aggravation of lung metastasis or osteolysis. Adipose tissue-derived soluble factors increased the in vitro proliferation of osteosarcoma cells up to 180 percent. Interleukin-6 and leptin were measured in higher concentrations in adipose tissue-conditioned medium than in osteosarcoma cell-conditioned medium, but the authors' results indicated that they were not implicated alone. Furthermore, adipose tissue-derived soluble factors did not favor a G0-to-G1 phase transition of MNNG-HOS cells in nonadherent oncospheres. This study indicates that adipose tissue-soluble factors activate osteosarcoma cell cycle from G1 to mitosis phases, but do not promote the transition from quiescent G0 to G1 phases. Autologous adipose tissue transfer may not be involved in the activation of dormant tumor cells or cancer stem cells.

Biodegradable magnesium-based screw clinically equivalent to titanium screw in hallux valgus surgery: short term results of the first prospective, randomized, controlled clinical pilot study

PubMed Central

2013-01-01

Purpose Nondegradable steel-and titanium-based implants are commonly used in orthopedic surgery. Although they provide maximal stability, they are also associated with interference on imaging modalities, may induce stress shielding, and additional explantation procedures may be necessary. Alternatively, degradable polymer implants are mechanically weaker and induce foreign body reactions. Degradable magnesium-based stents are currently being investigated in clinical trials for use in cardiovascular medicine. The magnesium alloy MgYREZr demonstrates good biocompatibility and osteoconductive properties. The aim of this prospective, randomized, clinical pilot trial was to determine if magnesium-based MgYREZr screws are equivalent to standard titanium screws for fixation during chevron osteotomy in patients with a mild hallux valgus. Methods Patients (n=26) were randomly assigned to undergo osteosynthesis using either titanium or degradable magnesium-based implants of the same design. The 6 month follow-up period included clinical, laboratory, and radiographic assessments. Results No significant differences were found in terms of the American Orthopaedic Foot and Ankle Society (AOFAS) score for hallux, visual analog scale for pain assessment, or range of motion (ROM) of the first metatarsophalangeal joint (MTPJ). No foreign body reactions, osteolysis, or systemic inflammatory reactions were detected. The groups were not significantly different in terms of radiographic or laboratory results. Conclusion The radiographic and clinical results of this prospective controlled study demonstrate that degradable magnesium-based screws are equivalent to titanium screws for the treatment of mild hallux valgus deformities. PMID:23819489

Anterior total hip arthroplasty using a metaphyseal bone-sparing stem: component alignment and early complications.

PubMed

Ahmed, Mohammed M; Otto, Thomas J; Moed, Berton R

2016-04-22

Limited-incision total hip arthroplasty (THA) preserves hip abductors, posterior capsule, and external rotators potentially diminishing dislocation risk. However, potential complications also exist, such as component malposition. Specific implants have been manufactured that enhance compatibility with this technique, while preserving metaphyseal bone; however, little data exists documenting early complications and component position. The purpose was to evaluate primary THA using a curved, bone-sparing stem inserted through the anterior approach with respect to component alignment and early complications. In a retrospective analysis of 108 cases, the surgical technique was outlined and the occurrence of intraoperative fractures, postoperative dislocations, infection, and limb length inequality was determined. Femoral stem and acetabular cup alignment was quantified using the initial postoperative radiographs. Patient follow-up averaged 12.9 (range 2 to 36) months. There were eight (7.4 %) complications requiring revision surgery in three (2.8 %) patients with three (2.8 %) infections and three (2.8 %) dislocations. Intraoperative complications included one calcar fracture above the lesser trochanter. Leg length inequality >5 mm was present in three (2.8 %) patients. Radiographic analysis showed that femoral neutral alignment was achieved in 95 hips (88.0 %). All femoral stems demonstrated satisfactory fit and fill and no evidence of subsidence, osteolysis, or loosening. An average abduction angle of 44.8° (± 5.3) and average cup anteversion of 16.2° (± 4.2) were also noted. Although the technique with this implant and approach is promising, it does not appear to offer important advantages over standard techniques. However, the findings merit further, long-term study.

Intragenic SNP haplotypes associated with 84dup18 mutation in TNFRSF11A in four FEO pedigrees suggest three independent origins for this mutation.

PubMed

Elahi, Elahe; Shafaghati, Yousef; Asadi, Sareh; Absalan, Farnaz; Goodarzi, Hani; Gharaii, Nava; Karimi-Nejad, Mohammad Hassan; Shahram, Farhad; Hughes, Anne E

2007-01-01

Familial expansile osteolysis (FEO) is a rare disorder causing bone dysplasia. The clinical features of FEO include early-onset hearing loss, tooth destruction, and progressive lytic expansion within limb bones causing pain, fracture, and deformity. An 18-bp duplication in the first exon of the TNFRSF11A gene encoding RANK has been previously identified in four FEO pedigrees. Despite having the identical mutation, phenotypic variations among affected individuals of the same and different pedigrees were noted. Another 18-bp duplication, one base proximal to the duplication previously reported, was subsequently found in two unrelated FEO patients. Finally, mutations overlapping with the mutations found in the FEO pedigrees have been found in ESH and early-onset PDB pedigrees. An Iranian FEO pedigree that contains six affected individuals dispersed in three generations has previously been introduced; here, the clinical features of the proband are reported in greater detail, and the genetic defect of the pedigree is presented. Direct sequencing of the entire coding region and upstream and downstream noncoding regions of TNFRSF11A in her DNA revealed the same 18-bp duplication mutation as previously found in the four FEO pedigrees. Additionally, eight sequence variations as compared to the TNFRSF11A reference sequence were identified, and a haplotype linked to the mutation based on these variations was defined. Although the mutation in the Iranian and four of the previously described FEO pedigrees was the same, haplotypes based on the intragenic SNPs suggest that the mutations do not share a common descent.

Shape Tracking of a Dexterous Continuum Manipulator Utilizing Two Large Deflection Shape Sensors

PubMed Central

Farvardin, Amirhossein; Grupp, Robert; Murphy, Ryan J.; Taylor, Russell H.; Iordachita, Iulian

2016-01-01

Dexterous continuum manipulators (DCMs) can largely increase the reachable region and steerability for minimally and less invasive surgery. Many such procedures require the DCM to be capable of producing large deflections. The real-time control of the DCM shape requires sensors that accurately detect and report large deflections. We propose a novel, large deflection, shape sensor to track the shape of a 35 mm DCM designed for a less invasive treatment of osteolysis. Two shape sensors, each with three fiber Bragg grating sensing nodes is embedded within the DCM, and the sensors’ distal ends fixed to the DCM. The DCM centerline is computed using the centerlines of each sensor curve. An experimental platform was built and different groups of experiments were carried out, including free bending and three cases of bending with obstacles. For each experiment, the DCM drive cable was pulled with a precise linear slide stage, the DCM centerline was calculated, and a 2D camera image was captured for verification. The reconstructed shape created with the shape sensors is compared with the ground truth generated by executing a 2D–3D registration between the camera image and 3D DCM model. Results show that the distal tip tracking accuracy is 0.40 ± 0.30 mm for the free bending and 0.61 ± 0.15 mm, 0.93 ± 0.05 mm and 0.23 ± 0.10 mm for three cases of bending with obstacles. The data suggest FBG arrays can accurately characterize the shape of large-deflection DCMs. PMID:27761103

Wear Behaviours and Oxidation Effects on Different UHMWPE Acetabular Cups Using a Hip Joint Simulator

PubMed Central

Jaber, Sami Abdel; Merola, Massimiliano

2018-01-01

Given the long-term problem of polyethylene wear, medical interest in the new improved cross-linked polyethylene (XLPE), with or without the adding of vitamin E, has risen. The main aim of this study is to gain further insights into the mutual effects of radiation cross-linking and addition of vitamin E on the wear performance of ultra-high-molecular-weight polyethylene (UHMWPE). We tested four different batches of polyethylene (namely, a standard one, a vitamin E-stabilized, and two cross-linked) in a hip joint simulator for five million cycles where bovine calf serum was used as lubricant. The acetabular cups were then analyzed using a confocal profilometer to characterize the surface topography. Moreover; the cups were analyzed by using Fourier Transformed Infrared Spectroscopy and Differential Scanning Calorimetry in order to assess the chemical characteristics of the pristine materials. Comparing the different cups’ configuration, mass loss was found to be higher for standard polyethylene than for the other combinations. Mass loss negatively correlated to the cross-link density of the polyethylenes. None of the tested formulations showed evidence of oxidative degradation. We found no correlation between roughness parameters and wear. Furthermore, we found significantly differences in the wear behavior of all the acetabular cups. XLPEs exhibited lower weight loss, which has potential for reduced wear and decreased osteolysis. However, surface topography revealed smoother surfaces of the standard and vitamin E stabilized polyethylene than on the cross-linked samples. This observation suggests incipient crack generations on the rough and scratched surfaces of the cross-linked polyethylene liners. PMID:29547536

NF-κB as a Therapeutic Target in Inflammatory-Associated Bone Diseases.

PubMed

Lin, T-H; Pajarinen, J; Lu, L; Nabeshima, A; Cordova, L A; Yao, Z; Goodman, S B

Inflammation is a defensive mechanism for pathogen clearance and maintaining tissue homeostasis. In the skeletal system, inflammation is closely associated with many bone disorders including fractures, nonunions, periprosthetic osteolysis (bone loss around orthopedic implants), and osteoporosis. Acute inflammation is a critical step for proper bone-healing and bone-remodeling processes. On the other hand, chronic inflammation with excessive proinflammatory cytokines disrupts the balance of skeletal homeostasis involving osteoblastic (bone formation) and osteoclastic (bone resorption) activities. NF-κB is a transcriptional factor that regulates the inflammatory response and bone-remodeling processes in both bone-forming and bone-resorption cells. In vitro and in vivo evidences suggest that NF-κB is an important potential therapeutic target for inflammation-associated bone disorders by modulating inflammation and bone-remodeling process simultaneously. The challenges of NF-κB-targeting therapy in bone disorders include: (1) the complexity of canonical and noncanonical NF-κB pathways; (2) the fundamental roles of NF-κB-mediated signaling for bone regeneration at earlier phases of tissue damage and acute inflammation; and (3) the potential toxic effects on nontargeted cells such as lymphocytes. Recent developments of novel inhibitors with differential approaches to modulate NF-κB activity, and the controlled release (local) or bone-targeting drug delivery (systemic) strategies, have largely increased the translational application of NF-κB therapy in bone disorders. Taken together, temporal modulation of NF-κB pathways with the combination of recent advanced bone-targeting drug delivery techniques is a highly translational strategy to reestablish homeostasis in the skeletal system. © 2017 Elsevier Inc. All rights reserved.

F-18 FDG PET/CT in 26 patients with SAPHO syndrome: a new vision of clinical and bone scintigraphy correlation.

PubMed

Sun, Xiaochuan; Li, Chen; Cao, Yihan; Shi, Ximin; Li, Li; Zhang, Weihong; Wu, Xia; Wu, Nan; Jing, Hongli; Zhang, Wen

2018-05-22

Whole-body bone scintigraphy (WBBS) and MRI are widely used in assessment of patients with synovitis, acne, pustulosis, hyperostosis, and osteitis (SAPHO) syndrome. However, the value of F-18 fluorodeoxyglucose-positron emission tomography/computed tomography ( 18 F-FDG PET/CT) in SAPHO syndrome was unclear. The aim of this study was to characterize the manifestation of SAPHO syndrome on 18 F-FDG PET/CT and explore its relationship with clinical symptoms and WBBS. Twenty-six patients who suffered from SAPHO syndrome and had undergone whole-body 18 F-FDG PET/CT were recruited in Peking Union Medical College Hospital from 2004 to 2016. Clinical manifestations and laboratory findings were recorded for all patients. Imaging data on 18F-FDG PET/CT and WBBS were collected and analyzed retrospectively. All the 26 patients (20 females and 6 males) exhibited skeletal abnormalities on 18 F-FDG PET/CT. Multiple skeletal lesions affecting the anterior chest wall or spine with low to moderate 18 F-FDG uptake and coexistence of osteolysis and osteosclerosis presented as the typical features of SAPHO syndrome. Sixteen (61.5%) patients had abnormal 18 F-FDG uptake outside the osteoarticular system. PET scan had moderate to substantial agreement with CT and WBBS in revealing lesions in the anterior chest wall and axial skeleton. Nonetheless, the correlation between increased 18 F-FDG uptake and clinical symptoms was weak. SAPHO syndrome exhibits characteristic features on 18 F-FDG PET/CT. It showed comparable capacity in revealing skeletal lesions with bone scintigraphy.

NF-κB as a Therapeutic Target in Inflammatory-Associated Bone Diseases

PubMed Central

Lin, T.-h.; Pajarinen, J.; Lu, L.; Nabeshima, A.; Cordova, L.A.; Yao, Z.; Goodman, S.B.

2017-01-01

Inflammation is a defensive mechanism for pathogen clearance and maintaining tissue homeostasis. In the skeletal system, inflammation is closely associated with many bone disorders including fractures, nonunions, periprosthetic osteolysis (bone loss around orthopedic implants), and osteoporosis. Acute inflammation is a critical step for proper bone-healing and bone-remodeling processes. On the other hand, chronic inflammation with excessive proinflammatory cytokines disrupts the balance of skeletal homeostasis involving osteoblastic (bone formation) and osteoclastic (bone resorption) activities. NF-κB is a transcriptional factor that regulates the inflammatory response and bone-remodeling processes in both bone-forming and bone-resorption cells. In vitro and in vivo evidences suggest that NF-κB is an important potential therapeutic target for inflammation-associated bone disorders by modulating inflammation and bone-remodeling process simultaneously. The challenges of NF-κB-targeting therapy in bone disorders include: (1) the complexity of canonical and noncanonical NF-κB pathways; (2) the fundamental roles of NF-κB-mediated signaling for bone regeneration at earlier phases of tissue damage and acute inflammation; and (3) the potential toxic effects on nontargeted cells such as lymphocytes. Recent developments of novel inhibitors with differential approaches to modulate NF-κB activity, and the controlled release (local) or bone-targeting drug delivery (systemic) strategies, have largely increased the translational application of NF-κB therapy in bone disorders. Taken together, temporal modulation of NF-κB pathways with the combination of recent advanced bone-targeting drug delivery techniques is a highly translational strategy to reestablish homeostasis in the skeletal system. PMID:28215222

A CT scan protocol for the detection of radiographic loosening of the glenoid component after total shoulder arthroplasty

PubMed Central

2014-01-01

Background and purpose It is difficult to evaluate glenoid component periprosthetic radiolucencies in total shoulder arthroplasties (TSAs) using plain radiographs. This study was performed to evaluate whether computed tomography (CT) using a specific patient position in the CT scanner provides a better method for assessing radiolucencies in TSA. Methods Following TSA, 11 patients were CT scanned in a lateral decubitus position with maximum forward flexion, which aligns the glenoid orientation with the axis of the CT scanner. Follow-up CT scanning is part of our routine patient care. Glenoid component periprosthetic lucency was assessed according to the Molé score and it was compared to routine plain radiographs by 5 observers. Results The protocol almost completely eliminated metal artifacts in the CT images and allowed accurate assessment of periprosthetic lucency of the glenoid fixation. Positioning of the patient within the CT scanner as described was possible for all 11 patients. A radiolucent line was identified in 54 of the 55 observed CT scans and osteolysis was identified in 25 observations. The average radiolucent line Molé score was 3.4 (SD 2.7) points with plain radiographs and 9.5 (SD 0.8) points with CT scans (p = 0.001). The mean intra-observer variance was lower in the CT scan group than in the plain radiograph group (p = 0.001). Interpretation The CT scan protocol we used is of clinical value in routine assessment of glenoid periprosthetic lucency after TSA. The technique improves the ability to detect and monitor radiolucent lines and, therefore, possibly implant loosening also. PMID:24286563

Afferent Drive Elicits Ongoing Pain in a Model of Advanced Osteoarthritis

PubMed Central

Okun, Alec; Liu, Ping; Davis, Peg; Ren, Jiyang; Remeniuk, Bethany; Brion, Triza; Ossipov, Michael H.; Xie, Jennifer; Dussor, Gregory O.; King, Tamara; Porreca, Frank

2012-01-01

Osteoarthritis (OA) is a chronic condition characterized by pain during joint movement. Additionally, patients with advanced disease experience pain at rest (i.e., ongoing pain)that is generally resistant to non-steroidal anti-inflammatory drugs (NSAIDs). Injection of monosodium iodoacetate (MIA) into the intra-articular space of the rodent knee is a well-established model of OA that elicits weight-bearing asymmetry and referred tactile and thermal hypersensitivity. Whether ongoing pain is present in this model is unknown. Additionally, the possible relationship of ongoing pain to MIA dose is not known. MIA produced weight asymmetry, joint osteolysis, and cartilage erosion across a range of doses (1, 3, and 4.8 mg). However, only rats treated with the highest dose of MIA showed conditioned place preference to a context paired with intra-articular lidocaine, indicating relief from ongoing pain. Diclofenac blocked the MIA-induced weight asymmetry but failed to block MIA-induced ongoing pain. Systemic AMG9810, a TRPV1 antagonist, effectively blocked thermal hypersensitivity, but failed to block high dose MIA-induced weight asymmetry or ongoing pain. Additionally, systemic or intra-articular HC030031, a TRPA1 antagonist, failed to block high dose MIA-induced weight asymmetry or ongoing pain. Our studies suggest that a high dose of intra-articular MIA induces ongoing pain originating from the site of injury that is dependent on afferent fiber activity but apparently independent of TRPV1 or TRPA1 activation. Identification of mechanisms driving ongoing pain may enable development of improved treatments for patients with severe OA pain and diminish the need for joint replacement surgery. PMID:22387095

Postoperative Complications Associated With rhBMP2 Use in Posterior/Posterolateral Lumbar Fusion.

PubMed

Esmail, Nabil; Buser, Zorica; Cohen, Jeremiah R; Brodke, Darrel S; Meisel, Hans-Joerg; Park, Jong-Beom; Youssef, Jim A; Wang, Jeffrey C; Yoon, S Tim

2018-04-01

Retrospective database review. Posterior/posterolateral lumbar fusion (PLF) is an effective treatment for a variety of spinal disorders; however, variations in surgical technique have different complication profiles. The aim of our study was to quantify the frequency of various complications in patients undergoing PLF with and without human recombinant bone morphogenetic protein 2 (rhBMP2). We queried the orthopedic subset of the Medicare database (PearlDiver) between 2005 and 2011 for patients undergoing PLF procedures with and without rhBMP2. Complication and reoperation rates were analyzed within 1 year of the index procedure. Complications assessed include: acute renal failure, deep vein thrombosis, dural tear, hematoma, heterotopic ossification, incision and drainage, cardiac complications, nervous system complications, osteolysis, pneumonia, pseudarthrosis, pulmonary embolism, radiculopathy, respiratory complications, sepsis, urinary retention, urinary tract infection, mechanical, and wound complications. Chi-square analysis was used to calculate the complication differences between the groups. Our data revealed higher overall complication rates in patients undergoing PLF with rhBMP2 versus no_rhBMP2 (76.9% vs 68.8%, P < .05). Stratified by gender, rhBMP2 males had higher rates of mechanical complications, pseudarthrosis, and reoperations compared with no_rhBMP2 males ( P < .05), whereas rhBMP2 females had higher rates of pseudarthrosis, urinary tract infection, and urinary retention compared with no_rhBMP2 females ( P < .05). Our data revealed higher overall complication rates in PLF patients given rhBMP2 compared with no_rhBMP2. Furthermore, our data suggests that rhBMP2-associated complications may be gender specific.

Bone Tumor Environment as a Potential Therapeutic Target in Ewing Sarcoma

PubMed Central

Redini, Françoise; Heymann, Dominique

2015-01-01

Ewing sarcoma is the second most common pediatric bone tumor, with three cases per million worldwide. In clinical terms, Ewing sarcoma is an aggressive, rapidly fatal malignancy that mainly develops not only in osseous sites (85%) but also in extra-skeletal soft tissue. It spreads naturally to the lungs, bones, and bone marrow with poor prognosis in the two latter cases. Bone lesions from primary or secondary (metastases) tumors are characterized by extensive bone remodeling, more often due to osteolysis. Osteoclast activation and subsequent bone resorption are responsible for the clinical features of bone tumors, including pain, vertebral collapse, and spinal cord compression. Based on the “vicious cycle” concept of tumor cells and bone resorbing cells, drugs, which target osteoclasts, may be promising agents as adjuvant setting for treating bone tumors, including Ewing sarcoma. There is also increasing evidence that cellular and molecular protagonists present in the bone microenvironment play a part in establishing a favorable “niche” for tumor initiation and progression. The purpose of this review is to discuss the potential therapeutic value of drugs targeting the bone tumor microenvironment in Ewing sarcoma. The first part of the review will focus on targeting the bone resorbing function of osteoclasts by means of bisphosphonates or drugs blocking the pro-resorbing cytokine receptor activator of NF-kappa B ligand. Second, the role of this peculiar hypoxic microenvironment will be discussed in the context of resistance to chemotherapy, escape from the immune system, or neo-angiogenesis. Therapeutic interventions based on these specificities could be then proposed in the context of Ewing sarcoma. PMID:26779435

Bone Tumor Environment as a Potential Therapeutic Target in Ewing Sarcoma.

PubMed

Redini, Françoise; Heymann, Dominique

2015-01-01

Ewing sarcoma is the second most common pediatric bone tumor, with three cases per million worldwide. In clinical terms, Ewing sarcoma is an aggressive, rapidly fatal malignancy that mainly develops not only in osseous sites (85%) but also in extra-skeletal soft tissue. It spreads naturally to the lungs, bones, and bone marrow with poor prognosis in the two latter cases. Bone lesions from primary or secondary (metastases) tumors are characterized by extensive bone remodeling, more often due to osteolysis. Osteoclast activation and subsequent bone resorption are responsible for the clinical features of bone tumors, including pain, vertebral collapse, and spinal cord compression. Based on the "vicious cycle" concept of tumor cells and bone resorbing cells, drugs, which target osteoclasts, may be promising agents as adjuvant setting for treating bone tumors, including Ewing sarcoma. There is also increasing evidence that cellular and molecular protagonists present in the bone microenvironment play a part in establishing a favorable "niche" for tumor initiation and progression. The purpose of this review is to discuss the potential therapeutic value of drugs targeting the bone tumor microenvironment in Ewing sarcoma. The first part of the review will focus on targeting the bone resorbing function of osteoclasts by means of bisphosphonates or drugs blocking the pro-resorbing cytokine receptor activator of NF-kappa B ligand. Second, the role of this peculiar hypoxic microenvironment will be discussed in the context of resistance to chemotherapy, escape from the immune system, or neo-angiogenesis. Therapeutic interventions based on these specificities could be then proposed in the context of Ewing sarcoma.

Computational wear assessment of hard on hard hip implants subject to physically demanding tasks.

PubMed

Nithyaprakash, R; Shankar, S; Uddin, M S

2018-05-01

Hip implants subject to gait loading due to occupational activities are potentially prone to failures such as osteolysis and aseptic loosening, causing painful revision surgeries. Highly risky gait activities such as carrying a load, stairs up or down and ladder up or down may cause excessive loading at the hip joint, resulting in generation of wear and related debris. Estimation of wear under the above gait activities is thus crucial to design and develop a new and improved implant component. With this motivation, this paper presents an assessment of wear generation of PCD-on-PCD (poly crystalline diamond) hip implants using finite element (FE) analysis. Three-dimensional (3D) FE model of hip implant along with peak gait and peak flexion angle for each activity was used to estimate wear of PCD for 10 million cycles. The maximum and minimum initial contact pressures of 206.19 MPa and 151.89 MPa were obtained for carrying load of 40 kg and sitting down or getting up activity. The simulation results obtained from finite element model also revealed that the maximum linear wear of 0.585 μm occurred for the patients frequently involved in sitting down or getting up gait activity and maximum volumetric wear of 0.025 mm 3 for ladder up gait activity. The stair down activity showed the least linear and volumetric wear of 0.158 μm and 0.008 mm 3 , respectively, at the end of 10 million cycles. Graphical abstract Computational wear assessment of hip implants subjected to physically demanding tasks.

Bone morphogenetic proteins: a powerful osteoinductive compound with non-negligible side effects and limitations.

PubMed

Oryan, Ahmad; Alidadi, Soodeh; Moshiri, Ali; Bigham-Sadegh, Amin

2014-01-01

Healing and regeneration of large bone defects leading to non-unions is a great concern in orthopedic surgery. Since auto- and allografts have limitations, bone tissue engineering and regenerative medicine (TERM) has attempted to solve this issue. In TERM, healing promotive factors are necessary to regulate the several important events during healing. An ideal treatment strategy should provide osteoconduction, osteoinduction, osteogenesis, and osteointegration of the graft or biomaterials within the healing bone. Since many materials have osteoconductive properties, only a few biomaterials have osteoinductive properties which are important for osteogenesis and osteointegration. Bone morphogenetic proteins (BMPs) are potent inductors of the osteogenic and angiogenic activities during bone repair. The BMPs can regulate the production and activity of some growth factors which are necessary for the osteogenesis. Since the introduction of BMP, it has added a valuable tool to the surgeon's possibilities and is most commonly used in bone defects. Despite significant evidences suggesting their potential benefit on bone healing, there are some evidences showing their side effects such as ectopic bone formation, osteolysis and problems related to cost effectiveness. Bone tissue engineering may create a local environment, using the delivery systems, which enables BMPs to carry out their activities and to lower cost and complication rate associated with BMPs. This review represented the most important concepts and evidences regarding the role of BMPs on bone healing and regeneration from basic to clinical application. The major advantages and disadvantages of such biologic compounds together with the BMPs substitutes are also discussed. © 2014 International Union of Biochemistry and Molecular Biology.

Characteristics of highly cross-linked polyethylene wear debris in vivo

PubMed Central

Baxter, Ryan M.; MacDonald, Daniel W.; Kurtz, Steven M.; Steinbeck, Marla J.

2014-01-01

Despite the widespread implementation of highly cross-linked polyethylene (HXLPE) liners to reduce the clinical incidence of osteolysis, it is not known if the improved wear resistance will outweigh the inflammatory potential of HXLPE wear debris generated in vivo. Thus, we asked: What are the differences in size, shape, number, and biological activity of polyethylene wear particles obtained from primary total hip arthroplasty revision surgery of conventional polyethylene (CPE) versus remelted or annealed HXLPE liners? Pseudocapsular tissue samples were collected from revision surgery of CPE and HXLPE (annealed and remelted) liners, and digested using nitric acid. The isolated polyethylene wear particles were evaluated using scanning electron microscopy. Tissues from both HXLPE cohorts contained an increased percentage of submicron particles compared to the CPE cohort. However, the total number of particles was lower for both HXLPE cohorts, as a result there was no significant difference in the volume fraction distribution and specific biological activity (SBA; the relative biological activity per unit volume) between cohorts. In contrast, based on the decreased size and number of HXLPE wear debris there was a significant decrease in total particle volume (mm3/g of tissue). Accordingly, when the SBA was normalized by total particle volume (mm3/gm tissue) or by component wear volume rate (mm3/year), functional biological activity of the HXLPE wear debris was significantly decreased compared to the CPE cohort. Indications for this study are that the osteolytic potential of wear debris generated by HXLPE liners in vivo is significantly reduced by improvements in polyethylene wear resistance. PMID:23436587

Adenosine A2A Receptor Activation Prevents Wear Particle-Induced Osteolysis

PubMed Central

Mediero, Aránzazu; Frenkel, Sally R.; Wilder, Tuere; He, Wenjie; Mazumder, Amitabha; Cronstein, Bruce N.

2012-01-01

Prosthesis loosening, associated with wear-particle–induced inflammation and osteoclast-mediated bone destruction, is a common cause for joint implant failure, leading to revision surgery. Adenosine A2A receptors (A2AR) mediate potent anti-inflammatory effects in many tissues and prevent osteoclast differentiation. We tested the hypothesis that an A2AR agonist could reduce osteoclast-mediated bone resorption in a murine calvaria model of wear-particle–induced bone resorption. C57Bl/6 and A2A knockout (A2ARKO) mice received ultrahigh-molecular weight polyethylene particles (UHMWPE) and were treated daily with either saline or the A2AR agonist CGS21680. After 2 weeks, micro-computed tomography of calvaria demonstrated that CGS21680 reduced particle-induced bone pitting and porosity in a dose-dependent manner, increasing cortical bone and bone volume compared to control mice. Histological examination demonstrated diminished inflammation after treatment with CGS21680. In A2AKO mice, CGS21680 did not affect osteoclast-mediated bone resorption or inflammation. Levels of bone-resorption markers receptor activator of nuclear factor-kB (RANK), RANK ligand (RANKL), cathepsin K, CD163, and osteopontin were reduced following CGS21680 treatment, together with a reduction in osteoclasts. Secretion of interleukin 1β (IL-1β) and TNFα was significantly decreased, whereas IL-10 was markedly increased in bone by CGS21680. These results in mice suggest that site-specific delivery of an adenosine A2AR agonist could enhance implant survival, delaying or eliminating the need for revision arthroplastic surgery. PMID:22623741

The Pathology of Orthopedic Implant Failure Is Mediated by Innate Immune System Cytokines

PubMed Central

Landgraeber, Stefan; Jäger, Marcus; Jacobs, Joshua J.; Hallab, Nadim James

2014-01-01

All of the over 1 million total joint replacements implanted in the US each year are expected to eventually fail after 15–25 years of use, due to slow progressive subtle inflammation at the bone implant interface. This inflammatory disease state is caused by implant debris acting, primarily, on innate immune cells, that is, macrophages. This slow progressive pathological bone loss or “aseptic loosening” is a potentially life-threatening condition due to the serious complications in older people (>75 yrs) of total joint replacement revision surgery. In some people implant debris (particles and ions from metals) can influence the adaptive immune system as well, giving rise to the concept of metal sensitivity. However, a consensus of studies agrees that the dominant form of this response is due to innate reactivity by macrophages to implant debris where both danger (DAMP) and pathogen (PAMP) signalling elicit cytokine-based inflammatory responses. This paper discusses implant debris induced release of the cytokines and chemokines due to activation of the innate (and the adaptive) immune system and the subsequent formation of osteolysis. Different mechanisms of implant-debris reactivity related to the innate immune system are detailed, for example, danger signalling (e.g., IL-1β, IL-18, IL-33, etc.), toll-like receptor activation (e.g., IL-6, TNF-α, etc.), apoptosis (e.g., caspases 3–9), bone catabolism (e.g., TRAP5b), and hypoxia responses (Hif1-α). Cytokine-based clinical and basic science studies are in progress to provide diagnosis and therapeutic intervention strategies. PMID:24891761

R3 Cup Does Not Have a High Failure Rate in Conventional Bearings: A Minimum of 5-Year Follow-Up.

PubMed

Teoh, Kar H; Whitham, Robert D J; Golding, David M; Wong, Jenny F; Lee, Paul Y F; Evans, Aled R

2018-02-01

The R3 cementless acetabular system was first marketed in Australia and Europe in 2007. Previous papers have shown high failure rates of the R3 cup with up to 24% with metal-on-metal bearing. There are currently no medium term clinical results on this cup. The aim of the study is to review our results of the R3 acetabular cup with conventional bearings with a minimum of 5-year follow-up. Patients who were implanted with the R3 acetabular cup were identified from our center's arthroplasty database. A total of 293 consecutive total hip arthroplasties were performed in 286 patients. The primary outcome was revision. The secondary outcomes were the Oxford Hip Scores (OHS) and radiographic evaluation. The mean age of the patients was 69.4 years. The mean preoperative OHS was 23 (range 10-34) and the mean OHS was 40 (range 33-48) at the final follow-up. Radiological evaluation showed an excellent ARA score in all patients at 5 years. None of the R3 cups showed osteolysis at the final follow-up. There were 3 revisions in our series, of which 2 R3 cups were revised. The risk of revision was 1.11% at 5 years. Our experience of using the R3 acetabular system with conventional bearings showed high survivorship and is consistent with the allocated Orthopaedic Data Evaluation Panel rating of 5A* as rated in 2015 in the United Kingdom. Copyright © 2017 Elsevier Inc. All rights reserved.

Immunological Responses to Total Hip Arthroplasty.

PubMed

Man, Kenny; Jiang, Lin-Hua; Foster, Richard; Yang, Xuebin B

2017-08-01

The use of total hip arthroplasties (THA) has been continuously rising to meet the demands of the increasingly ageing population. To date, this procedure has been highly successful in relieving pain and restoring the functionality of patients' joints, and has significantly improved their quality of life. However, these implants are expected to eventually fail after 15-25 years in situ due to slow progressive inflammatory responses at the bone-implant interface. Such inflammatory responses are primarily mediated by immune cells such as macrophages, triggered by implant wear particles. As a result, aseptic loosening is the main cause for revision surgery over the mid and long-term and is responsible for more than 70% of hip revisions. In some patients with a metal-on-metal (MoM) implant, metallic implant wear particles can give rise to metal sensitivity. Therefore, engineering biomaterials, which are immunologically inert or support the healing process, require an in-depth understanding of the host inflammatory and wound-healing response to implanted materials. This review discusses the immunological response initiated by biomaterials extensively used in THA, ultra-high-molecular-weight polyethylene (UHMWPE), cobalt chromium (CoCr), and alumina ceramics. The biological responses of these biomaterials in bulk and particulate forms are also discussed. In conclusion, the immunological responses to bulk and particulate biomaterials vary greatly depending on the implant material types, the size of particulate and its volume, and where the response to bulk forms of differing biomaterials are relatively acute and similar, while wear particles can initiate a variety of responses such as osteolysis, metal sensitivity, and so on.

[Patellar bone deficiency in revision total knee arthroplasty].

PubMed

Kloiber, J; Goldenitsch, E; Ritschl, P

2016-05-01

Patellar bone deficiency in revision total knee arthroplasty (TKA) determines the surgical procedure. Different reconstructive and ablative techniques, dependent on the remaining bone stock, are described. The primary patella implant can be retained in up to 50 % of revision situations. Reasons for replacement are aseptic and septic loosening, implant failure, expanding osteolysis, maltracking of the patella and "metal-backed" prosthesis. The aim of the reconstruction is the stable fixation and proper tracking of the implant by restoring the extensor mechanism. Dependent on the extent of bone loss and the availability of a patellar rim, the following surgical procedures are recommended. When the remaining bone thickness is 10 mm or more: implantation of a polyethylene "onlay-type" patella; when it is between 6-9 mm and there is an intact patellar rim: reconstruction with a biconvex "inlay-type" patella implant, where the biconvex shape replaces the bone defect partially. When there is deficient bone stock (less than 6 mm) or no cortical patellar rim then augmenting procedures with autologous spongiosa and procedures such as "impaction bone grafting", "trabecular metal" prosthesis, where the trabecular part of the implant serves as the base for the cemented polyethylene button, "gull-wing" osteotomy, which is an adapting and configuring technique of osteotomy; and in exceptional cases patelloplasty or patellectomy are used. Regarding the importance of the patellar component in biomechanics of the joint and function of the extensor mechanism, the reconstruction of the patella should be the primary aim. Patelloplasty or patellectomy should be avoided.

Biomechanical Analysis of Implanted Clavicle Hook Plates With Different Implant Depths and Materials in the Acromioclavicular Joint: A Finite Element Analysis Study.

PubMed

Lee, Cheng-Hung; Shih, Cheng-Min; Huang, Kui-Chou; Chen, Kun-Hui; Hung, Li-Kun; Su, Kuo-Chih

2016-11-01

Clinical implantation of clavicle hook plates is often used as a treatment for acromioclavicular joint dislocation. However, it is not uncommon to find patients that have developed acromion osteolysis or had peri-implant fracture after hook plate fixation. With the aim of preventing complications or fixation failure caused by implantation of inappropriate clavicle hook plates, the present study investigated the biomechanics of clavicle hook plates made of different materials and with different hook depths in treating acromioclavicular joint dislocation, using finite element analysis (FEA). This study established four parts using computer models: the clavicle, acromion, clavicle hook plate, and screws, and these established models were used for FEA. Moreover, implantations of clavicle hook plates made of different materials (stainless steel and titanium alloy) and with different depths (12, 15, and 18 mm) in patients with acromioclavicular joint dislocation were simulated in the biomechanical analysis. The results indicate that deeper implantation of the clavicle hook plate reduces stress on the clavicle, and also reduces the force applied to the acromion by the clavicle hook plate. Even though a clavicle hook plate made of titanium alloy (a material with a lower Young's modulus) reduces the force applied to the acromion by the clavicle hook plate, slightly higher stress on the clavicle may occur. The results obtained in this study provide a better reference for orthopedic surgeons in choosing different clavicle hook plates for surgery. Copyright © 2016 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

SOST Inhibits Prostate Cancer Invasion

DOE PAGES

Hudson, Bryan D.; Hum, Nicholas R.; Thomas, Cynthia B.; ...

2015-11-06

Inhibitors of Wnt signaling have been shown to be involved in prostate cancer (PC) metastasis; however the role of Sclerostin (Sost) has not yet been explored. Here we show that elevated Wnt signaling derived from Sost deficient osteoblasts promotes PC invasion, while rhSOST has an inhibitory effect. In contrast, rhDKK1 promotes PC elongation and filopodia formation, morphological changes characteristic of an invasive phenotype. Furthermore, rhDKK1 was found to activate canonical Wnt signaling in PC3 cells, suggesting that SOST and DKK1 have opposing roles on Wnt signaling in this context. Gene expression analysis of PC3 cells co-cultured with OBs exhibiting varyingmore » amounts of Wnt signaling identified CRIM1 as one of the transcripts upregulated under highly invasive conditions. We found CRIM1 overexpression to also promote cell-invasion. These findings suggest that bone-derived Wnt signaling may enhance PC tropism by promoting CRIM1 expression and facilitating cancer cell invasion and adhesion to bone. We concluded that SOST and DKK1 have opposing effects on PC3 cell invasion and that bone-derived Wnt signaling positively contributes to the invasive phenotypes of PC3 cells by activating CRIM1 expression and facilitating PC-OB physical interaction. As such, we investigated the effects of high concentrations of SOST in vivo. In conclusion, we found that PC3-cells overexpressing SOST injected via the tail vein in NSG mice did not readily metastasize, and those injected intrafemorally had significantly reduced osteolysis, suggesting that targeting the molecular bone environment may influence bone metastatic prognosis in clinical settings.« less

Restrictive orbital myofibroblastic sarcoma in a cat--cross-sectional imaging (MRI & CT) appearance, treatment, and outcome.

PubMed

Thomasy, Sara M; Cissell, Derek D; Arzi, Boaz; Vilches-Moure, Jose G; Lo, Winnie Y; Wisner, Erik R; Dubielzig, Richard R; Maggs, David J

2013-07-01

A 16-year-old spayed female cat was evaluated for lagophthalmos and chronic exposure keratitis in both eyes. Ophthalmic examination revealed upper and lower eyelid entropion of the left eye (OS) and markedly decreased retropulsion, restricted eye movement, marked episcleral congestion, and severe keratitis of both eyes (OU). Magnetic resonance imaging of both orbits revealed extensive, irregular, contrast-enhancing tissue without evidence of osteolysis considered compatible with diffuse inflammatory tissue. Feline herpesvirus DNA was not detected in conjunctival samples. Partial temporary tarsorrhaphies were placed OU, and the cat was treated with topically administered erythromycin ointment OU, orally administered famciclovir and prednisolone, and sublingually administered buprenorphine. Little improvement was noted after 2 weeks. Six weeks after initial presentation, a left exenteration was performed and histopathology was consistent with idiopathic sclerosing orbital pseudotumor (ISOP). Ten weeks after initial presentation, the patient represented for weight loss and jaw pain. Computed tomography demonstrated disease progression in the right orbit and the patient was euthanized. Histopathology of the decalcified skull revealed an aggressive and highly infiltrative mass involving the right orbit with extension to the maxilla, hard palate, nasal cavity and gingiva most consistent with feline restrictive orbital myofibroblastic sarcoma (FROMS). Clinical data from this patient support the reclassification of ISOP as FROMS. MRI and CT may provide supportive evidence for FROMS, but histopathology is necessary for definitive diagnosis. Aggressive and early surgical treatment, including bilateral exenteration, with adjunctive radiotherapy and/or chemotherapy should be considered for patients with FROMS. © 2013 American College of Veterinary Ophthalmologists.

Adipose, Bone, and Myeloma: Contributions from the Microenvironment.

