Sample records for oxaliplatin-dna adduct formation

  1. Polymorphic acetylation of arylamines and DNA-adduct formation.


    Weber, W W; Levy, G N; Martell, K J


    Inbred mouse strains congenic for rapid and slow N-acetyltransferase (NAT) (A.B6, rapid and B6.A, slow) were used to separate the effect of the NAT polymorphism from the influence of other genetically polymorphic enzymes on DNA adduct formation induced by exposure to arylamine carcinogens. Adduct formation was measured by HPLC analysis of 32P-postlabeled nucleotides from DNA of the urinary bladder and liver. Acetylator phenotype was a significant determinant of DNA damage in females as slow acetylators had higher levels of bladder DNA adducts than rapids. This correlation was the reverse of that seen with liver DNA. Older mice (20-23 weeks) formed much higher bladder DNA adduct levels than young mice (7 week). The increase in bladder adduct formation with age was seen in both sexes of all mouse strains. The older male B6 mice showed a 26-fold increase in bladder adducts and the older females showed no more than a 2-fold increase. In addition, the older male B6 mice produced significant amounts of an unidentified, early eluting adduct peak. Biochemical studies of liver NAT and O-acetyltransferase (OAT) activities showed a direct correlation between the levels of liver 2-aminofluorene (AF) NAT activity and levels of liver DNA-adduct formation, but the role of OAT activity in adduct formation in the mouse remains unclear. These results indicate that the NAT phenotype, age and sex are all important determinants of arylamine-DNA adduct formation in mice. PMID:2134671

  2. DNA adduct formation by alachlor metabolites

    SciTech Connect

    Brown, M.A.; Kimmel, E.C.; Casida, J.E.


    The extent of DNA adduct formation by alachlor (ArN(CH/sub 2/OCH/sub 3/)C(O)CH/sub 2/Cl wherein Ar is 2,6-diethylphenyl) and its metabolites is used as a guide to deduce the causal agent(s) in the carcinogenicity of this major herbicide. (/sup 14/C-phenyl)Alachlor is compared to its two metabolic cleavage products, (/sup 14/C-phenyl) 2-chloro-N-(2,6-diethylphenyl)acetamide (CDEPA) (ArNHC(O)CH/sub 2/Cl) and (/sup 14/C-phenyl)2,6-diethylaniline (DEA) (ArNH/sub 2/), and to (/sup 14/C-methoxy)alachlor in various in vitro and in vivo systems. Horseradish peroxidase and hydrogen peroxide activate DEA, but not CEDPA or alachlor, for formation of adducts with calf thymus DNA, which probably involves 2,6-diethylnitrosobenzene (ArNO) as an intermediate. Mouse liver microsomes and NADPH are both required to enhance the binding from each labeled preparation to calf thymus DNA; 4-fold higher labeling is observed from (/sup 14/C-methoxy)- than from (/sup 14/C-phenyl)alachlor. This 4-fold preferential DNA labeling from the /sup 14/C-methoxy compound is likewise found in the liver of mice treated intraperitoneally. Mouse liver protein and hemoglobin are also labeled, in vivo, with (/sup 14/C-phenyl)alachlor, -CDEPA and -DEA, and, as with the DNA, the labeling of these proteins is 1.5- to 2-fold higher with (/sup 14/C-methoxy)alachlor.

  3. Diet-related DNA adduct formation in relation to carcinogenesis.


    Hemeryck, Lieselot Y; Vanhaecke, Lynn


    The human diet contributes significantly to the initiation and promotion of carcinogenesis. It has become clear that the human diet contains several groups of natural foodborne chemicals that are at least in part responsible for the genotoxic, mutagenic, and carcinogenic potential of certain foodstuffs. Electrophilic chemicals are prone to attack nucleophilic sites in DNA, resulting in the formation of altered nucleobases, also known as DNA adducts. Since DNA adduct formation is believed to signal the onset of chemically induced carcinogenesis, the DNA adduct-inducing potential of certain foodstuffs has been investigated to gain more insight into diet-related pathways of carcinogenesis. Many studies have investigated diet-related DNA adduct formation. This review summarizes work on known or suspected dietary carcinogens and the role of DNA adduct formation in hypothesized carcinogenesis pathways. PMID:27330144

  4. Protein modification by acrolein: Formation and stability of cysteine adducts

    PubMed Central

    Cai, Jian; Bhatnagar, Aruni; Pierce, William M.


    The toxicity of the ubiquitous pollutant and endogenous metabolite, acrolein, is due in part to covalent protein modifications. Acrolein reacts readily with protein nucleophiles via Michael addition and Schiff base formation. Potential acrolein targets in protein include the nucleophilic side chains of cysteine, histidine, and lysine residues as well as the free amino terminus of proteins. Although cysteine is the most acrolein-reactive residue, cysteine-acrolein adducts are difficult to identify in vitro and in vivo. In this study, model peptides with cysteine, lysine, and histidine residues were used to examine the reactivity of acrolein. Results from these experiments show that acrolein reacts rapidly with cysteine residues through Michael addition to form M+56 Da adducts. These M+56 adducts are, however, not stable, even though spontaneous dissociation of the adduct is slow. Further studies demonstrated that when acrolein and model peptides are incubated at physiological pH and temperature, the M+56 adducts decreased gradually accompanied by the increase of M+38 adducts, which are formed from intra-molecular Schiff base formation. Adduct formation with the side chains of other amino acid residues (lysine and histidine) was much slower than cysteine and required higher acrolein concentration. When cysteine residues were blocked by reaction with iodoacetamide and higher concentrations of acrolein were used, adducts of the N-terminal amino group or histidyl residues were formed but lysine adducts were not detected. Collectively, these data demonstrate that acrolein reacts avidly with protein cysteine residues and that the apparent loss of protein-acrolein Michael adducts over time may be related to the appearance of a novel (M+38) adduct. These findings may be important in identification of in vivo adducts of acrolein with protein cysteine residues. PMID:19231900

  5. Protein adduct formation as a molecular mechanism in neurotoxicity.


    Lopachin, Richard M; Decaprio, Anthony P


    Chemicals that cause nerve injury and neurological deficits are a structurally diverse group. For the majority, the corresponding molecular mechanisms of neurotoxicity are poorly understood. Many toxicants (e.g., hepatotoxicants) of other organ systems and/or their oxidative metabolites have been identified as electrophiles and will react with cellular proteins by covalently binding nucleophilic amino acid residues. Cellular toxicity occurs when adduct formation disrupts protein structure and/or function, which secondarily causes damage to submembrane organelles, metabolic pathways, or cytological processes. Since many neurotoxicants are also electrophiles, the corresponding pathophysiological mechanism might involve protein adduction. In this review, we will summarize the principles of covalent bond formation that govern reactions between xenobiotic electrophiles and biological nucleophiles. Because a neurotoxicant can form adducts with multiple nucleophilic residues on proteins, the challenge is to identify the mechanistically important adduct. In this regard, it is now recognized that despite widespread chemical adduction of tissue proteins, neurotoxicity can be mediated through binding of specific target nucleophiles in key neuronal proteins. Acrylamide and 2,5-hexanedione are prototypical neurotoxicants that presumably act through the formation of protein adducts. To illustrate both the promise and the difficulty of adduct research, these electrophilic chemicals will be discussed with respect to covalent bond formation, suspected protein sites of adduction, and proposed mechanisms of neurotoxicity. The goals of future investigations are to identify and quantify specific protein adducts that play a causal role in the generation of neurotoxicity induced by electrophilic neurotoxicants. This is a challenging but critical objective that will be facilitated by recent advances in proteomic methodologies. PMID:15901921

  6. Paclitaxel Enhances Carboplatin-DNA Adduct Formation and Cytotoxicity

    SciTech Connect

    Jiang, Shuai; Pan, Amy W.; Lin, Tzu-yin; Zhang, Hongyong; Malfatti, Michael; Turteltaub, Kenneth; Henderson, Paul T.; Pan, Chong-xian


    This rapid report focuses on the pharmacodynamic mechanism of the carboplatin/paclitaxel combination and correlates it with its cytotoxicity. Consistent with the synergistic to additive antitumor activity (the combination index ranging from 0.53 to 0.94), cells exposed to this combination had significantly increased carboplatin-DNA adduct formation when compared to that of carboplatin alone (450 ± 30 versus 320 ± 120 adducts per 108 nucleotides at 2 h, p = 0.004). Removal of paclitaxel increased the repair of carboplatin-DNA adducts: 39.4 versus 33.1 adducts per 108 nucleotides per hour in carboplatin alone (p = 0.021). In conclusion, this rapid report provides the first pharmacodynamics data to support the use of carboplatin/paclitaxel combination in the clinic.

  7. Paclitaxel Enhances Carboplatin-DNA Adduct Formation and Cytotoxicity


    Jiang, Shuai; Pan, Amy W.; Lin, Tzu-yin; Zhang, Hongyong; Malfatti, Michael; Turteltaub, Kenneth; Henderson, Paul T.; Pan, Chong-xian


    This rapid report focuses on the pharmacodynamic mechanism of the carboplatin/paclitaxel combination and correlates it with its cytotoxicity. Consistent with the synergistic to additive antitumor activity (the combination index ranging from 0.53 to 0.94), cells exposed to this combination had significantly increased carboplatin-DNA adduct formation when compared to that of carboplatin alone (450 ± 30 versus 320 ± 120 adducts per 108 nucleotides at 2 h, p = 0.004). Removal of paclitaxel increased the repair of carboplatin-DNA adducts: 39.4 versus 33.1 adducts per 108 nucleotides per hour in carboplatin alone (p = 0.021). In conclusion, this rapid report provides themore » first pharmacodynamics data to support the use of carboplatin/paclitaxel combination in the clinic.« less

  8. Paclitaxel Enhances Carboplatin-DNA Adduct Formation and Cytotoxicity.


    Jiang, Shuai; Pan, Amy W; Lin, Tzu-yin; Zhang, Hongyong; Malfatti, Michael; Turteltaub, Kenneth; Henderson, Paul T; Pan, Chong-xian


    This rapid report focuses on the pharmacodynamic mechanism of the carboplatin/paclitaxel combination and correlates it with its cytotoxicity. Consistent with the synergistic to additive antitumor activity (the combination index ranging from 0.53 to 0.94), cells exposed to this combination had significantly increased carboplatin-DNA adduct formation when compared to that of carboplatin alone (450 ± 30 versus 320 ± 120 adducts per 10(8) nucleotides at 2 h, p = 0.004). Removal of paclitaxel increased the repair of carboplatin-DNA adducts: 39.4 versus 33.1 adducts per 10(8) nucleotides per hour in carboplatin alone (p = 0.021). This rapid report provides the first pharmacodynamics data to support the use of carboplatin/paclitaxel combination in the clinic. PMID:26544157

  9. Ion-molecule adduct formation in tandem mass spectrometry.


    Alechaga, Élida; Moyano, Encarnación; Galceran, Maria Teresa


    Nowadays most LC-MS methods rely on tandem mass spectrometry not only for quantitation and confirmation of compounds by multiple reaction monitoring (MRM), but also for the identification of unknowns from their product ion spectra. However, gas-phase reactions between charged and neutral species inside the mass analyzer can occur, yielding product ions at m/z values higher than that of the precursor ion, or at m/z values difficult to explain by logical losses, which complicate mass spectral interpretation. In this work, the formation of adduct ions in the mass analyzer was studied using several mass spectrometers with different mass analyzers (ion trap, triple quadrupole, and quadrupole-Orbitrap). Heterocyclic amines (AαC, MeAαC, Trp-P-1, and Trp-P-2), photo-initiators (BP and THBP), and pharmaceuticals (phenacetin and levamisole) were selected as model compounds and infused in LCQ Classic, TSQ Quantum Ultra AM, and Q-Exactive Orbitrap (ThermoFisher Scientific) mass spectrometers using electrospray as ionization method. The generation of ion-molecule adducts depended on the compound and also on the instrument employed. Adducts with neutral organic solvents (methanol and acetonitrile) were only observed in the ion trap instrument (LCQ Classic), because of the ionization source on-axis configuration and the lack of gas-phase barriers, which allowed inertial entrance of the neutrals into the analyzer. Adduct formation (only with water) in the triple quadrupole instruments was less abundant than in the ion trap and quadrupole-Orbitrap mass spectrometers, because of the lower residence time of the reactive product ions in the mass analyzer. The moisture level of the CID and/or damper gas had a great effect in beam-like mass analyzers such as triple quadrupole, but not in trap-like mass analyzers, probably because of the long residence time that allowed adduct formation even with very low concentrations of water inside the mass spectrometer. PMID:26700446

  10. UVR Exposure Sensitizes Keratinocytes to DNA Adduct Formation

    PubMed Central

    Nair, Sudhir; Kekatpure, Vikram D.; Judson, Benjamin L.; Rifkind, Arleen B.; Granstein, Richard D.; Boyle, Jay O.; Subbaramaiah, Kotha; Guttenplan, Joseph B.; Dannenberg, Andrew J.


    Ultraviolet radiation (UVR) and exposure to tobacco smoke, a source of polycyclic aromatic hydrocarbons (PAH), have been linked to skin carcinogenesis. UVR-mediated activation of the aryl hydrocarbon receptor (AhR) stimulates the transcription of CYP1A1 and CYP1B1, which encode proteins that convert PAH to genotoxic metabolites. We determined whether UVR exposure sensitized human keratinocytes to PAH-induced DNA adduct formation. UVR exposure induced CYP1A1 and CYP1B1 in HaCaT cells, an effect that was mimicked by photooxidized tryptophan (aTRP) and FICZ, a component of aTRP. UVR exposure or pretreatment with aTRP or FICZ also sensitized cells to benzo[a]pyrene (B[a]P) induced DNA adduct formation. α-Naphthoflavone (αNF), an AhR antagonist, suppressed UVR-, aTRP- and FICZ-mediated induction of CYP1A1 and CYP1B1 and inhibited B[a]P induced DNA adduct formation. Treatment with 17-AAG, a Hsp90 inhibitor, caused a marked decrease in levels of AhR, inhibited UVR-, aTRP- and FICZ-mediated induction of CYP1A1 and CYP1B1 and blocked the sensitization of HaCaT cells to B[a]P induced DNA adduct formation. FICZ has been suggested to be a physiological ligand of the AhR that may have systemic effects. Hence, studies of FICZ were also carried out in MSK-Leuk1 cells, a model of oral leukoplakia. Pretreatment with αNF or 17-AAG blocked FICZ-mediated induction of CYP1A1 and CYP1B1, and suppressed the increased B[a]P-induced DNA adduct formation. Collectively, these results suggest that sunlight may activate AhR signaling and thereby sensitize cells to PAH-mediated DNA adduct formation. Antagonists of AhR signaling may have a role in the chemoprevention of photocarcinogenesis. PMID:19789301

  11. DNA adducts of ethylene dibromide: Aspects of formation and mutagenicity

    SciTech Connect

    Cmarik, J.L.


    1,2-Dibromoethane (ethylene dibromide, EDB), a potential human carcinogen, undergoes bioactivation by the pathway of glutathione (GSH) conjugation, which generates a reactive intermediate capable of alkylating DNA. The major DNA adduct formed is S-[2-(N[sup 7]-guanyl)ethyl]GSH. This dissertation examined the bioactivation of EDB and the formation of DNA adducts. The selectivity of purified rat and human GSH S-transferases for EDB was examined in vitro. An assay was developed to measure the formation of S,S[prime]-ethylene-bis(GSH). The [alpha] class of the GSH S-transferases was responsible for the majority of EDB-GSH conjugation with both the rat and human enzymes. Human tissue samples for a victim of EDB poisoning were analyzed for S-[2-(N[sup 7]-guanyl)ethyl]GSH utilizing electrochemical detection. No adducts were detected in samples of brain, heart, or kidney. The pattern of alkylation of guanines in fragments of plasmid pBR322 DNA by S-(2-chloroethyl)GSH and related compounds was determined. Alkylation varied approximately ten-fold in intensity and was strongest in runs of guanines. Few differences were observed in the alkylation patterns generated by the different compounds tested. The spectrum of mutations caused by S-(2-chloroethyl)GSH was determined using an M13 bacteriophage forward mutation assay. The majority of mutations (70%) were G:C to A:T transitions. Participation of the N[sup 7]-guanyl adduct in the mutagenic process is strongly implicated. The sequence selectivity of alkylation in the region of M13 sequenced in the mutation assay was determined. Comparison of the sequence selectivity with the mutation spectrum revealed no obligate relationship between the extent of adduct formation and the number of mutations which resulted at different sites. Sequence context appears to exert a strong influence on the processing of lesions. These studies strongly implicate S-[2-(N[sup 7]-guanyl)-ethyl]GSH as a mutagenic lesion formed by EDB.

  12. Metabolites and DNA adduct formation from flavoenzyme-activated porfiromycin.


    Pan, S S; Iracki, T


    Porfiromycin was reductively metabolized by NADPH cytochrome P-450 reductase and xanthine oxidase under anaerobic conditions. The production of metabolites varied with the pH and the contents of the reaction buffer. In Tris buffer, two major metabolites were produced at pH 7.5 and above, whereas one major metabolite was produced at pH 6.5. The three major metabolites were separated and isolated by HPLC. Identification by californium-252 plasma desorption mass spectrometry showed that the two major metabolites from pH 7.5 were (trans) and (cis)-forms of 7-amino-1-hydroxyl-2-methylaminomitosene and the major metabolite from pH 6.5 was 7-amino-2-methylaminomitosene. All three major metabolites showed substitutions at the C-1 position. DNA was alkylated readily by enzyme-activated porfiromycin. Digestion of porfiromycin-alkylated DNA by DNase, snake venom phosphodiesterase, and alkaline phosphatase resulted in an insoluble nuclease-resistant fraction and a soluble fraction. The nuclease-resistant fraction reflected a high content of cross-linked adducts. Upon HPLC analysis, the solubilized fraction contained two monofunctionally linked porfiromycin adducts and a possibly cross-linked dinucleotide. The major adduct was isolated by HPLC and identified by NMR, as N2-(2'-deoxyguanosyl)-7-amino-2-methylaminomitosene. The N2 position of deoxyguanosine appeared as the major monofunctional alkylating site for DNA alkylation by porfiromycin. Thus, mitomycin C and porfiromycin (which differs from mitomycin C only by the addition of a methyl group to the aziridine nitrogen) share the same enzymatic activating mechanism that leads to the formation of the same types of metabolites and the same specificity of DNA alkylation. PMID:3412325

  13. Temporal and spatial features of the formation of DNA adducts in sulfur mustard-exposed skin

    SciTech Connect

    Batal, Mohamed; Boudry, Isabelle; Mouret, Stéphane; Wartelle, Julien; Emorine, Sandy; Bertoni, Marine; Bérard, Izabel; and others


    Sulfur mustard (SM) is a chemical warfare agent that targets skin where it induces large blisters. DNA alkylation is a critical step to explain SM-induced cutaneous symptoms. We determined the kinetics of formation of main SM–DNA adducts and compare it with the development of the SM-induced pathogenesis in skin. SKH-1 mice were exposed to 2, 6 and 60 mg/kg of SM and treated skin was biopsied between 6 h and 21 days. Formation of SM DNA adducts was dose-dependent with a maximum immediately after exposure. However, adducts were persistent and still detectable 21 days post-exposure. The time-dependent formation of DNA adducts was also found to be correlated with the appearance of apoptotic cells. This temporal correlation suggests that these two early events are responsible for the severity of the damage to the skin. Besides, SM–DNA adducts were also detected in areas located next to contaminated zone, thus suggesting that SM diffuses in skin. Altogether, this work provides for the first time a clear picture of SM-induced genotoxicity using DNA adducts as a marker. - Highlights: • Sulfur mustard adducts are formed in DNA after skin exposure. • DNA damage formation is an early event in the pathological process of skin burn. • The amount of SM–DNA adducts is maximal at the earliest time point investigated. • Adducts are still detected 3 weeks after exposure. • Sulfur mustard diffuses in skin especially when large doses are applied.

  14. Effect of phytochemical intervention on dibenzo[a,l]pyrene-induced DNA adduct formation.


    Russell, Gilandra K; Gupta, Ramesh C; Vadhanam, Manicka V


    Dibenzo[a,l]pyrene (DBP) has been found to be the most potent carcinogen of the polycyclic aromatic hydrocarbons (PAHs). Primary sources for DBP in the environment are combustion of wood and coal burning, gasoline and diesel exhaust, and tires. Given the likelihood of environmental exposure to DBP and strong experimental evidence of its potency, it is likely to contribute to lung cancer development. Intervention with compounds of natural origin ("phytochemicals") is considered an effective means to prevent cancer development and favorably modulate the underlying mechanisms, including DNA adduct formation. In this study, several agents have been identified that inhibit environmental carcinogen-induced DNA adduct formation using a cell-free microsomal system. Of the ten agents tested, resveratrol (648 ± 26 adducts/10(9) nucleotides), oltipraz (1007 ± 348 adducts/10(9) nucleotides), delphinidin (1252 ± 142 adducts/10(9) nucleotides), tanshinone I (1981 ± 213 adducts/10(9) nucleotides), tanshinone IIA (2606 ± 478 adducts/10(9) nucleotides) and diindoylmethane (3643 ± 469 adducts/10(9) nucleotides) were the most effective compared to vehicle treatment (14,062 ± 1097 adducts/10(9) nucleotides). DBP is metabolized by phase I metabolizing enzymes CYP1A1, CYP1A2, and CYP1B1. DBP-induced DNA adducts can be inhibited by several mechanisms. We found that all the test agents inhibited DNA adducts by inhibiting one or more of these enzymes. Oltipraz inhibited DNA adducts entirely by inhibiting the CYP450s, while resveratrol and delphinidin inhibited DNA adducts by also interacting directly with the carcinogenic metabolite, anti-dibenzo(a,l)pyrene-11,12-dihydrodiol-13,14-epoxide. PMID:25794985

  15. Effect of phytochemical intervention on dibenzo[a,l]pyrene-induced DNA adduct formation

    PubMed Central

    Russell, Gilandra K.; Gupta, Ramesh C.; Vadhanam, Manicka V.


    Dibenzo[a,l]pyrene (DBP) has been found to be the most potent carcinogen of the polycyclic aromatic hydrocarbons (PAHs). Primary sources for DBP in the environment are combustion of wood and coal burning, gasoline and diesel exhaust, and tires. Given the likelihood of environmental exposure to DBP and strong experimental evidence of its potency, it is likely to contribute to lung cancer development. Intervention with compounds of natural origin (“phytochemicals”) is considered an effective means to prevent cancer development and favorably modulate the underlying mechanisms, including DNA adduct formation. In this study, several agents have been identified that inhibit environmental carcinogen-induced DNA adduct formation using a cell-free microsomal system. Of the ten agents tested, resveratrol (648 ± 26 adducts/109 nucleotides), oltipraz (1007 ± 348 adducts/109 nucleotides), delphinidin (1252 ± 142 adducts/109 nucleotides), tanshinone I (1981 ± 213 adducts/109 nucleotides), tanshinone IIA (2606 ± 478 adducts/109 nucleotides) and diindoylmethane (3643 ± 469 adducts/109 nucleotides) were the most effective compared to vehicle treatment (14,062 ± 1097 adducts/109 nucleotides). DBP is metabolized by phase I metabolizing enzymes CYP1A1, CYP1A2, and CYP1B1. DBP-induced DNA adducts can be inhibited by several mechanisms. We found that all the test agents inhibited DNA adducts by inhibiting one or more of these enzymes. Oltipraz inhibited DNA adducts entirely by inhibiting the CYP450s, while resveratrol and delphinidin inhibited DNA adducts by also interacting directly with the carcinogenic metabolite, anti-dibenzo(a,l)pyrene-11,12-dihydrodiol-13,14-epoxide. PMID:25794985

  16. Methods for synthesizing alane without the formation of adducts and free of halides


    Zidan, Ragaiy; Knight, Douglas A; Dinh, Long V


    A process is provided to synthesize an alane without the formation of alane adducts as a precursor. The resulting product is a crystallized .alpha.-alane and is a highly stable product and is free of halides.

  17. Preferential Formation of Benzo[a]pyrene Adducts at Lung Cancer Mutational Hotspots in P53

    NASA Astrophysics Data System (ADS)

    Denissenko, Mikhail F.; Pao, Annie; Tang, Moon-Shong; Pfeifer, Gerd P.


    Cigarette smoke carcinogens such as benzo[a]pyrene are implicated in the development of lung cancer. The distribution of benzo[a]pyrene diol epoxide (BPDE) adducts along exons of the P53 gene in BPDE-treated HeLa cells and bronchial epithelial cells was mapped at nucleotide resolution. Strong and selective adduct formation occurred at guanine positions in codons 157, 248, and 273. These same positions are the major mutational hotspots in human lung cancers. Thus, targeted adduct formation rather than phenotypic selection appears to shape the P53 mutational spectrum in lung cancer. These results provide a direct etiological link between a defined chemical carcinogen and human cancer.

  18. Metabolism and hemoglobin adduct formation of acrylamide in humans.


    Fennell, Timothy R; Sumner, Susan C J; Snyder, Rodney W; Burgess, Jason; Spicer, Rebecca; Bridson, William E; Friedman, Marvin A


    Acrylamide (AM), used in the manufacture of polyacrylamide and grouting agents, is produced during the cooking of foods. Workplace exposure to AM can occur through the dermal and inhalation routes. The objectives of this study were to evaluate the metabolism of AM in humans following oral administration, to compare hemoglobin adduct formation on oral and dermal administration, and to measure hormone levels. The health of the people exposed under controlled conditions was continually monitored. Prior to conducting exposures in humans, a low-dose study was conducted in rats administered 3 mg/kg (1,2,3-13C3) AM by gavage. The study protocol was reviewed and approved by Institute Review Boards both at RTI, which performed the sample analysis, and the clinical research center conducting the study. (1,2,3-13C3) AM was administered in an aqueous solution orally (single dose of 0.5, 1.0, or 3.0 mg/kg) or dermally (three daily doses of 3.0 mg/kg) to sterile male volunteers. Urine samples (3 mg/kg oral dose) were analyzed for AM metabolites using 13C NMR spectroscopy. Approximately 86% of the urinary metabolites were derived from GSH conjugation and excreted as N-acetyl-S-(3-amino-3-oxopropyl)cysteine and its S-oxide. Glycidamide, glyceramide, and low levels of N-acetyl-S-(3-amino-2-hydroxy-3-oxopropyl)cysteine were detected in urine. On oral administration, a linear dose response was observed for N-(2-carbamoylethyl)valine (AAVal) and N-(2-carbamoyl-2-hydroxyethyl)valine (GAVal) in hemoglobin. Dermal administration resulted in lower levels of AAVal and GAVal. This study indicated that humans metabolize AM via glycidamide to a lesser extent than rodents, and dermal uptake was approximately 6.6% of that observed with oral uptake. PMID:15625188

  19. DNA Adduct Formation of 4-Aminobiphenyl and Heterocyclic Aromatic Amines in Human Hepatocytes

    PubMed Central

    Nauwelaers, Gwendoline; Bessette, Erin E.; Gu, Dan; Tang, Yijin; Rageul, Julie; Fessard, Valérie; Yuan, Jian-Min; Yu, Mimi C.; Langouët, Sophie; Turesky, Robert J.


    DNA adduct formation of the aromatic amine, 4-aminobiphenyl (4-ABP), a known human carcinogen present in tobacco smoke, and the heterocyclic aromatic amines (HAAs), 2-amino-9H-pyrido[2,3-b]indole (AαC), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), and 2-amino-3,8-dimethylmidazo[4,5-f]quinoxaline (MeIQx), potential human carcinogens, which are also present in tobacco smoke or formed during the high-temperature cooking of meats, was investigated in freshly cultured human hepatocytes. The carcinogens (10 μM) were incubated with hepatocytes derived from eight different donors for time periods up to 24 h. The DNA adducts were quantified by liquid chromatography-electrospray ionization mass spectrometry with a linear quadrupole ion trap mass spectrometer. The principal DNA adducts formed for all of the carcinogens were N-(deoxyguanosin-8-yl) (dG-C8) adducts. The levels of adducts ranged from 3.4 to 140 adducts per 107 DNA bases. The highest level of adduct formation occurred with AαC, followed by 4-ABP, then by PhIP, MeIQx, and IQ. Human hepatocytes formed dG-C8-HAA-adducts at levels that were up to 100-fold greater than the amounts of adducts produced in rat hepatocytes. In contrast to HAA adducts, the levels of dG-C8-4-ABP adduct formation were similar in human and rat hepatocytes. These DNA binding data demonstrate that the rat, an animal model that is used for carcinogenesis bioassays, significantly underestimates the potential hepatic genotoxicity of HAAs in humans. The high level of DNA adducts formed by AαC, a carcinogen produced in tobacco smoke at levels that are up to 100-fold higher than the amounts of 4-ABP, is noteworthy. The possible causal role of AαC in tobacco-associated cancers warrants investigation. PMID:21456541

  20. Formation and Repair of Tobacco Carcinogen-Derived Bulky DNA Adducts


    Hang, Bo


    DNA adducts play a central role in chemical carcinogenesis. The analysis of formation and repair of smoking-related DNA adducts remains particularly challenging as both smokers and nonsmokers exposed to smoke are repetitively under attack from complex mixtures of carcinogens such as polycyclic aromatic hydrocarbons and N -nitrosamines. The bulky DNA adducts, which usually have complex structure, are particularly important because of their biological relevance. Several known cellular DNA repair pathways have been known to operate in human cells on specific types of bulky DNA adducts, for example, nucleotide excision repair, base excision repair, and direct reversal involving O 6more » -alkylguanine DNA alkyltransferase or AlkB homologs. Understanding the mechanisms of adduct formation and repair processes is critical for the assessment of cancer risk resulting from exposure to cigarette smoke, and ultimately for developing strategies of cancer prevention. This paper highlights the recent progress made in the areas concerning formation and repair of bulky DNA adducts in the context of tobacco carcinogen-associated genotoxic and carcinogenic effects.« less

  1. Formation and Repair of Tobacco Carcinogen-Derived Bulky DNA Adducts

    PubMed Central

    Hang, Bo


    DNA adducts play a central role in chemical carcinogenesis. The analysis of formation and repair of smoking-related DNA adducts remains particularly challenging as both smokers and nonsmokers exposed to smoke are repetitively under attack from complex mixtures of carcinogens such as polycyclic aromatic hydrocarbons and N-nitrosamines. The bulky DNA adducts, which usually have complex structure, are particularly important because of their biological relevance. Several known cellular DNA repair pathways have been known to operate in human cells on specific types of bulky DNA adducts, for example, nucleotide excision repair, base excision repair, and direct reversal involving O6-alkylguanine DNA alkyltransferase or AlkB homologs. Understanding the mechanisms of adduct formation and repair processes is critical for the assessment of cancer risk resulting from exposure to cigarette smoke, and ultimately for developing strategies of cancer prevention. This paper highlights the recent progress made in the areas concerning formation and repair of bulky DNA adducts in the context of tobacco carcinogen-associated genotoxic and carcinogenic effects. PMID:21234336

  2. Detection of mitomycin C-DNA adducts in vivo by 32P-postlabeling: time course for formation and removal of adducts and biochemical modulation.


    Warren, A J; Maccubbin, A E; Hamilton, J W


    Mitomycin C (MMC) is a DNA cross-linking agent that has been used in cancer chemotherapy for over 20 years, yet little is known either qualitatively or quantitatively about MMC-induced DNA adduct formation and repair in vivo. As an initial means of investigating this, we used a recently developed 32P-postlabeling assay to examine the formation and loss of MMC-DNA adducts in the tissues of a simple in vivo model test system, the chick embryo, following treatment with a chemotherapeutic dose of MMC. As early as 15 min after MMC treatment, four adducts could be detected in the liver which were tentatively identified as the (CpG) N2G-MMC-N2G interstrand cross-link, the bifunctionally activated MMC-N2G monoadduct, and two isomers (alpha and beta) of the monofunctionally activated MMC-N2G monoadduct. The (GpG) N2G-MMC-N2G intrastrand cross-link appears to be a poor substrate for nuclease P1 and/or T4 kinase and was not evaluable by this assay. Levels of all four detectable adducts increased substantially within the first 2 h after MMC treatment, reached maximal levels by 6 h, and decreased progressively thereafter through 24 h, although low levels of certain adducts persisted beyond 24 h. Lung and kidney had comparable levels of total MMC adducts, which were approximately 60% those of the liver, and there were no significant differences in the proportion of specific adducts among the three tissues. The interstrand cross-link represented approximately 13-14% of the total MMC adducts, which is approximately 5-fold greater than the proportion of CpG sites in the genome. In addition, the interstrand cross-link was selectively decreased after 16 h relative to the three monoadducts, suggesting preferential repair. The effect of modulating different components of the Phase I and Phase II drug metabolism on MMC adduct formation, using either glutethimide, 3,4,3',4'-tetrachlorobiphenyl, dexamethasone, buthionine sulfoximine, ethacrynic acid, or N-acetylcysteine pretreatments, was

  3. Kinetics, mechanism and thermodynamics of bisulfite-aldehyde adduct formation

    SciTech Connect

    Olson, T.M.; Boyce, S.D.; Hoffmann, M.R.


    The kinetics and mechanism of bisulfite addition to benzaldehyde were studied at low pH in order to assess the importance of this reaction in stabilizing S(IV) in fog-, cloud-, and rainwater. Previously, the authors established that appreciable concentrations of the formaldehyde-bisulfite adduct (HMSA) are often present in fogwater. Measured HMSA concentrations in fogwater often do not fully account for observed excess S(IV) concentrations, however, so that other S(IV)-aldehyde adducts may be present. Reaction rates were determined by monitoring the disappearance of benzaldehyde by U.V. spectrophotometry under pseudo-first order conditions, (S(IV))/sub T/ >>(phi-CHO)/sub T/, in the pH range 0 - 4.4 at 25/sup 0/C. The equilibrium constant was determined by dissolving the sodium salt of the addition compound in a solution adjusted to pH 3.9, and measuring the absorbance of the equilibrated solution at 250 nm. A literature value of the extinction coefficient for benzaldehyde was used to calculate the concentration of free benzaldehyde. All solutions were prepared under an N/sub 2/ atmosphere using deoxygenated, deionized water and ionic strength was maintained at 1.0 M with sodium chloride.

  4. Neutrophils amplify the formation of DNA adducts by benzo[a]pyrene in lung target cells.


    Borm, P J; Knaapen, A M; Schins, R P; Godschalk, R W; Schooten, F J


    Inflammatory cells and their reactive oxygen metabolites can cause mutagenic effects in lung cells. The purpose of this study was to investigate the ability of activated neutrophils to modulate DNA binding of benzo[a]pyrene (B[a]P), a known carcinogen, in lung target cells. Equivalent numbers of rat lung epithelial cells (RLE-6TN cell line) and freshly isolated human blood neutrophils (PMN) were coincubated in vitro for 2 hr after addition of benzo[a]pyrene (0.5 microM) or two of its trans-diol metabolites, with or without stimulation with phorbol myristate acetate (PMA). DNA adducts of B[a]P-metabolites were determined in target cells using 32P-postlabeling; oxidative DNA damage (7-hydro-8-oxo-2'-deoxyguanosine [8-oxodG]) was evaluated by high performance liquid chromatography with electrochemical detection. Increased DNA adducts were observed in lung cells coincubated with polymorphonuclear leukocytes (PMN). Activation of PMN with PMA, or addition of more activated PMN in relation to the number of lung cells, further increased the number of adducts, the latter in a dose-response manner. Incubation with B[a]P-4,5-diol did not result in any adduct formation, while B[a]P-7,8-diol led to a significant number of adducts. Moreover, PMA-activated PMN strongly enhanced adduct formation by B[a]P-7,8-diol, but not 8-oxodG, in lung cells. The addition of antioxidants to the coincubations significantly reduced the number of adducts. Results suggest that an inflammatory response in the lung may increase the biologically effective dose of polycyclic aromatic hydrocarbons (PAHs), and may be relevant to data interpretation and risk assessment of PAH-containing particulates. PMID:9400705

  5. Formation of DNA Adducts by Ellipticine and Its Micellar Form in Rats — A Comparative Study

    PubMed Central

    Stiborova, Marie; Manhartova, Zuzana; Hodek, Petr; Adam, Vojtech; Kizek, Rene; Frei, Eva


    The requirements for early diagnostics as well as effective treatment of cancer diseases have increased the pressure on development of efficient methods for targeted drug delivery as well as imaging of the treatment success. One of the most recent approaches covering the drug delivery aspects is benefitting from the unique properties of nanomaterials. Ellipticine and its derivatives are efficient anticancer compounds that function through multiple mechanisms. Formation of covalent DNA adducts after ellipticine enzymatic activation is one of the most important mechanisms of its pharmacological action. In this study, we investigated whether ellipticine might be released from its micellar (encapsulated) form to generate covalent adducts analogous to those formed by free ellipticine. The 32P-postlabeling technique was used as a useful imaging method to detect and quantify covalent ellipticine-derived DNA adducts. We compared the efficiencies of free ellipticine and its micellar form (the poly(ethylene oxide)-block-poly(allyl glycidyl ether) (PAGE-PEO) block copolymer, P 119 nanoparticles) to form ellipticine-DNA adducts in rats in vivo. Here, we demonstrate for the first time that treatment of rats with ellipticine in micelles resulted in formation of ellipticine-derived DNA adducts in vivo and suggest that a gradual release of ellipticine from its micellar form might produce the enhanced permeation and retention effect of this ellipticine-micellar delivery system. PMID:25479328

  6. A new model for multiply charged adduct formation between peptides and anions in electrospray mass spectrometry.


    Liu, Xiaohua; Cole, Richard B


    A new model has been developed to account for adduct formation on multiply charged peptides observed in negative ion electrospray mass spectrometry. To obtain a stable adduct, the model necessitates an approximate matching of apparent gas-phase basicity (GB(app)) of a given proton bearing site on the peptide with the gas-phase basicity (GB) of the anion attaching at that site. Evidence supporting the model is derived from the fact that for [Glu] Fibrinopeptide B, higher GB anions dominated in adducts observed at higher negative charge states, whereas lower GB anions appeared predominately in lower charge state adducts. Singly charged adducts were only observed for lower GB anions: HSO(4)(-), I(-), CF(3)COO(-). Ions that have medium GBs (NO(3) (-), Br(-), H(2)PO(4)(-)) only form adducts having -2 charge states, whereas Cl(-) (higher GB) can form adducts having -3 charge states. The model portends that (1) carboxylate groups are much more basic than available amino groups; (2) apparent GBs of the various carboxylate groups on peptides do not vary substantially from one another; and (3) apparent GBs of the individual carboxylate and amino sites do not behave independently. This model was developed for negative ion attachment but an analogous mechanism is also proposed for the positive ion mode wherein (1) binding of a neutral at an amino site polarizes this amino group, but hardly affects apparent GBs of other sites; (2) proton addition (charge state augmentation) at one site can decrease the instrinsic GBs of other potential protonation sites and lower their apparent GBs. PMID:21997579

  7. A New Model for Multiply Charged Adduct Formation Between Peptides and Anions in Electrospray Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Liu, Xiaohua; Cole, Richard B.


    A new model has been developed to account for adduct formation on multiply charged peptides observed in negative ion electrospray mass spectrometry. To obtain a stable adduct, the model necessitates an approximate matching of apparent gas-phase basicity (GBapp) of a given proton bearing site on the peptide with the gas-phase basicity (GB) of the anion attaching at that site. Evidence supporting the model is derived from the fact that for [Glu] Fibrinopeptide B, higher GB anions dominated in adducts observed at higher negative charge states, whereas lower GB anions appeared predominately in lower charge state adducts. Singly charged adducts were only observed for lower GB anions: HSO{4/-}, I-, CF3COO-. Ions that have medium GBs (NO{3/-}, Br-, H2PO{4/-}) only form adducts having -2 charge states, whereas Cl- (higher GB) can form adducts having -3 charge states. The model portends that (1) carboxylate groups are much more basic than available amino groups; (2) apparent GBs of the various carboxylate groups on peptides do not vary substantially from one another; and (3) apparent GBs of the individual carboxylate and amino sites do not behave independently. This model was developed for negative ion attachment but an analogous mechanism is also proposed for the positive ion mode wherein (1) binding of a neutral at an amino site polarizes this amino group, but hardly affects apparent GBs of other sites; (2) proton addition (charge state augmentation) at one site can decrease the instrinsic GBs of other potential protonation sites and lower their apparent GBs.


    EPA Science Inventory

    The metabolism and DNA adduct formation by the mutagenic environmental contaminant 2-nitrofluoranthene (2-NFA) was studied. ncubation under aerobic conditions with liver microsomes of rats pretreated with 3-methylcholanthrene yielded 2-NFA tran-7.8-dihydrodiol, 2-NFA tran-9,10-di...


    EPA Science Inventory

    The formation of DNA adducts in the nasal, lung, and liver tissues of rats exposed daily to fresh smoke from a University of Kentucky refernece cigarette (2R1) for up to 40 weeks was examined. he amount of smoke total particulate matter (TPM) inhaled and the blood carboxyhemoglob...

  10. Nitroreduction and formation of hemoglobin adducts in rats with a human intestinal microflora

    SciTech Connect

    Scheepers, P.T.J.; Straetemans, M.M.E.; Koopman, J.P.; Bos, R.P.


    In the covalent binding of nitroarenes to macromolecules, nitroreduction is an important step. The intestinal microflora represents an enormous potential of bacterial nitroreductase activity. As a consequence, the in vivo nitroreduction of orally administerednitroarenes is primarily located in the intestine. In this study, we have investigated the nitroreduction of 2-nitrofluorene (2-NF) by a human microflora in female Wistar rats. Germ-free (FG) rats were equipped with a bacterial flora derived from human feces. Nontreated GF rats and GF animals equipped with a conventional rat flora were used as controls. The composition of the human and the conventional microflora isolated from the rats were consistent with the microflora of the administered feces. In the rats receiving only sunflower seed oil, no adducts were detected. The animals equipped with a human or rat microflora that received 2-aminofluorene (2-AF) formed 2-AF hemoglobin (Hb)-adducts at average levels mean {+-} 0.003 and 0.043 {+-} 0.010 {mu}mole/g Hb, respectively. In the FG rats, an adduct level of 0.57 {+-} 0.09 was determined after 2-AF administration and non adducts were detected after 2-NF administration. The results show that nitroreduction by an acquired human intestinal microflora and subsequent adduct formation can be studied in the rate in vivo. 21 refs., 3 tabs.

  11. Isomerism and adduct formation in the hector's base series: A MNDO study of model compounds

    NASA Astrophysics Data System (ADS)

    Cuthbertson, Alastair F.; Glidewell, Christopher

    MNDO calculations on a series of a model compounds show that the observed structures for Hector's base, Dost's base and Dost's keto compound are the thermodynamically most stable tautomers and that the bond-switched structure observed for the 1:1 adduct of Hector's base with carbon disulphide and the non-bond-switched structure observed for the corresponding adducts with isocyanates and isothiocyanates are both the thermodynamically most favoured isomers, so that the occurrence or otherwise of a bond switch in these compounds is determined by thermodynamic rather than by mechanistic factors. Proposed mechanisms for the formation of the carbon disulphide adduct of Hector's base, and for its desulphurisation are supported by MNDO calculations.

  12. Covalent adduct formation between the plasmalogen-derived modification product 2-chlorohexadecanal and phloretin

    PubMed Central

    Üllen, Andreas; Nusshold, Christoph; Glasnov, Toma; Saf, Robert; Cantillo, David; Eibinger, Gerald; Reicher, Helga; Fauler, Günter; Bernhart, Eva; Hallstrom, Seth; Kogelnik, Nora; Zangger, Klaus; Oliver Kappe, C.; Malle, Ernst; Sattler, Wolfgang


    Hypochlorous acid added as reagent or generated by the myeloperoxidase (MPO)-H2O2-Cl− system oxidatively modifies brain ether-phospholipids (plasmalogens). This reaction generates a sn2-acyl-lysophospholipid and chlorinated fatty aldehydes. 2-Chlorohexadecanal (2-ClHDA), a prototypic member of chlorinated long-chain fatty aldehydes, has potent neurotoxic potential by inflicting blood–brain barrier (BBB) damage. During earlier studies we could show that the dihydrochalcone-type polyphenol phloretin attenuated 2-ClHDA-induced BBB dysfunction. To clarify the underlying mechanism(s) we now investigated the possibility of covalent adduct formation between 2-ClHDA and phloretin. Coincubation of 2-ClHDA and phloretin in phosphatidylcholine liposomes revealed a half-life of 2-ClHDA of approx. 120 min, decaying at a rate of 5.9 × 10−3 min−1. NMR studies and enthalpy calculations suggested that 2-ClHDA-phloretin adduct formation occurs via electrophilic aromatic substitution followed by hemiacetal formation on the A-ring of phloretin. Adduct characterization by high-resolution mass spectroscopy confirmed these results. In contrast to 2-ClHDA, the covalent 2-ClHDA-phloretin adduct was without adverse effects on MTT reduction (an indicator for metabolic activity), cellular adenine nucleotide content, and barrier function of brain microvascular endothelial cells (BMVEC). Of note, 2-ClHDA-phloretin adduct formation was also observed in BMVEC cultures. Intraperitoneal application and subsequent GC–MS analysis of brain lipid extracts revealed that phloretin is able to penetrate the BBB of C57BL/6J mice. Data of the present study indicate that phloretin scavenges 2-ClHDA, thereby attenuating 2-ClHDA-mediated brain endothelial cell dysfunction. We here identify a detoxification pathway for a prototypic chlorinated fatty aldehyde (generated via the MPO axis) that compromises BBB function in vitro and in vivo. PMID:25576489

  13. Formation of metal-ion adducts and evidence for surface-catalyzed ionization in electrospray analysis of pharmaceuticals and pesticides

    USGS Publications Warehouse

    Thurman, E.M.; Ferrer, I.


    The formation of metal ion adducts in liquid chromatography/mass spectrometry positive-ion electrospray analysis of pharmaceuticals and pesticides was investigated. The evidence of surface-catalyzed ionization in the electrospray analysis was also studied. Both positive and negative ion mass spectrometry were used for the analysis of the products. It was found that the sodium adducts formed in the analysis included single, double, and triple sodium adducts. Adduction was found to occur by attachment of the metal ion to carboxyl, carbonyl and aromatic pi electrons of the molecule.

  14. Formation of 1,4-dioxo-2-butene-derived adducts of 2'-deoxyadenosine and 2'-deoxycytidine in oxidized DNA.


    Chen, Bingzi; Vu, Choua C; Byrns, Michael C; Dedon, Peter C; Peterson, Lisa A


    Oxidation of deoxyribose in DNA produces a variety of electrophilic residues that are capable of reacting with nucleobases to form adducts such as M(1)dG, the pyrimidopurinone adduct of dG. We now report that deoxyribose oxidation in DNA leads to the formation of oxadiazabicyclo(3.3.0)octaimine adducts of dC and dA. We previously demonstrated that these adducts arise in reactions of nucleosides and DNA with trans-1,4-dioxo-2-butene, the beta-elimination product of the 2-phosphoryl-1,4-dioxobutane residue arising from 5'-oxidation of deoxyribose in DNA, and with cis-1,4-dioxo-2-butene, a metabolite of furan. Treatment of DNA with enediyne antibiotics capable of oxidizing the 5'-position of deoxyribose (calicheamicin and neocarzinostatin) led to a concentration-dependent formation of oxadiazabicyclo(3.3.0)octaimine adducts of dC and dA, while the antibiotic bleomycin, which is capable of performing only 4-oxidation of deoxyribose, did not give rise to the adducts. The nonspecific DNA oxidant, gamma-radiation, also produced the adducts that represented approximately 0.1% of the 2-phosphoryl-1,4-dioxobutane residues formed during the irradiation. These results suggest that the oxadiazabicyclo(3.3.0)octaimine adducts of dC and dA could represent endogenous DNA lesions arising from oxidative stresses that also give rise to other DNA adducts. PMID:16918236

  15. Formation of melamium adducts by pyrolysis of thiourea or melamine/NH4 Cl mixtures.


    Braml, Nicole E; Sattler, Andreas; Schnick, Wolfgang


    Pyrolysis of prominent precursor compounds for the synthesis of carbon nitride type materials (e.g., melamine, thiourea) have been studied in detail. Molecular adducts containing monoprotonated melamium C(6)N(11)H(10)(+) and melaminium HC(3)N(3)(NH(2))(3)(+) ions, respectively, have been identified as intermediates. The adduct C(6)N(11)H(10)Cl·0.5NH(4)Cl was obtained by the reaction of melamine C(3)N(3)(NH(2))(3) with NH(4)Cl at 450 °C. During the pyrolysis of thiourea, guanidinium thiocyanate was initially formed and subsequently the melamium thiocyanate melamine adduct C(6)N(11)H(10)SCN·2C(3)N(3)(NH(2))(3) was isolated at 300 °C. A second melaminium thiocyanate melamine adduct with the formula HC(3)N(3)(NH(2))(3)SCN·2C(3)N(3)(NH(2))(3) represents an intermediary reaction product that is best accessible at low pressures. The crystal structures of the compounds were solved by single-crystal XRD. Unequivocal proton localization at the C(6)N(11)H(10)(+) ion was established. A typical intramolecular and interannular hydrogen bridge and other characteristic hydrogen-bonding motifs were identified. Additionally, the adducts were investigated by solid-state NMR spectroscopy. Our study provides detailed insight into the thermal condensation of thiourea by identifying and characterizing key intermediates involved in the condensation process leading to carbon nitride type materials. Furthermore, factors promoting the formation of melamium adduct phases over melem are discussed. PMID:22223531

  16. Monitoring the apple polyphenol oxidase-modulated adduct formation of phenolic and amino compounds.


    Reinkensmeier, Annika; Steinbrenner, Katrin; Homann, Thomas; Bußler, Sara; Rohn, Sascha; Rawel, Hashadrai M


    Minimally processed fruit products such as smoothies are increasingly coming into demand. However, they are often combined with dairy ingredients. In this combination, phenolic compounds, polyphenoloxidases, and amino compounds could interact. In this work, a model approach is presented where apple serves as a source for a high polyphenoloxidase activity for modulating the reactions. The polyphenoloxidase activity ranged from 128 to 333nakt/mL in different apple varieties. From these, 'Braeburn' was found to provide the highest enzymatic activity. The formation and stability of resulting chromogenic conjugates was investigated. The results show that such adducts are not stable and possible degradation mechanisms leading to follow-up products formed are proposed. Finally, apple extracts were used to modify proteins and their functional properties characterized. There were retaining antioxidant properties inherent to phenolic compounds after adduct formation. Consequently, such interactions may also be utilized to improve the textural quality of food products. PMID:26471529

  17. Formation of DNA adducts in rat lung following chronic inhalation of diesel emissions, carbon black and titanium dioxide particles.


    Gallagher, J; Heinrich, U; George, M; Hendee, L; Phillips, D H; Lewtas, J


    Exposure of rats to diesel emissions results in the development of lung tumors. The objective of this study was to determine whether the polycyclic aromatic hydrocarbons (PAHs), nitro-PAHs or other polycyclic organic matter adsorbed to diesel particles induces the formation of DNA adducts in the lung when compared to particles with little or no adsorbed organic matter. Rats were exposed to diesel emissions containing particles with over 30% solvent-extractable adsorbed organic matter and to particles with < 0.1% adsorbed organic matter (carbon black particles and TiO2). Wistar rats were exposed to diesel emissions (7.5 mg/m3) for 2 months, 6 months and 2 years and for 2 years to carbon black (11.3 mg/m3) and TiO2 particles (10.4 mg/m3) to compare tumorigenic response and DNA adduct formation in the lung. Two versions of the 32P-postlabeling assay for the detection of DNA adducts were used to tentatively identify nitrated-amine or arylamine adducts formed relative to other nitro PAH based on the demonstrated sensitivity of these adducts to nuclease P1 treatment. Total adduct levels were determined for peripheral lung tissue DNA as detected in a diagonal radioactive zone. One major adduct which migrated outside this region (adduct 1) and a nuclease P1-sensitive adduct (adduct 2) were quantitated separately. Adduct 1 increased significantly over time in the filtered air exposed animals but decreased markedly at the 2 year time points regardless of particle type, presumably as a result of adduct dilution through de novo cell synthesis or cell proliferation invoked in response to particle loading and/or effect on the endogenous synthesis or degradation of DNA reactive moieties. The nuclease sensitive adduct (adduct 2), possibly resulting from exposure to nitro-PAHs, was detected in diesel-exposed rats but was not detected in the rats exposed to TiO2 and carbon black. No significant elevation in PAH-derived adducts, relative to the filtered air controls, was observed in

  18. Role of CYP1B1 in PAH-DNA adduct formation and breast cancer risk

    SciTech Connect

    Goth-Goldstein, Regine; Russell, Marion L.; Muller, A.P.; Caleffi, M.; Eschiletti, J.; Graudenz, M.; Sohn, Michael D.


    This study investigated the hypothesis that increased exposure to polycyclic aromatic hydrocarbons (PAHs) increases breast cancer risk. PAHs are products of incomplete burning of organic matter and are present in cigarette smoke, ambient air, drinking water, and diet. PAHs require metabolic transformation to bind to DNA, causing DNA adducts, which can lead to mutations and are thought to be an important pre-cancer marker. In breast tissue, PAHs appear to be metabolized to their cancer-causing form primarily by the cytochrome P450 enzyme CYP1B1. Because the genotoxic impact of PAH depends on their metabolism, we hypothesized that high CYP1B1 enzyme levels result in increased formation of PAH-DNA adducts in breast tissue, leading to increased development of breast cancer. We have investigated molecular mechanisms of the relationship between PAH exposure, CYP1B1 expression and breast cancer risk in a clinic-based case-control study. We collected histologically normal breast tissue from 56 women (43 cases and 13 controls) undergoing breast surgery and analyzed these specimens for CYP1B1 genotype, PAH-DNA adducts and CYP1B1 gene expression. We did not detect any difference in aromatic DNA adduct levels of cases and controls, only between smokers and non-smokers. CYP1B1 transcript levels were slightly lower in controls than cases, but the difference was not statistically significant. We found no correlation between the levels of CYP1B1 expression and DNA adducts. If CYP1B1 has any role in breast cancer etiology it might be through its metabolism of estrogen rather than its metabolism of PAHs. However, due to the lack of statistical power these results should be interpreted with caution.

  19. Stereochemical Configuration of 4-Hydroxy-2-nonenal-Cysteine Adducts and Their Stereoselective Formation in a Redox-regulated Protein*

    PubMed Central

    Wakita, Chika; Maeshima, Takuya; Yamazaki, Atsushi; Shibata, Takahiro; Ito, Sohei; Akagawa, Mitsugu; Ojika, Makoto; Yodoi, Junji; Uchida, Koji


    4-Hydroxy-2-nonenal (HNE), a major racemic product of lipid peroxidation, preferentially reacts with cysteine residues to form a stable HNE-cysteine Michael addition adduct possessing three chiral centers. Here, to gain more insight into sulfhydryl modification by HNE, we characterized the stereochemical configuration of the HNE-cysteine adducts and investigated their stereoselective formation in redox-regulated proteins. To characterize the HNE-cysteine adducts by NMR, the authentic (R)-HNE- and (S)-HNE-cysteine adducts were prepared by incubating N-acetylcysteine with each HNE enantiomer, both of which provided two peaks in reversed-phase high performance liquid chromatography (HPLC). The NMR analysis revealed that each peak was a mixture of anomeric isomers. In addition, mutarotation at the anomeric center was also observed in the analysis of the nuclear Overhauser effect. To analyze these adducts in proteins, we adapted a pyridylamination-based approach, using 2-aminopyridine in the presence of sodium cyanoborohydride, which enabled analyzing the individual (R)-HNE- and (S)-HNE-cysteine adducts by reversed-phase HPLC following acid hydrolysis. Using the pyridylamination method along with mass spectrometry, we characterized the stereoselective formation of the HNE-cysteine adducts in human thioredoxin and found that HNE preferentially modifies Cys73 and, to the lesser extent, the active site Cys32. More interestingly, the (R)-HNE- and (S)-HNE-cysteine adducts were almost equally formed at Cys73, whereas Cys32 exhibited a remarkable preference for the adduct formation with (R)-HNE. Finally, the utility of the method for the determination of the HNE-cysteine adducts was confirmed by an in vitro study using HeLa cells. The present results not only offer structural insight into sulfhydryl modification by lipid peroxidation products but also provide a platform for the chemical analysis of protein S-associated aldehydes in vitro and in vivo. PMID:19692331

  20. Determinants of formation of aflatoxin-albumin adducts: a seven-township study in Taiwan

    PubMed Central

    Sun, C-A; Wu, D-M; Wang, L-Y; Chen, C-J; You, S-L; Santella, R M


    Dietary exposure to aflatoxins is one of the major risk factors for hepatocellular carcinoma. Individual susceptibility to aflatoxin-induced hepatocarcinogenesis may be modulated by both genetic and environmental factors affecting metabolism. A cross-sectional study was performed to evaluate determinants of the formation of aflatoxin covalently bound to albumin (AFB1-albumin adducts). A total of 474 subjects who were free of liver cancer and cirrhosis and were initially selected as controls for previous case–control studies of aflatoxin-induced hepatocarcinogenesis in Taiwan, were employed in this study. Aflatoxin-albumin adducts were determined by competitive enzyme-linked immunosorbent assay, hepatitis B surface antigen and antibodies to hepatitis C virus by enzyme immunoassay, as well as genotypes of glutathione S-transferase M1-1 and T1-1 by polymerase chain reaction. The detection rate of AFB1-albumin adducts was significantly higher in males (42.5%) than in females (21.6%) (multivariate-adjusted odds ratio=2.6, 95% confidence interval=1.4–5.0). The formation of detectable albumin adducts was moderately higher in hepatitis B surface antigen carriers (42.8%) than in non-carriers (36.6%) (multivariate-adjusted odds ratio=1.4, 95% confidence interval=1.0–2.1). In addition, the detection rate of AFB1-albumin adducts tended to increase with the increasing number of null genotypes of glutathione S-transferase M1-1 and glutathione S-transferase T1-1. In conclusion, this cross-sectional study has assessed the relative contributions of environmental exposure and host susceptibility factors in the formation of AFB1-albumin adducts in a well characterised Chinese adult population. This study further emphasises the necessity to reduce aflatoxin exposure in people living in an area endemic for chronic hepatitis B virus infection. British Journal of Cancer (2002) 87, 966–970. doi:10.1038/sj.bjc.6600584 © 2002 Cancer Research UK PMID:12434285

  1. The use of in vitro DNA adduct formation to estimate the genotoxicity of residues at contaminated sites.


    Shaw, G; Connell, D; Barron, W


    Genotoxic carcinogens such as polycyclic aromatic hydrocarbons (PAHs) covalently bind to the bases in DNA to form adducts. The formation of DNA adducts is significant with respect to chemical carcinogenesis. Many contaminated sites contain quantities of carcinogens such as PAHs, and the evaluation of the genotoxicity of these soils has important implications for human risk assessment. DNA adducts can be formed using an in vitro system incorporating extracts from contaminated soils. The 32P-postlabelling assay is a sensitive technique for the detection of DNA adducts from complex mixtures of environmental carcinogens. These techniques have been used to form and detect DNA adducts using soils from a number of coal gasworks sites. The results show that the extent of adduct formation depends partially on the petroleum hydrocarbon content of samples, but also on other undetermined factors related to composition. While environmental weathering has been shown to effect the PAH composition of samples, this is not an important factor in controlling the genotoxicity of samples as estimated by DNA adduct formation. PMID:7780722

  2. Novel methods for synthesizing halide-free alane without the formation of adducts

    NASA Astrophysics Data System (ADS)

    Dinh, Long V.; Knight, Douglas A.; Paskevicius, Mark; Buckley, Craig E.; Zidan, Ragaiy


    Many of the current synthesis methods for aluminum hydride (alane—AlH3) involve reacting AlCl3 and LiAlH4 in solvents. The reaction requires the formation of an alane adduct such as AlH3ṡ[(C2H5)2O] prior to obtaining crystallized stable α-AlH3. This process requires several hours of pumping in a vacuum system to remove the ether and convert the alane etherate into stable α-alane. This crystallization process is both costly and hazardous because a large amount of highly flammable material (e.g. ether) is removed by vacuum pumps over several hours. Conversely, the work presented herein describes novel methods to synthesize adduct-free alane. It is demonstrated here that AlH3 can form by mixing AlCl3 and LiAlH4 in the solid state and heating to 75∘C; only α-AlH3 was obtained. The α-AlH3 product can be washed with minimal solvents leading to zero formation of alane adducts. In addition, the unwanted LiCl by-product is also removed during the solvent wash, resulting in halide-free α-alane. Although simply mixing and heating the reactants led to a 40% yield of alane, having the reactants compacted and mechanically pressed while heating increases the yield to 60% crystalline α-AlH3.

  3. Adduct formation of 7,12-dimethylbenz(a)anthracene in the embryo of the Japanese medaka (Oryzias latipes)

    SciTech Connect

    Liu, H.; Cooper, K.R.


    DNA adduct formation of 7,1 2-dimethylbenz(a)anthracene (DMBA) in vivo in the Japanese medaka embryo were investigated using {sup 32}P-postlabeling analysis. 1-compounds (endogenous adducts) were not observed in the Japanese medaka embryo on days 4 (prior to liver formation), 6 (liver/swim bladder) or 10 (prior to hatch) of development. The level of DMBA:DNA adducts were concentration-dependent over the range of 0.625 ppm (Total Adducts 0.05707 pmol/mg of DNA) to 2.50 ppm (0.43341 pmol/mg of DNA) and decreased at 5.00 ppm (0.25338 pmol/mg of DNA) after medaka embryos were exposed to DMBA for 6 days from the day of fertilization. The decrease in DMBA:DNA adducts at 5.00 ppm was probably due to embryo toxicity (78% death). The level of DMBA:DNA adducts formed from the embryos exposed to DMBA for 24 hr decreased as the stage of development increased: day 4 > day 6 > day 10; 0.0262, 0.0179, 0.0129 pmol/mg of DNA, respectively. The level of DMBA:DNA adducts increased as the length of exposure increased: 4 day < 6 day < 10 day; 0.0233, 0.0614, 0.1502, respectively. There was both a time and dose dependence to the number of adducts detected. The data presented demonstrated the development of DM BA-DNA adducts in the developing Japanese medaka (Oryzias latipes) and the lack of I-compounds.

  4. The formation of lipid hydroperoxide-derived amide-type lysine adducts on proteins: a review of current knowledge.


    Kato, Yoji


    Lipid peroxidation is an important biological reaction. In particular, polyunsaturated fatty acid (PUFA) can be oxidized easily. Peroxidized lipids often react with other amines accompanied by the formation of various covalent adducts. Novel amide-type lipid-lysine adducts have been identified from an in vitro reaction mixture of lipid hydroperoxide with a protein, biological tissues exposed to conditions of oxidative stress and human urine from a healthy person. In this chapter, the current knowledge of amide type adducts is reviewed with a focus on the evaluation of functional foods and diseases with a history of discovery of hexanoyl-lysine (HEL). Although there is extensive research on HEL and other amide-type adducts, the mechanism of generation of the amide bond remains unclear. We have found that the decomposed aldehyde plus peroxide combined with a lysine moiety does not fully explain the formation of the amide-type lipid-lysine adduct that is generated by lipid hydroperoxide. Singlet oxygen or an excited state of the ketone generated from the lipid hydroperoxide may also contribute to the formation of the amide linkage. The amide-adducts may prove useful not only for the detection of oxidative stress induced by disease but also for the estimation of damage caused by an excess intake of PUFA. PMID:24374915

  5. Contribution of artifacts to N-methylated piperazine cyanide adduct formation in vitro from N-alkyl piperazine analogs.


    Zhang, Minli; Resuello, Christina M; Guo, Jian; Powell, Mark E; Elmore, Charles S; Hu, Jun; Vishwanathan, Karthick


    In the liver microsome cyanide (CN)-trapping assays, piperazine-containing compounds formed significant N-methyl piperazine CN adducts. Two pathways for the N-methyl piperazine CN adduct formation were proposed: 1) The α-carbon in the N-methyl piperazine is oxidized to form a reactive iminium ion that can react with cyanide ion; 2) N-dealkylation occurs followed by condensation with formaldehyde and dehydration to produce N-methylenepiperazine iminium ion, which then reacts with cyanide ion to form the N-methyl CN adduct. The CN adduct from the second pathway was believed to be an artifact or metabonate. In the present study, a group of 4'-N-alkyl piperazines and 4'-N-[¹³C]methyl-labeled piperazines were used to determine which pathway was predominant. Following microsomal incubations in the presence of cyanide ions, a significant percentage of 4'-N-[¹³C]methyl group in the CN adduct was replaced by an unlabeled natural methyl group, suggesting that the second pathway was predominant. For 4'-N-alkyl piperazine, the level of 4'-N-methyl piperazine CN adduct formation was limited by the extent of prior 4'-N-dealkylation. In a separate study, when 4'-NH-piperaziens were incubated with potassium cyanide and [¹³C]-labeled formaldehyde, 4'-N-[¹³C]methyl piperazine CN-adduct was formed without NADPH or liver microsome suggesting a direct Mannich reaction is involved. However, when [¹³C]-labeled methanol or potassium carbonate was used as the one-carbon donor, 4'-N-[¹³C]methyl piperazine CN adduct was not detected without liver microsome or NADPH present. The biologic and toxicological implications of bioactivation via the second pathway necessitate further investigation because these one-carbon donors for the formation of reactive iminium ions could be endogenous and readily available in vivo. PMID:23431111

  6. Aminofluorene-DNA adduct formation in Salmonella typhimurium exposed to the carcinogen N-hydroxy-2-acetylaminofluorene.

    PubMed Central

    Beranek, D T; White, G L; Heflich, R H; Beland, F A


    The DNA adducts formed during incubation of the hepatocarcinogen N-hydroxy-2-acetylaminofluorene with Salmonella typhimurium tester strain TA1538 were investigated to determine if the covalently bound products were identical to those adducts found in rat liver DNA and to establish the biological significance of the adducts in a mutational assay. When bacteria were exposed to N-hydroxy-2-acetylaminofluorene in the presence of a 9,000 x g supernatant from a rat liver homogenate (S9), only one adduct was detected. This adduct had chromatographic, pH-dependent partitioning, and UV spectral characteristics identical to those of N-(deoxyguanosin-8-yl)-2-aminofluorene. In the absence of S9 activation the same product was detected, but at a 85-90% lower level, which indicates that S. typhimurium also may be capable of metabolizing N-hydroxy-2-acetylaminofluorene to a reactive electrophile. When incubations were conducted with N-hydroxy-2-aminofluorene in the absence of the activation system, N-(deoxyguanosin-8-yl)-2-aminofluorene again was the major adduct. At equimolar concentrations, the arylhydroxylamine was approximately 10 times more efficient than the arylhydroxamic acid in inducing reversions in the bacteria. Comparison of the mutation rate to the level of binding in bacterial DNA gave a linear relationship with a slope of 0.96 and a correlation coefficient of 0.92. These data support previous suggestions that N-hydroxy-2-acetylaminofluorene is deacetylated by rat liver S9 to the ultimate mutagen, N-hydroxy-2-aminofluorene, and also indicate that S. typhimurium can mediate this reaction. The correlation between mutagenicity and the extent of N-(deoxyguanosin-8-yl)-2-aminofluorene adduct formation, coupled with the observation that this adduct is the major DNA adduct found in rat liver in vivo, suggests that N-(deoxyguanosin-8-yl)-2-aminofluorene may be a critical lesion for the initiation of hepatic tumorigenesis. PMID:6752940

  7. The formation of argpyrimidine, a methylglyoxal-arginine adduct, in the nucleus of neural cells

    SciTech Connect

    Nakadate, Yusuke; Uchida, Koji; Shikata, Keiji; Yoshimura, Saori; Azuma, Masayuki; Hirata, Tatsumi; Konishi, Hiroyuki; Kiyama, Hiroshi; Tachibana, Taro


    Methylglyoxal (MG) is an endogenous metabolite in glycolysis and forms stable adducts primarily with arginine residues of intracellular proteins. The biological role of this modification in cell function is not known. In the present study, we found that a MG-detoxification enzyme glyoxalase I (GLO1) is mainly expressed in the ventricular zone (VZ) at embryonic day 16 which neural stem and progenitor cells localize. Moreover, immunohistochemical analysis revealed that argpyrimidine, a major MG-arginine adduct, is predominantly produced in cortical plate neurons not VZ during cerebral cortex development and is exclusively located in the nucleus. Immunoblotting experiment showed that the formation of argpyrimidine occurs on some nuclear proteins of cortical neurons. To our knowledge, this is first report of the argpyrimidine formation in the nucleus of neuron. These findings suggest that GLO1, which is dominantly expressed in the embryonic VZ, reduces the intracellular level of MG and suppresses the formation of argpyrimidine in neural stem and progenitor cells. Argpyrimidine may contribute to the neural differentiation and/or the maintenance of the differentiated state via the modification of nuclear proteins.

  8. Proteinuria in passive Heymann nephritis is associated with lipid peroxidation and formation of adducts on type IV collagen.

    PubMed Central

    Neale, T J; Ojha, P P; Exner, M; Poczewski, H; Rüger, B; Witztum, J L; Davis, P; Kerjaschki, D


    Passive Heymann nephritis (PHN) is a model of human membranous nephropathy that is characterized by formation of granular subepithelial immune deposits in the glomerular capillary wall which results in complement activation. This is causally related to damage of the filtration barrier and subsequent proteinuria. The local accumulation of injurious reactive oxygen species (ROS) is a major effector mechanism in PHN. ROS may induce tissue damage by initiating lipid peroxidation (LPO). In turn, this leads to adduct formation between breakdown products of LPO with structural proteins, such as formation of malondialdehyde (MDA) or 4-hydroxynonenal-lysine adducts. To examine the role of LPO in the development of proteinuria we have localized MDA and 4-hydroxynonenal-lysine adducts in glomeruli of PHN rats by immunofluorescence microscopy, using specific monoclonal antibodies. By immunogold electron microscopy, MDA adducts were localized to cytoplasmic vesicles and cell membranes of glomerular epithelial cells, to the glomerular basement membrane (GBM), and also to immune deposits. Type IV collagen was specifically identified as being modified by MDA adducts, using a variety of techniques. Collagenase pretreatment of GBM extracts indicated that the NC-1 domain of type IV collagen was a site of adduct formation. When LPO was inhibited by pretreatment of PHN rats with the antioxidant probucol, proteinuria was reduced by approximately 85%, and glomerular immunostaining for dialdehyde adducts was markedly reduced, even though the formation of immune deposits was not affected. By contrast, lowering of the serum cholesterol levels had no influence on the development of proteinuria. These findings are consistent with the premise that ROS-induced glomerular injury in PHN involves LPO and that this results not only in damage of cell membranes but in modification of type IV collagen in the GBM as well. The close temporal correlation of the occurrence of LPO with proteinuria and the

  9. Effects of water and polymer content on covalent amide-linked adduct formation in peptide-containing amorphous lyophiles.


    DeHart, Michael P; Anderson, Bradley D


    Deamidation of asparagine-containing proteins and peptides results in the formation of hydrolysis products via a reactive succinimide intermediate. In amorphous lyophile formulations at low water content, nucleophilic amine groups in neighboring molecules can effectively compete with water for reaction with the succinimide intermediate resulting in the formation of a variety of covalent amide-linked adducts. This study examines the effects of changes in percentage of a polymeric excipient [hypromellose (HPMC)] and water content on the degradants formed from a model asparaginyl peptide (Gly-Phe-L-Asn-Gly) in amorphous solids also containing an excess of Gly-Val and carbonate buffer and stored at 40°C. Degradation of Gly-Phe-L-Asn-Gly and formation of succinimide intermediates, aspartyl peptides, and covalent amide-linked adducts were monitored by high-performance liquid chromatography. In all formulations and storage conditions, the formation kinetics of aspartyl hydrolysis products and covalent adducts could be described by a mechanism-based model that assigned a central role to the succinimide intermediate. Increasing the percentage of HPMC (i.e., reactant dilution) favored the formation of hydrolysis products over covalent amide-linked adducts, consistent with the bimolecular nature of covalent adduct formation. Increases in water content as relative humidity (RH) was varied from 33% to 75% produced orders-of-magnitude increases in the rate constants for succinimide formation and hydrolysis with both becoming nearly constant at high water contents. A bell-shaped profile for the dependence of the rate of covalent adduct formation on water content was observed, a result that may be indicative of phase separation at higher RHs. PMID:22437444

  10. Linking DNA adduct formation and human cancer risk in chemical carcinogenesis.


    Poirier, Miriam C


    Over two centuries ago, Sir Percival Pott, a London surgeon, published a pioneering treatise showing that soot exposure was the cause of high incidences of scrotal cancers occurring in young men who worked as chimney sweeps. Practicing at a time when cellular pathology was not yet recognized, Sir Percival nonetheless observed that the high incidence and short latency of the chimney sweep cancers, was fundamentally different from the rare scrotal cancers typically found in elderly men. Furthermore, his diagnosis that the etiology of these cancers was related to chimney soot exposure, was absolutely accurate, conceptually novel, and initiated the field of "occupational cancer epidemiology." After many intervening years of research focused on mechanisms of chemical carcinogenesis, briefly described here, it is clear that DNA damage, or DNA adduct formation, is "necessary but not sufficient" for tumor induction, and that many additional factors contribute to carcinogenesis. This review includes a synopsis of carcinogen-induced DNA adduct formation in experimental models and in the human population, with particular attention paid to molecular dosimetry and molecular cancer epidemiology. Environ. Mol. Mutagen. 57:499-507, 2016. © 2016 Wiley Periodicals, Inc. PMID:27346877

  11. Inhibition of DNA adduct formation of PhIP in female F344 rats by dietary conjugated linoleic acid.


    Josyula, S; He, Y H; Ruch, R J; Schut, H A


    The dietary mutagen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) is a mammary carcinogen in the female Fischer (F344) rat and a colon carcinogen in the male F344 rat. To exert its carcinogenicity, it is believed that PhIP needs to form adducts with DNA, a process requiring N-hydroxylation of PhIP by cytochromes P-450 1A1 and/or 1A2 (CYP 1A1 and/or 1A2), as well as further esterification of the hydroxylamine thus formed. Dietary conjugated linoleic acid (CLA) inhibits chemical carcinogenesis in various experimental models. We have examined the effect of dietary CLA on PhIP-DNA adduct formation in female F344 rats. Four-week-old animals were maintained on AIN-76A diet without or with CLA (1%, 0.5%, and 0.1% wt/wt) for 57 days. PhIP was added to the diets (0.04% wt/wt) from Days 14-42. Animals were killed (4/group) on Days 43, 50, and 57. DNA isolated from liver, mammary epithelial cells (MEC), colon, and white blood cells (WBC) was analyzed for PhIP-DNA adducts by 32P-postlabeling assays. On Day 43, CLA inhibited adduct formation in the liver (up to 58%) in a dose-dependent manner. CLA also inhibited hepatic adduct levels (29-39%) on Day 50 (at 1.0% and 0.5% CLA) and on Day 57 (53% at 0.5% CLA). CLA significantly reduced adduct levels in the WBC on Day 50 (63-70%). Adducts in MEC and the colon were not affected by dietary CLA. On Day 57, adduct levels in MEC, liver, colon, and WBC were 0-30.3%, 8.6-41.7%, 21.5-50.7%, and 7.5-11.8%, respectively, of those on Day 43. Northern blot analysis of liver RNA showed that dietary CLA did not affect steady-state levels of CYP 1A1 or 1A2 mRNA. It is concluded that dietary CLA inhibits PhIP-DNA adduct formation in liver and WBC but that those in MEC and the colon are unaffected when a low-level dietary regimen of carcinogen and inhibitor was used. In inhibiting PhIP-DNA adduct formation, CLA does not appear to act by inhibiting CYP 1A1 or 1A2 expression. PMID:10050262


    EPA Science Inventory

    DNA-carcinogen adducts offer a potential dosimeter for environmental genotoxicants reaching the exposed individual. ecause the target tissues for many chemical carcinogens are not readily accessible for monitoring adducts in humans, peripheral blood lymphocytes (PBLS) have served...

  13. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )


    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  14. N-Acetylcysteine blocks formation of cancer-initiating estrogen-DNA adducts in cells

    PubMed Central

    Zahid, Muhammad; Saeed, Muhammad; Ali, Mohammed F.; Rogan, Eleanor G.; Cavalieri, Ercole L.


    Catechol estrogens, especially 4-hydroxylated metabolites of 17β-estradiol (E2), are responsible for estrogen-induced carcinogenesis. 4-Hydroxyestradiol (4-OHE2), a major metabolite of E2 formed preferentially by cytochrome P-450 1B1, is oxidized to E2-3,4-quinone, which can react with DNA to yield the depurinating adducts 4-OHE2-1-N3Ade and 4-OHE2-1-N7Gua. The apurinic sites generated by the loss of these depurinating adducts induce mutations that could lead to cancer initiation. In the present study, we have evaluated the effects of N-acetycysteine (NAcCys) on the metabolism of two cell lines, MCF-10F (a normal human breast epithelial cell line) and E6 (a normal mouse mammary epithelial cell line), treated with 4-OHE2 or its reactive metabolite, E2-3,4-quinone. Extensive HPLC with electrochemical detection and UPLC-MS/MS analyses of the cell media demonstrated that the presence of NAcCys very efficiently shifted the estrogen metabolism towards protective methoxylation and conjugation pathways in multiple ways, while formation of depurinating DNA adducts was inhibited. Protection by NAcCys appears to be similar in both cell lines irrespective of their origin (human or mouse) or the presence of estrogen receptor-alpha. This finding suggests that NAcCys, a common dietary supplement, could be used as a potential chemopreventive agent to block the initial step in the genotoxicity caused by catechol estrogen quinones. PMID:20472053

  15. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.


    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  16. Impairment of histone H1 DNA binding by adduct formation with acetaldehyde

    SciTech Connect

    Niemela, O.; Mannermaa, R.; Oikarinen, J. )


    Incubation of histone H1 with pharmacologically relevant concentrations of acetaldehyde resulted in the formation of spontaneously stable acetaldehyde-protein linkages. The reaction of acetaldehyde and H1 purified from rat liver either by a DNA recognition site affinity chromatography or by perchloric acid extraction occurred primarily at the lysine residues in the carboxyterminal tail of H1, which is crucial for its function as a eukaryotic repressor. It was further shown using an H1-lacZ fusion protein produced in E. coli and the protein isolated from rat liver that the formation of acetaldehyde adducts with H1 impair its DNA binding properties. They propose that such a reaction may occur in vivo and lead to an inability to repress genes in the liver upon excessive alcohol consumption. This mechanism may play a role in acetaldehyde-induced collagen synthesis in alcoholics.

  17. Efficient CO2 capture by tertiary amine-functionalized ionic liquids through Li+-stabilized zwitterionic adduct formation

    PubMed Central

    Yang, Zhen-Zhen


    Summary Highly efficient CO2 absorption was realized through formation of zwitterionic adducts, combining synthetic strategies to ionic liquids (ILs) and coordination. The essence of our strategy is to make use of multidentate cation coordination between Li+ and an organic base. Also PEG-functionalized organic bases were employed to enhance the CO2-philicity. The ILs were reacted with CO2 to form the zwitterionic adduct. Coordination effects between various lithium salts and neutral ligands, as well as the CO2 capacity of the chelated ILs obtained were investigated. For example, the CO2 capacity of PEG150MeBu2N increased steadily from 0.10 to 0.66 (mol CO2 absorbed per mol of base) through the formation of zwitterionic adducts being stabilized by Li+. PMID:25246955

  18. Cysteine amide adduct formation from carboxylic acid drugs via UGT-mediated bioactivation in human liver microsomes.


    Harada, H; Toyoda, Y; Endo, T; Kobayashi, M


    Although chemical trapping has been widely used to evaluate cytochrome P450-mediated drug bioactivation, thus far, only a few in vitro-trapping studies have been performed on UDP-glucuronosyltransferase (UGT)-mediated drug bioactivation. In this study, we used cysteine (Cys) as trapping agent to gain new insights into the UGT-mediated bioactivation involving acyl glucuronides of carboxylic acid drugs. Diclofenac, ketoprofen and ibuprofen were incubated in human liver microsomes with UDPGA and Cys, followed by analysis using ultra-performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-QTOF/MS). The N-acyl-Cys amide adduct of diclofenac was characterized by mass analysis and was detectable even in photodiode array analysis. Our data indicated that the formation of such adducts reflects the reactivity of the corresponding acyl glucuronides. In addition, it was suggested that the adduct formation requires an N-terminal Cys moiety with both a free amine and a free thiol group, from the results using various cysteine derivatives. We propose that the S-acyl-Cys thioester adduct can form via transacylation of an acyl glucuronide and can then form to an N-acyl-Cys amide adduct through intramolecular S- to N-acyl rearrangement. This series of the reactions has important implications as a possible bioactivation mechanism for covalent binding of carboxylic acid drugs to macromolecules. PMID:26601426

  19. Formation of cigarette smoke-induced DNA adducts in the rat lung and nasal mucosa

    SciTech Connect

    Gupta, R.C.; Sopori, M.L.; Gairola, C.G.


    The formation of DNA adducts in the nasal, lung, and liver tissues of rats exposed daily to fresh smoke from a University of Kentucky reference cigarette (2R1) for up to 40 weeks was examined. The amount of smoke total particulate matter (TPM) inhaled and the blood carboxyhemoglobin (COHb) values averaged 5-5.5 mg smoke TPM/day/rat and 5.5%, respectively. The pulmonary AHH activity measured at the termination of each experiment showed an average increase of about two- to threefold in smoke-exposed groups. These observations suggested that animals effectively inhaled both gaseous and particulate phase constituents of cigarette smoke. DNAs from nasal, lung, and liver tissue were extracted and analyzed by an improved {sup 32}P-postlabeling procedure. The data demonstrate the DNA-damaging potential of long term fresh cigarette smoke exposure and suggest the ability of the tissue to partially recover from such damage following cessation of the exposure.


    EPA Science Inventory

    DNA binding and adduct formation of aflatoxin B1 (AFB1) was studied in cultured bladder and tracheobronchial explants from human, monkey, dog, hamster and rat. Explants were exposed to (3H)AFB1 (1 micrometer final concentration) in PFHR-4 medium (pH 7.4) without serum for 24 h, a...


    EPA Science Inventory

    Both mice and rats were injected i.p. with doses of benzo(a)pyrene [B(a)P] ranging from 10 to 100 mg/kg to compare species sensitivity to SCE induction and DNA adduct formation, as well as the relationship between these endpoints. wenty-four hours after injection, blood was remov...


    EPA Science Inventory

    The objective of this study was to determine whether the polycyclic aromatic hydrocarbons(PAH), nitro-PAH or other polycyclic organic matter adsorbed to diesel particles induces the formation of DNA adducts in the lung when compared to particles with little or no adsorbed organic...

  3. Coulometric Titrations in Wine Samples: Studies on the Determination of S(IV) and the Formation of Adducts

    NASA Astrophysics Data System (ADS)

    Lowinsohn, Denise; Bertotti, Mauro


    In this experiment, the sulfite in white wine samples is quantified by coulometric titration with iodine, using a procedure that minimizes errors due to air oxidation. Some aspects of the distinction of S(IV) forms in such matrices are discussed on the basis of the formation of adducts between sulfite and carbonyl compounds present in the wine. The reactivity of these S(IV)-bound compounds toward the reaction with iodine is addressed and the stability of the adducts as the sample pH is changed is discussed.

    See Letter re: this article.

  4. 2-Aminofluorene metabolism and DNA adduct formation by mononuclear leukocytes from rapid and slow acetylator mouse strains.


    Levy, G N; Chung, J G; Weber, W W


    Following exposure of mice to the arylamine carcinogen 2-aminofluorene, DNA-carcinogen adducts can be found in the target tissues liver and bladder, and also in circulating leukocytes. Evidence is presented here that mouse mononuclear leukocytes (MNL) are capable of metabolizing 2-aminofluorene to DNA-binding metabolites which give rise to the adducts found in the MNL. Both lymphocytes and monocytes were able to acetylate arylamines during 18 h of culture. The degree of acetylation was determined by the N-acetyltransferase genotype of the mice as shown through use of acetylator congenic strains which differ only in the Nat-2 gene. Cultured MNL from rapid acetylator mice (C57BL/6J and A.B6-Natr) produced about twice as much N-acetylaminofluorene from 2-aminofluorene and 6- to 8-fold as much N-acetyl-p-aminobenzoic acid from p-aminobenzoic acid as cells from slow acetylator mice (B6.A-Nat(s) and A/J). Other differences in arylamine metabolism by MNL in culture were observed and shown to be due to genetic factors, currently unidentified, other than N-acetyltransferase. DNA adduct formation following incubation of MNL with the arylamine carcinogen 2-aminofluorene was related to both acetylation capacity and to other genetic metabolic factors in the mouse genome. MNL from rapid acetylator mice with the C57BL/6J background (B6) had 3-fold the DNA adduct levels of cells from the corresponding slow acetylator congenic (B6.A-Nat(s)). Similarly, MNL from rapid acetylator mice with the A/J background (A.B6-Natr) had twice the DNA adduct levels of those from their corresponding slow congenic (A). Adduct levels in MNL from C57BL/6J were nearly the same as those of MNL from A/J, again indicating the involvement of loci other than acetylation in DNA adduct formation. The finding of genetically dependent arylamine carcinogen metabolism and DNA adduct formation in cultured MNL suggests the possibility of using cultured MNL for assessing individual susceptibility to arylamine


    EPA Science Inventory

    A method was developed for the determination of hemoglobin (Hb) adducts form by the neurotoxic agent acrylamide and its mutagenic epoxide metabolite glycidamide. he method was based on simultaneous measurements of the cysteine adducts formed by these two agents by means of gas ch...

  6. vapor pressure of uranyl beta-diketonates. IV. effect of adduct formation on volatility of uranyl pivaloyltrifluoroacetonate

    SciTech Connect

    Sidorenko, G.V.; Suglobov, D.N.


    Gas-phase adduct formation of uranyl pivaloyltrifluoroacetonate (I) with donor active materials such as trimethyl phosphate (TMP), pyridine (Py), tetrahydrofuran (THF), and ethanol (EtOH) was demonstrated by IR spectroscopy. Vapor pressure of the I-TMF adduct was measured by the flow method. The volatility of I was studied in a stream of helium saturated with vapors of donor-active materials: Py, THF, diethyl ether (Et/sub 2/O), EtOH, and acetonitrile. The temperature dependence of the pressure of saturated I.TMP and I vapor in a stream of neutral ligand vapor is described by log p (Pa) = -A/T + B. Following are, respectively, neutral ligand, T range (degreeK), and coefficiencts A, B: TMP 383453, 4648 +/- 48, 12.06 +/- 0.18; Py, 383-463, 5277 +/- 87, 13.36 +/- 0.21; THF, 363453, 4662 +/- 69, 12.66 +/- 0.17; Et/sub 2/O, 353-423, 4864 +/- 110, 13.29 +/- 0.28; EtOH, 363-443, 4509 +/- 89, 12.18 +/- 0.22. Adduct formation with these neutral ligands decreases the volatility of I significantly. A tendency to increase of adduct volatility was observed when the donor properties of the neutral ligand decrease.

  7. Inhaled cigarette smoke induces the formation of DNA adducts in lungs of rats

    SciTech Connect

    Bond, J.A.; Chen, B.T.; Griffith, W.C.; Mauderly, J.L.


    Cigarette smoking causes a variety of adverse human health effects, including lung cancer. The molecular events associated with smoke-induced carcinogenesis are thought to be related in part to the genotoxic activities of the chemicals associated with smoke. The purpose of this investigation was to determine the molecular dosimetry of compounds in cigarette smoke in lungs of rats exposed by inhalation. These studies investigated the effects of exposure mode, sex, and time (adduct persistence) on the level of DNA adducts. Male and female F344/N rats were exposed 6 hr/day, 5 days/week for 22 days to cigarette smoke by nose-only intermittent (NOI), nose-only continuous (NOC), or whole-body continuous (WBC) exposures. Separate groups of rats were sham-exposed nose-only (NOS) or whole-body (WBS) to filtered air. All smoke exposure modes yielded daily smoke exposure concentration X time products of 600 mg for the first week and 1200 mg particulate.hour/m3 thereafter. Groups of rats were killed at 18 hr and 3 weeks after the 22-day exposure period and DNA adducts in lung tissues were quantified by the /sup 32/P-postlabeling method. There were significant (p less than 0.05) increases in levels of clearly resolved lung DNA adducts in male and female rats exposed to smoke compared to sham-exposed rats. There were no significant effects of exposure mode or sex on lung DNA adducts. Mean levels (+/- SE) of clearly resolved lung DNA adducts for both sexes combined in NOI, NOC, WBC, NOS, and WBS groups were 50 +/- 4, 52 +/- 6, 52 +/- 7, 21 +/- 6, and 22 +/- 4 adducts per 10(9) bases, respectively. Levels of clearly resolved DNA adducts were significantly less in lungs of rats killed 3 weeks after exposure and had declined to near control levels, suggesting that smoke-induced adducts are repaired by lung DNA repair enzymes.

  8. Formation of 7-hydroxymethyl-12-methylbenz(a)anthracene-DNA adducts from 7,12-dimethylbenz(a)anthracene in mouse epidermis

    SciTech Connect

    DiGiovanni, J.; Nebzydoski, A.P.; Decina, P.C.


    The formation of DNA adducts from (/sup 3/H)-7-hydroxymethyl-12-methylbenz(a)anthracene (7-OHM-12-MBA) and (/sup 3/H)-7,12-dimethylbenz(a)anthracene (DMBA) in the epidermis of Sencar mice was analyzed. Comparison of Sephadex LH-20 chromatographic profiles of DNA samples isolated from mice treated with DMBA or 7-OHM-12-MBA suggested that the DMBA-treated animals contained DNA adduct(s) derived from the further metabolism of 7-OHM-12-MBA. Further analysis of DNA samples from DMBA-treated mice by high-pressure liquid chromatography demonstrated the presence of 5 DNA adducts which were chromatographically indistinguishable from the DNA adducts formed in 7-OHM-12-MBA-treated mice. Epidermal homogenates were utilized to catalyze the covalent binding of (/sup 3/H)DMBA and (/sup 3/H)-7-OHM-12-MBA to calf thymus DNA in vitro. Under conditions of limiting concentrations of (/sup 3/H)DMBA, the majority of the DNA adducts formed chromatographed in regions where 7-OHM-12-MBA-DNA adducts eluted. A major DMBA-DNA adduct formed in this in vitro system eluted with the same retention time as did the major 7-OHM-12-MBA-DNA adduct formed in mouse skin in vivo. These results when coupled with the in vivo data suggest that 7-OHM-12-MBA is an intermediate for at least some of the binding of DMBA to epidermal DNA in Sencar mice.

  9. Facile Formation of a DNA Adduct of Semicarbazide on Reaction with Apurinic/Apyrimidinic Sites in DNA.


    Wang, Yinan; Chan, Ho Wai; Chan, Wan


    Mutagenic semicarbazide (SEM) is a hydrazine-containing food contaminant found in a wide variety of foods. Despite decades of research, the toxicity of SEM remains incompletely understood. In this study, we demonstrate for the first time that SEM reacts rapidly with apurinic/apyrimidinic sites in an endogenous DNA lesion to form covalently bonded DNA adducts in vitro and in bacteria. Specifically, we performed high-performance liquid chromatography with high accuracy and tandem mass spectrometry to characterize the DNA adduct formed by reacting SEM with 2'-deoxyribose and single- and double-stranded oligonucleotides containing abasic sites under physiologically relevant conditions. By analyzing the reaction mixture at different time points, the reaction kinetics of SEM with DNA was also elucidated. Moreover, by using a highly sensitive and selective liquid chromatography-tandem mass spectrometry method, we show that SEM induces the dose-dependent formation of DNA adducts in Escherichia coli. The results from our studies provide the first direct evidence suggesting that SEM may exert genotoxicity by forming covalently bonded DNA adducts. PMID:27058397

  10. Malabaricone C-containing mace extract inhibits safrole bioactivation and DNA adduct formation both in vitro and in vivo.


    Martati, Erryana; Boonpawa, Rungnapa; van den Berg, Johannes H J; Paini, Alicia; Spenkelink, Albertus; Punt, Ans; Vervoort, Jacques; van Bladeren, Peter J; Rietjens, Ivonne M C M


    Safrole, present in mace and its essential oils, causes liver tumors in rodents at high dose levels due to formation of a DNA reactive 1'-sulfooxysafrole. The present study identifies malabaricone C as a mace constituent able to inhibit safrole DNA adduct formation at the level of sulfotransferase mediated bioactivation. This inhibition was incorporated into physiologically based biokinetic rat and human models. Dosing safrole at 50mg/kg body weight and malabaricone C-containing mace extract at a ratio reflecting the relative presence in mace, and assuming 100% or 1% uptake of malabaricone C-containing mace extract, the model predicted inhibition of 1'-sulfooxysafrole formation for rats and humans by 90% and 100% or 61% and 91%, respectively. To validate the model, mace extract and safrole were co-administered orally to Sprague-Dawley rats. LC-ECI-MS/MS based quantification of DNA adduct levels revealed a significant (p<0.01) 55% reduction of safrole DNA adduct formation by malabaricone C-containing mace extract in the liver of rats exposed to safrole. The data obtained were used to perform a refined risk assessment of safrole. Overall, the results suggest a lower tumor incidence when safrole would be tested within a relevant food matrix containing sulfotransferase inhibitors compared to dosing pure safrole. PMID:24508526

  11. Formation and removal of DNA adducts in rat liver treated with N-hydroxy derivatives of 2-acetylaminofluorene, 4-acetylaminobiphenyl, and 2-acetylaminophenanthrene.


    Gupta, R C; Dighe, N R


    Formation and removal of hepatic DNA adducts was studied in male Sprague-Dawley rats following single injections of two hepatocarcinogens, N-hydroxy-2-acetylaminofluorene (N-OH-AAF) and N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP) and a nonhepatocarcinogen, N-hydroxy-2-acetylaminophenanthrene (N-OH-AAP) at 0.5 h, 1.5 h, 4 h, 24 h, 9 d and 29 d. Using a previously described 32P-postlabeling assay, maximal DNA binding of these compounds was observed at approximately 1.5 h, 0.5 h and 24 h, respectively. In addition to the formation of three already known C8- and N2-acetylated and C8-deacetylated guanine derivatives and several minor unknown adducts with N-OH-AAF, a set of four new major adducts was also detected. These comprised approximately 50% of the total adducts during the first 4 h. The three known adducts amounted to 58, 16 and 6% of the 1.5-h value after 24 h, 9 d and 29 d, respectively, while the bulk (greater than 84%) of the new major adducts were removed from the DNA within 24 h and found only in traces after 9 d. N-OH-AABP formed several unknown minor adducts, in addition to the one major C8-deacetylated and two minor C8- and N2-acetylated guanine derivatives; only the C8-deacetylated and N2-acetylated adducts were detected after 29 d. In the case of N-OH-AAP, two major and several minor adducts were detected, most of which were found to be deacetylated, and as much as 60% of the adducts measured at 24 h were still present after 9 d treatment. These data indicate that certain DNA adducts are repaired rapidly, while others persist for long periods. PMID:6705140

  12. Cell toxicity of methacrylate monomers-the role of glutathione adduct formation.


    Ansteinsson, V; Kopperud, H B; Morisbak, E; Samuelsen, J T


    Polymer-based dental restorative materials are designed to polymerize in situ. However, the conversion of methacrylate monomer to polymer is never complete, and leakage of the monomer occurs. It has been shown that these monomers are toxic in vitro; hence concerns regarding exposure of patients and dental personnel have been raised. Different monomer methacrylates are thought to cause toxicity through similar mechanisms, and the sequestration of cellular glutathione (GSH) may be a key event. In this study we examined the commonly used monomer methacrylates, 2-hydroxyethylmethacrylate (HEMA), triethylenglycol-dimethacrylate (TEGDMA), bisphenol-A-glycidyl-dimethacrylate (BisGMA), glycerol-dimethacrylate (GDMA) and methyl-methacrylate (MMA). The study aimed to establish monomers' ability to complex with GSH, and relate this to cellular toxicity endpoints. Except for BisGMA, all the monomer methacrylates decreased the GSH levels both in cells and in a cell-free system. The spontaneous formation of methacrylate-GSH adducts were observed for all methacrylate monomers except BisGMA. However, we were not able to correlate GSH depletion and toxic response measured as SDH activity and changes in cell growth pattern. Together, the current study indicates mechanisms other than GSH-binding to be involved in the toxicity of methacrylate monomers. PMID:23613115

  13. Gas-Phase Anionic σ-Adduct (Trans)formations in Heteroaromatic Systems1

    NASA Astrophysics Data System (ADS)

    Zimnicka, Magdalena; Danikiewicz, Witold


    Anions of nitroderivatives of thiophene and furan were subjected to the reactions with selected C-H acids in the gas phase. Various structures and reaction pathways were proposed for the observed ionic products. In general, the reactions of heteroaromatic anions with C-H acids may be divided into three groups, depending on the proton affinity difference between C-H acid's conjugate base and heteroaromatic anion (ΔPA). The proton transfer from C-H acid to heteroaromatic anion is a dominant process in the reactions for which ΔPA < 0 kcal mol-1, whereas the reactions with high ΔPA (ΔPA > 16 kcal mol-1) do not lead to any ionic products. The formation of σ-adducts and products of their further transformations according to the VNS, SNAr, cine, and tele substitution mechanisms have been proposed for reactions with moderate ΔPA. The other possible mechanisms as SN2 reaction, nucleophilic addition to the cyano group, ring-opening pathway, and halogenophilic reaction have also been discussed to contribute in the reactions between heteroaromatic anions and C-H acids.

  14. Red meat enhances the colonic formation of the DNA adduct O6-carboxymethyl guanine: implications for colorectal cancer risk.


    Lewin, Michelle H; Bailey, Nina; Bandaletova, Tanya; Bowman, Richard; Cross, Amanda J; Pollock, Jim; Shuker, David E G; Bingham, Sheila A


    Red meat is associated with increased risk of colorectal cancer and increases the endogenous formation of N-nitrosocompounds (NOC). To investigate the genotoxic effects of NOC arising from red meat consumption, human volunteers were fed high (420 g) red meat, vegetarian, and high red meat, high-fiber diets for 15 days in a randomized crossover design while living in a volunteer suite, where food was carefully controlled and all specimens were collected. In 21 volunteers, there was a consistent and significant (P < 0.0001) increase in endogenous formation of NOC with the red meat diet compared with the vegetarian diet as measured by apparent total NOC (ATNC) in feces. In colonic exfoliated cells, the percentage staining positive for the NOC-specific DNA adduct, O(6)-carboxymethyl guanine (O(6)CMG) was significantly (P < 0.001) higher on the high red meat diet. In 13 volunteers, levels were intermediate on the high-fiber, high red meat diet. Fecal ATNC were positively correlated with the percentage of cells staining positive for O(6)CMG (r(2) = 0.56, P = 0.011). The presence of O(6)CMG was also shown in intact small intestine from rats treated with the N-nitrosopeptide N-acetyl-N'-prolyl-N'-nitrosoglycine and in HT-29 cells treated with diazoacetate. This study has shown that fecal NOC arising from red meat include direct acting diazopeptides or N-nitrosopeptides able to form alkylating DNA adducts in the colon. As these O(6)CMG adducts are not repaired, and if other related adducts are formed and not repaired, this may explain the association of red meat with colorectal cancer. PMID:16452248

  15. Evaluation of Interindividual Human Variation in Bioactivation and DNA Adduct Formation of Estragole in Liver Predicted by Physiologically Based Kinetic/Dynamic and Monte Carlo Modeling.


    Punt, Ans; Paini, Alicia; Spenkelink, Albertus; Scholz, Gabriele; Schilter, Benoit; van Bladeren, Peter J; Rietjens, Ivonne M C M


    Estragole is a known hepatocarcinogen in rodents at high doses following metabolic conversion to the DNA-reactive metabolite 1'-sulfooxyestragole. The aim of the present study was to model possible levels of DNA adduct formation in (individual) humans upon exposure to estragole. This was done by extending a previously defined PBK model for estragole in humans to include (i) new data on interindividual variation in the kinetics for the major PBK model parameters influencing the formation of 1'-sulfooxyestragole, (ii) an equation describing the relationship between 1'-sulfooxyestragole and DNA adduct formation, (iii) Monte Carlo modeling to simulate interindividual human variation in DNA adduct formation in the population, and (iv) a comparison of the predictions made to human data on DNA adduct formation for the related alkenylbenzene methyleugenol. Adequate model predictions could be made, with the predicted DNA adduct levels at the estimated daily intake of estragole of 0.01 mg/kg bw ranging between 1.6 and 8.8 adducts in 10(8) nucleotides (nts) (50th and 99th percentiles, respectively). This is somewhat lower than values reported in the literature for the related alkenylbenzene methyleugenol in surgical human liver samples. The predicted levels seem to be below DNA adduct levels that are linked with tumor formation by alkenylbenzenes in rodents, which were estimated to amount to 188-500 adducts per 10(8) nts at the BMD10 values of estragole and methyleugenol. Although this does not seem to point to a significant health concern for human dietary exposure, drawing firm conclusions may have to await further validation of the model's predictions. PMID:26952143

  16. A physiologically based biodynamic (PBBD) model for estragole DNA binding in rat liver based on in vitro kinetic data and estragole DNA adduct formation in primary hepatocytes

    SciTech Connect

    Paini, Alicia; Punt, Ans; Viton, Florian; Scholz, Gabriele; Delatour, Thierry; Marin-Kuan, Maricel; Schilter, Benoit; Bladeren, Peter J. van; Rietjens, Ivonne M.C.M.


    Estragole has been shown to be hepatocarcinogenic in rodent species at high-dose levels. Translation of these results into the likelihood of formation of DNA adducts, mutation, and ultimately cancer upon more realistic low-dose exposures remains a challenge. Recently we have developed physiologically based biokinetic (PBBK) models for rat and human predicting bioactivation of estragole. These PBBK models, however, predict only kinetic characteristics. The present study describes the extension of the PBBK model to a so-called physiologically based biodynamic (PBBD) model predicting in vivo DNA adduct formation of estragole in rat liver. This PBBD model was developed using in vitro data on DNA adduct formation in rat primary hepatocytes exposed to 1'-hydroxyestragole. The model was extended by linking the area under the curve for 1'-hydroxyestragole formation predicted by the PBBK model to the area under the curve for 1'-hydroxyestragole in the in vitro experiments. The outcome of the PBBD model revealed a linear increase in DNA adduct formation with increasing estragole doses up to 100 mg/kg bw. Although DNA adduct formation of genotoxic carcinogens is generally seen as a biomarker of exposure rather than a biomarker of response, the PBBD model now developed is one step closer to the ultimate toxic effect of estragole than the PBBK model described previously. Comparison of the PBBD model outcome to available data showed that the model adequately predicts the dose-dependent level of DNA adduct formation. The PBBD model predicts DNA adduct formation at low levels of exposure up to a dose level showing to cause cancer in rodent bioassays, providing a proof of principle for modeling a toxicodynamic in vivo endpoint on the basis of solely in vitro experimental data.

  17. Isoniazid-resistance conferring mutations in Mycobacterium tuberculosis KatG: Catalase, peroxidase, and INH-NADH adduct formation activities

    PubMed Central

    Cade, Christine E; Dlouhy, Adrienne C; Medzihradszky, Katalin F; Salas-Castillo, Saida Patricia; Ghiladi, Reza A


    Mycobacterium tuberculosis catalase-peroxidase (KatG) is a bifunctional hemoprotein that has been shown to activate isoniazid (INH), a pro-drug that is integral to frontline antituberculosis treatments. The activated species, presumed to be an isonicotinoyl radical, couples to NAD+/NADH forming an isoniazid-NADH adduct that ultimately confers anti-tubercular activity. To better understand the mechanisms of isoniazid activation as well as the origins of KatG-derived INH-resistance, we have compared the catalytic properties (including the ability to form the INH-NADH adduct) of the wild-type enzyme to 23 KatG mutants which have been associated with isoniazid resistance in clinical M. tuberculosis isolates. Neither catalase nor peroxidase activities, the two inherent enzymatic functions of KatG, were found to correlate with isoniazid resistance. Furthermore, catalase function was lost in mutants which lacked the Met-Tyr-Trp crosslink, the biogenic cofactor in KatG which has been previously shown to be integral to this activity. The presence or absence of the crosslink itself, however, was also found to not correlate with INH resistance. The KatG resistance-conferring mutants were then assayed for their ability to generate the INH-NADH adduct in the presence of peroxide (t-BuOOH and H2O2), superoxide, and no exogenous oxidant (air-only background control). The results demonstrate that residue location plays a critical role in determining INH-resistance mechanisms associated with INH activation; however, different mutations at the same location can produce vastly different reactivities that are oxidant-specific. Furthermore, the data can be interpreted to suggest the presence of a second mechanism of INH-resistance that is not correlated with the formation of the INH-NADH adduct. PMID:20054829

  18. 1,N(2)-propanodeoxyguanosine adduct formation in aortic DNA following inhalation of acrolein.

    PubMed Central

    Penn, A; Nath, R; Pan, J; Chen, L; Widmer, K; Henk, W; Chung, F L


    Recent reports indicate that many of the cytotoxic and health-threatening components of environmental tobacco smoke (ETS) reside in the vapor phase of the smoke. We have reported previously that inhalation of 1,3-butadiene, a prominent vapor phase component of ETS, accelerates arteriosclerotic plaque development in cockerels. In this study we asked whether inhaled acrolein, a reactive aldehyde that is also a prominent vapor-phase component of ETS, damages artery-wall DNA and accelerates plaque development. Cockerels inhaled 0, 1, or 10 ppm acrolein mixed with HEPA-filtered air for 6 hr. Half were killed immediately (day 1 group) for detection of the stable, premutagenic 1,N(2)-propanodeoxyguanosine acrolein adduct (AdG3) in aortic DNA via a (32)P-postlabeling/HPLC method, and half were killed after 10 days (day 10 group) for indirect assessment of adduct repair. In the day 1 group, acrolein-DNA adducts were 5 times higher in the 1 and 10 ppm groups than in HEPA-filtered air controls. However, in the day 10 group, adduct levels in the 1 and 10 ppm acrolein groups were reduced to the control adduct level. For the plaque studies, cockerels inhaled 1 ppm acrolein (6 hr/day, 8 weeks), mixed with the same HEPA-filtered air inhaled by controls. Plaque development was measured blind by computerized morphometry. Unlike butadiene inhalation, acrolein inhalation did not accelerate plaque development. Thus, even though repeated exposure to acrolein alone has no effect on plaque size under the exposure conditions described here, a single, brief inhalation exposure to acrolein elicits repairable DNA damage to the artery wall. These results suggest that frequent exposure to ETS may lead to persistent artery-wall DNA damage and thus provide sites on which other ETS plaque accelerants can act. PMID:11333181

  19. Formation of Hydroxymethyl DNA Adducts in Rats Orally Exposed to Stable Isotope Labeled Methanol

    PubMed Central

    Lu, Kun; Gul, Husamettin; Upton, Patricia B.; Moeller, Benjamin C.; Swenberg, James A.


    Methanol is a large volume industrial chemical and widely used solvent and fuel additive. Methanol’s well known toxicity and use in a wide spectrum of applications has raised long-standing environmental issues over its safety, including its carcinogenicity. Methanol has not been listed as a carcinogen by any regulatory agency; however, there are debates about its carcinogenic potential. Formaldehyde, a metabolite of methanol, has been proposed to be responsible for the carcinogenesis of methanol. Formaldehyde is a known carcinogen and actively targets DNA and protein, causing diverse DNA and protein damage. However, formaldehyde-induced DNA adducts arising from the metabolism of methanol have not been reported previously, largely due to the absence of suitable DNA biomarkers and the inability to differentiate what was due to methanol compared with the substantial background of endogenous formaldehyde. Recently, we developed a unique approach combining highly sensitive liquid chromatography-mass spectrometry methods and exposure to stable isotope labeled chemicals to simultaneously quantify formaldehyde-specific endogenous and exogenous DNA adducts. In this study, rats were exposed daily to 500 or 2000 mg/kg [13CD4]-methanol by gavage for 5 days. Our data demonstrate that labeled formaldehyde arising from [13CD4]-methanol induced hydroxymethyl DNA adducts in multiple tissues in a dose-dependent manner. The results also demonstrated that the number of exogenous DNA adducts was lower than the number of endogenous hydroxymethyl DNA adducts in all tissues of rats administered 500 mg/kg per day for 5 days, a lethal dose to humans, even after incorporating an average factor of 4 for reduced metabolism due to isotope effects of deuterium-labeled methanol into account. PMID:22157354

  20. Formation of DNA adducts and induction of mutations in rats treated with tumorigenic doses of 1,6-dinitropyrene

    SciTech Connect

    Beland, F.A.; Fullerton, N.F.; Smith, B.A.; Heflich, R.H.


    1,6-Dinitropyrene, a component of diesel exhaust, is a lung carcinogen in male F344 rats following a single intrapulmonary administration. In this study, rats were treated with tumorigenic doses of 1,6-dinitropyrene to establish dose-response relationships for the formation of DNA adducts in target (lung) and nontarget (liver) tissues and for the induction of 6-thioguanine-resistant mutations in spleen T-lymphocytes. One week after treatment with 0.3, 1, 3, 10, 30, 100, or 150 {mu}g of 1,6-dinitropyrene, dose-responsive DNA binding was measured in lung and liver with binding in the being 10-fold higher than in the liver. In the lung, a 2-fold increase in dose resulted in a 1.8-fold increase in DNA binding at treatments up to 30 {mu}g of 1,6-dinitropyrene, while in the liver, a 2-fold increase in 1,6-dinitropyrene produced a 2-fold increase in DNA binding at doses up to the 10 {mu}g treatment. Higher doses of 1,6-dinitropyrene resulted in proportionally smaller increases in adduct formation in the two tissues. When measured 21 weeks after treatment, mutations in T-lymphocytes increased with doses up to 100 {mu}g of 1,6-dinitropyrene, but the response was nonlinear throughout the dose range. These findings indicate that concentrations of 1,6-dinitropyrene that produce a dose-dependent induction of lung tumors also result in a dose-dependent formation of DNA adducts and induction of lymphocyte mutations but that the dose-response curves for DNA binding and mutations are different. 39 refs., 3 figs.

  1. Formation of S-substituted glutathione adducts of styrene catalyzed by protaglandin H synthase: a possible new mechanism for the formation of glutathione conjugates

    SciTech Connect

    Stock, B.H.; Bend, J.R.; Eling, T.E.


    The prostaglandin hydroperoxidase (PHP)- and horseradish peroxidase (HRP)-dependent metabolism of styrene was examined. In the presence of arachidonic acid or hydrogen peroxide and glutathione (GSH), microsomes prepared from ram seminal vesicles catalyzed the formation of styrene-GSH adducts. Neither styrene 7,8-oxide nor styrene-GSH adducts were isolated by HPLC and shown by NMR and MS-MS mass spectrometry to be a mixture of (2R)- and (2S)-S-(2-phenyl-2-hydroxyethyl)glutathione. No (1R)- or (1S)-S-(1-phenyl-2-hydroxyethyl)glutathione was formed. The addition of phenol or aminopyrine to incubation mixtures containing the appropriate cofactor and PHP or HRP, which greatly enhances the oxidation of GSH to a thiyl radical by these peroxidases, increased the amount of the two styrene-GSH adducts produced. The authors propose that the formation of (2R)- and (2S)-S-(2-phenyl-2-hydroxyethyl)glutathione is dependent on the initial oxidation of GSH to a thiyl radical by the peroxidases, and on the subsequent reaction of this thiyl radical with the terminal alkene carbon atom of styrene. This is an epoxide-independent mechanism for the formation of GSH conjugates of alkenes that can occur in the absence of cytochrome P-450-dependent monooxygenases.

  2. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne α,β-unsaturated aldehydes

    SciTech Connect

    Kiwamoto, R. Spenkelink, A.; Rietjens, I.M.C.M.; Punt, A.


    Acyclic α,β-unsaturated aldehydes present in food raise a concern because the α,β-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present study was to develop physiologically based kinetic/dynamic (PBK/D) models to examine dose-dependent detoxification and DNA adduct formation of a group of 18 food-borne acyclic α,β-unsaturated aldehydes without 2- or 3-alkylation, and with no more than one conjugated double bond. Parameters for the PBK/D models were obtained using quantitative structure–activity relationships (QSARs) defined with a training set of six selected aldehydes. Using the QSARs, PBK/D models for the other 12 aldehydes were defined. Results revealed that DNA adduct formation in the liver increases with decreasing bulkiness of the molecule especially due to less efficient detoxification. 2-Propenal (acrolein) was identified to induce the highest DNA adduct levels. At realistic dietary intake, the predicted DNA adduct levels for all aldehydes were two orders of magnitude lower than endogenous background levels observed in disease free human liver, suggesting that for all 18 aldehydes DNA adduct formation is negligible at the relevant levels of dietary intake. The present study provides a proof of principle for the use of QSAR-based PBK/D modelling to facilitate group evaluations and read-across in risk assessment. - Highlights: • Physiologically based in silico models were made for 18 α,β-unsaturated aldehydes. • Kinetic parameters were determined by in vitro incubations and a QSAR approach. • DNA adduct formation was negligible at levels relevant for dietary intake. • The use of QSAR-based PBK/D modelling facilitates group evaluations and read-across.

  3. Effects of selenium on 7,12-dimethylbenz(a)anthracene-induced mammary carcinogenesis and DNA adduct formation

    SciTech Connect

    Ip, C.; Daniel, F.B.


    The purpose of the present investigation was to determine the effects of dietary selenium deficiency or excess on 7,12-dimethylbenz(a)anthracene (DMBA)-induced mammary neoplasia in rats and to delineate whether selenium-mediated modification of mammary carcinogenesis was associated with changes in carcinogen:DNA adduct formation and activities of liver microsomal enzymes that are involved in xenobiotic metabolism. Female Sprague-Dawley rats were divided into three groups from weaning and were maintained on one of three synthetic diets designated as follows: selenium deficient (less than 0.02 ppm); selenium adequate (0.2 ppm); or selenium excess (2.5 ppm). For the DMBA binding and DNA adduct studies, rats were given a dose of (/sup 3/H)DMBA p.o. after 1 month on their respective diets. Results from the liver and the mammary gland indicated that neither selenium deficiency nor excess had any significant effect on the binding levels, which were calculated on the basis of total radioactivity isolated with the purified DNA. Furthermore, it was found that dietary selenium intake did not seem to affect quantitatively or qualitatively the formation of DMBA:DNA adducts in the liver. Similarly, in a parallel group of rats that did not receive DMBA, the activities of aniline hydroxylase, aminopyrine N-demethylase, and cytochrome c reductase were not significantly altered by dietary selenium levels. Concurrent with the above experiments, the effect of dietary selenium intake on carcinogenesis was also monitored. Results of this experiment indicated that selenium deficiency enhanced mammary carcinogenesis only when this nutritional condition was maintained in the postinitiation phase. Likewise, an excess of selenium intake inhibited neoplastic development only when this regimen was continued after DMBA administration.

  4. Kinetics, thermodynamics, and mechanism of the formation of benzaldehyde-S(IV) adducts

    SciTech Connect

    Olson, T.M.; Boyce, S.D.; Hoffmann, M.R.


    The kinetics and mechanism of the formation of ..cap alpha..-hydroxyphenylmethanesulfonate (HPMS) by the addition of bisulfite to benzaldehyde were studied at low pH. A three-term rate law was observed as d(HPMS)/dt - (k/sub 1/..cap alpha../sub 2/ + (k/sub 2/ + k/sub 3/K/sub H-/(H/sup +/))..cap alpha../sub 1/)(S(IV))/sub t/(C/sub 6/H/sub 5/CHO) where ..cap alpha../sub 1/ = (HSO/sub 2//sup -/)/(S(IV)), ..cap alpha../sub 3/ = (SO/sub 2//sup 2 -/)/(S(IV)), and K/sub H/ is the proton association constant of benzaldehyde. The rate-limiting steps of each term appeared to be the nucleophilic attack of SO/sub 3//sup 2 -/ on the carbonyl carbon of benzaldehyde, the attack of HSO/sub 3//sup -/ on the carbonyl carbon, and the attack by HSO/sub 3//sup -/ on the protonated carbon of the carbocation, C/sub 6/H/sub 5/C/sup +/H(OH), respectively. Over the pH range of most natural systems, only the k/sub 1/ and k/sub 2/ steps contribute to adduct formation while the k/sub 3/ term becomes important for pH < 1. At 25/sup 0/C and = 1.0 M, the intrinsic rate constants were determined to be k/sub 1/ = (2.15 +- 0.09) x 10/sup 4/ M/sup -1/ s/sup -1/, k/sub 2/ = (0.71 +- 0.03) M/sup -1/ s/sup -1/, k/sub 3/ approx. 2.5 x 10/sup 7/ M/sup -1/ s/sup -1/. Para-substitution on the benzaldehyde ring resulted in a slight increase in reactivity for p-NO/sub 2/- and p-Cl-, and a decrease for p-OH-, p-OCH/sub 3/-, and p-CH/sub 3/-C/sub 6/H/sub 5/CHO. The equilibrium association constant, K = (C/sub 6/H/sub 5/CH(OH)SO/sub 3//sup -/)/(HSO/sub 3//sup -/)(C/sub 6/H/sub 5/CHO), at 25/sup 0/C was determined to be 4.8 (+-0.8) x 10/sup 3/ at = 0.1 M and 0.98 (+- 0.11) x 10/sup 3/ M/sup -1/ at = 1.0 M. 0/ and 0/ was determined to be -64.6 kJ mol/sup -1/ and -146 J mol/sup -1/ deg/sup -1/, respectively.

  5. Uptake, distribution, and formation of hemoglobin and DNA adducts after inhalation of C2-C8 1-alkenes (olefins) in the rat.


    Eide, I; Hagemann, R; Zahlsen, K; Tareke, E; Törnqvist, M; Kumar, R; Vodicka, P; Hemminki, K


    Absorption, distribution, elimination and hemoglobin and DNA adduct formation were studied in the rat after inhalation of individual C2-C8 1-alkenes (olefins) at 300 p.p.m., 12 h a day for 3 consecutive days. The concentrations of olefins were measured in blood, lung, brain, liver, kidney and perirenal fat immediately after each exposure and 12 h after the third exposure. DNA adducts were determined by 32P-postlabeling in liver, and lymphocytes sampled immediately after the last exposure. Hemoglobin adducts were determined by GC/MS and GC/MS/MS in erythrocytes sampled immediately after the last exposure. Concentrations of 1-alkenes in blood and organs reached a steady-state level after the first 12 h exposure, and the concentrations 12 h after the last exposure were generally low, except in fat tissue. Concentrations of 1-alkenes in blood and the different tissues increased with increasing number of carbon atoms. In contrast, levels of hemoglobin and DNA adducts decreased with increasing number of carbon atoms. The decrease was most pronounced from C2 to C3. The decrease through the whole homologous series from ethene to 1-octene was most pronounced for hemoglobin adducts followed by the DNA adducts in the lymphocytes. All 1-alkenes caused formation of detectable levels of hemoglobin and DNA adducts, although the levels of hemoglobin adducts after C4-C8 exposure were low. The project illustrates important aspects of the use of biomarkers. The structure-activity approach gives possibilities for extrapolation within the homologous series. PMID:7614695

  6. Effects of dietary conjugated linoleic acid on DNA adduct formation of PhIP and IQ after bolus administration to female F344 rats.


    Josyula, S; Schut, H A


    Meats cooked at high temperatures contain mutagenic heterocyclic amines such as 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3-methylimidazo[4,5-f]quinoline (IQ). In female Fischer 344 rats, IQ is a multiorgan carcinogen, whereas PhIP induces mammary adenocarcinomas. For IQ and PhIP, N-hydroxylation, catalyzed by microsomal cytochrome P-450 1A1 and/or 1A2, and then esterification, especially O-acetylation, are the principal steps leading to DNA adduct formation. Conjugated linoleic acid (CLA) is a mixture of conjugated linoleic acid isomers found in various meat and dairy products. We have examined the effect of dietary CLA on DNA adduct formation by PhIP and IQ in female Fischer 344 rats. Four-week-old animals were maintained on AIN-76A diet without or with CLA (4% wt/wt) and treated with IQ or PhIP (50 mg/kg by gavage) after two weeks. Animals were killed (4/group) one, four, and eight days later. DNA isolated from mammary epithelial cells, liver, colon, and white blood cells was analyzed for carcinogen-DNA adducts by 32P-postlabeling assays. On Day 1, dietary CLA significantly inhibited adduct formation (82.0%) in mammary epithelial cells in IQ--but not in PhIP-treated rats. In the colon, dietary CLA significantly inhibited PhIP-DNA adduct formation (18.7%) on Day 8 but increased IQ-DNA adduct formation (30.5%) on Day 8. Dietary CLA had no effect on adduct levels in liver or white blood cells. Calf thymus DNA was incubated with N-hydroxy-PhIP or -IQ in the presence of acetyl-CoA. Enzymatic activation was catalyzed by liver or mammary cytosol. A two-week pretreatment with 2% (wt/wt) dietary CLA had no effect on O-acetyltransferase-catalyzed IQ- or PhIP-DNA adduct formation. It is concluded, under certain conditions, that dietary CLA can lower IQ- and PhIP-DNA adduct formation. Overall, however, the major mode of action of CLA is probably by a mechanism other than the inhibition of the N-hydroxylation and subsequent O-acetylation of PhIP or

  7. DNA adduct formation and induction of detoxification mechanisms in Dreissena polymorpha exposed to nitro-PAHs.


    Châtel, Amélie; Faucet-Marquis, Virginie; Pfohl-Leszkowicz, Annie; Gourlay-Francé, Catherine; Vincent-Hubert, Françoise


    Derived polycyclic aromatic hydrocarbons (PAHs) such as nitro-PAHs are present in the environment and are known to be much more toxic than PAHs compounds. However, very few studies have analysed their effects on the aquatic environment and none have investigated the freshwater environment. In the present study, we determined whether 1-nitropyrene (1-NP), a model of nitro-PAHs, can induce DNA adducts in gills and digestive glands of the freshwater mussel Dreissena polymorpha. Two concentrations of 1-NP (50 and 500 μM) were tested. In addition, in order to understand the metabolic pathways involved in 1-NP genotoxicity, mRNA expression of genes implicated in biotransformation mechanisms was assessed by quantitative reverse transcription-PCR. Results showed the presence of DNA adducts in both gills and digestive glands, with highest levels obtained after 5 days of exposure to 500 μM. Metallothionein mRNA levels were enhanced in digestive glands exposed to 50 μM. Surprisingly, at the higher concentration (500 μM), aryl hydrocarbon receptor and HSP70 genes were only up-regulated in digestive glands while PgP mRNA levels were increased in both tissues. Results suggested a cytotoxic and genotoxic effect of 1-NP. Mussels seemed to be able to partially detoxify this compound, in view of the low amount of DNA adducts observed after 5 days exposure to 50 μM. For the first time, 1-NP biotransformation and detoxification systems have been characterised in D. polymorpha. PMID:25209124

  8. Titanium dioxide nanoparticles induce oxidative stress and DNA-adduct formation but not DNA-breakage in human lung cells

    PubMed Central

    Bhattacharya, Kunal; Davoren, Maria; Boertz, Jens; Schins, Roel PF; Hoffmann, Eik; Dopp, Elke


    Titanium dioxide (TiO2), also known as titanium (IV) oxide or anatase, is the naturally occurring oxide of titanium. It is also one of the most commercially used form. To date, no parameter has been set for the average ambient air concentration of TiO2 nanoparticles (NP) by any regulatory agency. Previously conducted studies had established these nanoparticles to be mainly non-cyto- and -genotoxic, although they had been found to generate free radicals both acellularly (specially through photocatalytic activity) and intracellularly. The present study determines the role of TiO2-NP (anatase, ∅ < 100 nm) using several parameters such as cyto- and genotoxicity, DNA-adduct formation and generation of free radicals following its uptake by human lung cells in vitro. For comparison, iron containing nanoparticles (hematite, Fe2O3, ∅ < 100 nm) were used. The results of this study showed that both types of NP were located in the cytosol near the nucleus. No particles were found inside the nucleus, in mitochondria or ribosomes. Human lung fibroblasts (IMR-90) were more sensitive regarding cyto- and genotoxic effects caused by the NP than human bronchial epithelial cells (BEAS-2B). In contrast to hematite NP, TiO2-NP did not induce DNA-breakage measured by the Comet-assay in both cell types. Generation of reactive oxygen species (ROS) was measured acellularly (without any photocatalytic activity) as well as intracellularly for both types of particles, however, the iron-containing NP needed special reducing conditions before pronounced radical generation. A high level of DNA adduct formation (8-OHdG) was observed in IMR-90 cells exposed to TiO2-NP, but not in cells exposed to hematite NP. Our study demonstrates different modes of action for TiO2- and Fe2O3-NP. Whereas TiO2-NP were able to generate elevated amounts of free radicals, which induced indirect genotoxicity mainly by DNA-adduct formation, Fe2O3-NP were clastogenic (induction of DNA-breakage) and required reducing

  9. Substituents on Quinone Methides Strongly Modulate Formation and Stability of Their Nucleophilic Adducts

    PubMed Central

    Weinert, Emily E.; Dondi, Ruggero; Colloredo-Melz, Stefano; Frankenfield, Kristen N.; Mitchell, Charles H.; Freccero, Mauro; Rokita, Steven E.


    Electronic perturbation of quinone methides (QM) greatly influences their stability and in turn alters the kinetics and product profile of QM reaction with deoxynucleosides. Consistent with the electron deficient nature of this reactive intermediate, electron-donating substituents are stabilizing and electron-withdrawing substituents are destabilizing. For example, a dC N3-QM adduct is made stable over the course of observation (7 days) by the presence of an electron-withdrawing ester group that inhibits QM regeneration. Conversely, a related adduct with an electron donating methyl group is very labile and regenerates its QM with a half-life of approximately 5 hr. The generality of these effects is demonstrated with a series of alternative quinone methide precursors (QMP) containing a variety of substituents attached at different positions with respect to the exocyclic methylene. The rates of nucleophilic addition to substituted QMs measured by laser flash photolysis similarly span five orders of magnitude with electron rich species reacting most slowly and electron deficient species reacting most quickly. The reversibility of QM reaction can now be predictably adjusted for any desired application. PMID:16953635

  10. Reactions of OOH radical with beta-carotene, lycopene, and torulene: hydrogen atom transfer and adduct formation mechanisms.


    Galano, Annia; Francisco-Marquez, Misaela


    The relative free radical scavenging activity of beta-carotene, lycopene, and torulene toward OOH radicals has been studied using density functional theory. Hydrogen atom transfer (HAT) and radical adduct formation (RAF) mechanisms have been considered. All the possible reaction sites have been included in the modeling, and detailed branching ratios are reported for the first time. The reactions of hydrocarbon carotenoids (Car) with peroxyl radicals, in both polar and nonpolar environments, are predicted to proceed via RAF mechanism, with contributions higher than 98% to the overall OOH + Car reactions. Lycopene and torulene were found to be more reactive than beta-carotene. In nonpolar environments the reactivity of the studied carotenoids toward peroxyl radical follows the trend LYC > TOR > BC, whereas in aqueous solutions it is TOR > LYC > BC. OOH adducts are predicted to be formed mainly at the terminal sites of the conjugated polyene chains. The main addition sites were found to be C5 for beta-carotene and lycopene and C30 for torulene. The general agreement between the calculated magnitudes and the available experimental data supports the predictions from this work. PMID:19627101

  11. N7-glycidamide-guanine DNA adduct formation by orally ingested acrylamide in rats: a dose-response study encompassing human diet-related exposure levels.


    Watzek, Nico; Böhm, Nadine; Feld, Julia; Scherbl, Denise; Berger, Franz; Merz, Karl Heinz; Lampen, Alfonso; Reemtsma, Thorsten; Tannenbaum, Steven R; Skipper, Paul L; Baum, Matthias; Richling, Elke; Eisenbrand, Gerhard


    Acrylamide (AA) is formed during the heating of food and is classified as a genotoxic carcinogen. The margin of exposure (MOE), representing the distance between the bench mark dose associated with 10% tumor incidence in rats and the estimated average human exposure, is considered to be of concern. After ingestion, AA is converted by P450 into the genotoxic epoxide glycidamide (GA). GA forms DNA adducts, primarily at N7 of guanine (N7-GA-Gua). We performed a dose-response study with AA in female Sprague-Dawley (SD) rats. AA was given orally in a single dosage of 0.1-10 000 μg/kg bw. The formation of urinary mercapturic acids and of N7-GA-Gua DNA adducts in liver, kidney, and lung was measured 16 h after application. A mean of 37.0 ± 11.5% of a given AA dose was found as mercapturic acids (MAs) in urine. MA excretion in urine of untreated controls indicated some background exposure from endogenous AA. N7-GA-Gua adduct formation was not detectable in any organ tested at 0.1 μg AA/kg bw. At a dose of 1 μg/kg bw, adducts were found in kidney (around 1 adduct/10(8) nucleotides) and lung (below 1 adduct/10(8) nucleotides) but not in liver. At 10, respectively, 100 μg/kg bw, adducts were found in all three organs, at levels close to those found at 1 μg AA/kg, covering a range of about 1-2 adducts/10(8) nucleotides. As compared to DNA adduct levels from electrophilic genotoxic agents of various origin found in human tissues, N7-GA-Gua adduct levels within the dose range of 0.1-100 μg AA/kg bw were at the low end of this human background. We propose to take the background level of DNA lesions in humans more into consideration when doing risk assessment of food-borne genotoxic carcinogens. PMID:22211389

  12. Protective Role of CYP2E1 Inhibitor Diallyl Disulfide (DADS) on Alcohol Induced Malondialdehyde-Deoxyguanosine (M1dG) Adduct Formation

    PubMed Central

    Sapkota, M.; Hottor, T. K.; DeVasure, J. M.; Wyatt, T. A.; McCaskill, M. L.


    Background Alcohol use disorders are often associated with lung disease. Alcohol exposure leads to the production of reactive oxygen species, lipid peroxidation, and formation of malondialdehyde (MDA) as well as induce the expression of cytochrome p450 2E1 (CYP2E1). Likewise, cigarette smoking can lead to lung lipid peroxidation and formation of MDA. MDA can bind to DNA forming MDA deoxyguanosine (M1dG) adducts, which have been implicated in alcohol-related cancers and cardiovascular disease. Because CYP2E1 regulates MDA production, and our previous studies have shown that alcohol and cigarette smoke can lead to MDA formation, we hypothesized that CYP2E1 would modulate M1dG adduct formation and single strand DNA damage in alcohol- and cigarette smoke-exposed lung cells and tissue. Methods Normal human bronchial epithelial cells (HBEC) were pre-treated with 10 μM DADS for 1h, and treated with 80 mM ethanol +/− 5% cigarette smoke extract (CSE) for 3 hrs for comet assay and 6 hrs for CYP2E1, MDA, and M1dG adduct assays. C57BL/6 mice were administered 20% ethanol ad libitum in drinking water for 8 wk and exposed to whole body cigarette smoke for 5 wk. Mice were also fed a CYP2E1 inhibitor, diallyl disulfide (DADS), at 1 μM/g of feed in their daily diet for 7 wk. Whole lung tissue homogenate was used for CYP2E1, MDA, and M1dG adduct assays. Results Ethanol exposure significantly increased HBEC olive tail moment. DADS pretreatment of HBEC attenuated this ethanol effect. Ethanol also induced MDA and M1dG adduct formation, which was also significantly reduced by DADS treatment. CSE +/− ethanol did not enhance these effects. In lung tissue homogenate of 8 wk alcohol-fed mice, MDA and M1dG adduct levels were significantly elevated in comparison to control mice and mice fed DADS while consuming alcohol. No increase in MDA and M1dG adduct formation was observed in 5 wk cigarette smoke-exposed mice. Conclusions These findings suggest that CYP2E1 plays a pivotal role in

  13. 3-Methylcholanthrene elicits DNA adduct formation in the CYP1A1 promoter region and attenuates reporter gene expression in rat H4IIE cells

    SciTech Connect

    Moorthy, Bhagavatula . E-mail:; Muthiah, Kathirvel; Fazili, Inayat S.; Kondraganti, Sudha R.; Wang Lihua; Couroucli, Xanthi I.; Jiang Weiwu


    Cytochrome CYP1A (CYP1A) enzymes catalyze bioactivation of 3-methylcholanthrene (MC) to genotoxic metabolites. Here, we tested the hypothesis that CYP1A2 catalyzes formation of MC-DNA adducts that are preferentially formed in the promoter region of CYP1A1, resulting in modulation of CYP1A1 gene expression. MC bound covalently to plasmid DNA (50 {mu}g) containing human CYP1A1 promoter (pGL3-1A1), when incubated with wild-type (WT) liver microsomes (2 mg) and NAPPH 37 {sup o}C for 2 h, giving rise to 9 adducts, as determined by {sup 32}P-postlabeling. Eighty percent of adducts was located in the promoter region. Transient transfection of the adducted plasmids into rat hepatoma (H4IIE) cells for 16 h, followed by MC (1 {mu}M) treatment for 24 h inhibited reporter (luciferase) gene expression by 75%, compared to unadducted controls. Our results suggest that CYP1A2 plays a key role in sequence-specific MC-DNA adduct formation in the CYP1A1 promoter region, leading to attenuation of CYP1A1 gene expression.

  14. Influence of TCDD and natural Ah receptor agonists on benzo[a]pyrene-DNA adduct formation in the Caco-2 human colon cell line.


    de Waard, Pim W J; de Kok, Theo M C M; Maas, Lou M; Peijnenburg, Ad A C M; Hoogenboom, Ron L A P; Aarts, Jac M M J G; van Schooten, Frederik-Jan


    Several compounds originating from cruciferous vegetables and citrus fruits bind to and activate the aryl hydrocarbon receptor (AhR). This receptor plays an important role in the toxicity of the known tumour promoter and potent AhR-agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). However, vegetables and fruits are generally considered as healthy. Therefore, besides the AhR activation, the natural AhR agonists (NAhRAs) are assumed to show other health-concerning effects. AhR activation induces several cytochrome P450 phase I enzymes involved, e.g. in the bioactivation of carcinogenic polycyclic aromatic hydrocarbons, like benzo[a]pyrene (BaP), and may as such stimulate DNA adduct formation of those compounds. Therefore, the influence of TCDD, indolo[3,2-b]carbazole (ICZ, an NAhRA originating from cruciferous vegetables) and an NAhRA-containing extract of grapefruit juice (GJE) on BaP-DNA adduct formation in the human Caco-2 cell line was studied. Also, we investigated if different effects of TCDD, ICZ and GJE on adduct formation could be related to the modulation of transcription of biotransformation- and DNA-repair enzymes. Co-exposure to high AhR-activating concentrations of both TCDD and ICZ significantly reduced the amount of BaP-DNA adducts at 0.1 microM BaP, while at higher concentrations of BaP no influence was observed. In contrast, exposure to 0.1 microM BaP combined with GJE showed a significant increase in BaP-DNA adducts, and a significant decrease at 0.3 and 1 microM BaP. These differences could not be related to transcription of the phase I and II enzymes CYP1A1, CYP1B1, NQO1, GSTP1 and UGT1A6 or to transcription of the nucleotide excision repair enzymes ERCC1, XPA, XPC, XPF and XPG. We conclude that ICZ showed a similar effect on BaP-DNA adduct formation than TCDD, while GJE influenced the adduct formation in a different way. The difference in the influence on adduct formation may be due to effects at the level of enzyme activity, rather than gene

  15. Characterization of hemoglobin adduct formation in mice and rats after administration of ( sup 14 C)butadiene or ( sup 14 C)isoprene

    SciTech Connect

    Sun, J.D.; Dahl, A.R.; Bond, J.A.; Birnbaum, L.S.; Henderson, R.F. )


    Occupational exposures to 1,3-butadiene or isoprene occur through their use in the manufacture of rubber and other related polymer products. The purpose of this study was to determine if butadiene or isoprene administration would result in the formation of adducts with blood hemoglobin (Hb), and if such adducts can be used as a measure of previous exposure(s). Male B6C3F1 mice and male Sprague-Dawley rats were injected intraperitoneally with 1, 10, 100, or 1000 mumol (14C)butadiene or 0.3, 3.0, 300, 1000, or 3000 mumol (14C)isoprene per kilogram body weight. Animals were killed 24 hr later. Globin was isolated from blood samples and was analyzed for 14C by liquid scintillation spectroscopy. Hb adduct formation was linearly related to administered doses up to 100 mumol (14C)butadiene or 500 mumol (14C)isoprene per kilogram body weight for mice and rats, respectively. For (14C)butadiene, the efficiency of Hb adduct formation in mice and rats within the linear response range was 0.177 +/- 0.003 and 0.407 +/- 0.019 (pmol of 14C-adducts/mg globin)/(mumol of retained (14C)butadiene/kg body wt), respectively (mean +/- SE; n = 18). For (14C)isoprene, these values for mice and rats were 0.158 +/- 0.035 and 0.079 +/- 0.016 (pmol of 14C-adducts/mg globin)/(mumol of retained (14C)isoprene/kg body wt), respectively (mean +/- SE; n = 12). Hb adducts also accumulated linearly after repeated daily administration of 100 mumol (14C)butadiene or 500 mumol (14C)isoprene per kilogram body wt to mice and rats, respectively, for 3 days. (14C)Butadiene-derived Hb adducts in blood showed lifetimes of approximately 24 and approximately 65 days for mice and rats, respectively, which correlate with the reported lifetimes for red blood cells in these rodent species. Thus, levels of butadiene- or isoprene-derived adducts on Hb in circulating blood may be a useful measure of prior repeated exposures to these compounds.

  16. Glutathione transferase activity and formation of macromolecular adducts in two cases of acute methyl bromide poisoning.

    PubMed Central

    Garnier, R; Rambourg-Schepens, M O; Müller, A; Hallier, E


    OBJECTIVES: To determine the activity of glutathione transferase and to measure the S-methylcysteine adducts in blood proteins, after acute inhalation exposure to methyl bromide. To examine the influence of the polymorphism of glutathione-S-transferase theta (GSTT1) on the neurotoxicity of methyl bromide. METHODS: Two workers acutely exposed to methyl bromide with inadequate respiratory protective devices were poisoned. Seven weeks after the accident, blood samples were drawn from both patients, for measurement of glutathione transferase activity in erythrocytes (conjugator status--that is, GSTT1 phenotype) and measurement of binding products of methyl bromide with blood proteins. Conjugator status was determined by a standard procedure. The binding product of methyl bromide, S-methylcysteine, was measured in globin and albumin. RESULTS: Duration and intensity of exposure were identical for both patients as they worked together with the same protective devices and with similar physical effort. However, one patient had very severe poisoning, whereas the other only developed mild neurotoxic symptoms. The first patient was a "conjugator" with normal glutathone transferase activity, whereas this activity was undetectable in the erythrocytes of the second patient, who consequently had higher concentrations of S-methylcysteine adduct in albumin (149 v 91 nmol/g protein) and in globin (77 v 30 nmol/g protein). CONCLUSIONS: Methyl bromide is genotoxic and neurotoxic. Its genotoxicity seems to be the consequence of the alkylating activity of the parent compound, and conjugation to glutathione has a protective effect. The data presented here suggest a different mechanism for methyl bromide neurotoxicity which could be related to the transformation of methylglutathione into toxic metabolites such as methanethiol and formaldehyde. If such metabolites are the ultimate toxic species, N-acetylcysteine treatment could have a toxifying rather than a detoxifying effect. PMID:8704864

  17. Acetylator genotype-dependent formation of 2-aminofluorene-hemoglobin adducts in rapid and slow acetylator Syrian hamsters congenic at the NAT2 locus.


    Feng, Y; Rustan, T D; Ferguson, R J; Doll, M A; Hein, D W


    Arylamine-hemoglobin adducts are a valuable dosimeter for assessing arylamine exposures and carcinogenic risk. The effects of age, sex, time-course, dose, and acetylator genotype on levels of 2-aminofluorene-hemoglobin adducts were investigated in homozygous rapid (Bio. 82.73/H-Patr) and slow (Bio. 82.73/H-Pats) acetylator hamsters congenic at the polymorphic (NAT2) acetylator locus. Following administration of a single ip dose of [3H]2-aminofluorene, peak 2-aminofluorene-hemoglobin adduct levels were achieved at 12-18 hr and retained a plateau up to 72 hr postinjection in both rapid and slow acetylator congenic hamsters. 2-Aminofluorene-hemoglobin adduct levels did not differ significantly between young (5-6 weeks) and old (32-49 weeks) hamsters or between male and female hamsters within either acetylator genotype. 2-Aminofluorene-hemoglobin adduct levels increased in a dose-dependent manner (r = 0.95, p = 0.0001) and were consistently higher in slow versus rapid acetylator congenic hamsters in studies of both time-course and dose-effect. The magnitude of the acetylator genotype-dependent difference was a function of dose; 2-aminofluorene-hemoglobin adduct levels were 1.5-fold higher in slow acetylator congenic hamsters following a 60 mg/kg 2-aminofluorene dose (p = 0.0013) but 2-fold higher following a 100 mg/kg 2-aminofluorene dose (p < 0.0001). These results show a specific and significant role for NAT2 acetylator genotype in formation of arylamine-hemoglobin adducts, which may reflect the relationship between acetylator genotype and the incidence of different cancers from arylamine exposures. PMID:8291051

  18. Metabolism of methyleugenol in liver microsomes and primary hepatocytes: pattern of metabolites, cytotoxicity, and DNA-adduct formation.


    Cartus, Alexander T; Herrmann, Kristin; Weishaupt, Lucas W; Merz, Karl-Heinz; Engst, Wolfram; Glatt, Hansruedi; Schrenk, Dieter


    Methyleugenol (1) is a constituent of many foods, in particular of herbal spices, and is used as flavoring agent in foodstuffs and as fragrance in cosmetics. 1 has been found to be carcinogenic in rodents, its metabolite, 1-hydroxymethyleugenol (2) acting as proximate DNA-binding carcinogen. We incubated 1 with liver microsomes of rat, bovine, and human origin. We found 2, 3-hydroxymethylisoeugenol (3), and 6-hydroxymethyleugenol (4) as major metabolites, and 1-oxomethyleugenol (5), 3-oxomethylisoeugenol (6), eugenol (9), chavibetol (11), and (RS)-2,3-dihydroxy-2,3-dihydromethyleugenol (7) as minor metabolites. Methyleugenol-2,3-epoxide (8), probably the precursor of 7, could not be detected. Incubations with synthetic metabolites were applied in order to uncover metabolic pathways. Incubations with primary rat hepatocytes revealed mainly nonconjugated 2 and conjugated 4, and minor amounts of partly conjugated 7 and conjugated 9 + 11. The "reactive metabolites" 3, 5, 6, and 8 were not detectable, possibly due to rapid reaction with cellular macromolecules. The highest cytotoxicity (resazurin reduction assay and lactate dehydrogenase leakage assay) was observed for the main metabolite 2 and its secondary metabolite 5 with EC(50) values of 50 and 10 µM, respectively. Deoxyadenosine or deoxyguanosine adducts were formed by incubating 1 or metabolites with rat hepatocytes. The rank order of adduct formation was 2 > 1 > 3 > 6, whereas 4, 5, and 8 were inactive. In conclusion, we present a virtually complete pattern of microsomal (rat, bovine, and human) and hepatocellular (rat) metabolites of 1 suggesting the formation of several reactive metabolites possibly involved in carcinogenicity, organ toxicity, and immune reactions. PMID:22610610

  19. Exposure to the chlorofluorocarbon substitute 2,2-dichloro-1,1,1- trifluoroethane and the anesthetic agent halothane is associated with transient protein adduct formation in the heart

    SciTech Connect

    Huwyler, J.; Gut, J. )


    Hydrochlorofluorocarbons (HCFCs) that are structural analogues of the anesthetic agent halothane may follow a common pathway of bioactivation and formation of adducts to cellular targets of distinct tissues. Exposure of rats to a single dose of HCFC 123 (2,2-dichloro- 1,1,1-trifluoroethane) or its structural analogue halothane (2-bromo-2-chloro-1,1,1-trifluoroethane) in vivo resulted in the formation of one prominent trifluoroacetylated protein adduct (TFA-protein adduct) in the heart. In contrast, a variety of distinct TFA-protein adducts were formed in the liver and the kidney of the same animals. The TFA-protein adduct in the heart was processed rapidly; t1/2 of the intact TFA-protein adduct was less than 12 h.

  20. Prediction of treatment outcome by cisplatin-DNA adduct formation in patients with stage III/IV head and neck squamous cell carcinoma, treated by concurrent cisplatin-radiation (RADPLAT).


    Hoebers, Frank J P; Pluim, Dick; Verheij, Marcel; Balm, Alfons J M; Bartelink, Harry; Schellens, Jan H M; Begg, Adrian C


    The purpose of our study was to test the predictive value of cisplatin-DNA adduct levels in head and neck squamous cell carcinoma (HNSCC) patients treated with cisplatin-radiation. Patients with advanced-stage HNSCC were treated within a randomized trial, investigating the optimal route of cisplatin administration, concurrently with radiation. Cisplatin was administered intra-arterially (IA, 150 mg/m2, with systemic rescue by sodium thiosulfate) or intravenously (IV, 100 mg/m2). In a subgroup, adducts were quantified in normal tissue and tumor. 32P-postlabeling was used to quantify intrastrand guanosine-guanosine adducts (GG-adducts) and adenosine-guanosine adducts (AG-adducts). Adduct levels were correlated with treatment outcome. Thirty-five patients were included (21 IV and 14 IA). At median follow-up of 27 months, locoregional (LR) control was 75% at 1 and 70% at 2 years. Adduct levels in tumor were 4-5-fold higher than in white blood cells (WBC) for both IA and IV treatment (p = 0.01). Adduct formation in WBC and buccal cells was higher in IV treated patients compared with IA infusion (p = 0.049 and 0.005 for GG-adducts in WBC and buccal cells, respectively). Adducts in tumors after IA infusion were not statistically different from those after IV. A strong correlation was observed between GG- and AG-adduct formation (r = 0.86, p < 0.001). Patients with higher GG adduct levels (>median) in primary tumor had significantly better disease free survival (DFS) than patients with lower (< or = median) adduct levels (p = 0.02). For overall survival (OS), a nonsignificant trend was observed, again in favor of patients with higher adduct levels (p = 0.06). In conclusion, cisplatin-DNA adduct formation in primary tumor appears to be predictive for DFS in HNSCC. No differences were observed in intratumoral adduct levels between IA and IV treatments, despite selective infusion of high-dose cisplatin with the IA procedure. However, systemic adduct levels (WBC and buccal


    EPA Science Inventory

    Cultured bladder and tracheobronchial explants from human, monkey, dog, hamster, and rat were used to study the metabolism, covalent binding to DNA, and DNA:adduct formation of (3H0benzo(a)pyrene (BP). Both organs from all species formed large amounts (40 to 70% of total 3H in th...


    EPA Science Inventory

    Studies On The Metabolism of 6-Nitrochrysene and The Formation of DNA Adducts in the Liver, Lung and Bladder ofAJJ Mice
    Moses McDaniel*, Linda Adamst, Joycelyn Allisont, Michael George"l", Dhimant Desai+, 5hantu Amin+, Guy Lambertt, William Padgettt, Stephen Nesnowt and...


    EPA Science Inventory

    An Evaluation of the Mutagenicity, Metabolism and DNA Adduct Formation of 5-Nitrobenzo[b ]naphtho[2, I-d]thiophene

    Thioarenes, sulfur containing polycyclic aromatic compounds, are environmental contaminants suspected of posing human health risks. In this study, 5-nitroben...

  4. Application of Thio-Ugi Adducts for the Preparation of Benzo[b]thiophene and S-Heterocycle Library via Copper Catalyzed Intramolecular C-S Bond Formation.


    Kim, Yong-Sang; Kwak, Se Hun; Gong, Young-Dae


    Fused heterocycles, such as benzo[b]thiophene, thiochroman, benzo[b][1,4]thiazine, and 1,4-benzothiazepine were generated from thio-Ugi adducts containing a thioamide group through copper-catalyzed intramolecular C-S bond formation under microwave irradiation. PMID:25961783

  5. Evidence for adduct formation at the semiconductor-solution interface. Photoluminescent properties of cadmium selenide in the presence of lanthanide. beta. -diketonate complexes

    SciTech Connect

    Murphy, C.J.; Ellis, A.B. )


    Photoluminescence (PL) measurements of etched, single-crystal n-CdSe demonstrate that the semiconductor surface engages in adduct formation with a family of lanthanide {beta}-diketonate complexes, Ln(fod){sub 3} (Ln = lanthanide; fod = 6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedionato anion), in isooctane ambient.

  6. 2-Methoxyethanol metabolism, embryonic distribution, and macromolecular adduct formation in the rat: the effect of radiofrequency radiation-induced hyperthermia.


    Cheever, K L; Swearengin, T F; Edwards, R M; Nelson, B K; Werren, D W; Conover, D L; DeBord, D G


    Exposure of pregnant rats to the solvent 2-methoxyethanol (2ME) and radiofrequency (RF) radiation results in greater than additive fetal malformations (Nelson, B.K., Conover, D.L., Brightwell, W.S., Shaw, P.B., Werren, D.W., Edwards, R.M., Lary, J.M., 1991. Marked increase in the teratogenicity of the combined administration of the industrial solvent 2-methoxyethanol and radiofrequency radiation in rats. Teratology 43, 621-34; Nelson, B.K., Conover, D.L., Shaw, P.B., Werren, D.W., Edwards, R.M., Hoberman, A.M., 1994. Interactive developmental toxicity of radiofrequency radiation and 2-methoxyethanol in rats. Teratology 50, 275-93). The current study evaluated the metabolism of 14C-labeled 2ME and the distribution of methoxyacetic acid (MAA) in maternal and embryonic tissues of pregnant Sprague-Dawley rats either exposed to 10 MHz RF radiation or sham conditions. Additionally, adduct formation for both plasma and embryonic protein was tested as a possible biomarker for the observed 2ME/RF teratogenicity. Rats were administered [ethanol-1,2-(14)C]-2ME (150 mg/kg, 161 microCi/rat average) by gavage on gestation day 13 immediately before RF radiation sufficient to elevate body temperature to 42 degrees C for 30 min. Concurrent sham- and RF-exposed rats were sacrificed at 3, 6, 24 or 48 h for harvest of maternal blood, urine, embryos and extra-embryonic fluid. Tissues were either digested for determination of radioactivity or deproteinized with TCA and analyzed by HPLC for quantification of 2ME metabolites. Results show the presence of 2ME and seven metabolites, with the major metabolite, MAA, peaking at 6 h in the tissues tested. MAA, the proximal teratogen, was detectable in maternal serum, urine, embryo and extraembryonic fluid 48 h after dosing. Clearance of total body 14C was significantly reduced for the RF-exposed animals (P<0.05) for the 24-48 h period, but MAA values for serum, embryos and extraembryonic fluid were similar for both sham- and RF-exposed rats

  7. Induction of cytochromes P450 1A1 and 1A2 suppresses formation of DNA adducts by carcinogenic aristolochic acid I in rats in vivo

    PubMed Central

    Dračínská, Helena; Bárta, František; Levová, Kateřina; Hudecová, Alena; Moserová, Michaela; Schmeiser, Heinz H.; Kopka, Klaus; Frei, Eva; Arlt, Volker M.; Stiborová, Marie


    Aristolochic acid I (AAI) is a natural plant alkaloid causing aristolochic acid nephropathy, Balkan endemic nephropathy and their associated urothelial malignancies. One of the most efficient enzymes reductively activating AAI to species forming AAI-DNA adducts is cytosolic NAD(P)H:quinone oxidoreductase 1. AAI is also either reductively activated or oxidatively detoxified to 8-hydroxyaristolochic acid (AAIa) by microsomal cytochrome P450 (CYP) 1A1 and 1A2. Here, we investigated which of these two opposing CYP1A1/2-catalyzed reactions prevails in AAI metabolism in vivo. The formation of AAI-DNA adducts was analyzed in liver, kidney and lung of rats treated with AAI, Sudan I, a potent inducer of CYP1A1/2, or AAI after pretreatment with Sudan I. Compared to rats treated with AAI alone, levels of AAI-DNA adducts determined by the 32P-postlabeling method were lower in liver, kidney and lung of rats treated with AAI after Sudan I. The induction of CYP1A1/2 by Sudan I increased AAI detoxification to its O-demethylated metabolite AAIa, thereby reducing the actual amount of AAI available for reductive activation. This subsequently resulted in lower AAI-DNA adduct levels in the rat in vivo. Our results demonstrate that CYP1A1/2-mediated oxidative detoxification of AAI is the predominant role of these enzymes in rats in vivo, thereby suppressing levels of AAI-DNA adducts. PMID:26845733

  8. Absence of formation of benzo[a]pyrene/DNA adducts in the cuttlefish (Sepia officinalis, Mollusca: Cephalopoda)

    SciTech Connect

    Lee, P.G.; Lu, L.J.W.; Salazar, J.J.; Holoubek, V. )


    Benzo[a]pyrene (B[a]P) injected intramuscularly into the base of the arms of cuttlefish was released continuously from the injection site and removed from the organism. Only a portion of the compound accumulated in the body. Twenty-four hr after its injection, 75% of B[a]P applied in olive oil was removed from the cuttlefish, and 1.2% was found in the body outside the head, in site of injection. If the carcinogen was dissolved in dimethylformamide, the removal of B[a]P was slower, so that only 18% of the injected B[a]P was removed from the organism and 0.36% accumulated in the body outside the head 24 hr after injection. The high level of B[a]P in gills and hemolymph 4 hr after injection and the kinetics of the decrease of its concentration with time indicate that these two organs could be involved in the excretion of B[a]P from the body. The B[a]P/DNA adducts characteristic for vertebrates could not be demonstrated in gills, skin, brain, hepatopancreas, and lymphocytes of the cuttlefish 24 hr after injection. The dose of the carcinogene injected into the cuttlefish was 2-4 times higher than the dose resulting in the formation of a high level of B[a]P/DNA adducts in vertebrates. A different metabolism of B[a]P in the tissue of cephalopods, compared to vertebrates, could be less favorable to the process leading to malignant transformation and could explain the absence from the literature of reports of tumors in cephalopods. 15 refs., 1 fig., 2 tabs.