PubMed

McDonald, Michelle M; Fairfield, Heather; Falank, Carolyne; Reagan, Michaela R

2017-05-01

Researchers globally are working towards finding a cure for multiple myeloma (MM), a destructive blood cancer diagnosed yearly in ~750,000 people worldwide (Podar et al. in Expert Opin Emerg Drugs 14:99-127, 2009). Although MM targets multiple organ systems, it is the devastating skeletal destruction experienced by over 90 % of patients that often most severely impacts patient morbidity, pain, and quality of life. Preventing bone disease is therefore a priority in MM treatment, and understanding how and why myeloma cells target the bone marrow (BM) is fundamental to this process. This review focuses on a key area of MM research: the contributions of the bone microenvironment to disease origins, progression, and drug resistance. We describe some of the key cell types in the BM niche: osteoclasts, osteoblasts, osteocytes, adipocytes, and mesenchymal stem cells. We then focus on how these key cellular players are, or could be, regulating a range of disease-related processes spanning MM growth, drug resistance, and bone disease (including osteolysis, fracture, and hypercalcemia). We summarize the literature regarding MM-bone cell and MM-adipocyte relationships and subsequent phenotypic changes or adaptations in MM cells, with the aim of providing a deeper understanding of how myeloma cells grow in the skeleton to cause bone destruction. We identify avenues and therapies that intervene in these networks to stop tumor growth and/or induce bone regeneration. Overall, we aim to illustrate how novel therapeutic target molecules, proteins, and cellular mediators may offer new avenues to attack this disease while reviewing currently utilized therapies.

Feline restrictive orbital myofibroblastic sarcoma in a cat – Cross sectional imaging (MRI & CT) appearance, treatment and outcome

PubMed Central

Thomasy, Sara M.; Cissell, Derek D.; Arzi, Boaz; Vilches-Moure, Jose G.; Lo, Winnie Y.; Wisner, Erik R.; Dubielzig, Richard R.; Maggs, David J.

2012-01-01

Case Description A 16-year-old spayed female cat evaluated for lagophthalmos and chronic exposure keratitis in both eyes. Clinical Findings Ophthalmic examination revealed upper and lower eyelid entropion of the left eye (OS) and markedly decreased retropulsion, restricted eye movement, marked episcleral congestion, and severe keratitis of both eyes (OU). Magnetic resonance imaging of both orbits revealed extensive, irregular, contrast-enhancing tissue without evidence of osteolysis considered compatible with diffuse inflammatory tissue. Feline herpesvirus DNA was not detected in conjunctival samples. Treatment and Outcome Partial temporary tarsorrhaphies were placed OU and the cat was treated with topically administered erythromycin ointment OU, orally administered famciclovir and prednisolone, and sublingually administered buprenorphine. Little improvement was noted after 2 weeks. Six weeks after presentation, a left exenteration was performed and histopathology was consistent with idiopathic sclerosing orbital pseudotumor (ISOP). Ten weeks after presentation, the patient presented for weight loss and jaw pain. Computed tomography demonstrated disease progression in the right orbit and the patient was euthanized. Histopathology of the decalcified skull revealed an aggressive and highly infiltrative mass involving the right orbit with extension to the maxilla, hard palate, nasal cavity and gingiva most consistent with feline restrictive orbital myofibroblastic sarcoma (FROMS). Clinical Relevance Clinical data from this patient support the reclassification of ISOP as FROMS. MRI and CT may provide supportive evidence for FROMS but histopathology is necessary for definitive diagnosis. Aggressive and early surgical treatment, including bilateral exenteration, with adjunctive radiotherapy and/or chemotherapy should be considered for patients with FROMS. PMID:23281709

Successful high-resolution animal positron emission tomography of human Ewing tumours and their metastases in a murine xenograft model.

PubMed

Franzius, Christiane; Hotfilder, Marc; Poremba, Christopher; Hermann, Sven; Schäfers, Klaus; Gabbert, Helmut Erich; Jürgens, Heribert; Schober, Otmar; Schäfers, Michael; Vormoor, Josef

2006-12-01

As primary osseous metastasis is the main adverse prognostic factor in patients with Ewing tumours, a NOD/scid mouse model for human Ewing tumour metastases has been established to examine the mechanisms of metastasis. The aim of this study was to evaluate the feasibility of diagnostic molecular imaging by small animal PET in this mouse model. Human Ewing tumour cells were transplanted into immune-deficient NOD/scid mice via s.c injection (n=17) or i.v. injection (n=17). The animals (mean weight 23.2 g) were studied 2-7 weeks after transplantation using a submillimetre resolution animal PET scanner. To assess glucose utilisation and bone metabolism, mice were scanned after intravenous injection of 9.6 MBq (mean) 2-[(18)F]fluoro-2-deoxy-D: -glucose (FDG) or 9.4 MBq (mean) [(18)F]fluoride. Whole-body PET images were analysed visually and semi-quantitatively [%ID/g, tumour to non-tumour ratio (T/NT)]. Foci of pathological uptake were identified with respect to the physiological organ uptake in corresponding regions. Subcutaneously transplanted Ewing tumours demonstrated a moderately increased glucose uptake (median %ID/g 2.5; median T/NT 2.2). After i.v. transplantation, the pattern of metastasis was similar to that in patients with metastases in lung, bone and soft tissue. These metastases showed an increased FDG uptake (median %ID/g 3.6; median T/NT 2.7). Osseous metastases were additionally visible on [(18)F]fluoride PET by virtue of decreased [(18)F]fluoride uptake (osteolysis; median %ID/g 8.4; median T/NT 0.59). Metastases were confirmed immunohistologically. Diagnostic molecular imaging of Ewing tumours and their small metastases in an in vivo NOD/scid mouse model is feasible using a submillimetre resolution PET scanner.

Increased migration of uncemented acetabular cups in female total hip arthroplasty patients with low systemic bone mineral density. A 2-year RSA and 8-year radiographic follow-up study of 34 patients.

PubMed

Finnilä, Sami; Moritz, Niko; SvedströM, Erkki; Alm, Jessica J; Aro, Hannu T

2016-02-01

Low bone mineral density (BMD) may jeopardize the initial component stability and delay osseointegration of uncemented acetabular cups in total hip arthroplasty (THA). We measured the migration of uncemented cups in women with low or normal BMD. We used radiostereometric analysis (RSA) to measure the migration of hydroxyapatite-coated titanium alloy cups with alumina-on-alumina bearings in THA of 34 female patients with a median age of 64 (41-78) years. 10 patients had normal BMD and 24 patients had low systemic BMD (T-score ≤ -1) based on dual-energy X-ray absorptiometry (DXA). Cup migration was followed with RSA for 2 years. Radiographic follow-up was done at a median of 8 (2-10) years. Patients with normal BMD did not show a statistically significant cup migration after the settling period of 3 months, while patients with low BMD had a continuous proximal migration between 3 and 12 months (p = 0.03). These differences in cup migration persisted at 24 months. Based on the perceived risk of cup revision, 14 of the 24 cases were "at risk" (proximal translation of 0.2 to 1.0 mm) in the low-BMD group and 2 of the 10 cases were "at risk" in the normal-BMD group (odds ratio (OR) = 8.0, 95% CI: 1.3-48). The radiographic follow-up showed no radiolucent lines or osteolysis. 2 cups have been revised for fractures of the ceramic bearings, but none for loosening. Low BMD contributed to cup migration beyond the settling period of 3 months, but the migrating cups appeared to osseointegrate eventually.

A tissue-engineered humanized xenograft model of human breast cancer metastasis to bone

PubMed Central

Thibaudeau, Laure; Taubenberger, Anna V.; Holzapfel, Boris M.; Quent, Verena M.; Fuehrmann, Tobias; Hesami, Parisa; Brown, Toby D.; Dalton, Paul D.; Power, Carl A.; Hollier, Brett G.; Hutmacher, Dietmar W.

2014-01-01

ABSTRACT The skeleton is a preferred homing site for breast cancer metastasis. To date, treatment options for patients with bone metastases are mostly palliative and the disease is still incurable. Indeed, key mechanisms involved in breast cancer osteotropism are still only partially understood due to the lack of suitable animal models to mimic metastasis of human tumor cells to a human bone microenvironment. In the presented study, we investigate the use of a human tissue-engineered bone construct to develop a humanized xenograft model of breast cancer-induced bone metastasis in a murine host. Primary human osteoblastic cell-seeded melt electrospun scaffolds in combination with recombinant human bone morphogenetic protein 7 were implanted subcutaneously in non-obese diabetic/severe combined immunodeficient mice. The tissue-engineered constructs led to the formation of a morphologically intact ‘organ’ bone incorporating a high amount of mineralized tissue, live osteocytes and bone marrow spaces. The newly formed bone was largely humanized, as indicated by the incorporation of human bone cells and human-derived matrix proteins. After intracardiac injection, the dissemination of luciferase-expressing human breast cancer cell lines to the humanized bone ossicles was detected by bioluminescent imaging. Histological analysis revealed the presence of metastases with clear osteolysis in the newly formed bone. Thus, human tissue-engineered bone constructs can be applied efficiently as a target tissue for human breast cancer cells injected into the blood circulation and replicate the osteolytic phenotype associated with breast cancer-induced bone lesions. In conclusion, we have developed an appropriate model for investigation of species-specific mechanisms of human breast cancer-related bone metastasis in vivo. PMID:24713276

Multiscale alterations in bone matrix quality increased fragility in steroid induced osteoporosis

PubMed Central

Karunaratne, A.; Xi, L.; Bentley, L.; Sykes, D.; Boyde, A.; Esapa, C.T.; Terrill, N.J.; Brown, S.D.M.; Cox, R.D.; Thakker, R.V.; Gupta, H.S.

2016-01-01

A serious adverse clinical effect of glucocorticoid steroid treatment is secondary osteoporosis, enhancing fracture risk in bone. This rapid increase in bone fracture risk is largely independent of bone loss (quantity), and must therefore arise from degradation of the quality of the bone matrix at the micro- and nanoscale. However, we lack an understanding of both the specific alterations in bone quality n steroid-induced osteoporosis as well as the mechanistic effects of these changes. Here we demonstrate alterations in the nanostructural parameters of the mineralized fibrillar collagen matrix, which affect bone quality, and develop a model linking these to increased fracture risk in glucocorticoid induced osteoporosis. Using a mouse model with an N-ethyl-N-nitrosourea (ENU)-induced corticotrophin releasing hormone promoter mutation (Crh− 120/+) that developed hypercorticosteronaemia and osteoporosis, we utilized in situ mechanical testing with small angle X-ray diffraction, synchrotron micro-computed tomography and quantitative backscattered electron imaging to link altered nano- and microscale deformation mechanisms in the bone matrix to abnormal macroscopic mechanics. We measure the deformation of the mineralized collagen fibrils, and the nano-mechanical parameters including effective fibril modulus and fibril to tissue strain ratio. A significant reduction (51%) of fibril modulus was found in Crh− 120/+ mice. We also find a much larger fibril strain/tissue strain ratio in Crh− 120/+ mice (~ 1.5) compared to the wild-type mice (~ 0.5), indicative of a lowered mechanical competence at the nanoscale. Synchrotron microCT show a disruption of intracortical architecture, possibly linked to osteocytic osteolysis. These findings provide a clear quantitative demonstration of how bone quality changes increase macroscopic fragility in secondary osteoporosis. PMID:26657825

Crosstalk between bone niche and immune system: osteoimmunology signaling as a potential target for cancer treatment.

PubMed

Criscitiello, Carmen; Viale, Giulia; Gelao, Lucia; Esposito, Angela; De Laurentiis, Michele; De Placido, Sabino; Santangelo, Michele; Goldhirsch, Aron; Curigliano, Giuseppe

2015-02-01

There is a well recognized link between the bone and the immune system and in recent years there has been a major effort to elucidate the multiple functions of the molecules expressed in both bone and immune cells. Several molecules that were initially identified and studied in the immune system have been shown to have essential functions also in the bone. An interdisciplinary field embracing immune and bone biology has been brought together and called "osteoimmunology". The co-regulation of the skeletal and immune systems strikingly exemplifies the extreme complexity of such an interaction. Their interdependency must be considered in designing therapeutic approaches for either of the two systems. In other words, it is necessary to think of the osteoimmune system as a complex physiological unit. Denosumab was originally introduced to specifically target bone resorption, but it is now under evaluation for its effect on the long term immune response. Similarly, our current and still growing knowledge of the intimate link between the immune system and bone will be beneficial for the safety of drugs targeting either of these integrated systems. Given the large number of molecules exerting functions on both the skeletal and immune systems, osteoimmunological understanding is becoming increasingly important. Both bone and immune systems are frequently disrupted in cancer; and they may be crucial in regulating tumor growth and progression. Some therapies - such as bisphosphonates and receptor activator of NF-κB ligand (RANKL) targeted drugs - that aim at reducing pathologic osteolysis in cancer may interact with the immune system, thus providing potential favorable effects on survival. Copyright © 2014 Elsevier Ltd. All rights reserved.

Immunoexpression of tumour necrosis factor-α, interleukin-1α and interleukin-10 on odontogenic cysts and tumours.

PubMed

Sá, M C; de Matos, F R; Conceição, T S; Leitão, A C G H; Freitas, R A

2017-05-01

To analyse the immunoreactivity of IL-1α, TNF-α and IL-10 in odontogenic cysts and tumours and to investigate possible associations with established biological behaviours of these different lesions. Immunohistochemical expression of anti-IL-1α, anti-TNF-α and anti-IL-10 antibodies was assessed on epithelium and mesenchyme of 20 radicular cysts (RCs), 20 residual cysts (RECs), 20 dentigerous cysts (DCs), 18 solid ameloblastomas (SAs), 20 keratocystic odontogenic tumours (KCOTs) and 15 dental follicles (DFs). Comparative analysis of data was performed using the nonparametric Wilcoxon signed-rank test and Kruskal-Wallis's test. Significantly greater expression of IL-1α in the epithelium was noted in RC, KCOT and SA (P = 0.01), whilst IL-10 and TNF-α was in the epithelium of RC, DC and KCOT (P < 0.01). In the mesenchyme, significantly greater immunopositivity was observed for IL-1α, IL-10 and TNF-α in KCOT, DC and RC (P < 0.01). In epithelial and mesenchymal tissues, there were a significant number of cases of RC and DC with IL-1α < IL-10 ratio (P < 0.01), whilst SA and KCOT showed IL-1α > IL-10 (P < 0.01). There was a significantly greater percentage of DF, DC and KCOT with TNF-α > IL10 ratio (P < 0.01). These results suggest involvement of the proteins in the pathogenesis of odontogenic cysts and tumours, with emphasis on the highest immunoreactivity of osteolysis stimulating factors in tumours with aggressive biological behaviour, such as SA and KCOT. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Regulatory mechanisms of anthrax toxin receptor 1-dependent vascular and connective tissue homeostasis.

PubMed

Besschetnova, Tatiana Y; Ichimura, Takaharu; Katebi, Negin; St Croix, Brad; Bonventre, Joseph V; Olsen, Bjorn R

2015-03-01

It is well known that angiogenesis is linked to fibrotic processes in fibroproliferative diseases, but insights into pathophysiological processes are limited, due to lack of understanding of molecular mechanisms controlling endothelial and fibroblastic homeostasis. We demonstrate here that the matrix receptor anthrax toxin receptor 1 (ANTXR1), also known as tumor endothelial marker 8 (TEM8), is an essential component of these mechanisms. Loss of TEM8 function in mice causes reduced synthesis of endothelial basement membrane components and hyperproliferative and leaky blood vessels in skin. In addition, endothelial cell alterations in mutants are almost identical to those of endothelial cells in infantile hemangioma lesions, including activated VEGF receptor signaling in endothelial cells, increased expression of the downstream targets VEGF and CXCL12, and increased numbers of macrophages and mast cells. In contrast, loss of TEM8 in fibroblasts leads to increased rates of synthesis of fiber-forming collagens, resulting in progressive fibrosis in skin and other organs. Compromised interactions between TEM8-deficient endothelial and fibroblastic cells cause dramatic reduction in the activity of the matrix-degrading enzyme MMP2. In addition to insights into mechanisms of connective tissue homeostasis, our data provide molecular explanations for vascular and connective tissue abnormalities in GAPO syndrome, caused by loss-of-function mutations in ANTXR1. Furthermore, the loss of MMP2 activity suggests that fibrotic skin abnormalities in GAPO syndrome are, in part, the consequence of pathophysiological mechanisms underlying syndromes (NAO, Torg and Winchester) with multicentric skin nodulosis and osteolysis caused by homozygous loss-of-function mutations in MMP2. Copyright © 2014 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

Solid variant of aneurysmal bone cyst of the left parietal bone without preceding trauma.

PubMed

Nestler, Ulf; Wagner, Hans-Joachim; Schaenzer, Anne; Preuss, Matthias

2013-12-01

We report the case of a 17-year-old girl with an indolent, smooth swelling of the left cranial vault that had been developing for 2 months. Complete surgical excision was performed and the defect was closed using artificial bone cement. The integrity of the dura mater was conserved and the patient recovered without neurological deficit. Magnetic resonance imaging (MRI) controls 6 and 18 months after the operation did not find signs of recurrence. The lesion consisted of an elastic bone shell containing bony trabeculae with soft brown-greyish tissue and posthemorrhagic dark fluid. Histological assessment found CD68 positive multinucleated giant cells in a highly cellular fibroblastic matrix surrounding bony lamellar structures, without signs of inflammation or malignancy. Hyperparathyroidism was ruled out by normal serum values for parathyroid hormone, calcium, phosphate, and alkaline phosphatase. Histologically, first diagnosis was giant cell reparative granuloma and reference pathology disclosed aneurysmal bone cyst. The solid variant of aneurysmal bone cyst and the giant cell reparative granuloma can be histologically indistinguishable. Both lesions are only rarely encountered in cranial bones and most published cases affected the cranial base or the jaw, mainly in children or young adults. From a clinical point of view, classification into "outward" lesions (osteolysis of external parts of the vault with preservation of internal tabula) and "inward" lesions (intracranial multicystic lesions with raise of intracranial pressure) has been proposed. Three phases of development can be identified, and spontaneous involution has been described. Both entities are benign, but because in several cases an underlying malignant disease has been found, complete resection and regular follow-up by MRI are recommended. Georg Thieme Verlag KG Stuttgart · New York.

What are the causes of revision total knee arthroplasty in Japan?

PubMed

Kasahara, Yasuhiko; Majima, Tokifumi; Kimura, Shoichi; Nishiike, Osamu; Uchida, Jun

2013-05-01

There is limited information regarding the cause of revision TKA in Asia, especially Japan. Owing to differences in patient backgrounds and lifestyles, the modes of TKA failures in Asia may differ from those in Western countries. We therefore determined (1) causes of revision TKA in a cohort of Japanese patients with revision TKA and (2) whether patient demographic features and underlying diagnosis of primary TKA are associated with the causes of revision TKA. We assessed all revision TKA procedures performed at five major centers in Hokkaido from 2006 to 2011 for the causes of failures. Demographic data and underlying diagnosis for index primary TKA of the revision cases were compared to those of randomly selected primary TKAs during the same period. One hundred forty revision TKAs and 4047 primary TKAs were performed at the five centers, indicating a revision burden of 3.3%. The most common cause of revision TKA was mechanical loosening (40%) followed by infection (24%), wear/osteolysis (9%), instability (9%), implant failure (6%), periprosthetic fracture (4%), and other reasons (8%). The mean age of patients with periprosthetic fracture was older (77 versus 72 years) and the male proportion in patients with infection was higher (33% versus 19%) than those of patients in the primary TKA group. There was no difference in BMI between primary TKAs and any type of revision TKA except other causes. The revision burden at the five referral centers in Hokkaido was 3.3%, and the most common cause of revision TKA was mechanical loosening followed by infection. Demographic data such as age and sex might be associated with particular causes of revision TKA.

The influence of simulator input conditions on the wear of total knee replacements: An experimental and computational study

PubMed Central

Brockett, Claire L; Abdelgaied, Abdellatif; Haythornthwaite, Tony; Hardaker, Catherine; Fisher, John; Jennings, Louise M

2016-01-01

Advancements in knee replacement design, material and sterilisation processes have provided improved clinical results. However, surface wear of the polyethylene leading to osteolysis is still considered the longer-term risk factor. Experimental wear simulation is an established method for evaluating the wear performance of total joint replacements. The aim of this study was to investigate the influence of simulation input conditions, specifically input kinematic magnitudes, waveforms and directions of motion and position of the femoral centre of rotation, on the wear performance of a fixed-bearing total knee replacement through a combined experimental and computational approach. Studies were completed using conventional and moderately cross-linked polyethylene to determine whether the influence of these simulation input conditions varied with material. The position of the femoral centre of rotation and the input kinematics were shown to have a significant influence on the wear rates. Similar trends were shown for both the conventional and moderately cross-linked polyethylene materials, although lower wear rates were found for the moderately cross-linked polyethylene due to the higher level of cross-linking. The most important factor influencing the wear was the position of the relative contact point at the femoral component and tibial insert interface. This was dependent on the combination of input displacement magnitudes, waveforms, direction of motion and femoral centre of rotation. This study provides further evidence that in order to study variables such as design and material in total knee replacement, it is important to carefully control knee simulation conditions. This can be more effectively achieved through the use of displacement control simulation. PMID:27160561

Is there a need for routine follow-up after primary total hip arthroplasty?

PubMed

Hacking, Craig; Weinrauch, Patrick; Whitehouse, Sarah L; Crawford, Ross W; Donnelly, William J

2010-10-01

The objective of routine outpatient assessment of well-functioning patients after primary total hip arthroplasty (THA) is to detect asymptomatic failure of prostheses to guide recommendations for early intervention. We have observed that the revision of THAs in asymptomatic patients is highly uncommon. We therefore question the need for routine follow-up of patients after THA. A prospective analysis of an orthopaedic database identified 158 patients who received 177 revision THAs over a four-year period. A retrospective chart review was conducted. Patient demographics, primary and revision surgery parameters and follow-up information were recorded and cross-referenced with Australian Orthopaedic Association National Joint Replacement Registry data. One hundred ten THAs in 104 patients (average age 70.4 (SD 9.8 years)). There were 70 (63.6%) in total, 13 (11.8%) femoral and 27 (24.5%) acetabular revisions. The indications for revision were aseptic loosening (70%), dislocation (8.2%), peri-prosthetic fracture (7.3%), osteolysis (6.4%) and infection (4.5%). Only four (3.6%) were asymptomatic revisions. A mean of 5.3 (SD 5.2 and 1.9 (SD 5.3)) follow-up appointments were required before revision in patients with and without symptoms, respectively. The average time from the primary to revision surgery was 11.8 (SD 7.23) years. We conclude that patients with prostheses with excellent long-term clinical results as validated by joint registries, routine follow-up of asymptomatic THA should be questioned and requires further investigation. Based on the work of this study, the current practice of routine follow-up of asymptomatic THA may be excessively costly and unnecessary, and a less resource-intensive review method may be more appropriate. © 2010 The Authors. ANZ Journal of Surgery © 2010 Royal Australasian College of Surgeons.

The Hajdu Cheney Mutation Is a Determinant of B-Cell Allocation of the Splenic Marginal Zone.

PubMed

Yu, Jungeun; Zanotti, Stefano; Walia, Bhavita; Jellison, Evan; Sanjay, Archana; Canalis, Ernesto

2018-01-01

The neurogenic locus notch homolog protein (Notch)-2 receptor is a determinant of B-cell allocation, and gain-of-NOTCH2-function mutations are associated with Hajdu-Cheney syndrome (HCS), a disease presenting with osteoporosis and acro-osteolysis. We generated a mouse model reproducing the HCS mutation (Notch2HCS), and heterozygous global mutant mice displayed gain-of-Notch2 function. In the mutant spleen, the characteristic perifollicular rim marking the marginal zone (MZ), which is the interface between the nonlymphoid red pulp and the lymphoid white pulp, merged with components of the white pulp. As a consequence, the MZ of Notch2HCS mice occupied most of the splenic structure. To explore the mechanisms involved, lymphocyte populations from the bone marrow and spleen were harvested from heterozygous Notch2HCS mice and sex-matched control littermates and analyzed by flow cytometry. Notch2HCS mice had an increase in CD21/35 high CD23 - splenic MZ B cells of approximately fivefold and a proportional decrease in splenic follicular B cells (CD21/35 int CD23 + ) at 1, 2, and 12 months of age. Western blot analysis revealed that Notch2HCS mutant splenocytes had increased phospho-Akt and phospho-Jun N-terminal kinase, and gene expression analysis of splenic CD19 + B cells demonstrated induction of Hes1 and Hes5 in Notch2HCS mutants. Anti-Notch2 antibodies decreased MZ B cells in control and Notch2HCS mice. In conclusion, Notch2HCS mutant mice have increased mature B cells in the MZ of the spleen. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Effects of as-cast and wrought Cobalt-Chrome-Molybdenum and Titanium-Aluminium-Vanadium alloys on cytokine gene expression and protein secretion in J774A.1 macrophages.

PubMed

Jakobsen, Stig S; Larsen, A; Stoltenberg, M; Bruun, J M; Soballe, K

2007-09-11

Insertion of metal implants is associated with a possible change in the delicate balance between pro- and anti-inflammatory proteins, probably leading to an unfavourable predominantly pro-inflammatory milieu. The most likely cause is an inappropriate activation of macrophages in close relation to the metal implant and wear-products. The aim of the present study was to compare surfaces of as-cast and wrought Cobalt-Chrome-Molybdenum (CoCrMo) alloys and Titanium-Aluminium-Vanadium (TiAlV) alloy when incubated with mouse macrophage J774A.1 cell cultures. Changes in pro- and anti-inflammatory cytokines (TNF-alpha, IL-6, IL-alpha, IL-1beta, IL-10) and proteins known to induce proliferation (M-CSF), chemotaxis (MCP-1) and osteogenesis (TGF-beta, OPG) were determined by ELISA and Real Time reverse transcriptase - PCR (Real Time rt-PCR). Lactate dehydrogenase (LDH) was measured in the medium to asses the cell viability. Surface properties of the discs were characterised with a profilometer and with energy dispersive X-ray spectroscopy. We here report, for the first time, that the prosthetic material surface (non-phagocytable) of as-cast high carbon CoCrMo reduces the pro-inflammatory cytokine IL-6 transcription, the chemokine MCP-1 secretion, and M-CSF secretion by 77%, 36%, and 62%, respectively. Furthermore, we found that reducing surface roughness did not affect this reduction. The results suggest that as-cast CoCrMo alloy is more inert than wrought CoCrMo and wrought TiAlV alloys and could prove to be a superior implant material generating less inflammation which might result in less osteolysis.

Mutant monocyte chemoattractant protein 1 protein attenuates migration of and inflammatory cytokine release by macrophages exposed to orthopedic implant wear particles.

PubMed

Yao, Zhenyu; Keeney, Michael; Lin, Tzu-Hua; Pajarinen, Jukka; Barcay, Katherine; Waters, Heather; Egashira, Kensuke; Yang, Fan; Goodman, Stuart

2014-09-01

Wear particles generated from total joint replacements can stimulate macrophages to release chemokines, such as monocyte chemoattractant protein 1 (MCP-1), which is the most important chemokine regulating systemic and local cell trafficking and infiltration of monocyte/macrophages in chronic inflammation. One possible strategy to curtail the adverse events associated with wear particles is to mitigate migration and activation of monocyte/macrophages. The purpose of this study is to modulate the adverse effects of particulate biomaterials and inflammatory stimuli such as endotoxin by interfering with the biological effects of the chemokine MCP-1. In the current study, the function of MCP-1 was inhibited by the mutant MCP-1 protein called 7ND, which blocks its receptor, the C-C chemokine receptor type 2 (CCR2) on macrophages. Addition of 7ND decreased MCP-1-induced migration of THP-1 cells in cell migration experiments in a dose-dependent manner. Conditioned media from murine macrophages exposed to clinically relevant polymethylmethacrylate (PMMA) particles with/without endotoxin [lipopolysaccharide (LPS)] had a chemotactic effect on human macrophages, which was decreased dramatically by 7ND. 7ND demonstrated no adverse effects on the viability of macrophages, and the capability of mesenchymal stem cells (MSCs) to form bone at the doses tested. Finally, proinflammatory cytokine production was mitigated when macrophages were exposed to PMMA particles with/without LPS in the presence of 7ND. Our studies confirm that the MCP-1 mutant protein 7ND can decrease macrophage migration and inflammatory cytokine release without adverse effects at the doses tested. Local delivery of 7ND at the implant site may provide a therapeutic strategy to diminish particle-associated periprosthetic inflammation and osteolysis. © 2013 Wiley Periodicals, Inc.

N-acetyl cysteine (NAC)-mediated detoxification and functionalization of poly(methyl methacrylate) bone cement.

PubMed

Tsukimura, Naoki; Yamada, Masahiro; Aita, Hideki; Hori, Norio; Yoshino, Fumihiko; Chang-Il Lee, Masaichi; Kimoto, Katsuhiko; Jewett, Anahid; Ogawa, Takahiro

2009-07-01

Currently used poly(methyl methacrylate) (PMMA)-based bone cement lacks osteoconductivity and induces osteolysis and implant loosening due to its cellular and tissue-toxicity. A high percentage of revision surgery following the use of bone cement has become a significant universal problem. This study determined whether incorporation of the amino acid derivative N-acetyl cysteine (NAC) in bone cement reduces its cytotoxicity and adds osteoconductivity to the material. Biocompatibility and bioactivity of PMMA-based bone cement with or without 25mm NAC incorporation was examined using rat bone marrow-derived osteoblastic cells. Osteoconductive potential of NAC-incorporated bone cement was determined by microCT bone morphometry and implant biomechanical test in the rat model. Generation of free radicals within the polymerizing bone cement was examined using electron spin resonance spectroscopy. Severely compromised viability and completely suppressed phenotypes of osteoblasts on untreated bone cement were restored to the normal level by NAC incorporation. Bone volume formed around 25mm NAC-incorporated bone cement was threefold greater than that around control bone cement. The strength of bone-bone cement integration was 2.2 times greater for NAC-incorporated bone cement. For NAC-incorporated bone cement, the spike of free radical generation ended within 12h, whereas for control bone cement, a peak level lasted for 6 days and a level greater than half the level of the peak was sustained for 20 days. NAC also increased the level of antioxidant glutathione in osteoblasts. These results suggest that incorporation of NAC in PMMA bone cement detoxifies the material by immediate and effective in situ scavenging of free radicals and increasing intracellular antioxidant reserves, and consequently adds osteoconductivity to the material.

Gallium, a promising candidate to disrupt the vicious cycle driving osteolytic metastases.

PubMed

Strazic-Geljic, Ivana; Guberovic, Iva; Didak, Blanka; Schmid-Antomarchi, Heidy; Schmid-Alliana, Annie; Boukhechba, Florian; Bouler, Jean-Michel; Scimeca, Jean-Claude; Verron, Elise

2016-09-15

Bone metastases of breast cancer typically lead to a severe osteolysis due to an excessive osteoclastic activity. On the other hand, the semi-metallic element gallium (Ga) displays an inhibitory action on osteoclasts, and therefore on bone resorption, as well as antitumour properties. Thus, we explored in vitro Ga effects on osteoclastogenesis in an aggressive bone metastatic environment based on the culture of pre-osteoclast RAW 264.7 cells with conditioned medium from metastatic breast tumour cells, i.e. the breast tumour cell line model MDA-MB-231 and its bone-seeking clone MDA-231BO. We first observed that Ga dose-dependently inhibited the tumour cells-induced osteoclastic differentiation of RAW 264.7 cells. To mimic a more aggressive environment where pro-tumourigenic factors are released from bone matrix due to osteoclastic resorption, metastatic breast tumour cells were stimulated with TGF-β, a mayor cytokine in bone metastasis vicious cycle. In these conditions, we observed that Ga still inhibited cancer cells-driven osteoclastogenesis. Lastly, we evidenced that Ga affected directly and strongly the proliferation/viability of both cancer cell lines, as well as the expression of major osteolytic factors in MDA-231BO cells. With the exception of two small scale clinical studies from 1980s, this is the first time that antitumour properties of Ga have been specifically studied in the context of bone metastases. Our data strongly suggest that, through its action against the vicious cycle involving bone cells and tumour cells, Ga represents a relevant and promising candidate for the local treatment of bone metastases in patients with breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

Subacromial morphometric assessment of the clavicle hook plate.

PubMed

ElMaraghy, Amr W; Devereaux, Moira W; Ravichandiran, Kajeandra; Agur, Anne M

2010-06-01

Clavicle hook plates are an effective plate fixation alternative for distal clavicle fractures and severe acromioclavicular joint dislocations. However, post-operative complications associated with the subacromial portion of the hook include acromial osteolysis and subacromial impingement. We examine and quantify the three-dimensional position of the subacromial portion of the hook plate relative to surrounding acromial and subacromial structures in a series of cadaveric shoulders to determine if hook positioning predisposes the shoulder to these noted post-operative complications. Fifteen cadaveric shoulders (seven males, eight females) were implanted with 15- or 18-mm hook plates. Dimensions of the acromion and hook plate were digitised and reconstructed into a three-dimensional model to measure acromion dimensions and distances of the subacromial hook relative to surrounding acromial and subacromial structures. Inter-specimen dimensions of the acromion were highly variable. Mean acromion width and thickness were greater in males than in females (p=0.01). The posterior orientation of the subacromial hook varied widely (mean posterior implantation angle=32.5+/-20 degrees, range 0-67 degrees). The hook pierced the subacromial bursa in 13/15 specimens, made contact with the belly of the supraspinatus muscle in 9/15 specimens, and had focal contact at the hook tip with the undersurface of the acromion in 9/15 specimens. The wide range of acromial dimensions leads to a high degree of variability in the positioning of the subacromial hook. The observed frequency of hook contact with surrounding subacromial structures in a static shoulder confirms that the position of the hook portion of the implant can predispose anatomic structures to the post-operative complications of subacromial impingement and bony erosion. Copyright 2009 Elsevier Ltd. All rights reserved.

New Interleukins in Psoriasis and Psoriatic Arthritis Patients: The Possible Roles of Interleukin-33 to Interleukin-38 in Disease Activities and Bone Erosions.

PubMed

Li, Jiang; Liu, Lei; Rui, Wenlong; Li, Xiangyu; Xuan, Dandan; Zheng, Shucong; Yu, Yiyun; Zhang, Jiong; Kong, Ning; Zhu, Xiaoxia; Zou, Hejian; Wan, Weiguo; Xue, Yu

2017-01-01

New interleukins (ILs), especially members of IL-1 and IL-12 families, have recently been reported to be involved in the development and regulation of autoimmune and inflammatory diseases. In this study, we aimed to explore the impact of these new ILs in psoriasis (Ps) and psoriatic arthritis (PsA). Forty PsA patients, 20 Ps patients, and 20 healthy controls (HCs) were recruited. Blood samples were obtained for detecting the levels of ILs, IL-12/23p40, and tumor necrosis factor α (TNF-α). The severity of skin lesions was assessed by the Psoriasis Area and Severity Index (PASI). Arthritis activities of PsA patients were assessed by the PsA Joint Activity Index. For PsA patients, circulating osteoclastogenesis-related cytokines (osteoprotegerin and receptor activator of nuclear factor-κB ligand) and numbers of osteoclast precursors were evaluated. Radiographic features of affected joints in these patients were scored for erosion, joint-space narrowing, osteolysis, and new bone formation. Correlations among levels of these ILs, Ps, and PsA disease activities and bone erosions were studied. Ps and PsA patients had higher serum levels of TNF-α, IL-12/23p40, and IL-33. Serum levels of IL-34 and IL-35 were higher in PsA patients than in Ps patients and HCs. Patients with pustular Ps had higher serum levels of IL-36α and IL-38 than patients with Ps vulgaris or HCs. Increased serum levels of IL-36α were positively correlated with PASI. Certain ILs were elevated in the circulation of patients with Ps and PsA, which might contribute to the pathogenesis of skin lesions and arthritis. © 2017 S. Karger AG, Basel.

Postoperative Complications Associated With rhBMP2 Use in Posterior/Posterolateral Lumbar Fusion

PubMed Central

Esmail, Nabil; Buser, Zorica; Cohen, Jeremiah R.; Brodke, Darrel S.; Meisel, Hans-Joerg; Park, Jong-Beom; Youssef, Jim A.; Wang, Jeffrey C.; Yoon, S. Tim

2017-01-01

Study Design: Retrospective database review. Objective: Posterior/posterolateral lumbar fusion (PLF) is an effective treatment for a variety of spinal disorders; however, variations in surgical technique have different complication profiles. The aim of our study was to quantify the frequency of various complications in patients undergoing PLF with and without human recombinant bone morphogenetic protein 2 (rhBMP2). Methods: We queried the orthopedic subset of the Medicare database (PearlDiver) between 2005 and 2011 for patients undergoing PLF procedures with and without rhBMP2. Complication and reoperation rates were analyzed within 1 year of the index procedure. Complications assessed include: acute renal failure, deep vein thrombosis, dural tear, hematoma, heterotopic ossification, incision and drainage, cardiac complications, nervous system complications, osteolysis, pneumonia, pseudarthrosis, pulmonary embolism, radiculopathy, respiratory complications, sepsis, urinary retention, urinary tract infection, mechanical, and wound complications. Chi-square analysis was used to calculate the complication differences between the groups. Results: Our data revealed higher overall complication rates in patients undergoing PLF with rhBMP2 versus no_rhBMP2 (76.9% vs 68.8%, P < .05). Stratified by gender, rhBMP2 males had higher rates of mechanical complications, pseudarthrosis, and reoperations compared with no_rhBMP2 males (P < .05), whereas rhBMP2 females had higher rates of pseudarthrosis, urinary tract infection, and urinary retention compared with no_rhBMP2 females (P < .05). Conclusion: Our data revealed higher overall complication rates in PLF patients given rhBMP2 compared with no_rhBMP2. Furthermore, our data suggests that rhBMP2-associated complications may be gender specific. PMID:29662744

Loss of RUNX3 expression inhibits bone invasion of oral squamous cell carcinoma

PubMed Central

Park, Junhee; Kim, Hyun-Jeong; Kim, Ki Rim; Lee, Sun Kyoung; Kim, Hyungkeun; Park, Kwang-Kyun; Chung, Won-Yoon

2017-01-01

High recurrence and lower survival rates in patients with oral squamous cell carcinoma (OSCC) are associated with its bone invasion. We identified the oncogenic role of RUNX3 during bone invasion by OSCC. Tumor growth and the generation of osteolytic lesions were significantly inhibited in mice that were subcutaneously inoculated with RUNX3-knockdown human OSCC cells. RUNX3 knockdown enhanced TGF-β-induced growth arrest and inhibited OSCC cell migration and invasion in the absence or presence of transforming growth factor-β (TGF-β), a major growth factor abundant in the bone microenvironment. RUNX3 knockdown induced cell cycle arrest at the G1 and G2 phases and promoted G2 arrest by TGF-β in Ca9.22 OSCC cells. RUNX3 knockdown also inhibited both the basal and TGF-β-induced epithelial-to-mesenchymal transition by increasing E-cadherin expression and suppressing the nuclear translocation of β-catenin. In addition, the expression and TGF-β-mediated induction of parathyroid hormone-related protein (PTHrP), one of key osteolytic factors, was blocked in RUNX3-knockdown OSCC cells. Furthermore, treating human osteoblastic cells with conditioned medium derived from RUNX3-knockdown OSCC cells reduced the receptor activator of nuclear factor-kappaB ligand (RANKL)/osteoprotegerin ratio compared with treatment with conditioned medium from RUNX3-expressing cells. These findings indicate that RUNX3 expression in OSCC cells contributes to their bone invasion and the resulting osteolysis by inducing their malignant behaviors and production of osteolytic factors. RUNX3 alone or in combination with TGF-β and PTHrP may be a useful predictive biomarker and therapeutic target for bone invasion by oral cancer. PMID:28030842

L-MTP-PE and zoledronic acid combination in osteosarcoma: preclinical evidence of positive therapeutic combination for clinical transfer

PubMed Central

Biteau, Kevin; Guiho, Romain; Chatelais, Mathias; Taurelle, Julien; Chesneau, Julie; Corradini, Nadège; Heymann, Dominique; Redini, Françoise

2016-01-01

Osteosarcoma, the most frequent malignant primary bone tumor in pediatric patients is characterized by osteolysis promoting tumor growth. Lung metastasis is the major bad prognosis factor of this disease. Zoledronic Acid (ZA), a potent inhibitor of bone resorption is currently evaluated in phase III randomized studies in Europe for the treatment of osteosarcoma and Ewing sarcoma. The beneficial effect of the liposomal form of Muramyl-TriPeptide-Phosphatidyl Ethanolamine (L-mifamurtide, MEPACT®), an activator of macrophage populations has been demonstrated to eradicate lung metastatic foci in osteosarcoma. The objective of this study was to evaluate the potential therapeutic benefit and the safety of the ZA and L-mifamurtide combination in preclinical models of osteosarcoma, as a prerequisite before translation to patients. The effects of ZA (100 μg/kg) and L-mifamurtide (1 mg/kg) were investigated in vivo in xenogeneic and syngeneic mice models of osteosarcoma, at clinical (tumor proliferation, spontaneous lung metastases development), radiological (bone microarchitecture by microCT analysis), biological and histological levels. No interference between the two drugs could be observed on ZA-induced bone protection and on L-mifamurtide-induced inhibition of lung metastasis development. Unexpectedly, ZA and L-mifamurtide association induced an additional and in some cases synergistic inhibition of primary tumor progression. L-mifamurtide has no effect on tumor proliferation in vitro or in vivo, and macrophage population was not affected at the tumor site whatever the treatment. This study evidenced for the first time a significant inhibition of primary osteosarcoma progression when both drugs are combined. This result constitutes a first proof-of-principle for clinical application in osteosarcoma patients. PMID:27152244

Loss of RUNX3 expression inhibits bone invasion of oral squamous cell carcinoma.