  9. Chemical-Biological Properties of Zinc Sensors TSQ and Zinquin: Formation of Sensor-Zn-Protein Adducts versus Zn(Sensor)2 Complexes.


    Nowakowski, Andrew B; Meeusen, Jeffrey W; Menden, Heather; Tomasiewicz, Henry; Petering, David H


    Fluorescent zinc sensors are the most commonly used tool to study the intracellular mobile zinc status within cellular systems. Previously, we have shown that the quinoline-based sensors Zinquin and 6-methoxy-8-p-toluenesulfonamido-quinoline (TSQ) predominantly form ternary adducts with members of the Zn-proteome. Here, the chemistries of these sensors are further characterized, including how Zn(sensor)2 complexes may react in an intracellular environment. We demonstrate that these sensors are typically used in higher concentrations than needed to obtain maximum signal. Exposing cells to either Zn(Zinquin)2 or Zn(TSQ)2 resulted in efficient cellular uptake and the formation of sensor-Zn-protein adducts as evidenced by both a fluorescence spectral shift toward that of ternary adducts and the localization of the fluorescence signal within the proteome after gel filtration of cellular lysates. Likewise, reacting Zn(sensor)2 with the Zn-proteome from LLC-PK1 cells resulted in the formation of sensor-Zn-protein ternary adducts that could be inhibited by first saturating the Zn- proteome with excess sensor. Further, a native SDS-PAGE analysis of the Zn-proteome reacted with either the sensor or the Zn(sensor)2 complex revealed that both reactions result in the formation of a similar set of sensor-Zn-protein fluorescent products. The results of this experiment also demonstrated that TSQ and Zinquin react with different members of the Zn-proteome. Reactions with the model apo-Zn-protein bovine serum albumin showed that both Zn(TSQ)2 and Zn(Zinquin)2 reacted to form ternary adducts with its apo-Zn-binding site. Moreover, incubating Zn(sensor)2 complexes with non-zinc binding proteins failed to elicit a spectral shift in the fluorescence spectrum, supporting the premise that blue-shifted emission spectra are due to sensor-Zn-protein ternary adducts. It was concluded that Zn(sensors)2 species do not play a significant role in the overall reaction between these sensors and

  10. Chromium (VI) potentiates the DNA adducts (O(6)-methylguanine) formation of N-nitrosodimethylamine in rat: implication on carcinogenic risk.


    Ma, Fujun; Zhang, Zhaobin; Jiang, Jieqiong; Hu, Jianying


    Chromium (VI) [Cr(VI)] and nitrosamines such as N-nitrosodimethylamine (NDMA) exist commonly in the environment. To evaluate the potential influence of Cr(VI) co-exposure on the carcinogenic risk of NDMA, Female Wistar rats were treated with various concentrations of Cr(VI) and/or NDMA via drinking water for 15days and the DNA adducts (O(6)-methylguanine, O(6)-MeG) of NDMA in liver tissue was used as a bioindicator. The results showed that Cr(VI) synergistically enhanced the O(6)-MeG formation, which could lead to an increase in DNA damage and carcinogenic potential. Although Cr(VI) did not alter the CYP 2E1 enzyme activity, it decreased GSH content, which would be an potential mechanism for the potentiated O(6)-MeG formation by Cr(VI) co-exposure. These results would contribute to the development of quantitative risk assessment of NDMA or even for a group of nitrosamines under environmental mixture exposure. PMID:26143543

  11. Alcohol, Aldehydes, Adducts and Airways.


    Sapkota, Muna; Wyatt, Todd A


    Drinking alcohol and smoking cigarettes results in the formation of reactive aldehydes in the lung, which are capable of forming adducts with several proteins and DNA. Acetaldehyde and malondialdehyde are the major aldehydes generated in high levels in the lung of subjects with alcohol use disorder who smoke cigarettes. In addition to the above aldehydes, several other aldehydes like 4-hydroxynonenal, formaldehyde and acrolein are also detected in the lung due to exposure to toxic gases, vapors and chemicals. These aldehydes react with nucleophilic targets in cells such as DNA, lipids and proteins to form both stable and unstable adducts. This adduction may disturb cellular functions as well as damage proteins, nucleic acids and lipids. Among several adducts formed in the lung, malondialdehyde DNA (MDA-DNA) adduct and hybrid malondialdehyde-acetaldehyde (MAA) protein adducts have been shown to initiate several pathological conditions in the lung. MDA-DNA adducts are pre-mutagenic in mammalian cells and induce frame shift and base-pair substitution mutations, whereas MAA protein adducts have been shown to induce inflammation and inhibit wound healing. This review provides an insight into different reactive aldehyde adducts and their role in the pathogenesis of lung disease. PMID:26556381

  12. Alcohol, Aldehydes, Adducts and Airways

    PubMed Central

    Sapkota, Muna; Wyatt, Todd A.


    Drinking alcohol and smoking cigarettes results in the formation of reactive aldehydes in the lung, which are capable of forming adducts with several proteins and DNA. Acetaldehyde and malondialdehyde are the major aldehydes generated in high levels in the lung of subjects with alcohol use disorder who smoke cigarettes. In addition to the above aldehydes, several other aldehydes like 4-hydroxynonenal, formaldehyde and acrolein are also detected in the lung due to exposure to toxic gases, vapors and chemicals. These aldehydes react with nucleophilic targets in cells such as DNA, lipids and proteins to form both stable and unstable adducts. This adduction may disturb cellular functions as well as damage proteins, nucleic acids and lipids. Among several adducts formed in the lung, malondialdehyde DNA (MDA-DNA) adduct and hybrid malondialdehyde-acetaldehyde (MAA) protein adducts have been shown to initiate several pathological conditions in the lung. MDA-DNA adducts are pre-mutagenic in mammalian cells and induce frame shift and base-pair substitution mutations, whereas MAA protein adducts have been shown to induce inflammation and inhibit wound healing. This review provides an insight into different reactive aldehyde adducts and their role in the pathogenesis of lung disease. PMID:26556381

  13. DNA binding and adduct formation of 7,12-dimethylbenz(a)-anthracene by rat mammary epithelial cell aggregates in vitro

    SciTech Connect

    Singletary, K.W.; Milner, J.A.


    Freshly isolated mammary epithelial cell aggregates from female Sprague-Dawley rats metabolized 7,12-dimethylbenz-(a)anthracene (DMBA) to bay-region anti- and syn-dihydrodiolepoxides that bound to deoxyguanosine and deoxyadenosine residues in cellular DNA. After 24 h of incubation 68% of the DMBA (0.4 micrograms/ml) was metabolized and 58% of the extracellular metabolites were water-soluble. DMBA-DNA binding increased rapidly during the initial 24 h of incubation. Formation of the bay-region syn-dihydrodiolepoxide:deoxyadenosine adduct increased linearly throughout the 24 h, whereas formation of deoxyadenosine and deoxyguanosine adducts with the bay-region anti-dihydrodiolepoxide increased rapidly following a delay of 12 h.

  14. DNA Adduct Formation from Metabolic 5'-Hydroxylation of the Tobacco-Specific Carcinogen N'-Nitrosonornicotine in Human Enzyme Systems and in Rats.


    Zarth, Adam T; Upadhyaya, Pramod; Yang, Jing; Hecht, Stephen S


    N'-Nitrosonornicotine (NNN) is carcinogenic in multiple animal models and has been evaluated as a human carcinogen. NNN can be metabolized by cytochrome P450s through two activation pathways: 2'-hydroxylation and 5'-hydroxylation. While most previous studies have focused on 2'-hydroxylation in target tissues of rats, available evidence suggests that 5'-hydroxylation is a major activation pathway in human enzyme systems, in nonhuman primates, and in target tissues of some other rodent carcinogenicity models. In the study reported here, we investigated DNA damage resulting from NNN 5'-hydroxylation by quantifying the adduct 2-(2-(3-pyridyl)-N-pyrrolidinyl)-2'-deoxyinosine (py-py-dI). In rats treated with NNN in the drinking water (7-500 ppm), py-py-dI was the major DNA adduct resulting from 5'-hydroxylation of NNN in vivo. Levels of py-py-dI in the lung and nasal cavity were the highest, consistent with the tissue distribution of CYP2A3. In rats treated with (S)-NNN or (R)-NNN, the ratios of formation of (R)-py-py-dI to (S)-py-py-dI were not the expected mirror image, suggesting that there may be a carrier for one of the unstable intermediates formed upon 5'-hydroxylation of NNN. Rat hepatocytes treated with (S)- or (R)-NNN or (2'S)- or (2'R)-5'-acetoxyNNN exhibited a pattern of adduct formation similar to that of live rats. In vitro studies with human liver S9 fraction or human hepatocytes incubated with NNN (2-500 μM) demonstrated that py-py-dI formation was greater than the formation of pyridyloxobutyl-DNA adducts resulting from 2'-hydroxylation of NNN. (S)-NNN formed more total py-py-dI adducts than (R)-NNN in human liver enzyme systems, which is consistent with the critical role of CYP2A6 in the 5'-hydroxylation of NNN in human liver. The results of this study demonstrate that the major DNA adduct resulting from NNN metabolism by human enzymes is py-py-dI and provide potentially important new insights into the metabolic activation of NNN in rodents and humans


    EPA Science Inventory

    Little is known about the formation and disposition of benzene oxide (BO), the initial metabolite arising from oxidation of benzene by cytochrome P450. In this study, reactions of BO with hemoglobin (Hb) and albumin (Alb) were investigated in blood from B6C3F1 mice, F344 rats, ...

  16. Formation of cyclic 1,N2-propanodeoxyguanosine and thymidine adducts in the reaction of the mutagen 2-bromoacrolein with calf thymus DNA

    SciTech Connect

    Meerman, J.H.; Smith, T.R.; Pearson, P.G.; Meier, G.P.; Nelson, S.D. )


    The interaction of the mutagen 2-bromoacrolein (2BA) with DNA and thymidine was studied in vitro by reaction of (3-3H)2BA with thymidine, RNA, single-stranded DNA, and double-stranded DNA in phosphate buffer (pH 7.4). After purification of the nucleic acids, they were incubated at alkaline pH to convert any (hydroxybromo)propano(deoxy)-guanosine adducts to their dihydroxy analogues. After acid or enzymatic hydrolysis, the hydrolysates were analyzed by reversed-phase high-performance liquid chromatography. At a concentration of 1.6 mM, the fraction of 2BA that became covalently bound to DNA was 2.3% of the amount added. Only 3% of the radioactivity bound to DNA after extensive purification could be accounted for as cyclic 1,N2-(6,7-dihydroxy)-propanoguanine adducts. More 2BA became covalently bound to single-stranded DNA and RNA as compared with double-stranded DNA. However, high-performance liquid chromatographic analyses showed that formation of cyclic 1,N2-(6,7-dihydroxy)propanoguanine adducts was also a minor reaction with these macromolecules. Because these data showed that other type(s) of reaction(s) are more important in the reaction of 2BA with nucleic acids, we have investigated the reaction of 2BA with other nucleosides. It was found that 2BA reacted well with thymidine in vitro, and the major product was identified by 500 MHz 1H and 75.43 MHz 13C nuclear magnetic resonance and thermospray mass spectrometry as 3-(2-bromo-3-oxopropyl)thymidine. This adduct was unstable and decomposed upon storage. After enzymatic hydrolysis of (3H)2BA-modified double-stranded DNA and subsequent analysis of the hydrolysate by high-performance liquid chromatography, 22% of the covalently bound radioactivity to DNA coeluted with decomposition products of the 3-(bromooxypropyl)thymidine adduct.

  17. Inhibition of aryl hydrocarbon receptor transactivation and DNA adduct formation by CYP1 isoform-selective metabolic deactivation of benzo[a]pyrene

    SciTech Connect

    Endo, Kaori; Uno, Shigeyuki; Seki, Taiichiro; Ariga, Toyohiko; Kusumi, Yoshiaki; Mitsumata, Masako; Yamada, Sachiko; Makishima, Makoto


    Benzo[a]pyrene (BaP), a polyaromatic hydrocarbon produced by the combustion of cigarettes and coke ovens, is a known procarcinogen. BaP activates the aryl hydrocarbon receptor (AhR) and induces the expression of a battery of genes, including CYP1A1, which metabolize BaP to toxic compounds. The possible role of CYP1 enzymes in mediating BaP detoxification or metabolic activation remains to be elucidated. In this study, we assessed the effects of CYP1 enzymes (CYP1A1, CYP1A2 and CYP1B1) on BaP-induced AhR transactivation and DNA adduct formation in HEK293 cells and HepG2 cells. Transfection of CYP1A1 and CYP1B1, but not CYP1A2, suppressed BaP-induced activation of AhR. Expression of CYP1A1 and CYP1A2, but not CYP1B1, inhibited DNA adduct formation in BaP-treated HepG2 cells. These results indicate that CYP1A1 and CYP1B1 play a role in deactivation of BaP on AhR and that CYP1A1 and CYP1A2 are involved in BaP detoxification by suppressing DNA adduct formation. BaP treatment did not induce DNA adduct formation in HEK293 cells, even after transfection of CYP1 enzymes, suggesting that expression of CYP1 enzymes is not sufficient for DNA adduct formation. Lower expression of epoxide hydrolase and higher expression of glutathione S-transferase P1 (GSTP1) and GSTM1/M2 were observed in HEK293 cells compared with HepG2 cells. Dynamic expression of CYP1A1, CYP1A2 and CYP1B1 along with expression of other enzymes such as epoxide hydrolase and phase II enzymes may determine the detoxification or metabolic activation of BaP.

  18. Inhibition of the formation of benzo[a]pyrene adducts to DNA in A549 lung cells exposed to mixtures of polycyclic aromatic hydrocarbons.


    Genies, Camille; Jullien, Amandine; Lefebvre, Emmanuel; Revol, Morgane; Maitre, Anne; Douki, Thierry


    Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous pollutants, which exhibit carcinogenic properties especially in lungs. In the present work, we studied the effect of mixtures of 12 PAHs on the A549 alveolar cells. We first assess the ability of each PAH at inducing gene expression of phase I metabolization enzymes and at generating DNA adducts. A good correlation was found between these two endpoints. We then exposed cells to either binary mixtures of the highly genotoxic benzo[a]pyrene (B[a]P) with each PAH or complex mixtures of all studied PAHs mimicking by real emissions including combustion of wood, cigarette smoke, and atmospheres of garage, silicon factory and urban environments. Compared to pure B[a]P, both types of mixtures led to reduced CYP450 activity measured by the EROD test. A similar trend was observed for the formation of DNA adducts. Surprisingly, the complex mixtures were more potent than B[a]P used at the same concentration for the induction of genes coding for CYP. Our results stress the lack of additivity of the genotoxic properties of PAH in mixtures. Interestingly, an opposite synergy in the formation of B[a]P adducts were observed previously in hepatocytes. Our data also show that measurement of the metabolic activity rather than quantification of gene expression reflects the actual bioactivation of PAHs into DNA damaging species. PMID:27196671

  19. Cytochrome P4501A induction and DNA adduct formation in glaucous gulls (Larus hyperboreus), fed with environmentally contaminated gull eggs.


    Østby, Lene; Gabrielsen, Geir Wing; Krøkje, Ase


    This study indicates that complex mixtures of pollutants found in the Arctic marine environment have genotoxic effects in glaucous gulls (Larus hyperboreus). DNA adducts were quantified, by the (32)P-postlabeling technique, in liver samples from gulls fed with hen eggs (controls) and from gulls fed with environmentally contaminated gull eggs (exposed). All birds were grown and fed under laboratory conditions. Hepatic homologues to mammalian cytochrome P4501A (CYP1A) proteins were also determined by Western blotting. DNA adducts were detected in all but one liver sample, but the exposed birds had a significantly increased level of DNA adducts relative to that of the controls. There was no clear significant correlation between the DNA adduct level and the level of organochlorine compounds (OCs) in blood. The level of CYP1A protein was significantly higher in the liver of exposed male gulls than in the liver of control males and positively correlated, with significance, to the level of OC compounds measured in blood. There was no significant correlation between the level of DNA adducts and the CYP1A protein content. PMID:16216630

  20. Improvement in the diagnostic potential of (32)P-postlabeling analysis demonstrated by the selective formation and comparative analysis of nitrated-PAH-derived adducts arising from diesel-particle extracts

    SciTech Connect

    Gallagher, J.E.; Kohan, M.J.; George, M.H.; Lewtas, J.


    Studies suggest that DNA adducts derived from N-substituted aryl-compounds are poorly recovered in the nuclease P1 version of the (32)P-postlabeling assay but not the butanol extraction version. Both versions were employed to ascertain whether the differences in sensitivity could be used to select for nitroaromatic-DNA adducts derived by treating calf thymus DNA with organic extracts from four diesel and one gasoline vehicle emission particles. The authors' enhanced the formation of nitrated-PAH-derived adducts through xanthine oxidase-catalyzed nitroreduction of nitrated-polycyclic aromatic hydrocarbons; constituents previously detected in the diesel emissions. All four diesel organic extracts treated with xanthine oxidase resulted in the formation of one major DNA adduct chromatographically distinct from the multiple DNA adducts detected in the rat liver S9-treated incubations. The adduct was detectable with the butanol extraction but not the nuclease P1 version of the (32)P-postlabeling assay and was chromatographically similar to DNA adducts formed following xanthine oxidase nitroreduction of 1-nitropyrene or ascorbic acid treatment of 1-nitro-8-nitrosopyrene and 1-nitro-6-nitrosopyrene.

  1. Effects of epigallocatechin gallate, L-ascorbic acid, alpha-tocopherol, and dihydrolipoic acid on the formation of deoxyguanosine adducts derived from lipid peroxidation.


    Nath, Raghu G; Wu, Mona Y; Emami, Armaghan; Chung, Fung-Lung


    Oxidation of polyunsaturated fatty acids (PUFAs) releases alpha,beta-unsaturated aldehydes that modify deoxyguanosine (dG) to form cyclic 1,N(2)-propanodeoxyguanosine adducts. One of the major adducts detected in vivo is acrolein (Acr)-derived 1,N(2)-propanodeoxyguanosine (Acr-dG). We used a chemical model system to examine the effects of 4 antioxidants known to inhibit fatty acid oxidation on the formation of Acr-dG and 8-oxodeoxyguaonsine (8-oxodG) from the PUFA docosahexaenoic acid (DHA) under oxidative conditions. We found that epigallocatechin gallate (EGCG) and dihydrolipoic acid (DHLA) inhibit both Acr-dG and 8-oxodG formation. In contrast, ascorbic acid and alpha-tocopherol actually increase Acr-dG at high concentrations and do not show a concentration-dependant inhibition of 8-oxodG. We also studied their effects on blocking Acr-dG formation directly from Acr. EGCG and DHLA can both effectively block Acr-dG formation, but ascorbic acid and alpha-tocopherol show weak or little effect. These results highlight the complexity of antioxidant mechanisms and also reveal that EGCG and DHLA are effective at suppressing lipid peroxidation-induced Acr-dG and 8-oxodG formation as well as blocking the reaction of dG with Acr. PMID:20574923

  2. Carbanion reactivity, kinetic and equilibrium studies of sigma-adduct formation and elimination in the reactions of 4-nitrobenzofurazan derivatives with nitroalkane anions.


    Asghar, Basim H M; Crampton, Michael R


    1H NMR studies are reported of the reactions in [2H(6)]-DMSO of 4-nitrobenzofurazan, 2a, and its 7-chloro- and 7-methoxy-derivatives, 2b and 2c respectively, with anions derived from nitromethane, 3, nitroethane, 4, and 2-nitropropane, 5. The initial reactions result in sigma-adduct formation by carbanion attack at the 5-position of 2a-c and in the case of reaction of 2a with 5 the adduct at the 7-position is also observed. These reactions may be followed by base catalysed elimination of nitrous acid to yield anionic alkene derivatives. Kinetic and equilibrium measurements of these reactions were made spectrophotometrically in methanol. The carbon nucleophilicities of the carbanions decrease in the order 3> 4> 5, as also found in their reactions with benzhydrylium cations, and are much lower than the nucleophilicities of some cyano-substituted carbanions. Comparison with corresponding sigma-adduct forming reactions of 1,3,5-trinitrobenzene, TNB, show that here 2 and TNB have similar electrophilicity, although the value of the intrinsic rate coefficient k(o) = 0.05, for reaction of 2 is rather lower than that, k(o) = 0.20, for the TNB reactions. Literature data suggest that for reaction with a variety of nucleophiles 2 and TNB show similar electrophilicities. Measurements of the rates of elimination of nitrous acid from some 5-adducts in methanol catalysed by methoxide ions are reported. Values of rate constants may be influenced both by steric requirements at the reaction centre and by the electronic effects of the 7-substituent. PMID:17571196

  3. Cytochrome P450 system expression and DNA adduct formation in the liver of Zacco platypus following waterborne benzo(a)pyrene exposure: implications for biomarker determination.


    Lee, Jin Wuk; Kim, Yong Hwa; Yoon, Seokjoo; Lee, Sung Kyu


    Benzo(a)pyrene (BaP) is a polycyclic aromatic hydrocarbon that causes mutations and tumor formation. Zacco platypus is a sentinel species that is suitable for monitoring aquatic environments. We studied cytochrome P450 system (CYP system) expression and DNA adduct formation in the liver of Z. platypus following waterborne exposure to BaP. The results showed both dose and time dependency. The significant induction levels of CYP system mRNA and protein reached maximums at 2 days and 14 days, respectively, and hepatosomatic index was maximally induced at 4 days during 14 days BaP exposure. DNA adduct formation was significantly induced compared to corresponding controls (t-test, p < 0.01) after 4 days of exposure in 100 μg/L BaP. These results indicate that the only use of mRNA expression level of CYP system as a biomarker make us underestimate prolonged toxicity (4-14 days) of BaP and the only use of protein expression level of CYP system make us underestimate acute toxicity (1-2 days) of BaP. Therefore, we suggests that a combinational use of the mRNA expression level and protein expression level of CYP system, hepatosomatic index is a useful biomarker in risk assessment of waterborne BaP exposure. In addition, DNA adduct formation was a useful biomarker in risk assessment of waterborne BaP exposure at 4 days. CYP1A was a more sensitive biomarker than CYP reductase for BaP exposure when considering both the mRNA and protein level. Furthermore, our results show that Z. platypus is a useful species for assessing the risk of waterborne BaP exposure. PMID:23192953

  4. Metabolism of isoniazid by neutrophil myeloperoxidase leads to isoniazid-NAD(+) adduct formation: A comparison of the reactivity of isoniazid with its known human metabolites.


    Khan, Saifur R; Morgan, Andrew G M; Michail, Karim; Srivastava, Nutan; Whittal, Randy M; Aljuhani, Naif; Siraki, Arno G


    The formation of isonicotinyl-nicotinamide adenine dinucleotide (INH-NAD(+)) via the mycobacterial catalase-peroxidase enzyme, KatG, has been described as the major component of the mode of action of isoniazid (INH). However, there are numerous human peroxidases that may catalyze this reaction. The role of neutrophil myeloperoxidase (MPO) in INH-NAD(+) adduct formation has never been explored; this is important, as neutrophils are recruited at the site of tuberculosis infection (granuloma) through infected macrophages' cell death signals. In our studies, we showed that neutrophil MPO is capable of INH metabolism using electron paramagnetic resonance (EPR) spin-trapping and UV-Vis spectroscopy. MPO or activated human neutrophils (by phorbol myristate acetate) catalyzed the oxidation of INH and formed several free radical intermediates; the inclusion of superoxide dismutase revealed a carbon-centered radical which is considered to be the reactive metabolite that binds with NAD(+). Other human metabolites, including N-acetyl-INH, N-acetylhydrazine, and hydrazine did not show formation of carbon-centered radicals, and either produced no detectable free radicals, N-centered free radicals, or superoxide, respectively. A comparison of these free radical products indicated that only the carbon-centered radical from INH is reducing in nature, based on UV-Vis measurement of nitroblue tetrazolium reduction. Furthermore, only INH oxidation by MPO led to a new product (λmax=326nm) in the presence of NAD(+). This adduct was confirmed to be isonicotinyl-NAD(+) using LC-MS analysis where the intact adduct was detected (m/z=769). The findings of this study suggest that neutrophil MPO may also play a role in INH pharmacological activity. PMID:26867495

  5. DNA adduct formation in mice following dermal application of smoke condensates from cigarettes that burn or heat tobacco

    SciTech Connect

    Lee, C.K.; Brown, B.G.; Reed, E.A.; Mosberg, A.T.; Doolittle, D.J.; Hayes, A.W. ); Hejtmancik, M. )


    A prototype cigarette that heats tobacco (test cigarette), developed by R.J. Reynolds Tobacco Company, has yielded consistently negative results in several in vivo and in vitro genetic toxicology tests. The objective of the present study was to evaluate the potential of cigarette smoke condensate (CSC) from the test cigarette to induce DNA adducts in mouse tissues and compare the results with those obtained with CSC from a reference tobacco-burning cigarette (1R4F). CD-1 mice were skin-painted with CSF from reference and test cigarettes three times a week for 4 weeks. The highest mass of CSC applied was 180 mg tar per week per animal for both reference and test cigarette. DNA adducts were analyzed in skin and lung tissues using the [sup 32]P-postlabeling method with the P[sub 1] nuclease modification. Distinct diagonal radioactive zones (DRZ) were observed in the DNA from both skin and lung tissues of animals dosed with reference CSC, whereas no corresponding DRZ were observed from the DNA of animals dosed with either test CSC or acetone (solvent control). The relative adduct labeling (RAL) values of skin and lung DNA from reference CSC-treated animals were significantly greater than those of the test CSC-treated animals. The RAL values of the test CSC-treated animals were no greater than those of solvent controls. The negative results in DNA adduct assays with test CSC are consistent with all previous results of in vivo and in vitro genetic toxicology testing on this cigarette and provide additional evidence that smoke condensate from the test cigarette is not genotoxic. 31 refs., 4 figs., 2 tabs.

  6. Covalent Adduct Formation between the Antihypertensive Drug Hydralazine and Abasic Sites in Double- and Single-Stranded DNA

    PubMed Central


    Hydralazine (4) is an antihypertensive agent that displays both mutagenic and epigenetic properties. Here, gel electrophoretic, mass spectroscopic, and chemical kinetics methods were used to provide evidence that medicinally relevant concentrations of 4 rapidly form covalent adducts with abasic sites in double- and single-stranded DNA under physiological conditions. These findings raise the intriguing possibility that the genotoxic properties of this clinically used drug arise via reactions with an endogenous DNA lesion rather than with the canonical structure of DNA. PMID:25405892

  7. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P


    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  8. Competitive Deprotonation and Superoxide [O₂⁻•)] Radical-Anion Adduct Formation Reactions of Carboxamides under Negative-Ion Atmospheric-Pressure Helium-Plasma Ionization (HePI) Conditions.


    Hassan, Isra; Pinto, Spencer; Weisbecker, Carl; Attygalle, Athula B


    Carboxamides bearing an N-H functionality are known to undergo deprotonation under negative-ion-generating mass spectrometric conditions. Herein, we report that N-H bearing carboxamides with acidities lower than that of the hydroperoxyl radical (HO-O(•)) preferentially form superoxide radical-anion (O2(-•)) adducts, rather than deprotonate, when they are exposed to the glow discharge of a helium-plasma ionization source. For example, the spectra of N-alkylacetamides show peaks for superoxide radical-anion (O2(-•)) adducts. Conversely, more acidic amides, such as N-alkyltrifluoroacetamides, preferentially undergo deprotonation under similar experimental conditions. Upon collisional activation, the O2(-•) adducts of N-alkylacetamides either lose the neutral amide or the hydroperoxyl radical (HO-O(•)) to generate the superoxide radical-anion (m/z 32) or the deprotonated amide [m/z (M - H)(-)], respectively. For somewhat acidic carboxamides, the association between the two entities is weak. Thus, upon mildest collisional activation, the adduct dissociates to eject the superoxide anion. Superoxide-adduct formation results are useful for structure determination purposes because carboxamides devoid of a N-H functionality undergo neither deprotonation nor adduct formation under HePI conditions. PMID:26545766

  9. Competitive Deprotonation and Superoxide [O2 -•] Radical-Anion Adduct Formation Reactions of Carboxamides under Negative-Ion Atmospheric-Pressure Helium-Plasma Ionization (HePI) Conditions

    NASA Astrophysics Data System (ADS)

    Hassan, Isra; Pinto, Spencer; Weisbecker, Carl; Attygalle, Athula B.


    Carboxamides bearing an N-H functionality are known to undergo deprotonation under negative-ion-generating mass spectrometric conditions. Herein, we report that N-H bearing carboxamides with acidities lower than that of the hydroperoxyl radical (HO-O•) preferentially form superoxide radical-anion (O2 -•) adducts, rather than deprotonate, when they are exposed to the glow discharge of a helium-plasma ionization source. For example, the spectra of N-alkylacetamides show peaks for superoxide radical-anion (O2 -•) adducts. Conversely, more acidic amides, such as N-alkyltrifluoroacetamides, preferentially undergo deprotonation under similar experimental conditions. Upon collisional activation, the O2 -• adducts of N-alkylacetamides either lose the neutral amide or the hydroperoxyl radical (HO-O•) to generate the superoxide radical-anion ( m/z 32) or the deprotonated amide [ m/z (M - H)-], respectively. For somewhat acidic carboxamides, the association between the two entities is weak. Thus, upon mildest collisional activation, the adduct dissociates to eject the superoxide anion. Superoxide-adduct formation results are useful for structure determination purposes because carboxamides devoid of a N-H functionality undergo neither deprotonation nor adduct formation under HePI conditions.

  10. Isolevuglandin Adducts in Disease

    PubMed Central

    Bi, Wenzhao


    Abstract Significance: A diverse family of lipid-derived levulinaldehydes, isolevuglandins (isoLGs), is produced by rearrangement of endoperoxide intermediates generated through both cyclooxygenase (COX) and free radical-induced cyclooxygenation of polyunsaturated fatty acids and their phospholipid esters. The formation and reactions of isoLGs with other biomolecules has been linked to alcoholic liver disease, Alzheimer's disease, age-related macular degeneration, atherosclerosis, cardiac arythmias, cancer, end-stage renal disease, glaucoma, inflammation of allergies and infection, mitochondrial dysfunction, multiple sclerosis, and thrombosis. This review chronicles progress in understanding the chemistry of isoLGs, detecting their production in vivo and understanding their biological consequences. Critical Issues: IsoLGs have never been isolated from biological sources, because they form adducts with primary amino groups of other biomolecules within seconds. Chemical synthesis enabled investigation of isoLG chemistry and detection of isoLG adducts present in vivo. Recent Advances: The first peptide mapping and sequencing of an isoLG-modified protein present in human retina identified the modification of a specific lysyl residue of the sterol C27-hydroxylase Cyp27A1. This residue is preferentially modified by iso[4]LGE2 in vitro, causing loss of function. Adduction of less than one equivalent of isoLG can induce COX-associated oligomerization of the amyloid peptide Aβ1-42. Adduction of isoLGE2 to phosphatidylethanolamines causes gain of function, converting them into proinflammatory isoLGE2-PE agonists that foster monocyte adhesion to endothelial cells. Future Directions: Among the remaining questions on the biochemistry of isoLGs are the dependence of biological activity on isoLG isomer structure, the structures and mechanism of isoLG-derived protein–protein and DNA–protein cross-link formation, and its biological consequences. Antioxid. Redox Signal. 22

  11. Formation of S-Cl phosphorothioate adduct radicals in dsDNA-S-oligomers: Hole transfer to guanine vs. disulfide anion radical formation

    PubMed Central

    Adhikary, Amitava; Kumar, Anil; Palmer, Brian J.; Todd, Andrew D.; Sevilla, Michael D.


    In phosphorothioate containing dsDNA-oligomers (S-oligomers), one of the two non-bridging oxygen atoms in the phosphate moiety of sugar-phosphate backbone is replaced by sulphur. In this work, electron spin resonance (ESR) studies of one-electron oxidation of several S-oligos by Cl2•− at low temperatures are investigated. Electrophilic addition of Cl2•− to phosphorothioate with elimination of Cl− leads to the formation of a 2-center three-electron σ2σ*1 bonded adduct radical (-P-S∸Cl). In AT S-oligomers with mutiple phosphorothioates, i.e., d[ATATAsTsAsT]2, -P-S∸Cl reacts with a neighboring phosphorothioate to form the σ2σ*1 bonded disulphide anion radical ([-P-S∸S-P-]−). With AT S-oligomers with a single phosphorothioate, i.e., d[ATTTAsAAT]2, reduced levels of conversion of -P-S∸Cl dsDNA [-P-S∸S-P-]− are found. For guanine containing S-oligomers containing one phosphorothioate, -P-S∸Cl results in one-electron oxidation of guanine base but not of A, C, or T thereby leading to selective hole transfer to G. The redox potential of -P-S∸Cl is thus higher than that of G but is lower than those of A, C, and T. Spectral assignments to -P-S∸Cl and [-P-S∸S-P-]− are based on reaction of Cl2•− with the model compound diisopropyl phosphorothioate. The results found for d[TGCGsCsGCGCA]2 suggest that [-P-S∸S-P-]− undergoes electron transfer to the one-electron oxidized G healing the base but producing a cyclic disulfide bonded backbone with a substantial bond strength (50 kcal/mol). Formation of -P-S∸Cl and its conversion to [-P-S∸S-P-]− is found to be unaffected by O2 and this is supported by the theoretically calculated electron affinities and reduction potentials of [-P-S-S-P-] and O2. PMID:23885974


    EPA Science Inventory

    We have studied adduct formation of the antineoplastic agent diaziquone with DNA and nucleotides in vitro. he aziridine moieties of AZQ can be expected to interact covalently with DNA which in turn presumably elicit the antitumor activity. e analyzed AZQ-DNA adducts by a modified...

  13. Formation of DNA adducts in wild-type and transgenic mice expressing human sulfotransferases 1A1 and 1A2 after oral exposure to furfuryl alcohol

    PubMed Central

    Høie, Anja Hortemo; Monien, Bernhard Hans; Sakhi, Amrit Kaur; Glatt, Hansruedi; Hjertholm, Hege; Husøy, Trine


    Furfuryl alcohol (FFA) is present in many heat-treated foods as a result of its formation via dehydration of pentoses. It is also used legally as a flavouring agent. In an inhalation study conducted in the National Toxicology Program, FFA showed some evidence of carcinogenic activity in rats and mice. FFA was generally negative in conventional genotoxicity assays, which suggests that it may be a non-genotoxic carcinogen. However, it was recently found that FFA is mutagenic in Salmonella strains expressing appropriate sulfotransferases (SULTs), such as human or mouse SULT1A1. The same DNA adducts that were formed by FFA in these strains, mainly N 2-((furan-2-yl)methyl)-2′-deoxyguanosine (N 2-MF-dG), were also detected in tissues of FFA-exposed mice and even in human lung specimens. In the present study, a single oral dose of FFA (250mg/kg body weight) or saline was administered to FVB/N mice and transgenic mice expressing human SULT1A1/1A2 on the FVB/N background. The transgenic mice were used, since human and mouse SULT1A1 substantially differ in substrate specificity and tissue distribution. DNA adducts were studied in liver, kidney, proximal and distal small intestine as well as colon, using isotope-dilution ultra performance liquid chromatography (UPLC–MS/MS). Surprisingly, low levels of adducts that may represent N 2-MF-dG were detected even in tissues of untreated mice. FFA exposure enhanced the adduct levels in colon and liver, but not in the remaining investigated tissues of wild-type (wt) mice. The situation was similar in transgenic mice, except that N 2-MF-dG levels were also strongly enhanced in the proximal small intestine. These different results between wt and transgenic mice may be attributed to the fact that human SULT1A1, but not the orthologous mouse enzyme, is strongly expressed in the small intestine. PMID:25904584

  14. Formation of Metal-Adducted Analyte Ions by Flame-Induced Atmospheric Pressure Chemical Ionization Mass Spectrometry.


    Cheng, Sy-Chyi; Wang, Chin-Hsiung; Shiea, Jentaie


    A flame-induced atmospheric pressure chemical ionization (FAPCI) source, consisting of a miniflame, nebulizer, and heated tube, was developed to ionize analytes. The ionization was performed by reacting analytes with a charged species generated in a flame. A stainless steel needle deposited with saturated alkali chloride solution was introduced into the mini oxyacetylene flame to generate alkali ions, which were reacted with analytes (M) generated in a heated nebulizer. The alkali-adducted 18-crown-6 ether ions, including (M + Li)(+), (M + Na)(+), (M + K)(+), (M + Rb)(+), and (M + Cs)(+), were successfully detected on the FAPCI mass spectra when the corresponding alkali chloride solutions were separately introduced to the flame. When an alkali chloride mixture was introduced, all alkali-adducted analyte ions were simultaneously detected. Their intensity order was as follows: (M + Cs)(+) > (M + Rb)(+) > (M + K)(+) > (M + Na)(+) > (M + Li)(+), and this trend agreed with the lattice energies of alkali chlorides. Besides alkali ions, other transition metal ions such as Ni(+), Cu(+), and Ag(+) were generated in a flame for analyte ionization. Other than metal ions, the reactive species generated in the fossil fuel flame could also be used to ionize analytes, which formed protonated analyte ions (M + H)(+) in positive ion mode and deprotonated analyte ions (M - H)(-) in negative ion mode. PMID:27093572

  15. Formation and collision-induced dissociation of adduct ions [matrix + C]+ (C = Li, Na, Cs and NH4) produced under fast atom bombardment conditions

    NASA Astrophysics Data System (ADS)

    Takayama, Mitsuo


    The formation of adduct ions of matrices B with organic/metallic cations C+, [B + C]+ (C = Li, Na, Cs and NH4), under fast atom bombardment (FAB) conditions has been examined. The cation affinity (CA) for various matrix materials, glycerol, thioglycerol, dithiothreitol, m-nitrobenzylalcohol and diethanolamine, was evaluated from the positive-ion FAB mass spectra obtained for the salts LiCl, NaCl, CsCl or NH4Cl added to matrix B. The order of the CA of matrices for relatively small cations Li+ and Na+ was in accordance with that of the proton affinity (PA) of the matrices used. The collision-induced dissociation (CID) spectra of [B + H]+ and [B + C]+ ions have been obtained. The PA differences between matrix B and ammonia (NH3) molecules were roughly estimated from the CID spectra of [B + NH4]+ ions. The CID spectra of [B + C]+ ions, which have different dissociation windows from [B + H]+ ions, were analyzed by proposing multidentate-binding structures of the adduct ions. Some dissociations of [B + C]+ ions could be explained by charge-remote fragmentations. The results obtained suggest that the binding energy for the coordination complex (B...C+) can be evaluated from the CID patterns.

  16. Carcinogenicity and DNA adduct formation of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone and enantiomers of its metabolite 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol in F-344 rats.


    Balbo, Silvia; Johnson, Charles S; Kovi, Ramesh C; James-Yi, Sandra A; O'Sullivan, M Gerard; Wang, Mingyao; Le, Chap T; Khariwala, Samir S; Upadhyaya, Pramod; Hecht, Stephen S


    4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is metabolized to enantiomers of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL), found in the urine of virtually all people exposed to tobacco products. We assessed the carcinogenicity in male F-344 rats of (R)-NNAL (5 ppm in drinking water), (S)-NNAL (5 ppm), NNK (5 ppm) and racemic NNAL (10 ppm) and analyzed DNA adduct formation in lung and pancreas of these rats after 10, 30, 50 and 70 weeks of treatment. All test compounds induced a high incidence of lung tumors, both adenomas and carcinomas. NNK and racemic NNAL were most potent; (R)-NNAL and (S)-NNAL had equivalent activity. Metastasis was observed from primary pulmonary carcinomas to the pancreas, particularly in the racemic NNAL group. DNA adducts analyzed were O (2)-[4-(3-pyridyl)-4-oxobut-1-yl]thymidine (O (2)-POB-dThd), 7-[4-(3-pyridyl)-4-oxobut-1-yl]guanine(7-POB-Gua),O (6)-[4-(3-pyridyl)-4-oxobut-1-yl]deoxyguanosine(O (6)-POB-dGuo),the 4-(3-pyridyl)-4-hydroxybut-1-yl(PHB)adductsO (2)-PHB-dThd and 7-PHB-Gua, O (6)-methylguanine (O (6)-Me-Gua) and 4-hydroxy-1-(3-pyridyl)-1-butanone (HPB)-releasing adducts. Adduct levels significantly decreased with time in the lungs of rats treated with NNK. Pulmonary POB-DNA adducts and O (6)-Me-Gua were similar in rats treated with NNK and (S)-NNAL; both were significantly greater than in the (R)-NNAL rats. In contrast, pulmonary PHB-DNA adduct levels were greatest in the rats treated with (R)-NNAL. Total pulmonary DNA adduct levels were similar in (S)-NNAL and (R)-NNAL rats. Similar trends were observed for DNA adducts in the pancreas, but adduct levels were significantly lower than in the lung. The results of this study clearly demonstrate the potent pulmonary carcinogenicity of both enantiomers of NNAL in rats and provide important new information regarding DNA damage by these compounds in lung and pancreas. PMID:25269804

  17. 3,2'-Dimethyl-4-aminobiphenyl-DNA adduct formation in tumor target and nontarget organs of rapid and slow acetylator Syrian hamsters cogenic at the NAT2 locus.


    Feng, Y; Jiang, W; Deitz, A C; Hein, D W


    DNA adduct formation is an important step in initiation of the carcinogenic process. 3,2'-Dimethyl-4-aminobiphenyl (DMABP) is a well-documented multiorgan carcinogenic aromatic amine in rodents. In the present study, DMABP-DNA adduct levels were measured in rapid (Bio. 82.73/H-Pat(r)) and slow (Bio. 82.73/H-Pat(s)) acetylator Syrian hamsters congenic at the NAT2 locus following a single injection of 33 or 100 mg/kg body wt DMABP. Two DNA adducts, N-(deoxyguanosin-8-yl)-DMABP and 5-(deoxyguanosin-N2-yl)-DMABP, were identified and quantitated by 32P-postlabeling assay. After injection of 33 mg/kg, DMABP-DNA adducts were detected in urinary bladder at 6, 18, 24, and 48 hr with adduct levels increasing up to 48 hr postinjection. DMABP-DNA adducts were not detected in liver, colon, and heart. After injection of 100 mg/kg, DMABP-DNA adducts were detected in urinary bladder, liver, prostate, colon, and heart at 48 hr postinjection. DMABP-DNA adduct levels were significantly higher in urinary bladder (primary tumor target organ) than in the other organs of both rapid and slow acetylator congenic hamsters. N-(deoxyguanosin-8-yl)-DMABP levels were significantly higher in liver and prostate than in colon and heart of rapid and slow acetylator congenic hamsters, whereas 5-(deoxyguanosin-N2-yl)-DMABP levels were significantly higher in prostate than in colon and heart of rapid and slow acetylator congenic hamsters. DMABP-DNA adduct levels in each tissue examined did not differ significantly between rapid and slow acetylator hamsters following either 33 or 100 mg/kg injection. The tissue-dependent differences in DMABP-DNA adduct levels observed in the Syrian hamster differ from those reported in the rat and are consistent with previous studies that show DMABP induces primarily urinary bladder tumors in the Syrian hamster. PMID:8887447

  18. Multidrug resistance protein (MRP) 4 attenuates benzo[a]pyrene-mediated DNA-adduct formation in human bronchoalveolar H358 cells.


    Gelhaus, Stacy L; Gilad, Oren; Hwang, Wei-Ting; Penning, Trevor M; Blair, Ian A


    Multi-drug resistance protein (MRP) 4, an ATP-binding cassette (ABC) transporter, has broad substrate specificity. It facilitates the transport of bile salt conjugates, conjugated steroids, nucleoside analogs, eicosanoids, and cardiovascular drugs. Recent studies in liver carcinoma cells and hepatocytes showed that MRP4 expression is regulated by the aryl hydrocarbon receptor (AhR) and nuclear factor E2-related factor 2 (Nrf2). The AhR has particular importance in the lung and is most commonly associated with the up-regulation of cytochrome P-450 (CYP)-mediated metabolism of benzo[a]pyrene (B[a]P) to reactive intermediates. Treatment of H358, human bronchoalveolar, cells with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or (-)-benzo[a]pyrene-7,8-dihydro-7,8-diol (B[a]P-7,8-dihydrodiol), the proximate carcinogen of B[a]P, revealed that MRP4 expression was increased compared to control. This suggested that MRP4 expression might contribute to the paradoxical decrease in (+)-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene-2'-deoxyguanosine ((+)-anti-trans-B[a]PDE-dGuo) DNA-adducts observed in TCDD-treated H358 cells. We have now found that decreased MRP4 expression induced by a short hairpin RNA (shRNA), or chemical inhibition with probenecid, increased (+)-anti-trans-B[a]PDE-dGuo formation in cells treated with (-)-B[a]P-7,8-dihydrodiol, but not the ultimate carcinogen (+)-anti-trans-B[a]PDE. Thus, up-regulation of MRP4 increased cellular efflux of (-)-B[a]P-7,8-dihydrodiol, which attenuated DNA-adduct formation. This is the first report identifying a specific MRP efflux transporter that decreases DNA damage arising from an environmental carcinogen. PMID:22155354


    EPA Science Inventory

    The K -region dihydrodiol ofbenzo[ a ]pyrene induces DNA damage and morphological cell transformation in C3HlOTY2CL8 mouse embryo cells without the formation of detectable stable covalent DNA adducts

    Benzo[ a ]pyrene (B[ a ]P) is the most thoroughly studied polycyclic aro...

  20. DNA adducts in biomonitoring.


    Hemminki, K


    The types of occupational groups studied by postlabelling include foundry, coke oven and aluminium workers, roofers, garage and terminal workers, car mechanics and chimney sweeps. There does not seem to be a direct relationship between the exposure and adduct levels. However, the postlabelling assay is sensitive enough to show adducts in apparently unexposed individuals. The origin of such adducts is unknown; in the case of aromatic adducts, the origin is likely to be environmental and/or dietary. PMID:7618142

  1. On-line cation exchange for suppression of adduct formation in negative-ion electrospray mass spectrometry of nucleic acids.


    Huber, C G; Buchmeiser, M R


    One major difficulty in the analysis of nucleic acids by electrospray mass spectrometry is represented by the affinity of the polyanionic sugar-phosphate backbone for nonvolatile cations, especially ubiquitous sodium and potassium ions. A simple on-line sample preparation system comprising a microflow pumping system and 45 x 0.8-mm-i.d. microcolumns packed with weak or strong cation-exchange resins is described for the efficient removal of cations from nucleic acid samples. Samples were analyzed by flow injection analysis at a 3-5 microL/min flow of 10 mM triethylamine in 50% water-50% acetonitrile. After on-line desalting, mass spectra of oligonucleotides revealed no significant sodium adduct peaks. Moreover, signal-to-noise ratios were greatly enhanced compared to direct injection of the samples. Electrospray mass spectrometry with on-line sample preparation allowed accurate molecular mass determinations of picomole amounts of crude oligonucleotide preparations ranging in size from 8 to 80 nucleotides within a few minutes. The good linearity of the calibration plot (R2 = 0.9988) over at least 2 orders of magnitude and a relative standard deviation in peak areas of less than 9% permitted the sensitive quantitative measurement of oligonucleotides in a concentration range of 0.2-20 microM with selected-ion monitoring. Finally, the on-line sample preparation system was evaluated for the mass spectrometric analysis of complex oligonucleotide mixtures. PMID:9868919

  2. Food borne bacterial models for detection of benzo[a]pyrene-DNA adducts formation using RAPD-PCR.


    Lanzone, Valentina; Tofalo, Rosanna; Fasoli, Giuseppe; Perpetuini, Giorgia; Suzzi, Giovanna; Sergi, Manuel; Corrado, Federica; Compagnone, Dario


    Random amplified polymorphic DNA (RAPD) PCR is a feasible method to evaluate genotoxin-induced DNA damage and mutations. In this study, Lactobacillus plantarum ATCC 14917T, Enterococcus faecium DSMZ 20477T, Escherichia coli PQ37 and Saccharomyces cerevisiae S441 were screened for DNA genetic alterations by DNA fingerprinting using M13 and LA1 primers after treatment with three compounds forming covalent adducts with DNA [benzo[a]pyrenediol epoxide (BPDE), methyl methanesulfonate and 1,2,3,4-diepoxybutane (DEB)]. M13 RAPD fingerprinting revealed that the total number of bands decreased in all treated DNA compared to control samples and generally the lost bands were characterized by high molecular weight. Some extra bands were detected for L. plantarum and E. faecium, while in E. coli and S. cerevisiae DNAs BPDE and DEB treatments did not result in new extra bands. Besides qualitatively analysis, cluster analysis based on Unweighted Pair-Group Method with Average algorithm was performed to compare DNA fingerprints before and after treatments. This analysis confirmed the absence of significant differences between negative controls and treated DNA in S. cerevisiae and E. coli however the disappearance of some bands can be detected. The data indicate that this approach can be used for DNA damage detection and mutations induced by genotoxic compounds and highlighted the possible use of L. plantarum and E. faecium M13 based fingerprinting as reference for hazard identification in risk assessment. PMID:26991971

  3. Measurement artifacts identified in the UV-vis spectroscopic study of adduct formation within the context of molecular imprinting of naproxen.


    Perez, Martin; Concu, Riccardo; Ornelas, Mariana; Cordeiro, M Natália D S; Azenha, Manuel; Silva, A Fernando


    The ultraviolet-visible spectroscopy has been assessed as a technique for the evaluation of the strength of template-precursor adduct in the development of molecular imprints of the non-steroidal anti-inflammatory drug naproxen (NAP). The commonly employed approach relies on the collection of UV spectra of drug+precursor mixtures at different proportions, the spectra being recorded against blanks containing the same concentration of the precursor. The observation of either blue or red band-shifts and abatement of a major band are routinely attributed to template-precursor adduct formation. Following the described methodology, the precursors 1-(triethoxysilylpropyl)-3-(trimethoxysilylpropyl)-4,5-dihydroimidazolium iodide (AO-DHI(+)) and 4-(2-(trimethoxysilyl)ethyl)pyridine (PETMOS) provoked a blue-shift and band abatement effect on the NAP spectrum. Molecular dynamics simulations indicated a reasonable affinity between NAP and these precursors (coordination numbers 0.33 for AO-DHI(+) and 0.18 for PETMOS), hence showing that NAP-precursor complexation is in fact effective. However, time dependent density functional theory (TD-DFT) calculations of the spectra of both free and precursor-complexed NAP were identical, thus providing no theoretical basis for the complexation-induced effects observed. We realized that the intense spectral bands of AO-DHI(+) and PETMOS (at around 265 nm) superimpose partially with the NAP bands, and the apparent "blue-shifting" in the NAP spectra when mixed with AO-DHI+ and PETMOS was in this case a spurious effect of the intense background subtraction. Therefore, extreme care must be taken when interpreting other spectroscopic results obtained in a similar fashion. PMID:26458249

  4. Measurement artifacts identified in the UV-vis spectroscopic study of adduct formation within the context of molecular imprinting of naproxen

    NASA Astrophysics Data System (ADS)

    Perez, Martin; Concu, Riccardo; Ornelas, Mariana; Cordeiro, M. Natália D. S.; Azenha, Manuel; Fernando Silva, A.


    The ultraviolet-visible spectroscopy has been assessed as a technique for the evaluation of the strength of template-precursor adduct in the development of molecular imprints of the non-steroidal anti-inflammatory drug naproxen (NAP). The commonly employed approach relies on the collection of UV spectra of drug + precursor mixtures at different proportions, the spectra being recorded against blanks containing the same concentration of the precursor. The observation of either blue or red band-shifts and abatement of a major band are routinely attributed to template-precursor adduct formation. Following the described methodology, the precursors 1-(triethoxysilylpropyl)-3-(trimethoxysilylpropyl)-4,5-dihydroimidazolium iodide (AO-DHI+) and 4-(2-(trimethoxysilyl)ethyl)pyridine (PETMOS) provoked a blue-shift and band abatement effect on the NAP spectrum. Molecular dynamics simulations indicated a reasonable affinity between NAP and these precursors (coordination numbers 0.33 for AO-DHI+ and 0.18 for PETMOS), hence showing that NAP-precursor complexation is in fact effective. However, time dependent density functional theory (TD-DFT) calculations of the spectra of both free and precursor-complexed NAP were identical, thus providing no theoretical basis for the complexation-induced effects observed. We realized that the intense spectral bands of AO-DHI+ and PETMOS (at around 265 nm) superimpose partially with the NAP bands, and the apparent "blue-shifting" in the NAP spectra when mixed with AO-DHI + and PETMOS was in this case a spurious effect of the intense background subtraction. Therefore, extreme care must be taken when interpreting other spectroscopic results obtained in a similar fashion.

  5. Flight restriction prevents associative learning deficits but not changes in brain protein-adduct formation during honeybee ageing.


    Tolfsen, Christina C; Baker, Nicholas; Kreibich, Claus; Amdam, Gro V


    Honeybees (Apis mellifera) senesce within 2 weeks after they discontinue nest tasks in favour of foraging. Foraging involves metabolically demanding flight, which in houseflies (Musca domestica) and fruit flies (Drosophila melanogaster) is associated with markers of ageing such as increased mortality and accumulation of oxidative damage. The role of flight in honeybee ageing is incompletely understood. We assessed relationships between honeybee flight activity and ageing by simulating rain that confined foragers to their colonies most of the day. After 15 days on average, flight-restricted foragers were compared with bees with normal (free) flight: one group that foraged for ∼15 days and two additional control groups, for flight duration and chronological age, that foraged for ∼5 days. Free flight over 15 days on average resulted in impaired associative learning ability. In contrast, flight-restricted foragers did as well in learning as bees that foraged for 5 days on average. This negative effect of flight activity was not influenced by chronological age or gustatory responsiveness, a measure of the bees' motivation to learn. Contrasting their intact learning ability, flight-restricted bees accrued the most oxidative brain damage as indicated by malondialdehyde protein adduct levels in crude cytosolic fractions. Concentrations of mono- and poly-ubiquitinated brain proteins were equal between the groups, whereas differences in total protein amounts suggested changes in brain protein metabolism connected to forager age, but not flight. We propose that intense flight is causal to brain deficits in aged bees, and that oxidative protein damage is unlikely to be the underlying mechanism. PMID:21430210

  6. Kinetics and Thermochemistry of Reversible Adduct Formation in the Reaction of Cl((sup 2)P(sub J)) with CS2

    NASA Technical Reports Server (NTRS)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.


    Reversible adduct formation in the reaction of Cl((sup 2)P(sub J)) with CS2 has been observed over the temperature range 193-258 K by use of time-resolved resonance fluorescence spectroscopy to follow the decay of pulsed-laser-generated Cl((sup 2)P(sub J)) into equilbrium with CS2Cl. Rate coefficients for CS2Cl formation and decomposition have been determined as a function of temperature and pressure; hence, the equilbrium constant has been determined as a function of temperature. A second-law analysis of the temperature dependence of Kp and heat capacity corrections calculated with use of an assumed CS2Cl structure yields the following thermodynamic parameters for the association reaction: Delta-H(sub 298) = -10.5 +/- 0.5 kcal/mol, Delta-H(sub 0) = -9.5 +/- 0.7 kcal/mol, Delta-S(sub 298) = -26.8 +/- 2.4 cal/mol.deg., and Delta-H(sub f,298)(CS2Cl) = 46.4 +/- 0.6 kcal/mol. The resonance fluorescence detection scheme has been adapted to allow detection of Cl((sup 2)P(sub J)) in the presence of large concentrations of O2, thus allowing the CS2Cl + Cl + O2 reaction to be investigated. We find that the rate coefficient for CS2Cl + O2 reaction via all channels that do not generate Cl((sup 2)P(sub J)) is less than 2.5 x 10(exp-16) cu cm/(molecule.s) at 293 K and 300-Torr total pressure and that the total rate coefficient is less than 2 x 10 (exp -15) cu cm/(molecule.s) at 230 K and 30-Torr total pressure. Evidence for reversible adduct formation in the reaction of Cl((sup 2)P(sub J)) with COS was sought but not observed, even at temperatures as low as 194 K.

  7. Influence of selenium, age and dosage of 7,12-dimethylbenz(a)anthracene (DMBA) on the in vivo formation of DNA adducts in mammary tissue

    SciTech Connect

    Jinzhou Liu; Milner, J.A. )


    Diets formulated to contain selenium, as sodium selenite, 0.1 or 2 {mu}g/g were fed for 2 weeks prior to DMBA treatment. Food intake and weight gain were not influenced by Se intake. Anti- and syn-dihydrodiol epoxide adducts reached maximum binding by 24 h. Se supplementation inhibited by about 50% the appearance of both anti-and syn- DMBA-DNA adducts. Dietary selenium increased the rate of removal of the anti-dihydrodiol epoxide adduct bound to guanine, but delayed the removal of the other adducts. The occurrence of DMBA-DNA adducts correlated positively with the dosage of DMBA administered. Binding increased about 40% as the rat's age increased from 36 to 125 d. Se supplementation inhibited binding in 36, 54 and 125 d old rats. These data confirmed that dietary selenium is effective in inhibiting in vivo metabolism of DMBA.

  8. Influence of the uvr-dependent nucleotide excision repair on DNA adducts formation and mutagenic spectrum of a potent genotoxic agent: 7-methoxy-2-nitronaphtho[2,1-b]furan (R7000).


    Quillardet, P; Touati, E; Hofnung, M


    The influence of the uvr-dependent excision repair system on the lethal action, mutagenic specificity, SOS induction and DNA adducts formation of 7-methoxy-2-nitronaphtho[2,1-b]furan (R7000), a potent genotoxic nitrofuran, were examined in Escherichia coli. Binding measurements of 3H-labelled R7000 to DNA indicated that R7000-DNA adducts can be removed by excision repair soon after the action of the chemical: 50% of the DNA adducts were removed within 10 min of treatment. After 1 h of incubation the level of excision reached 70%. This result was confirmed using the postlabelling technique. We found that R7000 yielded at least 10 different DNA adducts. Each of the adducts detected could be removed by excision repair. The rates of excision appeared different from one to the other. In addition, using a lacZ reversion system that is able to detect each type of base substitution mutations [1], we found that in uvrA bacteria deficient in excision repair, R7000 can induce 5 out of the 6 possible mutational events: GC-->TA, AT-->TA, GC-->CG, AT-->CG and GC-->AT. The transition AT-->GC was not observed. Only 3 transversions: GC-->TA, AT-->TA and GC-->CG could be detected in repair proficient uvr+ bacteria. The differences between the mutagenic spectra obtained in either uvr+ bacteria or uvrA mutants indicate that some potentially mutagenic DNA adducts induced by R7000 can be removed by excision repair, thus lowering the mutagenic potency of the chemical and modifying the mutagenic spectrum detected. PMID:8921981

  9. Modulation of 3-methylcholanthrene toxicity in cultured neoplastic keratinocytes by glucocorticoids and retinoids is not accounted for by macromolecular adduct formation

    SciTech Connect

    Rubin, A.L.; Rice, R.H. )


    3-Methylcholanthrene (3-MC) greatly inhibits the growth of two lines of human squamous carcinoma cells, SCC-9 and SCC-12B{sub 2}. The degree of 3-MC-mediated inhibition, however, was markedly alleviated by inclusion of retinoic acid and hydrocortisone or dexamethasone in the culture medium. These physiological effectors, which are known to have opposing actions on keratinocyte character in SCC cells, did not significantly alter either aryl hydrocarbon hydroxylase activity or macromolecular adduct formation. Further analysis of the cellular responses indicated that hydrocortisone and, in some experiments, retinoids increased the growth rate in 3-MC-exposed cultures, while 3-MC increased the saturation density in retinoic acid-exposed cultures, an example of interference with a physiological response of the cells. These results indicate that alteration of the differentiated state, regardless of the direction of the change, can alter the sensitivity of these cells to toxic stimuli. Further investigation of the bases of such toxic responses and their modulation by the microenvironment may enhance our understanding of the target cell specificity of polycyclic aromatic hydrocarbons.

  10. 32P-postlabelling methods for cyclic DNA adducts.


    Watson, W P; Crane, A E; Steiner, S


    32P-Postlabelling procedures coupled with HPLC have been developed to detect and measure a range of cyclic DNA adducts formed by bifunctional genotoxic agents. The methods are based on reverse-phase HPLC, particularly column-switching HPLC, to enrich adduct 3'-monophosphates before labelling. Following 3'-dephosphorylation of the 3'5'-[5'-32P]bisphosphates with nuclease P1, the resulting 5'-[32P]monophosphate adducts are resolved, identified and characterized by co-chromatography with synthetic reference standards. The procedures have been applied to a number of cyclic adducts including those formed by chloroacetaldehyde, glycidaldehyde and malonaldehyde. In general, labelling efficiencies measured as chromatographed 5'-[32P]monophosphates were in the range 30-40%. However, the values for the malonaldehyde deoxyguanosine adduct were much lower. The techniques have been applied to studies on the formation of DNA adducts in the skin of male C3H mice treated cutaneously with glycidaldehyde. The HPLC-32P-postlabelling analysis of epidermal DNA hydrolysates indicated that a single major cyclic adduct was formed by reaction with deoxyadenosine residues in mouse skin DNA. The adduct was identified as a hydroxymethyl ethenodeoxyadenosine adduct by comparison with a synthetic standard. This adduct was highly fluorescent and it was possible to make quantitative comparisons of the amounts of adduct determined by either HPLC-32P-postlabelling or HPLC-fluorescence detection. PMID:8225493

  11. Human DNA adduct measurements: state of the art.

    PubMed Central

    Poirier, M C; Weston, A


    Human DNA adduct formation (covalent modification of DNA with chemical carcinogens) is a promising biomarker for elucidating the molecular epidemiology of cancer. Classes of compounds for which human DNA adducts have been observed include polycyclic aromatic hydrocarbons (PAHs), nitrosamines, mycotoxins, aromatic amines, heterocyclic amines, ultraviolet light, and alkylating cancer chemotherapeutic agents. Most human DNA adduct exposure monitoring has been performed with either 32P-postlabeling or immunoassays, neither of which is able to chemically characterize specific DNA adducts. Recently developed combinations of methods with chemical and physical end points have allowed identification of specific adducts in human tissues. Studies are presented that demonstrate that high ambient levels of benzo[a]pyrene are associated with high levels of DNA adducts in human blood cell DNA and that the same DNA adduct levels drop when the ambient PAH levels decrease significantly. DNA adduct dosimetry, which has been achieved with some dietary carcinogens and cancer chemotherapeutic agents, is described, as well as studies correlating DNA adducts with other biomarkers. It is likely that some toxic, noncarcinogenic compounds may have genotoxic effects, including oxidative damage, and that adverse health outcomes other than cancer may be correlated with DNA adduct formation. The studies presented here may serve as useful prototypes for exploration of other toxicological end points. PMID:8933030

  12. Covalent adduction of nitrogen mustards to model protein nucleophiles.


    Thompson, Vanessa R; DeCaprio, Anthony P


    Protein adducts have the potential to serve as unique biomarkers of exposure to compounds of interest. Many xenobiotics (or their metabolites) are electrophilic and therefore reactive with nucleophilic amino acid residues on proteins. Nitrogen mustards are reactive xenobiotics with potential use as chemical warfare agents (CWA) or agents of terrorist attack, in addition to being employed as chemotherapeutic agents. The present study utilized cysteine-, lysine-, and histidine-containing model peptides to characterize in vitro adduction of the nitrogen mustards mechloroethamine (HN-2) and tris-(2-chlorethyl)amine (HN-3) to these nucleophilic amino acid residues by means of liquid chromatography-tandem mass spectrometry. The study assessed the structure of adducts formed, the time course of adduct formation, concentration-response relationships, and temporal stability of adducts. Adduction was hypothesized to occur on all three model peptides via initial formation of a reactive aziridinium intermediate for both mechloroethamine and tris-(2-chlorethyl)amine, followed by covalent adduction to nucleophilic residues. While adduction was found to occur most readily with cysteine, it was also observed at lysine and histidine, demonstrating that adduction by mechloroethamine and tris-(2-chlorethyl)amine is possible at multiple nucleophilic sites. Following solid phase extraction cleanup, adducts formed with mechloroethamine were stable for up to three weeks. Adducts formed with tris-(2-chlorethyl)amine were less stable; however, hydrolyzed secondary adducts were observed throughout the three week period. This study demonstrates that the nitrogen mustards mechloroethamine and tris-(2-chlorethyl)amine form stable adducts with reactive protein nucleophiles other than cysteine. PMID:23859065

  13. Investigating the adduct formation of organic mercury species with carbonic anhydrase and hemoglobin from human red blood cell hemolysate by means of LC/ESI-TOF-MS and LC/ICP-MS.


    Hogeback, Jens; Schwarzer, Miriam; Wehe, Christoph A; Sperling, Michael; Karst, Uwe


    The interaction of mercury species with human erythrocytes is studied to investigate possible high molecular binding partners for mercury species. Human blood hemolysate was spiked with methylmercury and investigated by means of liquid chromatography (LC) coupled to electrospray ionization time of flight mass spectrometry (ESI-ToF-MS) and inductively coupled plasma mass spectrometry (ICP-MS). Beside adduct formation of mercury species with hemoglobin, the main compound of the erythrocytes, mercury binding to the enzyme carbonic anhydrase was revealed. Due to an enzymatic digest of the protein-mercury adduct, the binding site at the free thiol group of the protein was identified. These results indicate that carbonic anhydrase might play a role in mercury toxicity. PMID:26442983

  14. Regio- and stereochemically controlled formation of hydroxamic acids from indium triflate-mediated nucleophilic ring-opening reactions with acylnitroso-Diels–Alder adducts

    PubMed Central

    Yang, Baiyuan; Miller, Marvin J.


    Treatment of acylnitroso-Diels–Alder [2.2.1] bicyclic adducts 2a–b with indium triflate in an alcohol solvent induces ring opening reactions to afford monocyclic anti-1,2-, anti-1,4- and syn-1,4-hydroxamic acids with good to excellent regio- and stereoselectivity (up to 7:86:7). Treatment of [2.2.2] bicyclic nitroso adducts 2c–d under similar reaction conditions generates only anti-1,2- and anti-1,4-hydroxamic acids with anti-1,4-product predominant (up to 17:83). PMID:20209116

  15. Stereospecific Formation of Interstrand Carbinolamine DNA Crosslinks by Crotonaldehyde- and Acetaldehyde-Derived α-CH3-γ-OH-1,N2-Propano-2’-deoxyguanosine Adducts in the 5′-CpG-3′ Sequence

    PubMed Central

    Cho, Young-Jin; Wang, Hao; Kozekov, Ivan D.; Kurtz, Andrew J.; Jacob, Jaison; Voehler, Markus; Smith, Jarrod; Harris, Thomas M.; Lloyd, R. Stephen; Rizzo, Carmelo J.; Stone, Michael P.


    The crotonaldehyde- and acetaldehyde-derived R- and S-α-CH3-γ-OH-1,N2-propanodeoxyguanosine adducts were monitored in single-stranded and duplex oligodeoxynucleotides using NMR spectroscopy. In both instances the cis and trans diastereomers of the α-CH3 and γ-OH groups underwent slow exchange, with the trans diastereomers being favored. In single-stranded oligodeoxynucleotides, the aldehyde intermediates were not detected spectroscopically, but their presence was revealed through the formation of N-terminal conjugates with the tetrapeptide KWKK. When annealed into 5′-d(GCTAGCXAGTCC)-3′•5′-d(GGACTCYCTAGC)-3′ containing the 5′-CpG-3′ sequence context (X=R- or S-α-CH3-γ-13C-OH-PdG; Y=15N2-dG), at pH 7, partial opening of the R- or S-α-CH3-γ-13C-OH-PdG adducts to the corresponding N2-(3-oxo-1-methyl-propyl)-dG aldehydes was observed at temperatures below the Tm of the duplexes. These aldehydes equilibrated with their geminal diol hydrates; higher temperatures favored the aldehydes. When annealed opposite to T, the S-α-CH3-γ-13C-OH-PdG adduct was stable. At 37 °C, an interstrand DNA crosslink was observed spectroscopically only for the R-α-CH3-γ-OH-PdG adduct. Molecular modeling predicted that the interstrand crosslink formed by the R-α-CH3-γ-OH-PdG adduct introduced less disruption into the duplex structure than did the crosslink arising from the S-α-CH3-γ-OH-PdG adduct, due to differing orientations of the R- and S-CH3 groups. Modeling also predicted that the α-methyl group of the aldehyde arising from the R-α-CH3-γ-OH-PdG adduct oriented in the 3′ direction in the minor groove, facilitating crosslinking. In contrast, the α-methyl group of the aldehyde arising from the S-α-CH3-γ-OH-PdG adduct oriented in the 5′ direction within the minor groove potentially hindering crosslinking. NMR revealed that for the R-α-CH3-γ-OH-PdG adduct, the carbinolamine form of the crosslink was favored in duplex DNA, in situ, with the imine or


    EPA Science Inventory

    What is the study?
    Near roadway and immediate roadway exposures to transportation emissions gave very similar results in the Salmonella mutagenicity assay and in an assay for DNA adducts indicating that near roadway genotoxicity is not altered significantly over...

  17. Self-assembling of C60-imidazole and C60-pyridine adducts in the Langmuir and Langmuir-Blodgett films via complex formation with water-soluble zinc porphyrins

    NASA Astrophysics Data System (ADS)

    Marczak, Renata; Noworyta, Krzysztof; Kutner, Wlodzimierz; Gadde, Suresh; D'Souza, Francis


    The C60-pyridine, C60py, and C60-imidazole, C60im, adducts were found to self-assemble in films floating onto aqueous solutions of zinc tetrakis (N-methylpyridinium)porphyrin cation, Zn(TMPyP), or zinc tetrakis (4-sulfonatophenyl)porphyrin anion, Zn(TPPS). This self assembling was due to axial ligation of the C60 adducts (acceptors) by Zn porphyrins (donors), which lead to the formation of relatively stable donor-acceptor dyads in the water-air interfaces. The films were compressed in a Langmuir trough and characterized by isotherms of surface pressure vs. area per molecule as well as by the Brewster angle microscopy imaging. All systems formed stable aggregated Langmuir films of the "expanded liquid" type. Extensive compression of the films resulted in two-dimensional phase transitions. The area per molecule at infinite dilution of the adducts in films increased in the order: water<0.1 mM Zn(TPPS)<0.1 mM Zn(TPMyP). Comparison of the determined and calculated values of area per molecule indicated that orientation of porphyrins in the complexes was parallel with respect to the interface plane. The Langmuir films were transferred, by using the Langmuir-Blodgett technique, onto quartz slides. The UV-vis spectroscopic study of these films revealed that Zn porphyrins were transferred together with the C60 adducts and that the transfer efficiency increased in the order: C60py-Zn(TPPS)

  18. Modulation of carcinogen metabolism by nitric oxide-aspirin 2 is associated with suppression of DNA damage and DNA adduct formation.


    MacDonald, Christopher J; Cheng, Robert Y S; Roberts, David D; Wink, David A; Yeh, Grace Chao


    Nitric oxide (NO)-donating non-steroidal anti-inflammatory drugs (NSAIDs) represent a promising new class of drugs developed to provide a safer alternative than their conventional NSAID counterparts in chemoprevention. We tested the effects of NO-aspirin 2 on Phase I and Phase II carcinogen-metabolizing enzymes. In HepG2 human hepatoma cells and in LS180 colonic adenocarcinoma cells, NO-aspirin 2 inhibited 2,3,7,8-tetrachlordibenzo-p-dioxin (TCDD)-induced cytochrome P450 (CYP) enzyme activity and CYP1A1 and CYP1A2 mRNA expression. These effects were further characterized as being mediated through transcriptional regulation: NO-aspirin 2 inhibited binding of ligand (TCDD)-activated aryl hydrocarbon receptor to the CYP1A1 enhancer sequence; additionally, NO-aspirin 2 suppressed carcinogen-induced expression of CYP1A heterogeneous nuclear RNA. The fate of carcinogen metabolites depends not only on activation by CYP enzymes but also detoxification by Phase II enzymes. Both HepG2 and LS180 cells treated with NO-aspirin 2 showed an increase in glutathione S-transferase-P1 (GST-P1), glutamate-cysteine ligase (GCL), and NAD(P)H:quinone oxidoreductase-1 (NQO1) expression. Compared with two other NO-releasing compounds, diethylenetriamine-NO and the organic nitrate, isosorbide dinitrate, the inhibitory effects of NO-aspirin 2 on TCDD-induced CYP activity and mRNA expression were considerably more potent. Furthermore, aspirin alone had no inhibitory effect on TCDD-induced CYP activity, nor did aspirin up-regulate GCL, GST-P1, or NQO1 expression. Consequent to the effects on carcinogen-metabolizing enzymes, NO-aspirin 2 inhibited [3H]benzo[a]pyrene-DNA adduct formation and DNA damage elicited by TCDD or benzo[a]pyrene. Our results demonstrate that NO-aspirin 2 may be an effective chemopreventive agent by favorably affecting the inhibitory and enhancing effects of Phase I and Phase II carcinogen metabolism, thereby protecting DNA from carcinogenic insult. PMID:19542225

  19. Chicken Fetal Liver DNA Damage and Adduct Formation by Activation-Dependent DNA-Reactive Carcinogens and Related Compounds of Several Structural Classes

    PubMed Central

    Williams, Gary M.; Duan, Jian-Dong; Brunnemann, Klaus D.; Iatropoulos, Michael J.; Vock, Esther; Deschl, Ulrich


    The chicken egg genotoxicity assay (CEGA), which utilizes the liver of an intact and aseptic embryo-fetal test organism, was evaluated using four activation-dependent DNA-reactive carcinogens and four structurally related less potent carcinogens or non-carcinogens. In the assay, three daily doses of test substances were administered to eggs containing 9–11-day-old fetuses and the fetal livers were assessed for two endpoints, DNA breaks using the alkaline single cell gel electrophoresis (comet) assay and DNA adducts using the 32P-nucleotide postlabeling (NPL) assay. The effects of four carcinogens of different structures requiring distinct pathways of bioactivation, i.e., 2-acetylaminofluorene (AAF), aflatoxin B1 (AFB1), benzo[a]pyrene (B[a]P), and diethylnitrosamine (DEN), were compared with structurally related non-carcinogens fluorene (FLU) and benzo[e]pyrene (B[e]P) or weak carcinogens, aflatoxin B2 (AFB2) and N-nitrosodiethanolamine (NDELA). The four carcinogens all produced DNA breaks at microgram or low milligram total doses, whereas less potent carcinogens and non-carcinogens yielded borderline or negative results, respectively, at higher doses. AAF and B[a]P produced DNA adducts, whereas none was found with the related comparators FLU or B[e]P, consistent with comet results. DEN and NDELA were also negative for adducts, as expected in the case of DEN for an alkylating agent in the standard NPL assay. Also, AFB1 and AFB2 were negative in NPL, as expected, due to the nature of ring opened aflatoxin adducts, which are resistant to enzymatic digestion. Thus, the CEGA, using comet and NPL, is capable of detection of the genotoxicity of diverse DNA-reactive carcinogens, while not yielding false positives for non-carcinogens. PMID:24973097

  20. Fluorescence and mass spectral evidence for the formation of benzo[a]pyrene anti-diol-epoxide-DNA and -hemoglobin adducts in humans.