PubMed

Park, Junhee; Kim, Hyun-Jeong; Kim, Ki Rim; Lee, Sun Kyoung; Kim, Hyungkeun; Park, Kwang-Kyun; Chung, Won-Yoon

2017-02-07

High recurrence and lower survival rates in patients with oral squamous cell carcinoma (OSCC) are associated with its bone invasion. We identified the oncogenic role of RUNX3 during bone invasion by OSCC. Tumor growth and the generation of osteolytic lesions were significantly inhibited in mice that were subcutaneously inoculated with RUNX3-knockdown human OSCC cells. RUNX3 knockdown enhanced TGF-β-induced growth arrest and inhibited OSCC cell migration and invasion in the absence or presence of transforming growth factor-β (TGF-β), a major growth factor abundant in the bone microenvironment. RUNX3 knockdown induced cell cycle arrest at the G1 and G2 phases and promoted G2 arrest by TGF-β in Ca9.22 OSCC cells. RUNX3 knockdown also inhibited both the basal and TGF-β-induced epithelial-to-mesenchymal transition by increasing E-cadherin expression and suppressing the nuclear translocation of β-catenin. In addition, the expression and TGF-β-mediated induction of parathyroid hormone-related protein (PTHrP), one of key osteolytic factors, was blocked in RUNX3-knockdown OSCC cells. Furthermore, treating human osteoblastic cells with conditioned medium derived from RUNX3-knockdown OSCC cells reduced the receptor activator of nuclear factor-kappaB ligand (RANKL)/osteoprotegerin ratio compared with treatment with conditioned medium from RUNX3-expressing cells. These findings indicate that RUNX3 expression in OSCC cells contributes to their bone invasion and the resulting osteolysis by inducing their malignant behaviors and production of osteolytic factors. RUNX3 alone or in combination with TGF-β and PTHrP may be a useful predictive biomarker and therapeutic target for bone invasion by oral cancer.

Outcomes of Newer Generation Cementless Total Knee Arthroplasty: Beaded Periapatite-Coated vs Highly Porous Titanium-Coated Implants.

PubMed

Harwin, Steven F; Patel, Nirav K; Chughtai, Morad; Khlopas, Anton; Ramkumar, Prem N; Roche, Martin; Mont, Michael A

2017-07-01

Newer generation cementless total knee arthroplasty (TKA) designs are available and have novel implant coatings. We evaluated and compared beaded periapatite (PA)-coated vs highly porous titanium-coated cementless TKAs. Specifically, we compared: (1) survivorship, (2) Knee Society Scores (KSSs) and range of motion, (3) complications, and (4) radiographic findings. There were 805 TKAs with beaded PA-coated tibial and patellar components (PA group; mean age 67 years; range 41-86 years), and 219 TKAs with highly porous titanium-coated tibial and patella components (mean age 66 years; range 34-88 years). Mean follow-up was 4.4 years (range 2-9 years; median 4 years). Implant survivorship was calculated using Kaplan-Meier curves. Student t-tests and chi-square tests were used as appropriate. Radiographic evaluation was performed using Knee Society Roentgenographic Evaluation and Scoring System. All-cause implant survivorship in beaded PA-coated group was 99.5% (95% CI, 97.9%-99.9%) and 99.5% (95% CI, 92.7%-99.9%) in highly porous titanium-coated group. There were no significant differences in the KSS for pain and function. Improvement in flexion and extension was similar in the 2 groups. Overall, complication rate (2.2% vs 2.3%; P = .274) and number of revisions (6 [0.8%] vs 2 [0.2%]; P = .936) were similar in the 2 groups. Excluding the aseptic and septic failures, there were no progressive radiolucencies or osteolysis on radiographic evaluation. This study has shown good clinical and patient-reported outcomes of cementless TKA for both implants. Future multicenter large scale clinical and cost-effectiveness studies are needed to determine the superiority of one cementless implant type over the other. Copyright © 2017 Elsevier Inc. All rights reserved.

Midterm Outcomes of Revision Total Hip Arthroplasty With the Use of a Multihole Highly-Porous Titanium Shell.

PubMed

Delanois, Ronald E; Gwam, Chukwuweike U; Mohamed, Nequesha; Khlopas, Anton; Chughtai, Morad; Malkani, Arthur L; Mont, Michael A

2017-09-01

We are reporting on the minimum 5-year outcomes of patients who underwent revision total hip arthroplasty (THA) using a specific highly-porous titanium shell. We assessed (1) aseptic and all-cause survivorship; (2) functional outcomes; (3) complications; and (4) radiographic outcomes. Two hospital databases were evaluated for patients who underwent revision THA due to component instability or aseptic loosening using a cementless highly-porous titanium shell between September 2006 and December 2011. This yielded 35 patients who had a mean age of 61 years (range 14-88 years). Patients had a mean follow-up of 6 years (minimum 5 years). All-cause and aseptic survivorship of the shell was calculated. Functional outcomes were assessed using the Harris Hip Score. We determined the incidence of postoperative complications and performed radiographic evaluation of pelvic radiographs from regular office visits. The aseptic survivorship of the acetabular component was 97% (95% confidence interval; 8.1-9.5). The all-cause survivorship of the acetabular component was 91% (95% confidence interval; 7.3-8.1). One patient had an aseptic failure and 2 patients had septic failures. The mean postoperative Harris Hip Score was 76 points (range, 61-91 points). Excluding the aseptic and septic failures, there was no osteolysis or progressive radiolucencies present on radiographic evaluation at final follow-up. At a minimum of 5-year follow-up, the highly-porous titanium acetabular revision shell has excellent survivorship and functional outcomes. Although long-term follow-up is needed to further monitor these implants, the results are promising and demonstrate that this prosthesis may be an excellent option for patients undergoing revision THA. Copyright © 2017 Elsevier Inc. All rights reserved.

An osteoblast-derived proteinase controls tumor cell survival via TGF-beta activation in the bone microenvironment.

PubMed

Thiolloy, Sophie; Edwards, James R; Fingleton, Barbara; Rifkin, Daniel B; Matrisian, Lynn M; Lynch, Conor C

2012-01-01

Breast to bone metastases frequently induce a "vicious cycle" in which osteoclast mediated bone resorption and proteolysis results in the release of bone matrix sequestered factors that drive tumor growth. While osteoclasts express numerous proteinases, analysis of human breast to bone metastases unexpectedly revealed that bone forming osteoblasts were consistently positive for the proteinase, MMP-2. Given the role of MMP-2 in extracellular matrix degradation and growth factor/cytokine processing, we tested whether osteoblast derived MMP-2 contributed to the vicious cycle of tumor progression in the bone microenvironment. To test our hypothesis, we utilized murine models of the osteolytic tumor-bone microenvironment in immunocompetent wild type and MMP-2 null mice. In longitudinal studies, we found that host MMP-2 significantly contributed to tumor progression in bone by protecting against apoptosis and promoting cancer cell survival (caspase-3; immunohistochemistry). Our data also indicate that host MMP-2 contributes to tumor induced osteolysis (μCT, histomorphometry). Further ex vivo/in vitro experiments with wild type and MMP-2 null osteoclast and osteoblast cultures identified that 1) the absence of MMP-2 did not have a deleterious effect on osteoclast function (cd11B isolation, osteoclast differentiation, transwell migration and dentin resorption assay); and 2) that osteoblast derived MMP-2 promoted tumor survival by regulating the bioavailability of TGFβ, a factor critical for cell-cell communication in the bone (ELISA, immunoblot assay, clonal and soft agar assays). Collectively, these studies identify a novel "mini-vicious cycle" between the osteoblast and metastatic cancer cells that is key for initial tumor survival in the bone microenvironment. In conclusion, the findings of our study suggest that the targeted inhibition of MMP-2 and/or TGFβ would be beneficial for the treatment of bone metastases.

Does cyclic stress and accelerated ageing influence the wear behavior of highly crosslinked polyethylene?

PubMed

Affatato, Saverio; De Mattia, Jonathan Salvatore; Bracco, Pierangiola; Pavoni, Eleonora; Taddei, Paola

2016-06-01

First-generation (irradiated and remelted or annealed) and second-generation (irradiated and vitamin E blended or doped) highly crosslinked polyethylenes were introduced in the last decade to solve the problems of wear and osteolysis. In this study, the influence of the Vitamin-E addition on crosslinked polyethylene (XLPE_VE) was evaluated by comparing the in vitro wear behavior of crosslinked polyethylene (XLPE) versus Vitamin-E blended polyethylene XLPE and conventional ultra-high molecular weight polyethylene (STD_PE) acetabular cups, after accelerated ageing according to ASTM F2003-02 (70.0±0.1°C, pure oxygen at 5bar for 14 days). The test was performed using a hip joint simulator run for two millions cycles, under bovine calf serum as lubricant. Mass loss was found to decrease along the series XLPE_VE>STD_PE>XLPE, although no statistically significant differences were found between the mass losses of the three sets of cups. Micro-Raman spectroscopy was used to investigate at a molecular level the morphology changes induced by wear. The spectroscopic analyses showed that the accelerated ageing determined different wear mechanisms and molecular rearrangements during testing with regards to the changes in both the chain orientation and the distribution of the all-trans sequences within the orthorhombic, amorphous and third phases. The results of the present study showed that the addition of vitamin E was not effective to improve the gravimetric wear of PE after accelerated ageing. However, from a molecular point of view, the XLPE_VE acetabular cups tested after accelerated ageing appeared definitely less damaged than the STD_PE ones and comparable to XLPE samples. Copyright © 2016 Elsevier Ltd. All rights reserved.

Radiofrequency ablation of the basivertebral nerve as potential treatment of back pain: pathologic assessment in an ovine model (Invited Paper)

NASA Astrophysics Data System (ADS)

Hoopes, P. J.; Eskey, Cliff J.; Attawia, Mohammed; Patel, Samit J.; Ryan, T. P.; Pellegrino, Richard; Bergeron, Jeffrey A.

2005-04-01

Pathological involvement of the basivertebral nerve (BVN), an intraosseous vertebral nerve, may play a significant role in some forms of back pain. This study was designed to assess the feasibility and effects of thermal ablation of the lumbar basivertebral nerve in mature sheep. Sixteen adult female sheep weighing 65-80 kg were anesthetized and positioned for ventral recumbent surgery. Under fluoroscopic guidance, two bilarterally oposed 5mm active length rediofrequency (RF) electrodes (1.65mm diameter were perfutaneously placed in select lumbar vertebrae at a relative angle of 70 degrees with a 5 mm tip separation. The elctrodes were advanced to the region of the vertebral bodies which contained the BVN. A thermal dose of 95° C/720 seconds was administered. Animals were survived for 2, 14, 90, or 180 days post-treatment. Clinical, radiologic and pathologic investigations were performed to determine the effect of the heat on the BVN and associated tissues. Thermal damage to the basivertebral neurovascular bundle was characterized by early hemorrhage and necrosis, followed by inflammation and fibrosis. Although there wasa significant revascularization of the treated bone marow regions, there was no evidence of basivertebral nerve survival or regeneration regeneration. In addition to ablation of teh basivertebral nerovascular bundle, the areas receiving the greatest treatment demonstrated initial mild local osteolysis and demineralization of the vertebral body bone and regional depopulation of the vertebral bone marrow cellular elements. Significant bone remodeling in the affected areas had begun by 14 days post-treatment. Bone remodeling was characterized by conventional osteoblast proliferation, osteoid deposition, and mineralization. This study demonstrated the ability to accurately, reproducibly, and safely ablate the basivertebral nerve and neurovascular bundle in mature sheep using a fluoroscopically guided percutaneously delivered radiofrequency technique.

Acrylic injectable and self-curing formulations for the local release of bisphosphonates in bone tissue.

PubMed

Rodríguez-Lorenzo, L M; Fernández, M; Parra, J; Vázquez, B; López-Bravo, A; Román, J San

2007-11-01

Two bisphosphonates (BPs), namely 1-hydroxy-2-[4-aminophenyl]ethane-1,1-diphosphonic acid (APBP) and 1-hydroxy-2-[3-indolyl]ethane-1,1-diphosphonic acid (IBP), have been synthesized and incorporated to acrylic injectable and self-curing formulations. Alendronic acid monosodium trihydrated salt (ALN) containing cement was formulated as control. These systems have potential applications in low density hard tissues affected by ailments characterized by a high osteoclastic resorption, i.e. osteoporosis and osteolysis. Values of curing parameters of APBP and IBP were acceptable to obtain pastes with enough fluency to be injected through a biopsy needle into the bone cavity. Working times ranged between 8 and 15 min and maximum temperature was around 50 degrees C. Cured systems stored for a month in synthetic body fluid had compressive strengths between 90 and 96 MPa and modulus between 1.2 and 1.3 GPa, which suggest mechanical stabilization after setting and in the short time. BPs were released in PBS at an initial rate depending on the corresponding chemical structure in the order ALN > APBP > IBP to give final concentrations in PBS of 2.21, 0.44, and 0.19 mol/mL for ALN, APBP, and IBP, respectively. Cytotoxicities of bisphosphonates were evaluated, IC(50) values being in the order APBP > ALN > IBP. Absence of cytotoxicity coming from leachables of the cured systems was observed in all cases independently of the BP. An improved cell growth and proliferation for the systems loaded with APBP and IBP compared with that loaded with ALN was observed, as assessed by measuring cell adhesion and proliferation, and total DNA content.

Medium-term results of ceramic-on-polyethylene Zweymüller-Plus total hip arthroplasty.

PubMed

Li, H; Zhang, S; Wang, X M; Lin, J H; Kou, B L

2017-08-01

The need for better durability and longevity in total hip arthroplasty for patients with various hip joint diseases remains a challenge. This study aimed to obtain medium-term results at a follow-up of >10 years for Zweymüller-Plus total hip arthroplasty with ceramic-on-polyethylene bearing. A retrospective study was conducted to review the results after a minimum of 12.4 years of 207 consecutive total hip arthroplasties in 185 patients in Peking University People's Hospital in China using the Zweymüller SL-Plus stem in combination with the Bicon-Plus threaded cup and ceramic-on-polyethylene bearing between October 1994 and April 2000. During the study period, two patients (2 hips) died and 25 patients (28 hips) were lost to follow-up. Two hips were revised for aseptic loosening of the Bicon-Plus cup. The mean clinical and radiological follow-up was 14.1 years (range, 12.4-16.5 years) for the remaining 156 patients (175 hips). The mean (standard deviation) Harris Hip score for the 175 hips increased significantly from 39.3 (3.8) preoperatively to 94.1 (2.5) postoperatively at a mean follow-up of 14.1 years (P<0.05). Focal osteolysis was observed in seven (4.0%) of 175 stems and three (1.7%) of 175 cups. The Kaplan-Meier survival with revision for any reason as the end-point was 99.03% (95% confidence interval, 95%-100%). The high survival rate of the cementless Zweymüller-Plus system with ceramic-on-polyethylene bearing at mid-term follow-up makes this total hip arthroplasty system reliable for patients with various hip joint diseases.

Total knee arthroplasty with an oxidised zirconium femoral component: ten-year survivorship analysis.

PubMed

Ahmed, I; Salmon, L J; Waller, A; Watanabe, H; Roe, J P; Pinczewski, L A

2016-01-01

Oxidised zirconium was introduced as a material for femoral components in total knee arthroplasty (TKA) as an attempt to reduce polyethylene wear. However, the long-term survival of this component is not known. We performed a retrospective review of a prospectively collected database to assess the ten year survival and clinical and radiological outcomes of an oxidised zirconium total knee arthroplasty with the Genesis II prosthesis. The Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), Knee Injury and Osteoarthritis Outcome Score (KOOS) and a patient satisfaction scale were used to assess outcome. A total of 303 consecutive TKAs were performed in 278 patients with a mean age of 68 years (45 to 89). The rate of survival ten years post-operatively as assessed using Kaplan-Meier analysis was 97% (95% confidence interval 94 to 99) with revision for any reason as the endpoint. There were no revisions for loosening, osteolysis or failure of the implant. There was a significant improvement in all components of the WOMAC score at final follow-up (p < 0.001). The mean individual components of the KOOS score for symptoms (82.4 points; 36 to 100), pain (87.5 points; 6 to 100), activities of daily life (84.9 points; 15 to 100) and quality of life (71.4 points; 6 to 100) were all at higher end of the scale. This study provides further supportive evidence that the oxidised zirconium TKA gives comparable rates of survival with other implants and excellent functional outcomes ten years post-operatively. Total knee arthroplasty with an oxidised zirconium femoral component gives comparable long-term rates of survival and functional outcomes with conventional implants. ©2016 The British Editorial Society of Bone & Joint Surgery.

Pro-inflammatory Analysis of Macrophages in Contact with Titanium Particles and Porphyromonas gingivalis.

PubMed

Dodo, Cindy Goes; Meirelles, Luiz; Aviles-Reyes, Alejandro; Ruiz, Karina Gonzalez Silvério; Abranches, Jacqueline; Cury, Altair Antoninha Del Bel

2017-01-01

During insertion of titanium dental implants, particles may shear from the implant to the periimplant region causing osteolysis, and their association with bacteria can exacerbate the inflammatory reaction. However, the association of a high invasive bacterium from the oral cavity, Porphyromonas gingivalis (Pg), and titanium particles remains unknown. This study evaluated pro-inflammatory reaction of human macrophages in contact with micro and nanoparticles of titanium associated with Porphyromonas gingivalis lipopolysaccharide (PgLPS). THP-1 cell were used and treated for 12, 24 and 48 h following 6 groups: Control(C), PgLPS (L); Microparticles (M); Nanoparticles (N); PgLPS and microparticles (LM); PgLPS and nanoparticles (LN). The following assays were carried out: i) cell viability using MTS, ii) cell morphology by SEM and iii) expression of tumor necrosis factor alpha (TNF-α), interleukin-1 beta (IL-1β) and interleukin-6 (IL-6) by qRT-PCR and ELISA. For statistics two-way ANOVA followed by Tukey's test was used (p<0.05). After treatment, cells presented similar viability and morphology demonstrating that the treatments were not able to induce cell death. Gene expression was significantly higher for TNF-α and IL1-β after 12 h, and for IL-6 after 24 h in the N and LN groups. Cytokine production over time was an ascending curve for TNF-α with the peak at 48 h and IL1-β and IL-6 had a straight line among the time points, although cells from N group presented a significant production of IL-6 at 48 h. In conclusion, these results suggest that titanium nanoparticles stimulate stronger pro-inflammatory response in macrophages, independent of their association with LPS from P.gingivalis.

Effects of interleukin-7/interleukin-7 receptor on RANKL-mediated osteoclast differentiation and ovariectomy-induced bone loss by regulating c-Fos/c-Jun pathway.

PubMed

Zhao, Ji-Jun; Wu, Zhao-Feng; Yu, Ying-Hao; Wang, Ling; Cheng, Li

2018-09-01

To explore the effects of IL-7/IL-7R on the RANKL-mediated osteoclast differentiation in vitro and OVX-induced bone loss in vivo. BMMs and RAW264.7 were transfected with IL-7, IL-7R siRNA, c-Fos siRNA, and c-jun siRNA and later stimulated by RANKL. TRAP and toluidine blue staining were used to observe osteoclast formation and bone resorption, respectively. HE and TRAP staining were used to detect trabecular bone microstructure and osteoclasts of mice, respectively. qRT-PCR and Western blot analysis were used to examine expression. IL-7 unregulated the expression of CTSK, NFATc1, MMP9, and the phosphorylation of p38 and Akt by activating the c-Fos/c-Jun pathway, which increased osteoclast numbers and bone resorption in RANKL-stimulated macrophages. While IL-7R siRNA and c-Fos siRNA decreased the expression, as well as and the phosphorylation of p38 and Akt.IL-7 decreased the BMD and OPG expression in OVX-induced mice and increased the TRAP positive cells, the mRNA expression of c-fos, c-jun, and RANKL, which was contradictory to IL-7R siRNA, and c-Fos siRNA. Furthermore, IL-7R siRNA and c-Fos siRNA caused thicker trabeculae, increased trabecular number, and decreased osteolysis in OVX mice. IL-7/IL-7R can promote RANKL-mediated osteoclast formation and bone resorption by activating the c-Fos/c-Jun pathway, as well as inducing bone loss in OVX mice. © 2018 Wiley Periodicals, Inc.

Cathepsin K expression and activity in canine osteosarcoma.

PubMed

Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M

2012-01-01

Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.

Fighting cancer with nanomedicine---drug-polyester nanoconjugates for targeted cancer therapy

NASA Astrophysics Data System (ADS)

Yin, Qian

The aim of my Ph. D. research is to develop drug-polyester nanoconjugates (NCs) as a novel translational polymeric drug delivery system that can successfully evade non-specific uptake by reticuloendothelial system (RES) and facilitate targeted cancer diagnosis and therapy. By uniquely integrating well-established chemical reaction-controlled ring opening polymerization (ROP) with nanoprecipitation technique, I successfully developed a polymeric NC system based on poly(lactic acid) and poly(O-carboxyanhydrides) (OCA) that allows for the quantitative loading and controlled release of a variety of anticancer drugs. The developed NC system could be easily modified with parmidronate, one of bisphosphonates commonly used as the treatment for disease characterized by osteolysis, to selectively deliver doxorubicin (Doxo) to the bone tissues and substantially to improve their therapeutic efficiency in inhibiting the growth of osteosarcoma in both murine and canine models. More importantly, the developed NCs could avidly bind to human serum albumin, a ubiquitous protein in the blood, to bypass the endothelium barrier and penetrate into tumor tissues more deeply and efficiently. When compared with PEGylated NCs, these albumin-bound NCs showed significantly reduced accumulation in RES and enhanced tumor accumulation, which consequently contributed to higher their tumor inhibition capabilities. In addition, the developed NC system allows easy incorporation of X-ray computed tomography (CT) contrast agents to largely facilitate personalized therapy by improving diagnosis accuracy and monitoring therapeutic efficacy. Through the synthetic and formulation strategy I developed, a large quantity (grams or larger-scale) of drug-polyester NCs can be easily obtained, which can be used as a model drug delivery system for fundamental studies as well as a real drug delivery system for disease treatment in clinical settings.

Long-term results of total knee arthroplasty for valgus knees: soft-tissue release technique and implant selection.

PubMed

Rajgopal, Ashok; Dahiya, Vivek; Vasdev, Attique; Kochhar, Hemanshu; Tyagi, Vipin

2011-04-01

To report long-term results of total knee arthroplasty (TKA) for valgus knees. 34 women and 19 men aged 39 to 84 (mean, 74) years with valgus knees underwent primary TKA by a senior surgeon. Of the 78 knees, 43, 29, and 6 had type-I, type-II, and type-III valgus deformities, respectively. A preliminary lateral soft-tissue release was performed, and the tibia and femur were prepared. The tight lateral structures were released using the pie-crusting technique. In 92% of the knees, cruciate-retaining implants were used. In knees with severe deformity and medial collateral ligament insufficiency, the posterior cruciate ligament was sacrificed and constrained implants were used. The Hospital for Special Surgery (HSS) knee score was assessed, as were tibiofemoral alignment, range of motion, stability, and evidence of loosening or osteolysis. Patients were followed up for 8 to 14 (mean, 10) years. All knees had a good patellar position and were clinically stable in both mediolateral and anteroposterior planes. No radiolucency was noted. The mean HSS knee score improved from 48 to 91 (p<0.001). The mean tibiofemoral alignment improved from valgus 20 to 5 degrees (p<0.001). The mean range of motion improved from 65 to 110 degrees (p<0.001). One patient developed a deep infection at year 4, and 2 had periprosthetic fractures at years 6 and 8. Adequate lateral soft-tissue release is the key to successful TKAs in valgus knees. The choice of implant depends on the severity of the valgus deformity and the extent of soft-tissue release needed to obtain a stable, balanced flexion and extension gap, in order to achieve minimal constraint with maximum stability.

Ten-Year Cross-Sectional Study of Mechanically Assisted Crevice Corrosion in 1352 Consecutive Patients With Metal-on-Polyethylene Total Hip Arthroplasty.

PubMed

Hussey, Daniel K; McGrory, Brian J

2017-08-01

Mechanically assisted crevice corrosion (MACC) in metal-on-polyethylene total hip arthroplasty (THA) is of concern, but its prevalence, etiology, and natural history are incompletely understood. From January 2003 to December 2012, 1352 consecutive THA surgeries using a titanium stem, cobalt-chromium alloy femoral head, and highly cross-linked polyethylene liner from a single manufacturer were performed. Patients were followed at 1-year and 5-year intervals for surveillance, but also seen earlier if they had symptoms. Any patient with osteolysis >1 cm (n = 3) or unexplained pain (n = 85) underwent examination, radiographs, complete blood count, erythrocyte sedimentation rate, and C-reactive protein, as well as tests for serum cobalt and chromium levels. Symptomatic MACC was present in 43 of 1352 patients (3.2%). Prevalence of MACC by year of implant ranged from 0% (0 of 61, 2003; 0 of 138, 2005) to 10.5% (17 of 162; 2009). The M/L Taper stem had a greater prevalence (4.9%) of MACC than all other Zimmer (Zimmer, Inc, Warsaw, IN) 12/14 trunnion stem types combined (1.2%; P < .001). Twenty-seven of 43 (62.8%) patients have undergone revision surgery, and 16 of 43 (37.2%) patients have opted for ongoing surveillance. Comparing symptomatic THA patients with and without MACC, no demographic, clinical, or radiographic differences were found. MACC was significantly more common in 0 length femoral heads (compared with both -3.5 mm and +3.5 mm heads). The prevalence of MACC in metal-on-polyethylene hips is higher in this cross-sectional study than previously reported. A significantly higher prevalence was found in patients with M/L Taper style stem and THA performed both in 2009 and also between 2009 and 2012 with this manufacturer. Copyright © 2017 Elsevier Inc. All rights reserved.

A highly selective, orally active inhibitor of Janus kinase 2, CEP-33779, ablates disease in two mouse models of rheumatoid arthritis

PubMed Central

2011-01-01

Introduction Janus kinase 2 (JAK2) is involved in the downstream activation of signal transducer and activator of transcription 3 (STAT3) and STAT5 and is responsible for transducing signals for several proinflammatory cytokines involved in the pathogenesis of rheumatoid arthritis (RA), including interleukin (IL)-6, interferon γ (IFNγ) and IL-12. In this paper, we describe the efficacy profile of CEP-33779, a highly selective, orally active, small-molecule inhibitor of JAK2 evaluated in two mouse models of RA. Methods Collagen antibody-induced arthritis (CAIA) and collagen type II (CII)-induced arthritis (CIA) were established before the oral administration of a small-molecule JAK2 inhibitor, CEP-33779, twice daily at 10 mg/kg, 30 mg/kg, 55 mg/kg or 100 mg/kg over a period of 4 to 8 weeks. Results Pharmacodynamic inhibition of JAK2 reduced mean paw edema and clinical scores in both CIA and CAIA models of arthritis. Reduction in paw cytokines (IL-12, IFNγ and tumor necrosis factor α) and serum cytokines (IL-12 and IL-2) correlated with reduced spleen CII-specific T helper 1 cell frequencies as measured by ex vivo IFNγ enzyme-linked immunosorbent spot assay. Both models demonstrated histological evidence of disease amelioration upon treatment (for example, reduced matrix erosion, subchondral osteolysis, pannus formation and synovial inflammation) and reduced paw phosphorylated STAT3 levels. No changes in body weight or serum anti-CII autoantibody titers were observed in either RA model. Conclusions This study demonstrates the utility of using a potent and highly selective, orally bioavailable JAK2 inhibitor for the treatment of RA. Using a selective inhibitor of JAK2 rather than pan-JAK inhibitors avoids the potential complication of immunosuppression while targeting critical signaling pathways involved in autoimmune disease progression. PMID:21510883

Treatment of Lateral Tibial Condylar Fractures Using Bioactive, Bioresorbable Forged Composites of Raw Particulate Unsintered Hydroxyapatite/Poly-L-Lactide Screws.

PubMed

Kuroyanagi, Gen; Yoshihara, Hiroyuki; Yamamoto, Naohiro; Suzuki, Hiroyuki; Yamada, Kunio; Yoshida, Yukio; Otsuka, Takanobu; Takada, Naoya

2018-05-01

Forged composites of raw particulate unsintered hydroxyapatite/poly-L-lactide (F-u-HA/PLLA) devices possess high mechanical strength, bioactivity, and radio-opacity. The aim of this study was to assess the efficacy of F-u-HA/PLLA screws in the treatment of lateral tibial condylar fractures. From January 2005 to December 2010, a total of 7 patients with displaced closed lateral tibial condylar fractures (Schatzker type II) were treated using F-u-HA/PLLA screws. Open reduction and internal fixation was performed using 2 or 3 F-u-HA/PLLA screws. After surgery, weight bearing was not allowed for 6 weeks. Range of motion exercise was initiated after removal of the plaster splint. Radiographs were evaluated for fracture healing, joint depression, and the radioopacity of F-u-HA/PLLA screws. Clinical outcomes and postoperative complications were also assessed. Average follow-up was 44 months. All fractures were successfully healed. Average values for joint depression were 4.7 mm (range, 2-9 mm) preoperatively, 0.4 mm (range, 0-1 mm) postoperatively, and 0.4 mm (range, 0-1 mm) at final follow-up. Whole shadows of F-u-HA/PLLA screws were observed during the follow-up period. Breakage of screws, osteolysis, and a radiolucent zone around the screws were not observed at final follow-up. Average knee flexion and extension were 134° (range, 110° to 150°) and -1° (range, -10° to 0°), respectively. No patient had wound infection, late aseptic tissue response, or foreign body reaction postoperatively. None of the patients reported pain at final follow-up. These results suggest that F-u-HA/PLLA screws could be an alternative option for the treatment of lateral tibial condylar fractures. [Orthopedics. 2018; 41(3):e365-e368.]. Copyright 2018, SLACK Incorporated.

Posterior lumbar interbody fusion using non resorbable poly-ether-ether-ketone versus resorbable poly-L-lactide-co-D,L-lactide fusion devices. Clinical outcome at a minimum of 2-year follow-up.

PubMed

Jiya, Timothy U; Smit, T; van Royen, B J; Mullender, M

2011-04-01

Previous papers on resorbable poly-L-lactide-co-D,L-lactide (PLDLLA) cages in spinal fusion have failed to report adequately on patient-centred clinical outcome measures. Also comparison of PLDLLA cage with a traditionally applicable counterpart has not been previously reported. This is the first randomized prospective study that assesses clinical outcome of PLDLLA cage compared with a poly-ether-ether-ketone (PEEK) implant. Twenty-six patients were randomly assigned to undergo instrumented posterior lumbar interbody fusion (PLIF) whereby either a PEEK cage or a PLDLLA cage was implanted. Clinical outcome based on visual analogue scale scores for leg pain and back pain, as well as Oswestry Disability Index (ODI) and SF-36 questionnaires were documented and analysed. When compared with preoperative values, all clinical parameters have significantly improved in the PEEK group at 2 years after surgery with the exception of SF-36 general health, SF-36 mental health and SF-36 role emotional scores. No clinical parameter showed significant improvement at 2 years after surgery compared with preoperative values in the PLDLLA patient group. Only six patients (50%) in the PLDLLA group showed improvement in the VAS scores for leg and back pain as well as the ODI, as opposed to 10 patients (71%) in the PEEK group. One-third of the patients in the PLDLLA group actually reported worsening of their pain scores and ODI. Three cases of mild to moderate osteolysis were seen in the PLDLLA group. Following up on our preliminary report, these 2-year results confirm the superiority of the PEEK implant to the resorbable PLDLLA implant in aiding spinal fusion and alleviating symptoms following PLIF in patients with degenerative spondylolisthesis associated with either canal stenosis or foramen stenosis or both and emanating from a single lumbar segment.

Rapid ex vivo imaging of PAIII prostate to bone tumor with SWIFT-MRI.

PubMed

Luhach, Ihor; Idiyatullin, Djaudat; Lynch, Conor C; Corum, Curt; Martinez, Gary V; Garwood, Michael; Gillies, Robert J

2014-09-01

The limiting factor for MRI of skeletal/mineralized tissue is fast transverse relaxation. A recent advancement in MRI technology, SWIFT (Sweep Imaging with Fourier Transform), is emerging as a new approach to overcome this difficulty. Among other techniques like UTE, ZTE, and WASPI, the application of SWIFT technology has the strong potential to impact preclinical and clinical imaging, particularly in the context of primary or metastatic bone cancers because it has the added advantage of imaging water in mineralized tissues of bone allowing MRI images to be obtained of tissues previously visible only with modalities such as computed tomography (CT). The goal of the current study is to examine the feasibility of SWIFT for the assessment of the prostate cancer induced changes in bone formation (osteogenesis) and destruction (osteolysis) in ex vivo specimens. A luciferase expressing prostate cancer cell line (PAIII) or saline control was inoculated directly into the tibia of 6-week-old immunocompromised male mice. Tumor growth was assessed weekly for 3 weeks before euthanasia and dissection of the tumor bearing and sham tibias. The ex vivo mouse tibia specimens were imaged with a 9.4 Tesla (T) and 7T MRI systems. SWIFT images are compared with traditional gradient-echo and spin-echo MRI images as well as CT and histological sections. SWIFT images with nominal resolution of 78 μm are obtained with the tumor and different bone structures identified. Prostate cancer induced changes in the bone microstructure are visible in SWIFT images, which is supported by spin-echo, high resolution CT and histological analysis. SWIFT MRI is capable of high-quality high-resolution ex vivo imaging of bone tumor and surrounding bone and soft tissues. Furthermore, SWIFT MRI shows promise for in vivo bone tumor imaging, with the added benefits of nonexposure to ionizing radiation, quietness, and speed. Copyright © 2013 Wiley Periodicals, Inc.

The flavonoid quercetin inhibits titanium dioxide (TiO2)-induced chronic arthritis in mice.

PubMed

Borghi, Sergio M; Mizokami, Sandra S; Pinho-Ribeiro, Felipe A; Fattori, Victor; Crespigio, Jefferson; Clemente-Napimoga, Juliana T; Napimoga, Marcelo H; Pitol, Dimitrius L; Issa, João P M; Fukada, Sandra Y; Casagrande, Rubia; Verri, Waldiceu A

2018-03-01

Titanium dioxide (TiO 2 ) is a common component of orthopedic prosthesis. However, prosthesis wear releases TiO 2 , which induces inflammation and osteolysis in peri-prosthetic tissues. Quercetin is a flavonoid widely present in human diet, which presents biological activities such as antinociceptive, anti-inflammatory and antioxidant effects. Therefore, the effect of intraperitoneal treatment with quercetin in TiO 2 -induced arthritis model was evaluated. In the first set of experiments, mice received injection of TiO 2 (0.1-3 mg/knee joint) and articular mechanical hyperalgesia, edema and histopathology analysis were performed in a 30 days protocol. The dose of 3 mg of TiO 2 showed the most harmful effect, and was chosen to the following experiments. Subsequently, mice received 3 mg of TiO 2 followed by post-treatment with quercetin during 30 days. Quercetin (10-100 mg/kg) inhibited in a dose-dependent manner TiO 2 -induced knee joint mechanical hyperalgesia, edema and leukocyte recruitment and did not induce damage in major organs such as liver, kidney and stomach. The dose of 30 mg/kg was chosen for the subsequent analysis, and reduced histopathological changes such as leukocyte infiltration, vascular proliferation and synovial hyperplasia (pannus formation) on day 30 after TiO 2 challenge. The protective analgesic and anti-inflammatory mechanisms of quercetin included the inhibition of TiO 2 -induced neutrophil and macrophage recruitment, proteoglycan degradation, oxidative stress, cytokine production (TNF-α, IL-1β, IL-6, and IL-10), COX-2 mRNA expression, and bone resorption as well as activation of Nrf2/HO-1 signaling pathway. These results demonstrate the potential therapeutic applicability of the dietary flavonoid quercetin to reduce pain and inflammatory damages associated with prosthesis wear process-induced arthritis. Copyright © 2017 Elsevier Inc. All rights reserved.

Monitoring Bacterial Burden, Inflammation and Bone Damage Longitudinally Using Optical and μCT Imaging in an Orthopaedic Implant Infection in Mice

PubMed Central

Niska, Jared A.; Meganck, Jeffrey A.; Pribaz, Jonathan R.; Shahbazian, Jonathan H.; Lim, Ed; Zhang, Ning; Rice, Brad W.; Akin, Ali; Ramos, Romela Irene; Bernthal, Nicholas M.; Francis, Kevin P.; Miller, Lloyd S.

2012-01-01

Background Recent advances in non-invasive optical, radiographic and μCT imaging provide an opportunity to monitor biological processes longitudinally in an anatomical context. One particularly relevant application for combining these modalities is to study orthopaedic implant infections. These infections are characterized by the formation of persistent bacterial biofilms on the implanted materials, causing inflammation, periprosthetic osteolysis, osteomyelitis, and bone damage, resulting in implant loosening and failure. Methodology/Principal Findings An orthopaedic implant infection model was used in which a titanium Kirshner-wire was surgically placed in femurs of LysEGFP mice, which possess EGFP-fluorescent neutrophils, and a bioluminescent S. aureus strain (Xen29; 1×103 CFUs) was inoculated in the knee joint before closure. In vivo bioluminescent, fluorescent, X-ray and μCT imaging were performed on various postoperative days. The bacterial bioluminescent signals of the S. aureus-infected mice peaked on day 19, before decreasing to a basal level of light, which remained measurable for the entire 48 day experiment. Neutrophil EGFP-fluorescent signals of the S. aureus-infected mice were statistically greater than uninfected mice on days 2 and 5, but afterwards the signals for both groups approached background levels of detection. To visualize the three-dimensional location of the bacterial infection and neutrophil infiltration, a diffuse optical tomography reconstruction algorithm was used to co-register the bioluminescent and fluorescent signals with μCT images. To quantify the anatomical bone changes on the μCT images, the outer bone volume of the distal femurs were measured using a semi-automated contour based segmentation process. The outer bone volume increased through day 48, indicating that bone damage continued during the implant infection. Conclusions/Significance Bioluminescent and fluorescent optical imaging was combined with X-ray and μCT imaging to provide noninvasive and longitudinal measurements of the dynamic changes in bacterial burden, neutrophil recruitment and bone damage in a mouse orthopaedic implant infection model. PMID:23082163

What have we learned from 100% success of press fit condylar rotating platform posterior stabilized knees?: A 5-10 years followup by a nondesigner.