    Weston, A; Rowe, M L; Manchester, D K; Farmer, P B; Mann, D L; Harris, C C


    Highly specific methods are required to detect and quantitate carcinogen-macromolecular adducts in humans who are exposed to complex mixtures of chemical carcinogens. High performance liquid chromatography and fluorescence spectroscopy have been used successfully to detect and identify residues of benzo[a]pyrene-7,10/8,9-tetrahydrotetrol (BP-7,10/8,9-tetrol) that were released upon mild acid hydrolysis of human DNA or hemoglobin. Synchronous fluorescence spectroscopy data indicate that levels of benzo[a]pyrene-diol-epoxide-DNA (BPDE-DNA) adducts as high as 1.54 fmol BPDE/micrograms DNA are formed (1 adduct in 5 million nucleotides) in peripheral blood lymphocytes of coke-oven workers; these data were subsequently corroborated by gas chromatography/mass spectroscopy single ion monitoring analysis (m/z 404+). Additionally, among lung cancer patients, 5 samples of tumor DNA were found to be negative and 1 of 4 samples of corresponding lung tissue was found to be positive. Extraction and purification of BP-7,10/8,9-tetrol from the hemoglobin of smokers suggested levels of bound carcinogen in excess of 1 ng BPDE/gm of hemoglobin. High performance liquid chromatography combined with synchronous fluorescence spectroscopy provides a highly specific method for the detection of covalently bound BP residues in both human hemoglobin and DNA. PMID:2912575

  1. Metformin inhibits 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis and adduct formation in human breast cells by inhibiting the cytochrome P4501A1/aryl hydrocarbon receptor signaling pathway

    SciTech Connect

    Maayah, Zaid H.; Ghebeh, Hazem; Alhaider, Abdulqader A.; El-Kadi, Ayman O.S.; Soshilov, Anatoly A.; Denison, Michael S.; Ansari, Mushtaq Ahmad; Korashy, Hesham M.


    Recent studies have established that metformin (MET), an oral anti-diabetic drug, possesses antioxidant activity and is effective against different types of cancer in several carcinogen-induced animal models and cell lines. However, whether MET can protect against breast cancer has not been reported before. Therefore, the overall objectives of the present study are to elucidate the potential chemopreventive effect of MET in non-cancerous human breast MCF10A cells and explore the underlying mechanism involved, specifically the role of cytochrome P4501A1 (CYP1A1)/aryl hydrocarbon receptor (AhR) pathway. Transformation of the MCF10A cells into initiated breast cancer cells with DNA adduct formation was conducted using 7,12-dimethylbenz[a]anthracene (DMBA), an AhR ligand. The chemopreventive effect of MET against DMBA-induced breast carcinogenesis was evidenced by the capability of MET to restore the induction of the mRNA levels of basic excision repair genes, 8-oxoguanine DNA glycosylase (OGG1) and apurinic/apyrimidinic endonuclease1 (APE1), and the level of 8-hydroxy-2-deoxyguanosine (8-OHdG). Interestingly, the inhibition of DMBA-induced DNA adduct formation was associated with proportional decrease in CYP1A1 and in NAD(P)H:quinone oxidoreductase 1 (NQO1) gene expression. Mechanistically, the involvements of AhR and nuclear factor erythroid 2-related factor-2 (Nrf2) in the MET-mediated inhibition of DMBA-induced CYP1A1 and NQO1 gene expression were evidenced by the ability of MET to inhibit DMBA-induced xenobiotic responsive element and antioxidant responsive element luciferase reporter gene expression which suggests an AhR- and Nrf2-dependent transcriptional control. However, the inability of MET to bind to AhR suggests that MET is not an AhR ligand. In conclusion, the present work shows a strong evidence that MET inhibits the DMBA-mediated carcinogenicity and adduct formation by inhibiting the expression of CYP1A1 through an AhR ligand-independent mechanism

  2. Metabolic activation of 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine and DNA adduct formation depends on p53: Studies in Trp53(+/+),Trp53(+/-) and Trp53(-/-) mice.


    Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M


    The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. PMID:26335255

  3. Formation of Fused-Ring 2′-Deoxycytidine Adducts from 1-Chloro-3-buten-2-one, an in Vitro 1,3-Butadiene Metabolite, under in Vitro Physiological Conditions

    PubMed Central

    Sun, Liang; Pelah, Avishay; Zhang, Dong-Ping; Zhong, Yu-Fang; An, Jing; Yu, Ying-Xin; Zhang, Xin-Yu; Elfarra, Adnan A.


    1-Chloro-3-buten-2-one (CBO) is a potential metabolite of 1,3-butadiene (BD), a carcinogenic air pollutant. CBO is a bifunctional alkylating agent that readily reacts with glutathione (GSH) to form mono-GSH and di-GSH adducts. Recently, CBO and its precursor 1-chloro-2-hydroxy-3-butene (CHB) were found to be cytotoxic and genotoxic in human liver cells in culture with CBO being approximately 100-fold more potent than CHB. In the present study, CBO was shown to react readily with 2′-deoxycytidine (dC) under in vitro physiological conditions (pH 7.4, 37 °C) to form four dC adducts with the CBO moieties forming fused rings with the N3 and N4 atoms of dC. The four products were structurally characterized as 2-hydroxy-2-hydroxymethyl-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahy dro-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-1 and dC-2, a pair of diastereomers), 4-chloromethyl-4-hydroxy-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahydr o-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-3), and 2-chloromethyl-2-hydroxy-7-(2-deoxy-β-D-erythro-pentofuranosyl)-1,2,3,4-tetrahydr o-6-oxo-6H,7H-pyrimido[1,6-a]pyrimidin-5-ium (dC-4). Interestingly, dC-1 and dC-2 were stable under our experimental conditions (pH 7.4, 37 °C, 6 h) and existed in equilibrium as indicated by HPLC analysis, whereas dC-3 and dC-4 were labile with the half-lives being 3.0 ± 0.36 and 1.7 ± 0.06 h, respectively. Decomposition of dC-4 produced both dC-1 and dC-2, whereas acid hydrolysis of dC-1/dC-2 and dC-4 in 1 M HCl at 100 °C for 30 min yielded the deribosylated adducts dC-1H/dC-2H and dC-4H, respectively. Because fused-ring dC adducts of other chemicals are mutagenic, the characterized CBO-dC adducts could be mutagenic and play a role in the cytotoxicity and genotoxicity of CBO and its precursors, CHB and BD. The CBO-dC adducts may also be used as standards to characterize CBO-DNA adducts and to develop potential biomarkers for CBO formation in vivo. PMID:24020501

  4. General method for quantifying base adducts in specific mammalian genes

    SciTech Connect

    Thomas, D.C.; Morton, A.G.; Bohr, V.A.; Sancar, A.


    A general method has been developed to measure the formation and removal of DNA adducts in defined sequences of mammalian genomes. Adducted genomic DNA is digested with an appropriate restriction enzyme, treated with Escherichia coli UvrABC excision nuclease (ABC excinuclease), subjected to alkaline gel electrophoresis, and probed for specific sequences by Southern hybridization. The ABC excinuclease incises DNA containing bulky adducts and thus reduces the intensity of the full-length fragments in Southern hybridization in proportion to the number of adducts present in the probed sequence. This method is similar to that developed by Bohr et al. for quantifying pyrimidine dimers by using T4 endonuclease V. Because of the wide substrate range of ABC exinuclease, however, our method can be used to quantify a large variety of DNA adducts in specific genomic sequences.

  5. DNA adduct formation and DNA strand breaks in green-lipped mussels (Perna viridis) exposed to benzo[a]pyrene: dose- and time-dependent relationships.


    Ching, E W; Siu, W H; Lam, P K; Xu, L; Zhang, Y; Richardson, B J; Wu, R S


    Green-lipped mussels, Perna viridis, were exposed to 0, 0.3, 3 and 30 micrograms l-1 (nominal concentrations) B[a]P under laboratory conditions over a period of 24 days. Mussels were collected on day 0, 1, 3, 6, 12, 18 and 24, and the levels of DNA adducts and DNA strand breaks in their hepatopancreas tissues monitored. Mussels exposed to 0.3 and 3 micrograms l-1 B[a]P showed marked increases in strand breaks after 1 day of exposure. DNA strand break levels in these mussels remained high and significantly different from the control values until day 3 for the 0.3 microgram l-1 treatment group, and day 6 for the 3 micrograms l-1 treatment group. This was followed by a gradual reduction in strand breaks. After 12 days, the levels of both groups had returned to the same level as that of the control. No increase in DNA strand breaks was observable in mussels exposed to 30 micrograms l-1 B[a]P in the first 12 days of exposure, but a significant increase was observed from day 12 to day 24. Increasing B[a]P concentrations resulted in elevated DNA adduct levels after 3-6 days of exposure, but this pattern of dose-related increase disappeared after 12 days. These results indicate that a better understanding of the complex interactions between exposure levels and durations is crucially important before DNA adduct levels and DNA strand breaks in P. viridis can be used as effective biomarkers for monitoring genotoxicants in marine waters. PMID:11488241

  6. MeIQx-induced DNA adduct formation and mutagenesis in DNA repair deficient CHO cells expressing human CYP1A1 and rapid or slow acetylator NAT2

    PubMed Central

    Bendaly, Jean; Zhao, Shuang; Neale, Jason R.; Metry, Kristin J.; Doll, Mark A.; States, J. Christopher; Pierce, William M.; Hein, David W.


    2-Amino-3,8-dimethylimidazo-[4,5-f]quinoxaline (MeIQx) is one of the most potent and abundant mutagens in the western diet. Bioactivation includes N-hydroxylation catalyzed by cytochrome P450s followed by O-acetylation catalyzed by N-acetyltransferase 2 (NAT2). Nucleotide excision repair-deficient chinese hamster ovary (CHO) cells were constructed by stable transfection of human cytochrome P4501A1 (CYP1A1) and a single copy of either NAT2*4 (rapid acetylator) or NAT2*5B (slow acetylator) alleles. CYP1A1 and NAT2 catalytic activities were undetectable in untransfected CHO cell lines. CYP1A1 activity did not differ significantly (p > 0.05) among the CYP1A1-transfected cell lines. Cells transfected with NAT2*4 had significantly higher levels of sulfamethazine N-acetyltransferase (p = 0.0001) and N-hydroxy-MeIQx O-acetyltransferase (p = 0.0093) catalytic activity than cells transfected with NAT2*5B. Only cells transfected with both CYP1A1 and NAT2*4 showed concentration-dependent cytotoxicity and hypoxanthine phosphoribosyl transferase (hprt) mutagenesis following MeIQx treatment. dG-C8-MeIQx was the primary DNA adduct formed and levels were dose-dependent in each cell line and in the order: untransfected < transfected with CYP1A1 < transfected with CYP1A1 & NAT2*5B < transfected with CYP1A1 & NAT2*4. MeIQx DNA adduct levels were significantly higher (p < 0.001) in CYP1A1/NAT2*4 than CYP1A1/NAT2*5B cells at all concentrations of MeIQx tested. MeIQx-induced DNA adduct levels correlated very highly (r2 = 0.88) with MeIQx-induced mutants. These results strongly support extrahepatic activation of MeIQx by CYP1A1 and a robust effect of human NAT2 genetic polymorphism on MeIQx –induced DNA adducts and mutagenesis. The results provide laboratory-based support for epidemiological studies reporting higher frequency of heterocyclic amine-related cancers in rapid NAT2 acetylators. PMID:17627018

  7. Sperm DNA oxidative damage and DNA adducts.


    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi


    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps=0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps=0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps=0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm

  8. Ethanol and 4-methylpyrazole increase DNA adduct formation of furfuryl alcohol in FVB/N wild-type mice and in mice expressing human sulfotransferases 1A1/1A2.


    Sachse, Benjamin; Meinl, Walter; Glatt, Hansruedi; Monien, Bernhard H


    Furfuryl alcohol (FFA) is a carcinogenic food contaminant, which is formed by acid- and heat-catalyzed degradation of fructose and glucose. The activation by sulfotransferases (SULTs) yields a DNA reactive and mutagenic sulfate ester. The most prominent DNA adduct, N(2)-((furan-2-yl)methyl)-2'-deoxyguanosine (N(2)-MF-dG), was detected in FFA-treated mice and also in human tissue samples. The dominant pathway of FFA detoxification is the oxidation via alcohol dehydrogenases (ADHs) and aldehyde dehydrogenases (ALDHs). The activity of these enzymes may be greatly altered in the presence of inhibitors or competitive substrates. Here, we investigated the impact of ethanol and the ADH inhibitor 4-methylpyrazole (4MP) on the DNA adduct formation by FFA in wild-type and in humanized mice that were transgenic for human SULT1A1/1A2 and deficient in the mouse (m) Sult1a1 and Sult1d1 genes (h1A1/1A2/1a1(-)/1d1(-)). The administration of FFA alone led to hepatic adduct levels of 4.5 N(2)-MF-dG/10(8) nucleosides and 33.6 N(2)-MF-dG/10(8) nucleosides in male and female wild-type mice, respectively, and of 19.6 N(2)-MF-dG/10(8) nucleosides and 95.4 N(2)-MF-dG/10(8) nucleosides in male and female h1A1/1A2/1a1(-)/1d1(-) mice. The coadministration of 1.6g ethanol/kg body weight increased N(2)-MF-dG levels by 2.3-fold in male and by 1.7-fold in female wild-type mice and by 2.5-fold in male and by 1.5-fold in female h1A1/1A2/1a1(-)/1d1(-) mice. The coadministration of 100mg 4MP/kg body weight had a similar effect on the adduct levels. These findings indicate that modulators of the oxidative metabolism, e.g. the drug 4MP or consumption of alcoholic beverages, may increase the genotoxic effects of FFA also in humans. PMID:26775039

  9. Induction of Cyp1a1 and Cyp1b1 and formation of DNA adducts in C57BL/6, Balb/c, and F1 mice following in utero exposure to 3-methylcholanthrene

    SciTech Connect

    Xu Mian; Nelson, Garret B.; Moore, Joseph E.; McCoy, Thomas P.; Dai, Jian; Manderville, Richard A.; Ross, Jeffrey A.; Miller, Mark Steven . E-mail:


    Fetal mice are more sensitive to chemical carcinogens than are adults. Previous studies from our laboratory demonstrated differences in the mutational spectrum induced in the Ki-ras gene from lung tumors isolated from [D2 x B6D2F1]F2 mice and Balb/c mice treated in utero with 3-methylcholanthrene (MC). We thus determined if differences in metabolism, adduct formation, or adduct repair influence strain-specific responses to transplacental MC exposure in C57BL/6 (B6), Balb/c (BC), and reciprocal F1 crosses between these two strains of mice. The induction of Cyp1a1 and Cyp1b1 in fetal lung and liver tissue was determined by quantitative fluorescent real-time PCR. MC treatment caused maximal induction of Cyp1a1 and Cyp1b1 RNA 2-8 h after injection in both organs. RNA levels for both genes then declined in both fetal organs, but a small biphasic, secondary increase in Cyp1a1 was observed specifically in the fetal lung 24-48 h after MC exposure in all four strains. Cyp1a1 induction by MC at 4 h was 2-5 times greater in fetal liver (7000- to 16,000-fold) than fetal lung (2000- to 6000-fold). Cyp1b1 induction in both fetal lung and liver was similar and much lower than that observed for Cyp1a1, with induction ratios of 8- to 18-fold in fetal lung and 10- to 20-fold in fetal liver. The overall kinetics and patterns of induction were thus very similar across the four strains of mice. The only significant strain-specific effect appeared to be the relatively poor induction of Cyp1b1 in the parental strain of B6 mice, especially in fetal lung tissue. We also measured the levels of MC adducts and their disappearance from lung tissue by the P{sup 32} post-labeling assay on gestation days 18 and 19 and postnatal days 1, 4, 11, and 18. Few differences were seen between the different strains of mice; the parental strain of B6 mice had nominally higher levels of DNA adducts 2 (gestation day 19) and 4 (postnatal day 1) days after injection, although this was not statistically

  10. High performance addition-type thermoplastics (ATTs) - Evidence for the formation of a Diels-Alder adduct in the reaction of an acetylene-terminated material and a bismaleimide

    NASA Technical Reports Server (NTRS)

    Pater, R. H.; Soucek, M. D.; Chang, A. C.; Partos, R. D.


    Recently, the concept and demonstration of a new versatile synthetic reaction for making a large number of high-performance addition-type thermoplastics (ATTs) were reported. The synthesis shows promise for providing polymers having an attractive combination of easy processability, good toughness, respectable high temperature mechanical performance, and excellent thermo-oxidative stability. The new chemistry involves the reaction of an acetylene-terminated material with a bismaleimide or benzoquinone. In order to clarify the reaction mechanism, model compound studies were undertaken in solutions as well as in the solid state. The reaction products were purified by flash chromatography and characterized by conventional analytical techniques including NMR, FT-IR, UV-visible, mass spectroscopy, and high pressure liquid chromatography. The results are presented of the model compound studies which strongly support the formation of a Diels-Alder adduct in the reaction of an acetylene-terminated compound and a bismaleimide or benzoquinone.

  11. Comparative DNA adduct formation and induction of colonic aberrant crypt foci in mice exposed to 2-amino-9H-pyrido[2,3-b]indole, 2-amino-3,4-dimethylimidazo[4,5-f]quinoline, and azoxymethane.


    Kim, Sangyub; Guo, Jingshu; O'Sullivan, M Gerald; Gallaher, Daniel D; Turesky, Robert J


    Considerable evidence suggests that environmental factors, including diet and cigarette smoke, are involved in the pathogenesis of colon cancer. Carcinogenic nitroso compounds (NOC), such as N-nitrosodimethylamine (NDMA), are present in tobacco and processed red meat, and NOC have been implicated in colon cancer. Azoxymethane (AOM), commonly used for experimental colon carcinogenesis, is an isomer of NDMA, and it produces the same DNA adducts as does NDMA. Heterocyclic aromatic amines (HAAs) formed during the combustion of tobacco and high-temperature cooking of meats are also associated with an elevated risk of colon cancer. The most abundant carcinogenic HAA formed in tobacco smoke is 2-amino-9H-pyrido[2,3-b]indole (AαC), whereas 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ) is the most potent carcinogenic HAA formed during the cooking of meat and fish. However, the comparative tumor-initiating potential of AαC, MeIQ, and AOM is unknown. In this report, we evaluate the formation of DNA adducts as a measure of genotoxicity, and the induction of colonic aberrant crypt foci (ACF) and dysplastic ACF, as an early measure of carcinogenic potency of these compounds in the colon of male A/J mice. Both AαC and AOM induced a greater number of DNA adducts than MeIQ in the liver and colon. AOM induced a greater number of ACF and dysplastic ACF than either AαC or MeIQ. Conversely, based on adduct levels, MeIQ-DNA adducts were more potent than AαC- and AOM-DNA adducts at inducing ACF. Long-term feeding studies are required to relate levels of DNA adducts, induction of ACF, and colon cancer by these colon genotoxicants. PMID:26734915

  12. Quantitation of DNA adducts by stable isotope dilution mass spectrometry

    PubMed Central

    Tretyakova, Natalia; Goggin, Melissa; Janis, Gregory


    Exposure to endogenous and exogenous chemicals can lead to the formation of structurally modified DNA bases (DNA adducts). If not repaired, these nucleobase lesions can cause polymerase errors during DNA replication, leading to heritable mutations potentially contributing to the development of cancer. Due to their critical role in cancer initiation, DNA adducts represent mechanism-based biomarkers of carcinogen exposure, and their quantitation is particularly useful for cancer risk assessment. DNA adducts are also valuable in mechanistic studies linking tumorigenic effects of environmental and industrial carcinogens to specific electrophilic species generated from their metabolism. While multiple experimental methodologies have been developed for DNA adduct analysis in biological samples – including immunoassay, HPLC, and 32P-postlabeling – isotope dilution high performance liquid chromatography-electrospray ionization-tandem mass spectrometry (HPLC-ESI-MS/MS) generally has superior selectivity, sensitivity, accuracy, and reproducibility. As typical DNA adducts concentrations in biological samples are between 0.01 – 10 adducts per 108 normal nucleotides, ultrasensitive HPLC-ESI-MS/MS methodologies are required for their analysis. Recent developments in analytical separations and biological mass spectrometry – especially nanoflow HPLC, nanospray ionization MS, chip-MS, and high resolution MS – have pushed the limits of analytical HPLC-ESI-MS/MS methodologies for DNA adducts, allowing researchers to accurately measure their concentrations in biological samples from patients treated with DNA alkylating drugs and in populations exposed to carcinogens from urban air, drinking water, cooked food, alcohol, and cigarette smoke. PMID:22827593

  13. Reactions of Ph3Sb═S with copper(I) complexes supported by N-donor ligands: formation of stable adducts and S-transfer reactivity.


    Yang, Lei; Tehranchi, Jacqui; Tolman, William B


    In the exploration of sulfur-delivery reagents useful for synthesizing models of the tetracopper-sulfide cluster of nitrous oxide reductase, reactions of Ph(3)Sb═S with Cu(I) complexes of N,N,N',N'-tetramethyl-2R,3R-cyclohexanediamine (TMCHD) and 1,4,7-trialkyltriazacyclononanes (R(3)tacn; R = Me, Et, iPr) were studied. Treatment of [(R(3)tacn)Cu(NCCH(3))]SbF(6) (R = Me, Et, or iPr) with 1 equiv of S═SbPh(3) in CH(2)Cl(2) yielded adducts [(R(3)tacn)Cu(S═SbPh(3))]SbF(6) (1-3), which were fully characterized, including by X-ray crystallography. The adducts slowly decayed to [(R(3)tacn)(2)Cu(2)(μ-η(2):η(2)-S(2))](2+) species (4-6) and SbPh(3), or more quickly in the presence of additional [(R(3)tacn)Cu(NCCH(3))]SbF(6) to 4-6 and [(R(3)tacn)Cu(SbPh(3))]SbF(6) (7-9). The results of mechanistic studies of the latter process were consistent with rapid intermolecular exchange of S═SbPh(3) between 1-3 and added [(R(3)tacn)Cu(NCCH(3))]SbF(6), followed by conversion to product via a dicopper intermediate formed in a rapid pre-equilibrium step. Key evidence supporting this step came from the observation of saturation behavior in a plot of the initial rate of loss of 1 versus the initial concentration of [(Me(3)tacn)Cu(NCCH(3))]SbF(6). Also, treatment of [(TMCHD)Cu(CH(3)CN)]PF(6) with S═SbPh(3) led to the known tricopper cluster [(TMCHD)(3)Cu(3)(μ(3)-S)(2)](PF(6))(3) in good yield (79%), a synthetic procedure superior to that previously reported (Brown, E. C.; York, J. T.; Antholine, W. E.; Ruiz, E.; Alvarez, S.; Tolman, W. B. J. Am. Chem. Soc. 2005, 127, 13752-13753). PMID:21338053

  14. Sustained induction of cytochrome P4501A1 in human hepatoma cells by co-exposure to benzo[a]pyrene and 7H-dibenzo[c,g]carbazole underlies the synergistic effects on DNA adduct formation

    SciTech Connect

    Gábelová, Alena; Poláková, Veronika; Prochazka, Gabriela; Kretová, Miroslava; Poloncová, Katarína; Regendová, Eva; Luciaková, Katarína; Segerbäck, Dan


    To gain a deeper insight into the potential interactions between individual aromatic hydrocarbons in a mixture, several benzo[a]pyrene (B[a]P) and 7H-dibenzo[c,g]carbazole (DBC) binary mixtures were studied. The biological activity of the binary mixtures was investigated in the HepG2 and WB-F344 liver cell lines and the Chinese hamster V79 cell line that stably expresses the human cytochrome P4501A1 (hCYP1A1). In the V79 cells, binary mixtures, in contrast to individual carcinogens, caused a significant decrease in the levels of micronuclei, DNA adducts and gene mutations, but not in cell survival. Similarly, a lower frequency of micronuclei and levels of DNA adducts were found in rat liver WB-F344 cells treated with a binary mixture, regardless of the exposure time. The observed antagonism between B[a]P and DBC may be due to an inhibition of Cyp1a1 expression because cells exposed to B[a]P:DBC showed a decrease in Cyp1a1 mRNA levels. In human liver HepG2 cells exposed to binary mixtures for 2 h, a reduction in micronuclei frequency was also found. However, after a 24 h treatment, synergism between B[a]P and DBC was determined based on DNA adduct formation. Accordingly, the up-regulation of CYP1A1 expression was detected in HepG2 cells exposed to B[a]P:DBC. Our results show significant differences in the response of human and rat cells to B[a]P:DBC mixtures and stress the need to use multiple experimental systems when evaluating the potential risk of environmental pollutants. Our data also indicate that an increased expression of CYP1A1 results in a synergistic effect of B[a]P and DBC in human cells. As humans are exposed to a plethora of noxious chemicals, our results have important implications for human carcinogenesis. - Highlights: • B[a]P:DBC mixtures were less genotoxic in V79MZh1A1 cells than B[a]P and DBC alone. • An antagonism between B[a]P and DBC was determined in rat liver WB-F344 cells. • The inhibition of CYP1a1 expression by B[a]P:DBC mixture

  15. Epoxidation of the methamphetamine pyrolysis product, trans-phenylpropene, to trans-phenylpropylene oxide by CYP enzymes and stereoselective glutathione adduct formation

    SciTech Connect

    Sanga, Madhu; Younis, Islam R.; Tirumalai, Padma S.; Bland, Tina M.; Banaszewska, Monica; Konat, Gregory W.; Tracy, Timothy S.; Gannett, Peter M.; Callery, Patrick S. . E-mail:


    Pyrolytic products of smoked methamphetamine hydrochloride are well established. Among the various degradation products formed, trans-phenylpropene (trans-{beta}-methylstyrene) is structurally similar to styrene analogues known to be bioactivated by CYP enzymes. In human liver microsomes, trans-phenylpropene was converted to the epoxide trans-phenylpropylene oxide (trans-2-methyl-3-phenyloxirane) and cinnamyl alcohol. Incubation of trans-phenylpropene with microsomes in the presence of enzyme-specific P450 enzyme inhibitors indicated the involvement of CYP2E1, CYP1A2, and CYP3A4 enzymes. Both (R,R)-phenylpropylene oxide and (S,S)-phenylpropylene oxide were formed in human liver microsomal preparations. Enantiomers of trans-phenylpropylene oxide were stereoselectively and regioselectively conjugated in a Phase II drug metabolism reaction catalyzed by human liver cytosolic enzymes consisting of conjugation with glutathione. The structure of the phenylpropylene oxide-glutathione adduct is consistent with nucleophilic ring-opening by attack at the benzylic carbon. Exposure of cultured C6 glial cells to (S,S)-phenylpropylene oxide produced a cytotoxic response in a concentration-dependent manner based on cell degeneration and death.

  16. Structure of adducts of isoindolo[2,1-a]benzimidazole derivatives with maleimides

    NASA Astrophysics Data System (ADS)

    Korolev, Oleksandr; Yegorova, Tatyana; Levkov, Igor; Malytskyy, Volodymyr; Shishkin, Oleg; Zubatyuk, Roman; Palamarchuk, Genadiy; Vedrenne, Marc; Baltas, Michel; Voitenko, Zoia


    The selectivity of formation and some mechanistic insights during the synthesis of substituted isoindolo[2,1-a]benzimidazoles are discussed. Furthermore, the reactions of the obtained products with maleimides were carried out. Two types rearrangement adducts together with intermediate Michael type adducts were isolated. The influence of the reaction conditions and reagents ratio is discussed. Specific spectral criteria for the identification of the Michael type adducts are indicated.

  17. 32P-postlabeling DNA adduct assay: cigarette smoke-induced dna adducts in the respiratory and nonrespiratory rat tissues. Book chapter

    SciTech Connect

    Gupta, R.C.; Gairola, C.G.


    An analysis of the tissue DNA adducts in rats by the sensitive (32)p-postlabeling assay showed one to eight detectable DNA adducts in lung, trachea, larynx, heart and bladder of the sham controls. Chronic exposure of animals to mainstream cigarette smoke showed a remarkable enhancement of most adducts in the lung and heart DNA. Since cigarette smoke contains several thousand chemicals and a few dozen of them are known or potential carcinogens, the difference between the DNA adducts of nasal and the other tissues may reflect the diversity of reactive constituents and their differential absorption in different tissues. In comparison to the lung DNA adducts, the adducts in nasal DNA were less hydrophobic. Identity of the predominant adducts was further investigated by comparison with several reference DNA adducts from 10 PAH and aromatic amines. Since some of these chemicals are present in cigarette smoke, the results suggest that these constituents of cigarette smoke may not be directly responsible for formation of DNA adducts in the lung and heart of the smoke-exposed animals.

  18. Formation of Metal Clusters or Nitrogen-Bridged Adducts by Reaction of a Bis(amino)stannylene with Halides of Two-Valent Transition Metals.


    Veith, Michael; Müller, Alice; Stahl, Lothar; Nötzel, Martin; Jarczyk, Maria; Huch, Volker


    When the cyclic bis(amino)stannylene Me(2)Si(NtBu)(2)Sn is allowed to react with metal halides MX(2) (M = Cr, Fe, Co, Zn; X = Cl, Br [Zn]) adducts of the general formula [Me(2)Si(NtBu)(2)Sn.MX(2)](n) are obtained. The compounds are generally dimeric (n = 2) except the ZnBr(2) adduct, which is monomeric in benzene. The crystal structures of [Me(2)Si(NtBu)(2)Sn.CoCl(2)](2) (triclinic, space group &Pmacr;1; a = 8.620(9) Å, b = 9.160(9) Å, c = 12.280(9) Å, alpha = 101.2(1) degrees, beta = 97.6(1) degrees, gamma = 105.9(1) degrees, Z = 1) and of [Me(2)Si(NtBu)(2)Sn.ZnCl(2)](2) (monoclinic, space group P2(1)/c; a = 8.156(9) Å, b = 16.835(12) Å, c = 13.206(9) Å, beta = 94.27(6) degrees, Z = 2) were determined by X-ray diffraction techniques. The two compounds form similar polycyclic, centrosymmetrical assemblies of metal atoms bridged by chlorine or nitrogen atoms. While in the case of the cobalt compound Co is pentacoordinated by three chlorine and two nitrogen atoms, in the zinc derivative Zn is almost tetrahedrally coordinated by three chlorine atoms and one nitrogen atom. The iron derivative [Me(2)Si(NtBu)(2)Sn.FeCl(2)](2) seems to be isostructural with the cobalt compound as can be deduced from the crystal data (triclinic, a = 8.622(7) Å, b = 9.158(8) Å, c = 12.353(8) Å, alpha = 101.8(1) degrees, beta = 96.9(1) degrees, gamma = 105.9(1) degrees, Z = 1). If NiBr(2), PdCl(2), or PtCl(2) is combined with the stannylene, the reaction product is totally different: 4 equiv of the stannylene are coordinating per metal halide, forming the molecular compound [Me(2)Si(NtBu)(2)Sn](4)MX(2), which crystallizes with half a mole of benzene per molecular formula. The crystal structures of [Me(2)Si(NtBu)(2)Sn](4).NiBr(2).(1)/(2)C(6)H(6) (tetragonal, space group I4(1)/a, a = b = 43.86(4) Å, c = 14.32(2) Å, Z = 16) and [Me(2)Si(NtBu)(2)Sn](4).PdCl(2).(1)/(2)C(6)H(6) (tetragonal, space group I4(1)/a, a = b = 43.99(4) Å, c = 14.318(14) Å, Z = 16) reveal the two compounds to

  19. Covalent thiol adducts arising from reactive intermediates of cocaine biotransformation.


    Schneider, Kevin J; DeCaprio, Anthony P


    Exposure to cocaine results in the depletion of hepatocellular glutathione and macromolecular protein binding in humans. Such cocaine-induced responses have generally been attributed to oxidative stress and reactive metabolites resulting from oxidative activation of the cocaine tropane nitrogen. However, little conclusive data exists on the mechanistic pathways leading to protein modification or the structure and specificity of cocaine-derived adduction products. We now report a previously uncharacterized route of cocaine bioactivation leading to the covalent adduction of biological thiols, including cysteine and glutathione. Incubation of cocaine with biological nucleophiles in an in vitro biotransformation system containing human liver microsomes identified a monooxygenase-mediated event leading to the oxidation of, and subsequent sulfhydryl addition to, the cocaine aryl moiety. Adduct structures were confirmed using ultra-high performance liquid chromatography coupled to high resolution, high mass accuracy mass spectrometry. Examination of assays containing transgenic bactosomes expressing single human cytochrome P450 isoforms determined the role of P450s 1A2, 2C19, and 2D6 in the oxidation process resulting in adduct formation. P450-catalyzed aryl epoxide formation and subsequent attack by free nucleophilic moieties is consistent with the resulting adduct structures, mechanisms of formation, and the empirical observation of multiple structural and stereo isomers. Analogous adduction mechanisms were maintained across all sulfhydryl-containing nucleophile models examined; N-acetylcysteine, glutathione, and a synthetic cysteine-containing hexapeptide. Predictive in silico calculations of molecular reactivity and electrophilicity/nucleophilicity were compared to the results of in vitro assay incubations in order to better understand the adduction process using the principles of hard and soft acid and base (HSAB) theory. This study elucidated a novel metabolic

  20. Zinc acetylacetonate hydrate adducted with nitrogen donor ligands: Synthesis, spectroscopic characterization, and thermal analysis

    NASA Astrophysics Data System (ADS)

    Brahma, Sanjaya; Shivashankar, S. A.


    We report synthesis, spectroscopic characterization, and thermal analysis of zinc acetylacetonate complex adducted by nitrogen donor ligands, such as pyridine, bipyridine, and phenanthroline. The pyridine adducted complex crystallizes to monoclinic crystal structure, whereas other two adducted complexes have orthorhombic structure. Addition of nitrogen donor ligands enhances the thermal property of these complexes as that with parent metal-organic complex. Zinc acetylacetonate adducted with pyridine shows much higher volatility (106 °C), decomposition temperature (202 °C) as that with zinc acetylacetonate (136 °C, 220 °C), and other adducted complexes. All the adducted complexes are thermally stable, highly volatile and are considered to be suitable precursors for metal organic chemical vapor deposition. The formation of these complexes is confirmed by powder X-ray diffraction, Fourier transform infrared spectroscopy, mass spectroscopy, and elemental analysis. The complexes are widely used as starting precursor materials for the synthesis of ZnO nanostructures by microwave irradiation assisted coating process.


    EPA Science Inventory

    Formation of DNA adducts is regarded a- an essential initial step in the process of chemical carcinogenesis. To determine how chronic exposure to cigarette smoke affects the distribution of DNA adducts In selected respiratory and nonrespiratory tissues, we exposed male Sprague-Da...

  2. Benzo(a)pyrene (B(a)P) metabolism and in vitro formation of B(a)P-DNA adducts by hepatic microsomes from rats fed diets containing corn and menhaden oils

    SciTech Connect

    Dharwadkar, S.; Bellow, J.; Ramanathan, R.; Wade, A.


    Dietary unsaturated fat is required for maximum induction of hepatic mixed function oxidases responsible for activating carcinogens which may bind covalently to DNA. The aim of this study was to assess the influence of dietary fat type on in vitro B(a)P metabolism and B(a)P-DNA adduct formation. Male rats were starved 2 days and refed diet devoid of fat, or containing 20% corn oil (CO) or 20% menhaden oil (MO) for 4 days. Both dietary fats increased Vmax for B(a)P hydroxylation without affecting Km. Phenobarbital (PB) administration increased Vmax in all animals but Km was increased only in rats fed the fat diets. PB resulted in decreased B(a)P metabolism when conducted at 15 =M only in rats fed the two fat diets even in the presence of increased cytochrome P-450 (P-450). This effect was due to a decrease in B(a)P metabolism at low substrate concentrations in PB treated fat-fed animals. Binding of B(a)P to calf-thymus DNA was increased in animals fed both fats which was enhanced further by PB only in rats fed the CO and MO diets. When the data are calculated as B(a)P metabolized per unit of P-450, PB seems to induce a P-450 in fat-fed animals having lower affinity and capacity for B(a)P metabolism and activation.

  3. Cigarette smoke-induced DNA-damage: role of hydroquinone and catechol in the formation of the oxidative DNA-adduct, 8-hydroxydeoxyguanosine.


    Leanderson, P; Tagesson, C


    This study demonstrates the ability of cigarette smoke condensate to generate hydrogen peroxide and to hydroxylate deoxyguanosine (dG) residues in isolated DNA to 8-hydroxydeoxyguanosine (8-OHdG). Both the formation of hydrogen peroxide and that of 8-OHdG in DNA was significantly decreased when catalase or tyrosinase was added to the smoke condensates, and this also occurred when pure hydroquinone or catechol, two major constitutes in cigarette smoke, was used instead of smoke condensate. Moreover, pure hydroquinone and catechol both caused dose-dependent formation of hydrogen peroxide and 8-OHdG, and there was good correlation between the amounts of hydrogen peroxide and 8-OHdG formed. These findings suggest that (i) hydroquinone and catechol may be responsible for the ability of cigarette smoke to cause 8-OHdG formation in DNA, (ii) this oxidative DNA-damage is due to the action of hydroxyl radicals formed during dissociation of hydrogen peroxide and (iii) the hydrogen peroxide in cigarette smoke is generated via autooxidation of hydroquinone and catechol. PMID:2114224

  4. Urinary biomarkers suggest that estrogen-DNA adducts may play a role in the aetiology of non-Hodgkin lymphoma

    PubMed Central

    Gaikwad, Nilesh W.; Yang, Li; Weisenburger, Dennis D.; Vose, Julie; Beseler, Cheryl; Rogan, Eleanor G.; Cavalieri, Ercole L.


    A variety of evidence suggests that estrogens may induce non-Hodgkin lymphoma (NHL). The reaction of catechol estrogen quinones with DNA to form depurinating estrogen-DNA adducts is hypothesized to initiate this process. These adducts are released from DNA, shed from cells into the bloodstream and excreted in urine. The aim of this study was to determine whether or not the depurinating estrogen-DNA adducts might be involved in the aetiology of human NHL. Estrogen metabolites, conjugates and depurinating DNA adducts were identified and quantified in spot urine samples from 15 men with NHL and 30 healthy control men by using ultraperformance liquid chromatography/tandem mass spectrometry. The levels of estrogen-DNA adducts were significantly higher in the men with NHL than in the healthy control men. Thus, formation of estrogen-DNA adducts may play a critical role in the aetiology of NHL, and these adducts could be potential biomarkers of NHL risk. PMID:19863189

  5. Detection and comparison of DNA adducts after in vitro and in vivo diesel emission exposures

    SciTech Connect

    Gallagher, J.; George, M.; Kohan, M.; Thompson, C.; Shank, T.


    Development of methodologies to evaluate certain classes of polycyclic aromatic compounds (PAC) detected in complex mixtures to which humans are exposed would greatly improve the diagnostic potential of (32)P-postlabeling analysis. Identification of DNA adduct patterns of specific exposure-related marker adducts would strengthen associations between observed DNA adducts and exposures to different environmental pollutants (e.g., kerosene, cigarette smoke, coke oven, and diesel). Diesel-modified DNA adduct patterns were compared in various in vitro and in vivo rodent model systems and then compared to DNA reactive oxidative and reductive metabolites of 1-nitropyrene. The formation of nitrated-polycyclic aromatic hydrocarbon (nitrated-PAH) DNA adducts, derived from the metabolism of diesel extract constituents, was enhanced relative to other PAH-derived DNA adducts via xanthine oxidase-catalyzed nitroreduction. These adducts were detectable only by the butanol extraction version of the postlabeling analysis. Marker adducts detected in the various test systems presented here will assist in characterizing nuclease-P1-sensitive nitrated PAH adducts in humans.

  6. Glutathione transferase A4-4 resists adduction by 4-hydroxynonenal☆

    PubMed Central

    Shireman, Laura M.; Kripps, Kimberly A.; Balogh, Larissa M.; Conner, Kip P.; Whittington, Dale; Atkins, William M.


    4-Hydroxy-2-trans-nonenal (HNE) is a lipid peroxidation product that contributes to the pathophysiology of several diseases with components of oxidative stress. The electrophilic nature of HNE results in covalent adduct formation with proteins, fatty acids and DNA. However, it remains unclear whether enzymes that metabolize HNE avoid inactivation by it. Glutathione transferase A4-4 (GST A4-4) plays a significant role in the elimination of HNE by conjugating it with glutathione (GSH), with catalytic activity toward HNE that is dramatically higher than the homologous GST A1-1 or distantly related GSTs. To determine whether enzymes that metabolize HNE resist its covalent adduction, the rates of adduction of these GST isoforms were compared and the functional effects of adduction on catalytic properties were determined. Although GST A4-4 and GST A1-1 have striking structural similarity, GST A4-4 was insensitive to adduction by HNE under conditions that yield modest adduction of GST A1-1 and extensive adduction of GST P1-1. Furthermore, adduction of GST P1-1 by HNE eliminated its activity toward the substrates 1-chloro- 2,4-dinitrobenzene (CDNB) and toward HNE itself. HNE effects on GST A4-4 and A1-1 were less significant. The results indicate that enzymes that metabolize HNE may have evolved structurally to resist covalent adduction by it. PMID:20836986

  7. Glutathione transferase A4-4 resists adduction by 4-hydroxynonenal.


    Shireman, Laura M; Kripps, Kimberly A; Balogh, Larissa M; Conner, Kip P; Whittington, Dale; Atkins, William M


    4-Hydroxy-2-trans-nonenal (HNE) is a lipid peroxidation product that contributes to the pathophysiology of several diseases with components of oxidative stress. The electrophilic nature of HNE results in covalent adduct formation with proteins, fatty acids and DNA. However, it remains unclear whether enzymes that metabolize HNE avoid inactivation by it. Glutathione transferase A4-4 (GST A4-4) plays a significant role in the elimination of HNE by conjugating it with glutathione (GSH), with catalytic activity toward HNE that is dramatically higher than the homologous GST A1-1 or distantly related GSTs. To determine whether enzymes that metabolize HNE resist its covalent adduction, the rates of adduction of these GST isoforms were compared and the functional effects of adduction on catalytic properties were determined. Although GST A4-4 and GST A1-1 have striking structural similarity, GST A4-4 was insensitive to adduction by HNE under conditions that yield modest adduction of GST A1-1 and extensive adduction of GST P1-1. Furthermore, adduction of GST P1-1 by HNE eliminated its activity toward the substrates 1-chloro-2,4-dinitrobenzene (CDNB) and toward HNE itself. HNE effects on GST A4-4 and A1-1 were less significant. The results indicate that enzymes that metabolize HNE may have evolved structurally to resist covalent adduction by it. PMID:20836986

  8. Proton-coupled electron transfer and adduct configuration are important for C4a-hydroperoxyflavin formation and stabilization in a flavoenzyme.


    Wongnate, Thanyaporn; Surawatanawong, Panida; Visitsatthawong, Surawit; Sucharitakul, Jeerus; Scrutton, Nigel S; Chaiyen, Pimchai


    Determination of the mechanism of dioxygen activation by flavoenzymes remains one of the most challenging problems in flavoenzymology for which the underlying theoretical basis is not well understood. Here, the reaction of reduced flavin and dioxygen catalyzed by pyranose 2-oxidase (P2O), a flavoenzyme oxidase that is unique in its formation of C4a-hydroperoxyflavin, was investigated by density functional calculations, transient kinetics, and site-directed mutagenesis. Based on work from the 1970s-1980s, the current understanding of the dioxygen activation process in flavoenzymes is believed to involve electron transfer from flavin to dioxygen and subsequent proton transfer to form C4a-hydroperoxyflavin. Our findings suggest that the first step of the P2O reaction is a single electron transfer coupled with a proton transfer from the conserved residue, His548. In fact, proton transfer enhances the electron acceptor ability of dioxygen. The resulting ·OOH of the open-shell diradical pair is placed in an optimal position for the formation of C4a-hydroperoxyflavin. Furthermore, the C4a-hydroperoxyflavin is stabilized by the side chains of Thr169, His548, and Asn593 in a "face-on" configuration where it can undergo a unimolecular reaction to generate H2O2 and oxidized flavin. The computational results are consistent with kinetic studies of variant forms of P2O altered at residues Thr169, His548, and Asn593, and kinetic isotope effects and pH-dependence studies of the wild-type enzyme. In addition, the calculated energy barrier is in agreement with the experimental enthalpy barrier obtained from Eyring plots. This work revealed new insights into the reaction of reduced flavin with dioxygen, demonstrating that the positively charged residue (His548) plays a significant role in catalysis by providing a proton for a proton-coupled electron transfer in dioxygen activation. The interaction around the N5-position of the C4a-hydroperoxyflavin is important for dictating the

  9. MS/MS and LC-MS/MS analysis of choline/ethanolamine plasmalogens via promotion of alkali metal adduct formation.


    Otoki, Yurika; Nakagawa, Kiyotaka; Kato, Shunji; Miyazawa, Teruo


    Tandem mass spectrometry (MS/MS) has been used for the analysis of plasmalogen (Pls), a physiologically important class of vinyl ether-linked phospholipid. However, MS/MS generally causes little fragmentation of Pls, especially choline Pls (PC-Pls). Previous MS/MS studies reported an increased formation of product ions of PC-Pls (and also ethanolamine Pls (PE-Pls)) in the presence of 'alkali metals.' Therefore, use of alkali metals considerably leads to the development of a method for analysis of both PC- and PE-Pls. In this study, this notion was evaluated using quadrupole-time-of-flight MS/MS and liquid chromatography (LC) coupled with MS/MS. Results from MS/MS confirmed that alkali metals (e.g., sodium) produced significant fragmentation of PC-Pls and PE-Pls. A number of structure-diagnostic product ions exhibiting high intensities were observed under optimized MS/MS conditions using alkali metals. Moreover, the ability to selectively and sensitively identify PC-Pls and PE-Pls at the molecular species level in biological samples (rat brain and heart) was demonstrated using LC-MS/MS. Therefore, the herein developed method appears to be a powerful tool for analyzing Pls and may provide a better understanding of their physiological roles in vivo. PMID:26447938

  10. Cytochrome P4501A induction, benzo[a]pyrene metabolism, and nucleotide adduct formation in fish hepatoma cells: Effect of preexposure to 3,3',4,4',5-pentachlorobiphenyl

    USGS Publications Warehouse

    Smeets, J.M.W.; Voormolen, A.; Tillitt, D.E.; Everaarts, J.M.; Seinen, W.; Vanden Berg, M.D.


    In PLHC-1 hepatoma cells, benzo[a]pyrene (B[a]P) caused a maximum induction of cytochrome P4501A (CYP1A) activity, measured as ethoxyresorufin O-deethylation (EROD), after 4 to 8 h of exposure, depending on the B[a]P concentration. The decline of EROD activity at longer exposure times was probably caused by the rapid metabolism of B[a]P in this system (57% metabolism within 4 h incubation). In subsequent experiments, PLHC-1 cells were preinduced with PCB 126 for 24 h and then received a dose of 10, 100, or 1,000 nM 3H-B[a]P. A 1-nM concentration of PCB 126 caused an 80-fold induction of CYP1A activity, resulting in an increase in B[a]P metabolism of less than 10%, except at the highest concentration of B[a]P (1,000 nM), where a 50% increase was observed. In another experiment, an 80-fold induction of CYP1A activity caused a 20% increase in the metabolism of B[a]P (100 nM), and RNA adduct formation was increased approximately twofold. These results indicate that, at exposure concentrations up to 100 nM B[a]P, CYP1A activity is not rate limiting for B[a]P metabolism. Furthermore, CYP1A seems to also he specifically involved in B[a]P activation in PLHC-1 cells. However, CYP1A induction causes only a relatively small increase in activation, probably because of the action of other enzymes involved in B[a]P activation and deactivation.

  11. Depurinating estrogen-DNA adducts, generators of cancer initiation: their minimization leads to cancer prevention.


    Cavalieri, Ercole L; Rogan, Eleanor G


    Estrogens can initiate cancer by reacting with DNA. Specific metabolites of endogenous estrogens, the catechol estrogen-3,4-quinones, react with DNA to form depurinating estrogen-DNA adducts. Loss of these adducts leaves apurinic sites in the DNA, generating mutations that can lead to the initiation of cancer. A variety of endogenous and exogenous factors can disrupt estrogen homeostasis, which is the normal balance between estrogen activating and protective enzymes. In fact, if estrogen metabolism becomes unbalanced and generates excessive catechol estrogen 3,4-quinones, formation of depurinating estrogen-DNA adducts increases and the risk of initiating cancer is greater. The levels of depurinating estrogen-DNA adducts are high in women diagnosed with breast cancer and those at high risk for the disease. High levels of depurinating estrogen-DNA adducts before the presence of breast cancer indicates that adduct formation is a critical factor in breast cancer initiation. Women with thyroid or ovarian cancer also have high levels of estrogen-DNA adducts, as do men with prostate cancer or non-Hodgkin lymphoma. Depurinating estrogen-DNA adducts are initiators of many prevalent types of human cancer. These findings and other discoveries led to the recognition that reducing the levels of estrogen-DNA adducts could prevent the initiation of human cancer. The dietary supplements N-acetylcysteine and resveratrol inhibit formation of estrogen-DNA adducts in cultured human breast cells and in women. These results suggest that the two supplements offer an approach to reducing the risk of developing various prevalent types of human cancer. Graphical abstract Major metabolic pathway in cancer initiation by estrogens. PMID:26979321

  12. NADH:Cytochrome b5 Reductase and Cytochrome b5 Can Act as Sole Electron Donors to Human Cytochrome P450 1A1-Mediated Oxidation and DNA Adduct Formation by Benzo[a]pyrene

    PubMed Central


    Benzo[a]pyrene (BaP) is a human carcinogen that covalently binds to DNA after activation by cytochrome P450 (P450). Here, we investigated whether NADH:cytochrome b5 reductase (CBR) in the presence of cytochrome b5 can act as sole electron donor to human P450 1A1 during BaP oxidation and replace the canonical NADPH:cytochrome P450 reductase (POR) system. We also studied the efficiencies of the coenzymes of these reductases, NADPH as a coenzyme of POR, and NADH as a coenzyme of CBR, to mediate BaP oxidation. Two systems containing human P450 1A1 were utilized: human recombinant P450 1A1 expressed with POR, CBR, epoxide hydrolase, and cytochrome b5 in Supersomes and human recombinant P450 1A1 reconstituted with POR and/or with CBR and cytochrome b5 in liposomes. BaP-9,10-dihydrodiol, BaP-7,8-dihydrodiol, BaP-1,6-dione, BaP-3,6-dione, BaP-9-ol, BaP-3-ol, a metabolite of unknown structure, and two BaP-DNA adducts were generated by the P450 1A1-Supersomes system, both in the presence of NADPH and in the presence of NADH. The major BaP-DNA adduct detected by 32P-postlabeling was characterized as 10-(deoxyguanosin-N2-yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydro-BaP (assigned adduct 1), while the minor adduct is probably a guanine adduct derived from 9-hydroxy-BaP-4,5-epoxide (assigned adduct 2). BaP-3-ol as the major metabolite, BaP-9-ol, BaP-1,6-dione, BaP-3,6-dione, an unknown metabolite, and adduct 2 were observed in the system using P450 1A1 reconstituted with POR plus NADPH. When P450 1A1 was reconstituted with CBR and cytochrome b5 plus NADH, BaP-3-ol was the predominant metabolite too, and an adduct 2 was also generated. Our results demonstrate that the NADH/cytochrome b5/CBR system can act as the sole electron donor both for the first and second reduction of P450 1A1 during the oxidation of BaP in vitro. They suggest that NADH-dependent CBR can replace NADPH-dependent POR in the P450 1A1-catalyzed metabolism of BaP. PMID:27404282

  13. Lack of Involvement of CEP Adducts in TLR Activation and in Angiogenesis

    PubMed Central

    Gounarides, John; Cobb, Jennifer S.; Zhou, Jing; Cook, Frank; Yang, Xuemei; Yin, Hong; Meredith, Erik; Rao, Chang; Huang, Qian; Xu, YongYao; Anderson, Karen; De Erkenez, Andrea; Liao, Sha-Mei; Crowley, Maura; Buchanan, Natasha; Poor, Stephen; Qiu, Yubin; Fassbender, Elizabeth; Shen, Siyuan; Woolfenden, Amber; Jensen, Amy; Cepeda, Rosemarie; Etemad-Gilbertson, Bijan; Giza, Shelby; Mogi, Muneto; Jaffee, Bruce; Azarian, Sassan


    Proteins that are post-translationally adducted with 2-(ω-carboxyethyl)pyrrole (CEP) have been proposed to play a pathogenic role in age-related macular degeneration, by inducing angiogenesis in a Toll Like Receptor 2 (TLR2)-dependent manner. We have investigated the involvement of CEP adducts in angiogenesis and TLR activation, to assess the therapeutic potential of inhibiting CEP adducts and TLR2 for ocular angiogenesis. As tool reagents, several CEP-adducted proteins and peptides were synthetically generated by published methodology and adduction was confirmed by NMR and LC-MS/MS analyses. Structural studies showed significant changes in secondary structure in CEP-adducted proteins but not the untreated proteins. Similar structural changes were also observed in the treated unadducted proteins, which were treated by the same adduction method except for one critical step required to form the CEP group. Thus some structural changes were unrelated to CEP groups and were artificially induced by the synthesis method. In biological studies, the CEP-adducted proteins and peptides failed to activate TLR2 in cell-based assays and in an in vivo TLR2-mediated retinal leukocyte infiltration model. Neither CEP adducts nor TLR agonists were able to induce angiogenesis in a tube formation assay. In vivo, treatment of animals with CEP-adducted protein had no effect on laser-induced choroidal neovascularization. Furthermore, in vivo inactivation of TLR2 by deficiency in Myeloid Differentiation factor 88 (Myd88) had no effect on abrasion-induced corneal neovascularization. Thus the CEP-TLR2 axis, which is implicated in other wound angiogenesis models, does not appear to play a pathological role in a corneal wound angiogenesis model. Collectively, our data do not support the mechanism of action of CEP adducts in TLR2-mediated angiogenesis proposed by others. PMID:25343517

  14. Significance of DNA adduct studies in animal models for cancer molecular dosimetry and risk assessment.

    PubMed Central

    Beland, F A; Poirier, M C


    To elucidate the relationship between DNA adduct formation and tumorigenesis, a number of experiments have been conducted to measure DNA adducts in target tissues from experimental animals during continuous exposure to carcinogens. With aflatoxins, aromatic amines, and polycyclic aromatic hydrocarbons, tumor induction appears to be associated with the major DNA adduct detected, whereas with N-nitrosamines the response is normally correlated with minor forms of DNA damage. During continuous carcinogen administration, steady-state adduct concentrations are generally obtained in the target tissues, and there is often a linear correlation between the carcinogen concentration and the steady-state DNA adduct level. Exceptions exist when the mechanism of activation changes or with the onset of significant toxicity. Steady-state DNA adduct levels are often linearly related to the tumorigenic response. Carcinogen-induced cell proliferation occurs when significant deviations from linearity are observed. Because DNA adducts detected in humans are chemically identical to those found in experimental animals, DNA adduct data in animals may contribute to our understanding of human cancer risk. PMID:8319658

  15. Benzo(a)pyrene-albumin adducts in humans exposed to polycyclic aromatic hydrocarbons in an industrial area of Poland.

    PubMed Central

    Kure, E H; Andreassen, A; Ovrebø, S; Grzybowska, E; Fiala, Z; Strózyk, M; Chorazy, M; Haugen, A


    OBJECTIVES: The interaction of benzo(a)pyrene with serum albumin was measured in an attempt to identify the actual exposure and to evaluate albumin adduct measurements as biomarkers for exposure monitoring. METHODS: Benzo(a)pyrene-diol-epoxide (BPDE)-albumin adducts were measured by competitive enzyme linked immunosorbent assay (ELISA) in plasma of coke oven plant workers from three plants and from people living in a highly industrialised area of Silesia in Poland. Due to the high air concentrations of polycyclic aromatic hydrocarbons (PAHs) in this area, a control group was selected from a rural non-industrialised area in Poland. Breathing zone air measurements of PAHs were collected from some of the participants. RESULTS: Coke oven plant workers and non-occupationally exposed people had similar concentrations of albumin adducts whereas the rural controls were significantly lower (2.74 fmol adducts/microgram albumin (SEM 0.124)). The mean concentration of BPDE-albumin adduct in plasma of both the occupational and the environmental groups were significantly higher in the summer samples (4.34 fmol adducts/microgram albumin (SEM 0.335) and 4.55 fmol adducts/microgram albumin (SEM 0.296), respectively) than in the winter samples (3.06 fmol adducts/microgram albumin (SEM 0.187) and 3.04 fmol adducts/microgram albumin (SEM 0.184), respectively) even though the air measurements showed higher concentrations of PAHs in the winter. The statistical analysis did not show any effects of air exposures on concentrations of BPDE-albumin adduct. CONCLUSIONS: A multiple regression analysis of the measured concentrations of BPDE-albumin adducts for all the groups, during both seasons, indicates that occupational exposures do not contribute significantly to the formation of adducts. In general, the concentrations of albumin adducts found vary within relatively small limits for the two seasons and between the various groups of participants. No extreme differences were found. PMID

  16. DNA adducts-chemical addons.


    Rajalakshmi, T R; AravindhaBabu, N; Shanmugam, K T; Masthan, K M K


    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers. PMID:26015708

  17. DNA adducts-chemical addons

    PubMed Central

    Rajalakshmi, T. R.; AravindhaBabu, N.; Shanmugam, K. T.; Masthan, K. M. K.


    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers. PMID:26015708

  18. DNA adducts as a measure of lung cancer risk in humans exposed to polycyclic aromatic hydrocarbons.

    PubMed Central

    Kriek, E; Van Schooten, F J; Hillebrand, M J; Van Leeuwen, F E; Den Engelse, L; De Looff, A J; Dijkmans, A P


    Workers in the coking, foundry, and aluminum industry can be exposed to high concentrations of polycyclic aromatic hydrocarbons (PAHs) and are at increased risk for lung cancer, as are cigarette smokers. In recent years several studies on workers in the foundry and coking industries have been reported. In these studies, white blood cell(WBC) DNA was used for analysis of PAH-DNA adducts. Theoretically, DNA adduct formation is a more relevant biological parameter for assessing exposure risk than PAH in the work atmosphere, or the amount of a metabolite in the urine, because adduct levels reflect that part of the dose that escapes detoxification and binds to DNA. We analyzed WBC DNA from coke-oven workers and from workers in an aluminum production plant and demonstrated the presence of PAH-DNA adducts. Forty-seven percent of the coke-oven workers had detectable levels of PAH-DNA adducts in their WBC compared with 27% of the controls (p < 0.05), measured with ELISA. In both groups, smokers had significantly higher levels of PAH-DNA adducts than did nonsmokers. In the aluminum workers, no PAH-DNA adducts were detected by ELISA, although the benzo[a]pyrene concentrations in the work atmosphere were comparable to those of the coke-oven workers. The more sensitive 32P-postlabeling assay showed the presence of PAH-DNA adducts in 91% of the aluminum workers. There was no correlation of WBC adduct levels with the concentration of PAH in the work atmosphere. Recently we showed that total PAH-DNA adduct levels in WBC from lung cancer patients were much higher than those generally found in healthy smokers.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8319662

  19. Line narrowing spectroscopic studies of DNA-carcinogen adducts and DNA-dye complexes

    SciTech Connect

    Suh, Myungkoo


    Laser-induced fluorescence line narrowing and non-line narrowing spectroscopic methods were applied to conformational studies of stable DNA adducts of the 7{beta}, 8{alpha}-dihydoxy-9{alpha}, l0{alpha}-epoxy-7,8,9, 10-tetrahydrobenzo[{alpha}]pyrene (anti-BPDE). Stereochemically distinct (+)-trans-, ({minus})-trans-, (+)-cis- and ({minus})-cis adducts of anti-BPDE bound to exocyclic amino group of the central guanine in an 11-mer oligonucleotide, exist in a mixture of conformations in frozen aqueous buffer matrices. The (+)-trans adduct adopts primarily an external conformation with a smaller fraction ( {approximately} 25 %) exists in a partially base-stacked conformation. Both cis adducts were found to be intercalated with significant {pi}-{pi} stacking interactions between the pyrenyl residues and the bases. Conformations of the trans-adduct of (+)-anti -BPDE in 11-mer oligonucleotides were studied as a function of flanking bases. In single stranded form the adduct at G{sub 2} or G{sub 3} (5 ft-flanking, base guanine) adopts a conformation with strong, interaction with the bases. In contrast, the adduct with a 5ft-flanking, thymine exists in a primarily helixexternal conformation. Similar differences were observed in the double stranded oligonucleotides. The nature of the 3ft-flanking base has little influence on the conformational equilibrium of the (+)-trans-anti BPDE-dG adduct. The formation and repair of BPDE-N{sup 2}-dG in DNA isolated from the skin of mice treated topically with benzo[{alpha}]pyrene (BP) was studied. Low-temperature fluorescence spectroscopy of the intact DNA identified the major adduct as (+)-trans-anti-BPDE-N-dG, and the minor adduct fraction consisted mainly of (+)-cis-anti-BPDE-N{sup 2}-dG.

  20. The boron trifluoride nitromethane adduct

    NASA Astrophysics Data System (ADS)

    Ownby, P. Darrell


    The separation of the boron isotopes using boron trifluoride·organic-donor, Lewis acid·base adducts is an essential first step in preparing 10B enriched and depleted crystalline solids so vital to nuclear studies and reactor applications such as enriched MgB 2, boron carbide, ZrB 2, HfB 2, aluminum boron alloys, and depleted silicon circuits for radiation hardening and neutron diffraction crystal structure studies. The appearance of this new adduct with such superior properties demands attention in the continuing search for more effective and efficient means of separation. An evaluation of the boron trifluoride nitromethane adduct, its thermodynamic and physical properties related to large-scale isotopic separation is presented. Its remarkably high separation factor was confirmed to be higher than the expected theoretical value. However, the reportedly high acid/donor ratio was proven to be an order of magnitude lower. On-going research is determining the crystal structure of deuterated and 11B enriched 11BF 3·CD 3NO 2 by X-ray and neutron diffraction.

  1. Transplatin-conjugated triplex-forming oligonucleotides form adducts with both strands of DNA.


    Campbell, Meghan A; Miller, Paul S


    Triplex-forming oligonucleotides (TFOs) can bind to polypurine x polypyrimidine tracts in DNA and, as a consequence, perturb the normal functioning of a targeted gene. The effectiveness of such antigene TFOs can potentially be enhanced by covalent attachment of the TFO to its DNA target. Here, we report that attachment of N-7-platinated guanine nucleosides to the 3'- and/or 5'-ends of oligopyrimidine TFOs enables these TFOs to form highly stable adducts with target DNA deoxyguanosines or deoxyadenosines that are adjacent to the TFO binding site. Such adduct formation stably anchors the TFO to its target. Depending on the sequences adjacent to the TFO binding site, adduct formation can occur on either strand of the DNA. Adduct formation by 3',5'-bis-platinated TFOs can result in the formation of an interstrand cross-link between both strands of the DNA duplex. Formation of the adducts, which could be reversed by treatment with sodium cyanide, was dependent upon the ability of the TFO to bind to DNA and appeared to occur at a rate slower than that at which the TFO bound to the DNA duplex. The extent of adduct formation at 37 degrees C by platinated deoxyribo-TFOs diminished as the pH was increased from 6.5 to 7.4. In contrast, high levels (approximately 86%) of adduct formation by platinated 2'-O-methylribo-TFOs were observed at both pH 6.5 and pH 7.4. Platinated 2'-O-methylribo-TFOs were also shown to bind to plasmid DNA and inhibit transcription in vitro, and to inhibit plasmid replication in E. coli cells. These results suggest that platinum-conjugated TFOs may be good candidates for use as antigene agents. PMID:19950917

  2. Polycyclic aromatic hydrocarbon-DNA adducts and the CYP1A1 restriction fragment length polymorphism

    SciTech Connect

    Shields, P.G.; Bowman, E.D.; Weston, A.; Harris, C.C.; Sugimura, H.; Caporaso, N.E.; Petruzzelli, S.F. ); Trump, B.F. )


    Human cancer risk assessment at a genetic level involves the investigation of carcinogen metabolism and DNA adduct formation. Wide interindividual differences in metabolism result in different DNA adduct levels. For this and other reasons, many laboratories have considered DNA adducts to be a measure of the biologically effective dose of a carcinogen. Techniques for studying DNA adducts using chemically specific assays are becoming available. A modification of the [sup 32]P-postlabeling assay for polycyclic aromatic hydrocarbon DNA adducts described here provides potential improvements in quantification. DNA adducts, however, reflect only recent exposure to carcinogens; in contrast, genetic testing for metabolic capacity indicates the extent to which carcinogens can be activated and exert genotoxic effects. Such studies may reflect both separate and integrated risk factors together with DNA adduct levels. A recently described restriction fragment length polymorphism for the CYP1A1, which codes for the cytochrome P450 enzyme primarily responsible for the metabolic activation of carcinogenic polycyclic aromatic hydrocarbons, has been found to be associated with lung cancer risk in a Japanese population. In a subset of individuals enrolled in a US lung cancer case-control study, no association with lung cancer was found. 17 refs., 3 figs.

  3. The Frequency of 1,4-Benzoquinone-Lysine Adducts in Cytochrome c Correlate with Defects in Apoptosome Activation

    PubMed Central

    Fisher, Ashley A.; Labenski, Matthew T.; Chapman, John D.; Bratton, Shawn B.; Monks, Terrence J.; Lau, Serrine S.


    Electrophile-mediated post-translational modifications (PTMs) are known to cause tissue toxicities and disease progression. These effects are mediated via site-specific modifications and structural disruptions associated with such modifications. 1,4-Benzoquinone (BQ) and its quinone-thioether metabolites are electrophiles that elicit their toxicity via protein arylation and the generation of reactive oxygen species. Site-specific BQ-lysine adducts are found on residues in cytochrome c that are necessary for protein-protein interactions, and these adducts contribute to interferences in its ability to facilitate apoptosome formation. To further characterize the structural and functional impact of these BQ-mediated PTMs, the original mixture of BQ-adducted cytochrome c was fractionated by liquid isoelectric focusing to provide various fractions of BQ-adducted cytochrome c species devoid of the native protein. The fractionation process separates samples based on their isoelectric point (pI), and because BQ adducts form predominantly on lysine residues, increased numbers of BQ adducts on cytochrome c correlate with a lower protein pI. Each fraction was analyzed for structural changes, and each was also assayed for the ability to support apoptosome-mediated activation of caspase-3. Circular dichroism revealed that several of the BQ-adducted cytochrome c species maintained a slightly more rigid structure in comparison to native cytochrome c. BQ-adducted cytochrome c also failed to activate caspase-3, with increasing numbers of BQ-lysine adducts corresponding to a greater inability to activate the apoptosome. In summary, the specific site of the BQ-lysine adducts, and the nature of the adduct, are important determinants of the subsequent structural changes to cytochrome c. In particular, adducts at sites necessary for protein-protein interactions interfere with the proapoptotic function of cytochrome c. PMID:21527774

  4. 7-Alkylguanine adduct levels in urine, lungs and liver of mice exposed to styrene by inhalation

    SciTech Connect

    Vodicka, Pavel Erik . E-mail:; Linhart, Igor; Novak, Jan; Koskinen, Mikko; Vodickova, Ludmila; Hemminki, Kari


    This study describes urinary excretion of two nucleobase adducts derived from styrene 7,8-oxide (SO), i.e., 7-(2-hydroxy-1-phenylethyl)guanine (N7{alpha}G) and 7-(2-hydroxy-2-phenylethyl)guanine (N7{beta}G), as well as a formation of N7-SO-guanine adducts in lungs and liver of two month old male NMRI mice exposed to styrene by inhalation in a 3-week subacute study. Strikingly higher excretion of both isomeric nucleobase adducts in the first day of exposure was recorded, while the daily excretion of nucleobase adducts in following time intervals reached the steady-state level at 4.32 + 1.14 and 6.91 + 1.17 pmol/animal for lower and higher styrene exposure, respectively. {beta}-SO-guanine DNA adducts in lungs increased with exposure in a linear way (F = 13.7 for linearity and 0.17 for non-linearity, respectively), reaching at the 21st day the level of 23.0 adducts/10{sup 8} normal nucleotides, i.e., 0.74 fmol/{mu}g DNA of 7-alkylguanine DNA adducts for the concentration of 1500 mg/m{sup 3}, while no 7-SO-guanine DNA adducts were detected in the liver after 21 days of inhalation exposure to both of styrene concentrations. A comparison of 7-alkylguanines excreted in urine with 7-SO-guanines in lungs (after correction for depurination and for missing {alpha}-isomers) revealed that persisting 7-SO-guanine DNA adducts in lungs account for about 0.5% of the total alkylation at N7 of guanine. The total styrene-specific 7-guanine alkylation accounts for about 1.0 x 10{sup -5}% of the total styrene uptake, while N1-adenine alkylation contributes to this percentage only negligibly.

  5. The effect of knockout of sulfotransferases 1a1 and 1d1 and of transgenic human sulfotransferases 1A1/1A2 on the formation of DNA adducts from furfuryl alcohol in mouse models.


    Sachse, Benjamin; Meinl, Walter; Glatt, Hansruedi; Monien, Bernhard H


    Furfuryl alcohol is a rodent carcinogen present in numerous foodstuffs. Sulfotransferases (SULTs) convert furfuryl alcohol into the DNA reactive and mutagenic 2-sulfoxymethylfuran. Sensitive techniques for the isotope-dilution ultra performance liquid chromatography-tandem mass spectrometry quantification of resulting DNA adducts, e.g. N (2)-((furan-2-yl)methyl)-2'-deoxyguanosine (N (2)-MF-dG), were developed. To better understand the contribution of specific SULT forms to the genotoxicity of furfuryl alcohol in vivo, we studied the tissue distribution of N (2)-MF-dG in different mouse models. Earlier mutagenicity studies with Salmonella typhimurium strains expressing different human and murine SULT forms indicated that human SULT1A1 and murine Sult1a1 and 1d1 catalyze furfuryl alcohol sulfo conjugation most effectively. Here, we used three mouse lines to study the bioactivation of furfuryl alcohol by murine SULTs, FVB/N wild-type (wt) mice and two genetically modified models lacking either murine Sult1a1 or Sult1d1. The animals received a single dose of furfuryl alcohol, and the levels of the DNA adducts were determined in liver, kidney, lung, colon and small intestine. The effect of Sult1d1 gene disruption on the genotoxicity of furfuryl alcohol was moderate and limited to kidney and small intestine. In contrast, the absence of functional Sult1a1 had a massive influence on the adduct levels, which were lowered by 33-73% in all tissues of the female Sult1a1 null mice compared with the wt animals. The detection of high N (2)-MF-dG levels in a humanized mouse line expressing hSULT1A1/1A2 instead of endogeneous Sult1a1 and Sult1d1 supports the hypothesis that furfuryl alcohol is converted to the mutagenic 2-sulfoxymethylfuran also in humans. PMID:25053625

  6. Metabolism of the Antibacterial Triclocarban by Human Epidermal Keratinocytes to Yield Protein Adducts

    PubMed Central

    Schebb, Nils Helge; Buchholz, Bruce A.; Hammock, Bruce D.; Rice, Robert H.


    Previous studies of triclocarban suggest that its biotransformation could yield reactive metabolites that form protein adducts. Since the skin is the major route of triclocarban exposure, present work examined this possibility in cultured human keratinocytes. The results provide evidence for considerable biotransformation and protein adduct formation when cytochrome P450 activity is induced in the cells by TCDD, a model Ah receptor ligand. Since detecting low adduct levels in cells and tissues is difficult, we utilized the novel approach of accelerator mass spectrometry for this purpose. Exploiting the sensitivity of the method, we demonstrated that a substantial portion of triclocarban forms adducts with keratinocyte protein under the P450 inducing conditions employed. PMID:22711420

  7. Abacavir forms novel cross-linking abacavir protein adducts in patients.


    Meng, Xiaoli; Lawrenson, Alexandre S; Berry, Neil G; Maggs, James L; French, Neil S; Back, David J; Khoo, Saye H; Naisbitt, Dean J; Park, B Kevin


    Abacavir (ABC), a nucleoside-analogue reverse transcriptase inhibitor, is associated with severe hypersensitivity reactions that are thought to involve the activation of CD8+ T cells in a HLA-B*57:01-restricted manner. Recent studies have claimed that noncovalent interactions of ABC with HLA-B*57:01 are responsible for the immunological reactions associated with ABC. However, the formation of hemoglobin-ABC aldehyde (ABCA) adducts in patients exposed to ABC suggests that protein conjugation might represent a pathway for antigen formation. To further characterize protein conjugation reactions, we used mass spectrometric methods to define ABCA modifications in patients receiving ABC therapy. ABCA formed a novel intramolecular cross-linking adduct on human serum albumin (HSA) in patients and in vitro via Michael addition, followed by nucleophilic adduction of the aldehyde with a neighboring protein nucleophile. Adducts were detected on Lys159, Lys190, His146, and Cys34 residues in the subdomain IB of HSA. Only a cysteine adduct and a putative cross-linking adduct were detected on glutathione S-transferase Pi (GSTP). These findings reveal that ABC forms novel types of antigens in all patients taking the drug. It is therefore vital that the immunological consequences of such pathways of haptenation are explored in the in vitro models that have been used by various groups to define new mechanisms of drug hypersensitivity exemplified by ABC. PMID:24571427

  8. Cigarette smoke-induced DNA adducts in the respiratory and nonrespiratory tissues of rats

    SciTech Connect

    Gairola, C.G.; Gupta, R.C. )


    Formation of DNA adducts is regarded as an essential initial step in the process of chemical carcinogenesis. To determine how chronic exposure to cigarette smoke affects the distribution of DNA adducts in selected respiratory and nonrespiratory tissues. The authors exposed male Sprague-Dawley rats daily to fresh mainstream smoke from the Univ. of Kentucky reference cigarettes (2R1) in a nose-only exposure system for 32 weeks. Blood carboxyhemoglobin, total particulate matter (TPM) intake, and pulmonary aryl hydrocarbon hydroxylase values indicated effective exposure of animals to cigarette smoke. DNA was extracted from three respiratory (larynx, trachea, and lung) and three nonrespiratory (liver, heart, and bladder) tissues and analyzed for DNA adducts by the {sup 32}P-postlabeling assay under conditions capable of detecting low levels of diverse aromatic/hydrophobic adducts. Data showed that the total DNA adducts in the lung, heart, and trachea, and larynx were increased by 10- to 20-fold in the smoke-exposed group. These data suggest selective formation of DNA adducts in the tissues.

  9. Recognition of cisplatin adducts by cellular proteins.


    Kartalou, M; Essigmann, J M


    Cisplatin is a widely used chemotherapeutic agent. It reacts with nucleophilic bases in DNA and forms 1,2-d(ApG), 1,2-d(GpG) and 1,3-d(GpTpG) intrastrand crosslinks, interstrand crosslinks and monofunctional adducts. The presence of these adducts in DNA is through to be responsible for the therapeutic efficacy of cisplatin. The exact signal transduction pathway that leads to cell cycle arrest and cell death following treatment with the drug is not known but cell death is believed to be mediated by the recognition of the adducts by cellular proteins. Here we describe the structural information available for cisplatin and related platinum adducts, the interactions of the adducts with cellular proteins and the implications of these interactions for cell survival. PMID:11406166

  10. Thermal stability of DNA adducts induced by cyanomorpholinoadriamycin in vitro.

    PubMed Central

    Cullinane, C; Phillips, D R


    The Adriamycin derivative, cyanomorpholinoadriamycin (CMA) was reacted with DNA in vitro to form apparent interstrand crosslinks. The extent of interstrand crosslink formation was monitored by a gel electrophoresis assay and maximal crosslinking of DNA was observed within 1 hr with 5 microM of drug. The interstrand crosslinks were heat labile, with a midpoint melting temperature of 70 degrees C (10 min exposure to heat) in 45% formamide. When CMA-induced adducts were detected as blockages of lambda-exonuclease, 12 blockage sites were observed with 8 being prior to 5'-GG sequences, one prior to 5'-CC, one prior to 5'-GC and 2 at unresolved combinations of these sequences. These exonuclease-detected blockages reveal the same sites of CMA-induced crosslinking as detected by in vitro transcription footprinting and primer-extension blockages on single strand DNA, where the blockages at 5'-GG and 5'-CC were identified as sites of intrastrand crosslinking and the 5'-GC blockage as a probable site of interstrand crosslinking. The thermal stability of both types of crosslink (10 min exposure to heat) ranged from 63-70 degrees C at individual sites. High levels of adduct were detected with poly (dG-dC) but not with poly (dI-dC). These results suggest adduct formation involving an aminal linkage between the 3 position of the morpholino moiety and N2 of guanine. Images PMID:8493102

  11. Structural Characterization of Hydroxyl Radical Adducts in Aqueous Media

    NASA Astrophysics Data System (ADS)

    Janik, Ireneusz; Tripathi, G. N. R.