PubMed

Vaidya, Shrinand V; Virani, Siddharth; Phunde, Rajendra; Mahajan, Abhishek

2016-01-01

Total joint arthroplasties of the hip and knee represent a remarkable feat of modern medicine in terms of reducing pain and restoring function to millions of patients afflicted with severe arthritis. Oftentimes, the performance and longevity of new implants and devices are based on limited data. This is the first study by a non-designer on the press fit condylar rotating platform posterior stabilized (PFC-RP-PS) design with 100' success. This has a relevance, vis-á -vis bias that one may have in terms of reproducibility of technique and funding from the manufacturer. We associate our excellent mid-term results to intra operative technical aspects and stringent intra operative exclusion criteria. Our study includes a cohort of 121 selected knees operated between January 2003 and October 2010. We used cemented, posterior stabilized (PS), mobile bearing (MB), and RP prosthesis from the same manufacturer in all these 121 knees. The patients were evaluated bi-annually with the calculation of their Knee Society Scores (KSS) and a radiological assessment for loosening/osteolysis. 120 knees were available for followup. The average Knee Society clinical and functional scores, respectively, were 27 points and 40 points preoperatively and 93 points and 95 points postoperatively. This indicates a mean increase of about 71' in the clinical score and about 58' in the functional score, which is statistically significant. The mean postoperative flexion was 124°, a mean increase of 23° from the preoperative flexion of 101°. There were no revisions (Kaplan--Meier survivorship of 100'). We feel durable and reproducible results of PFC-RP-PS design knees are very technique sensitive. The way ahead with the PFC-RP-PS knees looks promising when the exclusion criteria for this design are strictly met. Coming from a non-designer, this study acquires a higher degree of relevance without any designer's or manufacturer's bias.

Clinical, radiographic, ultrasonographic and computed tomographic features of nonseptic osteitis of the axial border of the proximal sesamoid bones.

PubMed

Vanderperren, K; Bergman, H J; Spoormakers, T J P; Pille, F; Duchateau, L; Puchalski, S M; Saunders, J H

2014-07-01

Lysis of the axial aspect of equine proximal sesamoid bones (PSBs) is a rare condition reported to have septic or traumatic origins. Limited information exists regarding imaging of nonseptic axial osteitis of a PSB. To report the clinical, radiographic, ultrasonographic, computed tomographic and intra-arterial contrast-enhanced computed tomographic abnormalities in horses with axial nonseptic osteitis of a PSB. Retrospective clinical study. Eighteen horses diagnosed with nonseptic osteitis of the axial border of a PSB between 2007 and 2012 were reviewed retrospectively. Case details, clinical examination, radiographic, ultrasonographic, computed tomographic and intra-arterial/intra-articular contrast-enhanced computed tomographic features were recorded, when available. Radiographic, ultrasonographic and computed tomographic evaluations of the fetlock region had been performed on 18, 15 and 9 horses, respectively. The effect of the degree of lysis on the grade and duration of lameness was determined. All horses had chronic unilateral lameness, 4 with forelimb and 14 with hindlimb signs. On radiographs, lysis was identified in both PSBs in 14 horses, one PSB in 3 horses and in one horse no lysis was identified. The degree of osteolysis was variable. Ultrasonography identified variably sized irregularities of the bone surface and alteration in echogenicity of the palmar/plantar ligament (PL). All horses undergoing computed tomographic examination (n = 9) had biaxial lysis. The lesions were significantly longer and deeper on computed tomographic images compared with radiographic images. Intra-arterial contrast-enhanced computed tomography may reveal moderate to marked contrast enhancement of the PL. There was no significant effect of the degree of lysis on the grade and duration of lameness. Lesions of nonseptic axial osteitis of a PSB can be identified using a combination of radiography and ultrasonography. Computed tomography provides additional information regarding the extent of the pathology. © 2013 EVJ Ltd.

Conception on the cell mechanisms of bone tissue loss under spase flight conditions

NASA Astrophysics Data System (ADS)

Rodionova, Natalia; Oganov, Victor; Kabitskaya, Olga

Basing on the analysis of available literature and the results of our own electron microscopic and radioautographic researches the data are presented about the morpho-functional peculiarities and succession of cellular interactions in adaptive remodeling of bone structures under normal conditions and after exposure of animals (rats, monkeys, mice) to microgravity (SLS-2, Bion-11, BionM-1). The probable cellular mechanisms of the development of osteopenia and osteoporosis are considered. Our conception on remodeling proposes the following sequence in the development of cellular interactions after decrease of the mechanical loading: a primary response of osteocytes (mechanosensory cells) to the mechanical stimulus; osteocytic remodeling (osteolysis); transmission of the mechanical signals through a system of canals and processes to functionally active osteoblasts and surface osteocytes as well as to the bone-marrow stromal cells and to those lying on bone surfaces. As a response to the mechanical stimulus (microgravity) the system of stromal cell-preosteoblast-osteoblast shows a delay in proliferation, differentiation and specific functioning of the osteogenetic cells, some of the osteoblasts undergo apoptosis. Then the osteoclastic reaction occurs (attraction of monocytes and formation of osteoclasts and bone matrix resorption in the loci of apoptosis of osteoblasts and osteocytes). The macrophagal reaction is followed by osteoblastogenesis, which appears to be a rehabilitating process. However, during prolonged absence of mechanical stimuli (microgravity, long-time immobilization) the adaptive activization of osteoblastogenesis doesn’t occur (as it is the case during the physiological remodeling of bone tissue) or it occurs to a smaller degree. The loading deficit leads to an adaptive differentiation of stromal cells to fibroblastic cells and adipocytes in these remodeling loci. These cell reactions are considered as adaptive-compensatory, but they don’t result in rehabilitation of the resorbed bone tissue. This sequence of events is considered as a mechanism of bone tissue loss which underlies the development of osteopenia and osteoporosis under the mechanical loading deficit.

Flexible intramedullary nailing for the treatment of unicameral bone cysts in long bones.

PubMed

Roposch, A; Saraph, V; Linhart, W E

2000-10-01

Unicameral bone cyst is characterized by its tenacity and risk of recurrence. Pathological fracture is common and is often the presenting symptom. The objective of the present study was to evaluate the results of flexible intramedullary nailing for the treatment of a unicameral bone cyst with or without a pathological fracture. Flexible intramedullary nailing for the treatment of a unicameral bone cyst was performed in thirty-two patients. Thirty of these patients presented with a pathological fracture; twenty-four were managed immediately with intramedullary nailing, and the other six had been managed conservatively at other clinics before they were referred to our department. The remaining two cysts were detected incidentally. The cyst was located in the humerus in twenty-one patients, in the femur in nine, and in the radius in two. The mean age of the patients at the time of surgery was 9.8 years, and the mean duration of follow-up was 53.7 months. Radiographic evaluation was performed according to the criteria of Capanna et al., and the cyst was classified as completely healed, healed with residual radiolucency (osteolysis), recurred, or having no response. The healing period ranged from three to 105 months. Fourteen cysts healed completely, and sixteen healed with residual radiolucent areas visible on radiographs. There was recurrence of two cysts that had healed with residual radiolucency. All of the cysts in the present study responded to treatment. A change of nails was necessary in nine patients, as the nails had become too short after bone growth. No major complications were observed. Flexible intramedullary nailing provides early stability, which allows early mobilization and thus obviates the need for a plaster cast and decreases the prevalence of the most common complication: a pathological fracture. This method of treatment also allows for an early return to normal activity.

Aspergillus osteomyelitis: epidemiology, clinical manifestations, management, and outcome.

PubMed

Gamaletsou, Maria N; Rammaert, Blandine; Bueno, Marimelle A; Moriyama, Brad; Sipsas, Nikolaos V; Kontoyiannis, Dimitrios P; Roilides, Emmanuel; Zeller, Valerie; Prinapori, Roberta; Taj-Aldeen, Saad J; Brause, Barry; Lortholary, Olivier; Walsh, Thomas J

2014-05-01

The epidemiology, pathogenesis, diagnosis, and management of Aspergillus osteomyelitis are not well understood. Protocol-defined cases of Aspergillus osteomyelitis published in the English literature were reviewed for comorbidities, microbiology, mechanisms of infection, clinical manifestations, radiological findings, inflammatory biomarkers, antifungal therapy, and outcome. Among 180 evaluable patients, 127 (71%) were males. Possible predisposing medical conditions in 103 (57%) included pharmacological immunosuppression, primary immunodeficiency, and neutropenia. Seventy-three others (41%) had prior open fracture, trauma or surgery. Eighty (44%) followed a hematogenous mechanism, 58 (32%) contiguous infections, and 42 (23%) direct inoculation. Aspergillus osteomyelitis was the first manifestation of aspergillosis in 77%. Pain and tenderness were present in 80%. The most frequently infected sites were vertebrae (46%), cranium (23%), ribs (16%), and long bones (13%). Patients with vertebral Aspergillus osteomyelitis had more previous orthopedic surgery (19% vs 0%; P = 0.02), while those with cranial osteomyelitis had more diabetes mellitus (32% vs 8%; P = 0.002) and prior head/neck surgery (12% vs 0%; P = 0.02). Radiologic findings included osteolysis, soft-tissue extension, and uptake on T2-weighted images. Vertebral body Aspergillus osteomyelitis was complicated by spinal-cord compression in 47% and neurological deficits in 41%. Forty-four patients (24%) received only antifungal therapy, while 121 (67%) were managed with surgery and antifungal therapy. Overall mortality was 25%. Median duration of therapy was 90 days (range, 10-772 days). There were fewer relapses in patients managed with surgery plus antifungal therapy in comparison to those managed with antifungal therapy alone (8% vs 30%; P = 0.006). Aspergillus osteomyelitis is a debilitating infection affecting both immunocompromised and immunocompetent patients. The most common sites are vertebrae, ribs, and cranium. Based upon this comprehensive review, management of Aspergillus osteomyelitis optimally includes antifungal therapy and selective surgery to avoid relapse and to achieve a complete response. Copyright © 2013 The British Infection Association. All rights reserved.

Aspergillus Osteomyelitis: Epidemiology, Clinical Manifestations, Management, and Outcome

PubMed Central

Gamaletsou, Maria N.; Rammaert, Blandine; Bueno, Marimelle A.; Moriyama, Brad; Sipsas, Nikolaos V.; Kontoyiannis, Dimitrios P.; Roilides, Emmanuel; Zeller, Valerie; Prinapori, Roberta; Tajaldeen, Saad Jaber; Brause, Barry; Lortholary, Olivier; Walsh, Thomas J.

2014-01-01

Background The epidemiology, pathogenesis, diagnosis, and management of Aspergillus osteomyelitis are not well understood. Methods Protocol-defined cases of Aspergillus osteomyelitis published in the English literature were reviewed for comorbidities, microbiology, mechanisms of infection, clinical manifestations, radiological findings, inflammatory biomarkers, antifungal therapy, and outcome. Results Among 180 evaluable patients, 127 (71%) were males. Possible predisposing medical conditions in 103 (57%) included pharmacological immunosuppression, primary immunodeficiency, and neutropenia. Seventy-three others (41%) had prior open fracture, trauma or surgery. Eighty (44%) followed a hematogenous mechanism, 58 (32%) contiguous infections, and 42 (23%) direct inoculation. Aspergillus osteomyelitis was the first manifestation of aspergillosis in 77%. Pain and tenderness were present in 80%. The most frequently infected sites were vertebrae (46%), cranium (23%), ribs (16%), and long bones (13%). Patients with vertebral Aspergillus osteomyelitis had more previous orthopedic surgery (19% vs 0%; P=0.02), while those with cranial osteomyelitis had more diabetes mellitus (32% vs 8%; P=0.002) and prior head/neck surgery (12% vs 0%; P=0.02). Radiologic findings included osteolysis, soft-tissue extension, and uptake on T2-weighted images. Vertebral body Aspergillus osteomyelitis was complicated by spinal-cord compression in 47% and neurological deficits in 41%. Forty-four patients (24%) received only antifungal therapy, while 121(67%) were managed with surgery and antifungal therapy. Overall mortality was 25%. Median duration of therapy was 90 days (range, 10–772 days). There were fewer relapses in patients managed with surgery plus antifungal therapy in comparison to those managed with antifungal therapy alone (8% vs 30%; P=0.006). Conclusions Aspergillus osteomyelitis is a debilitating infection affecting both immunocompromised and immunocompetent patients. The most common sites are vertebrae, ribs, and cranium. Based upon this comprehensive review, management of Aspergillus osteomyelitis optimally includes antifungal therapy and selective surgery to avoid relapse and to achieve a complete response. PMID:24378282

Early clinical and radiological outcomes of reverse shoulder arthroplasty with an eccentric all-polyethylene glenosphere to treat failed hemiarthroplasty and the sequelae of proximal humeral fractures.

PubMed

Merolla, Giovanni; Tartarone, Antonio; Sperling, John W; Paladini, Paolo; Fabbri, Elisabetta; Porcellini, Giuseppe

2017-01-01

The aim of this study was to assess the effectiveness of reverse total shoulder arthroplasty (RTSA) with an all-polyethylene glenosphere in patients with failed hemiarthroplasty (HH) or the sequelae of proximal humeral fractures. Thirty-six patients were assessed at a mean follow-up of 36 months using clinical scores and recording shoulder range of movement (ROM). Active anterior elevation (p < 0.001), lateral elevation (p < 0.001) and internal rotation (p < 0.0001) improved significantly, whereas improvement in external rotation was not significant. The mean Constant score rose significantly from 8.5 ± 7.6 to 40.7 ± 15.7 (p < 0.001) and the Simple Shoulder Test score from 0.42 ± 0.85 to 5.5 ± 2.6 (p < 0.001). Pain improved significantly from 8.7 ± 0.9 to 2.3 ± 1.2 (p < 0.001). Implant radiographic survivorship was 84.6 %. Scapular notching was detected in 7/36 patients (17.5 %). There were five complications: one (stiffness) among patients with fracture sequelae and four among those with failed HH (instability, n = 2; humeral component disassembly, n = 1; pain, n = 1). The two groups did not exhibit significant differences in pain, clinical scores or ROM. RTSA with an all-polyethylene glenosphere may have the potential to reduce the risk of biological notching due to polyethylene osteolysis. Further long-term studies are required to assess its efficacy. The good clinical performance and reasonable rate of notching of the polyethylene glenosphere support its use in primary and revision shoulder arthroplasty. Level 4, retrospective therapeutic case series.

Ceramic-on-ceramic total hip arthroplasty in patients younger than 55 years.

PubMed

Shah, Roshan P; Scolaro, John A; Componovo, Roger; Garino, Jonathan P; Lee, Gwo-Chin

2014-12-01

To review the outcomes of 65 patients younger than 55 years who underwent uncemented total hip arthroplasty (THA) using third-generation ceramic-on-ceramic prostheses. Medical records of 30 men and 35 women (80 hips) aged 18 to 55 (mean, 39) years who underwent uncemented THA using third-generation ceramic-onceramic prostheses by a single surgeon were reviewed. 61 THAs used the Reflection cup with the Synergy stem (n=49), Spectron stem (n=7), or Anthology stem (n=5), and 19 THAs used the Trident cup with the Secur-Fit stem. Outcomes were assessed based on the UCLA Activity Score and Harris Hip Score, as well as radiolucency around the implants, malposition, and subsidence on radiographs. Patients were asked about their satisfaction with current activity level (yes/no), activity limitation (no limitation, musculoskeletal limitation, psychological impediments and lack of motivation, and pain or disability of the operative hip), and change in occupational activity level (same or similar, more active, and less active or disability). The mean follow-up period was 54 (range, 24-110) months. Six patients were excluded from the analysis owing to prosthetic failure secondary to ceramic liner fracture after falling (n=2), acetabular component loosening (n=1), intolerable squeak (n=1), periprosthetic fracture (n=1), and instability (n=1). The mean UCLA Activity Score improved from 4.0 (range, 1-10) to 7.7 (range, 2-10) [p<0.001], and the mean Harris Hip Score improved from 52.8 (range, 25-69) to 91.0 (range, 38-100) [p<0.001]. No hip had evidence of subsidence, loosening, or osteolysis. 52 (80%) patients were satisfied with their activity level; 28 (43%) patients reported no activity limitation; and 57 (88%) patients kept the same or similar occupation. Ceramic-on-ceramic THA achieved acceptable clinical and radiographic outcomes.

Effect of bisphosphonates on periprosthetic bone loss after total knee arthroplasty: a meta-analysis of randomized controlled trials.

PubMed

Shi, Mingmin; Chen, Lei; Wu, Haobo; Wang, Yangxin; Wang, Wei; Zhang, Yujie; Yan, Shigui

2018-05-30

Aseptic loosening and osteolysis are the most common indications after TKA for revision surgery. This meta-analysis which included high-quality randomized controlled trials (RCTs) aimed to analyze the effect of bisphosphonates (BPs) on maintaining periprosthetic bone mineral density (BMD) after total knee arthroplasty. PubMed, AMED, EMBASE, the Cochrane library, ISI Web of Science, and China National Knowledge Infrastructure were systematically searched, five RCTs were included and the total number of participants was 188. The weighted mean differences with 95% confidence interval were calculated to evaluate the efficacy of BPs on total BMD of knee and the BMD of different periprosthetic regions. A descriptive review was performed for BP-related adverse effects. The BPs group presented significantly higher total BMD in proximal part of the tibia than the control group at 3 and 6 months (P < 0.05), but no significant difference at 12 months (P = 0.09). The BPs group presented significantly higher BMD in the distal aspect of the femur than that in the control group at 3, 6, 12 months. The BPs group presented significantly higher periprosthetic BMD than that in the control group at 3, 6 and 12 months in tibial medial and lateral metaphyseal region, and femoral anterior, central and posterior metaphyseal region (p < 0.05), but no significant difference for tibial diaphyseal region at 3, 6, and 12 months. None of the included studies described severe or fatal adverse effects related to BPs. BPs have a short-term effect on reducing periprosthetic bone loss after total knee arthroplasty. Compared with diaphyseal region, BPs are more effective on the preservation of BMD in medial lateral metaphyseal regions of proximal tibia and in anterior, central, and posterior metaphyseal region of distal femur.

Release of zirconia nanoparticles at the metal stem-bone cement interface in implant loosening of total hip replacements.

PubMed

Schunck, Antje; Kronz, Andreas; Fischer, Cornelius; Buchhorn, Gottfried Hans

2016-02-01

In a previous failure analysis performed on femoral components of cemented total hip replacements, we determined high volumes of abraded bone cement. Here, we describe the topography of the polished surface of polymethyl methacrylate (PMMA) bone cement containing zirconia radiopacifier, analyzed by scanning electron microscopy and vertical scanning interferometry. Zirconia spikes protruded about 300nm from the PMMA matrix, with pits of former crystal deposition measuring about 400nm in depth. We deduced that the characteristically mulberry-shaped agglomerates of zirconia crystals are ground and truncated into flat surfaces and finally torn out of the PMMA matrix. Additionally, evaluation of in vitro PMMA-on-PMMA articulation confirmed that crystal agglomerations of zirconia were exposed to grain pullout, fatigue, and abrasion. In great quantities, micron-sized PMMA wear and zirconia nanoparticles accumulate in the cement-bone interface and capsular tissues, thereby contributing to osteolysis. Dissemination of nanoparticles to distant lymph nodes and organs of storage has been reported. As sufficient information is lacking, foreign body reactions to accumulated nanosized zirconia in places of long-term storage should be investigated. The production of wear particles of PMMA bone cement in the interface to joint replacement devices, presents a local challenge. The presence of zirconia particles results in frustrated digestion attempts by macrophages, liberation of inflammatory mediators, and necrosis leading to aseptic inflammation and osteolyses. Attempts to minimize wear of articulating joints reduced the attention to the deterioration of cement cuffs. We therefore investigated polished surfaces of retrieved cuffs to demonstrate their morphology and to measure surface roughness. Industrially admixed agglomerates of the radiopacifier are abraded to micron and nano-meter sized particles. The dissemination of zirconia particles in the reticulo-endothelial system to storage organs is a possible burden. Research to replace the actual contrast media by non-particulate material deserves more attention. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Candida Arthritis: Analysis of 112 Pediatric and Adult Cases

PubMed Central

Gamaletsou, Maria N.; Rammaert, Blandine; Bueno, Marimelle A.; Sipsas, Nikolaos V.; Moriyama, Brad; Kontoyiannis, Dimitrios P.; Roilides, Emmanuel; Zeller, Valerie; Taj-Aldeen, Saad J.; Miller, Andy O.; Petraitiene, Ruta; Lortholary, Olivier; Walsh, Thomas J.

2016-01-01

Background. Candida arthritis is a debilitating form of deeply invasive candidiasis. However, its epidemiology, clinical manifestations, management, and outcome are not well understood. Methods. Cases of Candida arthritis were reviewed from 1967 through 2014. Variables included Candida spp in joint and/or adjacent bone, underlying conditions, clinical manifestations, inflammatory biomarkers, diagnostic imaging, management, and outcome. Results. Among 112 evaluable cases, 62% were males and 36% were pediatric. Median age was 40 years (range, <1–84 years). Most patients (65%) were not pharmacologically immunosuppressed. Polyarticular infection (≥3 joints) occurred in 31% of cases. Clinical manifestations included pain (82%), edema (71%), limited function (39%), and erythema (22%) with knees (75%) and hips (15%) most commonly infected. Median erythrocyte sedimentation rate was 62 mm/hr (10–141) and C reactive protein 26 mg/dL (0.5–95). Synovial fluid median white blood cell count was 27 500/µL (range, 100–220 000/µL) with 90% polymorphonuclear neutrophils (range, 24–98). Adjacent osteomyelitis was present in 30% of cases. Candida albicans constituted 63%, Candida tropicalis 14%, and Candida parapsilosis 11%. Most cases (66%) arose de novo, whereas 34% emerged during antifungal therapy. Osteolysis occurred in 42%, joint-effusion in 31%, and soft tissue extension in 21%. Amphotericin and fluconazole were the most commonly used agents. Surgical interventions included debridement in 25%, irrigation 10%, and drainage 12%. Complete or partial response was achieved in 96% and relapse in 16%. Conclusion. Candida arthritis mainly emerges as a de novo infection in usually non-immunosuppressed patients with hips and knees being most commonly infected. Localizing symptoms are frequent, and the most common etiologic agents are C albicans, C tropicalis, and C parapsilosis. Management of Candida arthritis remains challenging with a clear risk of relapse, despite antifungal therapy. PMID:26858961

Arthroscopic coracoid transfer in the treatment of recurrent shoulder instability: a systematic review of early results.

PubMed

Butt, Usman; Charalambous, Charalambos P

2013-04-01

Systematic review of the literature to characterize safety profile and complication rates associated with arthroscopic coracoid transfer procedures. We conducted a combined search of Medline, EMBASE, and the CINAHL databases from 1985 to November 2012. Articles were selected and data extracted according to standard criteria. Only 3 studies met the inclusion criteria, and these originated from the pioneers of this technique. These studies described the results of 172 arthroscopic coracoid transfer procedures with an overall complication rate of 19.8% ± 5.6%. Conversion to open surgery was necessary in 6/172 (3.5%) patients. Repeated surgery was described in 5/172 (2.9% ± 2.5%) cases, all for screw removal. The overall rate of recurrent instability was 3/172 cases (1.7% ± 2%). Hardware-related complications occurred in 4/172 patients (2.3% ± 2.3%). Coracoid grafts failed to unite in 14/172 patients (8.1% ± 4.1%); graft osteolysis was seen in 7/172 patients (4.1% ± 2.6%). The coracoid graft fractured in 2/172 cases (1.2% ± 1.6%); one of these occurred intraoperatively and one occurred early postoperatively. There was one transient nerve palsy (0.6% ± 1.1%). Results of arthroscopic coracoid transfer surgery for anterior shoulder instability are sparse, with the available studies originating from the pioneers of this technique. Early results suggest that arthroscopic coracoid transfer is a technically feasible procedure that is able to restore shoulder stability. However, this technique seems to be associated with a high complication rate and a steep learning curve. Results from the wider orthopaedic shoulder arthroscopic community are awaited. Extensive cadaveric training and experience with the open technique is recommended before performing the arthroscopic procedure. Systematic review of Level IV studies. Copyright © 2013 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Synergistic suppression of human breast cancer cells by combination of plumbagin and zoledronic acid In vitro.

PubMed

Qiao, Han; Wang, Ting-yu; Yan, Wei; Qin, An; Fan, Qi-ming; Han, Xiu-guo; Wang, Yu-gang; Tang, Ting-ting

2015-09-01

Zoledronic acid (ZA), a bisphosphonate, is currently used in combination with chemotherapeutic agents to suppress breast cancer cell proliferation or breast cancer-induced osteolysis. The aim of this study was to investigate the effects of ZA combined with a natural anticancer compound plumbagin (PL) against human breast cancer cells in vitro. Human breast cancer MDA-MB-231SArfp cells were treated with ZA, PL or a combination of ZA and PL. The cell growth, apoptosis and migration were evaluated using CCK-8 assay, flow cytometry and transwell assay, respectively. The expression of apoptosis-related proteins was measured using real-time PCR and Western blotting. Synergism was evaluated using Compusyn software, and the combination index (CI) and drug reduction index (DRI) values were determined. PL or ZA alone caused mild cytotoxicity (the IC50 value at 24 h was 12.18 and above 100 μmol/L, respectively). However, the combination of ZA and PL caused a synergistic cytotoxicity (CI=0.26). The DRI values also showed a synergistic effect between PL and ZA, with actual values of 5.52 and 3.59, respectively. Furthermore, PL and ZA synergistically induced apoptosis and inhibited migration of the breast cancer cells. Moreover, the combination of ZA and PL decreased the expression of Notch-1, cleaved PARP, Bcl-2 and Bcl-xl, and increased the expression of cleaved caspase-3, CDKN1A and ID1. When the breast cancer cells were transfected with specific siRNA against Notch-1, the combination of ZA and PL markedly increased the expression of Bcl-2. Combination of ZA and PL synergistically suppresses human breast cancer MDA-MB-231SArfp cells in vitro. PL can inhibit ZA-induced activation of the Notch-1 signaling pathway and subsequently reduce the expression of Bcl-2, thus potentiating cancer cell apoptosis.

Structural simulation of adenosine phosphate via plumbagin and zoledronic acid competitively targets JNK/Erk to synergistically attenuate osteoclastogenesis in a breast cancer model

PubMed Central

Qiao, H; Wang, T-y; Yu, Z-f; Han, X-g; Liu, X-q; Wang, Y-g; Fan, Q-m; Qin, A; Tang, T-t

2016-01-01

The treatment of breast cancer-induced osteolysis remains a challenge in clinical settings. Here, we explored the effect and mechanism of combined treatment with zoledronic acid (ZA) and plumbagin (PL), a widely investigated component derived from Plumbago zeylanica, against breast cancer-induced osteoclastogenesis. We found that the combined treatment with PL and ZA suppressed cell viability of precursor osteoclasts and synergistically inhibited MDA-MB-231-induced osteoclast formation (combination index=0.28) with the abrogation of recombinant mouse receptor activator of nuclear factor-κB ligand (RANKL)-induced activation of NF-κB/MAPK (nuclear factor-κB/mitogen-activated protein kinase) pathways. Molecular docking suggested a putative binding area within c-Jun N-terminal kinase/extracellular signal-regulated kinase (JNK/Erk) protease active sites through the structural mimicking of adenosine phosphate (ANP) by the spatial combination of PL with ZA. A homogeneous time-resolved fluorescence assay further illustrated the direct competitiveness of the dual drugs against ANP docking to phosphorylated JNK/Erk, contributing to the inhibited downstream expression of c-Jun/c-Fos/NFATc-1 (nuclear factor of activated T cells, cytoplasmic, calcineurin-dependent 1). Then, in vivo testing demonstrated that the combined administration of PL and ZA attenuated breast cancer growth in the bone microenvironment. Additionally, these molecules prevented the destruction of proximal tibia, with significant reduction of tartrate-resistant acid phosphatase (TRAcP)-positive osteoclast cells and potentiation of apoptotic cancer cells, to a greater extent when combined than when the drugs were applied independently. Altogether, the combination treatment with PL and ZA could significantly and synergistically suppress osteoclastogenesis and inhibit tumorigenesis both in vitro and in vivo by simulating the spatial structure of ANP to inhibit competitively phosphorylation of c-Jun N-terminal kinase/extracellular signal-regulated kinase (JNK/Erk). PMID:26866274

RBP-J-Regulated miR-182 Promotes TNF-α-Induced Osteoclastogenesis.

PubMed

Miller, Christine H; Smith, Sinead M; Elguindy, Mahmoud; Zhang, Tuo; Xiang, Jenny Z; Hu, Xiaoyu; Ivashkiv, Lionel B; Zhao, Baohong

2016-06-15

Increased osteoclastogenesis is responsible for osteolysis, which is a severe consequence of inflammatory diseases associated with bone destruction, such as rheumatoid arthritis and periodontitis. The mechanisms that limit osteoclastogenesis under inflammatory conditions are largely unknown. We previously identified transcription factor RBP-J as a key negative regulator that restrains TNF-α-induced osteoclastogenesis and inflammatory bone resorption. In this study, we tested whether RBP-J suppresses inflammatory osteoclastogenesis by regulating the expression of microRNAs (miRNAs) important for this process. Using high-throughput sequencing of miRNAs, we obtained the first, to our knowledge, genome-wide profile of miRNA expression induced by TNF-α in mouse bone marrow-derived macrophages/osteoclast precursors during inflammatory osteoclastogenesis. Furthermore, we identified miR-182 as a novel miRNA that promotes inflammatory osteoclastogenesis driven by TNF-α and whose expression is suppressed by RBP-J. Downregulation of miR-182 dramatically suppressed the enhanced osteoclastogenesis program induced by TNF-α in RBP-J-deficient cells. Complementary loss- and gain-of-function approaches showed that miR-182 is a positive regulator of osteoclastogenic transcription factors NFATc1 and B lymphocyte-induced maturation protein-1. Moreover, we identified that direct miR-182 targets, Foxo3 and Maml1, play important inhibitory roles in TNF-α-mediated osteoclastogenesis. Thus, RBP-J-regulated miR-182 promotes TNF-α-induced osteoclastogenesis via inhibition of Foxo3 and Maml1. Suppression of miR-182 by RBP-J serves as an important mechanism that restrains TNF-α-induced osteoclastogenesis. Our results provide a novel miRNA-mediated mechanism by which RBP-J inhibits osteoclastogenesis and suggest that targeting of the newly described RBP-J-miR-182-Foxo3/Maml1 axis may represent an effective therapeutic approach to suppress inflammatory osteoclastogenesis and bone resorption. Copyright © 2016 by The American Association of Immunologists, Inc.

Mid-term results of the BIOLOX delta ceramic-on-ceramic total hip arthroplasty.

PubMed

Lee, Y K; Ha, Y C; Yoo, J-I; Jo, W L; Kim, K-C; Koo, K H

2017-06-01

We conducted a prospective study of a delta ceramic total hip arthroplasty (THA) to determine the rate of ceramic fracture, to characterise post-operative noise, and to evaluate the mid-term results and survivorship. Between March 2009 and March 2011, 274 patients (310 hips) underwent cementless THA using a delta ceramic femoral head and liner. At each follow-up, clinical and radiological outcomes were recorded. A Kaplan-Meier analysis was undertaken to estimate survival. Four patients (four hips) died and 18 patients (20 hips) were lost to follow-up within five years. The remaining 252 patients (286 hips) were followed for a mean of 66.5 months (60 to 84). There were 144 men (166 hips) and 108 women (120 hips) with a mean age of 49.7 years (16 to 83) at surgery. The mean pre-operative Harris Hip Score of 47.1 points improved to 93.8 points at final follow-up. Six patients reported squeaking in seven hips; however, none were audible. Radiolucent lines involving Gruen zones one and/or seven were seen in 52 hips (18.2%). No hip had detectable wear, focal osteolysis or signs of loosening. One hip was revised because of fracture of the ceramic liner, which occurred due to an undetected malseating of the ceramic liner at the time of surgery. One hip was revised for a periprosthetic fracture of the femur, and one hip was treated for periprosthetic joint infection. The six-year survivorship with re-operation for any reason as the endpoint was 99.0% (95% confidence interval 97.8% to 100%). The rate of delta ceramic fracture was 0.3% (one of 286). While ceramic head fracture was dominant in previous ceramic-on-ceramic THA, fracture of the delta ceramic liner due to malseating is a concern. Cite this article: Bone Joint J 2017;99-B:741-8. ©2017 The British Editorial Society of Bone & Joint Surgery.

Porous titanium particles for acetabular reconstruction in total hip replacement show extensive bony armoring after 15 weeks

PubMed Central

Walschot, Lucas H B; Aquarius, René; Verdonschot, Nico; Buma, Pieter

2014-01-01

Background and purpose — The bone impaction grafting technique restores bone defects in total hip replacement. Porous titanium particles (TiPs) are deformable, like bone particles, and offer better primary stability. We addressed the following questions in this animal study: are impacted TiPs osteoconductive under loaded conditions; do released micro-particles accelerate wear; and are systemic titanium blood levels elevated after implantation of TiPs? Animals and methods — An AAOS type-III defect was created in the right acetabulum of 10 goats weighing 63 (SD 6) kg, and reconstructed with calcium phosphate-coated TiPs and a cemented polyethylene cup. A stem with a cobalt chrome head was cemented in the femur. The goats were killed after 15 weeks. Blood samples were taken pre- and postoperatively. Results — The TiP-graft layer measured 5.6 (SD 0.8) mm with a mean bone ingrowth distance of 2.8 (SD 0.8) mm. Cement penetrated 0.9 (0.3–1.9) mm into the TiPs. 1 reconstruction showed minimal cement penetration (0.3 mm) and failed at the cement-TiP interface. There were no signs of accelerated wear, metallic particle debris, or osteolysis. Median systemic titanium concentrations increased on a log-linear scale from 0.5 (0.3–1.1) parts per billion (ppb) to 0.9 (0.5–2.8) ppb (p = 0.01). Interpretation — Adequate cement pressurization is advocated for impaction grafting with TiPs. After implantation, calcium phosphate-coated TiPs were osteoconductive under loaded conditions and caused an increase in systemic titanium concentrations. However, absolute levels remained low. There were no signs of accelerated wear. A clinical pilot study should be performed to prove that application in humans is safe in the long term. PMID:25238431

Clinical Biomechanics of Wear in Total Hip Arthroplasty

PubMed Central

Callaghan, John J; Pedersen, Douglas R; Johnston, Richard C; Brown, Thomas D

2003-01-01

Complementary clinical and laboratory studies were performed to identify variables associated with polyethylene wear following total hip replacement, and to elucidate the mechanisms responsible for accelerated wear in the total hip arthroplasty construct. Observational cohort studies were performed using a prospective clinical database of more than 4000 consecutive primary total hip arthroplasties performed by a single surgeon, to identify wear-related variables. These variables included head size, acetabular/femoral component impingement, and third body debris. Novel digital edge detection techniques were developed and employed to accurately measure wear, and to determine the relationships of head size and third body debris to acceleration of wear. A novel slidingdistance-coupled finite element model was formulated and employed to examine the mechanisms responsible for wear. The long-term cohort studies demonstrated smaller head sizes to be associated with less wear. Third body debris generated from cable fretting was associated with an increase in wear, osteolysis, and acetabular loosening, especially with larger head sizes. The sliding-distance-coupled finite element model replicated the wear rates occurring in vitro and in vivo, demonstrating the importance of sliding distance on polyethylene wear following total hip arthroplasty. It also demonstrated substantial increases in wear associated with femoral head scratching from third body debris. Further extension of the finite element formulation demonstrated the potential for acetabular component rim damage from impingement wear, and the enhanced potential for third body ingress to the bearing surface with larger head sizes. Edge detection wear measurement techniques demonstrated that early wear rates were predictive of long-term wear rates. These complementary clinical and laboratory investigations have provided insight into 1) the significance of sliding distance and physiologic loci of motion as contributing factors in minimizing wear, 2) the deleterious effects of third body particulates in accelerating wear, 3) the potential for, and factors related to, impingement wear, and 4) the potential advantages and compromises related to the use of larger head sizes in the bearing surface construct. PMID:14575243

An Osteoblast-Derived Proteinase Controls Tumor Cell Survival via TGF-beta Activation in the Bone Microenvironment

PubMed Central

Thiolloy, Sophie; Edwards, James R.; Fingleton, Barbara; Rifkin, Daniel B.; Matrisian, Lynn M.; Lynch, Conor C.

2012-01-01

Background Breast to bone metastases frequently induce a “vicious cycle” in which osteoclast mediated bone resorption and proteolysis results in the release of bone matrix sequestered factors that drive tumor growth. While osteoclasts express numerous proteinases, analysis of human breast to bone metastases unexpectedly revealed that bone forming osteoblasts were consistently positive for the proteinase, MMP-2. Given the role of MMP-2 in extracellular matrix degradation and growth factor/cytokine processing, we tested whether osteoblast derived MMP-2 contributed to the vicious cycle of tumor progression in the bone microenvironment. Methodology/Principal Findings To test our hypothesis, we utilized murine models of the osteolytic tumor-bone microenvironment in immunocompetent wild type and MMP-2 null mice. In longitudinal studies, we found that host MMP-2 significantly contributed to tumor progression in bone by protecting against apoptosis and promoting cancer cell survival (caspase-3; immunohistochemistry). Our data also indicate that host MMP-2 contributes to tumor induced osteolysis (μCT, histomorphometry). Further ex vivo/in vitro experiments with wild type and MMP-2 null osteoclast and osteoblast cultures identified that 1) the absence of MMP-2 did not have a deleterious effect on osteoclast function (cd11B isolation, osteoclast differentiation, transwell migration and dentin resorption assay); and 2) that osteoblast derived MMP-2 promoted tumor survival by regulating the bioavailability of TGFβ, a factor critical for cell-cell communication in the bone (ELISA, immunoblot assay, clonal and soft agar assays). Conclusion/Significance Collectively, these studies identify a novel “mini-vicious cycle” between the osteoblast and metastatic cancer cells that is key for initial tumor survival in the bone microenvironment. In conclusion, the findings of our study suggest that the targeted inhibition of MMP-2 and/or TGFβ would be beneficial for the treatment of bone metastases. PMID:22238668

A Multicenter Approach Evaluating the Impact of Vitamin E-Blended Polyethylene in Cementless Total Hip Replacement

PubMed Central

Jäger, Marcus; van Wasen, Andrea; Warwas, Sebastian; Landgraeber, Stefan; Haversath, Marcel; Group, VITAS

2014-01-01

Since polyethylene is one of the most frequently used biomaterials as a liner in total hip arthroplasty, strong efforts have been made to improve design and material properties over the last 50 years. Antioxidants seems to be a promising alternative to further increase durability and reduce polyethylene wear in long term. As of yet, only in vitro results are available. While they are promising, there is yet no clinical evidence that the new material shows these advantages in vivo. To answer the question if vitamin-E enhanced ultra-high molecular weight polyethylene (UHMWPE) is able to improve long-term survivorship of cementless total hip arthroplasty we initiated a randomized long-term multicenter trial. Designed as a superiority study, the oxidation index assessed in retrieval analyses of explanted liners was chosen as primary parameter. Radiographic results (wear rate, osteolysis, radiolucency) and functional outcome (Harris Hip Scores, University of California-Los Angeles, Hip Disability and Osteoarthritis Outcome Score, Visual Analogue Scale) will serve as secondary parameters. Patients with the indication for a cementless total hip arthroplasty will be asked to participate in the study and will be randomized to either receive a standard hip replacement with a highly cross-linked UHMWPE-X liner or a highly cross-linked vitamin-E supplemented UHMWPE-XE liner. The follow-up will be 15 years, with evaluation after 5, 10 and 15 years. The controlled randomized study has been designed to determine if Vitamin-E supplemented highly cross-linked polyethylene liners are superior to standard XLPE liners in cementless total hip arthroplasty. While several studies have been started to evaluate the influence of vitamin-E, most of them evaluate wear rates and functional results. The approach used for this multicenter study, to analyze the oxidation status of retrieved implants, should make it possible to directly evaluate the ageing process and development of the implant material itself over a time period of 15 years. PMID:25002933

The use of an Ossis custom 3D-printed tri-flanged acetabular implant for major bone loss: minimum 2-year follow-up: Short title: Ossis custom 3D-Printed tri-flanged acetabular implant.