    The oxidation by the hydroxyl (OH) radical is one of the most widely studied reactions because of its central role in chemistry, biology, organic synthesis, and photocatalysis in aqueous environments, wastewater treatment, and numerous other chemical processes. Although the redox potential of OH is very high, direct electron transfer (ET) is rarely observed. If it happens, it mostly proceeds through the formation of elusive OH adduct intermediate which facilitates ET and formation of hydroxide anion. Using time resolved resonance Raman technique we structurally characterized variety of OH adducts to sulfur containing organic compounds, halide ions as well as some metal cations. The bond between oxygen of OH radical and the atom of oxidized molecule differs depending on the nature of solute that OH radical reacts with. For most of sulfur containing organics, as well as halide and pseudo-halide ions, our observation suggested that this bond has two-center three-electron character. For several metal aqua ions studied, the nature of the bond depends on type of the cation being oxidized. Discussion on spectral parameters of all studied hydroxyl radical adducts as well as the role solvent plays in their stabilization will be presented.

  12. The formation of cyclo-addition adducts in the reaction of an acetylene-terminated material with a bismaleimide: A model compound study for addition-type thermoplastics (ATTs) using metal catalysts

    SciTech Connect

    Soucek, M.D., Pater, R.H.; Ritenour, S.L.


    A model compound study using an acetylene-terminated material and a bismaleimide has provided evidence that a diruthenium complex Ru{sub 2}(CO){sub 6}[1,2-({mu}-PPh){sub 2}C{sub 6}H{sub 4}] and a rhodium complex Rh(PPh{sub 3}){sub 3}Cl can catalyze a Diels-Alder type cycloaddition in which acetylene-terminated material acts as a diene and the bismaleimide is a dieneophile. The molten state reaction of N-(3-ethynylphenyl) phthalimide and N-(4-phenoxyphenyl) maleimide with Ru{sub 2}(CO){sub 6}[{mu}-(PhP){sub 2}C{sub 6}H{sub 4}] or Rh(PPh{sub 3}){sub 3}Cl heated to 170{degrees}C led to two major products. The spectral data for the first major product is consistent with a 2:1 Diels-Alder adduct formed from two molecules of the acetylene compound and one molecule of the maleimide. The spectral data for the second major product is consistent with a 2:2 Diels-Alder adduct formed from two molecules of each reactant.

  13. Crystal structure of the 1,3,6,8-tetra­aza­tri­cyclo[,8]undecane (TATU)–4-nitro­phenol (1/2) adduct: the role of anomeric effect in the formation of a second hydrogen-bond inter­action

    PubMed Central

    Rivera, Augusto; Osorio, Héctor Jairo; Uribe, Juan Manuel; Ríos-Motta, Jaime; Bolte, Michael


    In the title ternary co-crystalline adduct, C7H14N4·2C6H5NO3, mol­ecules are linked by two inter­molecular O—H⋯N hydrogen bonds, forming a tricomponent aggregates in the asymmetric unit. The hydrogen-bond formation to one of the N atoms is enough to induce structural stereoelectronic effects in the normal donor→acceptor direction. In the title adduct, the two independent nitro­phenol mol­ecules are essentially planar, with maximum deviations of 0.0157 (13) and 0.0039 (13) Å. The dihedral angles between the planes of the nitro group and the attached benzene rings are 4.04 (17) and 5.79 (17)°. In the crystal, aggregates are connected by C—H⋯O hydrogen bonds, forming a supra­molecular dimer enclosing an R 6 6(32) ring motif. Additional C—H⋯O inter­molecular hydrogen-bonding inter­actions form a second supra­molecular inversion dimer with an R 2 2(10) motif. These units are linked via C—H⋯O and C—H⋯N hydrogen bonds, forming a three-dimensional network. PMID:26594510

  14. Crystal structure of the 1,3,6,8-tetra-aza-tri-cyclo[,8)]undecane (TATU)-4-nitro-phenol (1/2) adduct: the role of anomeric effect in the formation of a second hydrogen-bond inter-action.


    Rivera, Augusto; Osorio, Héctor Jairo; Uribe, Juan Manuel; Ríos-Motta, Jaime; Bolte, Michael


    In the title ternary co-crystalline adduct, C7H14N4·2C6H5NO3, mol-ecules are linked by two inter-molecular O-H⋯N hydrogen bonds, forming a tricomponent aggregates in the asymmetric unit. The hydrogen-bond formation to one of the N atoms is enough to induce structural stereoelectronic effects in the normal donor→acceptor direction. In the title adduct, the two independent nitro-phenol mol-ecules are essentially planar, with maximum deviations of 0.0157 (13) and 0.0039 (13) Å. The dihedral angles between the planes of the nitro group and the attached benzene rings are 4.04 (17) and 5.79 (17)°. In the crystal, aggregates are connected by C-H⋯O hydrogen bonds, forming a supra-molecular dimer enclosing an R 6 (6)(32) ring motif. Additional C-H⋯O inter-molecular hydrogen-bonding inter-actions form a second supra-molecular inversion dimer with an R 2 (2)(10) motif. These units are linked via C-H⋯O and C-H⋯N hydrogen bonds, forming a three-dimensional network. PMID:26594510

  15. Studies of two-center three-electron S...S bonds in [n-Pr{sub 2}S...Sn-Pr{sub 2}]{sup +} and [i-Pr{sub 2}S...Si-Pr{sub 2}]{sup +}: Thermochemistry of adduct formation and MS/MS metastable and collision-induced dissociation spectra of the adducts

    SciTech Connect

    James, M.A.; Illies, A.J.


    Gas-phase ion-molecule association reactions of n-propyl sulfide radical cation ([n-Pr{sub 2}S]{sup +}) with n-propyl sulfide (n-Pr{sub 2}S) were studied by equilibrium methods in CO{sub 2} bath gas to investigate the bond energy of the 2c-3e bond. The 2c-3e S...S bond enthalpy in [n-Pr{sub 2}S...Sn-Pr{sub 2}]{sup +} was determined to be 119 kJ/mol at 507 K. This results in a scaled S...S bond energy of 123 kJ/mol. The S...S bond enthalpy in the i-propyl sulfide dimer cation ([i-Pr{sub 2}S...Si-Pr{sub 2}]{sup +}) could not be determined due to a fragmentation reaction, the loss of an i-propyl group. MS/MS metastable and collision-induced dissociation experiments were carried out to determine metastable fragmentation pathways and to aid in structure analysis. The results are consistent with association products containing 2c-3e bonds; statistical unimolecular metastable fragmentation of the association adduct, [i-Pr{sub 2}S...Si-Pr{sub 2}]{sup +}, confirms the loss of the i-propyl group, which prevented the equilibrium experiments. 21 refs., 11 figs., 1 tab.

  16. DNA adducts of 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) in fetal tissues of patas monkeys after transplacental exposure.


    Josyula, S; Lu, L J; Salazar, J J; Nerurkar, P V; Jones, A B; Grady, J J; Snyderwine, E G; Anderson, L M


    Transplacental genotoxicity of the heterocyclic amine food-derived mutagen/carcinogen 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) has been investigated by (32)P-postlabeling assay for IQ-DNA adducts in maternal liver, placenta, and several fetal tissues of patas monkeys, after exposure to 15, 35, or 50 mg/kg IQ near the end of gestation or to the highest dose in the first or second trimester. Dose-dependent adduct formation occurred in all tissues, with the highest levels occurring in maternal liver. Adduct amounts were similar among fetal tissues and placenta, except for lower levels in fetal brain and slightly more adducts in fetal liver. Adducts in placenta, fetal liver, lung, kidney, skin, and adrenal gland, but not in maternal liver or fetal brain, increased significantly as gestation progressed. Pretreatment with phenobarbital, which induces CYP enzymes that detoxify IQ, decreased adducts in maternal liver and possibly placenta, but not in fetal tissues. The CYP inducer beta-naphthoflavone caused a significant increase in IQ-DNA adducts in fetal lungs. Regression analysis suggested that IQ activation in maternal and fetal liver and possibly placenta contributed to adduct formation in fetal tissues; adducts in placenta and/or fetal liver were strong predictors for those in most fetal tissues. The results indicate that exposure of pregnant primates to IQ results in DNA adduct formation in most fetal tissues, especially late in gestation; that upregulation of maternal detoxification does not provide fetal protection; and that adducts in placenta indicate adduct levels in fetal tissues. PMID:10906279

  17. [DNA adducts in human female genital organs].


    Postawski, Krzysztof; Przadka-Rabaniuk, Dorota; Monist, Marta; Baranowski, Włodzimierz


    DNA adducts, one of genetic damages markers, precede and finally can lead to oncogenic mutations. They appear in genome as a result of DNA bases damages caused by various and numerous environmental factors eg. ultraviolet light, ionic radiation, toxins and also endogenic substances, for example estrogens. It is believed that the creation of DNA adducts is a necessary but insufficient process for the neoplastic transformation of the cell. The following review presents concise knowledge about the DNA adducts creation and their sequels served in healthy and cancerous tissues of the female genital organs, on the base of the available data. PMID:18411923

  18. Malondialdehyde–Deoxyguanosine Adducts among Workers of a Thai Industrial Estate and Nearby Residents

    PubMed Central

    Peluso, Marco; Srivatanakul, Petcharin; Munnia, Armelle; Jedpiyawongse, Adisorn; Ceppi, Marcello; Sangrajrang, Suleeporn; Piro, Sara; Boffetta, Paolo


    Background Humans living near industrial point emissions can experience high levels of exposures to air pollutants. Map Ta Phut Industrial Estate in Thailand is the location of the largest steel, oil refinery, and petrochemical factory complexes in Southeast Asia. Air pollution is an important source of oxidative stress and reactive oxygen species, which interact with DNA and lipids, leading to oxidative damage and lipid peroxidation, respectively. Objective We measured the levels of malondialdehyde–deoxyguanosine (dG) adducts, a biomarker of oxidative stress and lipid peroxidation, in petrochemical workers, nearby residents, and subjects living in a control district without proximity to industrial sources. Design We conducted a cross-sectional study to compare the prevalence of malondialdehyde-dG adducts in groups of subjects experiencing various degrees of air pollution. Results The multivariate regression analysis shows that the adduct levels were associated with occupational and environmental exposures to air pollution. The highest adduct level was observed in the steel factory workers. In addition, the formation of DNA damage tended to be associated with tobacco smoking, but without reaching statistical significance. A nonsignificant increase in DNA adducts was observed after 4–6 years of employment among the petrochemical complexes. Conclusions Air pollution emitted from the Map Ta Phut Industrial Estate complexes was associated with increased adduct levels in petrochemical workers and nearby residents. Considering the mutagenic potential of DNA lesions in the carcinogenic process, we recommend measures aimed at reducing the levels of air pollution. PMID:20056580

  19. In situ detection of acetylaminofluorene-DNA adducts in human cells using monoclonal antibodies.


    Iwamoto, Taka-aki; Kobayashi, Nobuhiko; Imoto, Kyoko; Yamamoto, Aya; Nakamura, Yu; Yamauchi, Yukika; Okumura, Hiromi; Tanaka, Akiko; Hanaoka, Fumio; Shibutani, Shinya; Miyagawa, Sachiko; Mori, Toshio


    The present study was performed to generate monoclonal antibodies capable of detecting N-acetoxy-2-acetylaminofluorene (NA-AAF)-derived DNA adducts in human cells in situ. As an immunogen, we employed NA-AAF-modified single-stranded DNA coupled electrostatically to methylated protein and we produced five different monoclonal antibodies. All of them showed strong binding to NA-AAF-modified DNA, but had undetectable or minimal binding to undamaged DNA. Competitive inhibition experiments revealed that the epitope recognized by these antibodies is N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-C8-AAF) in DNA, although deacetylated N-(deoxyguanosin-8-yl)-2-aminofluorene in DNA is also recognized with slightly less efficiency. In contrast, these antibodies did not bind to 3-(deoxyguanosin-N(2)-yl)-2-acetylaminofluorene in DNA or to UV-induced lesions in DNA. Interestingly, they showed only minimal binding to small AAF-nucleoside adducts (dG-C8-AAF), indicating that DNA regions flanking a DNA-bound adduct, in addition to the adduct itself, are essential for the stable binding of the antibodies. Using an enzyme-linked immunosorbent assay with the most promising antibody (AAF-1), we detected the concentration-dependent induction of NA-AAF-modified adducts in DNA from repair deficient xeroderma pigmentosum (XP) cells treated with physiological concentrations of NA-AAF. Moreover, the assay enabled to confirm that normal human cells efficiently repaired NA-AAF-induced DNA adducts but not XP-A cells. Most importantly, the formation of NA-AAF-induced DNA adducts in individual nuclei of XP cells could be clearly visualized using indirect immunofluorescence. Thus, we succeeded in establishing novel monoclonal antibodies capable of the in situ detection of NA-AAF-induced DNA adducts in human cells. PMID:15380103

  20. DNA adducts in human carcinogenesis: etiological relevance and structure-activity relationship.


    Bartsch, H


    '-monophosphates. Liver DNA from unexposed rats, mice and from human samples contained background levels of epsilon dA and epsilon dC (Bartsch et al. (1994) Drug. Metab. Rev., 26, 349-371). As formation of epsilon dA and epsilon dC adducts by lipid peroxidation products was demonstrated (El Ghissassi et al. (1995) Chem. Res. Toxicol., 8, 278-283), they may serve as markers for oxidative stress. Results from testing this hypothesis are presented. PMID:8692183

  1. Metabolic activation of 2‐amino‐1‐methyl‐6‐phenylimidazo [4,5‐b]pyridine and DNA adduct formation depends on p53: Studies in T rp53(+/+),T rp53(+/−) and T rp53(−/−) mice

    PubMed Central

    Krais, Annette M.; Speksnijder, Ewoud N.; Melis, Joost P.M.; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H.


    The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)‐mediated biotransformation. The carcinogen 2‐amino‐1‐methyl‐6‐phenylimidazo[4,5‐b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/−) and Trp53(−/−) mice with a single oral dose of 50 mg/kg body weight PhIP. N‐(Deoxyguanosin‐8‐yl)‐2‐amino‐1‐methyl‐6‐phenylimidazo[4,5‐b]pyridine (PhIP‐C8‐dG) levels in DNA, measured by liquid chromatography‐tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(−/−) mice compared to Trp53(+/+) mice. Lower PhIP‐DNA adduct levels in the livers of Trp53(−/−) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin‐O‐demethylase activity) in these animals. Interestingly, PhIP‐DNA adduct levels were significantly higher in kidney and bladder of Trp53(−/−) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2‐naphthylsulfate formation from 2‐naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue‐dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP‐DNA adduct formation. PMID:26335255

  2. Adenine-DNA adducts derived from the highly tumorigenic dibenzo[a,l]pyrene are resistant to nucleotide excision repair while guanine adducts are not

    PubMed Central

    Kropachev, Konstantin; Kolbanovskiy, Marina; Liu, Zhi; Cai, Yuqin; Zhang, Lu; Schwaid, Adam G.; Kolbanovskiy, Alexander; Ding, Shuang; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.


    The structural origins of differences in susceptibilities of various DNA lesions to nucleotide excision repair (NER) are poorly understood. Here we compared, in the same sequence context, the relative NER dual incision efficiencies elicited by two stereochemically distinct pairs of guanine (N2-dG) and adenine (N6-dA) DNA lesions, derived from enantiomeric genotoxic diol epoxides of the highly tumorigenic fjord region polycyclic aromatic hydrocarbon dibenzo[a,l]pyrene (DB[a,l]P). Remarkably, in cell-free HeLa cell extracts, the guanine adduct with R absolute chemistry at the N2-dG linkage site is ~ 35 times more susceptible to NER dual incisions than the stereochemically identical N6-dA adduct. For the guanine and adenine adducts with S stereochemistry, a similar, but somewhat smaller effect (factor of ~15) is observed. The striking resistance of the bulky N6-dA in contrast to the modest to good susceptibilities of the N2-dG adducts to NER are interpreted in terms of the balance between lesion-induced DNA-distorting and DNA-stabilizing van der Waals interactions in their structures, that are partly reflected in the overall thermal stabilities of the modified duplexes. Our results are consistent with the hypothesis that the high genotoxic activity of DB[a,l]P is related to the formation of NER-resistant and persistent DB[a,l]P-derived adenine adducts in cellular DNA. PMID:23570232

  3. Characterization of the lysyl adducts of prostaglandin H-synthases that are derived from oxygenation of arachidonic acid.


    Boutaud, O; Brame, C J; Chaurand, P; Li, J; Rowlinson, S W; Crews, B C; Ji, C; Marnett, L J; Caprioli, R M; Roberts, L J; Oates, J A


    These investigations characterize the covalent binding of reactive products of prostaglandin H-synthases (PGHSs) to the enzyme and to other molecules. The intermediate product of oxygenation of arachidonic acid by the PGHSs, prostaglandin (PG) H2, undergoes rearrangement to the highly reactive gamma-keto aldehydes, levuglandin (LG) E2 and D2. We previously have demonstrated that LGE2 reacts with the epsilon-amine of lysine to form both the lysyl-levuglandin Shiff base and the pyrrole-derived lysyl-levuglandin lactam adducts. We now demonstrate that these lysyl-levuglandin adducts are formed on the PGHSs following the oxygenation of arachidonic acid; after reduction of the putative Schiff base, proteolytic digestion of the enzyme, and isolation of the adducted amino acid residues, these adducts were identified by liquid chromatography-tandem mass spectrometry. The reactivity of the LGs is reflected by the finding that virtually all of the LG predicted to be formed from PGH2 can be accounted for as adducts of the PGH-synthase and that oxygenation of arachidonic acid by PGH-synthases also leads to the formation of adducts of other proteins present in the reaction solution. The reactivity of the PGH-synthase adducts themselves is demonstrated by the formation of intermolecular cross-links. PMID:11389610

  4. Fruit and vegetable and fried food consumption and 3-(2-deoxy-β-D-erythro-pentafuranosyl)pyrimido[1,2-α]purin-10(3H)-one deoxyguanosine adduct formation

    PubMed Central



    Diet has been shown to modulate M1dG adduct, a biomarker of oxidative stress and lipid peroxidation. Thus, we analysed the association between diet and M1dG in 120 controls and 67 Map Ta Phut industrial estate workers, Rayong, Thailand to evaluate the influence of fruit and vegetables, and fried and charcoal-grilled/barbecued food consumption on M1dG. M1dG was decreased in controls reporting to consume 14–17 servings/week of fruit and vegetables [Mean Ratio (MR)=0.35, C.I. 0.18–0.69, p<0.05]. Conversely, a non-statistically significant M1dG increment was detected in controls consuming 9–18 servings/week of fried food (MR=1.33, C.I. 0.88–2.00, p=0.168). No effect of charcoal-grilled/barbecued food was found. No effect of diet was observed in workers. An association with smoking was observed in controls (MR=1.88, C.I. 1.14–3.10, p<0.05), but not in workers. M1dG can induce mutations and/or methylation changes within the promoter regions of cancer-related genes, thus promotion of healthy eating practices should be recommended. PMID:22081860

  5. DNA adducts and carcinogenicity of nitro-polycyclic aromatic hydrocarbons

    SciTech Connect

    Fu, P.P.; Herreno-Saenz, D.; Von Tungeln, L.S.


    We have been interested in the structure-activity relationships of nitro-polycyclic aromatic hydrocarbons (nitro-PAHs), and have focused on the correlation of structural and electronic features with biological activities, including mutagenicity and tumorigenicity. In our studies, we have emphasized 1-, 2-, 3-, and 6-nitrobenzo[a]pyrenes (nitro-B[a]Ps) and related compounds, all of which are derived from the potent carcinogen benzo[a]pyrene. While 1-, 2-, and 3-nitro-B[a]P are potent mutagens in Salmonella, 6-nitro-B[a]P is a weak mutagen. In vitro metabolism of 1- and 3-nitro-B[a]P has been found to generate multiple pathways for mutagenic activation. The formation of the corresponding trans-7,8-dihydrodiols and 7,8,9,10-tetrahydrotetrols suggests that 1- and 3-nitro-B[a]P trans-7,8-diol-anti-9, 10--epoxides are ultimate metabolites of the parent nitro-B[a]Ps. We have isolated a DNA adduct from the reaction between 3-nitro-B[a]P trans-7,8-diol-anti-9, 10-epoxide and calf thymus DNA, and identified it as 10-(deoxyguanosin-N{sup 2}-yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydro-3-nitro-B[a]P. The same adduct was identified from in vitro metabolism of [{sup 3}H]3-nitro-B[a]P by rat liver microsomes in the presence of calf thymus DNA. A DNA adduct of 3-nitro-B[a]P formed from reaction of N-hydroxy-3-amino-B[a]P, prepared in situ with calf thymus DNA was also isolated. This adduct was identified as 6-(deoxyguanosin-N{sup 2}-yl)-3-amino-B[a]P. The same adduct was obtained from incubating DNA with 3-nitro-B[a]P in the presence of the mammalian nitroreductase, xanthine oxidase, and hypoxanthine. 48 refs., 6 figs., 1 tab.

  6. p53 controls global nucleotide excision repair of low levels of structurally diverse benzo(g)chrysene-DNA adducts in human fibroblasts.


    Lloyd, Daniel R; Hanawalt, Philip C


    Benzo(g)chrysene is a widespread environmental contaminant and potent carcinogen. We have measured the formation and nucleotide excision repair of covalent DNA adducts formed by the DNA-reactive metabolite of this compound in human fibroblasts, in which expression of the p53 tumor suppressor gene could be controlled by a tetracycline-inducible promoter. Cells were exposed for 1 h to 0.01, 0.1, or 1.2 microM (+/-)-anti-benzo(g)chrysene diol-epoxide, and DNA adducts were assessed at various post-treatment times by subjecting isolated DNA to (32)P-postlabeling analysis. Four major DNA adducts were detected, corresponding to the reaction of either the (+)- or (-)-anti-benzo(g)chrysene diol-epoxide stereoisomer with adenine or guanine. Treatment with 1.2 microM resulted in a level of 1100 total adducts/10(8) nucleotides for both p53-proficient and -deficient cells; removal of adducts was not observed in either case. In cells treated with 0.1 microM, the maximum level of total adducts at 24 h was 150/10(8) nucleotides in p53-proficient cells and 210 adducts/10(8) nucleotides in p53-deficient cells. A concentration of 0.01 microM resulted in a maximum of 20 adducts/10(8) nucleotides in p53-proficient cells at 4 h, but 40 adducts/10(8) nucleotides persisted in p53-deficient cells at 24 h. Whereas there were clear differences in the time course of adduct levels in p53-proficient compared with p53-deficient cells treated with 0.1 microM or 0.01 microM, these levels did not decrease extensively over 3 days. This is likely because of the stabilization of the diol-epoxide in cells, and consequent exposure and formation of adducts for many hours after the initial treatment. Furthermore, despite minor quantitative differences, all 4 of the adducts behaved similarly with respect to the effect of p53 expression on their removal. p53 appears to minimize the appearance of benzo(g)chrysene adducts in human cells by up-regulating global nucleotide excision repair and reducing the

  7. Characterization of DNA adducts of the carcinogen N-methyl-4-aminoazobenzene in vitro and in vivo.


    Beland, F A; Tullis, D L; Kadlubar, F F; Straub, K M; Evans, F E


    Since the susceptibility of specific tissues to tumor formation has been correlated with the persistence of DNA-carcinogen adducts, the identity and persistence of DNA adducts formed from the hepatocarcinogen N-methyl-4-aminoazobenzene (MAB) has been determined. The synthetic ultimate carcinogen N-benzoyloxy-N-methyl-4-aminoazobenzene (N-BxO-MAB) was reacted in vitro with either calf thymus or rat liver DNA to yield approx. 1 bound residue per 1000 nucleotides. After enzymatic hydrolysis of the DNA and high pressure liquid chromatographic analysis, at least six MAB adducts were detected. Two of the products cochromatographed with MAB-DNA adducts formed in rat liver in vivo following oral administration of the precarcinogen MAB. These two adducts were identified by mass, UV and nuclear magnetic resonance (NMR) spectroscopy as N-(deoxyguanosin-8-yl)- and 3-(deoxyguanosin-N2-yl)-MAB. The former adduct was initially the predominant product in vivo, but it could not be detected 7 days following treatment. The latter adduct remained at a constant level for 14 days and therefore appears to be a persistent lesion. PMID:7389004

  8. The analysis of DNA adducts: the transition from (32)P-postlabeling to mass spectrometry.


    Klaene, Joshua J; Sharma, Vaneet K; Glick, James; Vouros, Paul


    The technique of (32)P-postlabeling, which was introduced in 1982 for the analysis of DNA adducts, has long been the method of choice for in vivo studies because of its high sensitivity as it requires only <10μg DNA to achieve the detection of 1 adduct in 10(10) normal bases. (32)P-postlabeling has therefore been utilized in numerous human and animal studies of DNA adduct formation. Like all techniques (32)P-postlabeling does have several disadvantages including the use of radioactive phosphorus, lack of internal standards, and perhaps most significantly does not provide any structural information for positive identification of unknown adducts, a shortcoming that could significantly hamper progress in the field. Structural methods have since been developed to allow for positive identification of DNA adducts, but to this day, the same level of sensitivity and low sample requirements provided by (32)P-postlabeling have not been matched. In this mini review we will discuss the (32)P-postlabeling method and chronicle the transition to mass spectrometry via the hyphenation of gas chromatography, capillary electrophoresis, and ultimately liquid chromatography which, some 30years later, is only just starting to approach the sensitivity and low sample requirements of (32)P-postlabeling. This paper focuses on the detection of bulky carcinogen-DNA adducts, with no mention of oxidative damage or small alkylating agents. This is because the (32)P-postlabeling assay is most compatible with bulky DNA adducts. This will also allow a more comprehensive focus on a subject that has been our particular interest since 1990. PMID:22960573

  9. The modulation of topoisomerase I-mediated DNA cleavage and the induction of DNA–topoisomerase I crosslinks by crotonaldehyde-derived DNA adducts

    PubMed Central

    Dexheimer, Thomas S.; Kozekova, Albena; Rizzo, Carmelo J.; Stone, Michael P.; Pommier, Yves


    Crotonaldehyde is a representative α,β-unsaturated aldehyde endowed of mutagenic and carcinogenic properties related to its propensity to react with DNA. Cyclic crotonaldehyde-derived deoxyguanosine (CrA-PdG) adducts can undergo ring opening in duplex DNA to yield a highly reactive aldehydic moiety. Here, we demonstrate that site-specifically modified DNA oligonucleotides containing a single CrA-PdG adduct can form crosslinks with topoisomerase I (Top1), both directly and indirectly. Direct covalent complex formation between the CrA-PdG adduct and Top1 is detectable after reduction with sodium cyanoborohydride, which is consistent with the formation of a Schiff base between Top1 and the ring open aldehyde form of the adduct. In addition, we show that the CrA-PdG adduct alters the cleavage and religation activities of Top1. It suppresses Top1 cleavage complexes at the adduct site and induces both reversible and irreversible cleavage complexes adjacent to the CrA-PdG adduct. The formation of stable DNA–Top1 crosslinks and the induction of Top1 cleavage complexes by CrA-PdG are mutually exclusive. Lastly, we found that crotonaldehyde induces the formation of DNA–Top1 complexes in mammalian cells, which suggests a potential relationship between formation of DNA–Top1 crosslinks and the mutagenic and carcinogenic properties of crotonaldehyde. PMID:18550580

  10. DNA adduct measurements in zebra mussels, Dreissena polymorpha, Pallas. Potential use for genotoxicant biomonitoring of fresh water ecosystems.


    Le Goff, J; Gallois, J; Pelhuet, L; Devier, M H; Budzinski, H; Pottier, D; André, V; Cachot, J


    The purpose of this study was to examine PAH accumulation and bulky DNA adduct formation in the digestive gland of zebra mussels exposed in their habitat or in controlled laboratory conditions to complex mixture of PAH. DNA adducts were measured using a 32P-postlabelling protocol with nuclease P1 enrichment adapted from Reddy and Randerath [Reddy, M.V., Randerath, K., 1986. Nuclease P1-mediated enhancement of sensitivity of 32P-postlabelling test for structurally diverse DNA adducts. Carcinogenesis 7, 1543-1551]. Specimens collected in the upper part of the Seine estuary were shown to accumulate higher levels of PAH (up to 1.6 microg g(-1) dry weight) in comparison to individuals from the reference site (0.053 microg g(-1) dry weight). The former exhibited elevated levels of DNA adducts (up to 4.0/10(8) nucleotides) and higher diversity of individual adducts with five distinct spots being specifically detected in individuals originating from the Seine estuary. Zebra mussels exposed for 5 days to 0.01% (v/v) of organic extract of sediment from the Seine estuary were shown to accumulate high amounts of PAH (up to 138 microg g(-1) dry weight) but exhibited relatively low levels of DNA adducts. Exposure to benzo[a]pyrene led to a dose-dependent accumulation of B[a]P (up to 7063 microg g(-1) dry weight) and a clear induction of DNA adduct formation in the digestive gland of mussels (up to 1.13/10(8) nucleotides). Comparisons with other bivalves exposed to the same model PAH, revealed similar levels of adducts and comparable adduct profiles with a main adduct spot and a second faint one. This study clearly demonstrated that zebra mussels are able to biotransform B[a]P and probably other PAH into reactive metabolites with DNA-binding activity. This work also demonstrated the applicability of the nuclease P1 enhanced 32P-postlabelling method for bulky adduct detection in the digestive gland of zebra mussels. DNA adduct measurement in zebra mussels could be a suitable

  11. Conformational, IR spectroscopic and electronic properties of conium alkaloids and their adducts with C60 fullerene

    NASA Astrophysics Data System (ADS)

    Zabolotnyi, M. A.; Prylutskyy, Yu I.; Poluyan, N. A.; Evstigneev, M. P.; Dovbeshko, G. I.


    Conformational, IR spectroscopic and electronic properties of the components of Conium alkaloids (Conium maculatum) in aqueous environment were determined by model calculations and experiment. With the help of FT-IR spectroscopy the possibility of formation of an adduct between γ-coniceine alkaloid and C60 fullerene was demonstrated, which is important for further application of conium analogues in biomedical purposes.

  12. DNA adducts induced by in vitro activation of extracts of diesel and biodiesel exhaust particles

    EPA Science Inventory

    AbstractContext: Biodiesel and biodiesel-blend fuels offer a renewable alternative to petroleum diesel, but few data are available concerning the carcinogenic potential of biodiesel exhausts. Objectives: We compared the formation of covalent DNA adducts by the in vitro metabol...

  13. Enzyme-DNA biocolloids for DNA adduct and reactive metabolite detection by chromatography-mass spectrometry.


    Bajrami, Besnik; Hvastkovs, Eli G; Jensen, Gary C; Schenkman, John B; Rusling, James F


    Silica microbead bioreactors (0.5 microm diameter) coated with DNA and enzymes were fabricated to measure reactive metabolite and DNA-adduct formation rates relevant to genotoxicity screening. Cytochrome (cyt) P450 2E1, cyt P450(cam), and myoglobin (Mb) were incorporated into thin films with DNA using the electrostatic layer-by-layer (LbL) method. The utility of these biocolloids was demonstrated by oxidation of guaiacol, styrene, and (4-methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK). Enzyme turnover rates for formation of reactive metabolites were monitored using gas chromatography/mass spectrometry (GC/MS) and liquid chromatography-mass spectrometry (LC-MS). Capillary LC-MS/MS was employed to determine DNA nucleobase adducts after catalyzing the reactive metabolite formation with DNA-enzyme biocolloids and then using neutral thermal hydrolysis on the biocolloids. Dramatic improvements in surface area to volume ratio over similar films on macroscopic surfaces opens new avenues for genotoxicity screening and enabled the first use of pure cyt P450 enzymes in enzyme-DNA films to produce DNA adducts. The method makes possible identification and formation rate measurements of major and minor DNA adducts as well as the metabolites themselves in <5 min of reaction time using relevant human liver enzymes. PMID:18217727

  14. Insights into the Mechanism of Protein Electrospray Ionization From Salt Adduction Measurements

    NASA Astrophysics Data System (ADS)

    Yue, Xuanfeng; Vahidi, Siavash; Konermann, Lars


    The mechanisms whereby protein ions are liberated from charged droplets during electrospray ionization (ESI) remain under investigation. Compact conformers electrosprayed from aqueous solution in positive ion mode likely follow the charged residue model (CRM), which envisions analyte release after solvent evaporation to dryness. The concentration of nonvolatile salts such as NaCl increases sharply within vanishing CRM droplets, promoting nonspecific pairing of Cl- and Na+ with charged groups on the protein surface. For unfolded proteins, it has been proposed that ion formation occurs via the chain ejection model (CEM). During the CEM proteins are expelled from the droplet long before complete solvent evaporation has taken place. Here we examine whether salt adduction levels support the view that folded and unfolded proteins follow different ESI mechanisms. Solvent evaporation during the CEM is expected to be less extensive and, hence, the salt concentration at the point of protein release should be substantially lower than for the CRM. CEM ions should therefore exhibit lower adduction levels than CRM species. We explore the adduction behavior of several proteins that were chosen to allow comparative studies on folded and unfolded structures in the same solution. In-source activation eliminates chloride adducts via HCl release, generating protein ions that are heterogeneously charged because of sodiation and protonation. Sodiation levels measured under such conditions provide estimates of the salt adduction behavior experienced by the "nascent" analyte ions. Sodiation levels are significantly reduced for unfolded proteins, supporting the view that these species are indeed formed via the CEM.

  15. New fluorescence methodology for detecting DNA adducts

    SciTech Connect

    Giese, R.W.


    A new reagent, BO-IMI, has been developed that achieves, single step, phosphate specific fluorescence labeling under aqueous conditions. Both 3 in. and 5 in. mononucleotides, including representative DNA adducts can be labeled. Included in this technique is a convenient procedure for postlabeling sample cleanup, leading to a practical detection of the products by capillary electrophoresis with laser fluorescencedetection. We consider that this new method will have a significant impact on the measurement of DNA adducts in human samples. This work was largely accomplished in the second half of our project. In the first half, we set up a new way to isolate DNA nucleotides from blood, worked with an initial, less specific technique for labeling DNA adducts, compared ionizing radiation vs oxidative damage to fluorescein labeled deoxyadenylic acid, and set up a capillary electrophoresis laser fluorescence detection system.

  16. Selection of adduct-forming chemicals for human-monitoring studies

    SciTech Connect

    Not Available


    The U.S. EPA, through its Environmental Monitoring Systems Laboratory-Las Vegas (EMSL-LV) and its Health Effects Research Laboratory-Research Triangle Park (HERL-RTP) has been exploring the feasibility of using biological markers to monitor exposure to environmental chemicals. The participants began by compiling a list of chemicals of known or suspected health hazards and for which the potential for human exposure exists. The chemicals on the master list were then systematically evaluated for: (1) the potential for adduct-formation in vivo, (2) the availability of supportive adduct research data, (3) the identifiability of exposed population(s), and (4) the level of genetic activity. After considering all the relevant data, the participants selected and prioritized for further study a small group of chemicals considered to have the greatest potential for use in pilot, adduct-based, biological monitoring studies in human populations.

  17. Reduced variational space analysis of methane adducts

    SciTech Connect

    Cundari, T.R.; Klinckman, T.R.


    Methane is the major component of natural gas, and hence its catalytic conversion to functionalized products (e.g., methanol) is of great interest. A variety of transition metal complexes have been investigated experimentally for the selective activation of methane. Recent experiments and computations suggest that weakly bound methane adducts play a pivotal role in metal-mediated methane activation. Calculation of the intrinsic reaction coordinates for methane activation by d{sup 0} imidos indicates that the adduct lies along the pathway for methane activation. Isolation of a stable methane adduct, suitable for experimental characterization, would be aided by a greater understanding of their chemistry. Given the short-lived nature of these adducts and the limited direct experimental information, computational chemistry is a useful tool for understanding the bonding and structure of these catalytic intermediates. This research investigated the bonding forces in methane adducts of transition metal (TM) complexes. The calculations reported here employed effective core potential (ECP) methods within the Hartree-Fock approximation using the GAMESS quantum chemistry program. The reduced variational space self-consistent field (RVS-SCF) method developed by Stevens and Fink was employed. This technique was used to analyze the Coulomb and exchange energy (CEX), polarization energy (POL), and charge transfer energy (CT) contributions to the binding energy ({Delta}E{sub add}) of methane to a TM complex. Adducts of high-valent (d{sup 0}) transition metal complexes were studied. The role of metal, ligand, and charge on the different contributions to the binding energy were analyzed.

  18. Detection of DNA methylation adducts in Hodgkin's disease patients treated with procarbazine.


    Bianchini, F; Weiderpass, E; Kyrtopoulos, S; Souliotis, V L; Henry-Amar, M; Wild, C P; Boffetta, P


    Abstract The aim of the present study was to assess the relationship between dose of the methylating agent procarbazine (PCZ), DNA methylation adduct formation andresponse to chemotherapy treatment in 23 Hodgkin's disease patients receiving MOPP/ABV combination therapy. The DNA adducts, 7-methyldeoxyguanosine (7-medG) and0(6)-methyldeoxyguanosine (0(6)-medG), were measured in leucocytes at the end of the first cycle of PCZ treatment (77-100 mg m(Z) per day). 7-medG was detected in only two patients prior to treatment and0(6)-medG was below the detection limit (0.08 pole per mole dG) in all subjects prior to treatment. The mean levels after PCZ treatment were 12.55 pmole 7-medG per mole dG and0.254 μmole 0(6)-medG per mole dG with a 2-3 fold variation between individuals. No correlation was observed between the levels of the two adducts suggesting inter-individual differences in formation andremoval of the two adducts. Failure of treatment was observed in five patients andthis was not correlated with higher or lower levels of 7-medG or 0(6)-medG. Other adducts formed as a consequence of treatment with PCZ or other MOPP/ABV components could have more relevance in this respect. The ability to measure DNA methylation adducts at the individual level following exposure to PCZ or other methylating chemotherapeutic drugs (e.g. dacarbazine) could be useful in prospective studies of secondary cancer in Hodgkin's disease patients. PMID:23888989

  19. Synthesis of Mitomycin C and Decarbamoylmitomycin C N(2) deoxyguanosine-adducts.


    Champeil, Elise; Cheng, Shu-Yuan; Huang, Bik Tzu; Conchero-Guisan, Marta; Martinez, Thibaut; Paz, Manuel M; Sapse, Anne-Marie


    Mitomycin C (MC) and Decarbamoylmitomycin C (DMC) - a derivative of MC lacking the carbamate on C10 - are DNA alkylating agents. Their cytotoxicity is attributed to their ability to generate DNA monoadducts as well as intrastrand and interstrand cross-links (ICLs). The major monoadducts generated by MC and DMC in tumor cells have opposite stereochemistry at carbon one of the guanine-mitosene bond: trans (or alpha) for MC and cis (or beta) for DMC. We hypothesize that local disruptions of DNA structure from trans or cis adducts are responsible for the different biochemical responses produced by MC and DMC. Access to DNA substrates bearing cis and trans MC/DMC lesions is essential to verify this hypothesis. Synthetic oligonucleotides bearing trans lesions can be obtained by bio-mimetic methods. However, this approach does not yield cis adducts. This report presents the first chemical synthesis of a cis mitosene DNA adduct. We also examined the stereopreference exhibited by the two drugs at the mononucleotide level by analyzing the formation of cis and trans adducts in the reaction of deoxyguanosine with MC or DMC using a variety of activation conditions. In addition, we performed Density Functional Theory calculations to evaluate the energies of these reactions. Direct alkylation under autocatalytic or bifunctional conditions yielded preferentially alpha adducts with both MC and DMC. DFT calculations showed that under bifunctional activation, the thermodynamically favored adducts are alpha, trans, for MC and beta, cis, for DMC. This suggests that the duplex DNA structure may stabilize/oriente the activated pro-drugs so that, with DMC, formation of the thermodynamically favored beta products are possible in a cellular environment. PMID:26894558

  20. Molecular characterization of the boron adducts of the proteasome inhibitor bortezomib with epigallocatechin-3-gallate and related polyphenols.


    Glynn, Stephen J; Gaffney, Kevin J; Sainz, Marcos A; Louie, Stan G; Petasis, Nicos A


    The green tea polyphenol epigallocatechin-3-gallate (EGCG) was reported to effectively antagonize the ability of Bortezomib (BZM) to induce apoptosis in cancer cells. This interaction was attributed to the formation of a covalent adduct between a phenolic moiety of EGCG with the boronic acid group of Bortezomib. However, the structural details of this boron adduct and the molecular factors that contribute to its formation and its ability to inhibit Bortezomib's activity remain unclear. This paper describes the use of NMR spectroscopy and cell assays to characterize the structures and properties of the boron adducts of EGCG and related polyphenols. The observed boron adducts included both boronate and borate derivatives, and their structural characteristics were correlated with cell-based evaluation of the ability of EGCG and other phenols to antagonize the anticancer activity of Bortezomib. The enhanced stability of the BZM/EGCG adduct was attributed to electronic and steric reasons, and a newly identified intramolecular interaction of the boron atom of BZM with the adjacent amide bond. The reported approach provides a useful method for determining the potential ability of polyphenols to form undesired adducts with boron-based drugs and interfere with their actions. PMID:25669488

  1. Molecular characterization of the boron adducts of the proteasome inhibitor Bortezomib with epigallocatechin-3-gallate and related polyphenols

    PubMed Central

    Glynn, Stephen J.; Gaffney, Kevin J.; Sainz, Marcos A.; Louie, Stan G.


    The green tea polyphenol epigallocatechin-3-gallate (EGCG) was reported to effectively antagonize the ability of Bortezomib to induce apoptosis in cancer cells. This interaction was attributed to the formation of a covalent adduct between a phenolic moiety of EGCG with the boronic acid group of Bortezomib. However, the structural details of this boron adduct and the molecular factors that contribute to its formation and its ability to inhibit Bortezomib's activity remain unclear. This paper describes the use of NMR spectroscopy and cell assays to characterize the structures and properties of the boron adducts of EGCG and related polyphenols. The observed boron adducts included both boronate and borate derivatives, and their structural characteristics were correlated with cell-based evaluation of the ability of EGCG and other phenols to antagonize the anticancer activity of Bortezomib. The enhanced stability of the BZM/EGCG adduct was attributed to electronic and steric reasons, and a newly identified intramolecular interaction of the boron atom of BZM with the adjacent amide bond. The reported approach provides a useful method for determining the potential ability of polyphenols to form undesired adducts with boron-based drugs and interfere with their actions. PMID:25669488


    EPA Science Inventory

    The present project was undertaken to develop new methodologies for biological monitoring of exposure to the toxicant acrylamide in laboratory animals as well as humans. ethods were developed to measure the adducts of acrylamide and its epoxide metabolite glycinamide to cysteine ...

  3. 32P-post-labelling analysis of DNA adducts formed in the upper gastrointestinal tissue of mice fed bracken extract or bracken spores.


    Povey, A C; Potter, D; O'Connor, P J


    Bracken toxicity to both domestic and laboratory animals is well established and tumours are formed when rodents are treated with either bracken extracts or bracken spores. In this study we have administered bracken spores and extract to mice in order to investigate whether such exposure leads to the formation of DNA adducts. DNA, isolated from the upper gastrointestinal tract and liver, was digested to 3'-nucleotides. Adducts were extracted with butanol, 32P-post-labelled, separated by thin layer chromatography (TLC) and visualised and quantified using storage-phosphor technology. A cluster of adducts was clearly seen in the DNA of the upper gastrointestinal tract, but not liver, 5 and 24 h after treatment with bracken extract or bracken spores. These adducts were not observed in DNA extracted from vehicle-treated animals. Whereas, after 5 h adduct levels in extract and spore-treated animals were similar, after 24 h adduct levels in the extract-treated animals had diminished by > 75%, but levels in spore-treated animals remained similar to those found after 5 h. This suggests that the DNA-reactive compounds were being released slowly from the spores, even though the spores had been sonicated before administration. Adducts were also quantified after the addition of an internal standard (deoxyinosine 3'-monophosphate) by comparing the amount of label incorporated into the adducts with that found in a known amount of the internal standard. Adduct levels using this internal standard approach were similar to those found by direct measurement of radioactivity incorporated into the adduct, indicating that the labelling of adducts was quantitative. We have tried, unsuccessfully, to synthesise ptaquiloside, the principal carcinogenic component present within bracken. However, similar patterns of adducts were observed when two other compounds, (1-(4-chlorophenyl sulphonyl)-l-cyclopropane carbonitrile and 3-cyclopropylindeno [1,2-c] pyrazol-4-(O-methyl)oxime), which both

  4. 32P-post-labelling analysis of DNA adducts formed in the upper gastrointestinal tissue of mice fed bracken extract or bracken spores.

    PubMed Central

    Povey, A. C.; Potter, D.; O'Connor, P. J.


    Bracken toxicity to both domestic and laboratory animals is well established and tumours are formed when rodents are treated with either bracken extracts or bracken spores. In this study we have administered bracken spores and extract to mice in order to investigate whether such exposure leads to the formation of DNA adducts. DNA, isolated from the upper gastrointestinal tract and liver, was digested to 3'-nucleotides. Adducts were extracted with butanol, 32P-post-labelled, separated by thin layer chromatography (TLC) and visualised and quantified using storage-phosphor technology. A cluster of adducts was clearly seen in the DNA of the upper gastrointestinal tract, but not liver, 5 and 24 h after treatment with bracken extract or bracken spores. These adducts were not observed in DNA extracted from vehicle-treated animals. Whereas, after 5 h adduct levels in extract and spore-treated animals were similar, after 24 h adduct levels in the extract-treated animals had diminished by > 75%, but levels in spore-treated animals remained similar to those found after 5 h. This suggests that the DNA-reactive compounds were being released slowly from the spores, even though the spores had been sonicated before administration. Adducts were also quantified after the addition of an internal standard (deoxyinosine 3'-monophosphate) by comparing the amount of label incorporated into the adducts with that found in a known amount of the internal standard. Adduct levels using this internal standard approach were similar to those found by direct measurement of radioactivity incorporated into the adduct, indicating that the labelling of adducts was quantitative. We have tried, unsuccessfully, to synthesise ptaquiloside, the principal carcinogenic component present within bracken. However, similar patterns of adducts were observed when two other compounds, (1-(4-chlorophenyl sulphonyl)-l-cyclopropane carbonitrile and 3-cyclopropylindeno [1,2-c] pyrazol-4-(O-methyl)oxime), which both

  5. Environmental toxins and breast cancer on Long Island. I. Polycyclic aromatic hydrocarbon DNA adducts.


    Gammon, Marilie D; Santella, Regina M; Neugut, Alfred I; Eng, Sybil M; Teitelbaum, Susan L; Paykin, Andrea; Levin, Bruce; Terry, Mary Beth; Young, Tie Lan; Wang, Lian Wen; Wang, Qiao; Britton, Julie A; Wolff, Mary S; Stellman, Steven D; Hatch, Maureen; Kabat, Geoffrey C; Senie, Ruby; Garbowski, Gail; Maffeo, Carla; Montalvan, Pat; Berkowitz, Gertrud; Kemeny, Margaret; Citron, Marc; Schnabel, Freya; Schuss, Allan; Hajdu, Steven; Vinceguerra, Vincent


    Polycyclic aromatic hydrocarbons (PAH) are potent mammary carcinogens in rodents, but their effect on breast cancer development in women is not clear. To examine whether currently measurable PAH damage to DNA increases breast cancer risk, a population-based case-control study was undertaken on Long Island, NY. Cases were women newly diagnosed with in situ and invasive breast cancer; controls were randomly selected women frequency matched to the age distribution of cases. Blood samples were donated by 1102 (73.0%) and 1141 (73.3%) of case and control respondents, respectively. Samples from 576 cases and 427 controls were assayed for PAH-DNA adducts using an ELISA. The geometric mean (and geometric SD) of the log-transformed levels of PAH-DNA adducts on a natural scale was slightly, but nonsignificantly, higher among cases [7.36 (7.29)] than among controls [6.21 (4.17); P = 0.51]. The age-adjusted odds ratio (OR) for breast cancer in relation to the highest quintile of adduct levels compared with the lowest was 1.51 [95% confidence interval (CI), 1.04-2.20], with little or no evidence of substantial confounding (corresponding multivariate-adjusted OR, 1.49; 95% CI, 1.00-2.21). There was no consistent elevation in risk with increasing adduct levels, nor was there a consistent association between adduct levels and two of the main sources of PAH, active or passive cigarette smoking or consumption of grilled and smoked foods. These data indicate that PAH-DNA adduct formation may influence breast cancer development, although the association does not appear to be dose dependent and may have a threshold effect. PMID:12163319

  6. Identification of adducts derived from reactions of (1-chloroethenyl)oxirane with nucleosides and calf thymus DNA.


    Munter, Tony; Cottrell, Lisa; Hill, Stuart; Kronberg, Leif; Watson, William P; Golding, Bernard T


    (1-Chloroethenyl)oxirane is a major mutagenic metabolite of chloroprene, an important large-scale petrochemical used in the manufacture of synthetic rubbers. The reactions of (1-chloroethenyl)oxirane with 2'-deoxyguanosine, 2'-deoxyadenosine, 2'-deoxycytidine, thymidine, and calf thymus DNA have been studied in aqueous buffered solutions. The adducts from the nucleosides were isolated by reversed-phase HPLC, and characterized by their UV absorbance and (1)H and (13)C NMR spectroscopic and mass spectrometric features. The reaction with 2'-deoxyguanosine gave one major adduct, N7-(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGI), and eight minor adducts which were identified as diastereoisomeric pairs of N1-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyguanosine (dGII, dGIII), N3,N7-bis(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGIV, dGV), N7,N9-bis(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGVI, dGVII), and N1,N7-bis(3-chloro-2-hydroxy-3-buten-1-yl)-guanine (dGVIII, dGIX). The reaction of 2'-deoxyadenosine with (1-chloroethenyl)oxirane gave two adducts: N1-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyadenosine (dAI) and N(6)-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyadenosine (dAII). The adduct dAII was shown to arise via a Dimroth rearrangement of adduct dAI. The HPLC analyses of the reaction mixtures of (1-chloroethenyl)oxirane with 2'-deoxycytidine and thymidine showed the formation of one major product in each reaction. The adduct from 2'-deoxycytidine was identified as N3-(3-chloro-2-hydroxy-3-buten-1-yl)-2'-deoxyuridine (dCI) derived by alkylation at N-3 followed by deamination. The adduct from thymidine was identified as N3-(3-chloro-2-hydroxy-3-buten-1-yl)-thymidine (TI). Reaction of (1-chloroethenyl)oxirane with calf thymus DNA gave all of the adducts observed from the individual nucleosides except dGII and dGIII. However, there was selectivity for the formation of dGI and dCI. The adduct levels in DNA were 9,630 (dGI), 240 (dCI), 83 (dAI), 6 (dAII), and 28 (TI

  7. Synthesis and structural studies of flavin and alloxazine adducts with O-nucleophiles

    NASA Astrophysics Data System (ADS)

    Ménová, Petra; Eigner, Václav; Čejka, Jan; Dvořáková, Hana; Šanda, Miloslav; Cibulka, Radek


    Five flavin (isoalloxazine) and alloxazine adducts with O-nucleophiles, 5-ethyl-4a-hydroxy-3,7,8,10-tetramethyl-4a,5-dihydroisoalloxazine ( 1a-OH), 5-ethyl-4a-hydroxy-3,10-dimethyl-4a,5-dihydroisoalloxazine ( 1b-OH), 5-ethyl-4a-methoxy-3,10-dimethyl-4a,5-dihydroisoalloxazine ( 1b-OMe), 5-ethyl-4a-hydroxy-1,3-dimethyl-4a,5-dihydroalloxazine ( 2a-OH) and 5-ethyl-4a-methoxy-1,3-dimethyl-4a,5-dihydroalloxazine ( 2a-OMe) were prepared from the corresponding salts, 5-ethyl-3,7,8,10-tetramethylisoalloxazinium ( 1a), 5-ethyl-3,10-dimethylisoalloxazinium ( 1b) and 5-ethyl-1,3-dimethylalloxazinium ( 2a) perchlorates by the addition of a nucleophile (water or methanol) and triethylamine as a base. The prepared adducts represent artificial analogs of flavin cofactor derivatives which are essential for the functioning of flavoenzymes. They were characterized by 1H and 13C NMR, HR-MS and UV-VIS spectra. In the cases of 1a-OH, 1b-OH, and 2a-OMe, the crystal structures were determined by X-ray diffraction. Flavinium and alloxazinium salts are in rapid equilibria with their adducts in water or methanolic solutions without the presence of a base. It was found that the equilibrium constants for flavin adduct formation is higher by six orders of magnitude than those for alloxazine derivatives. The presence of the sp 3 hybridized C4a atom in the molecule of the adducts causes deviation from planarity. The interplanar angles between benzene and the pyrimidine ring were found to be 31.5°, 23.64° and 15.62° for 1a-OH, 1b-OH and 2a-OMe, respectively, which are much higher than those of previously published adducts of C-nucleophiles. In isoalloxazine adducts, delocalization of π electrons between the N10-C10a and C10a-N1 bonds was detected while the length of the N10-C10a and C10a-N1 bonds in the alloxazine adducts corresponds to a double and single bond, respectively.

  8. White blood cell DNA adducts and fruit and vegetable consumption in bladder cancer.


    Peluso, M; Airoldi, L; Magagnotti, C; Fiorini, L; Munnia, A; Hautefeuille, A; Malaveille, C; Vineis, P


    The 'Mediterranean diet', a diet rich in cereals, fruit and vegetables, has been associated with lowering the risk of a variety of cancers of the digestive tract and the bladder. In a previous study, we showed that the high phenolic content these dietary components produce in the urine could be associated with higher antimutagenic properties of the urine and lower arylamine-DNA adducts in exfoliated bladder cells. We have conducted a case-control study on 162 bladder cancer patients and 104 hospital controls. Total aromatic DNA adducts were measured in white blood cells (WBC) of all subjects by (32)P-post-labelling. Genetically based metabolic polymorphisms were analysed by PCR-RFLP (NAT2, GSTM1, GSTT1, GSTP1, COMT and NQO1). All subjects were interviewed about their tobacco use, dietary habits and other risk factors. The odds ratio (OR) for the risk of bladder cancer according to the presence/absence of WBC DNA adducts (detection limit 0.1 RALx10(8)) was 3.7 [95% confidence interval (CI) 2.2-6.3] and a dose-response relationship with levels of adducts was apparent. The association between case/control status and the presence of WBC DNA adducts was significantly stronger in the subjects who consumed fewer portions of fruit or vegetables per day (OR 7.80, 95% CI 3.0-20.30 for 0-1 portions of vegetables) than in the heavy consumers (OR 4.98 for consumers of 2 portions daily, OR 1.97 for consumers of > or =3 portions; similar but lower estimates were found for the intake of fruit). No association was noticed between tobacco smoking and WBC DNA adducts. Only NAT-2, among the several genotypes considered, was associated in a statistically significant way with the risk of bladder cancer (OR 1.72, 95% CI 1.03-2.87) and with the levels of WBC DNA adducts. Our report suggests that fruit and vegetables could protect against bladder cancer by inhibiting the formation of DNA adducts. PMID:10657956

  9. Detection of mitomycin C-DNA adducts in human breast cancer cells grown in culture, as xenografted tumors in nude mice, and in biopsies of human breast cancer patient tumors as determined by (32)P-postlabeling.


    Warren, A J; Mustra, D J; Hamilton, J W


    Mitomycin C (MMC) is a DNA cross-linking agent that has been used in cancer chemotherapy for >20 years. However, little is known either qualitatively or quantitatively about the relationship between formation and repair of specific MMC-DNA adducts and specific biological outcomes. The goal of this study was to examine formation and removal of specific MMC-DNA adducts in breast cancer cells using a (32)P-postlabeling assay in relation to cytotoxicity and other biological end points. MMC-DNA adducts were measured in cultured human metastatic MDA-MB-435 cells, in the same cells xenografted as a mammary tumor in nude mice, and in metastatic tumor biopsies obtained from human breast cancer patients undergoing MMC-based therapy. MMC adducts corresponding to the CpG interstrand cross-link, the MMC-G bifunctional monoadduct, and two isomers of the MMC-G monofunctional monoadduct were detected in most samples. Despite similarities in the overall patterns of adduct formation, there were substantial differences between the cultured cells and the in vivo tumors in their adduct distribution profile, kinetics of adduct formation and removal, and relationship of specific adduct levels to cytotoxicity, suggesting that the in vivo microenvironment (e.g., degree of oxygenation, pH, activity of oxidoreductases, and other factors) of breast cancer cells may significantly modulate these parameters. PMID:11309355

  10. Prenatal Exposure to Polycyclic Aromatic Hydrocarbons, Benzo[a]pyrene–DNA Adducts, and Genomic DNA Methylation in Cord Blood

    PubMed Central

    Tang, Deliang; Zhu, Deguang; Qu, Lirong; Sjödin, Andreas; Li, Zheng; Camann, David; Perera, Frederica P.


    Background: Polycyclic aromatic hydrocarbons (PAHs) are carcinogenic environmental pollutants generated during incomplete combustion. After exposure and during metabolism, PAHs can form reactive epoxides that can covalently bind to DNA. These PAH–DNA adducts are established markers of cancer risk. PAH exposure has been associated with epigenetic alterations, including genomic cytosine methylation. Both global hypomethylation and hypermethylation of specific genes have been associated with cancer and other diseases in humans. Experimental evidence suggests that PAH–DNA adduct formation may preferentially target methylated genomic regions. Early embryonic development may be a particularly susceptible period for PAH exposure, resulting in both increased PAH–DNA adducts and altered DNA methylation. Objective: We explored whether prenatal exposure to PAHs is associated with genomic DNA methylation in cord blood and whether methylation levels are associated with the presence of detectable PAH–DNA adducts. Methods: In a longitudinal cohort study of nonsmoking women in New York City, we measured PAH exposure during pregnancy using personal air monitors, assessed PAH internal dose using prenatal urinary metabolites (in a subset), and quantified benzo[a]pyrene–DNA adducts and genomic DNA methylation in cord blood DNA among 164 participants. Results: Prenatal PAH exposure was associated with lower global methylation in umbilical cord white blood cells (p = 0.05), but global methylation levels were positively associated with the presence of detectable adducts in cord blood (p = 0.01). Conclusions: These observations suggest that PAH exposure was adequate to alter global methylation in our study population. Additional epidemiologic studies that can measure site-specific cytosine methylation and adduct formation will improve our ability to understand this complex molecular pathway in vivo. PMID:22256332

  11. Development of an immunoassay to detect benzene adducts in hemoglobin

    SciTech Connect

    Grassman, J.A.


    The purpose of this project was to develop an immunoassay to detect the adducts formed in hemoglobin after exposure to benzene, which is known to cause bone marrow degeneration and acute myelogenous leukemia. The use of benzene-adduct detection as a biological monitoring method would permit measurement of low exposures and exposures sustained weeks earlier. The reactivity of hydroquinone, an important benzene metabolite, with blood proteins and amino acids was investigated in order to decide which antigens and analytes were likely to be suitable for immunoassay development. The second section determined the combination of benzene-metabolite and antigen need to produce an immunoassay with the requisite low detection limit and specificity. The immunoassays with the best performance were tested on hemoglobin from benzene-exposed mice. In vitro studies showed that hydroquinone efficiently formed adducts with erythrocyte membranes and hemoglobin but not with albumin. Adduction efficiency was greater in incubations using purified hemoglobin than whole blood. Cysteine accounted for 15 to 27% of the adducts formed by hydroquinone. The site of the other adducts were not identified although there was evidence that the hemoglobin heme was adducted. Adducts were found on only 1 of the 2 globin chains. Tryptic digestion of the globin failed to associate the adducts with a specific peptide. Antigens made from hydroquinone-adducted hemoglobin but not hydroquinone-adducted cysteines coupled to carrier proteins effectively elicited adduct-specific antibodies. Interference due to reactivity to hemoglobin was controlled by using uniform quantities of hemoglobin in all wells. The mid-range of the best assays were approximately 12 pmoles HQ per well. Antibodies directed toward hemoglobin adducted with the benzene metabolites phenol, catechol and 1,2,4-trihydroxybenzene were also made. The performance of the anti-1,2,4-trihydroxybenzene were suitable for quantitative immunoassays.

  12. Adduct supported analysis of γ-hydroxybutyrate in human serum with LC-MS/MS.


    Dziadosz, Marek; Weller, Jens-Peter; Klintschar, Michael; Teske, Jörg


    To avoid the detection of small fragmentation products of γ-hydroxybutyrate (GHB), a liquid chromatography-tandem mass spectrometry GHB quantification method in human serum supported by adduct formation was developed and validated. The continuous infusion of GHB/GHB-D6 made the identification of two adducts possible and GHB/GHB-D6 sodium acetate adduct fragmentation was used as target mass transition. A Luna 5 μm C18 (2) 100 A, 150 mm × 2 mm analytical column and elution with a programmed flow of the mobile phase consisting of 10% A (H2O/methanol = 95/5, v/v) and 90% B (H2O/methanol = 3/97, v/v), both with 10 mM ammonium acetate and 0.1% acetic acid (pH = 3.2), were used. Protein precipitation with 1 mL of the mobile phase B was used as the sample preparation. The calculated limit of detection/quantification was 1 μg/mL. The presented study shows that the fragmentation of GHB sodium acetate adducts is an effective way of quantification of this small molecule and is an interesting alternative to other methods based on the detection of ions smaller than 85 Da. This fact together with the short analysis time of 3 min and the fast sample preparation make this method very attractive for forensic/clinical application. PMID:23712650

  13. Noni juice reduces lipid peroxidation-derived DNA adducts in heavy smokers.


    Wang, Mian-Ying; Peng, Lin; Jensen, Claude J; Deng, Shixin; West, Brett J


    Food plants provide important phytochemicals which help improve or maintain health through various biological activities, including antioxidant effects. Cigarette smoke-induced oxidative stress leads to the formation of lipid hydroperoxides (LOOHs) and their decomposition product malondialdehyde (MDA), both of which cause oxidative damage to DNA. Two hundred forty-five heavy cigarette smokers completed a randomized, double-blind, placebo-controlled clinical trial designed to investigate the effect of noni juice on LOOH- and MDA-DNA adducts in peripheral blood lymphocytes (PBLs). Volunteers drank noni juice or a fruit juice placebo every day for 1 month. DNA adducts were measured by (32)P postlabeling analysis. Drinking 29.5-118 mL of noni juice significantly reduced adducts by 44.6-57.4%. The placebo, which was devoid of iridoid glycosides, did not significantly influence LOOH- and MDA-DNA adduct levels in current smokers. Noni juice was able to mitigate oxidative damage of DNA in current heavy smokers, an activity associated with the presence of iridoids. PMID:24804023

  14. Noni juice reduces lipid peroxidation–derived DNA adducts in heavy smokers

    PubMed Central

    Wang, Mian-Ying; Peng, Lin; Jensen, Claude J; Deng, Shixin; West, Brett J


    Food plants provide important phytochemicals which help improve or maintain health through various biological activities, including antioxidant effects. Cigarette smoke–induced oxidative stress leads to the formation of lipid hydroperoxides (LOOHs) and their decomposition product malondialdehyde (MDA), both of which cause oxidative damage to DNA. Two hundred forty-five heavy cigarette smokers completed a randomized, double-blind, placebo-controlled clinical trial designed to investigate the effect of noni juice on LOOH- and MDA-DNA adducts in peripheral blood lymphocytes (PBLs). Volunteers drank noni juice or a fruit juice placebo every day for 1 month. DNA adducts were measured by 32P postlabeling analysis. Drinking 29.5–118 mL of noni juice significantly reduced adducts by 44.6–57.4%. The placebo, which was devoid of iridoid glycosides, did not significantly influence LOOH- and MDA-DNA adduct levels in current smokers. Noni juice was able to mitigate oxidative damage of DNA in current heavy smokers, an activity associated with the presence of iridoids. PMID:24804023

  15. Separation and characterization of oxidized isomeric lipid-peptide adducts by ion mobility mass spectrometry.


    Milic, Ivana; Kipping, Marc; Hoffmann, Ralf; Fedorova, Maria


    Phospholipids are major components of cell membranes and lipoprotein complexes. They are prone to oxidation by endogenous and exogenous reactive oxygen species yielding a large variety of modified lipids including small aliphatic and phospholipid bound aldehydes and ketones. These carbonyls are strong electrophiles that can modify proteins and, thereby, alter their structures and functions triggering various pathophysiological conditions. The analysis of lipid-protein adducts by liquid chromatography-MS is challenged by their mixed chemical nature (polar peptide and hydrophobic lipid), low abundance in biological samples, and formation of multiple isomers. Thus, we investigated traveling wave ion mobility mass spectrometry (TWIMS) to analyze lipid-peptide adducts generated by incubating model peptides corresponding to the amphipathic β1 sheet sequence of apolipoprotein B-100 with 1-palmitoyl-2-(oxo-nonanoyl)-sn-glycerophosphatidylcholine (PONPC). The complex mixture of peptides, lipids, and peptide-lipid adducts was separated by TWIMS, which was especially important for the identification of two mono-PONPC-peptide isomers containing Schiff bases at different lysine residues. Moreover, TWIMS separated structural conformers of one peptide-lipid adduct possessing most likely different orientations of the hydrophobic sn-1 fatty acyl residue and head group of PONPC, relative to the peptide backbone. PMID:26634972

  16. Synthesis and structures of Se analogues of the antithyroid drug 6-n-propyl-2-thiouracil and its alkyl derivatives: formation of dimeric Se-Se compounds and deselenation reactions of charge-transfer adducts of diiodine.


    Antoniadis, Constantinos D; Hadjikakou, Sotiris K; Hadjiliadis, Nick; Papakyriakou, Athanasios; Baril, Martin; Butler, Ian S


    Four selenium analogues of the antithyroid drug 6-n-propyl-2-thiouracil (PTU), of formulae RSeU, (R = methyl (Me) (1), ethyl (Et) (2), n-propyl (nPr) (3), and isopropyl (iPr) 4), have been synthesized. Reaction of 1-4 with diiodine in a 1:1 molar ratio in dichloromethane results in the formation of [(RSeU)I(2)] (R = methyl (5), ethyl (6), n-propyl (7) and isopropyl (8)). All compounds have been characterized by elemental analysis, FT-Raman, FT-IR, UV/Vis, (1)H-, (13)C-, (77)Se-1D and -2D NMR spectroscopy, and ESI-MS spectrometric techniques. Recrystallization of 4 from dichloromethane afforded (4CH(2)Cl(2)). Crystals of [(nPrSeU)I(2)] (7), a charge-transfer complex, were obtained from chloroform solutions, while crystallization of 6 and 7 from acetone afforded the diselenides [N-(6-Et-4-pyrimidone)(6-EtSeU)(2)] (92 H(2)O) and [N-(6-nPr-4-pyrimidone)(6-nPrSeU)(2)] (10) as oxidation products. Recrystallization of 7 from methanol/acetonitrile solutions led to deselenation with the formation of 6-n-propyl-2-uracil (nPrU) (11). [(nPrSeU)I(2)] (7) was found to be a charge-transfer complex with a Se--I bond. These results are discussed in relation to the mechanism of action of antithyroid drugs. PMID:16773663

  17. The GSTM1null (deletion) and MGMT84 rs12917 (Phe/Phe) haplotype are associated with bulky DNA adduct levels in human leukocytes.


    Molina, Edith; Pérez-Morales, Rebeca; Rubio, Julieta; Petrosyan, Pavel; Cadena, Leticia Hernández; Arlt, Volker M; Phillips, David H; Gonsebatt, María E


    Tobacco smoke and air pollutants contain carcinogens, such as polycyclic aromatic hydrocarbons (PAHs) and tobacco specific nitrosamines (TSNA), that are substrates of metabolizing enzymes generating reactive metabolites that can bind to DNA. Variation in the activity of these enzymes may modify the extent to which these metabolites can interact with DNA. We compared the levels of bulky DNA adducts in blood leukocytes from 93 volunteers living in Mexico City with the presence of 13 single nucleotide polymorphisms (SNPs) in genes related to PAH and TSNA metabolism (AhR rs2044853, CYP1A1 rs1048943, CYP1A1 rs1048943, CYP1A1 rs1799814, EPHX1 rs1051740, EPHX1 rs2234922, GSTM1 null, GSTT1 null and GSTP1 rs947894), DNA repair (XRCC1 rs25487, ERCC2 rs13181 and MGMT rs12917) and cell cycle (TP53 rs1042522). (32)P-postlabeling analysis was used to quantify bulky DNA adduct formation. Genotyping was performed using PCR-RFLP. The mean levels of bulky DNA adducts were 8.51±3.66 adducts/10(8) nucleotides (nt) in smokers and 8.38±3.59 adducts/10(8) nt in non-smokers, being the difference not statistically significant. Without taking into account the smoking status, GSTM1 null individuals had a marginally significant lower adduct levels compared with GSTM1 volunteers (p=0.0433) and individuals heterozygous for MGMT Leu/Phe had a higher level of bulky adducts than those who were homozygous wild type (p=0.0170). A multiple regression analysis model showed a significant association between the GSTM1 (deletion) and MGMT rs12917 (Phe/Phe) haplotype and the formation of DNA adducts in smokers (R(2)=0.2401, p=0.0215). The presence of these variants conferred a greater risk for higher adduct levels in this Mexican population. PMID:24084248

  18. Methylthiodeoxynivalenol (MTD): insight into the chemistry, structure and toxicity of thia-Michael adducts of trichothecenes.


    Fruhmann, Philipp; Weigl-Pollack, Theresa; Mikula, Hannes; Wiesenberger, Gerlinde; Adam, Gerhard; Varga, Elisabeth; Berthiller, Franz; Krska, Rudolf; Hametner, Christian; Fröhlich, Johannes


    Methylthiodeoxynivalenol (MTD), a novel derivative of the trichothecene mycotoxin deoxynivalenol (DON), was prepared by applying a reliable procedure for the formal Michael addition of methanethiol to the conjugated double bond of DON. Structure elucidation revealed the preferred formation of the hemiketal form of MTD by intramolecular cyclisation between C8 and C15. Computational investigations showed a negative total reaction energy for the hemiketalisation step and its decrease in comparison with theoretical model compounds. Therefore, this structural behaviour seems to be a general characteristic of thia-Michael adducts of type B trichothecenes. MTD was shown to be less inhibitory for a reticulocyte lysate based in vitro translation system than the parent compound DON, which supports the hypothesis that trichothecenes are detoxified through thia-adduct formation during xenobiotic metabolism. PMID:24903010

  19. Stereospecific Formation of the (R)-γ-Hydroxytrimethylene Interstrand N2-dG:N2-dG Cross-Link Arising from the γ-OH-1,N2-Propano-2'-deoxyguanosine Adduct in the 5′-CpG-3′ DNA Sequence

    PubMed Central

    Huang, Hai; Kim, Hye-Young; Kozekov, Ivan D.; Cho, Young-Jin; Wang, Hao; Kozekova, Albena; Harris, Thomas H.; Rizzo, Carmelo J.; Stone, Michael P.


    Acrolein reacts with dG to form hydroxylated 1,N2-propanodeoxyguanosine (OH-PdG) adducts. Most abundant are the epimeric 3-(2-deoxy-β-D-erythro-pentofuranosyl)-5,6,7,8-tetrahydro-8-hydroxypyrimido[1,2a] purin-10(3H)-ones, commonly referred to as the γ-OH-PdG adduct. When placed complementary to deoxycytosine in duplex DNA, these undergo rearrangment to the N2-(3-oxopropyl)-dG aldehyde. The latter forms diastereomeric interstrand N2-dG:N2-dG cross-links in the 5'-CpG-3' sequence. Here we report the structure of the stereochemically favored (R)-γ-hydroxytrimethylene N2-dG:N2-dG interstrand DNA cross-link in 5'-d(G1C2T3A4G5C6X7A8G9T10C11C12)-3'•5'-d(G13G14A15C16T17C18Y19C20T21A22G23C24)-3' (X7 is the dG adjacent to the α-carbon of the carbinolamine linkage and Y19 is the dG adjacent to the γ-carbon of the carbinolamine linkage; the cross-link is in the 5'-CpG-3' sequence). The structure was characterized using isotope-edited 15N NOESY-HSQC NMR, in which the exocyclic amines at X7 or Y19 were 15N-labeled. Analyses of NOE intensities involving Y19 N2H indicated that the (R)-γ-hydroxytrimethylene linkage was the major cross-link species, constituting 80–90% of the cross-link. The X7 and Y19 imino resonances were observed at 65 °C. Additionally, for the 5'-neighbor base pair G5•C20, the G5 imino resonance remained sharp at 55 °C, but broadened at 65 °C. In contrast, for the 3'-neighbor A8•T17 base pair, the T17 imino resonance was severely broadened at 55 °C. Structural refinement using NOE distance restraints obtained from isotope-edited 15N NOESY HSQC data indicated that the (R)-γ-hydroxytrimethylene linkage maintained the C6•Y19 and X7•C18 base pairs with minimal structural perturbations. The (R)-γ-hydroxytrimethylene linkage was located in the minor groove. The X7 N2 and Y19 N2 atoms were in the gauche-conformation with respect to the linkage, which maintained Watson-Crick hydrogen bonding of the cross-linked base pairs. The anti conformation

  20. Detection of human butyrylcholinesterase-nerve gas adducts by liquid chromatography-mass spectrometric analysis after in gel chymotryptic digestion.


    Tsuge, Kouichiro; Seto, Yasuo


    To verify the exposure to nerve gas, a method for detecting human butyrylcholinesterase (BuChE)-nerve gas adduct was developed using LC-electrospray mass spectrometry (ESI-MS). Purified human serum BuChE was incubated with sarin, soman or VX, and the adduct was purified by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and digested in gel by treatment with chymotrypsin. The resulting peptide mixture was subjected to LC-ESI-MS. From the chymotryptic digest of untreated human BuChE, one peak corresponding to the peptide fragment containing the active center serine residue was detected on the extracted ion chromatogram at m/z 948.5, and the sequence was ascertained to be "GESAGAASVSL" by MS/MS analysis. From the chymotryptic digest of the human BuChE-sarin adduct, a singly charged peptide peak was detected on the extracted ion chromatogram at m/z 1,069.5, and the sequence was ascertained to be "GEXAGAASVSL" by MS/MS analysis (X denotes isopropylmethylphosphonylated serine). The difference in molecular weight (120.0 Da) between the active center peptide fragments corresponding to the untreated BuChE and BuChE-sarin adduct was assumed to be derived from the addition of an isopropyl methylphosphonyl moiety to the serine residue. The formation of human BuChE adducts with soman, VX and an aged soman adduct was confirmed by detecting the respective active center peptide fragments using LC-ESI-MS. To apply the established method to an actual biological sample, human serum was incubated with VX, and the adduct was purified by procainamide affinity chromatography followed by SDS-PAGE. After chymotryptic in gel digestion, the ethylphosphonylated active center peptide fragment could be detected, and the structure of the residue was ascertained by LC-ESI-MS analysis. PMID:16569519

  1. Mutagenesis by site-specific arylamine adducts in plasmid DNA: Enhancing replication of the adducted strand alters mutation frequency

    SciTech Connect

    Reid, T.M.; Lee, Meisie; King, C.M. )


    Site specifically modified plasmids were used to determine the mutagenic effects of single arylamine adducts in bacterial cells. A synthetic heptadecamer bearing a single N-(guanin-8-yl)-2-aminofluorene (AF) or N-(guanin-8-yl)-2-(acetylamino)fluorene (AAF) adduct was used to introduce the adducts into a specific site in plasmid DNA that contained a 17-base single-stranded region complementary to the modified oligonucleotide. Following transformation of bacterial cells with the adduct-bearing DNA, putative mutants were detected by colony hybridization techniques that allowed unbiased detection of all mutations at or near the site of the adduct. The site-specific AF or AAF adducts were also placed into plasmid DNA that contained uracil residues on the strand opposite that bearing the lesions. The presence of uracil in one strand of the DNA decreases the ability of the bacterial replication system to use the uracil-containing strand, thereby favoring the use of the strand bearing the adducts. In a comparison of the results obtained with site specifically modified DNA, either with or without uracil, the presence of the uracil increased the mutation frequencies of the AF adduct by >7-fold to 2.9% and of the AAF adduct by >12-fold to 0.75%. The AF adduct produced primarily single-base deletions in the absence of uracil but only base substitutions in the uracil-containing constructs. The AAF adduct produced mutations only in the uracil-containing DNA, which included both frame shifts and base substitutions. Mutations produced by both adducts were SOS dependent.