PubMed

Kieser, David C; Ailabouni, Ramez; Kieser, Sandra C J; Wyatt, Michael C; Armour, Paul C; Coates, Mark H; Hooper, Gary J

2018-05-01

Custom 3D-printed acetabular implants are a new technology used in hip surgery with ever-increasing frequency. They offer patient-specific implants to optimise filling of bone defects and implant-bone contact, without the need for excessive bone resection. This is a retrospective cohort study of 46 consecutive patients who underwent an Ossis unilateral custom 3D-printed acetabular implant. Clinical (Oxford Hip Score OHS-60), Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), Harris Hip Score (HHS) and radiological (restoration of biomechanical hip centre, osteointegration, wear, heterotrophic ossification) results were assessed. Patient mean age was 68 years and follow-up was 38 months (minimum 24 months). 10 patients were excluded from the outcome analysis; 2 patients died, 1 required revision for deep infection and 7 were lost to follow-up. Of the 36 patients included, 21 had severe osteolysis. 7 were revised for infection, 3 for tumoural defects, 3 for metallosis, 1 for dysplasia and 1 for trauma (Paprosky 2a [n=6], 2b [n=2], 2c [n=5], 3a [n=6], 3b [n=11], pelvic dissociation [n=6]). OHS significantly improved postoperatively (16-8-48.4 p=0.027). Postoperative functional scores were good (WOMAC 98; HHS 79). The biomechanical hip centre was restored in all patients. 1 patient had early implant migration with subsequent stabilisation. 2 patients had radiographs concerning for failure of osteointegration. 1 patient had recurrent dislocations. The mid-term results of the Ossis custom 3D-printed tri-flanged acetabular implant for the management of severe acetabular defects are encouraging. The improvement in functional scores and radiographic outcomes are comparable to similar designs. In addition, no cases have required revision for aseptic loosening.

In vitro Reactivity to Implant Metals Demonstrates a Person Dependent Association with both T-Cell and B-Cell Activation

PubMed Central

Hallab, Nadim James; Caicedo, Marco; Epstein, Rachael; McAllister, Kyron; Jacobs, Joshua J

2009-01-01

Hypersensitivity to metallic implants remains relatively unpredictable and poorly understood. We initially hypothesized that metal-induced lymphocyte proliferation responses to soluble metal challenge (ions) are mediated exclusively by early T-cell activation (not B-cells), typical of a Delayed-Type-Hypersensitivity response. We tested this by comparing proliferation (6-days) of primary lymphocytes with early T-cell and B-cell activation (48-hours) in three groups of subjects likely to demonstrate elevated metal-reactivity: Group 1(n=12) history of metal-sensitivity with no implant; Group 2a(n=6) well performing metal-on-metal THRs, and Group 2b(n=20) subjects with poorly performing metal-on-polymer total joint arthroplasties (TJA). Group 1 showed 100%(12/12) metal reactivity (Stimulation Index>2) to Ni. Group 2a&2b were 83%(5/6) and 75%(15/22) metal reactive (to Co, Cr or Ni) respectively. Of the n=32 metal reactive subjects to Co, Cr or Ni (SI>2), n=22/32 demonstrated >2-fold elevations in % of T-cell or B-cell activation (CD25+,CD69+) to metal challenge compared to untreated control. 18/22 metal-activated subjects demonstrated an exclusively T-cell or B-cell activation response to metal challenge, where 6/18 demonstrated exclusively B-cell activation and 12/18 demonstrated a T-cell only response, as measured by surface activation markers CD25+ and CD69+. However, there was no direct correlation (R2<0.1) between lymphocyte proliferation and % T-cell or B-cell activation (CD25+:CD69+). Proliferation assays (LTT) showed greater ability to detect metal reactivity than did subject-dependent results of flow-cytometry analysis of T-cell or B-cell activation. The high incidence of lymphocyte reactivity and activation, indicate that more complex than initially hypothesized immune responses may contribute to the etiology of debris induced osteolysis in metal-sensitive individuals. PMID:19235773

Prognostic factors for bacterial cultures positive for Propionibacterium acnes and other organisms in a large series of revision shoulder arthroplasties performed for stiffness, pain, or loosening.

PubMed

Pottinger, Paul; Butler-Wu, Susan; Neradilek, Moni Blazej; Merritt, Andrew; Bertelsen, Alexander; Jette, Jocelyn L; Warme, Winston J; Matsen, Frederick A

2012-11-21

Propionibacterium acnes has been grown on culture in half of the reported cases of chronic infection associated with shoulder arthroplasty. The presence of this organism can be overlooked because its subtle presentation may not suggest the need for culture or because, in contrast to many orthopaedic infections, multiple tissue samples and weeks of culture incubation are often necessary to recover this organism. Surgical decisions regarding implant revision and antibiotic therapy must be made before the results of intraoperative cultures are known. In the present study, we sought clinically relevant prognostic evidence that could help to guide treatment decisions. We statistically correlated preoperative and intraoperative observations on 193 shoulder arthroplasty revisions that were performed because of pain, loosening, or stiffness with the results of a Propionibacterium acnes-specific culture protocol. Regression models were used to identify factors predictive of a positive culture for Propionibacterium acnes. One hundred and eight of the 193 revision arthroplasties were associated with positive cultures; 70% of the positive cultures demonstrated growth of Propionibacterium acnes. The rate of positive cultures per shoulder increased with the number of culture specimens obtained from each shoulder. Fifty-five percent of the positive cultures required observation for more than one week. Male sex, humeral osteolysis, and cloudy fluid were each associated with significant increases of ≥ 600% in the likelihood of obtaining a positive Propionibacterium acnes culture. Humeral loosening, glenoid wear, and membrane formation were associated with significant increases of >300% in the likelihood of obtaining a positive Propionibacterium acnes culture. Preoperative and intraoperative factors can be used to help to predict the risk of a positive culture for Propionibacterium acnes. This evidence is clinically relevant to decisions regarding prosthesis removal or retention and the need for immediate antibiotic therapy at the time of revision shoulder arthroplasty before the culture results become available. Prognostic Level II. See Instructions for Authors for a complete description of levels of evidence.

[Naringin reduced polymethylmethacrylate-induced osteolysis in the mouse air sacs model].

PubMed

Li, Nian-Hu; Xu, Zhan-wang

2015-04-01

To evaluate the influence of naringin on PMMA-induced osteoclastic bone resorption using the mouse air sacs model. Total 48 female Balb/c mices with the age of 8 to 10 weeks were chosen in the study. Air were injected into the back in 32 mices and formed the air sacs, 6 d later, the skulls (originated from other 16 mices) were implanted to the air sacs. Thirty-two animals were divided into naringin treatment group (with 2 concentrations of 150 mg/kg and 30 mg/ kg) , DMSO group and PBS blank group, 8 animals in each group. Polymethylmethacrylate (PMMA) particles were injected into the air sacs in naringin treatment groups and DMSO group so as to irritate inflammatory reaction. Naringin with 2 concentrations of 150 mg/kg and 30 mg/kg were dissolved in DMSO of 0.2 ml, and were injected into air sacs, respectively. In PBS black group, no stimulation with PMMA particles, only injected PBS, and in DMSO group, injected DMSO without naringin. Tartrate resistant acid phosphatase (TRAP), Ca2+ release, modified Masson stain and histological analysis were performed on the 7th day after stimulation. Compared with DMSO group, naringin treatment group's cellular infiltration decreased (P < 0.01); concentration of 150 mg/kg was better than that of concentrations of 30 mg/kg (8.90 ± 1.75 vs 15.23 ± 1.86). Naringin can decrease calcium release in the lavage of the air sacs bone resorption model, especially obvious in naringin with concentration of 150 mg/kg. Naringin can ameliorate the inflammatory reaction and the subsequent bone resorption (including bone collagen loss, TRAP positive cells amount and so on) in air sacs with bone implant and PMMA particles. Naringin with concentration of 150 mg/kg appeared to be an optimal dosage to deliver the therapeutic effects. Naringin inhibits PMMA-induced osteoclastogenesis and ameliorates the PMMA-associated inflammatory reaction and the subsequent bone resorption.

Inconsistency in the Reporting of Adverse Events in Total Ankle Arthroplasty: A Systematic Review of the Literature.

PubMed

Mercer, Jeff; Penner, Murray; Wing, Kevin; Younger, Alastair S E

2016-02-01

Systems for classifying complications have been proposed for many surgical subspecialties. The goal of this systematic review was to analyze the number and frequency of different terms used to identify complications in total ankle arthroplasty. We hypothesized that this terminology would be highly variable, supporting a need for a standardized system of reporting. Studies that met predefined inclusion/exclusion criteria were analyzed to identify terminology used to describe adverse events. All terms were then tabulated and quantified with regard to diversity and frequency of use across all included studies. Terms were also grouped into 10 categories, and the number of reported occurrences of each adverse event was calculated. A reporting tool was then developed. Of 572 unique terms used to describe adverse outcomes in 117 studies, 55.9% (320/572) were used in only a single study. The category that was most frequently reported was revision surgery, with 86% of papers reporting on this event using 115 different terms. Other categories included "additional non-revision surgeries" (74% of papers, 93 terms), "loosening/osteolysis" (63% of papers, 86 terms), "fractures" (60% of papers, 53 terms), "wound problems" (52% of papers, 27 terms), "infection" (52% of papers, 27 terms), "implant problems" (50% of papers, 57 terms), "soft tissue injuries" (31% of papers, 30 terms), "heterotopic ossification" (22% of papers, 17 terms), and "pain" (18% of papers, 11 terms). The reporting of complications and adverse outcomes for total ankle arthroplasty was highly variable. This lack of consistency impedes the accurate reporting and interpretation of data required for the development of cohesive, evidence-based treatment guidelines for end-stage ankle arthritis. Standardized reporting tools are urgently needed. This study presents a prototype worksheet for the standardized assessment and reporting of adverse events. Level-III, decision analyses, systematic review of Level III studies and above. © The Author(s) 2015.

Effect of acetabular cup abduction angle on wear of ultrahigh-molecular-weight polyethylene in hip simulator testing.

PubMed

Korduba, Laryssa A; Essner, Aaron; Pivec, Robert; Lancin, Perry; Mont, Michael A; Wang, Aiguo; Delanois, Ronald E

2014-10-01

The effect of acetabular component positioning on the wear rates of metal-on-polyethylene articulations has not been extensively studied. Placement of acetabular cups at abduction angles of more than 40° has been noted as a possible reason for early failure caused by increased wear. We conducted a study to evaluate the effects of different acetabular cup abduction angles on polyethylene wear rate, wear area, contact pressure, and contact area. Our in vitro study used a hip joint simulator and finite element analysis to assess the effects of cup orientation at 4 angles (0°, 40°, 50°, 70°) on wear and contact properties. Polyethylene bearings with 28-mm cobalt-chrome femoral heads were cycled in an environment mimicking in vivo joint fluid to determine the volumetric wear rate after 10 million cycles. Contact pressure and contact area for each cup abduction angle were assessed using finite element analysis. Results were correlated with cup abduction angles to determine if there were any differences among the 4 groups. The inverse relationship between volumetric wear rate and acetabular cup inclination angle demonstrated less wear with steeper cup angles. The largest abduction angle (70°) had the lowest contact area, largest contact pressure, and smallest head coverage. Conversely, the smallest abduction angle (0°) had the most wear and most head coverage. Polyethylene wear after total hip arthroplasty is a major cause of osteolysis and aseptic loosening, which may lead to premature implant failure. Several studies have found that high wear rates for cups oriented at steep angles contributed to their failure. Our data demonstrated that larger cup abduction angles were associated with lower, not higher, wear. However, this potentially "protective" effect is likely counteracted by other complications of steep cup angles, including impingement, instability, and edge loading. These factors may be more relevant in explaining why implants fail at a higher rate if cups are oriented at more than 40° of abduction.

Three-Dimensional Characterization of the Vascular Bed in Bone Metastasis of the Rat by Microcomputed Tomography (MicroCT)

PubMed Central

Nyangoga, Hervé; Mercier, Philippe; Libouban, Hélène; Baslé, Michel Félix; Chappard, Daniel

2011-01-01

Background Angiogenesis contributes to proliferation and metastatic dissemination of cancer cells. Anatomy of blood vessels in tumors has been characterized with 2D techniques (histology or angiography). They are not fully representative of the trajectories of vessels throughout the tissues and are not adapted to analyze changes occurring inside the bone marrow cavities. Methodology/Principal Findings We have characterized the vasculature of bone metastases in 3D at different times of evolution of the disease. Metastases were induced in the femur of Wistar rats by a local injection of Walker 256/B cells. Microfil®, (a silicone-based polymer) was injected at euthanasia in the aorta 12, 19 and 26 days after injection of tumor cells. Undecalcified bones (containing the radio opaque vascular casts) were analyzed by microCT, and a first 3D model was reconstructed. Bones were then decalcified and reanalyzed by microCT; a second model (comprising only the vessels) was obtained and overimposed on the former, thus providing a clear visualization of vessel trajectories in the invaded metaphysic allowing quantitative evaluation of the vascular volume and vessel diameter. Histological analysis of the marrow was possible on the decalcified specimens. Walker 256/B cells induced a marked osteolysis with cortical perforations. The metaphysis of invaded bones became progressively hypervascular. New vessels replaced the major central medullar artery coming from the diaphyseal shaft. They sprouted from the periosteum and extended into the metastatic area. The newly formed vessels were irregular in diameter, tortuous with a disorganized architecture. A quantitative analysis of vascular volume indicated that neoangiogenesis increased with the development of the tumor with the appearance of vessels with a larger diameter. Conclusion This new method evidenced the tumor angiogenesis in 3D at different development times of the metastasis growth. Bone and the vascular bed can be identified by a double reconstruction and allowed a quantitative evaluation of angiogenesis upon time. PMID:21464932

Transarticular fixation by hook plate versus coracoclavicular stabilization by single multistrand titanium cable for acute Rockwood grade-V acromioclavicular joint dislocation: a case-control study.

PubMed

Gao, You-Shui; Zhang, Yue-Lei; Ai, Zi-Sheng; Sun, Yu-Qiang; Zhang, Chang-Qing; Zhang, Wei

2015-11-19

Hook plate (HP) is popularly used for acute and severely displaced acromioclavicular (AC) dislocations. However, subacromial impingement and acromion osteolysis induced by transarticular fixation are notorious. The current case-control study was to compare transarticular fixation by HP to coracoclavicular (CC) stabilization by single multistrand titanium cable (MSTC). Between January 2006 and August 2009, 24 patients with acute AC dislocations were surgically treated by open reduction and transarticular fixation with HP. These patients were matched to a series of 24 patients, who were managed by CC stabilization with MSTC in the same period. All AC dislocations were graded as Rockwood type V. Implant was removed 8-12 months after the primary operation in all patients, and 12 months at least were needed to assess the maintenance of AC joint. Functional results were evaluated before implant removal as well as in the last follow-up based on Constant-Murley criteria. There were no differences of demographic data including age, dominant gender and side, injury-to-surgery interval, operation time and follow-up period. In terms of functionality, Constant score was 95.8 ± 4.1 in MSTC group, while 76.7 ± 8.0 in HP group before implant removal (P < 0.001). In detail, MSTC was superior to HP in pain, ROM and activities. Constant score was significantly improved to 86.1 ± 5.7 after hardware removal for patients in HP (P < 0.001). Degenerative change of acromioclavicular joint presented in 16 patients (66.7%) in patients treated by HP, while it was found in only 3 patients (12.5%) treated by MSTC (P < 0.001). MSTC is superior to HP for the treatment of Rockwood type-V acromioclavicular dislocation both before and after removal of the implant. Hardware removal is of great benefits for functional improvement in patients treated by HP.

Truncating mutations in the last exon of NOTCH3 cause lateral meningocele syndrome.

PubMed

Gripp, Karen W; Robbins, Katherine M; Sobreira, Nara L; Witmer, P Dane; Bird, Lynne M; Avela, Kristiina; Makitie, Outi; Alves, Daniela; Hogue, Jacob S; Zackai, Elaine H; Doheny, Kimberly F; Stabley, Deborah L; Sol-Church, Katia

2015-02-01

Lateral meningocele syndrome (LMS, OMIM%130720), also known as Lehman syndrome, is a very rare skeletal disorder with facial anomalies, hypotonia and meningocele-related neurologic dysfunction. The characteristic lateral meningoceles represent the severe end of the dural ectasia spectrum and are typically most severe in the lower spine. Facial features of LMS include hypertelorism and telecanthus, high arched eyebrows, ptosis, midfacial hypoplasia, micrognathia, high and narrow palate, low-set ears and a hypotonic appearance. Hyperextensibility, hernias and scoliosis reflect a connective tissue abnormality, and aortic dilation, a high-pitched nasal voice, wormian bones and osteolysis may be present. Lateral meningocele syndrome has phenotypic overlap with Hajdu-Cheney syndrome. We performed exome resequencing in five unrelated individuals with LMS and identified heterozygous truncating NOTCH3 mutations. In an additional unrelated individual Sanger sequencing revealed a deleterious variant in the same exon 33. In total, five novel de novo NOTCH3 mutations were identified in six unrelated patients. One had a 26 bp deletion (c.6461_6486del, p.G2154fsTer78), two carried the same single base pair insertion (c.6692_93insC, p.P2231fsTer11), and three individuals had a nonsense point mutation at c.6247A > T (pK2083*), c.6663C > G (p.Y2221*) or c.6732C > A, (p.Y2244*). All mutations cluster into the last coding exon, resulting in premature termination of the protein and truncation of the negative regulatory proline-glutamate-serine-threonine rich PEST domain. Our results suggest that mutant mRNA products escape nonsense mediated decay. The truncated NOTCH3 may cause gain-of-function through decreased clearance of the active intracellular product, resembling NOTCH2 mutations in the clinically related Hajdu-Cheney syndrome and contrasting the NOTCH3 missense mutations causing CADASIL. © 2014 Wiley Periodicals, Inc.

Epigenetic regulation of HGF/Met receptor axis is critical for the outgrowth of bone metastasis from breast carcinoma.

PubMed

Bendinelli, Paola; Maroni, Paola; Matteucci, Emanuela; Desiderio, Maria Alfonsina

2017-02-02

Our translational research deals with the influence of microenvironment on the phenotype and colonization of bone metastases from breast carcinoma, and on pre-metastatic niche formation. The aim of the present study was to clarify the origin of hepatocyte growth factor (HGF), ligand of Met receptor, the control of the axis HGF/Met by DNA methylation, and its importance for the nexus supportive cells-metastatic cells and for metastasis outgrowth. In bone metastasis of the 1833-xenograft model, DNA methyltransferase blockade using the chemotherapic drug 5-aza-2'-deoxycytidine (decitabine) strongly reduced the expression of HGF/Met receptor axis and of E-cadherin, with decrease of metastasis wideness and osteolysis, prolonging mice survival. Thus, DNA methylation events acted as commanders of breast carcinoma cells metastatizing to bone influencing the epithelial phenotype. HGF emerged as a bone-marrow stimulus, and the exosomes seemed to furnish HGF to metastatic cells. In fact, decitabine treatment similarly affected some markers of these microvesicles and HGF, indicating that its supply to recipient cells was prevented. Notably, in bone metastasis the hypomethylation of HGF, Met and E-cadherin promoters did not appear responsible for their elevated expression, but we suggest the involvement of hypermethylated regulators and of Wwox oncosuppressor, the latter being affected by decitabine. Wwox expression increased under decitabine strongly localizing in nuclei of bone metastases. We hypothesize a role of Wwox in Met activity since in vitro Wwox overexpression downregulated the level of nuclear-Met protein fragment and Met stability, also under long exposure of 1833 cells to decitabine. HGF enhanced phosphoMet and the activity in nuclei, an effect partially prevented by decitabine. Altogether, the data indicated the importance to target the tumor microenvironment by blocking epigenetic mechanisms, which control critical events for colonization such as HGF/Met axis and Wwox, as therapy of bone metastasis.

Juvenile Paget’s Disease With Heterozygous Duplication In TNFRSF11A Encoding RANK

PubMed Central

Whyte, Michael P.; Tau, Cristina; McAlister, William H.; Zhang, Xiafang; Novack, Deborah V.; Preliasco, Virginia; Santini-Araujo, Eduardo; Mumm, Steven

2014-01-01

Mendelian disorders of RANKL/OPG/RANK signaling feature the extremes of aberrant osteoclastogenesis and cause either osteopetrosis or rapid turnover skeletal disease. The patients with autosomal dominant accelerated bone remodeling have familial expansile osteolysis, early-onset Paget’s disease of bone, expansile skeletal hyperphosphatasia, or panostotic expansile bone disease due to heterozygous 18-, 27-, 15-, and 12-bp insertional duplications, respectively, within exon 1 of TNFRSF11A that encodes the signal peptide of RANK. Juvenile Paget’s disease (JPD), an autosomal recessive disorder, manifests extremely fast skeletal remodeling, and is usually caused by loss-of-function mutations within TNFRSF11B that encodes OPG. These disorders are ultra-rare. A 13-year-old Bolivian girl was referred at age 3 years. One femur was congenitally short and curved. Then, both bowed. Deafness at age 2 years involved missing ossicles and eroded cochleas. Teeth often had absorbed roots, broke, and were lost. Radiographs had revealed acquired tubular bone widening, cortical thickening, and coarse trabeculation. Biochemical markers indicated rapid skeletal turnover. Histopathology showed accelerated remodeling with abundant osteoclasts. JPD was diagnosed. Immobilization from a femur fracture caused severe hypercalcemia that responded rapidly to pamidronate treatment followed by bone turnover marker and radiographic improvement. No TNFRSF11B mutation was found. Instead, a unique heterozygous 15-bp insertional tandem duplication (87dup15) within exon 1 of TNFRSF11A predicted the same pentapeptide extension of RANK that causes expansile skeletal hyperphosphatasia (84dup15). Single nucleotide polymorphisms in TNFRSF11A and TNFRSF11B possibly impacted her phenotype. Our findings: i) reveal that JPD can be associated with an activating mutation within TNFRSF11A, ii) expand the range and overlap of phenotypes among the mendelian disorders of RANK activation, and iii) call for mutation analysis to improve diagnosis, prognostication, recurrence risk assessment, and perhaps treatment selection among the monogenic disorders of RANKL/OPG/RANK activation. PMID:25063546

Bone formation transcripts dominate the differential gene expression profile in an equine osteoporotic condition associated with pulmonary silicosis.

PubMed

Zavodovskaya, Regina; Stover, Susan M; Murphy, Brian G; Katzman, Scott; Durbin-Johnson, Blythe; Britton, Monica; Finno, Carrie J

2018-01-01

Osteoporosis has been associated with pulmonary silicosis in California horses exposed to soils rich in cytotoxic silica dioxide crystals, a syndrome termed silicate associated osteoporosis (SAO). The causal mechanism for the development of osteoporosis is unknown. Osteoporotic lesions are primarily located in bone marrow-rich sites such as ribs, scapula and pelvis. Gene transcription patterns within bone marrow and pulmonary lymph nodes of affected horses may offer clues to disease pathobiology. Bone marrow core and tracheobronchial lymph node tissue samples harvested postmortem from affected and unaffected horses were examined histologically and subjected to RNA sequencing (RNA-seq). Sequenced data were analyzed for differential gene expression and gene ontology. Metatranscriptomic and metagenomic assays evaluated samples for infectious agents. Thirteen of 17 differentially expressed transcripts in bone marrow were linked to bone and cartilage formation such as integrin binding bone sialoprotein (log2FC = 3.39, PFDR = 0.013) and chondroadherin (log2FC = 4.48, PFDR = 0.031). Equus caballus solute carrier family 9, subfamily A2 (log2FC = 3.77, PFDR = 0.0034) was one of the four differentially expressed transcripts linked to osteoclast activity. Osteoblasts were hyperplastic and hypertrophic in bone marrow from affected horses. Biological pathways associated with skeletal morphogenesis were significantly enriched in affected horses. The 30 differentially expressed genes in affected lymph nodes were associated with inflammatory responses. Evidence of infectious agents was not found. The SAO affected bone marrow molecular signature demonstrated increased transcription and heightened activation of osteoblasts. Increased osteoblastic activity could be part of the pathological mechanism for osteoporosis or a compensatory response to the accelerated osteolysis. Transcriptome data offer gene targets for inquiries into the role of osteocytes and osteoblasts in SAO pathogenesis. Viral or bacterial infectious etiology in SAO is less likely based on metatranscriptomic and metagenomic data but cannot be completely ruled out.

Clinical Application of Cone Beam Computed Tomography of the Rabbit Head: Part 2—Dental Disease

PubMed Central

Riggs, G. G.; Cissell, Derek D.; Arzi, Boaz; Hatcher, David C.; Kass, Philip H.; Zhen, Amy; Verstraete, Frank J. M.

2017-01-01

Domestic rabbits are increasing in popularity as household pets; therefore, veterinarians need to be familiar with the most common diseases afflicting rabbits including dental disease. Current diagnostic approaches include gross oral examination, endoscopic oral examination, skull radiography, and computed tomography (CT). Cone beam computed tomography (CBCT), a new oral and maxillofacial imaging modality that has the capability to produce high-resolution images, has not yet been described for use in evaluating dental disease in rabbits. A total of 15 client-owned rabbits had CBCT, oral examination, dental charting, and dental treatment performed under general anesthesia. Images were evaluated using transverse and custom multiplanar (MPR), 3D, and panoramic reconstructed images. The CBCT findings were grouped into abnormalities that could be detected on conscious oral examination vs. abnormalities that could not be detected by conscious oral examination. Potential associations between the two categories were examined by pairwise Fisher’s exact test with statistical significance determined by P < 0.05. The most common findings identified on CBCT images were periodontal ligament space widening (14/15), premolar and molar malocclusion (13/15), apical elongation (13/15), coronal elongation (12/15), inflammatory tooth resorption (12/15), periapical lucency (11/15), moth-eaten pattern of osteolysis of the alveolar bone (9/15), ventral mandibular border contour changes (9/15), and missing teeth (8/15). Of the CBCT abnormalities likely to be observed on oral examination, coronal elongation (detectable on oral examination) was significantly associated with apical elongation (P = 0.029). There were no other significant associations between CBCT findings that are also clinically detectable and CBCT findings that are not be detectable on oral examination. This suggests that pathology often exists that is not apparent upon oral examination. This study establishes the common CBCT findings associated with dental disease in rabbits and demonstrates the feasibility of this technology to diagnose and plan treatment in dental disorders in this species. PMID:28194401

[CORRECTION OF VARUS KNEE WITH REDUCTION OSTEOTOMY DURING TOTAL KNEE ARTHROPLASTY].

PubMed

Su, Weiping; Xie, Jie; Li, Mingqing; Zeng, Min; Lei, Pengfei; Wang, Long; Hu, Yihe

2015-12-01

To evaluate the effectiveness of reduction osteotomy for correction of varus knee during total knee arthroplasty. A retrospective analysis was made on the clinical data of 16 patients (24 knees) who received reduction osteotomy for correcting varus knee during total knee arthroplasty between May 2010 and July 2012. There were 2 males (3 knees) and 14 females (21 knees), with an average age of 67 years (range, 57-79 years). The disease duration ranged from 3 to 15 years (mean, 9.1 years). The Knee Society Score (KSS) was 38.71 ± 10.04 for clinical score and 50.31 ± 14.31 for functional score. The range of motion (ROM) of the knee was (91.88 ± 13.01). The tibiofemoral angle was (9.04 ± 4.53)° of varus deformity. Reduction osteotomy was applied to correct varus knee. The operation time was 85-245 minutes (mean, 165.5 minutes); the obvious blood loss was 10-800 mL (mean, 183.1 mL); the hospitalization time was 8-22 days (mean, 13.6 days). All incisions healed by first intention. No neurovascular injury or patellar fracture occurred. The follow-up duration ranged from 37 to 62 months (mean, 48 months). The tibiofemoral angle was corrected to (3.92 ± 1.89)° of valgus at 48 hours after operation. The lower limb alignment recovered to normal. The X-ray films showed no evidence of obvious radiolucent line, osteolysis, or prosthesis subsidence. The results of KSS were significantly improved to 84.21 ± 6.49 for clinical score and 85.31 ± 6.95 for functional score (t = 20.665, P = 0.000; t = 9.585, P = 0.000); and ROM of the knee was significantly increased to (105.83 ± 11.29)° (t = 8.333, P = 0.000) at last follow-up. The effectiveness of reduction osteotomy for varus knee deformity during total knee arthroplasty is satisfactory. Proper alignment, ROM, and function of knee can be achieved.

Modulating macrophage response to biomaterials

NASA Astrophysics Data System (ADS)

Zaveri, Toral

Macrophages recruited to the site of biomaterial implantation are the primary mediators of the chronic foreign body response to implanted materials. Since foreign body response limits performance and functional life of numerous implanted biomaterials/medical devices, various approaches have been investigated to modulate macrophage interactions with biomaterial surfaces to mitigate this response. In this work we have explored two independent approaches to modulate the macrophage inflammatory response to biomaterials. The first approach targets surface integrins, cell surface receptors that mediate cell adhesion to biomaterials through adhesive proteins spontaneously adsorbed on biomaterial surfaces. The second approach involves surface modification of biomaterials using nanotopographic features since nanotopography has been reported to modulate cell adhesion and viability in a cell type-dependent manner. More specifically, Zinc Oxide (ZnO) nanorod surface was investigated for its role in modulating macrophage adhesion and survival in vitro and foreign body response in vivo. For the first approach, we have investigated the role of integrin Mac-1 and RGD-binding integrins in the in-vivo osteolysis response and macrophage inflammatory processes of phagocytosis as well as inflammatory cytokine secretion in response to particulate biomaterials. We have also investigated the in vivo foreign body response (FBR) to subcutaneously implanted biomaterials by evaluating the thickness of fibrous capsule formed around the implants after 2 weeks of implantation. The role of Mac-1 integrin was isolated using a Mac-1 KO mouse and comparing it to a WT control. The role of RGD binding integrins in FBR was investigated by coating the implanted biomaterial with ELVAX(TM) polymer loaded with Echistatin which contains the RGD sequence. For the in-vivo osteolysis study and to study the in-vitro macrophage response to particulate biomaterials, we used the RGD peptide encapsulated in ELVAX(TM) and dissolved in macrophage media respectively. By studying the phagocytosis, inflammatory and FBR of macrophages from integrin knockout mice, as well as using various integrin blocking techniques we aim to identify the role of various integrins in macrophage inflammatory response. These integrins can serve as therapeutic targets for mitigating this inflammatory response and improve functional life of implanted biomaterials. Zinc oxide (ZnO) has been investigated in a number of biomedical applications and surfaces presenting well-controlled nanorod structures of ZnO have recently been developed. In order to investigate the influence of nanotopography on macrophage adhesive response, we evaluated macrophage adhesion and viability on ZnO nanorods, compared to a relatively flat sputtered ZnO controls and using glass substrates for reference. We found that although macrophages are capable of initially adhering to and spreading on ZnO nanorod substrates, the number of adherent macrophages on ZnO nanorods was reduced compared to ZnO flat substrate and glass. While these data suggest nanotopography may modulate macrophage adhesion, reduced cell viability on both sputtered and nanorod ZnO substrate indicates appreciable toxicity associated with ZnO. In order to determine long-term physiological responses, ZnO nanorodcoated and sputtered ZnO-coated polyethylene terephthalate (PET) discs were implanted subcutaneously in mice for 14 days. Upon implantation, both ZnO-coated discs resulted in a discontinuous cellular fibrous capsule indicative of unresolved inflammation, in contrast to uncoated PET discs, which resulted in typical foreign body capsule formation. Hence although ZnO substrates presenting nanorod topography have previously been shown to modulate cellular adhesion in a topography-dependent fashion for specific cell types, this work demonstrates that for primary murine macrophages, cell adhesion and viability correlate to both nanotopography and toxicity of dissolved Zn, parameters which are likely interdependent. Considering the toxicity of ZnO nanorod surface towards macrophages, their role as an antibacterial surface was explored. Antibacterial coating approaches are being investigated to modify implants to reduce bacterial adhesion and viability in order to reduce implant-associated infection. To assess the efficacy of ZnO nanorod surfaces as an anti-bacterial coating, we evaluated bacterial adhesion and viability, compared to sputtered ZnO and glass substrates. Common implant-associated pathogens, Pseudomonas aeruginosa and Staphylococcus epidermidis were investigated. ZnO nanorod surface and sputtered ZnO demonstrated a significant bactericidal effect, killing respectively 2.5x and 1.7x times the number of bacteria dead on glass. A similar bactericidal effect of ZnO substrates on S. epidermidis was also evident, with sputtered ZnO and ZnO nanorod substrates killing respectively 22x and 32x times bacteria dead on glass. These data support the further investigation of ZnO nanorod coatings for bacterial adhesion resistance and bactericidal properties.

Dual mobility hip arthroplasty wear measurement: Experimental accuracy assessment using radiostereometric analysis (RSA).

PubMed

Pineau, V; Lebel, B; Gouzy, S; Dutheil, J-J; Vielpeau, C

2010-10-01

The use of dual mobility cups is an effective method to prevent dislocations. However, the specific design of these implants can raise the suspicion of increased wear and subsequent periprosthetic osteolysis. Using radiostereometric analysis (RSA), migration of the femoral head inside the cup of a dual mobility implant can be defined to apprehend polyethylene wear rate. The study aimed to establish the precision of RSA measurement of femoral head migration in the cup of a dual mobility implant, and its intra- and interobserver variability. A total hip prosthesis phantom was implanted and placed under weight loading conditions in a simulator. Model-based RSA measurement of implant penetration involved specially machined polyethylene liners with increasing concentric wear (no wear, then 0.25, 0.5 and 0.75mm). Three examiners, blinded to the level of wear, analyzed (10 times) the radiostereometric films of the four liners. There was one experienced, one trained, and one inexperienced examiner. Statistical analysis measured the accuracy, precision, and intra- and interobserver variability by calculating Root Mean Square Error (RMSE), Concordance Correlation Coefficient (CCC), Intra Class correlation Coefficient (ICC), and Bland-Altman plots. Our protocol, that used a simple geometric model rather than the manufacturer's CAD files, showed precision of 0.072mm and accuracy of 0.034mm, comparable with machining tolerances with low variability. Correlation between wear measurement and true value was excellent with a CCC of 0.9772. Intraobserver reproducibility was very good with an ICC of 0.9856, 0.9883 and 0.9842, respectively for examiners 1, 2 and 3. Interobserver reproducibility was excellent with a CCC of 0.9818 between examiners 2 and 1, and 0.9713 between examiners 3 and 1. Quantification of wear is indispensable for the surveillance of dual mobility implants. This in vitro study validates our measurement method. Our results, and comparison with other studies using different measurement technologies (RSA, standard radiographs, Martell method) make model-based RSA the reference method for measuring the wear of total hip prostheses in vivo. Level 3. Prospective diagnostic study. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

The clinical implications of elevated blood metal ion concentrations in asymptomatic patients with MoM hip resurfacings: a cohort study

PubMed Central

Langton, David J; Sidaginamale, Raghavendra P; Joyce, Thomas J; Natu, Shonali; Blain, Peter; Jefferson, Robert Drysdale; Rushton, Stephen; Nargol, Antoni V F

2013-01-01

Objective To determine whether elevated blood cobalt (Co) concentrations are associated with early failure of metal-on-metal (MoM) hip resurfacings secondary to adverse reaction to metal debris (ARMD). Design Cohort study. Setting Single centre orthopaedic unit. Participants Following the identification of complications potentially related to metal wear debris, a blood metal ion screening programme was instigated at our unit in 2007 for all patients with Articular Surface Replacement (ASR) and Birmingham MoM hip resurfacings. Patients were followed annually unless symptoms presented earlier. Symptomatic patients were investigated with ultrasound scan and joint aspiration. The clinical course of all 278 patients with ‘no pain’ or ‘slight/occasional’ pain and a Harris Hip Score greater than or equal to 95 at the time of venesection were documented. A retrospective analysis was subsequently conducted using mixed effect modelling to investigate the temporal pattern of blood Co levels in the patients and survival analysis to investigate the potential role of case demographics and blood Co levels as risk factors for subsequent failure secondary to ARMD. Results Blood Co concentration was a positive and significant risk factor (z=8.44, p=2×10–16) for joint failure, as was the device, where the Birmingham Hip Resurfacing posed a significantly reduced risk for revision by 89% (z=−3.445, p=0.00005 (95% CI on risk 62 to 97)). Analysis using Cox-proportional hazards models indicated that men had a 66% lower risk of joint failure than women (z=−2.29419, p=0.0218, (95% CI on risk reduction 23 to 89)). Conclusions The results suggest that elevated blood metal ion concentrations are associated with early failure of MoM devices secondary to adverse reactions to metal debris. Co concentrations greater than 20 µg/l are frequently associated with metal staining of tissues and the development of osteolysis. Development of soft tissue damage appears to be more complex with females and patients with ASR devices seemingly more at risk when exposed to equivalent doses of metal debris. PMID:23482990

Histopathological characterization of corrosion product associated adverse local tissue reaction in hip implants: a study of 285 cases.

PubMed

Ricciardi, Benjamin F; Nocon, Allina A; Jerabek, Seth A; Wilner, Gabrielle; Kaplowitz, Elianna; Goldring, Steven R; Purdue, P Edward; Perino, Giorgio

2016-01-01

Adverse local tissue reaction (ALTR), characterized by a heterogeneous cellular inflammatory infiltrate and the presence of corrosion products in the periprosthetic soft tissues, has been recognized as a mechanism of failure in total hip replacement (THA). Different histological subtypes may have unique needs for longitudinal clinical follow-up and complication rates after revision arthroplasty. The purpose of this study was to describe the histological patterns observed in the periprosthetic tissue of failed THA in three different implant classes due to ALTR and their association with clinical features of implant failure. Consecutive patients presenting with ALTR from three major hip implant classes (N = 285 cases) were identified from our prospective Osteolysis Tissue Database and Repository. Clinical characteristics including age, sex, BMI, length of implantation, and serum metal ion levels were recorded. Retrieved synovial tissue morphology was graded using light microscopy. Clinical characteristics and features of synovial tissue analysis were compared between the three implant classes. Histological patterns of ALTR identified from our observations and the literature were used to classify each case. The association between implant class and histological patterns was compared. Our histological analysis demonstrates that ALTR encompasses three main histological patterns: 1) macrophage predominant, 2) mixed lymphocytic and macrophagic with or without features of associated with hypersensitivity/allergy or response to particle toxicity (eosinophils/mast cells and/or lymphocytic germinal centers), and 3) predominant sarcoid-like granulomas. Implant classification was associated with histological pattern of failure, and the macrophagic predominant pattern was more common in implants with metal-on-metal bearing surfaces (MoM HRA and MoM LHTHA groups). Duration of implantation and composition of periprosthetic cellular infiltrates was significantly different amongst the three implant types examined suggesting that histopathological features of ALTR may explain the variability of clinical implant performance in these cases. ALTR encompasses a diverse range of histological patterns, which are reflective of both the implant configuration independent of manufacturer and clinical features such as duration of implantation. The macrophagic predominant pattern and its mechanism of implant failure represent an important subgroup of ALTR which could become more prominent with increased length of implantation.

Incidence of revision after primary implantation of the Agility™ total ankle replacement system: a systematic review.

PubMed

Roukis, Thomas S

2012-01-01

Revision of failed total ankle replacement remains a challenge with limited information available to guide treatment options. I undertook a systematic review of electronic databases and other relevant sources to identify material relating to the incidence of revision after primary implantation of the Agility™ Total Ankle Replacement System. In an effort to procure the highest quality studies available, studies were eligible for inclusion only if they involved patients undergoing primary Agility™ Total Ankle Replacement; had evaluated patients at a mean follow-up of 12 months or longer; included details of the revision performed; and included revision etiologies of aseptic loosening, ballooning osteolysis, cystic changes, malalignment, or instability. A total of 14 studies involving 2312 ankles, with a weighted mean follow-up of 22.8 months, were included. Of the 2312 ankles, 224 (9.7%) underwent revision, of which 182 (81.3%) underwent implant component replacement, 34 (15.2%) underwent arthrodesis, and 8 (3.6%) underwent below-knee amputation. No significant effect from the surgeon's learning curve on the incidence of revision or the type of revision surgery performed was identified. However, excluding the inventor increased the incidence of revision twofold, from 6.6% to 12.2%, and skewed the type of revision away from arthrodesis and toward implant component replacement or below-knee amputation. Regardless, the incidence of revision after primary implantation of the Agility™ Total Ankle Replacement System was less than historically reported and amenable to implant component revision more than 80% of the time. However, methodologically sound cohort studies are needed that include the outcomes after revision surgery, specifically focusing on what implant component replacement techniques are effective in enhancing survivorship of these revised implants and the role of custom-stemmed talar and tibial components have in revision of the Agility™ Total Ankle Replacement System. A direct comparison of the incidence of revision between the various contemporary total ankle replacement systems in common use is also warranted. Copyright © 2012 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

CCD and offset after Nanos short stem in total hip arthroplasty.