  2. Inhibition by resistant starch of red meat-induced promutagenic adducts in mouse colon.


    Winter, Jean; Nyskohus, Laura; Young, Graeme P; Hu, Ying; Conlon, Michael A; Bird, Anthony R; Topping, David L; Le Leu, Richard K


    Population studies have shown that high red meat intake may increase colorectal cancer risk. Our aim was to examine the effect of different amounts and sources of dietary protein on induction of the promutagenic adduct O(6)-methyl-2-deoxyguanosine (O(6)MeG) in colonocytes, to relate these to markers of large bowel protein fermentation and ascertain whether increasing colonic carbohydrate fermentation modified these effects. Mice (n = 72) were fed 15% or 30% protein as casein or red meat or 30% protein with 10% high amylose maize starch as the source of resistant starch. Genetic damage in distal colonocytes was detected by immunohistochemical staining for O(6)MeG and apoptosis. Feces were collected for measurement of pH, ammonia, phenols, p-cresol, and short-chain fatty acids (SCFA). O(6)MeG and fecal p-cresol concentrations were significantly higher with red meat than with casein (P < 0.018), with adducts accumulating in cells at the crypt apex. DNA adducts (P < 0.01) and apoptosis (P < 0.001) were lower and protein fermentation products (fecal ammonia, P < 0.05; phenol, P < 0.0001) higher in mice fed resistant starch. Fecal SCFA levels were also higher in mice fed resistant starch (P < 0.0001). This is the first demonstration that high protein diets increase promutagenic adducts (O(6)MeG) in the colon and dietary protein type seems to be the critical factor. The delivery of fermentable carbohydrate to the colon (as resistant starch) seems to switch from fermentation of protein to that of carbohydrate and a reduction in adduct formation, supporting previous observations that dietary resistant starch opposes the mutagenic effects of dietary red meat. PMID:21885815

  3. Correlations between Photodegradation of Bisretinoid Constituents of Retina and Dicarbonyl Adduct Deposition.


    Zhou, Jilin; Ueda, Keiko; Zhao, Jin; Sparrow, Janet R


    Non-enzymatic collagen cross-linking and carbonyl adduct deposition are features of Bruch's membrane aging in the eye, and disturbances in extracellular matrix turnover are considered to contribute to Bruch's membrane thickening. Because bisretinoid constituents of the lipofuscin of retinal pigment epithelial (RPE) cells are known to photodegrade to mixtures of aldehyde-bearing fragments and small dicarbonyls (glyoxal (GO) and methylglyoxal (MG)), we investigated RPE lipofuscin as a source of the reactive species that covalently modify protein side chains. Abca4(-/-) and Rdh8(-/-)/Abca4(-/-) mice that are models of accelerated bisretinoid formation were studied and pre-exposure of mice to 430 nm light enriched for dicarbonyl release by bisretinoid photodegradation. MG protein adducts were elevated in posterior eyecups of mutant mice, whereas carbonylation of an RPE-specific protein was observed in Abca4(-/-) but not in wild-type mice under the same conditions. Immunolabeling of cryostat-sectioned eyes harvested from Abca4(-/-) mice revealed that carbonyl adduct deposition in Bruch's membrane was accentuated. Cell-based assays corroborated these findings in mice. Moreover, the receptor for advanced glycation end products that recognizes MG and GO adducts and glyoxylase 1 that metabolizes MG and GO were up-regulated in Abca4(-/-) mice. Additionally, in acellular assays, peptides were cross-linked in the presence of A2E (adduct of two vitamin A aldehyde and ethanolamine) photodegradation products, and in a zymography assay, reaction of collagen IV with products of A2E photodegradation resulted in reduced cleavage by the matrix metalloproteinases MMP2 and MMP9. In conclusion, these mechanistic studies demonstrate a link between the photodegradation of RPE bisretinoid fluorophores and aging changes in underlying Bruch's membrane that can confer risk of age-related macular degeneration. PMID:26400086

  4. Identification of adducts formed by reaction of N-acetoxy-3,5-dimethylaniline with DNA

    PubMed Central

    Cui, Liang; Sun, Hsiao-Lan; Wishnok, John S.; Tannenbaum, Steven R.; Skipper, Paul L.


    Aromatic amines constitute one of the most extensively studied classes of chemical carcinogens. Although monocyclic aromatic amines are generally regarded as weak carcinogens, a recent epidemiologic study of bladder cancer found that the arylamine 3,5-dimethylaniline (3,5-DMA) may play a significant role in the etiology of this disease in man. Investigations using experimental animals also strongly suggested that DNA adducts—of indeterminate structure—formed by 3,5-DMA might account for its presumptive activity. The present study was undertaken to determine the structures of the major DNA adducts formed in vitro by the known, and possibly carcinogenic, N-hydroxylated metabolite. Calf thymus DNA (ct-DNA) was modified by reaction with N-acetoxy-3,5-dimethylaniline (N-AcO-3,5-DMA). After enzymatic hydrolysis of DNA to individual 2'-deoxyribonucleosides, adduct profiles were determined using HPLC/MS. 3,5-DMA formed four major DNA adducts, one to 2’-deoxyguanosine (dG), two to 2’-deoxyadenosine (dA), and one to 2’-deoxycytidine (dC). Reactions of N-AcO-3,5-DMA with dG, dA, and dC produced the same adducts as reaction with ct-DNA with very similar profiles. Adducts were isolated chromatographically and unambiguously characterized as N-(deoxyguanosin-8-yl)-3,5-dimethylaniline (dG-C8−3,5-DMA), 4-(deoxyadenosin-N6-yl)-3,5-dimethylaniline (dA-N6-3,5-DMA), N-(deoxyadenosin-8-yl)-3,5-dimethylaniline (dA-C8−3,5-DMA), and N-(deoxycytidin-5-yl)-3,5-dimethylaniline (dC-C5−3,5-DMA) by high-resolution mass spectra (HR-MS) and NMR spectroscopy including 1H-NMR, 13C-NMR, and two-dimensional NMR. This report includes the first detailed description of a dC adduct of an aromatic amine. The present results provide chemical support for a carcinogenic mechanism of action by 3,5-DMA based on N-hydroxylation and the intermediacy of a nitrenium ion in the formation of DNA adducts. PMID:18020398


    EPA Science Inventory

    Cyclopenta[cd]pyrene (CPP) was examined for its lung tumorigenic activity in strain A/J mice, for the formation and persistence of CPP-induced DNA adducts in lung tissue, and for its induction of mutations in the Ki-ras oncogene from CPP-induced tumors. PP displayed high tumorige...


    EPA Science Inventory

    The in vitro metabolism of [3H]benzo[a]pyrene (BP) and [14C]benzo[a]pyrene-7,8-dihydrodiol (BP-7,8-diol) by liver of brown bullhead (Ictalurus Nebulosus) was characterized, as was the formation and persistence of BP-DNA adducts in vivo. ompared to rat liver microsomes, bullhead l...

  7. Cytochrome c adducts with PCB quinoid metabolites.


    Li, Miao; Teesch, Lynn M; Murry, Daryl J; Pope, R Marshal; Li, Yalan; Robertson, Larry W; Ludewig, Gabriele


    Polychlorinated biphenyls (PCBs) are a group of 209 individual congeners widely used as industrial chemicals. PCBs are found as by-products in dye and paint manufacture and are legacy, ubiquitous, and persistent as human and environmental contaminants. PCBs with fewer chlorine atoms may be metabolized to hydroxy- and dihydroxy-metabolites and further oxidized to quinoid metabolites both in vitro and in vivo. Specifically, quinoid metabolites may form adducts on nucleophilic sites within cells. We hypothesized that the PCB-quinones covalently bind to cytochrome c and, thereby, cause defects in the function of cytochrome c. In this study, synthetic PCB quinones, 2-(4'-chlorophenyl)-1,4-benzoquinone (PCB3-pQ), 4-4'-chlorophenyl)-1,2-benzoquinone (PCB3-oQ), 2-(3', 5'-dichlorophenyl)-1,4-benzoquinone, 2-(3',4', 5'-trichlorophenyl)-1,4-benzoquinone, and 2-(4'-chlorophenyl)-3,6-dichloro-1,4-benzoquinone, were incubated with cytochrome c, and adducts were detected by liquid chromatography-mass spectrometry (LC-MS) and matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI TOF). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was employed to separate the adducted proteins, while trypsin digestion and liquid chromatography-tandem mass spectrometry (LC-MS/MS) were applied to identify the amino acid binding sites on cytochrome c. Conformation change of cytochrome c after binding with PCB3-pQ was investigated by SYBYL-X simulation and cytochrome c function was examined. We found that more than one molecule of PCB-quinone may bind to one molecule of cytochrome c. Lysine and glutamic acid were identified as the predominant binding sites. Software simulation showed conformation changes of adducted cytochrome c. Additionally, cross-linking of cytochrome c was observed on the SDS-PAGE gel. Cytochrome c was found to lose its function as electron acceptor after incubation with PCB quinones. These data provide evidence that the covalent

  8. Methoxylation of Singly Bonded 1,4-1',4'-BnC60-C60Bn Dimer: Preferential Formation of 1,4-C60 Adduct with Sterically Less Demanding Addends and Stability Difference between 1,2- and 1,4-OMe(Bn)C60.


    He, Fa-Gui; Li, Zong-Jun; Gao, Xiang


    Methoxylation of the singly bonded 1,4-1',4'-BnC60-C60Bn dimer afforded 1,4-OMe(Bn)C60, a 1,4-C60 adduct with sterically less demanding addends, as the major adduct. The situation was different from that of direct functionalization of C60, where 1,2-OMe(Bn)C60 was obtained as the major product. The reaction was studied with in situ vis-NIR spectroscopy and computational calculations to obtain a better understanding of this unusual regioselectivity. The stability difference between 1,2- and 1,4-OMe(Bn)C60 was studied. PMID:27387300

  9. Red Wine Consumption is inversely associated with 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)-DNA Adduct Levels in Prostate

    PubMed Central

    Rybicki, Benjamin A.; Neslund-Dudas, Christine; Bock, Cathryn H.; Nock, Nora L.; Rundle, Andrew; Jankowski, Michelle; Levin, Albert M.; Beebe-Dimmer, Jennifer; Savera, Adnan T.; Takahashi, Satoru; Shirai, Tomoyuki; Tang, Deliang


    In humans, genetic variation and dietary factors may alter the biologic effects of exposure to 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), one of the major heterocyclic amines generated from cooking meats at high temperatures that has carcinogenic potential through the formation of DNA adducts. Previously, we reported grilled red meat consumption associated with PhIP-DNA adduct levels in human prostate. In the present study, we expanded our investigation to estimate the associations between beverage consumption and PhIP-DNA adduct levels in prostate for 391 prostate cancer cases. Of the 15 beverages analyzed, red wine consumption had the strongest association with PhIP-DNA adduct levels showing an inverse correlation in both tumor (p=0.006) and non-tumor (p=0.002) prostate cells. Red wine consumption differed significantly between African-American and white cases, but PhIP-DNA adduct levels in prostate did not vary by race. In African Americans compared with whites, however, associations between red wine consumption and PhIP-DNA adduct levels were not as strong as associations with specific (e.g., SULT1A1 and UGT1A10 genotypes) and non-specific (e.g., African ancestry) genetic variation. In a multivariable model, the covariate for red wine consumption explained a comparable percentage (13-16%) of the variation in PhIP-DNA adduct levels in prostate across the two racial groups, but the aforementioned genetic factors explained 33% of the PhIP-DNA adduct variation in African-American cases, while only 19% of the PhIPDNA adduct variation in whites. We conclude that red wine consumption may counteract biologic effects of PhIP exposure in human prostate, but genetic factors may play an even larger role, particularly in African Americans. PMID:21846795

  10. Mass spectrometry-based quantification of myocardial protein adducts with acrolein in an in vivo model of oxidative stress

    PubMed Central

    Wu, Jianyong; Stevens, Jan F.; Maier, Claudia S.


    Acrolein exposure leads to the formation of protein-acrolein adducts. Protein modification by acrolein has been associated with various chronic diseases including cardiovascular and neurodegenerative diseases. Here we report an analytical strategy that enables the quantification of Michael-type protein adducts of acrolein in mitochondrial proteome samples using liquid chromatography in combination with tandem mass spectrometry and selected ion monitoring (LC-MS/MS SRM) analysis. Our approach combines site-specific identification and relative quantification at the peptide level of protein–acrolein adducts in relation to the unmodified protein thiol pool. Treatment of 3-month old rats with CCl4, an established in vivo model of acute oxidative stress, resulted in significant increases in the ratios of distinct acrolein-adducted peptides to the corresponding unmodified thiol-peptides obtained from proteins that were isolated from cardiac mitochondria. The mitochondrial proteins that were found adducted by acrolein were malate dehydrogenase, NADH dehydrogenase [ubiquinone] flavoprotein 1, cytochrome c oxidase subunit VIb isoform 1, ATP synthase d chain, and ADP/ATP translocase 1. The findings indicate that protein modification by acrolein has potential value as an index of mitochondrial oxidative stress. PMID:21809440

  11. An abnormal N-heterocyclic carbene-carbon dioxide adduct from imidazolium acetate ionic liquids: the importance of basicity.


    Kelemen, Zsolt; Péter-Szabó, Barbara; Székely, Edit; Hollóczki, Oldamur; Firaha, Dzmitry S; Kirchner, Barbara; Nagy, József; Nyulászi, László


    In the reaction of 1-ethyl-3-methylimidazolium acetate [C2C1Im][OAc] ionic liquid with carbon dioxide at 125 °C and 10 MPa, not only the known N-heterocyclic carbene (NHC)-CO2 adduct I, but also isomeric aNHC-CO2 adducts II and III were obtained. The abnormal NHC-CO2 adducts are stabilized by the presence of the polarizing basic acetate anion, according to static DFT calculations and ab initio molecular dynamics studies. A further possible reaction pathway is facilitated by the high basicity of the system, deprotonating the initially formed NHC-CO2 adduct I, which can then be converted in the presence of the excess of CO2 to the more stable 2-deprotonated anionic abnormal NHC-CO2 adduct via the anionic imidazolium-2,4-dicarboxylate according to DFT calculations on model compounds. This suggests a generalizable pathway to abnormal NHC complex formation. PMID:25137312

  12. Determining protein adducts of fipexide: mass spectrometry based assay for confirming the involvement of its reactive metabolite in covalent binding.


    Sleno, Lekha; Varesio, Emmanuel; Hopfgartner, Gérard


    Fipexide is a nootropic drug, withdrawn from the market due to its idiosyncratic drug reactions causing adverse effects in man. Previous work on its metabolites has identified several potential reactive metabolites which could be implicated in protein binding. Here, we investigated the formation of these metabolites in rat and human hepatocytes. Based on these results, the o-quinone of fipexide (FIP), formed via the demethylenation reaction through a catechol intermediate, was chosen for further investigation. Studies were then pursued in order to relate this metabolite to protein binding, and thus better understand potential mechanisms for the toxicity of the parent compound. An assay was developed for determining the fipexide catechol-cysteine adduct in the microsomal protein fractions following in vitro incubations. This method digests the entire protein fraction into amino acids, followed by the detection of the Cys-metabolite adduct by liquid chromatography/mass spectrometry (LC/MS). We have designed a strategy where drug metabolism taking place in microsomal incubations and involved in protein binding can be assessed after the proteins have been digested, with the detection of the specific amino acid adduct. In this study, the structure of the fipexide adduct was hypothesized using knowledge previously gained in glutathione and N-acetylcysteine trapping experiments. Acetaminophen was used as a positive control for detecting a drug metabolite-cysteine adduct by LC/MS. This approach has the potential to be applicable as a protein-binding assay in early drug discovery without the need for radioactive compounds. PMID:18022964

  13. An Adenine-DNA Adduct Derived from Nitroreduction of 6-Nitrochrysene is more Resistant to Nucleotide Excision Repair than Guanine-DNA Adducts

    PubMed Central

    Krzeminski, Jacek; Kropachev, Konstantin; Reeves, Dara; Kolbanovskiy, Aleksandr; Kolbanovskiy, Marina; Chen, Kun-Ming; Sharma, Arun K.; Geacintov, Nicholas; Amin, Shantu; El-Bayoumy, Karam


    Previous studies in rats, mice and in vitro systems showed that 6-NC can be metabolically activated by two major pathways: 1) the formation of N-hydroxy-6-aminochrysene by nitroreduction to yield three major adducts: N-(dG-8-yl)-6-AC, 5-(dG-N2-yl)-6-AC and N-(dA-8-yl)-6-AC, and 2) the formation of trans-1,2-dihydroxy-1,2-dihydro-6-hydroxylaminochrysene (1,2-DHD-6-NHOH-C) by a combination of nitroreduction and ring oxidation pathways to yield: N-(dG-8-yl)-1,2-DHD-6-AC, 5-(dG-N2-yl)-1,2-DHD-6-AC and N-(dA-8-yl)-1,2-DHD-6-AC. These DNA lesions are likely to cause mutations if they are not removed by cellular defense mechanisms before DNA replication occurs. Here we compared for the first time, in HeLa cell extracts in vitro, the relative nucleotide excision repair (NER) efficiencies of DNA lesions derived from simple nitroreduction and from a combination of nitroreduction and ring oxidation pathways. We show that the N-(dG-8-yl)-1,2-DHD-6-AC adduct is more resistant to NER than the N-(dG-8-yl)-6-AC adduct by a factor of ~2. Furthermore, the N-(dA-8-yl)-6-AC is much more resistant to repair since its NER efficiency is ~ 8-fold lower than that of the N-(dG-8-yl)-6-AC adduct. On the basis of our previous study and the present investigation, lesions derived from 6-NC and benzo[a]pyrene can be ranked from the most to the least resistant lesion as follows: N-(dA-8-yl)-6-AC > N-(dG-8-yl)-1,2-DHD-6-AC > 5-(dG-N2-yl)-6-AC ~ N-(dG-8-yl)-6-AC ~ (+)-7R,8S,9S,10S-benzo[a]pyrene diol epoxide-derived trans-anti-benzo[a]pyrene-N2-dG adduct. The slow repair of the various lesions derived from 6-NC and thus their potential persistence in mammalian tissue, could in part account for the powerful carcinogenicity of 6-NC as compared to B[a]P in the rat mammary gland. PMID:24112095

  14. 40 CFR 721.4590 - Mannich-based adduct.

    Code of Federal Regulations, 2014 CFR


    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Mannich-based adduct. 721.4590 Section 721.4590 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.4590 Mannich-based adduct....


    EPA Science Inventory

    For many years 32P postlabeling has detected DNA adducts at very low levels and yet has not been able to identify unknown adducts. Mass spectrometry offers substantially improved identification powers, albeit at some loss in detection limits. With this ultimate utilization of ma...

  16. Intramolecular Tetrylene Lewis Adducts: Synthesis and Reactivity.


    Schneider, Julia; Krebs, Kilian M; Freitag, Sarah; Eichele, Klaus; Schubert, Hartmut; Wesemann, Lars


    A series of benzyl(diphenylphosphino) and o-phenyl(diphenlyphosphino) substituted germylenes and plumbylenes were synthesized by nucleophilic substitution between the respective lithium reagent and tetrylene halide. The Lewis pairs were characterized by X-ray crystallography and NMR spectroscopy. The reactivity of the tetrylenes was investigated with respect to azide addition. In the germylene case, the germaniumimide was formed as the kinetically controlled product, which rearranges upon heating to give the phosphinimide. The stannylene and plumbylene derivatives react with adamantylazide to give the azide adducts. 1-Pentene reacts diastereoselectively with the phosphagermirane to give a cyclic addition product. Trimethysilylacetylene shows an addition with the benzylphosphino-substituted germylene and plumbylene to give the cycloheteropentene molecules. The addition product between phenylacetylene and the four membered Ge-P adduct shows after addition at room temperature a 1,4-phenylmigration to give a cyclic phosphine. Alkylnitrene insertion into a Ge-C bond of the alkyne addition product of the phosphagermirane was found in reaction with adamantylazide. PMID:27273819

  17. A computational study of the activation of allenoates by Lewis bases and the reactivity of intermediate adducts.


    Huang, Gou-Tao; Lankau, Timm; Yu, Chin-Hui


    Several chemical properties of Lewis base-allenoate adducts (LB·allenoate), such as solvent effect, basicity, nucleophilicity and cycloaddition, are studied to provide a detailed foundation for the analysis of LB-catalyzed reactions of allenoates. The zwitterionic LB·allenoates formed between methyl allenoate and Lewis bases, such as N-heterocyclic carbenes (NHCs), phosphines, amines and aza-heterocycles, are studied at the M06-2X/6-31+G* level. The addition of the LBs to the allenoate can yield Z- or E-type adducts. The formation of the Z-type adducts is more favorable in the gas phase due to electrostatic interactions. The yield of the E-type adducts increases with the permittivity of the solvent. The lowest barriers for the addition and the most stable adducts are observed with NHCs as catalysts. It is also shown that the α-carbon atom of the allenic moiety in LB·allenoate is more nucleophilic than the γ-carbon atom. Aza-arenes, phosphines and NHCs stabilize the [3 + 2]-ylides formed by the cycloaddition of LB·allenoate to ethylene; therefore, these LBs thermodynamically support the [3 + 2] cycloadditions. The detailed analysis of [3 + 2]-, [2 + 4]-, [2 + 2]- and [2 + 2 + 2]-cycloadditions with enones/ketones shows that the amine-catalyzed reactions follow the kinetically preferred path, and that the exergonic formation of the P-ylide favors the [3 + 2] cycloaddition in the phosphine-catalyzed reaction. The thermodynamically preferred pathway is followed with NHCs whereas the high stability of NHC·allenoate adducts reduces the overall catalytic efficiency of NHCs. PMID:25110957

  18. Role of pyridine in Wyodak-pyridine adducts

    SciTech Connect

    David L. Wertz; Amanda Winters; Tara Craft; Jami Holloway


    When pyridine (PYR) is added to powdered Wyodak subbituminous coal (WYO), the sample is converted to a paste, and the molecular-level adduct which is formed is stable for months. After the excess pyridine has evaporated from the WYO-PYR sample, the stoichiometry of the adduct is ca. two pyridine molecules per bilayer of WYO polycyclic units; this adduct exists even after mild vacuum treatment of the sample. The pyridine molecules in this adduct appear to be located between the bilayer lamellae and to be H-bonded to either H-O or H-N moieties attached to the poly-cyclic aromatic units of WYO. An H-bonded N- - -H-X distance of 2.6 {angstrom} has been calculated from a structural model of the WYO-PYR adduct. 37 refs., 12 figs., 4 tabs.

  19. Role of retinoic acid in the modulation of benzo(a)pyrene-DNA adducts in human hepatoma cells: Implications for cancer prevention

    SciTech Connect

    Zhou Guodong; Richardson, Molly; Fazili, Inayat S.; Wang, Jianbo; Donnelly, Kirby C.; Wang Fen; Amendt, Brad; Moorthy, Bhagavatula


    Carcinogen-DNA adducts could lead to mutations in critical genes, eventually resulting in cancer. Many studies have shown that retinoic acid (RA) plays an important role in inducing cell apoptosis. Here we have tested the hypothesis that levels of carcinogen-DNA adducts can be diminished by DNA repair and/or by eliminating damaged cells through apoptosis. Our results showed that the levels of total DNA adducts in HepG2 cells treated with benzo(a)pyrene (BP, 2 {mu}M) + RA (1 {mu}M) were significantly reduced compared to those treated with BP only (P = 0.038). In order to understand the mechanism of attenuation of DNA adducts, further experiments were performed. Cells were treated with BP (4 {mu}M) for 24 h to initiate DNA adduct formation, following which the medium containing BP was removed, and fresh medium containing 1 {mu}M RA was added. The cells were harvested 24 h after RA treatment. Interestingly, the levels of total DNA adducts were lower in the BP/RA group (390 {+-} 34) than those in the BP/DMSO group (544 {+-} 33), P = 0.032. Analysis of cell apoptosis showed an increase in BP + RA group, compared to BP or RA only groups. Our results also indicated that attenuation of BP-DNA adducts by RA was not primarily due to its effects on CYP1A1 expression. In conclusion, our results suggest a mechanistic link between cellular apoptosis and DNA adduct formation, phenomena that play important roles in BP-mediated carcinogenesis. Furthermore, these results help understand the mechanisms of carcinogenesis, especially in relation to the chemopreventive properties of nutritional apoptosis inducers.

  20. Comprehensive High-Resolution Mass Spectrometric Analysis of DNA Phosphate Adducts Formed by the Tobacco-Specific Lung Carcinogen 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone

    PubMed Central


    The tobacco-specific nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK, 1) is a potent lung carcinogen in laboratory animals and is believed to play a key role in the development of lung cancer in smokers. Metabolic activation of NNK leads to the formation of pyridyloxobutyl DNA adducts, a critical step in its mechanism of carcinogenesis. In addition to DNA nucleobase adducts, DNA phosphate adducts can be formed by pyridyloxobutylation of the oxygen atoms of the internucleotidic phosphodiester linkages. We report the use of a liquid chromatography–nanoelectrospray ionization–high-resolution tandem mass spectrometry technique to characterize 30 novel pyridyloxobutyl DNA phosphate adducts in calf thymus DNA (CT-DNA) treated with 4-(acetoxymethylnitrosamino)-1-(3-pyridyl)-1-butanone (NNKOAc, 2), a regiochemically activated form of NNK. A 15N3-labeled internal standard was synthesized for one of the most abundant phosphate adducts, dCp[4-oxo-4-(3-pyridyl)butyl]dC (CpopC), and this standard was used to quantify CpopC and to estimate the levels of other adducts in the NNKOAc-treated CT-DNA. Formation of DNA phosphate adducts by NNK in vivo was further investigated in rats treated with NNK acutely (0.1 mmol/kg once daily for 4 days by subcutaneous injection) and chronically (5 ppm in drinking water for 10, 30, 50, and 70 weeks). This study provides the first comprehensive structural identification and quantitation of a panel of DNA phosphate adducts of a structurally complex carcinogen and chemical support for future mechanistic studies of tobacco carcinogenesis in humans. PMID:26398225


    EPA Science Inventory

    An analysis of the tissue DNA adducts in rats by the sensitive 32P-postlabeling assay showed one to eight detectable DNA adducts in lung, trachea, larynx, heart and bladder of the sham controls. hronic exposure of animals to mainstream cigarette smoke showed a remarkable enhancem...

  2. Novel pyrano and vinylphenol adducts of deoxyanthocyanidins in sorghum sourdough.


    Bai, Yunpeng; Findlay, Brandon; Maldonado, Alma Fernanda Sanchez; Schieber, Andreas; Vederas, John C; Gänzle, Michael G


    This study determined the fate of deoxyanthocyanidins in sorghum sourdoughs. Sourdoughs prepared from the red sorghum variety Town were fermented with the caffeic acid-decarboxylating strains Lactobacillus plantarum FUA3171 and the decarboxylase negative L. casei FUA3166. Deoxyanthocyanidins were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Apigeninidin and methoxyapigeninidin were the major deoxyanthocyanidins prior to fermentation. During fermentation, novel deoxyanthocyanidins were formed. Purification by preparative LC, followed by NMR analysis and high-resolution MS identified two of the compounds as 6-deoxyanthocyanidin-vinylphenol and pyrano-3-deoxyanthocyanidin. To identify pathways for their formation, sorghum was fermented with single strains, L. plantarum or L. casei. 6-Deoxyanthocyanidin-vinylphenol and pyrano-3-deoxyanthocyanidin were formed only during fermentation with L. plantarum FUA3171, indicating a role of vinylphenol in their formation. Chemical synthesis confirmed that 6-deoxyanthocyanidin-vinylphenol and pyrano-3-deoxyanthocyanidin are formed from apigeninidin with vinylphenol but not with p-coumaric acid as reactants. In conclusion, the products of microbial decarboxylation of hydroxycinnamic acids convert apigeninidin and methoxyapigeninidin to pyrano-3-deoxyanthocyanidins and vinylphenol adducts. PMID:25370078

  3. Phenobarbital increases DNA adduct and metabolites formed by ochratoxin A: role of CYP 2C9 and microsomal glutathione-S-transferase.


    El Adlouni, C; Pinelli, E; Azémar, B; Zaoui, D; Beaune, P; Pfohl-Leszkowicz, A


    Ochratoxin A (OTA), a mycotoxin that induces nephrotoxicity and urinary tract tumors, is genotoxic and can be metabolized not only by different cytochromes P450 (CYP) but also by peroxidases involved in the arachidonic cascade, although the exact nature of the metabolites involved in the genotoxic process is still unknown. In order to establish the relation between OTA genotoxicity and the formation of metabolites, we chose three experimental models: kidney microsomes from rabbit, human bronchial epithelial cells, and microsomes from yeast that specifically express the human cytochrome P450 2C9 or 2B6 genes. OTA-DNA adducts were analyzed by (32)P postlabeling and the OTA derivatives formed were isolated by HPLC after incubation of OTA in the presence of: (1) kidney microsomes from rabbit pretreated or not with phenobarbital (PB); (2) human pulmonary epithelial cells simultaneously pretreated (or not) with PB alone or in the presence of ethacrynic acid (EA); (3) microsomes expressing CYP 2B6 and 2C9. PB pretreatment significantly increased DNA adducts formed after OTA treatment, both in the presence of kidney microsomes and bronchial epithelial cells, and induced the formation of new adducts. Ethacrynic acid, which inhibits microsomal glutathione-S-transferase, reduced DNA adduct level. DNA adducts were detected when OTA were incubated with microsomes expressing human CYP 2C9 but not with those expressing CYP 2B6. Several metabolites detected by HPLC were increased after PB treatment. Some of them could be related to DNA-adduct formation. In conclusion, OTA biotransformation, enhanced by PB pretreatment, increased DNA-adduct formation through pathways involving microsomal glutathion-S-transferase and CYP 2C9. PMID:10712746

  4. Biocatalytic Reductions of Baylis - Hillman Adducts

    SciTech Connect

    A Walton; W Conerly; Y Pompeu; B Sullivan; J Stewart


    Baylis-Hillman adducts are highly useful synthetic intermediates; to enhance their value further, we sought enantiocomplementary alkene reductases to introduce chirality. Two solutions emerged: (1) a wild-type protein from Pichia stipitis (OYE 2.6), whose performance significantly outstrips that of the standard enzyme (Saccharomyces pastorianus OYE1), and (2) a series of OYE1 mutants at position 116 (Trp in the wild-type enzyme). To understand how mutations could lead to inverted enantioselectivity, we solved the X-ray crystal structure of the Trp116Ile OYE1 variant complexed with a cyclopentenone substrate. This revealed key protein-ligand interactions that control the orientation of substrate binding above the FMN cofactor.

  5. Glottal Adduction and Subglottal Pressure in Singing.


    Herbst, Christian T; Hess, Markus; Müller, Frank; Švec, Jan G; Sundberg, Johan


    Previous research suggests that independent variation of vocal loudness and glottal configuration (type and degree of vocal fold adduction) does not occur in untrained speech production. This study investigated whether these factors can be varied independently in trained singing and how subglottal pressure is related to average glottal airflow, voice source properties, and sound level under these conditions. A classically trained baritone produced sustained phonations on the endoscopic vowel [i:] at pitch D4 (approximately 294 Hz), exclusively varying either (a) vocal register; (b) phonation type (from "breathy" to "pressed" via cartilaginous adduction); or (c) vocal loudness, while keeping the others constant. Phonation was documented by simultaneous recording of videokymographic, electroglottographic, airflow and voice source data, and by percutaneous measurement of relative subglottal pressure. Register shifts were clearly marked in the electroglottographic wavegram display. Compared with chest register, falsetto was produced with greater pulse amplitude of the glottal flow, H1-H2, mean airflow, and with lower maximum flow declination rate (MFDR), subglottal pressure, and sound pressure. Shifts of phonation type (breathy/flow/neutral/pressed) induced comparable systematic changes. Increase of vocal loudness resulted in increased subglottal pressure, average flow, sound pressure, MFDR, glottal flow pulse amplitude, and H1-H2. When changing either vocal register or phonation type, subglottal pressure and mean airflow showed an inverse relationship, that is, variation of glottal flow resistance. The direct relation between subglottal pressure and airflow when varying only vocal loudness demonstrated independent control of vocal loudness and glottal configuration. Achieving such independent control of phonatory control parameters would be an important target in vocal pedagogy and in voice therapy. PMID:25944295

  6. Immunodetection of Serum Albumin Adducts as Biomarkers for Organophosphorus Exposure

    PubMed Central

    Chen, Sigeng; Zhang, Jun; Lumley, Lucille


    A major challenge in organophosphate (OP) research has been the identification and utilization of reliable biomarkers for the rapid, sensitive, and efficient detection of OP exposure. Although Tyr 411 OP adducts to human serum albumin (HSA) have been suggested to be one of the most robust biomarkers in the detection of OP exposure, the analysis of HSA-OP adduct detection has been limited to techniques using mass spectrometry. Herein, we describe the procurement of two monoclonal antibodies (mAb-HSA-GD and mAb-HSA-VX) that recognized the HSA Tyr 411 adduct of soman (GD) or S-[2-(diisopropylamino)ethyl]-O-ethyl methylphosphonothioate (VX), respectively, but did not recognize nonphosphonylated HSA. We showed that mAb-HSA-GD was able to detect the HSA Tyr 411 OP adduct at a low level (i.e., human blood plasma treated with 180 nM GD) that could not be detected by mass spectrometry. mAb-HSA-GD and mAb-HSA-VX showed an extremely low-level detection of GD adducted to HSA (on the order of picograms). mAb-HSA-GD could also detect serum albumin OP adducts in blood plasma samples from different animals administered GD, including rats, guinea pigs, and monkeys. The ability of the two antibodies to selectively recognize nerve agents adducted to serum albumin suggests that these antibodies could be used to identify biomarkers of OP exposure and provide a new biologic approach to detect OP exposure in animals. PMID:23192655

  7. Derivatization of isothiocyanates and their reactive adducts for chromatographic analysis.


    Agerbirk, Niels; De Nicola, Gina Rosalinda; Olsen, Carl Erik; Müller, Caroline; Iori, Renato


    Isothiocyanates form adducts with a multitude of biomolecules, and these adducts need analytical methods. Likewise, analytical methods for hydrophilic isothiocyanates are needed. We considered reaction with ammonia to form thiourea derivatives. The hydrophilic, glycosylated isothiocyanate moringin, 4-(α-L-rhamnopyranosyloxy)benzyl isothiocyanate, was efficiently derivatized to the thiourea derivative by incubation with ammonia. The hydrophobic benzyl isothiocyanate was also efficiently derivatized to the thiourea derivative. The thiourea group provided a UV absorbing chromophore, and the derivatives showed expectable sodium and hydrogen adducts in ion trap mass spectrometry and were suitable for liquid chromatography analysis. Reactive dithiocarbamate adducts constitute the major type of reactive ITC adduct expected in biological matrices. Incubation of a model dithiocarbamate with ammonia likewise resulted in conversion to the corresponding thiourea derivative, suggesting that a variety of matrix-bound reactive isothiocyanate adducts can be determined using this strategy. As an example of the application of the method, recovery of moringin and benzyl isothiocyanate applied to cabbage leaf discs was studied in simulated insect feeding assays. The majority of moringin was recovered as native isothiocyanate, but a major part of benzyl isothiocyanate was converted to reactive adducts. PMID:26342619

  8. Benzene-derived N2-(4-hydroxyphenyl)-deoxyguanosine adduct: UvrABC incision and its conformation in DNA

    SciTech Connect

    Hang, Bo; Rodriguez, Ben; Yang, Yanu; Guliaev, Anton B.; Chenna, Ahmed


    Benzene, a ubiquitous human carcinogen, forms DNA adducts through its metabolites such as p-benzoquinone (p-BQ) and hydroquinone (HQ). N(2)-(4-Hydroxyphenyl)-2'-deoxyguanosine (N(2)-4-HOPh-dG) is the principal adduct identified in vivo by (32)P-postlabeling in cells or animals treated with p-BQ or HQ. To study its effect on repair specificity and replication fidelity, we recently synthesized defined oligonucleotides containing a site-specific adduct using phosphoramidite chemistry. We here report the repair of this adduct by Escherichia coli UvrABC complex, which performs the initial damage recognition and incision steps in the nucleotide excision repair (NER) pathway. We first showed that the p-BQ-treated plasmid was efficiently cleaved by the complex, indicating the formation of DNA lesions that are substrates for NER. Using a 40-mer substrate, we found that UvrABC incises the DNA strand containing N(2)-4-HOPh-dG in a dose- and time-dependent manner. The specificity of such repair was also compared with that of DNA glycosylases and damage-specific endonucleases of E. coli, both of which were found to have no detectable activity toward N(2)-4-HOPh-dG. To understand why this adduct is specifically recognized and processed by UvrABC, molecular modeling studies were performed. Analysis of molecular dynamics trajectories showed that stable G:C-like hydrogen bonding patterns of all three Watson-Crick hydrogen bonds are present within the N(2)-4-HOPh-G:C base pair, with the hydroxyphenyl ring at an almost planar position. In addition, N(2)-4-HOPh-dG has a tendency to form more stable stacking interactions than a normal G in B-type DNA. These conformational properties may be critical in differential recognition of this adduct by specific repair enzymes.

  9. Characterization of glycidol-hemoglobin adducts as biomarkers of exposure and in vivo dose

    SciTech Connect

    Honda, Hiroshi; Törnqvist, Margareta; Nishiyama, Naohiro; Kasamatsu, Toshio


    Hemoglobin adducts have been used as biomarkers of exposure to reactive chemicals. Glycidol, an animal carcinogen, has been reported to form N-(2,3-dihydroxy-propyl)valine adducts to hemoglobin (diHOPrVal). To support the use of these adducts as markers of glycidol exposure, we investigated the kinetics of diHOPrVal formation and its elimination in vitro and in vivo. Five groups of rats were orally administered a single dose of glycidol ranging from 0 to 75 mg/kg bw, and diHOPrVal levels were measured 24 h after administration. A dose-dependent increase in diHOPrVal levels was observed with high linearity (R{sup 2} = 0.943). Blood sampling at different time points (1, 10, 20, or 40 days) from four groups administered glycidol at 12 mg/kg bw suggested a linear decrease in diHOPrVal levels compatible with the normal turnover of rat erythrocytes (life span, 61 days), with the calculated first-order elimination rate constant (k{sub el}) indicating that the diHOPrVal adduct was chemically stable. Then, we measured the second-order rate constant (k{sub val}) for the reaction of glycidol with N-terminal valine in rat and human hemoglobin in in vitro experiments with whole blood. The k{sub val} was 6.7 ± 1.1 and 5.6 ± 1.3 (pmol/g globin per μMh) in rat and human blood, respectively, indicating no species differences. In vivo doses estimated from k{sub val} and diHOPrVal levels were in agreement with the area under the (concentration–time) curve values determined in our earlier toxicokinetic study in rats. Our results indicate that diHOPrVal is a useful biomarker for quantification of glycidol exposure and for risk assessment. - Highlight: • Glycidol-hemoglobin adduct (diHOPrVal) was characterized for exposure evaluation. • We studied the kinetics of diHOPrVal formation and elimination in vitro and in vivo. • Dose dependent formation and chemical stability were confirmed in the rat study. • In vivo dose (AUC) of glycidol could be estimated from diHOPrVal levels

  10. Cigarette side-stream smoke lung and bladder carcinogenesis: inducing mutagenic acrolein-DNA adducts, inhibiting DNA repair and enhancing anchorage-independent-growth cell transformation

    PubMed Central

    Chin, Chiu; Huang, William; Lepor, Herbert; Wu, Xue-Ru; Rom, William N.; Chen, Lung-Chi; Tang, Moon-shong


    Second-hand smoke (SHS) is associated with 20–30% of cigarette-smoke related diseases, including cancer. Majority of SHS (>80%) originates from side-stream smoke (SSS). Compared to mainstream smoke, SSS contains more tumorigenic polycyclic aromatic hydrocarbons and acrolein (Acr). We assessed SSS-induced benzo(a)pyrene diol epoxide (BPDE)- and cyclic propano-deoxyguanosine (PdG) adducts in bronchoalveolar lavage (BAL), lung, heart, liver, and bladder-mucosa from mice exposed to SSS for 16 weeks. In SSS exposed mice, Acr-dG adducts were the major type of PdG adducts formed in BAL (p < 0.001), lung (p < 0.05), and bladder mucosa (p < 0.001), with no significant accumulation of Acr-dG adducts in heart or liver. SSS exposure did not enhance BPDE-DNA adduct formation in any of these tissues. SSS exposure reduced nucleotide excision repair (p < 0.01) and base excision repair (p < 0.001) in lung tissue. The levels of DNA repair proteins, XPC and hOGG1, in lung tissues of exposed mice were significantly (p < 0.001 and p < 0.05) lower than the levels in lung tissues of control mice. We found that Acr can transform human bronchial epithelial and urothelial cells in vitro. We propose that induction of mutagenic Acr-DNA adducts, inhibition of DNA repair, and induction of cell transformation are three mechanisms by which SHS induces lung and bladder cancers. PMID:26431382

  11. DNA adducts induced by food mutagen PhIP in a mouse model expressing human sulfotransferases 1A1 and 1A2.


    Høie, Anja Hortemo; Monien, Bernhard Hans; Glatt, Hansruedi; Hjertholm, Hege; Husøy, Trine


    Food processing contaminant 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) has previously been shown to induce formation of DNA adducts in vivo. In a previous study the adduct levels were found to increase in a mouse model expressing human (h) sulfotransferases (SULTs) 1A1 and 1A2 after PhIP exposure, detected by (32)P-postlabelling. Isotope dilution ultra performance liquid chromatography coupled with tandem mass spectrometry (UPLC-MS/MS) is emerging as the method of choice for selective and reproducible detection of known DNA adducts. In the present study we investigated the level and distribution of PhIP induced DNA adducts in male FVB mice 9-11 weeks of age with hSULT mice or wild-type mice (wt) using UPLC-MS/MS. Mice received a single administration of 75 mg/kg bw PhIP by oral gavage, and DNA was analysed 3h after exposure. C8-(2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine- N(2)-yl)-2'-deoxyguanosine (C8-PhIP-dG) adduct levels are significantly higher in PhIP exposed hSULT mice compared with PhIP exposed wt mice. The liver was the least affected organ in wild-type mice, whereas it was the most affected organ in hSULT mice with a 14-fold higher adduct level. PMID:26940682

  12. Molecular structures of five adducts assembled from p-dimethylaminobenzaldehyde and organic acids

    NASA Astrophysics Data System (ADS)

    Jin, Shouwen; Wang, Lanqing; Liu, Hui; Liu, Li; Zhang, Huan; Wang, Daqi; Li, Minghui; Guo, Jianzhong; Guo, Ming


    Five adducts 1-5 derived from p-dimethylaminobenzaldehyde have been prepared and characterized by X-ray diffraction analysis, IR, mp, and elemental analysis. Of the five adducts two are organic salts (1, and 2) and the other three (3-5) are cocrystals. In salts 1, and 2, the L molecules are protonated. The supramolecular architectures of the adducts 1-5 involve extensive intermolecular N-H⋯O, O-H⋯O, O-H⋯S, and C-H⋯O hydrogen bonds as well as other non-covalent interactions. The role of weak and strong non-covalent interactions in the crystal packing is ascertained. The complexes displayed 2D/3D framework structure for the synergistic effect of the various non-covalent interactions. The results presented herein tell that the strength and directionality of the N-H⋯O, O-H⋯O, and O-H⋯S hydrogen bonds between organic acids and p-dimethylaminobenzaldehyde are sufficient to bring about the formation of binary cocrystals or organic salts.

  13. The reversibility of the glutathionyl-quercetin adduct spreads oxidized quercetin-induced toxicity

    SciTech Connect

    Boots, Agnes W. . E-mail:; Balk, Jiska M.; Bast, Aalt; Haenen, Guido R.M.M.


    Quercetin is one of the most prominent dietary antioxidants. During its antioxidant activity, quercetin becomes oxidized into its o-quinone/quinone methide QQ. QQ is toxic since it instantaneously reacts with thiols of, e.g., proteins. In cells, QQ will initially form an adduct with glutathione (GSH), giving GSQ. We have found that GSQ is not stable; it dissociates continuously into GSH and QQ with a half life of 2 min. Surprisingly, GSQ incubated with 2-mercapto-ethanol (MSH), a far less reactive thiol, results in the conversion of GSQ into the MSH-adduct MSQ. A similar conversion of GSQ into relatively stable protein thiol-quercetin adducts is expected. With the dithiol dihydrolipoic acid (L(SH){sub 2}), quercetin is formed out of GSQ. These results indicate that GSQ acts as transport and storage of QQ. In that way, the initially highly focussed toxicity of QQ is dispersed by the formation of GSQ that finally spreads QQ-induced toxicity, probably even over cells.

  14. DNA adducts as a dosimeter for risk estimation

    SciTech Connect

    Belinsky, S.A.; White, C.M.; Devereux, T.R.; Anderson, M.W.


    The dose response for O/sup 6/-methylguanine (O/sup 6/MG) formation and cytotoxicity was determined in lung and nasal mucosa from Fischer 344 rats during multiple dose administration of the tobacco-specific nitrosamine 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone (NNK). O/sup 6/MG accumulated in the lung following treatment for 12 days with doses of NNK from 0.3 to 100 mgkgday. The dose response for NNK was nonlinear; the O/sup 6/MG-to-dose ratio, an index of alkylation efficiency, increased dramatically as the dose of carcinogen decreased. These data suggest that low- and high-K/sub m/ pathways may exist for activation to NNK to a methylating agent. Marked differences in O/sup 6/MG concentration were observed in specific lung cell populations. The presence of a high-affinity pathway in the Clara cell for activation of NNK may contribute to the potent carcinogenicity observed following low-dose exposure to this tobacco-specific carcinogen. The dose response for O/sup 6/MG formation differed considerably between the respiratory and olfactory mucosa from the nasal passages of the rat. These studies suggest that a low K/sub m/ pathway for NNK activation is also present in the nose and that this pathway is localized predominantly in the respiratory region. These data suggest that both the formation of promutagenic adducts and cell proliferation secondary to toxicity are required for the induction of neoplasia by NNK within the nose.

  15. Cellulose based hybrid hydroxylated adducts for polyurethane foams

    NASA Astrophysics Data System (ADS)

    De Pisapia, Laura; Verdolotti, Letizia; Di Mauro, Eduardo; Di Maio, Ernesto; Lavorgna, Marino; Iannace, Salvatore


    Hybrid flexible polyurethane foams (HPU) were synthesized by using a hybrid hydroxilated adduct (HHA) based on renewable resources. In particular the HHA was obtained by dispersing cellulose wastes in colloidal silica at room temperature, pressure and humidity. The colloidal silica was selected for its ability of modifying the cellulose structure, by inducing a certain "destructurization" of the crystalline phase, in order to allow cellulose to react with di-isocyanate for the final synthesis of the polyurethane foam. In fact, cellulose-polysilicate complexes are engaged in the reaction with the isocyanate groups. This study provides evidence of the effects of the colloidal silica on the cellulose structure, namely, a reduction of the microfiber cellulose diameter and the formation of hydrogen bonds between the polysilicate functional groups and the hydroxyl groups of the cellulose, as assessed by IR spectroscopy and solid state NMR. The HHA was added to a conventional polyol in different percentages (between 5 and 20%) to synthesize HPU in presence of catalysts, silicone surfactant and diphenylmethane diisocyanate (MDI). The mixture was expanded in a mold and cured for two hours at room temperature. Thermal analysis, optical microscopy and mechanical tests were performed on the foams. The results highlighted an improvement of thermal stability and a decrease of the cell size with respect neat polyurethane foam. Mechanical tests showed an improvement of the elastic modulus and of the damping properties with increasing HHA amount.

  16. Susceptibility factors and DNA adducts in peripheral blood mononuclear cells of aluminium smelter workers exposed to polycyclic aromatic hydrocarbons.


    Tuominen, Rainer; Baranczewski, Pawel; Warholm, Margareta; Hagmar, Lars; Möller, Lennart; Rannug, Agneta


    Formation of DNA adducts as a result of exposure to polycyclic aromatic hydrocarbons (PAH) was studied in 98 potroom workers from an aluminium smelting plant and in 55 blue-collar workers without occupational PAH exposure. DNA from peripheral blood mononuclear cells (PBMC) was used for quantitation of individual PAH-DNA adducts by 32P-postlabelling/high performance liquid chromatography (HPLC) analysis. Four individual DNA adducts (denoted A, B, C and D) were quantified in 141 of a total of 153 subjects. Genetic polymorphisms for cytochrome P-4501A1 ( CYP1A1), microsomal epoxide hydrolase, N-acetyltransferase 2, glutathione transferases M1, P1 and T1 ( GSTM1, GSTP1 and GSTT1, respectively) and NAD(P)H: quinone oxidoreductase 1 (NQO1) were analysed. For 52 subjects, analysis of mRNA inducibility of CYP1A1 was performed. No statistically significant differences in the levels of total or individual DNA adducts A, C and D were found between potroom workers and control subjects. All potroom workers and the subgroup of potroom workers who reported to never/sometimes use personal respiratory protection ( n=72) were found to have a significantly higher likelihood of having high levels of adduct B than control subjects [odds ratio (OR) =3.4 with 95% confidence interval (CI) of 1.3-9.2, and OR=4.2 with 95% CI 1.6-11.5, respectively]. In the subgroup, levels of adducts A and B were found to be significantly higher among workers with employment time of less than 6 months ( n=5). Also, the levels of the individual DNA adducts were to some extent modified by genetic polymorphisms in CYP1A1, GSTM1, GSTP1 and NQO1 and by CYP1A1 inducibility. In conclusion, levels of adduct B, identified by 32P-postlabelling/HPLC methodology as an indicator of PAH exposure in aluminium production, were modified by the use of respiratory protection, length of employment and genetic polymorphisms. PMID:11967624

  17. Induction of ovarian cancer and DNA adducts by dibenzo[a,l]pyrene in the mouse

    PubMed Central

    Chen, Kun-Ming; Zhang, Shang-Min; Aliaga, Cesar; Sun, Yuan-Wan; Cooper, Timothy; Gowdahalli, Krishnegowda; Zhu, Junjia; Amin, Shantu; El-Bayoumy, Karam


    Tobacco smoking is an etiological factor of ovarian cacner; however, the mechanisms remain largely undefined. Therefore, as an initial investigation we examined the carcinogenicity and DNA adducts formation in the ovary of mice treated with DB[a,l]P, a tobacco smoke constituent and environmental pollutant. Ovarian tumors in B6C3F1 mice were induced by direct application of DB[a,l]P (24, 12, 6, and 3 nmol/mouse, 3 times a week for 38 weeks) into the oral cavity of mice. At 6 nmol, DB[a,l]P induced the highest total ovarian tumor incidence (79%), but the incidence of malignancy was only 15%. However, at the dose of 12 nmol, the total ovarian tumor incidence was 75%, and the incidence of malignancy was 65%. In addition to ovarian tumors, at the dose of 24 nmol, DB[a,l]P induced lesions in sites distal from the ovaries including the skin, mammary, lung, and oral tissues which were rare at doses lower than 24 nmol. Another bioassay was conducted to detect and quantify DNA-adducts induced by DB[a,l]P (24 nmol, 3 times a week for 5 weeks) in the ovary at 48 h, 1, 2 and 4 weeks after the last administration of DB[a,l]P. DNA was isolated, and the dibenzo[a,l]pyrene-11,12-dihydrodiol-13,14-epoxide (DB[a,l]PDE)-DNA adducts were analyzed by a LC-MS/MS method. DB[a,l]P resulted in the formation of (−)-anti-cis-DB[a,l]PDE-dA and (−)-anti-trans-DB[a,l]PDE-dA adducts, which were 0.8 and 1.6 fmol/106 dA respectively in ovaries of mice within 48 h, and the level of adducts decreased over a week. Our results indicated that DB[a,l]P can be metabolized to form (−)-anti-DB[a,l]PDE; the latter may, in part, account for DB[a,l]P-induced ovarian cancer. This animal model should assist to better understand the mechanisms, account for the induction of ovarian cancer by tobacco carcinogens, and facilitate the development of chemopreventive agents against ovarian cancer. PMID:22107356

  18. Relating protein adduction to gene expression changes: a systems approach

    PubMed Central

    Zhang, Bing; Shi, Zhiao; Duncan, Dexter T; Prodduturi, Naresh; Marnett, Lawrence J; Liebler, Daniel C


    Modification of proteins by reactive electrophiles such as the 4-hydroxy-2-nonenal (HNE) plays a critical role in oxidant-associated human diseases. However, little is known about protein adduction and the mechanism by which protein damage elicits adaptive effects and toxicity. We developed a systems approach for relating protein adduction to gene expression changes through the integration of protein adduction, gene expression, protein-DNA interaction, and protein-protein interaction data. Using a random walk strategy, we expanded a list of responsive transcription factors inferred from gene expression studies to upstream signaling networks, which in turn allowed overlaying protein adduction data on the network for the prediction of stress sensors and their associated regulatory mechanisms. We demonstrated the general applicability of transcription factor-based signaling network inference using 103 known pathways. Applying our workflow on gene expression and protein adduction data from HNE-treatment not only rediscovered known mechanisms of electrophile stress but also generated novel hypotheses regarding protein damage sensors. Although developed for analyzing protein adduction data, the framework can be easily adapted for phosphoproteomics and other types of protein modification data. PMID:21594272

  19. Uranyl acetate induces hprt mutations and uranium-DNA adducts in Chinese hamster ovary EM9 cells.


    Stearns, Diane M; Yazzie, Monica; Bradley, Andrew S; Coryell, Virginia H; Shelley, Jake T; Ashby, Adam; Asplund, Craig S; Lantz, R Clark


    Questions about possible adverse health effects from exposures to uranium have arisen as a result of uranium mining, residual mine tailings and use of depleted uranium in the military. The purpose of the current study was to measure the toxicity of depleted uranium as uranyl acetate (UA) in mammalian cells. The activity of UA in the parental CHO AA8 line was compared with that in the XRCC1-deficient CHO EM9 line. Cytotoxicity was measured by clonogenic survival. A dose of 200 microM UA over 24 h produced 3.1-fold greater cell death in the CHO EM9 than the CHO AA8 line, and a dose of 300 microM was 1.7-fold more cytotoxic. Mutagenicity at the hypoxanthine (guanine) phosphoribosyltransferase (hprt) locus was measured by selection with 6-thioguanine. A dose of 200 microM UA produced approximately 5-fold higher averaged induced mutant frequency in the CHO EM9 line relative to the CHO AA8 line. The generation of DNA strand breaks was measured by the alkaline comet assay at 40 min and 24 h exposures. DNA strand breaks were detected in both lines; however a dose response may have been masked by U-DNA adducts or crosslinks. Uranium-DNA adducts were measured by inductively coupled plasma optical emission spectroscopy (ICP-OES) at 24 and 48 h exposures. A maximum adduct level of 8 U atoms/10(3) DNA-P for the 300 microM dose was found in the EM9 line after 48 h. This is the first report of the formation of uranium-DNA adducts and mutations in mammalian cells after direct exposure to a depleted uranium compound. Data suggest that uranium could be chemically genotoxic and mutagenic through the formation of strand breaks and covalent U-DNA adducts. Thus the health risks for uranium exposure could go beyond those for radiation exposure. PMID:16195314

  20. Insight on mendable resin made by combining Diels-Alder epoxy adducts with DGEBA

    NASA Astrophysics Data System (ADS)

    Dello Iacono, S.; Martone, A.; Filippone, G.; Acierno, D.; Zarrelli, M.; Giordano, M.; Amendola, E.


    Formation of micro-cracks is a critical problem in polymers and polymer composites during their service in structural applications. In this context, materials endowed with self-healing features would lead to the next polymers generation. In the present paper, an epoxy system integrating Diels-Alder epoxy adducts is investigated by thermal and spectroscopic analysis. The direct and retro D-A reaction have been studied by FTIR and specific absorption bands have been identified. Finally, mechanical tests have been performed on the system. The polymer is able to heal fracture and micro-cracks recovering its stiffness after a thermal treatment.

  1. In vitro studies of the genotoxic effects of bitumen and coal-tar fume condensates: comparison of data obtained by mutagenicity testing and DNA adduct analysis by 32P-postlabelling.


    De Méo, M; Genevois, C; Brandt, H; Laget, M; Bartsch, H; Castegnaro, M


    Bitumens contain traces of polycyclic aromatic compounds (PACs), a part of which will end up in the fumes emitted during hot handling of bitumen-containing products, e.g. during roadpaving. Although exposure of workers to these fumes is low, it might lead to health problems. Studies on bitumen fume condensates (BFCs) showed weak to moderate mutagenic activities, but studies on DNA adduct formation have not been reported. Therefore, a study was initiated in which fumes were generated from two road grade bitumens, in such a way that they were representative of the fumes produced in the field. The combined vapour/particulates were tested in vitro for their ability to produce DNA adducts and in modified Ames mutation assays, using a number of different strains. An attempt was made to relate the results to chemical data, such as the content of a number of individual polycyclic aromatic hydrocarbons (PAHs) and with a measure for the total PAC content. As a reference material fume condensate from coal-tar (coal-tar pitch volatiles; CTPV) were subjected to the same tests. All fume condensates tested were mutagenic to all strains and induced the formation of DNA adducts. The patterns of DNA adducts, obtained by 32P-postlabelling, arising from the BFCs were qualitatively different from the patterns of adducts obtained from the CTPVs, implying qualitative differences in the nature of the compounds responsible for the formation of these adducts. This is corroborated by the observation that for BFCs quantitative adduct levels are higher than would be expected based on the PAH content. These data thus indicate that the PAHs analysed are not the sole components responsible for adduct formation from BFCs, but that an important contribution comes from other (hetero- and/or substituted-) PACs. PMID:8760390

  2. 2-Amino-3,8-dimethylimidazo-[4,5-f]quinoxaline-induced DNA adduct formation and mutagenesis in DNA repair-deficient Chinese hamster ovary cells expressing human cytochrome P4501A1 and rapid or slow acetylator N-acetyltransferase 2.


    Bendaly, Jean; Zhao, Shuang; Neale, Jason R; Metry, Kristin J; Doll, Mark A; States, J Christopher; Pierce, William M; Hein, David W


    2-Amino-3,8-dimethylimidazo-[4,5-f]quinoxaline (MeIQx) is one of the most potent and abundant mutagens in the western diet. Bioactivation includes N-hydroxylation catalyzed by cytochrome P450s followed by O-acetylation catalyzed by N-acetyltransferase 2 (NAT2). In humans, NAT2*4 allele is associated with rapid acetylator phenotype, whereas NAT2*5B allele is associated with slow acetylator phenotype. We hypothesized that rapid acetylator phenotype predisposes humans to DNA damage and mutagenesis from MeIQx. Nucleotide excision repair-deficient Chinese hamster ovary cells were constructed by stable transfection of human cytochrome P4501A1 (CYP1A1) and a single copy of either NAT2*4 (rapid acetylator) or NAT2*5B (slow acetylator) alleles. CYP1A1 and NAT2 catalytic activities were undetectable in untransfected Chinese hamster ovary cell lines. CYP1A1 activity did not differ significantly (P > 0.05) among the CYP1A1-transfected cell lines. Cells transfected with NAT2*4 had 20-fold significantly higher levels of sulfamethazine N-acetyltransferase (P = 0.0001) and 6-fold higher levels of N-hydroxy-MeIQx O-acetyltransferase (P = 0.0093) catalytic activity than cells transfected with NAT2*5B. Only cells transfected with both CYP1A1 and NAT2*4 showed concentration-dependent cytotoxicity and hypoxanthine phosphoribosyl transferase mutagenesis following MeIQx treatment. Deoxyguanosine-C8-MeIQx was the primary DNA adduct formed and levels were dose dependent in each cell line and in the following order: untransfected < transfected with CYP1A1 < transfected with CYP1A1 and NAT2*5B < transfected with CYP1A1 and NAT2*4. MeIQx DNA adduct levels were significantly higher (P < 0.001) in CYP1A1/NAT2*4 than CYP1A1/NAT2*5B cells at all concentrations of MeIQx tested. MeIQx-induced DNA adduct levels correlated very highly (r2 = 0.88) with MeIQx-induced mutants. These results strongly support extrahepatic activation of MeIQx by CYP1A1 and a robust effect of human NAT2 genetic polymorphism

  3. Correlation between production of benzo(A)pyrene metabolites and BPDE I-DG adduct levels in human epithelial cells in vitro pretreated with cytochrome P450 inhibitors or inducer

    SciTech Connect

    Lehman, T.A.; Milo, G.E.


    Human epidermal keratinocytes were established from neonatal foreskins. Cultures were pretreated for 24 hr with either butylated hydroxyanisole (BHA), methyl butylated hydroxyanisole (MeBHA) or 7,8 benzoflavone (7,8BF). For metabolite detection studies, cultures were treated with radiolabeled benzo(a)pyrene (BP) for 24 hr. Ethyl acetate soluble metabolites were extracted for HPLC analysis. BHA and 7,8BF pretreatment both significantly decreased intracellular production of 7,8 diol BP compared to cultures treated only with radiolabeled BP. MeBHA pretreatment greatly increased intracellular 7,8 diol BP formation compared to BP treated controls. For DNA adduct analysis, cultures were pretreated as described above, and then treated for 24 hr with non-radiolabeled BP. Cellular DNA was isolated and /sup 32/P-postlabeled for adduct analysis. Cultures pretreated with either BHA or 7,8BF formed significantly fewer BPDE I-dG adducts than nonpretreated cultures, while cultures pretreated with MeBHa formed more BPDE I-dG adducts. Thus, BHA and 7,8BF act similarly in reducing BP activation and adduct formation while MeBHa, a structural analog of BHA, increases BP activation and adduct formation in human keratinocyte cultures in vitro.

  4. "Best Match" Model and Effect of Na+/H+ Exchange on Anion Attachment to Peptides and Stability of Formed Adducts in Negative Ion Electrospray Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Liu, Xiaohua; Cole, Richard B.


    The "Best Match" model has been extended to account for the role that Na+/H+ exchange plays on anion attachment in negative ion electrospray. Without any Na+/H+ exchange on (Glu) fibrinopeptide B, the higher basicity anions F- and CH3COO- can hardly form observable adducts; however, after multiple Na+/H+ exchanges, adduct formation is enabled. Moreover, dissociation pathways of CF3COO- adducts with singly deprotonated peptides that have undergone 0 to 3 Na+/H+ exchanges exhibit a shift in CID product ions from losing predominately CF3COOH (case of 0 Na+/H+ exchanges) to losing predominately CF3COO- (case of 3 Na+/H+ exchanges). These phenomena can be rationalized by considering that Na+ cations exchange at, and serve to "block", the most acidic sites, thereby forcing implicated anions to attach to lower acidity protons. In addition to forming ion pairs with carboxylate groups, Na+ also participates in formation of tri-atomic ions of the form ANaA- during adduct dissociation. The fact that low gas-phase basicity (GB) anions preferentially form ANaA- species, even though high GB anions form more stable tri-atomic species, indicates that the monatomic ions were not in close contact in the initial adduct. The propensity for formation of stable anionic adducts is dependent on the degree of matching between anion GBs and GBapp of deprotonated sites on the peptide. The GBapp is raised dramatically as the charge state of the peptide increases via a through-space effect. The presence of Na+ on carboxylate sites substantially decreases the GBapp by neutralizing these sites, while slightly increasing the intrinsic GBs by an inductive effect.

  5. Quantification of phase I / II metabolizing enzyme gene expression and polycyclic aromatic hydrocarbon-DNA adduct levels in human prostate

    PubMed Central

    John, Kaarthik; Ragavan, Narasimhan; Pratt, M. Margaret; Singh, Paras B.; Al-Buheissi, Salah; Matanhelia, Shyam S.; Phillips, David H.; Poirier, Miriam C.; Martin, Francis L.


    BACKGROUND Studies of migrant populations suggest that dietary and/or environmental factors play a crucial role in the aetiology of prostatic adenocarcinoma (CaP). The human prostate consists of the peripheral zone (PZ), transition zone (TZ) and central zone (CZ); CaP occurs most often in the PZ. METHODS To investigate the notion that an underlying differential expression of phase I/II genes, and/or the presence of polycyclic aromatic hydrocarbon (PAH)-DNA adducts might explain the elevated PZ susceptibility, we examined prostate tissues (matched tissue sets consisting of PZ and TZ) from men undergoing radical retropubic prostatectomy for CaP (n=26) or cystoprostatectomy (n=1). Quantitative gene expression analysis was employed for cytochrome P450 (CYP) isoforms CYP1A1, CYP1B1 and CYP1A2, as well as N-acetyltransferase 1 and 2 (NAT1 and NAT2) and catechol-O-methyl transferase (COMT). RESULTS CYP1B1, NAT1 and COMT were expressed in all tissue sets; levels of CYP1B1 and NAT1 were consistently higher in the PZ compared to TZ. Immunohistochemistry confirmed the presence of CYP1B1 (nuclear-associated and primarily in basal epithelial cells) and NAT1. Tissue sections from 23 of these aforementioned 27 matched tissue sets were analyzed for PAH-DNA adduct levels using antiserum elicited against DNA modified with r7, t8-dihydroxy-t-9,10-oxy-7,8,9,10-tetrahydro-benzo[a]pyrene (BPDE). PAH-DNA adduct levels were highest in glandular epithelial cells, but a comparison of PZ and TZ showed no significant differences. CONCLUSION Although expression of activating and/or detoxifying enzymes may be higher in the PZ, PAH-DNA adduct levels appear to be similar in both zones. Therefore, factors other than PAH-DNA adducts may be responsible for promotion of tumour formation in the human prostate. PMID:19143007

  6. Effect of Increased Water Intake on Urinary DNA Adduct Levels and Mutagenicity in Smokers: A Randomized Study

    PubMed Central

    Buendia Jimenez, Inmaculada; Richardot, Pascaline; Picard, Pascaline; Lepicard, Eve M.; De Meo, Michel; Talaska, Glenn


    The association between fluid intake and bladder cancer risk remains controversial. Very little is known about to which extent the amount of water intake influences the action of excreting toxics upon the urinary system. This proof of concept trial investigates the effect of water intake on mutagenesis in smokers, a high risk population for bladder cancer. Methods. Monocentric randomized controlled trial. Inclusion Criteria. Male subjects aged 2045–45 y/o, smokers, and small drinkers (24-hour urinary volume <1 L and osmolality >700 mOsmol/kg). Outcomes. 4-ABP DNA adducts formation in exfoliated bladder cells in 24-hour urine collection and urinary mutagenicity in 24-hour urine. Test Group. Subjects consumed 1.5 L daily of the study product (EVIAN) on top of their usual water intake for 50 days. Control Group. Subjects continued their usual lifestyle habits. Results. 65 subjects were randomized. Mean age was 30 y/o and mean cigarettes per day were 20. A slight decrease in adducts formation was observed between baseline and last visit but no statistically significant difference was demonstrated between the groups. Urinary mutagenicity significantly decreased. The study shows that increasing water intake decreases urinary mutagenicity. It is not confirmed by urinary adducts formation. Further research would be necessary. PMID:26357419


    PubMed Central

    Marsillach, Judit; Costa, Lucio G.; Furlong, Clement E.


    Exposure to organophosphorus (OP) compounds can lead to serious neurological damage or death. Following bioactivation by the liver cytochromes P450, the OP metabolites produced are potent inhibitors of serine active-site enzymes including esterases, proteases and lipases. OPs may form adducts on other cellular proteins. Blood cholinesterases (ChEs) have long served as biomarkers of OP exposure in humans. However, the enzymatic assays used for biomonitoring OP exposures have several drawbacks. A more useful approach will focus on multiple biomarkers and avoid problems with the enzymatic activity assays. OP inhibitory effects result from a covalent bond with the active-site serine of the target enzymes. The serine OP adducts become irreversible following a process referred to as aging where one alkyl group dissociates over variable lengths of time depending on the OP adduct. The OP-adducted enzyme then remains in circulation until it is degraded, allowing for a longer window of detection compared with direct analysis of OPs or their metabolites. Mass spectrometry (MS) provides a very sensitive method for identification of post-translational protein modifications. MS analyses of the percentage adduction of the active-site serine of biomarker proteins such as ChEs will eliminate the need for basal activity levels of the individual and will provide for a more accurate determination of OP exposure. MS analysis of biomarker proteins also provides information about the OP that has caused inhibition. Other useful biomarker proteins include other serine hydrolases, albumin, tubulin and transferrin. PMID:23261756

  8. Characterization of deoxyguanosine adducts from hydroquinone/benzoquinone

    SciTech Connect

    Jowa, J.; Winkel, S.; Witz, G.; Snyder, R.


    Occupational exposure to benzene has long been associated with the development of pancytopenia and leukemia. This toxicity has been attributed to the action of benzene metabolites. The authors have chosen to investigate the reaction of hydroquinone (HQ)/benzoquinone(BQ) with deoxyguanosine(dG) and DNA. (/sup 14/C)HQ was incubated with (/sup 3/H)dG in potassium phosphate buffer pH7.2 for 24 hours. Two dual labeled products were found by HPLC and presumed to be adducts. The same result was obtained when BQ was substituted in the reaction for HQ. Both adducts were found in isolated DNA from Clostridium perfringens, Micrococcus lysodeikticus, human placenta and calf thymus reacted with HO under similar conditions. One of the dG adducts was proposed to be (/sup 3/'OH) benzetheno(1,N-2)deoxyguanosine based on NMR and mass spectral results. The other adduct was characterized by a molecular weight of 339. The latter adduct was found in greater amounts than the former when HQ was reacted with denatured DNA.

  9. Organocatalytic removal of formaldehyde adducts from RNA and DNA bases

    NASA Astrophysics Data System (ADS)

    Karmakar, Saswata; Harcourt, Emily M.; Hewings, David S.; Lovejoy, Alexander F.; Kurtz, David M.; Ehrenschwender, Thomas; Barandun, Luzi J.; Roost, Caroline; Alizadeh, Ash A.; Kool, Eric T.


    Formaldehyde is universally used to fix tissue specimens, where it forms hemiaminal and aminal adducts with biomolecules, hindering the ability to retrieve molecular information. Common methods for removing these adducts involve extended heating, which can cause extensive degradation of nucleic acids, particularly RNA. Here, we show that water-soluble bifunctional catalysts (anthranilates and phosphanilates) speed the reversal of formaldehyde adducts of mononucleotides over standard buffers. Studies with formaldehyde-treated RNA oligonucleotides show that the catalysts enhance adduct removal, restoring unmodified RNA at 37 °C even when extensively modified, while avoiding the high temperatures that promote RNA degradation. Experiments with formalin-fixed, paraffin-embedded cell samples show that the catalysis is compatible with common RNA extraction protocols, with detectable RNA yields increased by 1.5-2.4-fold using a catalyst under optimized conditions and by 7-25-fold compared with a commercial kit. Such catalytic strategies show promise for general use in reversing formaldehyde adducts in clinical specimens.

  10. Organocatalytic removal of formaldehyde adducts from RNA and DNA bases.


    Karmakar, Saswata; Harcourt, Emily M; Hewings, David S; Scherer, Florian; Lovejoy, Alexander F; Kurtz, David M; Ehrenschwender, Thomas; Barandun, Luzi J; Roost, Caroline; Alizadeh, Ash A; Kool, Eric T


    Formaldehyde is universally used to fix tissue specimens, where it forms hemiaminal and aminal adducts with biomolecules, hindering the ability to retrieve molecular information. Common methods for removing these adducts involve extended heating, which can cause extensive degradation of nucleic acids, particularly RNA. Here, we show that water-soluble bifunctional catalysts (anthranilates and phosphanilates) speed the reversal of formaldehyde adducts of mononucleotides over standard buffers. Studies with formaldehyde-treated RNA oligonucleotides show that the catalysts enhance adduct removal, restoring unmodified RNA at 37 °C even when extensively modified, while avoiding the high temperatures that promote RNA degradation. Experiments with formalin-fixed, paraffin-embedded cell samples show that the catalysis is compatible with common RNA extraction protocols, with detectable RNA yields increased by 1.5-2.4-fold using a catalyst under optimized conditions and by 7-25-fold compared with a commercial kit. Such catalytic strategies show promise for general use in reversing formaldehyde adducts in clinical specimens. PMID:26291948

  11. Increased accumulation of 4-hydroxynonenal adducts in male GSTA4/PPAR alpha double knockout mice enhances injury during early stages of alcoholic liver disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hepatic lipid peroxidation and accumulation of aldehyde-adducted proteins occur early in alcohol-mediated injury and are postulated to mediate the subsequent pro-inflammatory and fibrotic responses observed in alcoholic liver disease. To test the significance of lipid peroxidation formation in the ...

  12. Isolation, identification, and assay of [3H]-porfiromycin adducts of EMT6 mouse mammary tumor cell DNA: effects of hypoxia and dicumarol on adduct patterns.


    Tomasz, M; Hughes, C S; Chowdary, D; Keyes, S R; Lipman, R; Sartorelli, A C; Rockwell, S


    [3H]-(N-la-methyl) Porfiromycin (POR) was employed to detect and identify the radiolabeled mono- and bis-adducts formed in living EMT6 mouse mammary tumor cells under different conditions. To provide authentic standard adducts, calf-thymus DNA was treated with POR under reductive activation, then digested to nucleosides and POR-nucleoside adducts. The three major adducts formed were isolated by HPLC and authenticated. Two were mono-adducts, composed of deoxyguanosine linked at its N2-position to C-1 of POR and of 10-decarbamoyl POR. The third was a bis-adduct, in which POR was crosslinked to two deoxyguanosines at their N2-positions. DNA from [3H]-POR treated EMT6 cells was digested an analyzed by HPLC. DNA-associated label was located in thymidine and in two mono-adducts and one bis-adduct identical to those described above. Label in thymidine resulted from N-demethylation of POR and reincorporation of label into new thymidylate residues. Adducts were formed more abundantly in hypoxia than in air. In addition, the mono-adduct to crosslink ratios were different, approximately 1:1 and 2:1 for hypoxic and aerobic cells, respectively. The different patterns of alkylation in air and hypoxia may be related to the greater toxicity of POR in hypoxia. When cells were treated simultaneously with POR and dicumarol, adduct levels were lower, and a new, unknown adduct was observed primarily under hypoxia; these changes may be related to the altered toxicity of POR in the presence of dicumarol. The HPLC assay detected simultaneously the full array of stable mono- and bis-adducts in DNA with good sensitivity (greater than or equal to 2 x 10(6) adducts/nucleotide) and excellent reproducibility. This assay should be generally applicable to all cells and tissues when MC or POR with high specific radioactivity can be employed. PMID:1714285

  13. The role of reactive oxygen species (ROS) and cytochrome P-450 2E1 in the generation of carcinogenic etheno-DNA adducts

    PubMed Central

    Linhart, Kirsten; Bartsch, Helmut; Seitz, Helmut K.