PubMed

Ettinger, M; Ettinger, P; Ezechieli, M; Büermann, S; Budde, S; Calließ, T; Petri, M; Thorey, F

2013-01-01

Many short stems for total hip arthroplasty have been introduced by the manufacturers only during the last decade. One of them is the Nanos short stem (Smith and Nephew, Marl, Germany). The development of short stems was aimed at preserving bone and soft tissue by utilizing a minimally invasive approach, thus allowing a quick return to an active life. It was purpose of this study to evaluate the radiological changes after using this device. We present the radiological results of 202 cementless THAs which were performed in 172 patients using the Nanos stem. Radiological evaluation was performed using standing anterior-posterior (AP) and lateral radiographs of the proximal femur preoperatively, postoperatively and during the follow up. We analyzed the preoperative and postoperativ CCD angle, the subsisdence, preoperative and postoperative offset, osteolysis, bone resorption, increased density, neocortex and periarthricular ossifications. One stem had to be revised due to subsidence four days after implantation. Two cups (BiconPlus, Smith and Nephew, Marl, Germany) had to be revised during the time of follow up due to an aseptic cup loosening. Two stems showed radiolucent lines at the implant-bone-interface at the last follow-up. An increase of bone density could be detected in 18 hips (8.9%). 14 hips showed periarticular ossifications. Measurable subsidence was detected in a total of four stems (1.9%). The preoperative neck-shaft-angle angle was 133.8 ± 4.4° (range: 118.5-146.2) and the neck-shaft-angle angle at the time of follow up was 134.6 ± 4.3° (range: 123.3-147; P< 0.05). The preoperative and postoperative offset changed from 109.3 ± 11.9 mm (range: 80.9-131.6) to 109.7 ± 12.3 mm (range: 79.7-155.6; P< 0.05). In summary, this study shows that a correct anatomical reconstruction is possible with a device of this design. The outcome is comparable to that of other short stems. Further studies should be performed in a prospective and randomized design to evaluate the advantage of such a device with a higher level of evidence.

PAI-1, a target gene of miR-143, regulates invasion and metastasis by upregulating MMP-13 expression of human osteosarcoma.

PubMed

Hirahata, Mio; Osaki, Mitsuhiko; Kanda, Yusuke; Sugimoto, Yui; Yoshioka, Yusuke; Kosaka, Nobuyoshi; Takeshita, Fumitaka; Fujiwara, Tomohiro; Kawai, Akira; Ito, Hisao; Ochiya, Takahiro; Okada, Futoshi

2016-05-01

Despite recent improvements in the therapy for osteosarcoma, 30-40% of osteosarcoma patients die of this disease, mainly due to its lung metastasis. We have previously reported that intravenous injection of miR-143 significantly suppresses lung metastasis of human osteosarcoma cells (143B) in a mouse model. In this study, we examined the biological role and mechanism of miR-143 in the metastasis of human osteosarcoma cells. We identified plasminogen activator inhibitor-1 (PAI-1) as a direct target gene of miR-143. To determine the role of PAI-1 in human osteosarcoma cells, siRNA was transfected into 143B cells for knockdown of PAI-1 expression. An in vitro study showed that downregulation of PAI-1 suppressed cell invasion activity, but not proliferation. Moreover, injection of PAI-1 siRNA into a primary lesion in the osteosarcoma mouse model inhibited lung metastasis compared to control siRNA-injected mice, without influencing the proliferative activity of the tumor cells. Subsequent examination using 143B cells revealed that knockdown of PAI-1 expression resulted in downregulation of the expression and secretion of matrix metalloproteinase-13 (MMP-13), which is also a target gene of miR-143 and a proteolytic enzyme that regulates tumor-induced osteolysis. Immunohistochemical analysis using clinical samples showed that higher miR-143 expressing cases showed poor expression of PAI-1 in the primary tumor cells. All such cases belonged to the lung metastasis-negative group. Moreover, the frequency of lung metastasis-positive cases was significantly higher in PAI-1 and MMP-13 double-positive cases than in PAI-1 or MMP-13 single-positive or double-negative cases (P < 0.05). These results indicated that PAI-1, a target gene of miR-143, regulates invasion and lung metastasis via enhancement of MMP-13 expression and secretion in human osteosarcoma cells, suggesting that these molecules could be potential therapeutic target genes for preventing lung metastasis in osteosarcoma patients. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Adventure sports and sexual freedom hip replacement: the tripolar hip.

PubMed

Pritchett, James W

2018-01-01

Certain athletic activities and lifestyles require a completely stable and very mobile hip. Total hip replacement with a natural femoral head size and two mobile-bearing surfaces (i.e., a "tripolar" prosthesis) is the most stable prosthesis. Elegant design and wear-resistant bearing surfaces are the keys to long-term implant survivorship. The hypothesis is that a ceramic-coated tripolar prosthesis using highly cross-linked polyethylene can provide full function and complete stability with low wear. This study sought to determine: (1) patient-reported outcomes, (2) functional outcomes, (3) implant survivorship and complications, and (4) postoperative sexual limitations. Between 1998 and 2011, the author performed 160 primary total hip replacements using tripolar prostheses in patients participating in adventure sports and other physically demanding activities. The institutional review board approved this study. The inclusion criteria were patients who needed unrestricted activity and who were not candidates for or did not choose hip resurfacing. Patients were followed every second year and assessed with radiographs, Harris Hip Score, WOMAC, SF-12, and UCLA functional outcome scores. Patients were asked about symptoms of instability and satisfaction with their hip replacement. Patients were asked both preoperatively and 2 years postoperatively four questions about their sexual activity. Mean follow-up was 11 years. At 2 years' postoperatively, 98% of patients reported their satisfaction as excellent or good and 99% were not limited for sexual activity following surgery. Seventy-four percent of patients reported they were recovered within 6 weeks of surgery. There were no dislocations. There were three revision procedures for implant loosening, infection, and periprosthetic fracture, but there were no failures of the tripolar articulation. The mean postoperative UCLA score was the highly athletic score of 8. There were no signs of osteolysis, wear, or metal sensitivity reactions. The range of motion achieved, sexual, and functional outcomes were higher than with other types of total hip replacement. This ceramic-coated tripolar prosthesis using highly cross-linked polyethylene provides full function, complete stability, and low wear to younger, active patients, thus confirming the hypothesis and clinical relevance.

Total hip arthroplasty performed in patients with residual poliomyelitis: does it work?

PubMed

Yoon, Byung-Ho; Lee, Young-Kyun; Yoo, Jeong Joon; Kim, Hee Joong; Koo, Kyung-Hoi

2014-03-01

Patients with residual poliomyelitis can have advanced degenerative arthritis of the hip in the paralytic limb or the nonparalytic contralateral limb. Although THA is a treatment option for some of these patients, there are few studies regarding THA in this patient population. We therefore reviewed a group of patients with residual poliomyelitis who underwent cementless THA on either their paralytic limb or nonparalytic limb to assess (1) Harris hip scores, (2) radiographic results, including implant loosening, (3) complications, including dislocation, and (4) limb length discrepancy after recovery from surgery. From January 2000 to December 2009, 10 patients with residual poliomyelitis (10 hips, four paralytic limbs and six nonparalytic contralateral limbs) underwent THA using cementless prostheses. Harris hip scores, complications, and leg length discrepancy were determined by chart review, and confirmed by questionnaire and examination; radiographs were reviewed by two observers for this study. Followup was available for all 10 patients at a minimum of 3 years (median, 7 years; range, 3.4-13 years). Surgery was done at the same side of the paralytic limb in four hips and contralateral to the paralytic limb in six. All patients had pain relief and improvement in function; the Harris hip score improved from mean of 68 preoperatively to 92 at last followup (p = 0.043). However, only three patients had complete pain relief. One hip dislocated, which was treated successfully with closed reduction and a hip spica cast for 2 months. There was no loosening or osteolysis in this series. Leg length discrepancy improved after the index operation, but only in the THAs performed in the paralytic limbs. Cementless THA may be suitable for painful hips in adult patients with residual poliomyelitis. Nonetheless, these patients should be informed of the possibility of mild residual pain and persistent leg length discrepancy, particularly patients whose THA is performed on the limb that was not affected by polio (ie, the nonparalytic contralateral limb). Level IV, therapeutic study. See the Instructions for Authors for a complete description of levels of evidence.

Squeaking friction phenomena in ceramic hip endoprosthesis: Modeling and experimental validation

NASA Astrophysics Data System (ADS)

Ouenzerfi, G.; Massi, F.; Renault, E.; Berthier, Y.

2015-06-01

The modern evolution of ceramic bearing surfaces for total hip arthroplasty has allowed longer implant longevity with lower amounts of osteolysis. It has been applied to younger patient expecting improved survivorship compared with traditional bearing surfaces. However, the phenomenon of an audible squeaking produced by implants during daily activities is reported as an annoying complication for patients. Although recent studies have been carried out on this topic, the origin of squeaking and the analysis of factors leading to this phenomenon are not completely identified. Numerical analyses are still not able to reproduce precisely the in vitro and in vivo observations. The lack of understanding on the physics of this issue is still an obstacle to find appropriate solutions to prevent it. In this paper, numerical and experimental approaches to reproduce squeaking are presented. A pre-stressed modal analysis is performed to identify the unstable eigenfrequencies that cause the vibrations and the perceived acoustic emission. The numerical results are validated by experiments on a laboratory test bench and the predicted frequencies are compared to the squeaking frequencies that can be found both in vitro and in vivo. The natural frequencies related to the femoral components are closer to the observed squeaking frequency. Simulations results confirmed that these vibrations are related to the stem dynamic response, which has a strong influence on the squeaking characteristic. In the other hand, the cup and the ceramic components play a main indirect role providing the frictional pair between the head and the liner. The analysis suggests that one of the possible mechanisms at the origin of squeaking is the modal coupling of two modes of vibration of the stem under frictional contact. The numerical model will allow for identifying the dominant factors and parameters affecting squeaking in order to avoid the unstable mode coupling. Squeaking can be reduced clinically by minimizing friction rising factors (such edge loading and situations promoting metal transfer or stripe wear) or by developing endoprosthesis design to avoid the unstable vibrations, regressing the squeaking emission to a negligible phenomenon.

An investigation of the microstructure, mechanical properties, and tribological performance of ultra high molecular weight polyethylene for applications in total joint arthroplasty

NASA Astrophysics Data System (ADS)

van Citters, Douglas W.

Ultra high molecular weight polyethylene (UHMWPE) is the most common bearing material in joint arthroplasty due to its biocompatibility, its wear resistance, and its mechanical toughness. Despite the favorable properties of UHMWPE and its success as a biomaterial, billions of dollars are spent annually to revise tens of thousands of failed artificial joints. Over half of these revision procedures are related to mechanical failure of the polymer bearing or osteolysis resulting from polymer wear. Contemporary material processing steps involving thermal treatment and/or radiation treatment seek to improve outcomes through improving the tribological properties of UHMWPE. However, it is widely recognized that achieving wear resistance through radiation-induced crosslinking comes at the cost of reduced mechanical properties. Moreover, current wear theories for orthopaedic UHMWPE are incomplete in that they predict zero wear in the absence of crossing motion. Wear nonetheless occurs in linear reciprocation, necessitating an alternate theory. The present work explains the effects of thermal treatments and radiation treatments on the properties of GUR1050 UHMWPE. A test matrix allows comparisons of different treatments across different test platforms. Characterization techniques include DSC, FTIR spectroscopy, tensile testing, x-ray diffraction, and electron microscopy. A novel quantitative stereology technique is developed to quantify crystallite size in the semicrystalline material. Seven clinically relevant materials are subjected to rolling-sliding tribotesting to determine polyethylene wear behavior in linear reciprocation. The multi-station tribotester employed for this work enables high throughput testing, and the specimen geometry allows direct measurement of wear rates without a gravimetric soak control. The results of the material characterization tests can be used to accurately predict the rolling-sliding wear behavior of UHMWPE. Wear rate is directly related to crystallite size divided by the material yield strength. A modification of the delamination theory of wear is proposed to explain the wear mechanism. The results and conclusions of the present study can be used to specify future UHMWPE treatments that might eliminate a toughness-reducing radiation dose while improving the wear properties of the polymer. Such treatments would improve the in vivo performance of UHMWPE and hence would improve orthopaedic surgery outcomes.

Zoledronic acid increases the circulating soluble RANKL level in mice, with a further increase in lymphocyte-derived soluble RANKL in zoledronic acid- and glucocorticoid-treated mice stimulated with bacterial lipopolysaccharide.

PubMed

Abe, Takahiro; Sato, Tsuyoshi; Kokabu, Shoichiro; Hori, Naoko; Shimamura, Yumiko; Sato, Tomoya; Yoda, Tetsuya

2016-07-01

The nitrogen-containing bisphosphonate (BP) zoledronic acid (ZA) is a potent antiresorptive drug used in conjunction with standard cancer therapy to treat osteolysis or hypercalcemia due to malignancy. However, it is unclear how ZA influences the circulating levels of bone remodeling factors. The aim of this study was to evaluate the effects of ZA on the serum levels of soluble receptor activator of NF-kB ligand (sRANKL) and osteoprotegerin (OPG). The following four groups of C57BL/6 mice were used (five mice per group): (1) the placebo+phosphate-buffered saline (PBS) group, in which placebo-treated mice were injected once weekly with PBS for 4weeks; (2) the placebo+ZA group, in which placebo-treated mice were injected once weekly with ZA for 4weeks; (3) the prednisolone (PSL)+PBS group, in which PSL-treated mice were injected once weekly with PBS for 4weeks; and (4) the PSL+ZA group, in which PSL-treated mice were injected once weekly with ZA for 4weeks. At the 3-week time point, all mice were subjected to oral inflammatory stimulation with bacterial lipopolysaccharide (LPS). The sera of these mice were obtained every week and the levels of sRANKL and OPG were measured using enzyme-linked immunosorbent assay. At the time of sacrifice, femurs were prepared for micro-computed tomography (micro-CT), histological, and histomorphometric analyses. Our data indicated that ZA administration remarkably reduced bone turnover and significantly increased the basal level of sRANKL. Interestingly, the PSL+ZA group showed a dramatically elevated sRANKL level after LPS stimulation. In contrast, the PSL+ZA group in nonobese diabetic mice with severe combined immunodeficiency disease (NOD-SCID mice), which are characterized by the absence of functional T- and B-lymphocytes, showed no increase in the sRANKL level. Our data suggest that, particularly with combination treatment of ZA and glucocorticoids, surviving lymphocytes might be the source of inflammation-induced sRANKL. Thus, circulating sRANKL levels might be modulated by ZA. Copyright © 2016 Elsevier Ltd. All rights reserved.

Could larger diameter of 4th generation ceramic bearing decrease the rate of dislocation after THA?

PubMed

Lee, Young-Kyun; Ha, Yong-Chan; Jo, Woo-Lam; Kim, Tae-Young; Jung, Woon-Hwa; Koo, Kyung-Hoi

2016-05-01

Fourth generation (Delta) ceramic bearing was developed to reduce dislocation after total hip arthroplasty (THA) by increasing the head diameter. We tested a hypothesis that 32/36 mm Delta ceramic bearing decreases the dislocation rate. We also evaluated ceramic-related complications and early outcome of this thin liner-on-large head ceramic bearing. We performed a prospective study on patients who underwent THA with use of 32/36 mm Delta ceramic bearing. The dislocation rate was compared with the historical dislocation rate of third generation 28 mm ceramic bearing. We also evaluated ceramic fracture, squeak, short-term results and survival. Follow-up period was minimum 2 years. Between April 2010 and February 2012, we enrolled 250 consecutive patients (278 hips). All patients received cementless prostheses. Four patients (4 hips) who received metal shells ≤ 46 mm and 28 mm heads were excluded. Three patients died and 2 patients were lost within 2 years. The remaining 241 patients (269 hips) were followed for 24-46 months. There were 142 men (161 hips) and 99 women (108 hips) with a mean age of 53.7 years (range, 17-75 years) at the index operation. Dislocation occurred in three hips (1.1%). An old age was a risk factor for dislocation. Ceramic fracture and squeaking did not occur in any patient. Mean Harris hip score was 90.3 points at the latest follow-up. All acetabular and femoral components had bone-ingrowth stability. No hip had detectable wear or osteolysis. The survival was 99.3% in the best case scenario and 97.8% in the worst at 48 months. Total hip arthroplasty with use of 32/36 mm Delta ceramic bearing showed lower incidence of hip dislocation compared with 28 mm third generation ceramic bearing. A caution should be paid to prevent a fall in senile patients even though a large head is used. The short-term results of THA with this type of ceramic articulation are encouraging and we did not find any ceramic-related complications. Copyright © 2016 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.

Influence of heat treatment on structural, mechanical and wear properties of crosslinked UHMWPE.

PubMed

Chiesa, R; Moscatelli, M; Giordano, C; Siccardi, F; Cigada, A

2004-01-01

New crosslinked ultra high molecular weight polyethylenes (UHMWPEs) have recently been developed, characterized and introduced in clinical applications. UHMWPE cross-linking treatments are very promising for reducing osteolysis induced by wear debris. The irradiation type, gamma or beta, the dosage and the thermal treatment performed during or following the irradiation process are all factors affecting polyethylene wear resistance. Thermal stabilization treatments performed after or during the irradiation process at a temperature above melting point (i.e. >130 degrees C) have been proven to effectively remove the free radicals generated during irradiation from UHMWPE, but their effect on the mechanical properties of UHMWPE are not completely clear. In addition to wear rate reduction, maintaining good mechanical properties is fundamental aspect in designing the new generation of crosslinked UHMWPE for artificial load bearing materials, especially considering the application in total knee replacements. In this study, we investigated the influence of different stabilization treatments, performed after gamma irradiation, on structural, wear and mechanical properties of UHMWPE. We performed four different stabilization treatments, with different temperatures and cooling rates, on 100 kGy gamma irradiated UHMWPE. Structural properties of UHMWPE were assessed by differential scanning calorimetry (DSC). To assess the mechanical performance of the materials, uni-axial tensile tests were performed according to the ASTM D638 standard, bi-axial tension performance was evaluated by small punch tests (ASTM F2183-02), toughness resistance was evaluated by the Izod method (ASTM F648), and cold flow resistance was analysed by a dynamic compressive test. Evaluation of wear resistance was by a multidirectional pin-on-disk screening machine. Materials considered were in "aged" and "non-aged" conditions. Results confirmed that cross-linking greatly enhances UHMWPE wear resistance, but introduces some detrimental effects on the mechanical properties. In this study, we found that the negative ef-fects on the mechanical properties of crosslinked UHMWPE can be modulated, to some extent, by choosing a thermal stabiliza-tion treatment at a correct temperature and cooling rate. (Journal of Applied Biomaterials & Biomechanics 2004; 2: 20-8).

Scleroderma and dentistry: Two case reports.

PubMed

Dixit, Shantanu; Kalkur, Chaithra; Sattur, Atul P; Bornstein, Michael M; Melton, Fred

2016-10-24

Scleroderma is a chronic connective tissue disorder with unknown etiology. It is characterized by excessive deposition of extracellular matrix in the connective tissues causing vascular disturbances which can result in tissue hypoxia. These changes are manifested as atrophy of the skin and/or mucosa, subcutaneous tissue, muscles, and internal organs. Such changes can be classified into two types, namely, morphea (localized) and diffuse (systemic). Morphea can manifest itself as hemifacial atrophy (Parry-Romberg syndrome) although this remains debatable. Hence, we present a case of morphea, associated with Parry-Romberg syndrome, and a second case with the classical signs of progressive systemic sclerosis. Case one: A 20-year-old man of Dravidian origin presented to our out-patient department with a complaint of facial asymmetry, difficulty in speech, and loss of taste sensation over the last 2 years. There was no history of facial trauma. After physical and radiological investigations, we found gross asymmetry of the left side of his face, a scar on his chin, tongue atrophy, relative microdontia, thinning of the ramus/body of his mandible, and sclerotic lesions on his trunk. Serological investigations were positive for antinuclear antibody for double-stranded deoxyribonucleic acid and mitochondria. A biopsy was suggestive of morphea. Hence, our final diagnosis was mixed morphea with Parry-Romberg syndrome. Case two: A 53-year-old woman of Dravidian origin presented to our out-patient department with a complaint of gradually decreasing mouth opening over the past 7 years. Her medical history was noncontributory. On clinical examination, we found her perioral, neck, and hand skin to be sclerotic. Also, her fingers exhibited bilateral telangiectasia. An oral examination revealed completely edentulous arches as well as xerostomia and candidiasis. Her serological reports were positive for antinuclear antibodies against centromere B, Scl-70, and Ro-52. A hand and wrist radiograph revealed acro-osteolysis of the middle finger on her right hand. Hence, our final diagnosis was progressive systemic sclerosis. Through this article, we have tried to emphasize the importance of a general examination when diagnosing rare systemic diseases such as scleroderma and the role of the general dentist when caring for such patients, even though they can be quite rare in general practice.

How often is the office visit needed? Predicting total knee arthroplasty revision risk using pain/function scores.

PubMed

Hightower, Charles D; Hightower, Lisa S; Tatman, Penny J; Morgan, Patrick M; Gioe, Terence; Singh, Jasvinder A

2016-08-24

Most patients have favorable outcomes after primary total knee arthroplasty (TKA). Well-validated methods to predict the risk of poor outcomes have not been developed or implemented. Several patients have annual clinic visits despite well-funcitoning TKA, as a routine practice, to detect early failure requiring revision surgery. It is not known whether assessment of pain and function can be used as a predictive tool for early failure and revision to guide practice. Our objective was to determine whether pain and function can predict revision after TKA. We retrospectively studied data from a large prospectively gathered TKA registry to examine changes in outcome scores for primary TKAs undergoing revision compared to those not requiring revision to determine the factors that are predictive for revision. Of the 1,012 patients, 721 had had a single-sided primary TKA and had American Knee Society (AKS) Scores for three or more visits. 46 patients underwent revision, 23 acutely (fracture, traumatic component failure or acute infection) and 23 for latent causes (late implant loosening, progressive osteolysis, or pain and indolent infection). Mean age was 70 years for the non-revision patients, and 64 years for those revised. Both AKS Clinical and AKS Function Scores for non-revised patients were higher than in revision patients, higher in acute revision compared to latent revision patients. Significant predictors of revision surgery were preoperative, 3- and 15-month postoperative AKS Clinical Scores and 3-month AKS Function Scores. At 15-month post-TKA, a patient with a low calculated probability of revision, 32 % or less, was unlikely to require revision surgery with a negative predictive value of 99 %. Time dependent interval evaluation post-TKA with the AKS outcome scores may provide the ability to assign risk of revision to patients at the 15-month follow-up visit. If these findings can be replicated using a patient-reported measure, a virtual follow-up with patient-reported outcomes and X-ray review may be an alternative to clinic visit for patients doing well.

[Radiographic appraisal between metal and bone interosculate backfill after total hip arthroplasty with trabecular metal cup].

PubMed

Li, Wei; Zhou, Yi-Xin; Wu, Jian; Xu, Hui; Ji, Song-Jie

2009-02-15

To evaluate the bone refilling in the interface between the trabecular metal (TM) acetabular shell and the bone surface according to consecutive X film measuring after surgery. From July 2006 to July 2007, 35 patients (40 hips) accepted total hip replacement using trabecular metal monoblock acetabular cup system (TM). The cup was made of a ellipse shaped press fit Tantalum shell and high cross-linked PE liner (Longevity) with 28 mm inner diameter. The patients demography was: 16 male (20 hips), 19 female (20 hips), 5 bilateral hip replacements, age from 41 - 71 (mean 53), including 18 avascular necrosis hips, 16 osteoarthritis hips (including those secondary to a dysplasia hip), 4 avascular necrosis hips after femoral neck fracture, 2 Ankylosis Spondylitis. All the 40 total hip replacements used posterior approach, using hemispherical acetabular reamer and 2 mm press fit of final metal shell without screw fixation. The consecutive X film was taken at the end time of surgery and 2, 6, 12, 24 weeks, and 12 months. The clinical results was evaluate according to Harris scoring system, and the standard pelvis AP X film was measured at the interface between metal shell and the acetabular bone surface, witch was divided into five regions (A, B, C, D, E). Totally 32 patients (37 hips) were followed with average 8.7 months (7 - 12 months). The Harris before surgery was 50.5 (32 - 85), promoted to 91.0 (72 - 100), including 29 excellent, 6 good, 2 fair, and the total excellent and good rate was 94.6%. Complications include 4 patients leg length discrepancy from 1 - 2 cm, 3 patients moderate thigh pain and released after conservative therapy. No infection and dislocation was found. Twenty-one patients (23 hips) were found lucent line at the bone-metal interface from 1 - 5 mm, most common in B region and BC boundary than C, D, and CD boundary. All the patients followed was found the lucent line disappeared and refilled with bone at X film 24 weeks after surgery, however, no patients was found osteolysis and cup migration. The trabecular metal has strong capacity of bone conductive and bone inducement.

The interactions of the cells in the development of osteoporotic changes in bones under space flight conditions

NASA Astrophysics Data System (ADS)

Rodionova, Natalia; Kabitskaya, Olga

2016-07-01

Using the methods of electron microscopy and autoradiography with ³N-glycine and ³N-thymidine on biosatellites "Bion-11" (Macaca mulatta, the duration of the experiments -10 days), "Bion-M1" (mouse C57 Black, duration of the flight - 30 days) in the experiments with modeled hypokinesia (white rats, hind limbs unloading, the duration of the experiments 28 days) new data about the morpho-functional peculiarities of cellular interactions in adaptive remodeling zones of bone structures under normal conditions and after exposure of animals to microgravity. Our conception on remodeling proposes the following sequence in the development of cellular interactions after decrease of the mechanical loading: a primary response of osteocytes (mechanosensory cells) to the mechanical stimulus; osteocytic remodeling (osteolysis); transmission of the mechanical signals through a system of canals and processes to functionally active osteoblasts and paving endost one as well as to the bone-marrow stromal cells and perivascular cells. As a response to the mechanical stimulus (microgravity) the system of perivascular cell-stromal cell-preosteoblast-osteoblast shows a delay in proliferation, differentiation and specific functioning of the osteogenetic cells, the number of apoptotic osteoblasts increases. Then the osteoclastic reaction occurs (attraction of monocytes and formation of osteoclasts, bone matrix resorption in the loci of apoptosis of osteoblasts and osteocytes). The macrophagal reaction is followed by osteoblastogenesis, which appears to be a rehabilitating process. However, during prolonged absence of mechanical stimuli (microgravity, long-time immobilization) the adaptive activization of osteoblastogenesis doesn't occur (as it is the case during the physiological remodeling of bone tissue) or it occurs to a smaller degree. The loading deficit leads to an adaptive differentiation of stromal cells to fibroblastic cells and adipocytes in remodeling loci. These cell reactions are considered as adaptive-compensatory, but they don't result in rehabilitation of the resorbed bone tissue. This sequence of cells interactions is considered as a mechanism of bone tissue loss which underlies the development of osteopenia and osteoporosis under the mechanical loading deficit.

In vivo evaluation of the anti-infection potential of gentamicin-loaded nanotubes on titania implants

PubMed Central

Yang, Ying; Ao, Hai-yong; Yang, Sheng-bing; Wang, Yu-gang; Lin, Wen-tao; Yu, Zhi-feng; Tang, Ting-ting

2016-01-01

Titanium-based implants have been widely used in orthopedic surgery; however, failures still occur. Our in vitro study has demonstrated that gentamicin-loaded, 80 nm-diameter nanotubes possessed both antibacterial and osteogenic activities. Thus, the aim of this study was to further investigate the in vivo anti-infection effect of the titanium implants with gentamicin-loaded nanotubes. Thirty-six male Sprague Dawley rats were used to establish an implant-associated infection model. A volume of 50 μL Staphylococcus aureus suspension (1×105 CFU/mL) was injected into the medullary cavity of the left femur, and then the titanium rods without modification (Ti), titanium nanotubes without drug loading (NT), and gentamicin-loaded titanium nanotubes (NT-G) were inserted with phosphate-buffered saline-inoculated Ti rods as a blank control. X-ray images were obtained 1 day, 21 days, and 42 days after surgery; micro-computed tomography, microbiological, and histopathological analyses were used to evaluate the infections at the time of sacrifice. Radiographic signs of bone infection, including osteolysis, periosteal reaction, osteosclerosis, and damaged articular surfaces, were demonstrated in the infected Ti group and were slightly alleviated in the NT group but not observed in the NT-G group. Meanwhile, the radiographic and gross bone pathological scores of the NT-G group were significantly lower than those of the infected Ti group (P<0.01). Explant cultures revealed significantly less bacterial growth in the NT-G group than in the Ti and NT groups (P<0.01), and the NT group showed decreased live bacterial growth compared with the Ti group (P<0.01). Confocal laser scanning microscopy, scanning electron microscopy, and histopathological observations further confirmed decreased bacterial burden in the NT-G group compared with the Ti and NT groups. We concluded that the NT-G coatings can significantly prevent the development of implant-associated infections in a rat model; therefore, they may provide an effective drug-loading strategy to combat implant-associated infections in clinic. PMID:27274245

Nine Year Follow-up of a Ceramic-on-Ceramic Bearing Total Hip Arthroplasty Utilizing a Layered Monoblock Acetabular Component

PubMed Central

Mayor, David; Patel, Savan; Perry, Clayton; Walter, Norman; Burton, Stephen; Atkinson, Theresa

2014-01-01

Introduction Early ceramic bearing systems in total hip arthoplasty (THA) sought to provide long term wear improvement over traditional metal on polyethylene systems. However, previous designs exhibited fractures of the ceramic acetabular liner, leading to the development of the Implex Hedrocel ceramic bearing THA system where the ceramic liner was supported on a layer of polyethylene intended to transition liner loads to the metal shell, a so-called “sandwich” design. Unfortunately, the device trial was stopped to further enrollment when liner fractures were reported. The current study examines nearly 10-year follow-up on 28 devices implanted by two surgeons at one institution in order to document ceramic bearing system performance over a longer time period. Methods Radiographic and patient reported outcomes, in the form of Harris Hip Scores (HHS) and 12-Item Short Form Health Survey (sF-12), were collected. Results During the study period two cups were replaced, one at three years and a second at seven years. At the five year follow-up HHS were similar to those reported in the literature for devices with traditional metal-on-polyethylene bearing surfaces and for other sandwich ceramic bearing designs. At the nine year follow-up, the HHS had not changed significantly and SF-12 scores measuring overall physical and mental health were higher than age matched national norms (p<0.001). There were no signs of cup migration, stem subsidence, osteolysis or cup loosening at any time up to the last follow-up in this patient cohort. The 89% survivorship rate and device revisions due to delamination of the liner observed in this group were similar to those reported earlier for this device and for other “sandwich design” ceramic bearing systems. Discussion This cohort did not exhibit new failure modes and HHS and SF-12 scores indicated high functionality for the majority of patients. These data suggest that a focus on preventing ceramic liner fracture through design and/or materials improvements may result in a device with long-term functionality. PMID:25328464

Recombinant human bone morphogenetic protein-2-augmented transforaminal lumbar interbody fusion for the treatment of chronic low back pain secondary to the homogeneous diagnosis of discogenic pain syndrome: two-year outcomes.

PubMed

Corenman, Donald S; Gillard, Douglas M; Dornan, Grant J; Strauch, Eric L

2013-09-15

A retrospective observational study. To assess clinical outcomes, perioperative complications, revision surgery rates, and recombinant human bone morphogenetic protein-2 (BMP-2)-related osteolysis, heterotopic bone, and unexplained postoperative radiculitis (BMPP) in a group of patients treated with BMP-2-augmented transforaminal lumbar interbody fusion (bTLIF) for the homogeneous diagnosis of discogenic pain syndrome (DPS) and to put forth the algorithm used to make the diagnosis. There is a paucity of literature describing outcomes of TLIF for the homogeneous diagnosis of DPS, an old but controversial member of the lumbar degenerative disease family. The registry from a single surgeon was queried for patients who had undergone bTLIF for the homogeneous diagnosis of DPS, which was made via specific diagnostic algorithm. Clinical outcomes were determined by analyzing point improvement from typical outcome questionnaires and the data from Patient Satisfaction and Return to Work questionnaires. Independent record review was used to assess all outcomes. Eighty percent of the cohort (36/45) completed preoperative and postoperative outcome questionnaires at an average follow-up of 41.9 ± 11.9 months, which demonstrated significant clinical improvement: Oswestry Disability Index = 16.4 (P < 0.0001), 12-Item Short Form Health Survey physical component summary score = 10.0 (P < 0.0001), and a Numeric Rating Scale for back pain = 2.3 (P < 0.0001). The median patient satisfaction score was 9.0 (10 = complete satisfaction), and 84.4% (27/32) of the cohort were able to return to their preoperative job, with or without modification. There were 3 perioperative complications, 4 revision surgical procedures, and 11 cases of benign BMPP. There were no incidents of the intraoperative dural tears or nerve root injury, and litigation involvement (11/36, P > 0.17), preoperative depression (15/36, P > 0.19) or prior discectomy/decompression (14/36, P < 0.37) was not a predictor of outcomes. Although limited by retrospective design and small cohort, the results of this investigation suggest that bTLIF is a reasonable treatment option for patients who experience DPS and affords high patient satisfaction. A larger study is needed to confirm these findings. 4.

Implant based differences in adverse local tissue reaction in failed total hip arthroplasties: a morphological and immunohistochemical study

PubMed Central

2014-01-01

Background Adverse local tissue reaction (ALTR) is characterized by periprosthetic soft tissue inflammation composed of a mixed inflammatory cell infiltrate, extensive soft tissue necrosis, and vascular changes. Multiple hip implant classes have been reported to result in ALTR, and clinical differences may represent variation in the soft tissue response at the cellular and tissue levels. The purpose of this study was to describe similarities and differences in periprosthetic tissue structure, organization, and cellular composition by conventional histology and immunohistochemistry in ALTR resulting from two common total hip arthroplasty (THA) implant classes. Methods Consecutive patients presenting with ALTR from two major hip implant classes (N = 54 patients with Dual-Modular Neck implant; N = 14 patients with Metal-on-Metal implant) were identified from our prospective Osteolysis Tissue Database and Repository. Clinical characteristics including age, sex, BMI, length of implantation, and serum metal ion levels were recorded. Retrieved synovial tissue morphology was graded using light microscopy and cellular composition was assessed using immunohistochemistry. Results Length of implantation was shorter in the DMN group versus MoM THA group (21.3 [8.4] months versus 43.6 [13.8] months respectively; p < 0.005) suggesting differences in implant performance. Morphologic examination revealed a common spectrum of neo-synovial proliferation and necrosis in both groups. Macrophages were more commonly present in diffuse sheets (Grade 3) in the MoM relative to DMN group (p = 0.016). Perivascular lymphocytes with germinal centers (Grade 4) were more common in the DMN group, which trended towards significance (p = 0.066). Qualitative differences in corrosion product morphology were seen between the two groups. Immunohistochemistry showed features of a CD4 and GATA-3 rich lymphocyte reaction in both implants, with increased ratios of perivascular T-cell relative to B-cell markers in the DMN relative to the MoM group (p = 0.032). Conclusion Our results demonstrate that both implant classes display common features of neo-synovial proliferation and necrosis with a CD4 and GATA-3 rich inflammatory infiltrate. Qualitative differences in corrosion product appearance, macrophage morphology, and lymphocyte distributions were seen between the two implant types. Our data suggests that ALTR represents a histological spectrum with implant-based features. PMID:25242891

Implant based differences in adverse local tissue reaction in failed total hip arthroplasties: a morphological and immunohistochemical study.

PubMed

Perino, Giorgio; Ricciardi, Benjamin F; Jerabek, Seth A; Martignoni, Guido; Wilner, Gabrielle; Maass, Dan; Goldring, Steven R; Purdue, P Edward

2014-01-01

Adverse local tissue reaction (ALTR) is characterized by periprosthetic soft tissue inflammation composed of a mixed inflammatory cell infiltrate, extensive soft tissue necrosis, and vascular changes. Multiple hip implant classes have been reported to result in ALTR, and clinical differences may represent variation in the soft tissue response at the cellular and tissue levels. The purpose of this study was to describe similarities and differences in periprosthetic tissue structure, organization, and cellular composition by conventional histology and immunohistochemistry in ALTR resulting from two common total hip arthroplasty (THA) implant classes. Consecutive patients presenting with ALTR from two major hip implant classes (N = 54 patients with Dual-Modular Neck implant; N = 14 patients with Metal-on-Metal implant) were identified from our prospective Osteolysis Tissue Database and Repository. Clinical characteristics including age, sex, BMI, length of implantation, and serum metal ion levels were recorded. Retrieved synovial tissue morphology was graded using light microscopy and cellular composition was assessed using immunohistochemistry. Length of implantation was shorter in the DMN group versus MoM THA group (21.3 [8.4] months versus 43.6 [13.8] months respectively; p < 0.005) suggesting differences in implant performance. Morphologic examination revealed a common spectrum of neo-synovial proliferation and necrosis in both groups. Macrophages were more commonly present in diffuse sheets (Grade 3) in the MoM relative to DMN group (p = 0.016). Perivascular lymphocytes with germinal centers (Grade 4) were more common in the DMN group, which trended towards significance (p = 0.066). Qualitative differences in corrosion product morphology were seen between the two groups. Immunohistochemistry showed features of a CD4 and GATA-3 rich lymphocyte reaction in both implants, with increased ratios of perivascular T-cell relative to B-cell markers in the DMN relative to the MoM group (p = 0.032). Our results demonstrate that both implant classes display common features of neo-synovial proliferation and necrosis with a CD4 and GATA-3 rich inflammatory infiltrate. Qualitative differences in corrosion product appearance, macrophage morphology, and lymphocyte distributions were seen between the two implant types. Our data suggests that ALTR represents a histological spectrum with implant-based features.

In vivo biocompatibility of new nano-calcium-deficient hydroxyapatite/poly-amino acid complex biomaterials.

PubMed

Dai, Zhenyu; Li, Yue; Lu, Weizhong; Jiang, Dianming; Li, Hong; Yan, Yonggang; Lv, Guoyu; Yang, Aiping

2015-01-01

To evaluate the compatibility of novel nano-calcium-deficient hydroxyapatite/poly-amino acid (n-CDHA/PAA) complex biomaterials with muscle and bone tissue in an in vivo model. Thirty-two New Zealand white rabbits were used in this study. Biomaterials were surgically implanted into each rabbit in the back erector spinae and in tibia with induced defect. Polyethylene was implanted into rabbits in the control group and n-CDHA/PAA into those of the experimental group. Animals were examined at four different points in time: 2 weeks, 4 weeks, 12 weeks, and 24 weeks after surgery. They were euthanized after embolization. Back erector spinae muscles with the surgical implants were examined after hematoxylin and eosin (HE) staining at these points in time. Tibia bones with the surgical implants were examined by X-ray and scanning electron microscopy (SEM) at these points in time to evaluate the interface of the bone with the implanted biomaterials. Bone tissues were sectioned and subjected to HE, Masson, and toluidine blue staining. HE staining of back erector spinae muscles at 4 weeks, 12 weeks, and 24 weeks after implantation of either n-CDHA/PAA or polyethylene showed disappearance of inflammation and normal arrangement in the peripheral tissue of implant biomaterials; no abnormal staining was observed. At 2 weeks after implantation, X-ray imaging of bone tissue samples in both experimental and control groups showed that the peripheral tissues of the implanted biomaterials were continuous and lacked bone osteolysis, absorption, necrosis, or osteomyelitis. The connection between implanted biomaterials and bone tissue was tight. The results of HE, Masson, toluidine blue staining and SEM confirmed that the implanted biomaterials were closely connected to the bone defect and that no rejection had taken place. The n-CDHA/PAA biomaterials induced differentiation of a large number of chondrocytes. New bone trabecula began to form at 4 weeks after implanting n-CDHA/PAA biomaterials, and lamellar bone gradually formed at 12 weeks and 24 weeks after implantation. Routine blood and kidney function tests showed no significant changes at 2 weeks and 24 weeks after implantation of both biomaterials. n-CDHA/PAA composites showed good compatibility in in vivo model. In this study, n-CDHA/PAA were found to be safe, nontoxic, and biologically active in bone repair.

Aspergillus arthritis: analysis of clinical manifestations, diagnosis, and treatment of 31 reported cases.