    Exocyclic etheno-DNA adducts are mutagenic and carcinogenic and are formed by the reaction of lipidperoxidation (LPO) products such as 4-hydoxynonenal or malondialdehyde with DNA bases. LPO products are generated either via inflammation driven oxidative stress or via the induction of cytochrome P-450 2E1 (CYP2E1). In the liver CYP2E1 is induced by various compounds including free fatty acids, acetone and ethanol. Increased levels of CYP2E1 and thus, oxidative stress are observed in the liver of patients with non-alcoholic steatohepatitis (NASH) as well as in the chronic alcoholic. In addition, chronic ethanol ingestion also increases CYP2E1 in the mucosa of the oesophagus and colon. In all these tissues CYP2E1 correlates significantly with the levels of carcinogenic etheno-DNA adducts. In contrast, in patients with non-alcoholic steatohepatitis (NASH) hepatic etheno-DNA adducts do not correlate with CYP2E1 indicating that in NASH etheno-DNA adducts formation is predominately driven by inflammation rather than by CYP2E1 induction. Since etheno-DNA adducts are strong mutagens producing various types of base pair substitution mutations as well as other types of genetic damage, it is strongly believed that they are involved in ethanol mediated carcinogenesis primarily driven by the induction of CYP2E1. PMID:25462066

  14. Quantitation of DNA Adducts Induced by 1,3-Butadiene

    NASA Astrophysics Data System (ADS)

    Sangaraju, Dewakar; Villalta, Peter W.; Wickramaratne, Susith; Swenberg, James; Tretyakova, Natalia


    Human exposure to 1,3-butadiene (BD) present in automobile exhaust, cigarette smoke, and forest fires is of great concern because of its potent carcinogenicity. The adverse health effects of BD are mediated by its epoxide metabolites such as 3,4-epoxy-1-butene (EB), which covalently modify genomic DNA to form promutagenic nucleobase adducts. Because of their direct role in cancer, BD-DNA adducts can be used as mechanism-based biomarkers of BD exposure. In the present work, a mass spectrometry-based methodology was developed for accurate, sensitive, and precise quantification of EB-induced N-7-(1-hydroxy-3-buten-2-yl) guanine (EB-GII) DNA adducts in vivo. In our approach, EB-GII adducts are selectively released from DNA backbone by neutral thermal hydrolysis, followed by ultrafiltration, offline HPLC purification, and isotope dilution nanoLC/ESI+-HRMS3 analysis on an Orbitrap Velos mass spectrometer. Following method validation, EB-GII lesions were quantified in human fibrosarcoma (HT1080) cells treated with micromolar concentrations of EB and in liver tissues of rats exposed to sub-ppm concentrations of BD (0.5-1.5 ppm). EB-GII concentrations increased linearly from 1.15 ± 0.23 to 10.11 ± 0.45 adducts per 106 nucleotides in HT1080 cells treated with 0.5-10 μM DEB. EB-GII concentrations in DNA of laboratory rats exposed to 0.5, 1.0, and 1.5 ppm BD were 0.17 ± 0.05, 0.33 ± 0.08, and 0.50 ± 0.04 adducts per 106 nucleotides, respectively. We also used the new method to determine the in vivo half-life of EB-GII adducts in rat liver DNA (2.20 ± 0.12 d) and to detect EB-GII in human blood DNA. To our knowledge, this is the first application of nanoLC/ESI+-HRMS3 Orbitrap methodology to quantitative analysis of DNA adducts in vivo.

  15. Chemistry and Biology of Aflatoxin-DNA Adducts

    SciTech Connect

    Stone, Michael P.; Banerjee, Surajit; Brown, Kyle L.; Egli, Martin


    Aspergillus flavus is a fungal contaminant of stored rice, wheat, corn, and other grainstuffs, and peanuts. This is of concern to human health because it produces the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}), which is genotoxic and is implicated in the etiology of liver cancer. AFB{sub 1} is oxidized in vivo by cytochrome P450 to form aflatoxin B{sub 1} epoxide, which forms an N7-dG adduct (AFB{sub 1}-N7-dG) in DNA. The latter rearranges to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative that equilibrates between {alpha} and {beta} anomers of the deoxyribose. In DNA, both the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts intercalate above the 5'-face of the damaged guanine. Each produces G {yields} T transversions in Escherichia coli, but the AFB{sub 1}-{beta}-FAPY adduct is more mutagenic. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) provides a model for understanding error-prone bypass of the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts. It bypasses the AFB{sub 1}-N7-dG adduct, but it conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including mis-insertion of dATP, consistent with the G {yields} T mutations characteristic of AFB{sub 1} mutagenesis in E. coli. Crystallographic analyses of a series of binary and ternary complexes with the Dpo4 polymerase revealed differing orientations of the N7-C8 bond of the AFB{sub 1}-N7-dG adduct as compared to the N{sup 5}-C8 bond in the AFB{sub 1}-{beta}-FAPY adduct, and differential accommodation of the intercalated AFB{sub 1} moieties within the active site. These may modulate AFB{sub 1} lesion bypass by this polymerase.

  16. Novel Fragmentation Pathways of Anionic Adducts of Steroids Formed by Electrospray Anion Attachment Involving Regioselective Attachment, Regiospecific Decompositions, Charge-Induced Pathways, and Ion-Dipole Complex Intermediates

    NASA Astrophysics Data System (ADS)

    Rannulu, Nalaka S.; Cole, Richard B.


    The analysis of several bifunctional neutral steroids, 5-α-pregnane diol (5-α-pregnane-3α-20βdiol), estradiol (3,17α-dihydroxy-1,3,5(10)-estratriene), progesterone (4-pregnene-3,20-dione), lupeol (3β-hydroxy-20(29)-lupene), pregnenolone (5-pregnen-3β-ol-20-one), and pregnenolone acetate (5-pregnen-3β-ol-20-one acetate) was accomplished by negative ion electrospray mass spectrometry (ESI-MS) employing adduct formation with various anions: fluoride, bicarbonate, acetate, and chloride. Fluoride yielded higher abundances of anionic adducts and more substantial abundances of deprotonated molecules compared with other investigated anions. Collision-induced dissociation (CID) of precursor [M + anion]- adducts of these steroids revealed that fluoride adduct [M + F]- precursors first lose HF to produce [M - H]- and then undergo consecutive decompositions to yield higher abundances of structurally-informative product ions than the other tested anions. In addition to charge-remote fragmentations, the majority of CID pathways of estradiol are deduced to occur via charge-induced fragmentation. Most interestingly, certain anions exhibit preferential attachment to a specific site on these bifunctional steroid molecules, which we are calling "regioselective anion attachment." Regioselective anion attachment is evidenced by subsequent regiospecific decomposition. Regioselective attachment of fluoride (and acetate) anions to low (and moderate) acidity functional groups of pregnenolone, respectively, is demonstrated using deuterated compounds. Moreover, the formation of unique intermediate ion-dipole complexes leading to novel fragmentation pathways of fluoride adducts of pregnenolone acetate, and bicarbonate adducts of d4-pregnenolone, are also discussed.

  17. A phenylacetaldehyde-flavonoid adduct, 8-C-(E-phenylethenyl)-norartocarpetin, exhibits intrinsic apoptosis and MAPK pathways-related anticancer potential on HepG2, SMMC-7721 and QGY-7703.


    Zheng, Zong-Ping; Yan, Yan; Xia, Ji; Zhang, Shuang; Wang, Mingfu; Chen, Jie; Xu, Yang


    Norartocarpetin, quercetin and naringenin were found to effectively inhibit 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) formation through trapping its phenylacetaldehyde and form their adducts in roast beef patties. Six adducts [8-C- or 6-C-(E-phenylethenyl) flavonoids] formed between phenylacetaldehyde and three flavonoids were detected in roast beef patties by UPLC-MS analyses and compared with their synthetic references. These flavonoid-phenylacetaldehyde adducts were synthesised and further subjected to cytotoxicity tests on three liver cancer cell lines HepG2, SMMC-7721 and QGY-7703. The adduct 8-C-(E-phenylethenyl)norartocarpetin (NARA1) was found to significantly induce cancer cell death with IC50 values about 7 μM. After pre-treating with MAPK and caspase inhibitors, alteration of the cell morphology and cleaved-PARP were detected in liver cancer cell lines administered with NARA1. These data indicated that norartocarpetin could inhibit PhIP formation in roast beef patties and form norartocarpetin-phenylacetaldehyde adducts. The adduct NARA1 has anticancer potential via intrinsic caspase-dependent and cell context-dependent MAPKs pathways. PMID:26675844

  18. Strategy for identifying unknown hemoglobin adducts using adductome LC-MS/MS data: Identification of adducts corresponding to acrylic acid, glyoxal, methylglyoxal, and 1-octen-3-one.


    Carlsson, Henrik; Törnqvist, Margareta


    Electrophilic compounds have the ability to form adducts with nucleophilic sites in proteins and DNA in tissues, and thereby constitute risks for toxic effects. Adductomic approaches are developed for systematic screening of adducts to DNA and blood proteins, with the aim to detect unknown internal exposures to electrophiles. In a previous adductomic screening of adducts to N-terminals in hemoglobin, using LC-MS/MS, 19 unknown adducts were detected in addition to seven previously identified adducts. The present paper describes the identification of four of these unknown adducts, as well as the strategy used to identify them. Using LC-MS data from the screening, hypotheses about adduct identities were formulated: probable precursor electrophiles with matching molecular weights were suggested based on the molecular weights of the modifications and the retention times of the analytes, in combination with comparisons of theoretical Log P calculations and databases. Reference adducts were generated by incubation of blood samples with the hypothesized precursor electrophiles. The four identified precursor electrophiles, corresponding to the observed unknown adducts, were glyoxal, methylglyoxal, acrylic acid and 1-octen-3-one. Possible origins/exposure sources and toxicological information concerning the electrophilic precursors are discussed. The identified adducts could be explored as possible biomarkers for exposure. PMID:27046699



    Kosińska, Katarzyna; Frański, Rafał; Frańska, Magdalena


    Amoxicillin and ampicillin were subjected to methanolysis. As expected, the methanolysis products were observed by HPLC-ESI-MS. Besides these products, diketopiperazine derivatives were also detected. Additionally, unusually stable adduct formed between the products of methanolysis and diketopiperazine derivatives was also identified. Analogical adducts were detected when ethanolysis was performed instead of methanolysis. HPLC-ESI-MS analysis of the separated adducts confirmed that the adducts were composed of methanolysis products and diketopiperazine derivatives. PMID:27180422

  20. Kinetics of hydroperoxy radical reactions with acetone/HO2 adduct and with acetonylperoxy radical

    NASA Astrophysics Data System (ADS)

    Grieman, F. J.; VanDerGeest, K.; Newenhouse, E.; Watkins, K.; Noell, A. C.; Hui, A.; Sander, S. P.; Okumura, M.


    Reactions of hydroperoxy radical, HO2, with acetone and with acetonylperoxy radical, CH3C(O)CH2OO, may play an important role in the oxidation chemistry of the troposphere. Using a temperature-controlled slow-flow tube cell and laser flash photolysis of Cl2 to produce HO2 and CH3C(O)CH2OO from methanol and acetone, respectively, we studied the chemical kinetics involved over the temperature range of 215 to 298 K at 100 Torr. Rates of chemical reactions were determined by monitoring the HO2 concentration as a function of time by near-IR diode laser wavelength modulation spectroscopy. (See Fig.1.) The primary reactions are rapid (<100 μsec) reactions to form the adducts HO2-CH3OH and HO2-CH3C(O)CH3 followed by HO2 reactions with itself, the adducts (chaperone mechanisms), and acetonylperoxy radical. The equilibrium constants for adduct formation were determined in previous work.1,2 In this work, rate coefficients were determined for the acetone chaperone mechanism over the entire temperature range. (E.g., see Fig. 2.) The rate coefficients and energies obtained are very similar to those found for the methanol case.1 Rate coefficients for the CH3C(O)CH2OO/HO2 reaction were also determined over a smaller temperature range, extending the measured value beyond room temperature, and yielding an activation energy. 1. Christensen et al. J. Phys. Chem. A 2006, 110, 6948-6959. 2. Grieman et al. J. Phys. Chem. A 2011, 115, 10527-10538. Fig.1. HO2 decay for HO2/Acetone chemistry at T = 298 K. Fig.2. Determining rate coefficient (k") for HO2/acetone chaperone effect at T = 222.5 K.

  1. Hydrosilane-B(C6F5)3 adducts as activators in zirconocene catalyzed ethylene polymerization.


    Varga, Vojtech; Lamač, Martin; Horáček, Michal; Gyepes, Róbert; Pinkas, Jiří


    Hydrosilane-B(C6F5)3 adducts were found to activate zirconocene dihalides and generate ternary catalytic systems possessing moderate to high activity in ethylene polymerization to high density polyethylene (HDPE). The activation efficacy of the adducts increased with increasing hydride donor ability and decreased with steric crowding of the particular hydrosilane used. NMR investigation of the HSiEt3/B(C6F5)3/Cp*2ZrF2 system (Cp* = η(5)-C5Me5) revealed the formation of a stable intermediate [Cp*2ZrF(FSiEt3-κF)](+)[HB(C6F5)3](-), whereas a crucial role of the [HB(C6F5)3](-) anion as a hydride donor for generation of an active cationic zirconium hydride center was elucidated. PMID:27254815

  2. 2-Amino-9H-pyrido[2,3-b]indole (AαC) Adducts and Thiol Oxidation of Serum Albumin as Potential Biomarkers of Tobacco Smoke*

    PubMed Central

    Pathak, Khyatiben V.; Bellamri, Medjda; Wang, Yi; Langouët, Sophie; Turesky, Robert J.


    2-Amino-9H-pyrido[2,3-b]indole (AαC) is a carcinogenic heterocyclic aromatic amine formed during the combustion of tobacco. AαC undergoes bioactivation to form electrophilic N-oxidized metabolites that react with DNA to form adducts, which can lead to mutations. Many genotoxicants and toxic electrophiles react with human serum albumin (albumin); however, the chemistry of reactivity of AαC with proteins has not been studied. The genotoxic metabolites, 2-hydroxyamino-9H-pyrido[2,3-b]indole (HONH-AαC), 2-nitroso-9H-pyrido[2,3-b]indole (NO-AαC), N-acetyloxy-2-amino-9H-pyrido[2,3-b]indole (N-acetoxy-AαC), and their [13C6]AαC-labeled homologues were reacted with albumin. Sites of adduction of AαC to albumin were identified by data-dependent scanning and targeted bottom-up proteomics approaches employing ion trap and Orbitrap MS. AαC-albumin adducts were formed at Cys34, Tyr140, and Tyr150 residues when albumin was reacted with HONH-AαC or NO-AαC. Sulfenamide, sulfinamide, and sulfonamide adduct formation occurred at Cys34 (AαC-Cys34). N-Acetoxy-AαC also formed an adduct at Tyr332. Albumin-AαC adducts were characterized in human plasma treated with N-oxidized metabolites of AαC and human hepatocytes exposed to AαC. High levels of N-(deoxyguanosin-8-yl)-AαC (dG-C8-AαC) DNA adducts were formed in hepatocytes. The Cys34 was the sole amino acid of albumin to form adducts with AαC. Albumin also served as an antioxidant and scavenged reactive oxygen species generated by metabolites of AαC in hepatocytes; there was a strong decrease in reduced Cys34, whereas the levels of Cys34 sulfinic acid (Cys-SO2H), Cys34-sulfonic acid (Cys-SO3H), and Met329 sulfoxide were greatly increased. Cys34 adduction products and Cys-SO2H, Cys-SO3H, and Met329 sulfoxide may be potential biomarkers to assess exposure and oxidative stress associated with AαC and other arylamine toxicants present in tobacco smoke. PMID:25953894


    EPA Science Inventory

    DNA adducts represent the putative initiating event in the chemical process. 2P-Postlabeling is one of several assayswhich have been developed for the sensitive detection of DNA adducts. n integral part of the 32p-postlabeling assay is the separation of adducted nucleotides by mu...


    EPA Science Inventory

    Since somatic mutations are suspected to contribute to the pathogenesis not only of cancer but also of atherosclerotic plaques, we measured DNA adducts in the smooth muscle layer of atherosclerotic lesions in abnormal aorta specimens taken at surgery from seven patients. NA adduc...


    EPA Science Inventory

    Hemoglobin (Hb) adduct determinations were used to monitor occupational exposure to acrylamide (AA) and acrylonitrile (AN). orth-one workers in a factory in the People's Republic of China who were involved in the synthesis of a AA by catalytic hydration of AN and the manufacturin...

  6. 40 CFR 721.4590 - Mannich-based adduct.

    Code of Federal Regulations, 2013 CFR


    ... reporting. (1) The chemical substance generically identified as a Mannich-based adduct (PMN P-93-66) is.... Requirements as specified in § 721.80(h). (ii) Release to water. Requirements as specified in § 721.90 (a)(4... 721.4590 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC...

  7. 40 CFR 721.4590 - Mannich-based adduct.

    Code of Federal Regulations, 2012 CFR


    ... reporting. (1) The chemical substance generically identified as a Mannich-based adduct (PMN P-93-66) is.... Requirements as specified in § 721.80(h). (ii) Release to water. Requirements as specified in § 721.90 (a)(4... 721.4590 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC...

  8. 40 CFR 721.4590 - Mannich-based adduct.

    Code of Federal Regulations, 2010 CFR


    ... reporting. (1) The chemical substance generically identified as a Mannich-based adduct (PMN P-93-66) is.... Requirements as specified in § 721.80(h). (ii) Release to water. Requirements as specified in § 721.90 (a)(4... 721.4590 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC...

  9. 40 CFR 721.4590 - Mannich-based adduct.

    Code of Federal Regulations, 2011 CFR


    ... reporting. (1) The chemical substance generically identified as a Mannich-based adduct (PMN P-93-66) is.... Requirements as specified in § 721.80(h). (ii) Release to water. Requirements as specified in § 721.90 (a)(4... 721.4590 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC...

  10. Distortions induced in DNA by cis-platinum interstrand adducts

    SciTech Connect

    Sip, M.; Schwartz, A.; Vovelle, F.; Ptak, M.; Leng, M. )


    A 22 base pair double-stranded oligonucleotide containing a unique interstrand adduct resulting from chelation of the two guanine residues within the central sequence d(TGCT/AGCA) by a cis-platinum residue has been studied by means of gel electrophoresis, chemical probes, and molecular mechanics. The anomalously slow electrophoretic mobility of the multimers of the platinated and ligated oligomers suggests that the platinated oligonucleotide is bent. The two cytosine residues (complementary to the platinated guanines) are hyperreactive to hydroxylamine, indicating a large exposure of the two bases to the solvent. The adduct does not induce a local denaturation within the flanking sequences since the adenine residues are not reactive with diethyl pyrocarbonate. This is confirmed by the nonreactivity of the complementary T residues with osmium tetraoxide. These results and the molecular mechanics modeling suggest that the interstrand adduct bends the double helix by approximately 55{degree} toward the major groove, that the double helix conserves its average twist angle, and that the distortion induced by the adduct is localized at the platinated sequence d(GC/CG).

  11. Mass Spectrometric Analyses of Organophosphate Insecticide Oxon Protein Adducts

    PubMed Central

    Thompson, Charles M.; Prins, John M.; George, Kathleen M.


    Objective Organophosphate (OP) insecticides continue to be used to control insect pests. Acute and chronic exposures to OP insecticides have been documented to cause adverse health effects, but few OP-adducted proteins have been correlated with these illnesses at the molecular level. Our aim was to review the literature covering the current state of the art in mass spectrometry (MS) used to identify OP protein biomarkers. Data sources and extraction We identified general and specific research reports related to OP insecticides, OP toxicity, OP structure, and protein MS by searching PubMed and Chemical Abstracts for articles published before December 2008. Data synthesis A number of OP-based insecticides share common structural elements that result in predictable OP–protein adducts. The resultant OP–protein adducts show an increase in molecular mass that can be identified by MS and correlated with the OP agent. Customized OP-containing probes have also been used to tag and identify protein targets that can be identified by MS. Conclusions MS is a useful and emerging tool for the identification of proteins that are modified by activated organophosphate insecticides. MS can characterize the structure of the OP adduct and also the specific amino acid residue that forms the key bond with the OP. Each protein that is modified in a unique way by an OP represents a unique molecular biomarker that with further research can lead to new correlations with exposure. PMID:20056576


    EPA Science Inventory

    The report summarizes the literature concerning adducts formed by xenobiotics with DNA and/or protein and discusses their feasibility as a monitoring tool for use in exposure and risk assessment. The report is divided into three segments. The first segment provides an introductio...

  13. NMR at the Picomole Level of a DNA Adduct

    PubMed Central

    Kautz, Roger; Wang, Poguang; Giese, Roger W.


    We investigate the limit of detection for obtaining NMR data of a DNA adduct using modern microscale NMR instrumentation, once the adduct has been isolated at the pmol level. Eighty nanograms (130 pmol) of a DNA adduct standard, N-(2′-deoxyguanosin-8-yl)-2-acetylaminofluorene 5′-monophosphate (AAF-dGMP), in 1.5 μL of D2O with 10% methanol-d4, in a vial, was completely picked up as a droplet suspended in a fluorocarbon liquid, and loaded efficiently into a microcoil probe. This work demonstrates a practical manual method of droplet microfluidic sample loading, previously demonstrated using automated equipment, which provides a several-fold advantage over conventional flow injection. Eliminating dilution during injection and confining the sample into the observed volume realizes the full theoretical mass sensitivity of a microcoil, comparable to a micro-cryo probe. With 80 ng, an NMR spectrum acquired over 40 hr showed all of the resonances seen in a standard spectrum of AAF-dGMP, with a S/N of at least 10, despite broadening due to previously-noted effects of conformational exchange. Also a 2D TOCSY spectrum (total correlation spectroscopy) was acquired on 1.6 μg in 18 hr. This work helps to define the utility of NMR in combination with other analytical methods for the structural characterization of a small amount of a DNA adduct. PMID:24028148

  14. Probing myo-inositol 1-phosphate synthase with multisubstrate adducts

    PubMed Central

    Deranieh, Rania M.; Greenberg, Miriam L.; Le Calvez, Pierre-B.; Mooney, Maura C.; Migaud, Marie E.


    The synthesis of a series of carbohydrate-nucleotide hybrids, designed to be multisubstrate adducts mimicking myo-inositol 1-phosphate synthase first oxidative transition state, is reported. Their ability to inhibit the synthase has been assessed and results have been rationalised computationally to estimate their likely binding mode. PMID:23132282

  15. Detection of protein adduction derived from dauricine by alkaline permethylation.


    Xie, Honglei; Liu, Yuyang; Peng, Ying; Zhao, Dongmei; Zheng, Jiang


    Dauricine is a bisbenzylisoquinoline alkaloid derivative and has shown multiple pharmacological properties. Despite this, our previous study demonstrated that dauricine induced severe lung toxicity in experimental animals. Metabolic activation of dauricine to the corresponding quinone methide intermediate is suggested to play an important role in dauricine-induced cytotoxicity. Protein adduction derived from the reactive intermediate is considered to initiate the process of the toxicity. In the present study, we developed an alkaline permethylation- and mass spectrometry-based approach to detect dauricine-derived protein adduction. Protein samples were permethylated in the presence of NaOH and CH3I at 80 °C, followed by LC-MS/MS analysis. A thioether product was produced in the reaction. Not only does this technique quantify dauricine-derived protein adduction but also it tells the nature of the interaction between the target proteins and the reactive intermediate of dauricine. The recovery, precision, limit of detection, limit of quantity, and method detection limit were found to be 102.8 %±1.7 %, 1.89 %, 1.32 fmol/mL, 4.93 fmol/mL and 3.37 fmol/mL respectively. The surrogate recovery and surrogate RSD values were 81.5-103.0 % and 2.59 %, respectively. This analytical method has proven sensitive, selective, reliable, and feasible to assess total protein adduction derived from dauricine, and will facilitate the mechanistic investigation of dauricine and other bisbenzylisoquinoline toxicities. Graphical Abstract Alkaline permethylation of dauricine derived protein adduct. PMID:27071763

  16. Quantification of Carnosine-Aldehyde Adducts in Human Urine.


    da Silva Bispo, Vanderson; Di Mascio, Paolo; Medeiros, Marisa


    Lipid peroxidation generates several reactive carbonyl species, including 4-hydroxy-2-nonenal (HNE), acrolein (ACR), 4-hydroxy-2-hexenal (HHE) and malondialdehyde. One major pathwayof aldehydes detoxification is through conjugation with glutathione catalyzed by glutathione-S-transferases or, alternatively, by conjugation with endogenous histidine containing dipeptides, such as carnosine (CAR). In this study, on-line reverse-phase high-performance liquid chromatography (HPLC) separation with tandem mass spectrometry detection was utilized for the accurate quantification of CAR- ACR, CAR-HHE and CAR-HNE adducts in human urinary samples from non-smokers young adults. Standard adducts were prepared and isolated by HPLC. The results showed the presence of a new product from the reaction of CAR with ACR. This new adduct was completely characterized by HPLC/MS-MSn, 1H RMN, COSY and HSQC. The new HPLC/MS/MS methodology employing stable isotope-labeled internal standards (CAR-HHEd5 and CAR-HNEd11) was developed for adducts quantification. This methodology permits quantification of 10pmol CAR-HHE and 1pmol of CAR-ACR and CAR-HNE. Accurate determinations in human urine sample were performed and showed 4.65±1.71 to CAR-ACR, 5.13±1.76 to CAR-HHE and 5.99±3.19nmol/mg creatinine to CAR-HNE. Our results indicate that carnosine pathways can be an important detoxification route of a, ß -unsaturated aldehydes. Moreover, carnosine adducts may be useful as redox stress indicator. PMID:26461323

  17. Differences between human slow N-acetyltransferase 2 alleles in levels of 4-aminobiphenyl-induced DNA adducts and mutations

    PubMed Central

    Bendaly, Jean; Doll, Mark A.; Millner, Lori M.; Metry, Kristin J.; Smith, Ned B.; Pierce, William M.; Hein, David W.


    Aromatic amines such as 4-aminobiphenyl (ABP) require biotransformation to exert their carcinogenic effects. Genetic polymorphisms in biotransformation enzymes such as N-acetyltransferase 2 (NAT2) may modify cancer risk following exposure. Nucleotide excision repair-deficient Chinese hamster ovary (CHO) cells stably transfected with human cytochrome P4501A1 (CYP1A1) and a single copy of either NAT2*4 (rapid acetylator), NAT2*5B (common Caucasian slow acetylator), or NAT2*7B (common Asian slow acetylator) alleles (haplotypes) were treated with ABP to test the effect of NAT2 polymorphisms on DNA adduct formation and mutagenesis. ABP N-acetyltransferase catalytic activities were detectable only in cell lines transfected with NAT2 and were highest in cells transfected with NAT2*4, lower in cells transfected with NAT2*7B, and lowest in cells transfected with NAT2*5B. Following ABP treatment, N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) was the primary adduct formed. Cells transfected with both CYP1A1 and NAT2*4 showed the highest concentration-dependent cytotoxicity, hypoxanthine phosphoribosyl transferase (hprt) mutants, and dG-C8-ABP adducts. Cells transfected with CYP1A1 and NAT2*7B showed lower levels of cytotoxicity, hprt mutagenesis, and dG-C8-ABP adducts. Cells transfected with CYP1A1 only or cells transfected with both CYP1A1 and NAT2*5B did not induce cytotoxicity, hprt mutagenesis or dG-C8-ABP adducts. ABP DNA adduct levels correlated very highly (r > 0.96) with ABP-induced hprt mutant levels following each treatment. The results of the present study suggest that investigations of NAT2 genotype or phenotype associations with disease or toxicity could be more precise and reproducible if heterogeneity within the “slow” NAT2 acetylator phenotype is considered and incorporated into the study design. PMID:19682468

  18. Loss of Dermatan-4-Sulfotransferase 1 Function Results in Adducted Thumb-Clubfoot Syndrome

    PubMed Central

    Dündar, Munis; Müller, Thomas; Zhang, Qi; Pan, Jing; Steinmann, Beat; Vodopiutz, Julia; Gruber, Robert; Sonoda, Tohru; Krabichler, Birgit; Utermann, Gerd; Baenziger, Jacques U.; Zhang, Lijuan; Janecke, Andreas R.


    Adducted thumb-clubfoot syndrome is an autosomal-recessive disorder characterized by typical facial appearance, wasted build, thin and translucent skin, congenital contractures of thumbs and feet, joint instability, facial clefting, and coagulopathy, as well as heart, kidney, or intestinal defects. We elucidated the molecular basis of the disease by using a SNP array-based genome-wide linkage approach that identified distinct homozygous nonsense and missense mutations in CHST14 in each of four consanguineous families with this disease. The CHST14 gene encodes N-acetylgalactosamine 4-O-sulfotransferase 1 (D4ST1), which catalyzes 4-O sulfation of N-acetylgalactosamine in the repeating iduronic acid-α1,3-N-acetylgalactosamine disaccharide sequence to form dermatan sulfate. Mass spectrometry of glycosaminoglycans from a patient's fibroblasts revealed absence of dermatan sulfate and excess of chondroitin sulfate, showing that 4-O sulfation by CHST14 is essential for dermatan sulfate formation in vivo. Our results indicate that adducted thumb-clubfoot syndrome is a disorder resulting from a defect specific to dermatan sulfate biosynthesis and emphasize roles for dermatan sulfate in human development and extracellular-matrix maintenance. PMID:20004762

  19. Detection of benzo[a]pyrene diol epoxide-DNA adducts in peripheral blood lymphocytes and antibodies to the adducts in serum from coke oven workers.

    PubMed Central

    Harris, C C; Vahakangas, K; Newman, M J; Trivers, G E; Shamsuddin, A; Sinopoli, N; Mann, D L; Wright, W E


    Coke oven workers are exposed to high levels of carcinogenic polycyclic aromatic hydrocarbons, including benzo[a]pyrene (B[a]P), and are at increased risk of lung cancer. Since B[a]P is enzymatically activated to 7 beta,8 alpha-dihydroxy(9 alpha, 10 alpha)epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (B[a]PDE) that forms adducts with DNA, the presence of these adducts was measured in DNA from peripheral blood lymphocytes by synchronous fluorescence spectrophotometry and enzyme radioimmunoassay. Approximately two-thirds of the workers had detectable levels of B[a]PDE-DNA adducts. Antibodies to the DNA adducts were also found in the serum of 27% of the workers. B[a]PDE-DNA adducts were not detectable in lymphocytes and antibodies to the adducts were not detected in sera from a control group of nonsmoking laboratory workers. DNA adducts and/or antibodies to the adducts indicate exposure to B[a]P and its metabolic activation to the carcinogenic metabolite that covalently binds to and damages DNA. Detection of adducts and antibodies to them may also be useful as internal dosimeters of the pathobiological effective doses of chemical carcinogens. PMID:2413443

  20. Chloroethyinitrosourea-derived ethano cytosine and adenine adducts are substrates for escherichia coli glycosylases excising analogous etheno adducts

    SciTech Connect

    Guliaev, Anton B.; Singer, B.; Hang, Bo


    Exocyclic ethano DNA adducts are saturated etheno ring derivatives formed mainly by therapeutic chloroethylnitrosoureas (CNUs), which are also mutagenic and carcinogenic. In this work, we report that two of the ethano adducts, 3,N{sup 4}-ethanocytosine (EC) and 1,N{sup 6}-ethanoadenine (EA), are novel substrates for the Escherichia coli mismatch-specific uracil-DNA glycosylase (Mug) and 3-methyladenine DNA glycosylase II (AlkA), respectively. It has been shown previously that Mug excises 3,N{sup 4}-ethenocytosine ({var_epsilon}C) and AlkA releases 1,N{sup 6}-ethenoadenine ({var_epsilon}A). Using synthetic oligonucleotides containing a single ethano or etheno adduct, we found that both glycosylases had a {approx}20-fold lower excision activity toward EC or EA than that toward their structurally analogous {var_epsilon}C or {var_epsilon}A adduct. Both enzymes were capable of excising the ethano base paired with any of the four natural bases, but with varying efficiencies. The Mug activity toward EC could be stimulated by E. coli endonuclease IV and, more efficiently, by exonuclease III. Molecular dynamics (MD) simulations showed similar structural features of the etheno and ethano derivatives when present in DNA duplexes. However, also as shown by MD, the stacking interaction between the EC base and Phe 30 in the Mug active site is reduced as compared to the {var_epsilon}C base, which could account for the lower EC activity observed in this study.

  1. Photochemistry of psoralen-DNA adducts, biological effects of psoralen-DNA adducts, applications of psoralen-DNA photochemistry

    SciTech Connect

    Shi, Yun-bo


    This thesis consists of three main parts and totally eight chapters. In Part I, The author will present studies on the photochemistry of psoralen-DNA adducts, specifically, the wavelength dependencies for the photoreversals of thymidine-HMT (4'-hydroxymethyl-4, 5', 8-trimenthylpsoralen) monoadducts and diadduct and the same adducts incorporated in DNA helices and the wavelength dependecies for the photocrossslinking of thymidine-HMT monoadducts in double-stranded helices. In Part II, The author will report some biological effects of psoralen-DNA adducts, i.e., the effects on double-stranded DNA stability, DNA structure, and transcription by E. coli and T7 RNA polymerases. Finally, The author will focus on the applications of psoralen-DNA photochemistry to investigation of protein-DNA interaction during transcription, which includes the interaction of E. coli and T7 RNA polymerases with DNA in elongation complexes arrested at specific psoralen-DNA adduct sites as revealed by DNase I footprinting experiments. 123 refs., 52 figs., 12 tabs.

  2. Removal of aflatoxin B1-DNA adducts and in vitro transformation in mouse embryo fibroblasts C3H/10T1 1/2

    SciTech Connect

    Amstad, P.A.; Wang, T.V.; Cerutti, P.A.


    The mechanism of in vitro transformation of the mouse embryo fibroblast C3H/10T 1/2 clone 8 by aflatoxin B1 (AFB1) was studied in confluent holding (CH) experiments. Confluent cultures of C3H/10T 1/2 cells were treated with AFB1 for 16 hours, and the DNA adduct composition and concentration were determined by chromatographic procedures after 0, 8, 16, and 40 hours of CH when the cells were replated at low density for the expression of their colony-forming ability and the formation of transformed foci. Total adduct concentration and the concentration of the major primary adduct 2,3-dihydro-2-(N7-guanyl)-3-hydroxyaflatoxin B1 (AFB1-N7-Gua) decreased continuously during CH due to spontaneous decomposition and probably also due to enzymatic repair processes. In contrast, the more chemically stable secondary product 2,3-dihydro-2-(N5-formyl-2',5',6'-triamino-4'-oxo-N5-pyrimidyl)-3-hydroxyaflatoxin B1 (AFB1-triamino-Py) accumulated in the DNA and reached its maximum concentration after 16 hours of CH. While the loss of total AFB1-DNA adducts during CH was reflected in recovery of viability, the potential to form transformed foci reached a maximum after 16 hours of CH and then decreased with continued CH below the initial value. Therefore, no simple relationship exists between the concentration of the total adducts AFB1-N7-Gua and AFB1-triamino-Py at the time of release from CH and the potential to form transformed foci. However, DNA lesions or abnormal DNA configurations formed during CH as a consequence of the cellular processing of AFB1-DNA adducts may play a role in the transformation process.

  3. Human Biomonitoring of DNA Adducts by Ion Trap Multistage Mass Spectrometry.


    Guo, Jingshu; Turesky, Robert J


    Humans are continuously exposed to hazardous chemicals in the environment. These chemicals or their electrophilic metabolites can form adducts with genomic DNA, which can lead to mutations and the initiation of cancer. The identification of DNA adducts is required for understanding exposure and the etiological role of a genotoxic chemical in cancer risk. The analytical chemist is confronted with a great challenge because the levels of DNA adducts generally occur at <1 adduct per 10(7) nucleotides, and the amount of tissue available for measurement is limited. Ion trap mass spectrometry has emerged as an important technique to screen for DNA adducts because of the high level sensitivity and selectivity, particularly when employing multi-stage scanning (MS(n) ). The product ion spectra provide rich structural information and corroborate the adduct identities even at trace levels in human tissues. Ion trap technology represents a significant advance in measuring DNA adducts in humans. © 2016 by John Wiley & Sons, Inc. PMID:27584705

  4. Redox proteomic profiling of neuroketal-adducted proteins in human brain: Regional vulnerability at middle age increases in the elderly.


    Domínguez, Mayelín; de Oliveira, Eliandre; Odena, María Antonia; Portero, Manuel; Pamplona, Reinald; Ferrer, Isidro


    Protein lipoxidation was assessed in the parietal cortex (PC), frontal cortex (FC), and cingulate gyrus (CG) in middle-aged and old-aged individuals with no clinical manifestations of cognitive impairment, in order to increase understanding of regional brain vulnerability to oxidative damage during aging. Twenty-five lipoxidized proteins were identified in all the three regions although with regional specificities, by using redox proteomics to detect target proteins of neuroketals (NKT) adduction. The number of cases with NKT-adducted proteins was higher in old-aged individuals but most oxidized proteins were already present in middle-aged individuals. Differences in vulnerability to oxidation were dependent on the sub-cellular localization, secondary structure, and external exposition of certain amino acids. Lipoxidized proteins included those involved in energy metabolism, cytoskeleton, proteostasis, neurotransmission and O2/CO2, and heme metabolism. Total NKT and soluble oligomer levels were estimated employing slot-blot, and these were compared between age groups. Oligomers increased with age in PC and FC; NKT significantly increased with age in FC, whereas total NKT and oligomer levels were not modified in CG, thus highlighting differences in brain regional vulnerability with age. Oligomers significantly correlated with NKT levels in the three cortical regions, suggesting that protein NKT adduction parallels soluble oligomer formation. PMID:26968793

  5. Equilibrium Dynamics of β-N-Methylamino-L-Alanine (BMAA) and Its Carbamate Adducts at Physiological Conditions.


    Zimmerman, David; Goto, Joy J; Krishnan, Viswanathan V


    Elevated incidences of Amyotrophic Lateral Sclerosis/Parkinsonism Dementia complex (ALS/PDC) is associated with β-methylamino-L-alanine (BMAA), a non-protein amino acid. In particular, the native Chamorro people living in the island of Guam were exposed to BMAA by consuming a diet based on the cycad seeds. Carbamylated forms of BMAA are glutamate analogues. The mechanism of neurotoxicity of the BMAA is not completely understood, and BMAA acting as a glutamate receptor agonist may lead to excitotoxicity that interferes with glutamate transport systems. Though the interaction of BMAA with bicarbonate is known to produce carbamate adducts, here we demonstrate that BMAA and its primary and secondary adducts coexist in solution and undergoes a chemical exchange among them. Furthermore, we determined the rates of formation/cleavage of the carbamate adducts under equilibrium conditions using two-dimensional proton exchange NMR spectroscopy (EXSY). The coexistence of the multiple forms of BMAA at physiological conditions adds to the complexity of the mechanisms by which BMAA functions as a neurotoxin. PMID:27513925

  6. Equilibrium Dynamics of β-N-Methylamino-L-Alanine (BMAA) and Its Carbamate Adducts at Physiological Conditions

    PubMed Central

    Zimmerman, David; Goto, Joy J.; Krishnan, Viswanathan V


    Elevated incidences of Amyotrophic Lateral Sclerosis/Parkinsonism Dementia complex (ALS/PDC) is associated with β-methylamino-L-alanine (BMAA), a non-protein amino acid. In particular, the native Chamorro people living in the island of Guam were exposed to BMAA by consuming a diet based on the cycad seeds. Carbamylated forms of BMAA are glutamate analogues. The mechanism of neurotoxicity of the BMAA is not completely understood, and BMAA acting as a glutamate receptor agonist may lead to excitotoxicity that interferes with glutamate transport systems. Though the interaction of BMAA with bicarbonate is known to produce carbamate adducts, here we demonstrate that BMAA and its primary and secondary adducts coexist in solution and undergoes a chemical exchange among them. Furthermore, we determined the rates of formation/cleavage of the carbamate adducts under equilibrium conditions using two-dimensional proton exchange NMR spectroscopy (EXSY). The coexistence of the multiple forms of BMAA at physiological conditions adds to the complexity of the mechanisms by which BMAA functions as a neurotoxin. PMID:27513925

  7. Determination of ginsenoside compound K in human plasma by liquid chromatography–tandem mass spectrometry of lithium adducts

    PubMed Central

    Chen, Yunhui; Lu, Youming; Yang, Yong; Chen, Xiaoyan; Zhu, Liang; Zhong, Dafang


    Ginsenoside compound K (GCK), the main metabolite of protopanaxadiol constituents of Panax ginseng, easily produces alkali metal adduct ions during mass spectrometry particularly with lithium. Accordingly, we have developed a rapid and sensitive liquid chromatography–tandem mass spectrometric method for analysis of GCK in human plasma based on formation of a lithium adduct. The analyte and paclitaxel (internal standard) were extracted from 50 µL human plasma using methyl tert-butyl ether. Chromatographic separation was performed on a Phenomenex Gemini C18 column (50 mm×2.0 mm; 5 μm) using stepwise gradient elution with acetonitrile–water and 0.2 mmol/L lithium carbonate at a flow rate of 0.5 mL/min. Detection was performed in the positive ion mode using multiple reaction monitoring of the transitions at m/z 629→449 for the GCK-lithium adduct and m/z 860→292 for the adduct of paclitaxel. The assay was linear in the concentration range 1.00–1000 ng/mL (r2>0.9988) with intra- and inter-day precision of ±8.4% and accuracy in the range of −4.8% to 6.5%. Recovery, stability and matrix effects were all satisfactory. The method was successfully applied to a pharmacokinetic study involving administration of a single GCK 50 mg tablet to healthy Chinese volunteers. PMID:26579476

  8. The effects of diet on DNA bulky adduct levels are strongly modified by GSTM1 genotype: a study on 634 subjects.


    Palli, Domenico; Masala, Giovanna; Peluso, Marco; Gaspari, Laura; Krogh, Vittorio; Munnia, Armelle; Panico, Salvatore; Saieva, Calogero; Tumino, Rosario; Vineis, Paolo; Garte, Seymour


    .04), vitamin E (P = 0.05) and beta-carotene (P = 0.02). Our results suggest that the role of a diet rich in antioxidants in preventing or reducing DNA adduct formation is restricted to subjects lacking the detoxifying activity of GSTM1 isoenzyme (approximately 50% of the general population). PMID:14656945

  9. Proteomic analysis of adducted butyrylcholinesterase for biomonitoring organophosphorus exposures

    PubMed Central

    Marsillach, Judit; Hsieh, Edward J.; Richter, Rebecca J.; MacCoss, Michael J.; Furlong, Clement E.


    Organophosphorus (OP) compounds include a broad group of toxic chemicals such as insecticides, chemical warfare agents and antiwear agents. The liver cytochromes P450 bioactivate many OPs to potent inhibitors of serine hydrolases. Cholinesterases were the first OP targets discovered and are the most studied. They are used to monitor human exposures to OP compounds. However, the assay that is currently used has limitations. The mechanism of action of OP compounds is the inhibition of serine hydrolases by covalently modifying their active-site serine. After structural rearrangement, the complex OP inhibitor-enzyme is irreversible and will remain in circulation until the modified enzyme is degraded. Mass spectrometry is a sensitive technology for analyzing protein modifications, such as OP-adducted enzymes. These analyses also provide some information about the nature of the OP adduct. Our aim is to develop high-throughput protocols for monitoring OP exposures using mass spectrometry. PMID:23123252

  10. Smoking related carcinogen-DNA adducts in biopsy samples of human urinary bladder: Identification of N-(deoxyguanosin-8-yl)-4-aminobiphenyl as a major adduct

    SciTech Connect

    Talaska, G. Univ. of Cincinnati, OH ); Al-Juburi, A.Z.S.S. ); Kadlubar, F.F. )


    The prevalence of covalent modifications to DNA (carcinogen-DNA adducts) in 42 human urinary bladder biopsy samples was investigated by {sup 32}P-postlabeling methods, with enhancement by both nuclease P1 treatment and 1-butanol extraction. Total mean carcinogen-DNA adduct levels and the mean levels of several specific adducts were significantly elevated in DNA samples of 13 current smokers, as opposed to 9 never smokers or 20 ex-smokers (5 years abstinence). There was no significant difference between the latter two groups. Several DNA adducts enhanced by nuclease P1 treatment were chromatographically similar to putative hydrocarbon DNA adducts reported earlier for placenta and lung DNA samples obtained from cigarette smokers. Putative aromatic amine adducts were detected by 1-butanol extraction that were not present when the samples were treated with nuclease P1. One of these displayed chromatographic behavior identical to the predominant adduct induced by the human urinary bladder carcinogen, 4-aminobiphenyl, which is present in cigarette smoke. This adduct comigrated in several thin-layer chromatographic systems with a synthetic N-(deoxyguanosin-8-yl)-4-amino(2,2{prime}-{sup 3}H)biphenyl-3{prime},5{prime}-bisphosphate marker. These data reinforce an association between cigarette smoking and DNA damage and suggest a molecular basis for the initiation of human urinary bladder cancer by cigarette smoke.

  11. Dispersant additives derived from lactone modified amido-amine adducts

    SciTech Connect

    Gutierrez, A.; Lundberg, R.D.


    This patent describes a lactone modified dispersant additive. It comprises one adduct of a polyolefin of 300 to 10,000 number average molecular weight substituted with at least 0.8 (e.g., from about 1 to 4) dicarboxylic acid producing moieties (preferably acid or anhydride moieties) per polyolefin molecule, an amido-amine or thioamido-amine characterized by being a reaction product of at least a polyamine and an alpha, beta-unsaturated compound.

  12. Ion Pairs or Neutral Molecule Adducts? Cooperativity in Hydrogen Bonding

    ERIC Educational Resources Information Center

    DeKock, Roger L.; Schipper, Laura A.; Dykhouse, Stephanie C.; Heeringa, Lee P.; Brandsen, Benjamin M.


    We performed theoretical studies on the systems NH[subscript 3] times HF times mH[subscript 2]O, NH[subscript 3] times HCl times mH[subscript 2]O, with m = 0, 1, 2, and 6. The molecules with m = 0 form hydrogen-bonded adducts with little tendency to form an ion-pair structure. The molecule NH[subscript 3] times HCl times H[subscript 2]O cannot be…

  13. 2' and 3' Carboranyl uridines and their diethyl ether adducts


    Soloway, Albert H.; Barth, Rolf F.; Anisuzzaman, Abul K.; Alam, Fazlul; Tjarks, Werner


    There is disclosed a process for preparing carboranyl uridine nucleoside compounds and their diethyl ether adducts, which exhibit a tenfold increase in boron content over prior art boron containing nucleoside compounds. Said carboranyl uridine nucleoside compounds exhibit enhanced lipophilicity and hydrophilic properties adequate to enable solvation in aqueous media for subsequent incorporation of said compounds in methods for boron neutron capture therapy in mammalian tumor cells.

  14. Protein tyrosine adduct in humans self-poisoned by chlorpyrifos

    SciTech Connect

    Li, Bin; Eyer, Peter; Eddleston, Michael; Jiang, Wei; Schopfer, Lawrence M.; Lockridge, Oksana


    Studies of human cases of self-inflicted poisoning suggest that chlorpyrifos oxon reacts not only with acetylcholinesterase and butyrylcholinesterase but also with other blood proteins. A favored candidate is albumin because in vitro and animal studies have identified tyrosine 411 of albumin as a site covalently modified by organophosphorus poisons. Our goal was to test this proposal in humans by determining whether plasma from humans poisoned by chlorpyrifos has adducts on tyrosine. Plasma samples from 5 self-poisoned humans were drawn at various time intervals after ingestion of chlorpyrifos for a total of 34 samples. All 34 samples were analyzed for plasma levels of chlorpyrifos and chlorpyrifos oxon (CPO) as a function of time post-ingestion. Eleven samples were analyzed for the presence of diethoxyphosphorylated tyrosine by mass spectrometry. Six samples yielded diethoxyphosphorylated tyrosine in pronase digests. Blood collected as late as 5 days after chlorpyrifos ingestion was positive for CPO-tyrosine, consistent with the 20-day half-life of albumin. High plasma CPO levels did not predict detectable levels of CPO-tyrosine. CPO-tyrosine was identified in pralidoxime treated patients as well as in patients not treated with pralidoxime, indicating that pralidoxime does not reverse CPO binding to tyrosine in humans. Plasma butyrylcholinesterase was a more sensitive biomarker of exposure than adducts on tyrosine. In conclusion, chlorpyrifos oxon makes a stable covalent adduct on the tyrosine residue of blood proteins in humans who ingested chlorpyrifos. - Highlights: • Chlorpyrifos-poisoned patients have adducts on protein tyrosine. • Diethoxyphosphate-tyrosine does not lose an alkyl group. • Proteins in addition to AChE and BChE are modified by organophosphates.

  15. A structurally-characterized NbCl5-NHC adduct.


    Bortoluzzi, Marco; Ferretti, Eleonora; Marchetti, Fabio; Pampaloni, Guido; Zacchini, Stefano


    The selective reactions of niobium pentachloride with two bulky NHC carbenes afforded NbCl5(NHC) complexes, bearing the highest oxidation state ever found for a metal centre in a transition metal halide-NHC adduct. The X-ray structure of 2a is the first one reported for a monodentate NHC-niobium species, and exhibits an abnormally long Nb-C bond. PMID:24658260

  16. 32P-postlabelling analysis of small aromatic and of bulky non-aromatic DNA adducts.


    Reddy, M V


    The 32P-postlabelling methodology for analysis of DNA adducts derived from carcinogens containing one aromatic ring (e.g., safrole, styrene oxide, benzene metabolites, 1-nitrosoindole-3-acetonitrile) or a bulky non-aromatic moiety (e.g., mitomycin C, diaziquone) is reviewed. Six steps are involved: digestion of DNA to 3'-nucleotides, enrichment of adducts, 32P-labelling of adducts, separation of labelled adducts by TLC, detection, and quantitation. The first step, DNA digestion with micrococcal nuclease and spleen phosphodiesterase, is applicable to DNA modified with most carcinogens independent of their size and structure. Of the two commonly used procedures for enrichment of aromatic adducts in DNA digests, the nuclease P1 treatment is substantially more effective than butanol extraction for small aromatic and bulky non-aromatic adducts. For initial purification of these adducts from unadducted material after 32P-labelling, multi-directional polyethyleneimine (PEI)-cellulose TLC using 1 M sodium phosphate, pH 6.0, as the D1 solvent is not suitable, because they are not retained on PEI-cellulose under these conditions. A higher concentration of sodium phosphate (e.g., 2.3 M) or development with D1 and D3 solvents in the same direction helps to retain adducts of safrole and of benzene metabolites. Also, transfer of adducts from multiple cut-outs above the origin after D1 chromatography, as adopted for analysis of I-compounds, is potentially applicable. However, initial purification by reverse-phase TLC, followed by in situ transfer and resolution by PEI-cellulose TLC has been found to be most effective for these adducts. Reverse-phase TLC at 4 degrees C or in a stronger salt solution further improves retention of some adducts (e.g., mitomycin C and diaziquone adducts). For adduct separation by PEI-cellulose TLC, salt solutions with or without urea are used. PMID:8225492

  17. Crystal and molecular structure of adduct of 6-benzylaminopurine and 5-sulfosalicylic acid

    SciTech Connect

    Xia Min Ma Kuirong


    The crystal structure of adduct of 6-benzylaminopurine and 5-sulfosalicylic acid C{sub 19}H{sub 25}N{sub 5}O{sub 10}S 1 is studied using single-crystal diffraction (R = 0.0482 for 2852 reflections with I > 2{sigma}(I)). The asymmetric unit of 1 contains one 6-benzylaminopurine molecule and one 5-sulfosalicylic acid molecule, as well as four lattice water molecules. Hydrogen bonds, formed by 6-benzylaminopurine and 5-sulfosalicylic acid, link the two molecules into one-dimensional chain (omitting four water molecules), further joined to two-dimensional layer network. Short ring-interactions with intra-chain {pi}-{pi} stacking are observed. The data of IR spectroscopy confirm the formation of the two-dimensional supramolecular layer structure. At last, a 3D supramolecular network constructs via hydrogen bonds.

  18. Toxic Dopamine Metabolite DOPAL Forms an Unexpected Dicatechol Pyrrole Adduct with Lysines of α-Synuclein.


    Werner-Allen, Jon W; DuMond, Jenna F; Levine, Rodney L; Bax, Ad


    Parkinson's disease has long been known to involve the loss of dopaminergic neurons in the substantia nigra and the coincidental appearance of Lewy bodies containing oligomerized forms of α-synuclein. The "catecholaldehyde hypothesis" posits a causal link between these two central pathologies mediated by 3,4-dihydroxyphenylacetaldehyde (DOPAL), the most toxic dopamine metabolite. Here we determine the structure of the dominant product in reactions between DOPAL and α-synuclein, a dicatechol pyrrole lysine adduct. This novel modification results from the addition of two DOPAL molecules to the Lys sidechain amine through their aldehyde moieties and the formation of a new carbon-carbon bond between their alkyl chains to generate a pyrrole ring. The product is detectable at low concentrations of DOPAL and its discovery should provide a valuable chemical basis for future studies of DOPAL-induced crosslinking of α-synuclein. PMID:27158766

  19. Low response in white blood cell DNA adducts among workers in a highly polluted cokery environment.


    Kuljukka, T; Savela, K; Vaaranrinta, R; Mutanen, P; Veidebaum, T; Sorsa, M; Peltonen, K


    Coke oven workers are often heavily exposed to polynuclear aromatic hydrocarbons (PAHs); this exposure has been associated with higher cancer rates among these workers. We assessed the exposure of cokery workers in an oil shale processing plant. Personal hygienic monitoring, measurement of urinary 1-hydroxypyrene (1-OHP), and analysis of PAH-DNA adducts in white blood cells (WBCs) were performed. The 32P-postlabeling method was used for adduct measurement. The mean adduct value, 1.6 adducts per 10(8) nucleotides, did not differ significantly from the control value (P = 0.098). Smokers had significantly higher adduct levels than non-smoking workers (P = 0.002). 1-OHP levels measured in post-shift samples correlated with DNA adducts found in white blood cells (WBCs). We conclude that hygienic monitoring and measurement of urinary metabolites are essential background exposure data when the biologically effective dose of chemical carcinogens is assessed. PMID:9636933

  20. Structural aspects of adducts of N-phthaloylglycine and its derivatives

    NASA Astrophysics Data System (ADS)

    Barooah, Nilotpal; Sarma, Rupam J.; Batsanov, Andrei S.; Baruah, Jubaraj B.


    N-phthaloylglycine forms 2:1 adduct with 1,3-dihydroxybenzene and 1:2 adduct with 2-aminopyrimidine. Whereas N-phthaloylglycine form salts with 2,6-diaminopyridine and with 8-hydroxyquinoline. The 1:1 adduct of N, N'-bis(glycinyl)pyromellitic diimide with dimethylsulphoxide, 2-aminopyrimidine and 4,4'-dihydroxybiphenyl are prepared and characterised. The reaction of N, N'-bis(glycinyl)pyromellitic diimide with 2,6-diaminopyridine gives corresponding salt.

  1. DNA Adducts of the Tobacco Carcinogens 2-Amino-9H-pyrido[2,3-b]indole and 4-Aminobiphenyl are Formed at Environmental Exposure levels and Persist in Human Hepatocytes

    PubMed Central

    Nauwelaërs, Gwendoline; Bellamri, Medjda; Fessard, Valérie; Turesky, Robert J.; Langouët, Sophie


    Aromatic amines and structurally related heterocyclic aromatic amines (HAAs) are produced during the combustion of tobacco or during the high-temperature cooking of meat. Exposure to some of these chemicals may contribute to the etiology of several common types of human cancers. 2-Amino-9H-pyrido[2,3-b]indole (AαC) is the most abundant HAA formed in mainstream tobacco smoke: it arises in amounts that are 25–100 times greater than the levels of the arylamine, 4-aminobiphenyl (4-ABP), a human carcinogen. 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) is a prevalent HAA formed in cooked meats. AαC and MeIQx are rodent carcinogens; however, their carcinogenic potency in humans is unknown. A preliminary assessment of the carcinogenic potential of these HAAs in humans was conducted by examining the capacity of primary human hepatocytes to form DNA adducts of AαC and MeIQx, in comparison to 4-ABP, followed by the kinetics of DNA adduct removal by cellular enzyme repair systems. The principal DNA adducts formed were N-(deoxyguanosin-8-yl) (dG-C8) adducts. Comparable levels of DNA adducts were formed with AαC and 4-ABP, whereas adduct formation was ~5-fold lower for MeIQx. dG-C8-AαC and dG-C8-4-ABP were formed at comparable levels in a concentration-dependent manner in human hepatocytes treated with procarcinogens over a ten thousand-fold concentration range (1 nM – 10 µM). Pretreatment of hepatocytes with furafylline, a selective inhibitor of cytochrome P450 1A2, resulted in a strong diminution of DNA adducts signifying that P450 1A2 is a major P450 isoform involved in bioactivation of these procarcinogens. The kinetics of adduct removal varied for each hepatocyte donor. Approximately half of the DNA adducts were removed within 24 h of treatment; however, the remaining lesions persisted over 5 days. The high levels of AαC present in tobacco smoke and its propensity to form persistent DNA adducts in human hepatocytes, suggests that AαC can contribute to

  2. Comparison of DNA adducts from exposure to complex mixtures in various human tissues and experimental systems

    PubMed Central

    Lewtas, Joellen; Mumford, Judy; Everson, Richard B.; Hulka, Barbara; Wilcosky, Tim; Kozumbo, Walter; Thompson, Claudia; George, Michael; Dobiáš, Lubomir; Šrám, Radim; Li, Xueming; Gallagher, Jane


    DNA adducts derived from complex mixtures of polycyclic aromatic compounds emitted from tobacco smoke are compared to industrial pollution sources (e.g., coke ovens and aluminum smelters), smoky coal burning, and urban air pollution. Exposures to coke oven emissions and smoky coal, both potent rodent skin tumor initiators and lung carcinogens in humans, result in high levels of DNA adducts compared to tobacco smoke in the in vitro calf thymus DNA model system, in cultured lymphocytes, and in the mouse skin assay. Using tobacco smoke as a model in human studies, we have compared relative DNA adduct levels detected in blood lymphocytes, placental tissue, bronchoalveolar lung lavage cells, sperm, and autopsy tissues of smokers and nonsmokers. Adduct levels in DNA isolated from smokers were highest in human heart and lung tissue with smaller but detectable differences in placental tissue and lung lavage cells. Comparison of the DNA adduct levels resulting from human exposure to different complex mixtures shows that emissions from coke ovens, aluminum smelters, and smoky coal result in higher DNA adduct levels than tobacco smoke exposure. These studies suggest that humans exposed to complex combustion mixtures will have higher DNA adduct levels in target cells (e.g., lung) as compared to nontarget cells (e.g., lymphocytes) and that the adduct levels will be dependent on the genotoxic and DNA adduct-forming potency of the mixture. ImagesFIGURE 1.FIGURE 1.FIGURE 2.FIGURE 3.FIGURE 3.FIGURE 3.FIGURE 3.FIGURE 3.FIGURE 3.FIGURE 4. PMID:8319665

  3. Lifetimes and stabilities of familiar explosives molecular adduct complexes during ion mobility measurements

    PubMed Central

    McKenzie, Alan; DeBord, John Daniel; Ridgeway, Mark; Park, Melvin; Eiceman, Gary; Fernandez-Lima, Francisco


    Trapped ion mobility spectrometry coupled to mass spectrometry (TIMS-MS) was utilized for the separation and identification of familiar explosives in complex mixtures. For the first time, molecular adduct complex lifetimes, relative stability, binding energies and candidate structures are reported for familiar explosives. Experimental and theoretical results showed that the adduct size and reactivity, complex binding energy and the explosive structure tailors the stability of the molecular adduct complex. TIMS flexibility to adapt the mobility separation as a function of the molecular adduct complex stability (i.e., short or long IMS experiments / low or high IMS resolution) permits targeted measurements of explosives in complex mixtures with higher confidence levels. PMID:26153567

  4. Chromatographic and fluorescence spectroscopic studies of individual 7,12-dimethylbenz(a)anthracene--deoxyribonucleoside adducts

    SciTech Connect

    Moschel, R.C.; Pigott, M.A.; Costantino, N.; Dipple, A.


    Compared with standard Sephadex LH-20 column chromatography, a newly developed high pressure liquid chromatographic separation of hydrocarbon deoxyribonucleoside adducts derived from the DNA of mouse embryo cell cultures exposed to 7,12-dimethylbenz(a)anthracene (DMBA) provides markedly superior resolution. Once resolved, the fluorescence spectroscopic properties of the three major DMBA--DNA adducts indicate that the fluorescence exhibited by adducts derived from a bay region syn dihydrodiol epoxide of DMBA differs subtly from that exhibited by adducts derived from the isomeric anti dihydrodiol epoxide.

  5. Specific Function of the Met-Tyr-Trp Adduct Radical and Residues Arg-418 and Asp-137 in the Atypical Catalase Reaction of Catalase-Peroxidase KatG*

    PubMed Central

    Zhao, Xiangbo; Khajo, Abdelahad; Jarrett, Sanchez; Suarez, Javier; Levitsky, Yan; Burger, Richard M.; Jarzecki, Andrzej A.; Magliozzo, Richard S.


    Catalase activity of the dual-function heme enzyme catalase-peroxidase (KatG) depends on several structural elements, including a unique adduct formed from covalently linked side chains of three conserved amino acids (Met-255, Tyr-229, and Trp-107, Mycobacterium tuberculosis KatG numbering) (MYW). Mutagenesis, electron paramagnetic resonance, and optical stopped-flow experiments, along with calculations using density functional theory (DFT) methods revealed the basis of the requirement for a radical on the MYW-adduct, for oxyferrous heme, and for conserved residues Arg-418 and Asp-137 in the rapid catalase reaction. The participation of an oxyferrous heme intermediate (dioxyheme) throughout the pH range of catalase activity is suggested from our finding that carbon monoxide inhibits the activity at both acidic and alkaline pH. In the presence of H2O2, the MYW-adduct radical is formed normally in KatG[D137S] but this mutant is defective in forming dioxyheme and lacks catalase activity. KatG[R418L] is also catalase deficient but exhibits normal formation of the adduct radical and dioxyheme. Both mutants exhibit a coincidence between MYW-adduct radical persistence and H2O2 consumption as a function of time, and enhanced subunit oligomerization during turnover, suggesting that the two mutations disrupting catalase turnover allow increased migration of the MYW-adduct radical to protein surface residues. DFT calculations showed that an interaction between the side chain of residue Arg-418 and Tyr-229 in the MYW-adduct radical favors reaction of the radical with the adjacent dioxyheme intermediate present throughout turnover in WT KatG. Release of molecular oxygen and regeneration of resting enzyme are thereby catalyzed in the last step of a proposed catalase reaction. PMID:22918833

  6. Analysis of dibenzo[def,p]chrysene-deoxyadenosine adducts in wild-type and cytochrome P450 1b1 knockout mice using stable-isotope dilution UHPLC-MS/MS.


    Harper, Tod A; Morré, Jeff; Lauer, Fredine T; McQuistan, Tammie J; Hummel, Jessica M; Burchiel, Scott W; Williams, David E


    The polycyclic aromatic hydrocarbon (PAH), dibenzo[def,p]chrysene (DBC; also known as dibenzo[a,l]pyrene), is a potent carcinogen in animal models and a class 2A human carcinogen. Recent investigations into DBC-mediated toxicity identified DBC as a potent immunosuppressive agent similar to the well-studied immunotoxicant 7,12-dimethylbenz[a]anthracene (DMBA). DBC, like DMBA, is bioactivated by cytochrome P450 (CYP) 1B1 and forms the reactive metabolite DBC-11,12-diol-13,14-epoxide (DBCDE). DBCDE is largely responsible for the genotoxicity associated with DBC exposure. The immunosuppressive properties of several PAHs are also linked to genotoxic mechanisms. Therefore, this study was designed to identify DBCDE-DNA adduct formation in the spleen and thymus of wild-type and cytochrome P450 1b1 (Cyp1b1) knockout (KO) mice using a highly sensitive stable-isotope dilution UHPLC-MS/MS method. Stable-isotope dilution UHPLC-MS/MS identified the major DBC adducts (±)-anti-cis-DBCDE-dA and (±)-anti-trans-DBCDE-dA in the lung, liver, and spleen of both WT and Cyp1b1 KO mice. However, adduct formation in the thymus was below the level of quantitation for our method. Additionally, adduct formation in Cyp1b1 KO mice was significantly reduced compared to wild-type (WT) mice receiving DBC via oral gavage. In conclusion, the current study identifies for the first time DBCDE-dA adducts in the spleen of mice supporting the link between genotoxicity and immunosuppression, in addition to supporting previous studies identifying Cyp1b1 as the primary CYP involved in DBC bioactivation to DBCDE. The high levels of DBC-DNA adducts identified in the spleen, along with the known high levels of Cyp1b1 expression in this organ, supports further investigation into DBC-mediated immunotoxicity. PMID:25868132

  7. Analysis of Dibenzo[def,p]chrysene-Deoxyadenosine Adducts in Wild-Type and Cytochrome P450 1b1 Knockout Mice using Stable-Isotope Dilution UHPLC-MS/MS

    PubMed Central

    Harper, Tod A.; Morré, Jeff; Lauer, Fredine T.; McQuistan, Tammie J.; Hummel, Jessica M.; Burchiel, Scott W.; Williams, David E.


    The polycyclic aromatic hydrocarbon (PAH), dibenzo[def,p]chrysene (DBC; also known as dibenzo[a,l]pyrene), is a potent carcinogen in animal models and a class 2A human carcinogen. Recent investigations into DBC-mediated toxicity identified DBC as a potent immunosuppressive agent similar to the well-studied immunotoxicant 7,12-dimethylbenz[a]anthracene (DMBA). DBC, like DMBA, is bioactivated by cytochrome P450 (CYP) 1B1 and forms the reactive metabolite DBC-11,12-diol-13,14-epoxide (DBCDE). DBCDE is largely responsible for the genotoxicity associated with DBC exposure. The immunosuppressive properties of several PAHs are also linked to genotoxic mechanisms. Therefore, this study was designed to identify DBCDE-DNA adduct formation in the spleen and thymus of wild-type and cytochrome P450 1b1 (Cyp1b1) knockout (KO) mice using a highly sensitive stable-isotope dilution UHPLC-MS/MS method. Stable-isotope dilution UHPLC-MS/MS identified the major DBC adducts (±)-anti-cis-DBCDE-dA and (±)-anti-trans-DBCDE-dA in the lung, liver, and spleen of both WT and Cyp1b1 KO mice. However, adduct formation in the thymus was below the level of quantitation for our method. Additionally, adduct formation in Cyp1b1 KO mice was significantly reduced compared to wild-type (WT) mice receiving DBC via oral gavage. In conclusion, the current study identifies for the first time DBCDE-dA adducts in the spleen of mice supporting the link between genotoxicity and immunosuppression, in addition to supporting previous studies identifying Cyp1b1 as the primary CYP involved in DBC bioactivation to DBCDE. The high levels of DBC-DNA adducts identified in the spleen, along with the known high levels of Cyp1b1 expression in this organ, supports further investigation into DBC-mediated immunotoxicity. PMID:25868132

  8. Urinary Metabolites of the Dietary Carcinogen PhIP are Predictive of Colon DNA Adducts After a Low Dose Exposure in Humans

    SciTech Connect

    Malfatti, M; Dingley, K; Nowell, S; Ubick, E; Mulakken, N; Nelson, D; Lang, N; Felton, J; Turteltaub, K


    Epidemiologic evidence indicates that exposure to heterocyclic amines (HAs) in the diet is an important risk factor for the development of colon cancer. Well-done cooked meats contain significant levels of HAs which have been shown to cause cancer in laboratory animals. To better understand the mechanisms of HA bioactivation in humans, the most mass abundant HA, 2-amino-l-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), was used to assess the relationship between PhIP metabolism and DNA adduct formation. Ten human volunteers were administered a dietary relevant dose of [{sup 14}C]PhIP 48-72 h prior to surgery to remove colon tumors. Urine was collected for 24 h after dosing for metabolite analysis, and DNA was extracted from colon tissue and analyzed by accelerator mass spectrometry for DNA adducts. All ten subjects were phenotyped for CYP1A2, NAT2, and SULT1A1 enzyme activity. Twelve PhIP metabolites were detected in the urine samples. The most abundant metabolite in all volunteers was N-hydroxy-PhIP-N{sup 2}-glucuronide. Metabolite levels varied significantly between the volunteers. Interindividual differences in colon DNA adducts levels were observed between each individual. The data showed that individuals with a rapid CYP1A2 phenotype and high levels of urinary N-hydroxy-PhIP-N{sup 2}-glucuronide, had the lowest level of colon PhIP-DNA adducts. This suggests that glucuronidation plays a significant role in detoxifying N-hydroxy-PhIP. The levels of urinary N-hydroxy-PhIP-N{sup 2}-glucuronide were negatively correlated to colon DNA adduct levels. Although it is difficult to make definite conclusions from a small data set, the results from this pilot study have encouraged further investigations using a much larger study group.

  9. N-terminal valine adduct from the anti-HIV drug abacavir in rat haemoglobin as evidence for abacavir metabolism to a reactive aldehyde in vivo

    PubMed Central

    Charneira, C; Grilo, NM; Pereira, SA; Godinho, ALA; Monteiro, EC; Marques, MM; Antunes, AMM


    BACKGROUND AND PURPOSE The aim of this study was to obtain evidence for the activation of the nucleoside reverse transcriptase inhibitor abacavir to reactive aldehyde metabolites in vivo. Protein haptenation by these reactive metabolites may be a factor in abacavir-induced toxic events. EXPERIMENTAL APPROACH The formation of N-terminal valine adducts from the abacavir-derived aldehydes was investigated in the haemoglobin of Wistar rats treated with eight daily doses (120 mg·kg−1) of abacavir. The analyses were conducted by high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry upon comparison with synthetic standards. KEY RESULTS An N-terminal valine haemoglobin adduct derived from an α,β-unsaturated aldehyde metabolite of abacavir was identified in vivo for the first time. CONCLUSIONS AND IMPLICATIONS This preliminary work on abacavir metabolism provides the first unequivocal evidence for the formation of an α,β-unsaturated aldehyde metabolite in vivo and of its ability to form haptens with proteins. The methodology described herein can be used to assess the formation of this metabolite in human samples and has the potential to become a valuable pharmacological tool for mechanistic studies of abacavir toxicity. In fact, the simplicity of the method suggests that the abacavir adduct with the N-terminal valine of haemoglobin could be used to investigate abacavir-induced toxicity for accurate risk/benefit estimations. PMID:22725138

  10. The impact of glutathione s-transferase M1 and cytochrome P450 1A1 genotypes on white-blood-cell polycyclic aromatic hydrocarbon-DNA adduct levels in humans.


    Rothman, N; Shields, P G; Poirier, M C; Harrington, A M; Ford, D P; Strickland, P T


    Carcinogenic polycyclic aromatic hydrocarbons (PAHs) form DNA adducts via a complex metabolic activation pathway that includes cytochrome P450 (CYP) 1A1, whereas intermediate metabolites can be detoxified by conjugation through pathways including glutathione s-transferase M1 (GSTM1). PAH-DNA adducts can be measured in peripheral white blood cells (WBCs) and should reflect the net effect of competing activation and detoxification pathways and DNA repair as well as exposure. We have previously shown that WBC PAH-DNA adducts measured by an enzyme-linked immunosorbent assay (ELISA) were associated with recent, frequent consumption of charbroiled food among 47 nonsmoking wildland fire-fighters who provided two blood samples 8 wk apart. In the investigation reported here, which was performed in the same population, we measured the association between the GSTM1 null genotype, which results in loss of enzyme activity, and PAH-DNA adduct levels, hypothesizing that subjects with this genotype would have higher levels of DNA adducts because of their decreased ability to detoxify PAH metabolites. However, PAH-DNA adduct levels were nonsignificantly lower in subjects with the GSTM1 null genotype (n = 28) compared with other subjects (n = 19) (median 0.04 fmol/microgram DNA vs 0.07 fmol/microgram DNA, respectively, P = 0.45, Wilcoxon rank-sum test). Adduct levels were also lower in the nine subjects heterozygous or homozygous for the CYP1A1 exon 7 polymorphism (which codes for a valine rather than isoleucine and is thought to be associated with greater CYP1A1 activity) compared with the 38 wild-type subjects (P = 0.12). In the entire group, there was a positive association between consuming charbroiled food and PAH-DNA adduct formation (r = 0.24, P = 0.02, Spearman rank-order correlation). This association was weaker in the subgroup of subjects with the GSTM1 null genotype (r = 0.03, P = 0.84) and stronger among the remaining subjects (r = 0.57, P = 0.0002). These results

  11. LOBSTAHS: An Adduct-Based Lipidomics Strategy for Discovery and Identification of Oxidative Stress Biomarkers.


    Collins, James R; Edwards, Bethanie R; Fredricks, Helen F; Van Mooy, Benjamin A S


    Discovery and identification of molecular biomarkers in large LC/MS data sets requires significant automation without loss of accuracy in the compound screening and annotation process. Here, we describe a lipidomics workflow and open-source software package for high-throughput annotation and putative identification of lipid, oxidized lipid, and oxylipin biomarkers in high-mass-accuracy HPLC-MS data. Lipid and oxylipin biomarker screening through adduct hierarchy sequences, or LOBSTAHS, uses orthogonal screening criteria based on adduct ion formation patterns and other properties to identify thousands of compounds while providing the user with a confidence score for each assignment. Assignments are made from one of two customizable databases; the default databases contain 14 068 unique entries. To demonstrate the software's functionality, we screened more than 340 000 mass spectral features from an experiment in which hydrogen peroxide was used to induce oxidative stress in the marine diatom Phaeodactylum tricornutum. LOBSTAHS putatively identified 1969 unique parent compounds in 21 869 features that survived the multistage screening process. While P. tricornutum maintained more than 92% of its core lipidome under oxidative stress, patterns in biomarker distribution and abundance indicated remodeling was both subtle and pervasive. Treatment with 150 μM H2O2 promoted statistically significant carbon-chain elongation across lipid classes, with the strongest elongation accompanying oxidation in moieties of monogalactosyldiacylglycerol, a lipid typically localized to the chloroplast. Oxidative stress also induced a pronounced reallocation of lipidome peak area to triacylglycerols. LOBSTAHS can be used with environmental or experimental data from a variety of systems and is freely available at . PMID:27322848

  12. Group 13 Superacid Adducts of [PCl2N]3.


    Tun, Zin-Min; Heston, Amy J; Panzner, Matthew J; Scionti, Vincenzo; Medvetz, Doug A; Wright, Brian D; Johnson, Nicholas A; Li, Linlin; Wesdemiotis, Chrys; Rinaldi, Peter L; Youngs, Wiley J; Tessier, Claire A


    Irrespective of the order of the addition of reagents, the reactions of [PCl2N]3 with MX3 (MX3 = AlCl3, AlBr3, GaCl3) in the presence of water or gaseous HX give the air- and light-sensitive superacid adducts [PCl2N]3·HMX4. The reactions are quantitative when HX is used. These reactions illustrate a Lewis acid/Brønsted acid dichotomy in which Lewis acid chemistry can become Brønsted acid chemistry in the presence of adventitious water or HX. The crystal structures of all three [PCl2N]3·HMX4 adducts show that protonation weakens the two P-N bonds that flank the protonated nitrogen atom. Variable-temperature NMR studies indicate that exchange in solution occurs in [PCl2N]3·HMX4, even at lower temperatures than those for [PCl2N]3·MX3. The fragility of [PCl2N]3·HMX4 at or near room temperature and in the presence of light suggests that such adducts are not involved directly as intermediates in the high-temperature ring-opening polymerization (ROP) of [PCl2N]3 to give [PCl2N]n. Attempts to catalyze or initiate the ROP of [PCl2N]3 with the addition of [PCl2N]3·HMX4 at room temperature or at 70 °C were not successful. PMID:26974866


    EPA Science Inventory

    Benzo[a]pyrene (B[a]P) is a potent human and rodent lung carcinogen. This activity has been ascribed in part to the formation of B[a]P-7,8-diol-9,10-epoxide (BPDE)-DNA adducts. Other carcinogenic mechanisms have been proposed: 1.] The induction of apurinic si...


    EPA Science Inventory

    Benzo[a]pyrene (B[a]P) is a potent human and rodent lung carcinogen. This activity has been ascribed in part to the formation of B[a]P-7,8-dio1-9,10-epoxide (BPDE)-DNA adducts. Other carcinogenic mechanisms have been proposed: 1.] The induction of apurinic sites from radical cati...