PubMed

Gamaletsou, Maria N; Rammaert, Blandine; Bueno, Marimelle A; Sipsas, Nikolaos V; Moriyama, Brad; Kontoyiannis, Dimitrios P; Roilides, Emmanuel; Zeller, Valerie; Taj-Aldeen, Saad J; Henry, Michael; Petraitis, Vidmantas; Denning, David W; Lortholary, Olivier; Walsh, Thomas J

2017-04-01

Aspergillus arthritis is a debilitating form of invasive aspergillosis. Little is known about its epidemiology, clinical manifestations, laboratory features, treatment, and prognosis. Cases of Aspergillus arthritis were reviewed in the English literature from 1967 through 2015 for variables of arthritis with Aspergillus spp. recovered from joint and/or adjacent bone, underlying conditions, symptoms, signs, inflammatory biomarkers, diagnostic imaging, management, and outcome. Among 31 evaluable cases, 87% were males and 13% pediatric. Median age was 50 y (range 1-83 y). Seventeen (55%) patients were immunosuppressed with such conditions as hematological malignancies (26%), corticosteroids (39%), and/or transplantation (26%). Approximately one-half (52%) of patients had hematogenous seeding of the joint, and more than 80% had de novo infection with no prior antifungal therapy. Oligoarticular infection (2-3 joints) occurred in 45% and contiguous osteomyelitis was present in 61%. Clinical manifestations included pain (87%), edema (26%), and limited function (23%), with knees (35%), intervertebral discs (26%), and hips (16%) being most commonly infected. Aspergillus fumigatus constituted 77% of cases followed by Aspergillus flavus in 13%, Aspergillus niger in 3%, and not specified in 7%. Median ESR was 90 mm/hr and median CRP was 3.6 mg/dl. Median synovial fluid WBC was 17,200/μL (7,300-128,000) with 72% PMNs (range 61-92). Osteolysis occurred in 35%, and soft-tissue extension 47%. Nineteen patients (61%) were managed with combined medical and surgical therapy, 10 (32%) with medical therapy only, and 2 (6%) surgery only. Amphotericin B and itraconazole were the most frequently used agents with median duration of therapy of 219 days (range 30-545). Surgical interventions included debridement in 61%, drainage 19%, and amputation 6%. Complete or partial response was achieved in 71% and relapse occurred in 16%. Medical therapy was reinstituted with successful outcome in these patients. Overall survival was 65%. Aspergillus arthritis mainly develops as a de novo infection involving knees and intervertebral disks in immunocompromised patients with localizing symptoms. Contiguous osteomyelitis is frequently observed. Diagnosis is established by synovial fluid culture. Aspergillus arthritis is therapeutically challenging with most patients undergoing surgery and protracted antifungal therapy. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Radiolucent rings around bioabsorbable anchors after rotator cuff repair are not associated with clinical outcomes.

PubMed

Park, Jin-Young; Jang, Suk-Hwan; Oh, Kyung-Soo; Li, Yi Jin

2017-11-01

Various researchers have observed small areas of osteolysis after using bioabsorbable anchors in shoulder surgeries. The purpose of this study is to determine whether radiographic perianchor radiolucent rings after rotator cuff repair are associated with the failure of repair and also assess their clinical implications. Further, the most frequent location of the radiolucent rings in the double-row suture bridge configuration was also assessed. One hundred and twenty-nine consecutive patients who underwent arthroscopic rotator cuff repair by suture bridge technique were retrospectively evaluated radiographically and clinically. The number and size of the rings that appeared at each follow-up were recorded. Also, the locations of each ring were recorded as anterior, middle or posterior, and medial or lateral according to the construct of the anchors used for suture bridge technique. The size of the tear, the number of anchors used and age of the patients were compared. Re-tear rates according to ultrasound examinations were also analyzed. After rotator cuff repair, the mean American Shoulder and Elbow Surgeons (ASES) score increased from 46.7 to 88.0 and the overall re-tear rate was 8.5% (11 cases). Seventy-three patients (56.6%) showed RR (total number of 99 rings) at least once during the course of their follow-up and the rings appeared at a mean period of 18.2 months after surgery. Mean size of the rings initially was 5.6 mm and the rings increased or decreased in mean size of 0.4 mm during mean follow-up of 37 months. No correlation was seen with the number of RRs and the rate of re-tears, number of anchors, size of tears, and clinical outcome as determined by the ASES score. Radiolucent ring measurement reproducibility was confirmed by independent, repeated measurements. The rings appeared mostly at anteromedial anchors (75 rings, 75.8%) and the authors suggest that mechanical factors may play a role for the cause of radiolucent rings. The number and the size of RRs around bioabsorbable anchors after rotator cuff repair do not appear to adversely affect the healing and clinical outcome of ARCR. Most radiolucent rings appeared at anteromedial anchors, indicating that mechanical factors may play a role for the radiolucencies. Case series, level IV.

In vivo biocompatibility of new nano-calcium-deficient hydroxyapatite/poly-amino acid complex biomaterials

PubMed Central

Dai, Zhenyu; Li, Yue; Lu, Weizhong; Jiang, Dianming; Li, Hong; Yan, Yonggang; Lv, Guoyu; Yang, Aiping

2015-01-01

Objective To evaluate the compatibility of novel nano-calcium-deficient hydroxyapatite/poly-amino acid (n-CDHA/PAA) complex biomaterials with muscle and bone tissue in an in vivo model. Methods Thirty-two New Zealand white rabbits were used in this study. Biomaterials were surgically implanted into each rabbit in the back erector spinae and in tibia with induced defect. Polyethylene was implanted into rabbits in the control group and n-CDHA/PAA into those of the experimental group. Animals were examined at four different points in time: 2 weeks, 4 weeks, 12 weeks, and 24 weeks after surgery. They were euthanized after embolization. Back erector spinae muscles with the surgical implants were examined after hematoxylin and eosin (HE) staining at these points in time. Tibia bones with the surgical implants were examined by X-ray and scanning electron microscopy (SEM) at these points in time to evaluate the interface of the bone with the implanted biomaterials. Bone tissues were sectioned and subjected to HE, Masson, and toluidine blue staining. Results HE staining of back erector spinae muscles at 4 weeks, 12 weeks, and 24 weeks after implantation of either n-CDHA/PAA or polyethylene showed disappearance of inflammation and normal arrangement in the peripheral tissue of implant biomaterials; no abnormal staining was observed. At 2 weeks after implantation, X-ray imaging of bone tissue samples in both experimental and control groups showed that the peripheral tissues of the implanted biomaterials were continuous and lacked bone osteolysis, absorption, necrosis, or osteomyelitis. The connection between implanted biomaterials and bone tissue was tight. The results of HE, Masson, toluidine blue staining and SEM confirmed that the implanted biomaterials were closely connected to the bone defect and that no rejection had taken place. The n-CDHA/PAA biomaterials induced differentiation of a large number of chondrocytes. New bone trabecula began to form at 4 weeks after implanting n-CDHA/PAA biomaterials, and lamellar bone gradually formed at 12 weeks and 24 weeks after implantation. Routine blood and kidney function tests showed no significant changes at 2 weeks and 24 weeks after implantation of both biomaterials. Conclusion n-CDHA/PAA composites showed good compatibility in in vivo model. In this study, n-CDHA/PAA were found to be safe, nontoxic, and biologically active in bone repair. PMID:26504382

Macrophage migration inhibitory factor (MIF) supports homing of osteoclast precursors to peripheral osteolytic lesions

PubMed Central

Movila, Alexandru; Ishii, Takenobu; Albassam, Abdullah; Wisitrasameewong, Wichaya; Howait, Mohammed; Yamaguchi, Tsuguno; Ruiz-Torruella, Montserrat; Bahammam, Laila; Nishimura, Kazuaki; Van Dyke, Thomas; Kawai, Toshihisa

2016-01-01

By binding to its chemokine receptor CXCR4 on osteoclast precursor cells (OCPs), it is well known that SDF-1 promotes the chemotactic recruitment of circulating OCPs to the homeostatic bone remodeling site. However, the engagement of circulating OCPs in pathogenic bone resorption remains to be elucidated. The present study investigated a possible chemoattractant role of MIF, another ligand for CXCR4, in the recruitment of circulating OCPs to the bone lytic lesion. To accomplish this, we used Csf1r-eGFP-KI mice to establish an animal model of Polymethyl methacrylate (PMMA) particle-induced calvarial osteolysis. In the circulating Csf1r-eGFP+ cells of healthy Csf1r-eGFP-KI mice, Csf1r+/CD11b+ cells showed a greater degree of RANKL-induced osteoclastogenesis compared to a subset of Csf1r+/RANK+ cells in vitro. Therefore, Csf1r-eGFP+/CD11b+ cells were targeted as functionally relevant OCPs in the present study. While expression of the two cognate receptors for MIF, CXCR2 and CXCR4, was elevated on Csf1r+/CD11b+ cells, transmigration of OCPs toward recombinant MIF in vitro was facilitated by ligation with CXCR4, but not CXCR2. Meanwhile, the level of PMMA-induced bone resorption in calvaria was markedly greater in wild-type mice compared to that detected in MIF-KO mice. Interestingly, in contrast to the elevated MIF, diminished SDF-1 was detected in a particle-induced bone lytic lesion of wild-type mice in conjunction with an increased number of infiltrating CXCR4+ OCPs. However, such diminished SDF-1 was not found in the PMMA-injected calvaria of MIF-KO mice. Furthermore, stimulation of osteoblasts with MIF in vitro suppressed their production of SDF-1, suggesting that MIF can down-modulate SDF-1 production in bone tissue. Systemically administered anti-MIF neutralizing mAb inhibited the homing of CXCR4+ OCPs, as well as bone resorption, in the PMMA-injected calvaria, while increasing locally produced SDF-1. Collectively, these data suggest that locally produced MIF in the inflammatory bone lytic site is engaged in the chemoattraction of circulating CXCR4+ OCPs. PMID:27082509

[APPLICATION AND EFFECTIVENESS OF BIOLOGICAL TYPE ACETABULAR CUP IN ADULT Crowe TYPE IV DEVELOPMENTAL DYSPLASIA OF THE HIP].

PubMed

Xu, Ning; Sun, Junying; Zhao, Xijiang; Wang, Tao

2016-01-01

To investigate the application and effectiveness of the biological type acetabular cup(diameter < 44 mm) in adult Crowe type IV developmental dysplasia of the hip (DDH). Between April 2001 andAugust 2013, biological type acetabular cup was used in total hip arthroplasty for the treatment of Crowe type IV DDH in16 cases (20 hips). There were 3 males and 13 females, aged 31-69 years (mean, 49 years). Unilateral hip was involved in 12cases, and bilateral hips in 4 cases. The patients showed pain of the hip joint and inequality of lower limb (shortening ofaffected limb 1.8-6.0 cm in length, 3.5 cm on average). Acetabular deformity, the relationship and the severity of femoralhead dislocation were comfirmed on the X-ray films. The preoperative Harris score was 34.0 ± 6.9. All patientsachieved healing of incision by first intention, with no complication of infection or neurovascular injury. Sixteen caseswere followed up 4-12 years (mean, 7.5 years). At 2 weeks after operation, dislocation occurred in 2 cases, and were fixedwith plaster for 3 weeks after reduction of the hip. Postoperative X-ray films showed complete reduction of femoral head;the average acetabular coverage of the cup of the weight-bearing area was 98.5% (range, 98.2%-99.1%). The cup from theRanawat triangle was 4.6-7.0 mm (mean, 5.8 mm) in medial shifting, and was 4.5-7.9 mm (mean, 6.2 mm) in elevation,it located at cup lateral surface area inside the iliopectineal line and the Kohler line (< 40%); the cup abduction angle was(45 ± 5)degrees, and the anteversion angle was (10 ± 5)degrees. The other patients had no prosthesis loosening except 1 patient havingextensive acetabular prosthesis loosening because of acetabular osteolysis at 12 years after operation. The hip Harris scorewas significantly improved to 85.0 ± 7.5 at 1 year after operation (t = 14.34, P = 0.01). The acetabular grindingprocess to retain enough bone combined with a small cup of-biological prosthesis treating adult Crowe type IV DDH has theadvantages of satisfactory coverage and initial acetabular fixation, so good early and mid-term effectiveness can be obtained.

[EFFECTIVENESS COMPARISON OF CORACOCLAVICULAR LIGAMENT RECONSTRUCTION BETWEEN BY AUTOLOGOUS AND ALLOGENEIC TENDON GRAFTS COMBINED WITH HOOK PLATE FIXATION FOR TREATING ACROMIOCLAVICULAR JOINT DISLOCATION].

PubMed

Yin, Fei; Sun, Zhenzhong; Wei, Xuming; Liu, Xueguang; Zhou, Ming; Zhuang, Yin; Song, Sheng

2016-05-08

To compare the effectiveness of coracoclavicular ligament reconstruction between by using autologous plantaris tendon graft combined with hook plate fixation and allogeneic tendon graft combined with hook plate fixation for treating acromiocavicular joint dislocation. Thirty-three patients with acromioclavicular joint dislocation who accorded with the inclusion criteria between January 2013 and June 2014 were assigned into 2 groups. The patients were treated with autologous plantaris tendon graft combined with hook plate fixation in group A ( n =17), and with allogeneic tendon graft combined with hook plate fixation in group B ( n =16). Thirteen-one patients was followed up more than 12 months (15 in group A and 16 in group B). There was no significant difference in gender, age, cause of injury, sides, time between injury and surgery, and type of dislocation ( P >0.05). The assessments included operation time, hospitalization time, hospitalization expenses, shoulder range of motion, gap of acromioclavicular, Constant-Murley scores, and visual analogue scale (VAS) for pain. The operation time of group A was significantly longer than that of group B, and the hospitalization expense was significantly lower than that of group B ( P <0.05). There was no significant difference in hospitalization time ( t =1.046, P =0.316). The incisions healed by first intention, and hook plate was removed after 3 months. The mean follow-up time was 21.3 months (range, 19-34 months) in group A and was 23.7 months (range, 18-37 months) in group B. X-ray examination showed no osteolysis. There was no significant difference in gap of acromiocavicular between 2 groups at preoperation, 1 week after operation, and last follow-up ( P >0.05). No redislocation of acromioclavicular joint and rejection reaction occurred during follow-up. At last follow-up, there was no significant difference in shoulder range of motion, Constant-Murley score, and VAS score between 2 groups ( P >0.05). Coracoclavicular ligament reconstruction by autologous plantaris tendon or allogeneic tendon graft combined with hook plate fixation for the treatment of acromioclavicular joint dislocation can achieve good effectiveness. The appropriate treatment should be chosen according to the patient's economic situation.

Association of QCT Bone Mineral Density and Bone Structure With Vertebral Fractures in Patients With Multiple Myeloma.

PubMed

Borggrefe, Jan; Giravent, Sarah; Thomsen, Felix; Peña, Jaime; Campbell, Graeme; Wulff, Asmus; Günther, Andreas; Heller, Martin; Glüer, Claus C

2015-07-01

Computed tomography (CT) is used for staging osteolytic lesions and detecting fractures in patients with multiple myeloma (MM). In the OsteoLysis of Metastases and Plasmacell-infiltration Computed Tomography 2 study (OLyMP-CT) study we investigated whether patients with and without vertebral fractures show differences in bone mineral density (BMD) or microstructure that could be used to identify patients at risk for fracture. We evaluated whole-body CT scans in a group of 104 MM patients without visible osteolytic lesions using an underlying lightweight calibration phantom (Image Analysis Inc., Columbia, KY, USA). QCT software (StructuralInsight) was used for the assessment of BMD and bone structure of the T11 or T12 vertebral body. Age-adjusted standardized odds ratios (sORs) per SD change were derived from logistic regression analyses, and areas under the receiver operating characteristics (ROC) curve (AUCs) analyses were calculated. Forty-six of the 104 patients had prevalent vertebral fractures (24/60 men, 22/44 women). Patients with fractures were not significantly older than patients without fractures (mean ± SD, 64 ± 9.2 versus 62 ± 12.3 years; p = 0.4). Trabecular BMD in patients with fractures versus without fractures was 169 ± 41 versus 192 ± 51 mg/cc (AUC = 0.62 ± 0.06, sOR = 1.6 [1.1 to 2.5], p = 0.02). Microstructural variables achieved optimal discriminatory power at bone thresholds of 150 mg/cc. Best fracture discrimination for single microstructural variables was observed for trabecular separation (Tb.Sp) (AUC = 0.72 ± 0.05, sOR = 2.4 (1.5 to 3.9), p < 0.0001). In multivariate models AUCs improved to 0.77 ± 0.05 for BMD and Tb.Sp, and 0.79 ± 0.05 for Tb.Sp and trabecular thickness (Tb.Th). Compared to BMD values, these improvements of AUC values were statistically significant (p < 0.0001). In MM patients, QCT-based analyses of bone structure derived from routine CT scans permit discrimination of patients with and without vertebral fractures. Rarefaction of the trabecular network due to plasma cell infiltration and osteoporosis can be measured. Deterioration of microstructural measures appear to be of value for vertebral fracture risk assessment and may indicate early stages of osteolytic processes not yet visible. © 2014 American Society for Bone and Mineral Research.

Large femoral heads decrease the incidence of dislocation after total hip arthroplasty: a randomized controlled trial.

PubMed

Howie, Donald W; Holubowycz, Oksana T; Middleton, Robert

2012-06-20

The use of larger femoral heads has been proposed to reduce the risk of dislocation after total hip arthroplasty, but there is a lack of evidence to support this proposal. The aim of this multicenter randomized controlled trial was to determine whether the incidence of dislocation one year after total hip arthroplasty is significantly lower in association with the use of a 36-mm femoral head articulation as compared with a 28-mm articulation. Six hundred and forty-four middle-aged and elderly patients undergoing primary or revision arthroplasty were randomized intraoperatively to receive either a 36 or 28-mm metal femoral head on highly cross-linked polyethylene. Patients who were at high risk of dislocation (including those with dementia and neuromuscular disease) and those undergoing revision for the treatment of recurrent hip dislocation or infection were excluded. Patients were stratified according to other potential risk factors for dislocation, including diagnosis and age. Diagnosis of hip dislocation required confirmation by a physician and radiographic evidence of a dislocation. Overall, at one year of follow-up, hips with a 36-mm femoral head articulation had a significantly lower incidence of dislocation than did those with a 28-mm articulation (1.3% [four of 299] compared with 5.4% [seventeen of 316]; difference, 4.1% [95% confidence interval, 1.2% to 7.2%]) when controlling for the type of procedure (primary or revision) (p = 0.012). The incidence of dislocation following primary arthroplasty was also significantly lower for hips with a 36-mm femoral head articulation than for those with a 28-mm articulation (0.8% [two of 258] compared with 4.4% [twelve of 275]; difference, 3.6% [95% confidence interval, 0.9% to 6.8%]) (p = 0.024). The incidence of dislocation following revision arthroplasty was 4.9% (two of forty-one) for hips with a 36-mm articulation and 12.2% (five of forty-one) for hips with a 28-mm articulation; this difference was not significant with the relatively small sample size of the revision group (difference, 7.3% [95% confidence interval, -5.9% to 21.1%]) (p = 0.273). Compared with a 28-mm femoral head articulation, a larger 36-mm articulation resulted in a significantly decreased incidence of dislocation in the first year following primary total hip arthroplasty. However, before a 36-mm metal-on-highly cross-linked polyethylene articulation is widely recommended, the incidence of late dislocation, wear, periprosthetic osteolysis, and liner fracture should be established.

Bisphosphonates as adjuvant therapy for breast cancer.

PubMed

Burkinshaw, Roger; Coleman, Robert

2006-01-01

Great strides have been made over the last 20 years in the treatment of breast cancer and despite an increasing incidence, the number of deaths has fallen sharply since the late 1980s. The advent of new therapies, including taxanes and aromatase inhibitors, and exciting results announced recently using trastuzumab in the adjuvant treatment of HER2-positive patients should decrease this even further. However, although most patients present with disease that appears to be localized to the breast, a significant proportion of women will eventually develop metastatic breast cancer. Therefore, the detection and treatment of micrometastatic disease represents perhaps the most important remaining challenge in breast cancer management, and is the focus of extensive ongoing research. Bone is the most frequent site of distant relapse, accounting for approximately 40% of all first recurrences. In addition to the well recognized release of bone cell-activating factors from the tumor, it is now appreciated that the release of bone-derived growth factors and cytokines from resorbing bone can attract cancer cells to the bone surface and facilitate their growth and proliferation. Bisphosphonates are potent inhibitors of bone osteolysis and the inhibition of bone resorption could therefore have an effect on the development and progression of metastatic bone disease. They could represent an adjuvant therapeutic strategy of potential importance. Clinical trial results with the early bisphosphonate, clodronate, have proved inconclusive. A large, randomized, controlled trial has recently completed accrual and should provide the definitive answer to the question of the role of clodronate in this setting. More potent second- and third-generation bisphosphonates have also shown enhanced antitumor effects in preclinical evaluation and further studies are required to determine whether this antitumor potential of bisphosphonates translates to the clinical setting. Adjuvant bisphosphonates are, therefore, currently only recommended in the research setting and clinical trials evaluating the adjuvant use of these newer compounds are currently recruiting or being established. This article will review in more detail the rationale for the adjuvant use of bisphosphonates, the results of early trials, the progress of the later trials and the potential future role of bisphosphonates in the adjuvant treatment of breast cancer. In addition, it is increasingly acknowledged that many cancer treatments have detrimental effects on bone and can increase the risk of fracture. The increasing use of aromatase inhibitors, in particular, will become a major cause of treatment-induced bone loss. This bone loss can be prevented with bisphosphonate treatment and this will also be discussed.

The development of whole blood titanium levels after instrumented spinal fusion – Is there a correlation between the number of fused segments and titanium levels?

PubMed Central

2012-01-01

Background Most modern spinal implants contain titanium and remain in the patient’s body permanently. Local and systemic effects such as tissue necrosis, osteolysis and malignant cell transformation caused by implants have been described. Increasing tissue concentration and whole blood levels of ions are necessary before a disease caused by a contaminant develops. The aim of the present study was the measurement of whole blood titanium levels and the evaluation of a possible correlation between these changes and the number of fused segments. Methods A prospective study was designed to determine changes in whole blood titanium levels after spinal fusion and to analyze the correlation to the number of pedicle screws, cross connectors and interbody devices implanted. Blood samples were taken preoperatively in group I (n = 15), on the first, second and 10th day postoperatively, as well as 3 and 12 months after surgery. Group II (n = 16) served as a control group of volunteers who did not have any metal implants in the body. Blood samples were taken once in this group. The number of screw-rod-connections and the length of the spinal fusion were determined using radiographic pictures. This study was checked and approved by the ethical committee of the University of Tuebingen. Results The mean age in group I was 47 ± 22 years (range 16 - 85 years). There were three male (20%) and twelve female (80%) patients. The median number of fused segments was 5 (range 1 to 11 segments). No statistically significant increase in the titanium level was seen 12 months after surgery (mean difference: -7.2 μg/l, 95% CI: -26.9 to 12.5 μg/l, p = 0.446). By observing the individual titanium levels, 4 out of 15 patients demonstrated an increase in titanium levels 12 months after surgery. No statistically significant correlation between fused segments (r = -0.188, p = 0.503) length of instrumentation (r = -0.329, p = 0.231), number of interbody devices (r = -0.202, p = 0.291) and increase of titanium levels over the observation period was seen. Conclusions Instrumented spinal fusion does not lead to a statistically significant increase in whole blood titanium levels. There seems to be no correlation between the number of pedicle screws, cross connectors and interbody devices implanted and the increase of serum titanium levels. PMID:22925526

Correlation of Cup Inclination Angle with Liner Wear for Metal-on-polyethylene in Hip Primary Arthroplasty.

PubMed

Tian, Jia-Liang; Sun, Li; Hu, Rui-Yin; Han, Wei; Tian, Xiao-Bin

2017-05-01

The relationship between cup inclination angle and liner wear is controversial. Most authors in the published literature agree that the ideal cup inclination is associated with lower inner wear; however, some disagree. All previous studies did not control for femoral head diameter and inclination, so it is difficult to assess the relative or synergistic effects of cup angle on outcomes. We retrospectively reviewed 154 patients (171 hips) with primary total hip arthroplasties performed from 2001 to 2004. All surgeries had been performed by the same physician team. A posterior approach was applied in all patients. All prostheses were non-cemented cups with a 28-mm metal head. Inclusion criteria included that the radiographic material was not completed or lost for primary or last follow up. Patients were divided into four groups according to different cup inclination angle. There were 108 hips with inclination angles below 50°; 35 hips with angles between 50° and 55°; 17 hips with angles between 55° and 60°; and 11 hips with angles greater than 60°. An immediate postoperative radiograph was compared with a follow-up radiograph. Clinical and radiographic data were collected on standardized hip evaluation forms preoperatively, 6 months after surgery and at yearly follow-up visits. Radiographs were digitized and enlarged 100%. After the radiographs were digitized, polyethylene wear rates and acetabular cup abduction were measured on all patients with Cavas 15.0 software. The results were analyzed using Student's two-tailed paired t-test with SPSS 11.5. The preoperative mean Harris hip score improved from 45.36 to 93.5 points 10 years after surgery. No acetabular component was revised for aseptic loosening. Three patients (three hips) had to undergo bone grafting and a lined arthroplasty for severe osteolysis around the acetabular component. The rate of implant survival at 10 years with respect to loosening was 100%. The mean liner wear rate was 0.135 mm/year in cups with inclination angles below 50°, 0.144 mm/year between 50° and 55°, 0.260 mm/year between 55° and 60°, and 0.403 mm/year when the angle was greater than 60°. Liner wear increased when the cup angle was larger than 55° (P < 0.05). For metal-on-polyethylene prostheses, liner wear correlates with cup inclination angle larger than 55°. The ideal abduction angle for metal-on-polyethylene prostheses is less than 55°. © 2017 Chinese Orthopaedic Association and John Wiley & Sons Australia, Ltd.

First metatarsophalangeal joint replacement with modular three-component press-fit implant. Preliminary report.

PubMed

Kolodziej, L; Bohatyrewicz, A; Zietek, P

2013-01-01

The aim of this retrospective study was to assess functional and radiographic results of the first metatarsophalangeal joint replacement with use of unconstrained, modular, three components, porous titanium and hydroxyapatite coated, press-fit METIS® prosthesis. According to author's knowledge, results of that type of prosthesis have never been published before. 25 prosthesis were implanted in 24 patients between February 2009 and May 2011. American Orthopaedic Foot and Ankle Society Hallux Metatarsophalangeal Interphalangeal scoring system (AOFAS-HMI) was used to assess functional results. Patients were also asked if they would undergo procedure again or recommend it to other people. Weight bearing radiographs ware made at final follow up and analyzed for presence of osteolysis and radiolucencies. In 8 patients total joint replacement was introduced as a salvage after failure of previous surgery like Keller resection arthroplasty, failed arthrodesis, avascular necrosis and postoperative arthritis. In 11 patients the reason for prosthetic replacement were hallux rigidus, in 4 cases rheumatoid arthritis and gout in one patient. In two patients additional procedures like Akin phalangeal osteotomy and in one case fifth metatarsal osteotomy, was performed. There were 20 females and 4 males in presented group. The mean age at the operation was 56 years. The average follow up period was 18 months (from 12 to 36 months). The median postoperative value of AOFAS-HMI scores was 88 points (from 75 to 95 points). First metatarsophalangeal joint motion (dorsiflexion plus plantarflexion) was classified according to AOFAS-HMI ranges as: moderately restricted (between 30 to 70 degrees) in 19 patients 80% (20 prosthesis) and severely restricted (less then 30 degrees) in 5 patients (20%). 15 (64%) patients were completely satisfied, 5 (20%) reported moderate satisfaction and (16%) 4 were totally disappointed and would not undergo this procedure again. A limited hallux dorsiflexion was the main dissatisfaction reason. Partial radiolucent line was seen in one patient (4%). Authors noticed two serious complications. In one patient, with rheumatoid arthritis, deep infection occurred 12 months after prosthesis implantation. In second case phalangeal implant was revised due to misalignment. METIS® metatarsophalangeal joint replacement allows alleviate of pain relating to hallux rigidus and partial restoration of joint movement, even in patients after failures of primary metatarsophalangeal joint surgery. AOFAS-HMI results are better than previously reported in the literature in assessment of the first metatarsophalangeal joint replacement. Radiographic results imply satisfactory bone ingrowth into the cementless implants.

Evora® chromium-cobalt dual mobility socket: results at a minimum 10 years' follow-up.

PubMed

Leclercq, S; Benoit, J Y; de Rosa, J P; Tallier, E; Leteurtre, C; Girardin, P H

2013-12-01

The Evora chromium-cobalt alloy dual mobility socket claims to display a large articulation tribology different from that of stainless steel models, limiting the risk of intraprosthetic dislocation and wear. The present study reports a minimum of 10years' follow-up in a multicenter prospective series of 200 sockets previously reported on at 5years. The use of chromium-cobalt in dual mobility sockets provides a low rate of failure at 10years, especially as regards to osteolysis and intraprosthetic dislocation. Two hundred hydroxyapatite-coated molded chromium-cobalt sockets without titanium interface were implanted without cement in 194 patients with a mean age of 70 years (range, 32-91 years). Clinical results were assessed on Postel Merle d'Aubigné and Harris scores, plain radiographs and survival analysis. At a mean 11 years' follow-up (10-13 years), 56 patients had died and 31 were lost to follow-up. Four underwent surgical revision (3 femoral components, and 1 socket for migration at 9 years with complete disappearance of the hydroxyapatite). A total of 109 implants were analyzable in 107 patients with a mean age of 81 years (55-93 years). At follow-up, the mean Harris score was 90 (75-96) and the PMA score 16.3 (14-18). There were no cases of loosening (except for the case reoperated on at 9 years) and no acetabular radiolucency or cysts. There were 2 cases of non-evolutive femoral radiolucency and 10 of femoral granuloma, involving head size > 22 mm (P<0.0001) and a cemented titanium stem (P=0.004) as risk factors. There were no dislocations in the large or small articulation. Ten-year survival was 99% (95% CI: 97.3%-100%) with socket revision as censorship criterion. The absence of dislocation in both small and large articulations confirmed the efficacy of the dual mobility concept and suggested an advantage for chromium-cobalt sockets in reducing the rate of intraprosthetic dislocation and preventing blockage of the large articulation by a better performance in the friction couple. Granulomas were associated with wear in cemented titanium stems and with heads greater than 22 mm in diameter. Ten-year survival was 99% (censorship criterion: revision for socket failure); there was, however, one case of socket loosening with disappearance of the hydroxyapatite, indicating that surveillance should be continued in this cohort. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

[Mid-term effectiveness of rotating hinge knee prosthesis for severe knee deformity].

PubMed

Zeng, Min; Hu, Yihe; Xie, Jie; Li, Mingqing; Lin, Shaoru

2014-01-01

To evaluate the mid-term effectiveness of rotating hinge knee prosthesis for severe knee deformity. A retrospective analysis was made on the clinical data of 24 patients (24 knees) who received rotating hinge knee prosthesis for total knee arthroplasty between January 2003 and June 2011. There were 14 males and 10 females, aged from 60 to 81 years (mean, 70 years). The disease causes included osteoarthritis in 5 cases, rheumatoid arthritis in 7 cases, traumatic arthritis in 9 cases, and Charcot's arthropathy in 3 cases. The disease duration ranged from 5 to 25 years (mean, 14.5 years). Of them, 13 cases had flexion deformity, 7 cases had valgus deformity, and 16 cases had varus deformity. The operation time, the amount of bleeding between operation and drainage-tubes removal, hospitalization time, incision healing, and complications were recorded. The results were evaluated according to Knee Society Score (KSS), visual analogue scale (VAS), and the range of motion (ROM) of knee. Short-form 36 health survey scale (SF-36) was used to evaluate the life quality of patients. The position of prosthesis was observed through X-ray examination. The operation time ranged from 70 to 90 minutes (mean, 78 minutes). The amount of bleeding between operation and drainage-tubes removal ranged from 400 to 1 000 mL (mean, 650 mL). The hospitalization time ranged from 14 to 18 days (mean, 15.2 days). Patellar fracture occurred in 1 case (4.17%) during operation, swelling and effusion of incision in 1 case (4.17%), and periprosthetic infections in 2 cases (8.33%) after operation. All patients were followed up 2-10 years (mean, 5.5 years). The X-ray films showed no evidence of obvious radiolucent line, osteolysis, prosthesis subsidence, and limb alignment change. The results of KSS, VAS socres, and ROM of knee at 1 year postoperatively and last follow-up were significantly better than preoperative ones (P < 0.05), but no significant difference was found between at 1 year postoperatively and last follow-up (P > 0.05). The physiological function and body pain scores were significantly lower than the reference value of urban men over 60 years old from Sichuan province (t = 2.42, P = 0.02; t = 5.26, P = 0.00), but no significant difference was found in the other scores of the SF-36 when compared with the reference value (P > 0.05). The mid-term effectiveness of total knee arthroplasty using rotating hinge knee for severe knee prosthesis deformity is satisfactory. But complications of postoperative infection should be emphasized.

The lexicon of polyethylene wear in artificial joints.

PubMed

McKellop, Harry A

2007-12-01

The analysis of wear on polyethylene components that have been retrieved after use in patients has provided invaluable understanding of how wear occurs in vivo, and how it may be minimized through improved materials and implant design. The great number of such studies that have been published over the past three decades has lead to an extensive vocabulary to describe the tribology of prosthetic joints. However, these also have led to some confusion, due to the occasional misuse of terms from classical tribology, along with the use of multiple terms to describe the same wear phenomenon, and vice versa. The author has proposed that our understanding of wear in artificial joints may be enhanced by recognizing that there are four general subject areas: Modes, Mechanisms, Damage and Debris. Wear Mode 1 occurs when the two bearing surfaces are articulating against each other in the manner intended by the implant designer. Mode 2 occurs when a bearing surface articulates against a non-bearing surface. Mode 3 occurs when third-body abrasive particles have become entrapped between the two bearing surfaces, and Mode 4 occurs when two non-bearing surfaces are wearing against each other. The least wear occurs in Mode 1, whereas severe wear typically occurs in Modes 2, 3 and 4. The classical wear mechanisms that apply to prosthetic joints include adhesion, abrasion and fatigue. These can occur in varying amounts in either of the four wear modes. As used in the literature for the past three decades, wear "damage" can best be defined as the change surface texture or morphology that is caused by the action of the wear mechanisms. Although a wide variety of terms have been used, an overview of the literature indicates that about eight terms have been sufficient to describe the types of damage that occur on retrieved polyethylene components, i.e., burnishing, abrasion, scratches, plastic deformation, cracks, pits, delamination, and embedded third bodies. The author suggests that, as far as possible, investigators endeavor to limit their descriptions of surface damage to these terms and, importantly, to clearly and consistently distinguish the classical wear mechanisms from the types of damage produced by those mechanisms. Wear debris refers to the billions of particles, some measuring in nanometers, that are generated by the wear mechanisms, and that initiate biological reactions, such as osteolysis, that may lead to the failure of the implant. As the methods for recovering wear debris from joint fluids and tissues are improved, investigators are using a growing number of terms to describe them. As with the types of damage, it will be important in the coming years to maximize clarity and minimize redundancy of the vocabulary in this important area of research.

Two- to 4-Year Followup of a Short Stem THA Construct: Excellent Fixation, Thigh Pain a Concern.

PubMed

Amendola, Richard L; Goetz, Devon D; Liu, Steve S; Callaghan, John J

2017-02-01

Short stem cementless femoral components were developed to aid insertion through smaller incisions, preserve metaphyseal bone, and potentially decrease or limit the incidence of thigh pain. Despite some clinical success, the senior author (DDG) believed a higher percentage of his patients who had received a cementless short stem design were experiencing thigh pain, which, coupled with concerns about bone ingrowth fixation, motivated the review of this case series. (1) What is the proportion of patients treated with a short stem cementless THA femoral component that develop thigh pain and what are the hip scores of this population? (2) What are the radiographic results, specifically with respect to bone ingrowth fixation and stress shielding, of this design? (3) Are there particular patient or procedural factors that are associated with thigh pain with this short stem design? Two hundred sixty-one primary THAs were performed in 238 patients by one surgeon between November 2010 and August 2012. During this time period, all patients undergoing primary THA by this surgeon received the same cementless short titanium taper stem. Seven patients (eight hips) died and five patients (five hips) were lost to followup, leaving 226 patients (248 hips) with a mean followup of 3 years (range, 2-5 years). Patients rated their thigh pain during activity or rest at final followup on a 10-point visual analog scale. Harris hip scores (HHS) were obtained at every clinic appointment. Thigh pain was evaluated at the final followup or by contacting the patient by phone. Radiographs were evaluated for bone-implant fixation, bone remodeling, and osteolysis. An attempt was made to correlate thigh pain with patient demographics, implant specifications, or radiographic findings. Seventy-six percent of hips (180 of 238) had no thigh pain, 16% of hips (37 of 238) had mild thigh pain, and 9% (21 of 238) had moderate or severe thigh pain. Preoperatively, mean HHS was 47 (SD, 16) and at last followup, mean HHS was 88 (SD, 13). There were two femoral revisions, one for severe thigh pain and the other for infection. All but two components demonstrated bone ingrowth fixation (99%). Femoral stress shielding was mild in 64% of hips (135 of 212), moderate in 0.5% (one of 212), and severe in no hips. There is an inverse linear relationship between age and severity of thigh pain (r = -0.196; p < 0.0024). Although reliable fixation was achieved and good HHS were attained, the frequency and severity of thigh pain with this short cementless stem were concerning. The surgeon has subsequently abandoned this short stem design and returned to a conventional length stem. Future study direction might investigate the biomechanical grounds for the thigh pain associated with this stem design. Level IV, therapeutic study.

[Determination of a Friction Coefficient for THA Bearing Couples].

PubMed

Vrbka, M; Nečas, D; Bartošík, J; Hartl, M; Křupka, I; Galandáková, A; Gallo, J

2015-01-01

The wear of articular surfaces is considered one of the most important factors limiting the life of total hip arthroplasty (THA). It is assumed that the particles released from the surface of a softer material induce a complex inflammatory response, which will eventually result in osteolysis and aseptic loosening. Implant wear is related to a friction coefficient which depends on combination of the materials used, roughness of the articulating surfaces, internal clearance, and dimensions of the prosthesis. The selected parameters of the bearing couples tested were studied using an experimental device based on the principle of a pendulum. Bovine serum was used as a lubricant and the load corresponded to a human body mass of 75 kg. The friction coefficient was derived from a curve of slowdown of pendulum oscillations. Roughness was measured with a device working on the principle of interferometry. Clearance was assessed by measuring diameters of the acetabular and femoral heads with a 3D optical scanner. The specimens tested included unused metal-on-highly cross-linked polyethylene, ceramic-on-highly cross-linked polyethylene and ceramic-on-ceramic bearing couples with the diameters of 28 mm and 36 mm. For each measured parameter, an arithmetic mean was calculated from 10 measurements. 1) The roughness of polyethylene surfaces was higher by about one order of magnitude than the roughness of metal and ceramic components. The Protasul metal head had the least rough surface (0.003 μm). 2) The ceramic-on-ceramic couples had the lowest clearance. Bearing couples with polyethylene acetabular liners had markedly higher clearances ranging from 150 μm to 545 μm. A clearance increased with large femoral heads (up to 4-fold in one of the couple tested). 3) The friction coefficient was related to the combination of materials; it was lowest in ceramic-on-ceramic surfaces (0.11 to 0.12) and then in ceramic-on-polyethylene implants (0.13 to 0.14). The friction coefficient is supposed to increase with a decreasing femoral head diameter. However, in the bearing couples with polyethylene liners manufactured by one company, paradoxically, the friction coefficient slightly increased with an increase in femoral head size from 28 mm to 36 mm. 4) The lowest friction moment (< 3.5 Nm) was found for ceramic-on-ceramic implants 28 mm in diameter; the highest values were recorded in metal-on-polyethylene bearing couples 36 mm in diameter (> 7 Nm). Although our study confirmed that the bearing couples produced by different manufacturers varied to some extent in the parameters studied, in our opinion, this variability was not significant because it was not within an order of magnitude in any of the tests. The study showed that both the friction coefficient and the friction moment are affected more by the combination of materials than by the diameter of a femoral head. The best results were achieved in ceramic-on-ceramic implants.

[Poldi-Čech cemented femoral stem in total hip arthroplasty after 25 years].

PubMed

Rozkydal, Z; Janíček, P

2010-08-01

The aim of the study was to evaluate the results of Poldi-Čech femoral stem implantation in primary total hip arthroplasty after 25 years. A group of 65 patients (90 hips) with Poldi-Čech total hip arthroplasty carried out between 1974 and 1984 was evaluated at the end of 2009. The mean follow-up of all patients was 28 years (25 to 35). There were seven men and 58 women. The mean age at the time of implantation was 43 years (26 to 60) and at the latest follow-up it was 72 years. In all patients the cemented UHMW PE acetabular component (RCH 1000) was used together with AKV Ultra 2 Poldi steel femoral stems (1st, 2nd and 3rd generations). The stem was a monoblock with a 32-mm head. The evaluation of the results was based on the Harris hip score and X ray with an A-P view of the pelvis and the affected hip. Statistical analysis was made using the life-table method. At the latest follow up the mean Harris score was 69.7 points (40 to 88). There were 69 hips with an original Poldi-Čech femoral component still in situ, 64 of them were stable and five with radiological evidence of aseptic loosening. Five patients had undergone Girdlestone resection arthroplasty for septic loosening. Thirteen patients (16 hips) had femoral stem revision. The cumulative proportion of clinical survivorship of the Poldi-Čech femoral stem, with revision for any reason as the endpoint, .was 0.93 at 6 years, 0.84 at 12 years, and 0.77 at 18, 24 and 30 years after the index surgery. Radiographic findings revealed 64 hips with stable stems, five hips with ;aseptic loosening (probable, 0 possible, 2, definite, 3). Six- teen hips were after revision surgery for aseptic loosening of the stem and five hips were after Girdlestone resection arthroplasty for septic failure. The cumulative proportion of radiological survivorship of the Poldi-Čech femoral stem with any reason as the endpoint was 0.92 at 6 years, 0.78 at 12 years, 0.72 at 18 years, 0.69 at 24 years and 0.69 at 30 years. The Poldi-Čech stem with its anatomical shape and a highly polished surface meets the principles of successful composite beam stems. Its disadvantage is a valgus neck- shaft angle of 140° giving lower femoral offset and the risk of development of valgus deformity of the ipsilateral knee. In most cases osteolysis, radiolucent lines and bone rarefaction of the femur resulted from polyethylene wear of the acetabular component. This study demonstrates a long-term survivorship of the Poldi-Čech femoral component in patients undergoing total hip arthroplasty 25 to 35 years ago.

Comparison of transforaminal lumbar interbody fusion outcomes in patients receiving rhBMP-2 versus autograft.

PubMed

Khan, Taleef R; Pearce, Kalin R; McAnany, Steven J; Peters, Colleen M; Gupta, Munish C; Zebala, Lukas P

2018-03-01

Recombinant human bone morphogenetic protein 2 (rhBMP-2) plays a pivotal role in complex spine surgery. Despite its limited approval, the off-label use of rhBMP-2 is prevalent, particularly in transforaminal lumbar interbody fusions (TLIFs). To determine the effectiveness and safety of rhBMP-2 use in TLIF procedures versus autograft. Retrospective cohort study. Patients older than 18 years undergoing spine surgery for lumbar degenerative spine disease at a single academic institution. Clinical outcome was determined according to patient records. Radiographic outcome was determined according to plain X-rays and computed tomography (CT). A retrospective study from 1997 to 2014 was conducted on 191 adults undergoing anterior-posterior instrumented spinal fusion with TLIF at a single academic institution. Patient data were gathered from operative notes, follow-up clinic notes, and imaging studies to determine complications and fusion rates. One hundred eighty-seven patients fit the criteria, which included patients with a minimum of one TLIF, and had a minimum 2-year radiographic and clinical follow-up. Patients were further classified into a BMP group (n=83) or non-BMP group (n=104). Three logistic regression models were run using rhBMP-2 exposure as the independent variable. The respective outcome variables were TLIF-related complications (radiculitis, seroma, osteolysis, and ectopic bone), surgical complications, and all complications. Bone morphogenetic protein (n=83) and non-BMP (n=104) groups had similar baseline demographics (sex, diabetes, pre-existing cancer). On average, the BMP and non-BMP groups were similarly aged (51.9 vs. 47.9 years, p>.05), but the BMP group had a shorter follow-up time (3.03 vs. 4.06 years; p<.001) and fewer smokers (8 vs. 21 patients; p<.048). The fusion rate for the BMP and non-BMP groups was 92.7% and 92.3%, respectively. The pseudoarthrosis rate was 7.5% (14 of 187 patients). Radiculitis was observed in seven patients in the BMP group (8.4%) and two patients in the non-BMP group (1.9%). Seroma was observed in two patients in the BMP group (2.4%) and none in the non-BMP group. No deep infections were observed in the BMP group, and in one patient in the non-BMP group (0.96%). Although patients exposed to BMP were at a significantlygreater risk of developing radiculitis and seroma (odds ratio [OR]=4.53, confidence interval [CI]=1.42-14.5), BMP exposure was not a significant predictor of surgical complications (OR=0.32, CI=0.10-1.00) or overall complications (OR=1.11, CI=0.53-2.34). The outcome of TLIF-related complications was too rare and the confidence interval too wide for practical significance of the first model. Evidence supports the hypothesis that off-label use of rhBMP-2 in TLIF procedures is relatively effective for achieving bone fusion at rates similar to patients receiving autograft. Patients exhibited similar complication rates between the two groups, with the BMP group exhibiting slightly higher rates of radiculitis and seroma. Copyright © 2017 Elsevier Inc. All rights reserved.

Tapered stems one-third proximally coated have higher complication rates than cylindrical two-third coated stems in patients with high hip dislocation undergoing total hip arthroplasty with step-cut shortening osteotomy.

PubMed

Ozden, V Emre; Dikmen, G; Beksac, B; Tozun, I Remzi

2017-06-01

The results of cementless stems in total hip arthroplasty (THA) done because of congenital dislocation with step-cut osteotomy is not well known, particularly the influence of the design and the role of extent of porous coating. Therefore we performed a retrospective study to evaluate the mid to long-term results THA performed with a single type acetabular component and different geometry and fixation type stems with ceramic bearings in the setting of step-cut subtrochanteric osteotomy in high hip dislocated (HHD) patients. We asked if the stem type affect the outcomes in terms of (1) intra and postoperative complication rates (2) radiographic outcomes (3) prosthesis survival in step-cut subtrochanteric shortening osteotomy. The type of the stem, whether cylindrical or tapered does not affect the outcome if the femoral canal fit and fill is obtained and the step-cut femoral shortening osteotomy is primarily fixed. Forty-five hips in 35 patients with a mean follow up of 10 years (range, 7-14 years) were evaluated. The single type cementless cup was placed at the level of the true acetabulum, a step-cut shortening femoral osteotomy was performed and reconstruction was performed with two different types of tapered stem in twenty-two hips (Synergy™ and Image™ proximally coated, Smith and Nephew, Menphis, TN, USA) and one type of cylindrical stem (Echelon™ with 2/3 coated, Smith and Nephew, Menphis, TN, USA) in twenty-three hips. Harris hip scores (HHS) and a University of California Los Angeles (UCLA) activity scores were calculated for all patients and successive X-rays were evaluated regarding component loosening and osteolysis, along with complications related to bearing, step-cut osteotomy and stem types. Forty-one hips (91%) had good and excellent clinical outcome according to HHS. The mean UCLA activity scores improved from 3.2±0.6 points (range, 2-4) preoperatively to 6.3 points±0.5 (range, 5-7) at the latest follow-up. The mean femoral shortening was 36±10mm (range, 20-65mm). Four (9%) dislocations were observed. There were five (11%) intra-operative femoral fractures and three (7%) cases of non-union, which were observed in tapered stems. Cylindrical stems had superior neutral alignment primarily. With any stem revision as the end point, cylindrical stems had a higher survival rate (100%) than all tapered stems (82%; 95% confident interval [CI] 77-97%) at ten years. With any revision as the end point, the 10-year survival rate for acetabular component (Reflection-Ceramic Interfit) and for femoral components were 98% (95% CI, 85-99%) and 91% (95% CI, 78-97%), respectively. There were more implant related complications in HHD patients undergoing THA when tapered stems with 1/3 proximal coating were used to reconstruct a step cut osteotomized femur, compared to cylindrical stems 2/3 coated. IV, retrospective study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Poor Survivorship and Frequent Complications at a Median of 10 Years After Metal-on-Metal Hip Resurfacing Revision.

PubMed

Matharu, Gulraj S; Pandit, Hemant G; Murray, David W

2017-02-01

High short-term failure rates have been reported for several metal-on-metal hip resurfacing (MoMHR) designs. Early observations suggested that MoMHRs revised to total hip arthroplasties (THAs) for pseudotumor had more major complications and inferior patient-reported outcomes compared with other revision indications. However, little is known about implant survivorship and patient-reported outcomes at more than 5 years after MoMHR revision. (1) What are the implant survivorship, proportion of complications and abnormal radiological findings, and patient-reported outcomes at a median of 10 years after MoMHR revision surgery? (2) Are survivorship, complications, and patient-reported outcomes influenced by revision indication? (3) Do any other factors predict survivorship, complications, and patient-reported outcomes? Between 1999 and 2008, 53 MoMHR revision procedures in 51 patients (mean age, 55 years; 62% female) were performed at one center and were all included in this retrospective study. Two patients (4%) were lost to followup and two patients (4%) died before a minimum followup of 7 years (median, 10.3 years; range 7-15 years). Revision indications included pseudotumor (n = 16), femoral neck fracture (n = 21), and other causes (n = 16). In most cases (62%, n = 33) both components were revised to a non-MoM bearing THA with the remainder (38%, n = 20: fracture, loosening, or head collapse) undergoing femoral-only revision to a large-diameter MoM THA. Postrevision complications, rerevision, Oxford Hip Score (OHS), and UCLA score were determined using both a longitudinally maintained institutional database and postal questionnaire. Implant survivorship was assessed using the Kaplan-Meier method (endpoint was rerevision surgery). Radiographs at latest followup were systematically assessed for any signs of failure (loosening, migration, osteolysis) by one observer blinded to all clinical information and not involved in the revision procedures. Overall, 45% (24 of 53) experienced complications and 38% (20 of 53) underwent rerevision. Ten-year survival free from rerevision for revised MoMHRs was 63% (95% confidence interval [CI], 48%-74%). Revision indications were not associated with differences in the frequency of complications or repeat revisions. With the numbers available, 10-year survival free from rerevision for pseudotumor revisions (56%; 95% CI, 30%-76%) was not different from the fracture (68%; 95% CI, 42%-85%; p = 0.359) and other groups (63%; 95% CI, 35%-81%; p = 0.478). Pseudotumor revisions had inferior OHSs (median, 21; range, 2-46; p = 0.007) and UCLA scores (median, 2; range, 2-7; p = 0.0184) compared with fracture and other revisions. Ten-year survival free from rerevision after femoral-only revision using another large-diameter MoM bearing was lower (p = 0.0498) compared with all component revisions using non-MoM bearings. After controlling for potential confounding variables such as age, sex, and revision indication, we found femoral-only revision as the only factor predicting rerevision (hazard ratio, 5.7; 95% CI, 1.1-29; p = 0.040). Poor implant survivorship and frequent complications were observed at a median of 10 years after MoMHR revision. However, patients undergoing femoral-only revisions with large-diameter MoM bearings had the worst survivorship, whereas patients revised for pseudotumor had the most inferior patient-reported outcomes. Our findings suggest these two patient subgroups require regular surveillance after MoMHR revision. Level III, therapeutic study.

What is the correlation of in vivo wear and damage patterns with in vitro TDR motion response?

PubMed Central

Kurtz, Steven M.; Patwardhan, Avinash; MacDonald, Daniel; Ciccarelli, Lauren; van Ooij, André; Lorenz, Mark; Zindrick, Michael; O’Leary, Patrick; Isaza, Jorge; Ross, Raymond

2008-01-01

Background Context Total disc replacements (TDRs) have been used to reduce pain and preserve motion. However, the comparison of polyethylene wear following long-term implantation to those tested using an in vitro model had not yet been investigated. Purpose The purpose of this study was to correlate wear and damage patterns in retrieved TDRs with motion patterns observed in a clinically validated in vitro lumbar spine model. We also sought to determine whether one-sided wear and motion patterns were associated with greater in vivo wear. Study Design This two-part study combined the evaluation of retrieved total disc replacements with a biomechanical study using human lumbar spines. Patient Sample 38 CHARITÉ lumbar artificial discs were retrieved from 32 patients (24 female, 75%) after 7.3 years average implantation (range: 1.8 to 16.1y). The components were implanted at L2/L3 (n=1), L3/L4 (n=2), L4/L5 (n=20), and L5/S1 (n=15). All the implants were removed due to intractable back pain and/or facet degeneration. In addition, they were removed due to subsidence (n=10), anterior migration (n=3), core dislocation (n=2), lateral subluxation (n=1), endplate loosening (n = 2), and osteolysis (n=1). In parallel, 7 new implants were evaluated at L4-L5 and 13 implants at L5-S1 in an in vitro lumbar spine model. Outcome Measures Retrieval analysis included evaluation of clinical data, dimensional measurements and assessment of the extent and severity of PE surface damage mechanisms. In vitro testing involved the observation of motion patterns during physiological loading. Methods For the retrievals, each side of the PE core was independently analyzed at the rim and dome for the presence of machining marks, wear, and fracture. 35 cores were further analyzed using MicroCT to determine whether the wear was one-sided, or symmetrically distributed. For the in vitro study the new implants were tested under physiologic loads (flexion-extension with a compressive follower preload) using a validated cadaveric lumbar spine model. The center of the prosthesis was 2 mm posterior to the mid-point of the vertebral body endplate in mid-sagittal plane. Motion patterns of the in vitro-tested implants were tracked using sequential video-flouroscopy. Results Substantial variability was observed in the wear patterns of the retrievals. 15/35 retrieved cores (43%) displayed one-sided wear patterns. The median dome penetration was 0.2 mm (range: 0.06 to 0.9 mm) and the median penetration rate was 0.04 mm/y (range: 0.01 to 0.2 mm/y). No significant difference in penetration or penetration rate was observed between retrievals with one-sided and symmetric wear patterns (p >0.05). Significant correlations were observed between implantation time and penetration (rho = 0.46, p = 0.004) and penetration rate (rho = −0.48, p = 0.003). In the in vitro study, there was clear visual evidence of motion at both articulations in 8/20 implantations. In additional 8/20 cases, there was some evidence of motion at both articulations; however, the predominant motion occurred at the top articulation. In 4/20 implantations motion could be visually detected only at the top articulation. Core entrapment and pinching was observed in 7/20 cases as the segment was extended, and was associated with visual evidence of core bending or deformation in 5/20 cases. PMID:18317190

Age of donor alters the effect of cyclic hydrostatic pressure on production by human macrophages and osteoblasts of sRANKL, OPG and RANK

PubMed Central

Evans, CE; Mylchreest, S; Andrew, JG

2006-01-01

Background Cyclic hydrostatic pressure within bone has been proposed both as a stimulus of aseptic implant loosening and associated bone resorption and of bone formation. We showed previously that cyclical hydrostatic pressure influenced macrophage synthesis of several factors linked to osteoclastogenesis. The osteoprotegerin/soluble receptor activator of NF-kappa β ligand /receptor activator of NF-kappa β (OPG/ RANKL/ RANK) triumvirate has been implicated in control of bone resorption under various circumstances. We studied whether cyclical pressure might affect bone turnover via effects on OPG/ sRANKL/ RANK. Methods In this study, cultures of human osteoblasts or macrophages (supplemented with osteoclastogenic factors) or co-cultures of macrophages and osteoblasts (from the same donor), were subjected to cyclic hydrostatic pressure. Secretion of OPG and sRANKL was assayed in the culture media and the cells were stained for RANK and osteoclast markers. Data were analysed by nonparametric statistics. Results In co-cultures of macrophages and osteoblasts, pressure modulated secretion of sRANKL or OPG in a variable manner. Examination of the OPG:sRANKL ratio in co cultures without pressurisation showed that the ratio was greater in donors <70 years at the time of operation (p < 0.05 Mann Whitney U) than it was in patients >70 years. However, with pressure the difference in the OPG:sRANKL ratios between young and old donors was not significant. It was striking that in some patients the OPG:sRANKL ratio increased with pressure whereas in some it decreased. The tendency was for the ratio to decrease with pressure in patients younger than 70 years, and increase in patients ≥ 70 years (Fishers exact p < 0.01). Cultures of osteoblasts alone showed a significant increase in both sRANKL and OPG with pressure, and again there was a decrease in the ratio of OPG:RANKL. Secretion of sRANKL by cultures of macrophages alone was not modulated by pressure. Only sRANKL was assayed in this study, but transmembrane RANKL may also be important in this system. Macrophages subjected to pressure (both alone and in co-culture) stained more strongly for RANK on immunohistochemstry than non-pressurized controls and 1,25-dihydroxyvitamin D3 (1,25 D3) further increased this. Immunocytochemical staining also demonstrated that more cells in pressurized co-cultures exhibited osteoclast markers (tartrate-resistant acid phosphatase, vitronectin receptor and multinuclearity) than did unpressurized controls. Conclusion These data show that in co-cultures of osteoblasts and macrophages the ratio of OPG : sRANKL was decreased by pressure in younger patients but increased in older patients. As falls in this ratio promote bone resorption, this finding may be important in explaining the relatively high incidence of osteolysis around orthopaedic implants in young patients. The finding that secretion of OPG and sRANKL by osteoblasts in monoculture was sensitive to hydrostatic pressure, and that hydrostatic pressure stimulated the differentiation of macrophages into cells exhibiting osteoclast markers indicates that both osteoblasts and preosteoclasts are sensitive to cyclic pressure. However, the effects of pressure on cocultures were not simply additive and coculture appears useful to examine the interaction of these cell types. These findings have implications for future therapies for aseptic loosening and for the development of tests to predict the development of this condition. PMID:16519799

Mechanical Unloading of Mouse Bone in Microgravity Significantly Alters Cell Cycle Gene Set Expression

NASA Astrophysics Data System (ADS)

Blaber, Elizabeth; Dvorochkin, Natalya; Almeida, Eduardo; Kaplan, Warren; Burns, Brnedan

2012-07-01

Spaceflight factors, including microgravity and space radiation, have many detrimental short-term effects on human physiology, including muscle and bone degradation, and immune system dysfunction. The long-term progression of these physiological effects is still poorly understood, and a serious concern for long duration spaceflight missions. We hypothesized that some of the degenerative effects of spaceflight may be caused in part by an inability of stem cells to proliferate and differentiate normally resulting in an impairment of tissue regenerative processes. Furthermore, we hypothesized that long-term bone tissue degeneration in space may be mediated by activation of the p53 signaling network resulting in cell cycle arrest and/or apoptosis in osteoprogenitors. In our analyses we found that spaceflight caused significant bone loss in the weight-bearing bones of mice with a 6.3% reduction in bone volume and 11.9% decrease in bone thickness associated with increased osteoclastic activity. Along with this rapid bone loss we also observed alterations in the cell cycle characterized by an increase in the Cdkn1a/p21 cell cycle arrest molecule independent of Trp53. Overexpression of Cdkn1a/p21 was localized to osteoblasts lining the periosteal surface of the femur and chondrocytes in the head of the femur, suggesting an inhibition of proliferation in two key regenerative cell types of the femur in response to spaceflight. Additionally we found overexpression of several matrix degradation molecules including MMP-1a, 3 and 10, of which MMP-10 was localized to osteocytes within the shaft of the femur. This, in conjunction with 40 nm resolution synchrotron nano-Computed Tomography (nano-CT) observations of an increase in osteocyte lacunae cross-sectional area, perimeter and a decrease in circularity indicates a potential role for osteocytic osteolysis in the observed bone degeneration in spaceflight. To further investigate the genetic response of bone to mechanical unloading in spaceflight, we conducted genome wide microarray analysis of total RNA isolated from the mouse pelvis. Specifically, 16 week old mice were subjected to 15 days spaceflight onboard NASA's STS-131 space shuttle mission. The pelvis of the mice was dissected, the bone marrow was flushed and the bones were briefly stored in RNAlater. The pelvii were then homogenized, and RNA was isolated using TRIzol. RNA concentration and quality was measured using a Nanodrop spectrometer, and 0.8% agarose gel electrophoresis. Samples of cDNA were analyzed using an Affymetrix GeneChip\\S Gene 1.0 ST (Sense Target) Array System for Mouse and GenePattern Software. We normalized the ST gene arrays using Robust Multichip Average (RMA) normalization, which summarizes perfectly matched spots on the array through the median polish algorithm, rather than normalizing according to mismatched spots. We also used Limma for statistical analysis, using the BioConductor Limma Library by Gordon Smyth, and differential expression analysis to identify genes with significant changes in expression between the two experimental conditions. Finally we used GSEApreRanked for Gene Set Enrichment Analysis (GSEA), with Kolmogorov-Smirnov style statistics to identify groups of genes that are regulated together using the t-statistics derived from Limma. Preliminary results show that 6,603 genes expressed in pelvic bone had statistically significant alterations in spaceflight compared to ground controls. These prominently included cell cycle arrest molecules p21, and p18, cell survival molecule Crbp1, and cell cycle molecules cyclin D1, and Cdk1. Additionally, GSEA results indicated alterations in molecular targets of cyclin D1 and Cdk4, senescence pathways resulting from abnormal laminin maturation, cell-cell contacts via E-cadherin, and several pathways relating to protein translation and metabolism. In total 111 gene sets out of 2,488, about 4%, showed statistically significant set alterations. These alterations indicate significant impairment of normal cellular function in the mechanically unloaded environment of space and could provide important genetic insight into the observed uncoupling of bone formation and resorption in space.

Is the Clavicula Pro Humero Technique of Value for Reconstruction After Resection of the Proximal Humerus in Children?

PubMed

Barbier, Dominique; De Billy, Benoît; Gicquel, Philippe; Bourelle, Sophie; Journeau, Pierre

2017-10-01

There are several options for reconstruction of proximal humerus resections after wide resection for malignant tumors in children. The clavicula pro humero technique is a biologic option that has been used in the past, but there are only scant case reports and small series that comment on the results of the procedure. Because the longevity of children mandates a reconstruction with potential longevity not likely to be achieved by other techniques, the clavicula pro humero technique may be a potential option in selected patients. (1) How successful is the clavicula pro humero procedure in achieving local tumor control? (2) What is the frequency of nonunion? (3) What are the complications of the procedure? (4) What scores do patients achieve (on the Musculoskeletal Tumor Society (MSTS) and the Toronto Extremity Salvage Score (TESS) after this procedure? Four university hospitals performed the clavicula pro humero technique in eight children aged 8 to 18 years between June 2006 and February 2014. During that period, general indications for this approach included all reconstructions of the proximal humerus for malignant tumors in children older than 8 years. All patients were followed for a mean of 40 months (range, 25-86 months); one patient was lost to followup before 2 years. The tumor resections removed the rotator cuff muscles in all patients, glenohumeral joint in five, and deltoid muscle in three. The median length of the bone defect after resection was 20 cm (range, 7-25 cm). It was reduced to 9 cm (range, 0-17 cm) or 27% (range, 0%-64%) of the total humerus length after clavicular rotation. Direct osteosynthesis (one patient), induced membrane technique (one patient), or vascularized fibular autograft (six patients) was used to complete the defect after rotation of the clavicle if necessary. Presence of union (defined as bone healing before 10 months, as assessed by disappearance of the osteotomy on AP and lateral view radiographs), and complications were determined by chart review performed by a surgeon not involved in patient care. Function assessed by the MSTS and the TESS scores were determined by the patients with their families. None of the patients had tumor recurrence. One patient died of pulmonary metastases before the 2-year followup. Proximal and distal bone unions were achieved before 10 months without an additional surgical procedure in two and six of seven patients, respectively. Fourteen local complications occurred resulting in nine revision operations. The main complication was aseptic proximal pseudarthrosis (five patients); other complications included one proximal junction fracture, one clavicle fracture complicated by clavicle osteolysis, one distal junction fracture, one necrosis of the skin paddle of the fibular autograft, one glenoclavicular ossification, and one distal pseudarthrosis complicated by a fracture of this distal junction. Function, as assessed by the MSTS score, was a median of 23 of 30 (range, 11-27). The median TESS score was 82% (range, 75%-92%). Shoulder ROM (median; range) in abduction, front elevation, and external and internal rotations were 70°(30°-90°), 75°(30°-85°), 10°(0°-20°), and 80°(80°-100°), respectively. Three of the seven patients reported dissatisfaction with the cosmetic appearance. The clavicula pro humero technique achieved oncologic local control after resection and reconstruction of proximal humerus tumors in children. Although union times are approximately 2 years and some patients underwent augmentation with other grafts, it eventually provides a solid, painless, biologic, and stable reconstruction and creates a mobile acromioclavicular joint and generally good function. Nonunion of the proximal junction is the main complication of this technique. We cannot directly compare this technique with other reconstruction options, and longer followup is needed, but this may be a useful reconstruction option to consider in select pediatric patients with sarcomas of the proximal humerus. Level IV, therapeutic study.

[Early aseptic loosening of the CF 30 femoral stem].

PubMed

Kovanda, M; Havlícek, V; Hudec, J

2007-02-01

The CF 30 stem in combination with a cementless acetabulum was used at the First Department of Orthopedic Surgery in Brno in the years 1994 to 1995. From the second year following implantation, aseptic stem loosening was recorded. In order to find explanation of this early loosening, the authors, in cooperation with the Institute of Solid Mechanics, Mechatronics and Biomechanics, carried out the stress-strain analysis in a model system. Eighty patients (31 men and 49 women) received a cemented CF30 femoral component in 1994. Of them, 16 patients underwent revision arthroplasty, three died of causes unrelated to the surgery, and four were lost to follow-up. The final clinical and radiographic check-up was carried out in 2001. The results of a comprehensive examination were available in 57 patients with a CF30 stem. The patients were evaluated on the basis of the Harris hip score and anteroposterior radiographs of the hip. X-ray films obtained immediately after surgery and those taken at regular intervals during follow-up were compared. The following characteristics were noted: translucent lines in individual zones along the stem at the cement-bone interface; osteolysis, i. e., non-linear translucent areas, at least 5 mm long, at the cement-bone interface; and subsidence of the femoral component, i. e., migration of the stem distal to the tip of the greater trochanter. The CF 30 stem survival curve showed that aseptic stem loosening occurred from post-implantation year 2, and increased during the following years. At 6 years and 6 months, a total of 16 patients underwent revision surgery, involving reimplantation in 14 and implant removal in 2 patients. Potential causes of aseptic loosening: Polyethylene wear.However, no acetabular loosening was found in this group, although acetabular components are reported to become loose more often than femoral components. By comparison of the stem survival curves for Poldi and CF 30 stems it appeared that, at 6 years and 6 months, the Poldi stem survival curve showed better results. Matt surface finish of the stem. However, the link between the CF 30 stem and cement was so strong that, in all 16 revised hips, the stem was removed together with nearly a complete cement mantle. The authors therefore dismiss this as a cause. Also, in the remaining cases of CF 30 aseptic loosening, which had not been revised, radiographic evidence suggested loosening between bone and cement. The authors did not find any movement of the CF stem in its cement mantle. The stem always fitted in with the cement mantle. Erroneous surgical technique or cementing was unlikely. The procedures were performed by experienced orthopedic surgeons who used the second-generation cementing technique. In patients with a Poldi stem, the first-generation cementing method was used and the proportion of aseptic loosening at 6 years of follow-up was only 4 %. In contrast, loosening in patients with the CF 30 stem was 20 % at 6 years and 6 months postoperatively. Shape of the CF 30 stem with the intention to find a relationship between stem shape and its early aseptic loosening, the authors started cooperation with the Institute of Solid Mechanics, Mechatronics and Biomechanics at the Faculty of Mechanical Engineering, Brno University of Technology. Using the method of finite elements, they carried out the stressstrain analysis in a model system. Stress at the cement-bone interface in the CF 30 stem was higher than in the Poldi stem, and this difference was statistically significant. The authors believe that the more frequent loosening found in patients with the CF 30 stem can be accounted for by its shape. The survival curve for the CF 30 femoral stem did not show good results, and therefore this stem is not recommended for implantation. The authors suggest that a more frequent early aseptic loosening of CF 30 stems may have been caused by its unsuitable shape.

Couches minces organiques riches en amines primaires par photo-polymerisation ultraviolette : Caracterisation et applications biomedicales

NASA Astrophysics Data System (ADS)

St-Georges-Robillard, Amelie

Biomaterials have evolved significantly over the past decades. There are now several types of polymeric biomaterials with physical characteristics suited to different applications. This project focuses on improving the physico-chemical properties of the surface of these materials by incorporating primary amines (R-NH2), a functional group known to promote adhesion and cell growth, in the context of two biomedical applications. First, it is necessary to develop a cell culture surface that enables the adhesion of U937 monocytes. These cells are used to evaluate the effect of wear particles produced by the prosthesis in periprosthetic osteolysis, a major cause of failure of a hip replacement. Second, one of the strategies used to improve the success rate of polymeric vascular grafts is to create a layer of endothelial cells on the lumen of the prosthesis. A coating that promotes the adhesion and growth of human umbilical vein endothelial cells (HUVEC) is required to achieve that layer. Previous studies have demonstrated that the addition of R-NH2 groups on the coating allows the adhesion of U937 monocytes, provided that their concentration [NH2] is higher than a certain critical value, [NH2]crit; R-NH2 groups were also found to enhance the adhesion and proliferation of HUVEC. Two different primary amine-rich coatings are investigated in this work: organic thin films deposited by vacuum ultraviolet (VUV) photo-polymerization, UV-PE:N; and parylene diX AM, deposited by chemical vapor deposition (CVD). The physico-chemical stability of these coatings in air and in water, essential for biomedical applications, was first studied. “Aging” of parylene diX AM in contact with the ambient air caused a diminution of [NH2]/[C] of around 6 % during 22 days and is caused by the oxidation of R-NH2 by atmospheric oxygen, while in the case of UV-PE:N, the diminution is only of 2,5 % over 26 days. Also, a second aging mechanism is present: the reaction of trapped free radicals in the coating with oxygen in air or dissolved in water. The UV-PE:N coating proved virtually insoluble, despite a high concentration of nitrogen and showed excellent retention of the R-NH 2 groups when immersed in water, two essential properties for applications in cell culture. These studies have also shown that UV-PE:N coatings (deposited with two gas ratios, R = 0.75 and 1) permit adhesion and survival of U937 monocytes without causing any significant inflammatory response, which enables one to study wear particle effects. However, the adhesion of U937 monocytes on parylene diX AM manifests a rather different behavior, adhesion being proportional to [NH2] and not controlled by the critical threshold, [NH 2]crit, observed for different types of plasma-polymer coatings. Also, monocytes do not survive for 24 hours on parylene diX AM. The cause for these differences remains to be elucidated. Finally, the adhesion and growth of HUVEC on both types of UV-PE:N (R = 0.75 and 1), as well as on L-PPE:N and on gelatinized polystyrene, were statistically higher than on untreated PET. Therefore, UV-PE:N has proven to be a cell culture surface well-adapted for HUVEC, of similar efficiency to gelatinized polystyrene, a surface known to promote the adhesion and growth of HUVEC. UV-PE: N is therefore a promising coating that provides stability in air and in water for use in cell culture and has demonstrated its performance for two biomedical applications. Keywords: biomaterials, primary amines, thin film deposition, photo-polymerization, plasma polymerization, XPS, chemical derivatization, ellipsometry, cellular adhesion, arthroplasty, vascular graft.

CSA-90 Promotes Bone Formation and Mitigates Methicillin-resistant Staphylococcus aureus Infection in a Rat Open Fracture Model.

PubMed

Mills, Rebecca; Cheng, Tegan L; Mikulec, Kathy; Peacock, Lauren; Isaacs, David; Genberg, Carl; Savage, Paul B; Little, David G; Schindeler, Aaron

2018-06-01

Infection of open fractures remains a significant cause of morbidity and mortality to patients worldwide. Early administration of prophylactic antibiotics is known to improve outcomes; however, increasing concern regarding antimicrobial resistance makes finding new compounds for use in such cases a pressing area for further research. CSA-90, a synthetic peptidomimetic compound, has previously demonstrated promising antimicrobial action against Staphylococcus aureus in rat open fractures. However, its efficacy against antibiotic-resistant microorganisms, its potential as a therapeutic agent in addition to its prophylactic effects, and its proosteogenic properties all require further investigation. (1) Does prophylactic treatment with CSA-90 reduce infection rates in a rat open fracture model inoculated with S aureus, methicillin-resistant S aureus (MRSA), and methicillin-resistant Staphylococcus epidermidis (MRSE) as measured by survival, radiographic union, and deep tissue swab cultures? (2) Does CSA-90 reduce infection rates when administered later in the management of an open fracture as measured by survival, radiographic union, and deep tissue swab cultures? (3) Does CSA-90 demonstrate a synergistic proosteogenic effect with bone morphogenetic protein 2 (BMP-2) in a noninfected rat ectopic bone formation assay as assessed by micro-CT bone volume measurement? (4) Can CSA-90 elute and retain its antimicrobial efficacy in vitro when delivered using clinically relevant agents measured using a Kirby-Bauer disc diffusion assay? All in vivo studies were approved by the local animal ethics committee. In the open fracture studies, 12-week-old male Wistar rats underwent open midshaft femoral fractures stabilized with a 1.1-mm Kirschner wire and 10 µg BMP-2 ± 500 µg CSA-90 was applied to the fracture site using a collagen sponge along with 1 x 10 colony-forming units of bacteria (S aureus/MRSA/MRSE; n = 10 per group). In the delayed treatment study, débridement and treatment with 500 µg CSA-90 were performed at Day 1 and Day 5 after injury and bacterial insult (S aureus). All animals were reviewed daily for signs of local infection and/or sepsis. An independent, blinded veterinarian reviewed twice-weekly radiographs, and rats showing osteolysis and/or declining overall health were culled at his instruction. The primary outcome of both fracture studies was fracture infection, incorporating survival, radiographic union, and deep tissue swab cultures. For the ectopic bone formation assay, 0 to 10 µg BMP-2 and 0 to 500 µg CSA-90 were delivered on a collagen sponge into bilateral quadriceps muscle pouches of 8-week-old rats (n = 10 per group). Micro-CT quantification of bone volume and descriptive histologic analysis were performed for all in vivo studies. Modified Kirby-Bauer disc diffusion assays were used to quantify antimicrobial activity in vitro using four different delivery methods, including bone cement. Infection was observed in none of the MRSA inoculated open fractures treated with CSA-90 with 10 of 10 deep tissue swab cultures negative at the time of cull. Median survival was 43 days (range, 11-43 days) in the treated group versus 11 days (range, 8-11 days) in the untreated MRSA inoculated group (p < 0.001). However, delayed débridement and treatment of open fractures with CSA-90 at either Day 1 or Day 5 did not prevent infection, resulting in early culls by Day 21 with positive swab cultures (10 of 10 for each time point). Maximal ectopic bone formation was achieved with 500 μg CSA-90 and 10 μg BMP-2 (mean volume, 9.58 mm; SD, 7.83), creating larger bone nodules than formed with 250 μg CSA-90 and 10 μg BMP-2 (mean volume, 1.7 mm; SD, 1.07; p < 0.001). Disc diffusion assays showed that CSA-90 could successfully elute from four potential delivery agents including calcium sulphate (mean zone of inhibition, 11.35 mm; SD, 0.957) and bone cement (mean, 4.67 mm; SD, 0.516). CSA-90 shows antimicrobial action against antibiotic-resistant Staphylococcal strains in vitro and in an in vivo model of open fracture infection. The antimicrobial properties of CSA-90 combined with further evidence of its proosteogenic potential make it a promising compound to develop further for orthopaedic applications.

Total Knee Replacement

PubMed Central

2005-01-01

Executive Summary Objective The aim of this review was to assess the effectiveness, in terms of pain reduction and functional improvement, and costing of total knee replacement (TKR) for people with osteoarthritis for whom less invasive treatments (such as physiotherapy, analgesics, anti-inflammatory drugs, intra-articular steroids, hyaluronic acids, and arthroscopic surgery) have failed. Clinical Need Osteoarthritis affects an estimated 10% to 12% of Canadian adults. The therapeutic goals of osteoarthritis treatment are to improve joint mobility and reduce pain. Stepwise treatment options include exercise, weight loss, physiotherapy, analgesics, anti-inflammatory drugs, intra-articular steroids and hyaluronic acids, arthroscopic surgery, and, in severe cases, total joint replacement with follow-up rehabilitation. These treatments are delivered by a range of health care professionals, including physiotherapists, occupational therapists, family physicians, internists, rheumatologists, and orthopedic surgeons. TKR is an end-of-line treatment for patients with severe pain and functional limitations. More women than men undergo knee replacement, and most patients are between 55 and 84 years old. The Technology TKR is a surgical procedure in which an artificial joint or prosthesis replaces a damaged knee joint. The primary indication for TKR is pain, followed by functional limitation. Usually, a person’s daily activities must be substantially affected by pain and functional limitations for him or her to be considered a candidate for TKR. There are 3 different types of knee replacement prostheses. Non-constrained prostheses use the patient’s ligaments and muscles to provide the stability for the prosthesis. Semi-constrained prostheses provide some stability for the knee and do not rely entirely on the patient’s ligaments and muscles to provide the stability. Constrained prostheses are for patients whose ligaments and muscles are not able to provide stability for the knee prosthesis. The most common risks and complications associated with TKR are deep venous thrombosis, infection, stiffness, loosening, and osteolysis. To prevent deep venous thrombosis, patients are treated with heparin prophylactically and/or given support stockings to wear. Patients are also given antibiotics for 24 hours after surgery to minimize the risk of infection. Stiffness is another associated complication. In most patients, it can be avoided by keeping the knee moving in the days and weeks following surgery. The National Institutes of Health in the United States concluded that the indications for TKR should include the following: radiological evidence of joint damage, moderate to severe persistent pain that is not adequately relieved by nonsurgical management, and clinically significant functional limitation resulting in diminished quality of life. Review Strategy In March 2005, the following databases were searched: Cochrane Library International Agency for Health Technology Assessment (first quarter 2005), Cochrane Database of Systematic Reviews (first quarter 2005), Cochrane Central Register of Controlled Trials (first quarter 2005), MEDLINE (1966 to March 2005), MEDLINE In-Process and Other Non-indexed Citations (1966 to March 14, 2005), and EMBASE (1980 to 2005 week 9). The Medical Advisory Secretariat also searched Medscape on the Internet for recent reports on trials that were unpublished but that were presented at international conferences. In addition, the Web site Current Controlled Trials (www.controlled-trials.com) was searched for ongoing trials investigating TKR or unicompartmental knee replacement. No studies were identified that compared TKR to an alternative treatment. Several studies have been reported that compare preoperative measurement scores on targeted measures of functioning and pain to postoperative measurement scores in patients undergoing various TKR procedures. In order for the Medical Advisory Secretariat to measure the effectiveness of TKR and to compare the effectiveness of TKR across studies, effect sizes were calculated in studies that reported the standard deviations of the preoperative and postoperative measurement scores. Percent change was also calculated. For this review, a 20% improvement in outcome score was defined as the minimal clinically important difference. Summary of Findings Overall, patients who undergo TKR surgery for osteoarthritis have substantial improvements in terms of reduction of pain and improvement of function. A comparison of the mean effect score and the percent change in 19 studies that reported preoperative and postoperative outcome scores for patients who had TKR showed that the procedure is effective. The 19 studies included patients of various ages and used a variety of prostheses and techniques to implant the device. TKR was effective in all of the studies. The revision rates ranged from 0% to 13% in the studies that reported at least 5 years of follow-up. As for the factors that predict TKR outcomes, a variety of factors have been evaluated, including obesity, age, gender, prosthesis design, and surgical techniques; however, none of these have been shown to predict outcomes (pain or function) consistently across studies. However, the regression analyses identified accounted for only 12% to 27% of the variance, indicating that over 70% of the variance in the outcomes of TKR is unexplained. In terms of the timing of TKR surgery, 2 studies found that the severity of osteoarthritis does not predict outcome, but 1 study was found that higher functioning patients had significantly less pain and better function up to 2 years after surgery compared with lower functioning patients. It is important to note that the patients in the low and high function groups were evenly matched on comorbid conditions. Unicompartmental knee replacement surgery seems to be as effective as TKR surgery for people who meet the indications for it. This is a subset of people who have osteoarthritis of the knee, because for unicompartmental knee replacement to be indicated, only 1 (usually the medial) compartment of the knee can be affected. Patients who undergo this kind of surgery seem to have shorter hospital stays and faster recovery times than do patients who have TKR surgery. Conclusion There is substantial evidence to indicate that TKR effectively reduces pain and improves function. PMID:23074478