  15. First Crystal Structure for a Gold Carbene-Protein Adduct.


    Ferraro, Giarita; Gabbiani, Chiara; Merlino, Antonello


    The X-ray structure of the adduct formed in the reaction between the gold N-heterocyclic carbene compound Au(NHC)Cl (with NHC = 1-butyl-3-methyl-imidazole-2-ylidene) and the model protein thaumatin is reported here. The structure reveals binding of Au(NHC)(+) fragments to distinct protein sites. Notably, binding of the gold compound occurs at lysine side chains and at the N-terminal tail; the metal binds the protein after releasing Cl(-) ligand, but retaining NHC fragment. PMID:27364343

  16. Unraveling the Photoswitching Mechanism in Donor-Acceptor Stenhouse Adducts.


    Lerch, Michael M; Wezenberg, Sander J; Szymanski, Wiktor; Feringa, Ben L


    Molecular photoswitches have opened up a myriad of opportunities in applications ranging from responsive materials and control of biological function to molecular logics. Here, we show that the photoswitching mechanism of donor-acceptor Stenhouse adducts (DASA), a recently reported class of photoswitches, proceeds by photoinduced Z-E isomerization, followed by a thermal, conrotatory 4π-electrocyclization. The photogenerated intermediate is manifested by a bathochromically shifted band in the visible absorption spectrum of the DASA. The identification of the role of this intermediate reveals a key step in the photoswitching mechanism that is essential to the rational design of switching properties via structural modification. PMID:27152878

  17. Covalent adducts arising from the decomposition products of lipid hydroperoxides in the presence of cytochrome C

    PubMed Central

    Williams, Michelle V.; Wishnok, John S.; Tannenbaum, Steven R.


    Polyunsaturated fatty acids can be converted to lipid hydroperoxides through non-enzymatic and enzymatic pathways. The prototypic ω-6 lipid hydroperoxide 13-hydroperoxy-octadecadienoic acid (13-HPODE) decomposes homolytically to form highly reactiveα,β-unsaturated aldehydes, such as 9,12-dioxo-10(E)-dodecenoic acid (DODE), 4-oxo-2(E)-nonenal (ONE), 4,5-epoxy-2(E)-decenal (EDE), and 4-hydroxy-2(E)-nonenal (HNE), that can form covalent adducts with DNA. Both 4-oxo-2(E)-nonenal and 4-hydroxy-2(E)-nonenal can also modify proteins to form products that can potentially serve as biomarkers of lipid hydroperoxide-mediated macromolecule damage. In this study cytochrome C was used to identify and characterize the modification sites individually for each of these aldehydes and also to determine the most abundant adduct formed following decomposition of 13-HPODE. The adducts were characterized by ESI-TOF/MS analysis of the intact proteins and by a combination of ESI-ion-trap/MSn and quadrupole-TOF/MS/MS analysis of the tryptic and chymotryptic peptides. The major adducts included an HNE-His Michael adduct on H33, EDE-Lys adducts on K7 and K8, ONE-Lys ketoamide adducts on K5, K7, and K8, an apparent ONE-Lys Michael adduct on K5, and DODE-Lys carboxyl ketoamide adducts on K86 and K87. DODE was the most reactive aldehyde toward cytochrome C. The major adduct from this reaction was analogous to the most abundant adduct resulting from the decomposition of 13-HPODE in the presence of cytochrome C. PMID:17407328

  18. Dynamic and static control of the human knee joint in abduction-adduction.


    Zhang, L Q; Wang, G


    It is unclear whether humans can voluntarily control dynamic and static properties in knee abduction-adduction, which may be important in performing functional tasks and preventing injuries, whether the main load is about the abduction axis or not. A joint-driving device was used to perturb the knee in abduction-adduction at full knee extension under both passive (muscle relaxed) and active (muscle contracted in abduction or adduction) conditions. Dynamic control properties in knee abduction-adduction were characterized by joint stiffness, viscosity, and limb inertia, and quasi-static knee torque-angle relationship was characterized by knee abduction-adduction laxity and quasi-static stiffness (at a 20Nm moment). It was found that the subjects were capable of generating net abduction and adduction moment through differential co-contraction of muscles crossing the medial and lateral sides of the knee, which helped to reduce the abduction-adduction joint laxity (p< or =0.01) and increase stiffness (p<0.027) and viscous damping. Knee abduction laxity was significantly lower than adduction laxity (p=0.043) and the quasi-static abduction stiffness was significantly higher than adduction stiffness (p<0.001). The knee joint showed significantly higher stiffness and viscosity in abduction-adduction than their counterparts in knee flexion-extension at comparable levels of joint torque (p<0.05). Similar to dynamic flexion-extension properties, the system damping ratio remained constant over different levels of contraction, indicating simplified control tasks for the central nervous system; while the natural undamped frequency increased considerably with abduction-adduction muscle contraction, presumably making the knee a quicker system during strenuous tasks involving strong muscle contraction. PMID:11506781

  19. Ultrasensitive isolation, identification and quantification of DNA-protein adducts by ELISA-based RADAR assay.


    Kiianitsa, Kostantin; Maizels, Nancy


    Enzymes that form transient DNA-protein covalent complexes are targets for several potent classes of drugs used to treat infectious disease and cancer, making it important to establish robust and rapid procedures for analysis of these complexes. We report a method for isolation of DNA-protein adducts and their identification and quantification, using techniques compatible with high-throughput screening. This method is based on the RADAR assay for DNA adducts that we previously developed (Kiianitsa and Maizels (2013) A rapid and sensitive assay for DNA-protein covalent complexes in living cells. Nucleic Acids Res., 41:e104), but incorporates three key new steps of broad applicability. (i) Silica-assisted ethanol/isopropanol precipitation ensures reproducible and efficient recovery of DNA and DNA-protein adducts at low centrifugal forces, enabling cell culture and DNA precipitation to be carried out in a single microtiter plate. (ii) Rigorous purification of DNA-protein adducts by a procedure that eliminates free proteins and free nucleic acids, generating samples suitable for detection of novel protein adducts (e.g. by mass spectroscopy). (iii) Identification and quantification of DNA-protein adducts by direct ELISA assay. The ELISA-based RADAR assay can detect Top1-DNA and Top2a-DNA adducts in human cells, and gyrase-DNA adducts in Escherichia coli. This approach will be useful for discovery and characterization of new drugs to treat infectious disease and cancer, and for development of companion diagnostics assays for individualized medicine. PMID:24914050


    EPA Science Inventory

    Identification of DNA adducts in peripheral lymphocytes could serve as a means of monitoring human exposure to potential genotoxic agents. n this study, DNA from peripheral lymphocytes of smokers and nonsmokers was examined for adducts by the P1 nuclease 32P-postlabeling techniqu...

  1. Cyclooctyne [60]fullerene hexakis adducts: a globular scaffold for copper-free click chemistry.


    Ramos-Soriano, Javier; Reina, José J; Pérez-Sánchez, Alfonso; Illescas, Beatriz M; Rojo, Javier; Martín, Nazario


    The synthesis of a new highly symmetric hexakis adduct of C60 appended with 12 cyclooctyne moieties has been carried out. This compound has been used for the copper-free strain-promoted cycloaddition reaction to a series of azides with excellent yields. This strategy for the obtention of clicked adducts of [60]fullerene is of special interest for biological applications. PMID:27492263

  2. 40 CFR 721.3680 - Ethylene oxide adduct of fatty acid ester with pentaerythritol.

    Code of Federal Regulations, 2011 CFR


    ... ester with pentaerythritol. 721.3680 Section 721.3680 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.3680 Ethylene oxide adduct of fatty acid ester with... identified generically as ethylene oxide adduct of fatty acid ester with pentaerythritol (PMN P-91-442)...

  3. 40 CFR 721.3680 - Ethylene oxide adduct of fatty acid ester with pentaerythritol.

    Code of Federal Regulations, 2010 CFR


    ... ester with pentaerythritol. 721.3680 Section 721.3680 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.3680 Ethylene oxide adduct of fatty acid ester with... identified generically as ethylene oxide adduct of fatty acid ester with pentaerythritol (PMN P-91-442)...

  4. Turned head--adducted hip--truncal curvature syndrome.

    PubMed Central

    Hamanishi, C; Tanaka, S


    One hundred and eight neonates and infants who showed the clinical triad of a head turned to one side, adduction contracture of the hip joint on the occipital side of the turned head, and truncal curvature, which we named TAC syndrome, were studied. These cases included seven with congenital and five with late infantile dislocations of the hip joint and 14 who developed muscular torticollis. Forty one were among 7103 neonates examined by one of the authors. An epidemiological analysis confirmed the aetiology of the syndrome to be environmental. The side to which the head was turned and that of the adducted hip contracture showed a high correlation with the side of the maternal spine on which the fetus had been lying. TAC syndrome is an important asymmetrical deformity that should be kept in mind during neonatal examination, and may be aetiologically related to the unilateral dislocation of the hip joint, torticollis, and infantile scoliosis which develop after a vertex presentation. Images PMID:8048823

  5. Spontaneous dehydrocoupling in peri-substituted phosphine-borane adducts.


    Taylor, Laurence J; Surgenor, Brian A; Wawrzyniak, Piotr; Ray, Matthew J; Cordes, David B; Slawin, Alexandra M Z; Kilian, Petr


    Bis(borane) adducts Acenap(PiPr2·BH3)(PRH·BH3) (Acenap = acenaphthene-5,6-diyl; 4a, R = Ph; 4b, R = ferrocenyl, Fc; 4c, R = H) were synthesised by the reaction of excess H3B·SMe2 with either phosphino-phosphonium salts [Acenap(PiPr2)(PR)](+)Cl(-) (1a, R = Ph; 1b, R = Fc), or bis(phosphine) Acenap(PiPr2)(PH2) (3). Bis(borane) adducts 4a-c were found to undergo dihydrogen elimination at room temperature, this spontaneous catalyst-free phosphine-borane dehydrocoupling yields BH2 bridged species Acenap(PiPr2)(μ-BH2)(PR·BH3) (5a, R = Ph; 5b, R = Fc; 5c, R = H). Thermolysis of 5c results in loss of the terminal borane moiety to afford Acenap(PiPr2)(μ-BH2)(PH) (14). Single crystal X-ray structures of 3, 4b and 5a-c are reported. PMID:26314761

  6. Quantitation of 4,4′-methylene diphenyl diisocyanate human serum albumin adducts

    PubMed Central

    Luna, Leah G.; Green, Brett J.; Zhang, Fagen; Arnold, Scott M.; Siegel, Paul D.; Bartels, Michael J.


    4,4′-Methylene diphenyl diisocyanate (herein 4,4′-MDI) is used in the production of polyurethane foams, elastomers, coatings, adhesives and the like for a wide range of commercial products. Occupational exposure to MDI levels above current airborne exposure limits can elicit immune mediated hypersensitivity reactions such as occupational asthma in sensitive individuals. To accurately determine exposure, there has been increasing interest in developing analytical methods to measure internal biomarkers of exposure to MDI. Previous investigators have reported methodologies for measuring MDI diamine metabolites and MDI-Lysine (4,4′-MDI-Lys) adducts. The purpose of this study was to develop and validate an ultra performance liquid chromatography isotope dilution tandem mass spectrometry (UPLC-ID/MS/MS) quantitation method via a signature peptide approach to enable biomonitoring of 4,4′-MDI adducted to human serum albumin (HSA) in plasma. A murine, anti-4,4′-MDI monoclonal IgM antibody was bound to magnetic beads and utilized for enrichment of the MDI adducted HSA. Following enrichment, trypsin digestion was performed to generate the expected 414 site (primary site of adduction) 4,4′-MDI-adducted HSA signature peptide that was quantified by UPLC-ID/MS/MS. An Agilent 6530 UPLC/quadrupole time of flight MS (QTOF) system was utilized for intact adducted protein analysis and an Agilent 6490 UPLC/MS/MS system operated in multiple reaction monitoring (MRM) mode was utilized for quantification of the adducted signature peptide biomarker both for in chemico and worker serum samples. Worker serum samples were initially screened utilizing the previously developed 4,4′-MDI-Lys amino acid method and results showed that 12 samples were identified as quantifiable for 4,4′-MDI-Lys adducts. The signature peptide adduct approach was applied to the 12 worker samples identified as quantifiable for 4,4′-MDI-Lys adducts. Results indicated no positive results were obtained

  7. Liquid chromatography-thermospray mass spectrometry of DNA adducts formed with mitomycin C, porfiromycin and thiotepa.


    Musser, S M; Pan, S S; Callery, P S


    High-performance liquid chromatography (HPLC) and thermospray mass spectrometry were combined for the analysis of DNA adducts formed from the interaction of the anticancer drugs mitomycin C, porfiromycin and thiotepa with calf thymus DNA. The adducts formed from reaction of mitomycin C and porfiromycin with DNA were separated from unmodified nucleosides by HPLC on a C18 column and identified by thermospray mass spectrometry. Thiotepa DNA adducts readily depurinated from DNA and were chromatographed and identified by thermospray liquid chromatography-mass spectrometry as the modified bases without the ribose moiety attached. The utility of thermospray mass spectrometry for the identification of microgram quantities of nucleoside adducts and depurinated base adducts of these anticancer drugs was demonstrated. PMID:2504760

  8. MRN, CtIP, and BRCA1 mediate repair of topoisomerase II–DNA adducts

    PubMed Central

    Aparicio, Tomas; Baer, Richard; Gottesman, Max


    Repair of DNA double-strand breaks (DSBs) with complex ends poses a special challenge, as additional processing is required before DNA ligation. For example, protein–DNA adducts must be removed to allow repair by either nonhomologous end joining or homology-directed repair. Here, we investigated the processing of topoisomerase II (Top2)–DNA adducts induced by treatment with the chemotherapeutic agent etoposide. Through biochemical analysis in Xenopus laevis egg extracts, we establish that the MRN (Mre11, Rad50, and Nbs1) complex, CtIP, and BRCA1 are required for both the removal of Top2–DNA adducts and the subsequent resection of Top2-adducted DSB ends. Moreover, the interaction between CtIP and BRCA1, although dispensable for resection of endonuclease-generated DSB ends, is required for resection of Top2-adducted DSBs, as well as for cellular resistance to etoposide during genomic DNA replication. PMID:26880199

  9. DNA adducts in marine mussel and fresh water fishes living in polluted and unpolluted environments

    SciTech Connect

    Kurelec, B.; Checko, M.; Krca, S.; Garg, A.; Gupta, R.C. Baylor College of Medicine, Houston, TX )


    {sup 32}P-postlabeling analysis of DNA adducts in the digestive gland of marine mussel Mytilus galloprovincialis from polluted and unpolluted sites near Rovinj, Northern Adriatic, revealed that majority of adducts are caused by natural environmental factors rather than by man-made chemicals. The only pollutant-specific adducts were observed in a mussel exposed to seawater experimentally polluted with aminofluorene, and in a population of mussel living at a site heavily polluted with a waste waters of an oil refinery. Fresh water fish species Leuciscus cephalus, Barbus barbus, Abramis brama and Rutilus pigus virgo living in a polluted Sava River, Yugoslavia, or in its unpolluted tributary Korana River, have induced in their livers qualitatively identical and quantitatively similar DNA adducts. These DNA adducts had a species-specific patterns and their appearance was seasonally-dependent.

  10. Tamoxifen Forms DNA Adducts In Human Colon After Administration Of A Single [14C]-Labeled Therapeutic Dose.

    SciTech Connect

    Brown, K; Tompkins, E M; Boocock, D J; Martin, E A; Farmer, P B; Turteltaub, K W; Ubick, E; Hemingway, D; Horner-Glister, E; White, I H


    Tamoxifen is widely prescribed for the treatment of breast cancer and is also licensed in the U.S. for the prevention of this disease. However, tamoxifen therapy is associated with an increased occurrence of endometrial cancer in women and there is also evidence that it may elevate the risk of colorectal cancer. The underlying mechanisms responsible for tamoxifen-induced carcinogenesis in women have not yet been elucidated but much interest has focussed on the role of DNA adduct formation. We investigated the propensity of tamoxifen to bind irreversibly to colorectal DNA when given to ten women as a single [{sup 14}C]-labeled therapeutic (20 mg) dose, {approx}18 h prior to undergoing colon resections. Using the sensitive technique of accelerator mass spectrometry, coupled with HPLC separation of enzymatically digested DNA, a peak corresponding to authentic dG-N{sup 2}-tamoxifen adduct was detected in samples from three patients, at levels ranging from 1-7 adducts/10{sup 9} nucleotides. No [{sup 14}C]-radiolabel associated with tamoxifen or its major metabolites was detected. The presence of detectable CYP3A4 protein in all colon samples suggests this tissue has the potential to activate tamoxifen to {alpha}-hydroxytamoxifen, in addition to that occurring in the systemic circulation, and direct interaction of this metabolite with DNA could account for the binding observed. Although the level of tamoxifeninduced damage displayed a degree of inter-individual variability, when present it was {approx}10-100 times higher than that reported for other suspect human colon carcinogens such as PhIP. These findings provide a mechanistic basis through which tamoxifen could increase the incidence of colon cancers in women.

  11. Enhanced Stability of Blood Matrices Using a Dried Sample Spot Assay to Measure Human Butyrylcholinesterase Activity and Nerve Agent Adducts

    PubMed Central

    Perez, Jonas W.; Pantazides, Brooke G.; Watson, Caroline M.; Thomas, Jerry D.; Blake, Thomas A.; Johnson, Rudolph C.


    Dried matrix spots are safer to handle and easier to store than wet blood products, but factors such as intra-spot variability and unknown sample volumes have limited their appeal as a sampling format for quantitative analyses. In this work, we introduce a dried spot activity assay for quantifying butyrylcholinesterase (BChE) specific activity which is BChE activity normalized to the total protein content in a sample spot. The method was demonstrated with blood, serum, and plasma spotted on specimen collection devices (cards) which were extracted to measure total protein and BChE activity using a modified Ellman assay. Activity recovered from dried spots was ∼80% of the initial spotted activity for blood and >90% for plasma and serum. Measuring total protein in the sample and calculating specific activity substantially improved quantification and reduced intra-spot variability. Analyte stability of nerve agent adducts was also evaluated, and the results obtained via BChE-specific activity measurements were confirmed by quantification of BChE adducts using a previously established LC-MS/MS method. The spotted samples were up to 10-times more resistant to degradation compared to unspotted control samples when measuring BChE inhibition by the nerve agents sarin and VX. Using this method, both BChE activity and adducts can be accurately measured from a dried sample spot. This use of a dried sample spot with normalization to total protein is robust, demonstrates decreased intra-spot variability without the need to control for initial sample volume, and enhances analyte stability. PMID:25955132

  12. /sup 32/P-postlabeling analysis of aromatic DNA adducts in fish from polluted areas

    SciTech Connect

    Dunn, B.P.; Black, J.J.; Maccubbin, A.


    Brown bullheads (Ictalurus nebulosus) were sampled from sites in the Buffalo and Detroit Rivers where fish are exposed to high levels of sediment bound polycyclic aromatic hydrocarbons, and suffer from an elevated frequency of liver cancer. DNA was isolated from the livers of these wild fish and from control specimens which were raised in clean aquariums. DNA was enzymatically digested to normal and adducted nucleotides, and hydrophobic/bulky adducts were enriched in the digests either by preparative reverse-phase high-pressure liquid chromatography, or selective nuclease P1 dephosphorylation of normal nucleotides. Aromatic DNA-carcinogen adducts were then quantitated using /sup 32/P-postlabeling analysis. Using both adduct enrichment procedures, chromatograms derived from DNA of fish from polluted areas showed a diffuse diagonal radioactive zone not present in DNA from aquarium raised fish. The diagonal zone appeared to consist at least in part of multiple overlapping discrete adduct spots which could be partially separated by gradient high-pressure liquid chromatography prior to /sup 32/P-postlabeling analysis, and most of which were more strongly retained on a reverse-phase column than the major benzo(a)pyrene-DNA adduct. The behavior of the adducts in the diagonal radioactive zone and of their unlabeled precursors is consistent with their identification as nucleotide adducts of a variety of bulky hydrophobic aromatic environmental compounds. Total pollution-related adduct levels as analyzed by HPLC adduct enrichment and /sup 32/P-postlabeling were 70.1 +/- 29 (SD) nmol/mol normal nucleotide in fish from the Buffalo River, and 52 and 56 nmol/mol for two specimens from the Detroit River.


    EPA Science Inventory

    The 1-nitropyrene (1-NPP and 3-nitrofluoranthene (3-NF) adducts have been analyzed by (32)P-postlabeling and with 1-NP have been compared to the total number of adducts estimated from (14)C binding in rabbit trachael epithelial (RTE) DNA samples. One adduct spot, by (32)P-postlab...


    EPA Science Inventory

    On Benzo [a] pyrene Derived DNA Adducts Formed in Lung Tissue of Mice
    The previously identified major DNA adducts of benzo[a]pyrene (BP) in vitro and in vivo are the stable and unstable adducts formed by reaction of the bay-region diol epoxide of BP (BPDE) and BP radical catio...


    EPA Science Inventory

    Cyclopenta-fused Polycyclic Aromatic Hydrocarbons in Strain AJJ Mouse Lung: DNA Adducts, Oncogene Mutations, and Tumorigenesis.

    We have examined the relationships between DNA adducts, Ki-ras oncogene mutations, DNA adducts, and adenoma induction in the lungs of strain A/J...

  16. IR spectra and structure of 4-hydroxybenzylidenemalononitrile, its oxyanion, cyanide adduct and adduct-oxyanion: experimental and ab initio studies

    NASA Astrophysics Data System (ADS)

    Velcheva, Evelina A.; Binev, Yuri I.; Petrova, Milena J.


    The structures of 4-hydroxybenzylidenemalononitrile (HO-C 6H 4-CHC(CN) 2, I), its oxyanion ( -O-C 6H 4-CHC(CN) 2, II), cyanide adduct (HO-C 6H 4-CH(CN)-C¯(CN) 2, III) and adduct-oxyanion ( -O-C 6H 4-CH(CN)-C¯(CN) 2, IV) have been studied by means of both quantitative IR spectra and ab initio force field calculations. The conversion of ( I) into the anionic species causes strong changes in the IR spectra: decreases in the ν CN frequency down to 110 cm -1, up to 7-fold increases in the ACN intensity, up to 58 cm -1 ν CN splitting, etc. The charge analysis shows that the intramolecular charge transfer between the electronegative [C(CN) 2] and electropositive fragments of ( I) is 0.34 e -. Nearly 0.6 e - of the oxyanionic charge of ( II) remains within the oxyphenylene fragment and nearly 0.5 e - of the carbanionic charge of ( III) delocalizes within the dicyanomethide fragment. The two charges in ( IV) are spread over the whole species.

  17. Acetaminophen-induced liver injury in rats and mice: Comparison of protein adducts, mitochondrial dysfunction, and oxidative stress in the mechanism of toxicity

    SciTech Connect

    McGill, Mitchell R.; Williams, C. David; Xie, Yuchao; Ramachandran, Anup; Jaeschke, Hartmut


    Acetaminophen (APAP) overdose is the most common cause of acute liver failure in the West. In mice, APAP hepatotoxicity can be rapidly induced with a single dose. Because it is both clinically relevant and experimentally convenient, APAP intoxication has become a popular model of liver injury. Early data demonstrated that rats are resistant to APAP toxicity. As a result, mice are the preferred species for mechanistic studies. Furthermore, recent work has shown that the mechanisms of APAP toxicity in humans are similar to mice. Nevertheless, some investigators still use rats. New mechanistic information from the last forty years invites a reevaluation of the differences between these species. Comparison may provide interesting insights and confirm or exclude the rat as an option for APAP studies. To this end, we treated rats and mice with APAP and measured parameters of liver injury, APAP metabolism, oxidative stress, and activation of the c-Jun N-terminal kinase (JNK). Consistent with earlier data, we found that rats were highly resistant to APAP toxicity. Although overall APAP metabolism was similar in both species, mitochondrial protein adducts were significantly lower in rats. Accordingly, rats also had less oxidative stress. Finally, while mice showed extensive activation and mitochondrial translocation of JNK, this could not be detected in rat livers. These data support the hypothesis that mitochondrial dysfunction is critical for the development of necrosis after APAP treatment. Because mitochondrial damage also occurs in humans, rats are not a clinically relevant species for studies of APAP hepatotoxicity. Highlights: ► Acetaminophen overdose causes severe liver injury only in mice but not in rats. ► APAP causes hepatic GSH depletion and protein adduct formation in rats and mice. ► Less protein adducts were measured in rat liver mitochondria compared to mouse. ► No oxidant stress, peroxynitrite formation or JNK activation was present in rats. ► The

  18. DNA adducts in human placenta as related to air pollution and to GSTM1 genotype.


    Topinka, J; Binková, B; Mracková, G; Stávková, Z; Benes, I; Dejmek, J; Lenícek, J; Srám, R J


    DNA adducts in human placenta have been studied in relation to metabolic genotype for glutathione S-transferase M1 (GSTM1) in 98 mothers living in two regions with a different annual average air pollution levels: Northern Bohemia-the district of Teplice as polluted industrial area (mines, brown coal power plants) and Southern Bohemia-the district of Prachatice as agricultural area without heavy industry. Forty-nine placenta samples (25 from the Teplice district and 24 from the Prachatice district) from non-smoking mothers with the date of delivery in the summer period and 49 placenta samples (25 from the Teplice district and 24 from Prachatice district) from mothers with the date of delivery in the winter period were analysed. The total DNA adduct levels were calculated as the sum of adducts in the diagnoal radioactive zone (DRZ) and one distinct spot outside of the DRZ (termed X), which was detected in almost all placenta samples. We found total DNA adduct levels of 1.40 +/- 0.87 (0.04-3.65) and 1.04 +/- 0.63 (0.11-3.08) adducts per 10(8) nucleotides for the Teplice and Prachatice districts, respectively. The significant difference between both districts in placental DNA adduct levels was found for the winter sampling period only (1.49 vs. 0.96 adducts per 10(8) nucleotides; p = 0.023). No seasonal variation was observed for DNA adduct levels in the overall population studied. A positive GSTM1 genotype was detected in 51 subjects, while GSTM1-null genotype was found in 47 subjects. Higher DNA adduct levels were detected in a group with GSTM1-null genotype (p = 0.009). This finding seems more significant for subjects in the Teplice district (p = 0.047) than for those in the Prachatice district (p = 0.092). Significant district and seasonal differences were found in subgroups carrying the GSTM1-null genotype. DNA adduct levels in placentas of mothers with GSTM1-null genotype living in the polluted district of Teplice were higher than those in Prachatice (p = 0

  19. In vitro and in vivo temperature modulation of hepatic metabolism and DNA adduction of aflatoxin B1 in rainbow trout.


    Carpenter, H M; Zhang, Q; el Zahr, C; Selivonchick, D P; Brock, D E; Curtis, L R


    Alterations in membrane lipid composition during temperature acclimation of poikilotherms is hypothesized to compensate for direct effects of temperature on membrane fluidity. Temperature also influences disposition and actions of some xenobiotics. This suggests the potential for complex interactions between temperature and metabolism of chemical carcinogens. Whole livers and hepatic microsomes from rainbow trout acclimated at 18 degrees C have more saturated fatty acids and less mono- and polyunsaturated fatty acids than those from fish acclimated at 10 degrees C. Such changes are consistent with a role for membrane lipid fluidity in temperature compensation. When 10 and 18 degrees C acclimated fish are ip injected with 0.4 mg/kg [3H]aflatoxin B1 (AFB1) at their respective acclimation temperatures, hepatic disposition of AFB1, DNA adduction, and biliary metabolites are similar. An acute shift of 18 degrees C acclimated trout to 14 degrees C reduces [3H]AFB-DNA adduct formation, while [3H]AFB1 adduction after acute shift of 10 degrees C acclimated fish to 14 degrees C is no different than in non-shifted fish. Hepatic microsomes isolated from 10 or 18 degrees C acclimated trout, incubated with 10 microM [3H]AFB1 and calf thymus DNA between 6 and 22 degrees C exhibit no differences in the "break points" of Arrhenius plots (16 degrees C in both groups). There is, however, more in vitro DNA adduction of [3H]AFB1 by microsomes from 18 degrees C acclimated fish, a difference abolished by 0.5 mM alpha-naphthoflavone (ANF). These results suggest that temperature acclimation of trout differentially modifies activities of cytochrome P-450 isozymes. When assayed at respective acclimation temperatures, hepatic cytosol from 18 degrees C fish produces more aflatoxicol, a detoxication product of AFB1, than cytosol from 10 degree C fish. Therefore, this soluble enzyme does not exhibit ideal temperature compensation. Such temperature-induced differences in microsomal cytochrome P

  20. Preparation and Characterization of Cysteine Adducts of Deoxynivalenol.


    Stanic, Ana; Uhlig, Silvio; Solhaug, Anita; Rise, Frode; Wilkins, Alistair L; Miles, Christopher O


    Conjugation with the biologically relevant thiol glutathione is one of the metabolic pathways for the mycotoxin deoxynivalenol (DON) in wheat. The occurrence of putative DON-cysteine conjugates has also been shown in wheat, likely in part as a result of degradation of the glutathione conjugates. It was reported that thiols react in vitro with DON at two positions: reversibly at C-10 of the α,β-unsaturated ketone and irreversibly at C-13 of the epoxy group. We synthesized pure DON-cysteine adducts and made analytical standards using quantitative NMR experiments. Compounds were characterized using NMR and LC-HRMS/MS and tested in vitro for toxicity. Cysteine conjugates were much less toxic than DON at the same concentration, and LC-HRMS analysis demonstrated that there was no detectable metabolism of the conjugates in human monocytes or human macrophages. PMID:27229448

  1. Vitamin A-aldehyde adducts: AMD risk and targeted therapeutics.


    Sparrow, Janet R


    Although currently available treatment options for age-related macular degeneration (AMD) are limited, particularly for atrophic AMD, the identification of predisposing genetic variations has informed clinical studies addressing therapeutic options such as complement inhibitors and anti-inflammatory agents. To lower risk of early AMD, recommended lifestyle interventions such as the avoidance of smoking and the intake of low glycemic antioxidant-rich diets have largely followed from the identification of nongenetic modifiable factors. On the other hand, the challenge of understanding the complex relationship between aging and cumulative damage leading to AMD has fueled investigations of the visual cycle adducts that accumulate in retinal pigment epithelial (RPE) cells and are a hallmark of aging retina. These studies have revealed properties of these compounds that provide insights into processes that may compromise RPE and could contribute to disease mechanisms in AMD. This work has also led to the design of targeted therapeutics that are currently under investigation. PMID:27071115

  2. Non Covalent Interactions and Internal Dynamics in Adducts of Freons

    NASA Astrophysics Data System (ADS)

    Caminati, Walther; Gou, Qian; Evangelisti, Luca; Feng, Gang; Spada, Lorenzo; Vallejo-López, Montserrat; Lesarri, Alberto; Cocinero, Emilio J.


    The complexation of chlorofluorocarbons (CFCs) with atmospheric water and pollutants of the atmosphere affects their reactivity and it seems to accelerate, for example, the decomposition rate of freons in the atmosphere [1]. For this reason we characterized shapes, stabilities, nature of the non-covalent interactions, structures and internal dynamics of a number of complexes of CFCs with water and of their dimers or oligomers by rotational spectroscopy. It has been found that hydrogenated CFCs form adducts with other molecules through weak hydrogen bonds (WHBs). Their C-H groups can act as proton donors, enhanced by the electron withdrawing of the halogen atoms, interacting with the electron rich regions of the partner molecules [2]. Also in adducts or oligomers of hydrogenated CFCs the monomer units are held together by nets of WHBs [3]. When CFCs are perhalogenated, the positive electrostatic region ("σ-hole") can interact electrostatically with negative sites of another, or of the same molecular entity, giving rise, according to IUPAC, to the so called halogen bond (HaB). However, it has been observed that when the perhalogenated CFCs has a Π electron system, a lone pair•••Π interaction (Bürgi-Dunitz) is favoured [4]. We describe here the HaBs that CF4 and CF3Cl form with a variety of partner molecules such as water, ammonia, dimethyl ether, etc. Important spectroscopic features outline strong dynamics effects taking place in this kind of complex. References [1] V. Vaida, H. G. Kjaergaard, K. J. Feierabend, Int. Rev. Phys. Chem. 22 (2003) 203. [2] See, for example: W. Caminati, S. Melandri, A. Maris, P. Ottaviani, Angew. Chem. Int. Ed. 45 (2006) 2438. [3] G. Feng, L. Evangelisti, I. Cacelli, L. Carbonaro, G. Prampolini, W. Caminati, Chem. Commun. 50 (2014) 171. [4] Q. Gou, G. Feng, L. Evangelisti, W. Caminati, Angew. Chem. Int. Ed. 52 (2013) 52 11888.

  3. Synthesis and mutagenesis of the butadiene-derived N3 2'-deoxyuridine adducts.


    Fernandes, Priscilla H; Hackfeld, Linda C; Kozekov, Ivan D; Hodge, Richard P; Lloyd, R Stephen


    1,3-Butadiene is a known carcinogen and mutagen that acts through a variety of metabolic intermediates that react with DNA, forming stable and unstable lesions on dG, dA, dC, and dT. The N3 2'-deoxyuridine adducts are a highly stable, stereoisomeric mixture of adducts derived from the reaction of cytosine with the monoepoxide metabolite of butadiene, followed by spontaneous deamination. In this study, the phosphoramidites and subsequent oligodeoxynucleotides containing the N3 2'-deoxyuridine adducts have been constructed and characterized. Using a single-stranded shuttle vector DNA, the mutagenic potential of these adducts has been tested following replication in mammalian cells. Replication past the N3 2'-deoxyuridine adducts was found to be highly mutagenic with an overall mutation yield of approximately 97%. The major mutations that were observed were C to T transitions and C to A transversions. In vitro, these adducts posed a complete block to both the Klenow fragment of Escherichia coli polymerase I and polymerase epsilon, while these lesions significantly blocked polymerase delta. These data suggested a possible involvement of bypass polymerases in the in vivo replication of these lesions. Overall, these findings indicate that the N3 2'-deoxyuridine adducts are highly mutagenic lesions that may contribute to butadiene-mediated carcinogenesis. PMID:16841966

  4. Conformational Properties of Equilenin-DNA Adducts: Stereoisomer and Base Effects

    PubMed Central

    Ding, Shuang; Shapiro, Robert; Cai, Yuqin; Geacintov, Nicholas E.; Broyde, Suse


    Equilin and equilenin, components of the hormone replacement therapy drug Premarin, can be metabolized to the catechol 4-hydroxyequilenin (4-OHEN). The quinoids produced by 4-OHEN oxidation react with dC, dA and dG to form unusual stable cyclic adducts, which have been found in human breast tumor tissue. Four stereoisomeric adducts have been identified for each base. These twelve Premarin-derived adducts provide a unique opportunity for analyzing effects of stereochemistry and base damage on DNA structure, and consequently its function. Our computational studies have shown that these adducts, with obstructed Watson-Crick hydrogen bond edges and near-perpendicular ring systems, have limited conformational flexibility, and near-mirror image conformations in stereoisomer pairs. The dC and dA adducts can adopt major and minor groove positions in the double helix, but the dG adducts are positioned only in the major groove. In all cases, opposite orientations of the equilenin rings with respect to the 5'→3' direction of the damaged strand are found in stereoisomer pairs derived from the same base, and no Watson-Crick pairing is possible. However, detailed structural properties in DNA duplexes are distinct for each stereoisomer of each damaged base. These differences may underlie observed differential stereoisomer and base-dependent mutagenicities and repair susceptibilities of these adducts. PMID:18416538

  5. A mathematical model for intracellular effects of toxins on DNA adduction and repair

    SciTech Connect

    Gaver, D.P.; Jacobs, P.A.; Carpenter, R.L.; Burkhart, J.G.


    The processes by which certain classes of toxic compounds or their metabolites may react with DNA to alter the genetic information contained in subsequent generations of cells or organisms are a major component of hazard associated with exposure to chemicals in the environment. Many classes of chemicals may form DNA adducts and there may or may not be a defined mechanism to remove a particular adduct from DNA independent of replication. Many compounds and metabolites that bind DNA also readily bind existing proteins; some classes of toxins and DNA adducts have the capacity to inactive a repair enzyme and divert the repair process competitively. This paper formulates an intracellular dynamic model for one aspect of the action of toxins that form DNA adducts, recognizing a capacity for removal of those adducts by a repair enzyme combined with reaction of the toxin and/or the DNA adduct to inactive the repair enzyme. This particular model illustrates the possible saturation of repair enzyme capacity by the toxin dosage and shows that bistable behavior can occur, with the potential to induce abrupt shifts away from steady-state equilibria. The model suggests that bistable behavior, dose and variation between individuals or tissues may combine under certain conditions to amplify the biological effect of dose observed as DNA adduction and its consequences as mutation. A model recognizing stochastic phenomena also indicates that variation in within-cell toxin concentration may promote jumps between stable equilibria.

  6. Metabolic Activation of the Antibacterial Agent Triclocarban by Cytochrome P450 1A1 Yielding Glutathione Adducts

    PubMed Central

    Muvvala, Jaya B.; Morin, Dexter; Buckpitt, Alan R.; Hammock, Bruce D.; Rice, Robert H.


    Triclocarban (3,4,4′-trichlorocarbanilide; TCC) is an antibacterial agent used in personal care products such as bar soaps. Small amounts of chemical are absorbed through the epidermis. Recent studies show that residues of reactive TCC metabolites are bound covalently to proteins in incubations with keratinocytes, raising concerns about the potential toxicity of this antimicrobial agent. To obtain additional information on metabolic activation of TCC, this study characterized the reactive metabolites trapped as glutathione conjugates. Incubations were carried out with 14C-labeled TCC, recombinant CYP1A1 or CYP1B1, coexpressed with cytochrome P450 reductase, glutathione-S-transferases (GSH), and an NADPH-generating system. Incubations containing CYP1A1, but not 1B1, led to formation of a single TCC-GSH adduct with a conversion rate of 1% of parent compound in 2 hours. Using high-resolution mass spectrometry and diagnostic fragmentation, the adduct was tentatively identified as 3,4-dichloro-3′-glutathionyl-4′-hydroxycarbanilide. These findings support the hypothesis that TCC is activated by oxidative dehalogenation and oxidation to a quinone imine. Incubations of TCDD-induced keratinocytes with 14C-TCC yielded a minor radioactive peak coeluting with TCC-GSH. Thus, we conclude that covalent protein modification by TCC in TCDD-induced human keratinocyte incubations is mainly caused by activation of TCC by CYP1A1 via a dehalogenated TCC derivative as reactive species. PMID:24733789

  7. Metabolic activation of the antibacterial agent triclocarban by cytochrome P450 1A1 yielding glutathione adducts.


    Schebb, Nils Helge; Muvvala, Jaya B; Morin, Dexter; Buckpitt, Alan R; Hammock, Bruce D; Rice, Robert H


    Triclocarban (3,4,4'-trichlorocarbanilide; TCC) is an antibacterial agent used in personal care products such as bar soaps. Small amounts of chemical are absorbed through the epidermis. Recent studies show that residues of reactive TCC metabolites are bound covalently to proteins in incubations with keratinocytes, raising concerns about the potential toxicity of this antimicrobial agent. To obtain additional information on metabolic activation of TCC, this study characterized the reactive metabolites trapped as glutathione conjugates. Incubations were carried out with (14)C-labeled TCC, recombinant CYP1A1 or CYP1B1, coexpressed with cytochrome P450 reductase, glutathione-S-transferases (GSH), and an NADPH-generating system. Incubations containing CYP1A1, but not 1B1, led to formation of a single TCC-GSH adduct with a conversion rate of 1% of parent compound in 2 hours. Using high-resolution mass spectrometry and diagnostic fragmentation, the adduct was tentatively identified as 3,4-dichloro-3'-glutathionyl-4'-hydroxycarbanilide. These findings support the hypothesis that TCC is activated by oxidative dehalogenation and oxidation to a quinone imine. Incubations of TCDD-induced keratinocytes with (14)C-TCC yielded a minor radioactive peak coeluting with TCC-GSH. Thus, we conclude that covalent protein modification by TCC in TCDD-induced human keratinocyte incubations is mainly caused by activation of TCC by CYP1A1 via a dehalogenated TCC derivative as reactive species. PMID:24733789

  8. Tylosin detection in animal feed by liquid chromatography-tandem mass spectrometry with enzymatic hydrolysis of the tylosin urea adduct.


    Van Poucke, Christof; Dumoulin, Fréderic; De Keyser, Kirsten; Elliott, Chris; Van Peteghem, Carlos


    When the use of tylosin as a feed additive was forbidden by Council Regulation 2821/98, the necessity of a chemical confirmation method for the monitoring of the ban was created. Recently a method was developed for the detection of tylosin in animal feed by means of LC-MS/MS. During the validation high deviating values for the decision limit, detection capability, and repeatability for tylosin in cattle feed were observed, and the presence of urea and the formation of a tylosin urea adduct (TUA) were suggested as possible explanations. In this study two hydrolysis approaches for the TUA adduct were compared, namely, a chemical hydrolysis and an enzymatic hydrolysis with urease. The latter yielded a more complete hydrolysis of urea and was used for further validation. The recovery increased by approximately 15-25% depending on the amount of urea present in the feed (0.5-2%). The decision limit and detection capability were hardly influenced by the enzymatic hydrolysis. PMID:15137817

  9. 32P analysis of DNA adducts in tissues of benzene-treated rats.


    Reddy, M V; Blackburn, G R; Schreiner, C A; Mehlman, M A; Mackerer, C R


    Solid tumors have been reported in the Zymbal gland, oral and nasal cavities, liver, and mammary gland of Sprague-Dawley rats following chronic, high-dose administration of benzene. The carcinogenic activity of benzene is thought to be caused by activation to toxic metabolites that can interact with DNA, forming covalent adducts. A nuclease P1-enhanced 32P-postlabeling assay, having a sensitivity limit of 1 adduct in 10(9-10) DNA nucleotides, was found suitable for measuring aromatic DNA adducts derived in vitro from catechol, benzenetriol (BT), phenol, hydroquinone (HQ), and benzoquinone (BQ), potential metabolites of benzene. When DNA specimens isolated from tissues of female Sprague-Dawley rats at 24 hr after an oral gavage dose of 200 to 500 mg/kg, 5 days/week, in olive oil (3 mL/kg) for 1 day, 1 week, 5 weeks, and 10 weeks were analyzed by the 32P-postlabeling procedure, no aromatic adducts were detected unequivocally with DNA samples of liver, kidney, bone marrow, and mammary gland. With Zymbal gland DNA, three weak spots at levels totaling four lesions per 10(9) DNA nucleotides were seen only after 10 weeks of treatment, and these adducts did not correspond chromatographically to major adducts in vitro from the above specified compounds. Consequently, this finding requires confirmatory experiments. This distinct adduct pattern may relate to tumor induction in this organ following benzene administration. Our results also indicate that DNA adducts derived from catechol, BT, phenol, HQ, and BQ are either not formed in vivo with benzene or formed at levels below the detection limit of 1 adduct per 10(9-10) DNA nucleotides. PMID:2792046

  10. 32P analysis of DNA adducts in tissues of benzene-treated rats.

    PubMed Central

    Reddy, M V; Blackburn, G R; Schreiner, C A; Mehlman, M A; Mackerer, C R


    Solid tumors have been reported in the Zymbal gland, oral and nasal cavities, liver, and mammary gland of Sprague-Dawley rats following chronic, high-dose administration of benzene. The carcinogenic activity of benzene is thought to be caused by activation to toxic metabolites that can interact with DNA, forming covalent adducts. A nuclease P1-enhanced 32P-postlabeling assay, having a sensitivity limit of 1 adduct in 10(9-10) DNA nucleotides, was found suitable for measuring aromatic DNA adducts derived in vitro from catechol, benzenetriol (BT), phenol, hydroquinone (HQ), and benzoquinone (BQ), potential metabolites of benzene. When DNA specimens isolated from tissues of female Sprague-Dawley rats at 24 hr after an oral gavage dose of 200 to 500 mg/kg, 5 days/week, in olive oil (3 mL/kg) for 1 day, 1 week, 5 weeks, and 10 weeks were analyzed by the 32P-postlabeling procedure, no aromatic adducts were detected unequivocally with DNA samples of liver, kidney, bone marrow, and mammary gland. With Zymbal gland DNA, three weak spots at levels totaling four lesions per 10(9) DNA nucleotides were seen only after 10 weeks of treatment, and these adducts did not correspond chromatographically to major adducts in vitro from the above specified compounds. Consequently, this finding requires confirmatory experiments. This distinct adduct pattern may relate to tumor induction in this organ following benzene administration. Our results also indicate that DNA adducts derived from catechol, BT, phenol, HQ, and BQ are either not formed in vivo with benzene or formed at levels below the detection limit of 1 adduct per 10(9-10) DNA nucleotides. Images FIGURE 1. FIGURE 2. FIGURE 3. PMID:2792046

  11. Polycyclic aromatic hydrocarbon-DNA adducts and survival among women with breast cancer

    SciTech Connect

    Sagiv, Sharon K. Gaudet, Mia M.; Eng, Sybil M.; Abrahamson, Page E.; Shantakumar, Sumitra; Teitelbaum, Susan L.; Bell, Paula; Thomas, Joyce A.; Neugut, Alfred I.; Santella, Regina M.; Gammon, Marilie D.


    Polycyclic aromatic hydrocarbons (PAH) are mammary carcinogens in animal studies, and a few epidemiologic studies have suggested a link between elevated levels of PAH-DNA adducts and breast cancer incidence. An association between PAH-DNA adducts and survival among breast cancer cases has not been previously reported. We conducted a survival analysis among women with newly diagnosed invasive breast cancer between 1996 and 1997, enrolled in the Long Island Breast Cancer Study Project. DNA was isolated from blood samples that were obtained from cases shortly after diagnosis and assayed for PAH-DNA adducts using ELISA. Among the 722 cases with PAH-DNA adduct measurements, 97 deaths (13.4%) from all causes and 54 deaths (7.5%) due to breast cancer were reported to National Death Index (NDI) by December 31, 2002. Using Cox proportional hazards models and controlling for age at diagnosis, we did not find evidence that all-cause mortality (hazard ratio (HR)=0.88; 95% confidence interval (CI): 0.57-1.37), or breast cancer mortality (HR=1.20; 95% CI: 0.63-2.28) was strongly associated with detectable PAH-DNA adduct levels compared with non-detectable adducts; additionally, no dose-response association was observed. Among a subgroup with treatment data (n=520), adducts were associated with over a two-fold higher mortality among those receiving radiation, but mortality for adducts was reduced among hormone therapy users. Results from this large population-based study do not provide strong support for an association between detectable PAH-DNA adducts and survival among women with breast cancer, except perhaps among those receiving radiation treatment.

  12. Determinants of 4-aminobiphenyl-DNA adducts in bladder cancer biopsies.


    Airoldi, Luisa; Orsi, Federica; Magagnotti, Cinzia; Coda, Renato; Randone, Donato; Casetta, Giovanni; Peluso, Marco; Hautefeuille, Agnes; Malaveille, Christian; Vineis, Paolo


    Exposure to 4-aminobiphenyl (4-ABP) is an important determinant of urinary bladder cancer in humans. We have analyzed by gas chromatography-mass spectrometry the DNA adducts of 4-ABP in 75 bladder cancer biopsies. The purpose was to understand whether smoking, N-acetyltransferase 2 (NAT2) polymorphism, diet or tumor grade were determinants of 4-ABP-DNA levels. 4-ABP-DNA adducts were above the detection limit of 0.1 fmol/microg DNA for 37/75 patients. Overall the level of adducts was 2.7 +/- 0.7 (mean +/- SE) fmol/microg DNA (86 +/- 22 adducts/10(8) normal nucleotides, mean +/- SE). A strong association with grade was observed. In the group of patients with detectable 4-ABP-DNA adducts the odds ratio for having a tumor grade of 2 or 3 was respectively 4.3 (95% CI 0.8-21.9) and 6 (1.3-27.5), compared with grade 1. A non-statistically significant association was found between adduct levels and the deduced slow acetylator phenotype in grades 2 and 3. The intake of fruit and vegetables produced a lower frequency of detectable adducts, though the association was not statistically significant. Detectable 4-ABP-DNA adducts were clearly associated with current smoking in higher tumor grades (grade 3 versus grades 1 + 2, odds ratios 10.4; 95% CI 1.7-63.1). Overall, our findings indicate that higher levels of DNA adducts characterize more invasive tumors (higher tumor grades). This seems to be facilitated by smoking and contrasted by the intake of fruit and vegetables. PMID:12016161

  13. Base-Displaced Intercalated Structure of the N-(2'-Deoxyguanosin-8-yl)-3-aminobenzanthrone DNA Adduct.


    Politica, Dustin A; Malik, Chanchal K; Basu, Ashis K; Stone, Michael P


    3-Nitrobenzanthrone (3-NBA), an environmental mutagen found in diesel exhaust and a suspected carcinogen, undergoes metabolic reduction followed by reaction with DNA to form aminobenzanthrone (ABA) adducts, with the major alkylation product being N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone (C8-dG-ABA). Site-specific synthesis of the C8-dG-ABA adduct in the oligodeoxynucleotide 5'-d(GTGCXTGTTTGT)-3':5'-d(ACAAACACGCAC)-3'; X = C8-dG-ABA adduct, including codons 272-275 of the p53 gene, has allowed for investigation into the structural and thermodynamic properties of this adduct. The conformation of the C8-dG-ABA adduct was determined using NMR spectroscopy and was refined using molecular dynamics (MD) calculations restrained by experimentally determined interproton distance restraints obtained from NOE experiments. The refined structure revealed that the C8-dG-ABA adduct formed a base-displaced intercalated conformation. The adducted guanine was shifted into the syn conformation about the glycosidic bond. The 5'- and 3'-neighboring base pairs remained intact. While this facilitated π-stacking interactions between the ABA moiety and neighboring bases, the thermal melting temperature (Tm) of the adduct-containing duplex showed a decrease of 11 °C as compared to the corresponding unmodified oligodeoxynucleotide duplex. Overall, in this sequence, the base-displaced intercalated conformation of the C8-dG-ABA lesion bears similarity to structures of other arylamine C8-dG adducts. However, in this sequence, the base-displaced intercalated conformation for the C8-dG-ABA adduct differs from the conformation of the N(2)-dG-ABA adduct reported by de los Santos and co-workers, in which it is oriented in the minor groove toward the 5' end of the duplex, with the modified guanine remaining in the anti conformation about the glyosidic torsion angle, and the complementary base remaining within the duplex. The results are discussed in relationship to differences between the C8-d

  14. The role of polycyclic aromatic hydrocarbon-DNA adducts in inducing mutations in mouse skin

    PubMed Central

    Chakravarti, Dhrubajyoti; Venugopal, Divya; Mailander, Paula C.; Meza, Jane L.; Higginbotham, Sheila; Cavalieri, Ercole L.; Rogan, Eleanor G.


    Polycyclic aromatic hydrocarbons (PAH) form stable and depurinating DNA adducts in mouse skin to induce preneoplastic mutations. Some mutations transform cells, which then clonally expand to establish tumors. Strong clues about the mutagenic mechanism can be obtained if the PAH-DNA adducts can be correlated with both preneoplastic and tumor mutations. To this end, we studied mutagenesis in PAH-treated early preneoplastic skin (1 day after exposure) and in the induced papillomas in SENCAR mice. Papillomas were studied by PCR amplification of the H-ras gene and sequencing. For benzo[a]pyrene (BP), BP-7,8-dihydrodiol (BPDHD), 7,12-dimethylbenz[a]anthracene (DMBA) and dibenzo[a,l]pyrene (DB[a,l]P), the codon 13 (GGC to GTC) and codon 61 (CAA to CTA) mutations in papillomas corresponded to the relative levels of Gua and Ade-depurinating adducts, despite BP and BPDHD forming significant amounts of stable DNA adducts. Such a relationship was expected for DMBA and DB[a,l]P, as they formed primarily depurinating adducts. These results suggest that depurinating adducts play a major role in forming the tumorigenic mutations. To validate this correlation, preneoplastic skin mutations were studied by cloning H-ras PCR products and sequencing individual clones. DMBA- and DB[a,l]P-treated skin showed primarily A.T to G.C mutations, which correlated with the high ratio of the Ade/Gua-depurinating adducts. Incubation of skin DNA with T.G-DNA glycosylase eliminated most of these A.T to G.C mutations, indicating that they existed as G.T heteroduplexes, as would be expected if they were formed by errors in the repair of abasic sites generated by the depurinating adducts. BP and its metabolites induced mainly G.C to T.A mutations in preneoplastic skin. However, PCR over unrepaired anti-BPDE-N2dG adducts can generate similar mutations as artifacts of the study protocol, making it difficult to establish an adduct-mutation correlation for determining which BP-DNA adducts induce the early

  15. Effects of Black Raspberry Extract and Protocatechuic Acid on Carcinogen-DNA Adducts and Mutagenesis, and Oxidative Stress in Rat and Human Oral Cells.


    Guttenplan, Joseph B; Chen, Kun-Ming; Sun, Yuan-Wan; Kosinska, Wieslawa; Zhou, Ying; Kim, Seungjin Agatha; Sung, Youngjae; Gowda, Krishne; Amin, Shantu; Stoner, Gary D; El-Bayoumy, Karam


    Effects of black raspberry (BRB) extract and protocatechuic acid (PCA) on DNA adduct formation and mutagenesis induced by metabolites of dibenzo[a,l]pyrene (DBP) were investigated in rat oral fibroblasts. The DBP metabolites, (±)-anti-11,12-dihydroxy-11,12,-dihydrodibenzo[a,l]pyrene (DBP-diol) and 11,12-dihydroxy-13,14-epoxy-11,12,13,14-tetrahydrodibenzo[a,l]pyrene (DBPDE) induced dose-dependent DNA adducts and mutations. DBPDE was considerably more potent, whereas the parent compound had no significant effect. Treatment with BRB extract (BRBE) and PCA resulted in reduced DBP-derived DNA adduct levels and reduced mutagenesis induced by DBP-diol, but only BRBE was similarly effective against (DBPDE). BRBE did not directly inactivate DBPDE, but rather induced a cellular response-enhanced DNA repair. When BRBE was added to cells 1 day after the DBP-diol, the BRBE greatly enhanced removal of DBP-derived DNA adducts. As oxidative stress can contribute to several stages of carcinogenesis, BRBE and PCA were investigated for their abilities to reduce oxidative stress in a human leukoplakia cell line by monitoring the redox indicator, 2',7'-dichlorodihydrofluorescein diacetate (H2DCF) in cellular and acellular systems. BRBE effectively inhibited the oxidation, but PCA was only minimally effective against H2DCF. These results taken together provide evidence that BRBE and PCA can inhibit initiation of carcinogenesis by polycyclic aromatic hydrocarbons; and in addition, BRBE reduces oxidative stress. Cancer Prev Res; 9(8); 704-12. ©2016 AACR. PMID:27267891

  16. Oligomerization and Membrane-binding Properties of Covalent Adducts Formed by the Interaction of α-Synuclein with the Toxic Dopamine Metabolite 3,4-Dihydroxyphenylacetaldehyde (DOPAL).


    Follmer, Cristian; Coelho-Cerqueira, Eduardo; Yatabe-Franco, Danilo Y; Araujo, Gabriel D T; Pinheiro, Anderson S; Domont, Gilberto B; Eliezer, David


    Oxidative deamination of dopamine produces the highly toxic aldehyde 3,4-dihydroxyphenylacetaldehyde (DOPAL), enhanced production of which is found in post-mortem brains of Parkinson disease patients. When injected into the substantia nigra of rat brains, DOPAL causes the loss of dopaminergic neurons accompanied by the accumulation of potentially toxic oligomers of the presynaptic protein α-synuclein (aS), potentially explaining the synergistic toxicity described for dopamine metabolism and aS aggregation. In this work, we demonstrate that DOPAL interacts with aS via formation of Schiff-base and Michael-addition adducts with Lys residues, in addition to causing oxidation of Met residues to Met-sulfoxide. DOPAL modification leads to the formation of small aS oligomers that may be cross-linked by DOPAL. Both monomeric and oligomeric DOPAL adducts potently inhibit the formation of mature amyloid fibrils by unmodified aS. The binding of aS to either lipid vesicles or detergent micelles, which results in a gain of α-helix structure in its N-terminal lipid-binding domain, protects the protein against DOPAL adduct formation and, consequently, inhibits DOPAL-induced aS oligomerization. Functionally, aS-DOPAL monomer exhibits a reduced affinity for small unilamellar vesicles with lipid composition similar to synaptic vesicles, in addition to diminished membrane-induced α-helical content in comparison with the unmodified protein. These results suggest that DOPAL could compromise the functionality of aS, even in the absence of protein oligomerization, by affecting the interaction of aS with lipid membranes and hence its role in the regulation of synaptic vesicle traffic in neurons. PMID:26381411

  17. Evidence for covalent lipoyl adduction with dopaquinone following tyrosinase-catalyzed oxidation.


    Tsuji-Naito, Kentaro; Hatani, Tomoko; Okada, Takeshi; Tehara, Takao


    Previous studies have examined the conjugation of sulfhydryl compounds such as L-cysteine and glutathione with DOPA-quinone following the oxidation of tyrosine and DOPA by tyrosinase. These covalent reactions play a key role in the regulation and metabolism of pigment cells. We report on the first direct evidence for the formation of lipoyl adducts in reactions of thiol groups with DOPA-quinone in dihydrolipoic acid (6,8-dimercaptooctanoic acid [DHLA]). Incubating DHLA with DOPA-quinone followed by tyrosinase-catalyzed oxidation resulted in the three products predicted by HPLC-UV and LC-ESI(-)-MS analyses for DHLA DOPA conjugates. In the current study, we identified 5-S-lipoyl-DOPA among the principal products isolated by HPLC and characterized by FAB(-)-MS, ESI(-)-MS/MS, and 1H NMR, 2D-COSY studies. Collectively, these results suggest that DHLA undergoes sulfhydryl conjugation with DOPA-quinone, pointing to the involvement of thiol-reactive metabolites. PMID:16527255

  18. Integrating S-phase Checkpoint Signaling with Trans-Lesion Synthesis of Bulky DNA Adducts

    PubMed Central

    Barkley, Laura R.; Ohmori, Haruo; Vaziri, Cyrus


    Bulky adducts are DNA lesions generated in response to environmental agents including benzo[a]pyrene (a combustion product) and solar ultraviolet radiation. Error-prone replication of adducted DNA can cause mutations, which may result in cancer. To minimize the detrimental effects of bulky adducts and other DNA lesions, S-phase checkpoint mechanisms sense DNA damage and integrate DNA repair with ongoing DNA replication. The essential protein kinase Chk1 mediates the S-phase checkpoint, inhibiting initiation of new DNA synthesis and promoting stabilization and recovery of stalled replication forks. Here we review the mechanisms by which Chk1 is activated in response to bulky adducts and potential mechanisms by which Chk1 signaling inhibits the initiation stage of DNA synthesis. Additionally, we discuss mechanisms by which Chk1 signaling facilitates bypass of bulky lesions by specialized Y-family DNA polymerases, thereby attenuating checkpoint signaling and allowing resumption of normal cell cycle progression. PMID:17652783

  19. 4-Aminobiphenyl-DNA adducts and p53 mutations in bladder cancer.


    Martone, T; Airoldi, L; Magagnotti, C; Coda, R; Randone, D; Malaveille, C; Avanzi, G; Merletti, F; Hautefeuille, A; Vineis, P


    Epidemiologic studies have suggested that smokers of air-cured tobacco (rich in arylamines) are at higher risk of bladder cancer than smokers of flue-cured tobacco. The risk has been shown to be modulated by the N-acetyltransferase genotype. We analyzed the biopsies of 45 patients with bladder cancer. p53 mutations were sought by direct sequencing, and 4-aminobiphenyl-DNA adducts were measured by negative ion gas chromatography-mass spectrometry. 4-Aminobiphenyl-DNA adducts were higher in smokers of air-cured tobacco and in current smokers, but no relationship with the number of cigarettes smoked was found. Adducts were higher in more advanced histologic grades of tumors. No pattern was evident for p53 mutations. Seven of 9 mutations occurred in grade 3 tumors. No association was found between 4-ABP adducts and GSTM1 or NAT2 genetic polymorphisms. PMID:9466649

  20. Syndromes presenting adducted thumb with/without clubfoot and Dundar syndrome.


    Uzak, A Subasioglu; Fryns, J P; Dundar, M


    Congenital adducted thumb has been called variously as congenital clasped thumb, thumb in palm deformity or flexion adduction deformity of the thumb. This condition can be an isolated anomaly or associated with several genetic disorders. The syndromes that include adducted thumb as a cardinal feature such as Dundar Syndrome are few in the literature. This syndrome is an autosomal-recessive very rare disorder characterized by typical facial appearance with dysmorphic features that includes wasted build, hyperextensible, thin and translucent skin with atrophic scarring, severe congenital contractures of fingers and thumbs, club feet, severe kyphoscoliosis, joint instability, muscular hypotonia, and ocular involvement. Heart, kidney, and/or intestinal defects can also be observed. Up to date the syndrome is described in few families in the literature. Here we discuss the syndromes that include adducted thumb as a cardinal feature and also the differential diagnosis of the Dundar Syndrome according to the literature. PMID:25059014

  1. Quantification of benzo[a]pyrene diol epoxide DNA-adducts by stable isotope dilution liquid chromatography/tandem mass spectrometry.


    Ruan, Qian; Kim, Hye-Young H; Jiang, Hao; Penning, Trevor M; Harvey, Ronald G; Blair, Ian A


    Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental pollutants found in car exhausts, charbroiled food, and tobacco smoke. Three pathways for the metabolic activation of B[a]P to ultimate carcinogens have been proposed. The most widely accepted pathway involves cytochrome-P450 (CYP) 1A1- and/or 1B1-mediated formation of B[a]P-7,8-oxide, which undergoes epoxide hydrolase-mediated metabolism to the proximate carcinogen B[a]P-7,8-dihydro-7,8-diol. Further CYP1A1- and/or CYP1B1-mediated activation of the dihydrodiol results in the formation of 7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (B[a]PDE), the ultimate carcinogen. In previous studies, it was demonstrated that (+)-anti-B[a]PDE was the most potent tumorigen of the CYP-derived B[a]PDE diastereomers. We have developed a stable isotope dilution, liquid chromatography multiple reaction monitoring/mass spectrometry (LC-MRM/MS) assay for all eight (+/-)-anti-B[a]PDE-derived dGuo and dAdo DNA-adducts. The LC-MRM/MS assay was rigorously validated and used to show that (+)-anti-trans-B[a]PDE-dGuo was the major adduct formed when naked DNA and human bronchoalveolar adenocarcinoma H358 cells were treated with (+/-)-anti-B[a]PDE. The preference for DNA-adducts derived from (+)-anti-B[a]PDE was even more apparent in cellular DNA. Thus, the increased potency of (+)-anti-B[a]PDE as a tumorigen is most likely due its ability to preferentially form DNA-adducts when compared with (-)-anti-B[a]PDE. Also, the adduct profile suggests that this occurs by binding of (+)-anti-B[a]PDE to DNA in a manner that facilitates covalent binding to dGuo rather than dAdo residues. PMID:16557497

  2. Structural Elucidation of a Carnosine-Acrolein Adduct and its Quantification in Human Urine Samples

    PubMed Central

    Bispo, Vanderson S.; de Arruda Campos, Ivan P.; Di Mascio, Paolo; Medeiros, Marisa H. G.


    Aldehydes accumulate in inflammation, during myocardial infarction and have been associated with pain symptoms. One pathway of aldehyde detoxification is the conjugation with carnosine. A 3-methylpyridinium carnosine adduct from the reaction of carnosine and acrolein was characterized using extensive spectroscopic measurements. The adduct with urinary concentrations of 1.82 ± 0.68 nmol/mg of creatinine is one of the most abundant acrolein metabolites in urine and opens promising therapeutic strategies for carnosine. PMID:26783107

  3. Structural Elucidation of a Carnosine-Acrolein Adduct and its Quantification in Human Urine Samples.


    Bispo, Vanderson S; de Arruda Campos, Ivan P; Di Mascio, Paolo; Medeiros, Marisa H G


    Aldehydes accumulate in inflammation, during myocardial infarction and have been associated with pain symptoms. One pathway of aldehyde detoxification is the conjugation with carnosine. A 3-methylpyridinium carnosine adduct from the reaction of carnosine and acrolein was characterized using extensive spectroscopic measurements. The adduct with urinary concentrations of 1.82 ± 0.68 nmol/mg of creatinine is one of the most abundant acrolein metabolites in urine and opens promising therapeutic strategies for carnosine. PMID:26783107

  4. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.


    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C


    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates. PMID:23543747

  5. Immunocytochemical analysis of cisplatin-induced platinum-DNA adducts with double-fluorescence video microscopy.

    PubMed Central

    Meijer, C.; de Vries, E. G.; Dam, W. A.; Wilkinson, M. H.; Hollema, H.; Hoekstra, H. J.; Mulder, N. H.


    To detect low-level DNA platination, a sensitive immunocyto- and histochemical technique was developed using a polyclonal antibody. The antibody GPt, derived after immunization of rabbits with highly platinated DNA and purified with affinity chromatography, detected the main platinum (Pt)-containing intrastrand and interstrand adducts. Double-fluorescence microscopy image analysis was used to quantify Pt-DNA adducts with Hoechst 33258 fluorescence to locate the nuclei and with fluorescein isothiocyanate fluorescence to measure the immunosignal. A two- to five-fold dose-dependent difference in the level of cisplatin (CDDP)-induced Pt-DNA adducts between a CDDP-sensitive and -resistant human tumour cell line was detected. Large differences in Pt-DNA adduct levels after in vitro CDDP incubation between human buccal cells, lymphocytes and biopsies of different tumour types were observed. Pt-DNA adduct levels were fivefold higher in human testicular tumours than in colon tumours, representing CDDP-sensitive and -resistant tumours, respectively, in the clinic. These data suggest the possibility of predictive testing by measuring Pt-DNA adduct levels. Pt-DNA adducts in patients after treatment with CDDP were shown in normal buccal cells and in imprints of fresh tumour biopsies as well as in paraffin-embedded tumour cells. The analysis of Pt-DNA adducts at a single-cell level in small samples of normal and tumour cells during and/or after treatment is feasible with GPt and will hopefully enable more selective treatment of patients. Images Figure 1 Figure 2 Figure 4 Figure 5 PMID:9252194

  6. Identification of Rosmarinic Acid-Adducted Sites in Meat Proteins in a Gel Model under Oxidative Stress by Triple TOF MS/MS.


    Tang, Chang-Bo; Zhang, Wan-Gang; Wang, Yao-Song; Xing, Lu-Juan; Xu, Xing-Lian; Zhou, Guang-Hong


    Triple TOF MS/MS was used to identify adducts between rosmarinic acid (RosA)-derived quinones and meat proteins in a gel model under oxidative stress. Seventy-five RosA-modified peptides responded to 67 proteins with adduction of RosA. RosA conjugated with different amino acids in proteins, and His, Arg, and Lys adducts with RosA were identified for the first time in meat. A total of 8 peptides containing Cys, 14 peptides containing His, 48 peptides containing Arg, 64 peptides containing Lys, and 5 peptides containing N-termini that which participated in adduction reaction with RosA were identified, respectively. Seventy-seven adduction sites were subdivided into all adducted proteins including 2 N-terminal adduction sites, 3 Cys adduction sites, 4 His adduction sites, 29 Arg adduction sites, and 39 Lys adduction sites. Site occupancy analyses showed that approximately 80.597% of the proteins carried a single RosA-modified site, 14.925% retained two sites, 1.492% contained three sites, and the rest 2.985% had four or more sites. Large-scale triple TOF MS/MS mapping of RosA-adducted sites reveals the adduction regulations of quinone and different amino acids as well as the adduction ratios, which clarify phenol-protein adductions and pave the way for industrial meat processing and preservation. PMID:27486909

  7. Correlation of mutagenic potencies of various petroleum oils and oil coal tar mixtures with DNA adduct levels in vitro.


    Reddy, M V; Blackburn, G R; Schreiner, C A; Mackerer, C R


    An in vitro system was utilized to measure DNA adduct-forming ability of petroleum oils and oil coal tar mixtures to define correlations between DNA adduct levels and their mutagenic potencies. The system consisted of reaction of dimethyl sulfoxide extracts of oils with calf thymus DNA in the presence of Aroclor-induced hamster liver microsomes for 30 min. Following DNA extraction, DNA adducts were measured by the nuclease P1-enhanced postlabeling assay coupled with two-dimensional polyethyleneimine (PEI)-cellulose TLC. Thin layer plates showed putative aromatic DNA adducts, with levels ranging from 60 to 1400 adducts per 10(9) DNA nucleotides. TLC mobilities suggested adducts to be aromatic compounds containing 4 or more rings. A good correlation (coefficient of correlation = 0.91) was observed between DNA adduct levels and Salmonella mutagenicity for 19 oils. All 19 samples tested produced DNA adducts. To expedite the TLC procedure, adducts were resolved by one-dimensional TLC and the radioactivity measured using a mechanical scanner. Results were comparable to those obtained by two-dimensional TLC and quantification after scraping. Our data show that the in vitro incubation system coupled with the postlabeling adduct assay is a useful screening method to identify mutagenic and potentially carcinogenic oils. PMID:9288888

  8. The use of an artificial nucleotide for polymerase-based recognition of carcinogenic O6-alkylguanine DNA adducts.


    Wyss, Laura A; Nilforoushan, Arman; Williams, David M; Marx, Andreas; Sturla, Shana J


    Enzymatic approaches for locating alkylation adducts at single-base resolution in DNA could enable new technologies for understanding carcinogenesis and supporting personalized chemotherapy. Artificial nucleotides that specifically pair with alkylated bases offer a possible strategy for recognition and amplification of adducted DNA, and adduct-templated incorporation of an artificial nucleotide has been demonstrated for a model DNA adduct O(6)-benzylguanine by a DNA polymerase. In this study, DNA adducts of biological relevance, O(6)-methylguanine (O(6)-MeG) and O(6)-carboxymethylguanine (O(6)-CMG), were characterized to be effective templates for the incorporation of benzimidazole-derived 2'-deoxynucleoside-5'-O-triphosphates ( BENZI: TP and BIM: TP) by an engineered KlenTaq DNA polymerase. The enzyme catalyzed specific incorporation of the artificial nucleotide BENZI: opposite adducts, with up to 150-fold higher catalytic efficiency for O(6)-MeG over guanine in the template. Furthermore, addition of artificial nucleotide BENZI: was required for full-length DNA synthesis during bypass of O(6)-CMG. Selective incorporation of the artificial nucleotide opposite an O(6)-alkylguanine DNA adduct was verified using a novel 2',3'-dideoxy derivative of BENZI: TP. The strategy was used to recognize adducts in the presence of excess unmodified DNA. The specific processing of BENZI: TP opposite biologically relevant O(6)-alkylguanine adducts is characterized herein as a basis for potential future DNA adduct sequencing technologies. PMID:27378785

  9. Human serum albumin-benzo[a]pyrene anti-diol epoxide adduct structure elucidation by fluorescence line narrowing spectroscopy.


    Day, B W; Doxtader, M M; Rich, R H; Skipper, P L; Singh, K; Dasari, R R; Tannenbaum, S R


    Cryogenic (4-10 K) laser-induced vibrationless ground state and vibronic excited state fluorescence emission spectra of the adducts resulting from reaction in vitro of human serum albumin and the carcinogen (+-)-r-7,t-8-dihydroxy-c-9,c-10-epoxy-7,8,9,10- tetrahydrobenzo[a]-pyrene were recorded in order to determine the structures formed. Comparison of these fluorescence line-narrowed (FLN) spectra to those obtained from BaP-7,8,9,10- tetrahydrotetrols, synthetic N-t-BOC-alaninate ester, and N tau- and N pi-histidine amine anti-BaPDE adducts revealed that a mixture of adduct types are formed with the protein. Extensive dialysis of the adducted protein simplified the FLN spectrum, causing it to become nearly identical to the FLN spectrum obtained from the stable peptide adduct. Comparison of the FLN spectra of the synthetic histidine adducts to those obtained from peptide adducts isolated from enzymic digestion of the adducted protein indicated that only one of the imidazole nitrogens is the nucleophile which forms a stable adduct with anti-BaPDE. The FLN studies confirm that N tau-histidine adducts are formed between human serum albumin and the C-10 position of anti-BaPDE. PMID:1581540

  10. Capturing Labile Sulfenamide and Sulfinamide Serum Albumin Adducts of Carcinogenic Arylamines by Chemical Oxidation

    PubMed Central

    Peng, Lijuan; Turesky, Robert J.


    Aromatic amines and heterocyclic aromatic amines (HAAs) are a class of structurally related carcinogens that are formed during the combustion of tobacco or during the high temperature cooking of meats. These procarcinogens undergo metabolic activation by N-oxidation of the exocyclic amine group to produce N-hydroxylated metabolites, which are critical intermediates implicated in toxicity and DNA damage. The arylhydroxylamines and their oxidized arylnitroso derivatives can also react with cysteine (Cys) residues of glutathione or proteins to form, respectively, sulfenamide and sulfinamide adducts. However, sulfur-nitrogen linked adducted proteins are often difficult to detect because they are unstable and undergo hydrolysis during proteolytic digestion. Synthetic N-oxidized intermediates of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), a carcinogenic HAA produced in cooked meats, and 4-aminobiphenyl, a carcinogenic aromatic amine present in tobacco smoke were reacted with human serum albumin (SA) and formed labile sulfenamide or sulfinamide adducts at the Cys34 residue. Oxidation of the carcinogen-modified SA with m-chloroperoxybenzoic acid (m-CPBA) produced the arylsulfonamide adducts, which were stable to heat and the chemical reduction conditions employed to denature SA. The sulfonamide adducts of PhIP and 4-ABP were identified, by liquid chromatography/mass spectrometry, in proteolytic digests of denatured SA. Thus, selective oxidation of arylamine-modified SA produces stable arylsulfonamide-SA adducts, which may serve as biomarkers of these tobacco and dietary carcinogens. PMID:23240913

  11. Assay of Protein and Peptide Adducts of Cholesterol Ozonolysis Products by Hydrophobic and Click Enrichment Methods

    PubMed Central


    Cholesterol undergoes ozonolysis to afford a variety of oxysterol products, including cholesterol-5,6-epoxide (CholEp) and the isomeric aldehydes secosterol A (seco A) and secosterol B (seco B). These oxysterols display numerous important biological activities, including protein adduction; however, much remains to be learned about the identity of the reactive species and the range of proteins modified by these oxysterols. Here, we synthesized alkynyl derivatives of cholesterol-derived oxysterols and employed a straightforward detection method to establish secosterols A and B as the most protein-reactive of the oxysterols tested. Model adduction studies with an amino acid, peptides, and proteins provide evidence for the potential role of secosterol dehydration products in protein adduction. Hydrophobic separation methods—Folch extraction and solid phase extraction (SPE)—were successfully applied to enrich oxysterol-adducted peptide species, and LC-MS/MS analysis of a model peptide–seco adduct revealed a unique fragmentation pattern (neutral loss of 390 Da) for that species. Coupling a hydrophobic enrichment method with proteomic analysis utilizing characteristic fragmentation patterns facilitates the identification of secosterol-modified peptides and proteins in an adducted protein. More broadly, these improved enrichment methods may give insight into the role of oxysterols and ozone exposure in the pathogenesis of a variety of diseases, including atherosclerosis, Alzheimer’s disease, Parkinson’s disease, and asthma. PMID:25185119

  12. Crystal and molecular structure of eight organic acid-base adducts from 2-methylquinoline and different acids

    NASA Astrophysics Data System (ADS)

    Zhang, Jing; Jin, Shouwen; Tao, Lin; Liu, Bin; Wang, Daqi


    Eight supramolecular complexes with 2-methylquinoline and acidic components as 4-aminobenzoic acid, 2-aminobenzoic acid, salicylic acid, 5-chlorosalicylic acid, 3,5-dinitrosalicylic acid, malic acid, sebacic acid, and 1,5-naphthalenedisulfonic acid were synthesized and characterized by X-ray crystallography, IR, mp, and elemental analysis. All of the complexes are organic salts except compound 2. All supramolecular architectures of 1-8 involve extensive classical hydrogen bonds as well as other noncovalent interactions. The results presented herein indicate that the strength and directionality of the classical hydrogen bonds (ionic or neutral) between acidic components and 2-methylquinoline are sufficient to bring about the formation of binary organic acid-base adducts. The role of weak and strong noncovalent interactions in the crystal packing is ascertained. These weak interactions combined, the complexes 1-8 displayed 2D-3D framework structure.

  13. Assessment of DNA adducts and the frequency of 6-thioguanine resistant T-lymphocytes in F344 rats fed 2,4-toluenediamine or implanted with a toluenediisocyanate-containing polyester polyurethane foam.


    Delclos, K B; Blaydes, B; Heflich, R H; Smith, B A


    Toluenediamines have been of toxicological concern because of their industrial use as intermediates in polyurethane synthesis and because of the potential of their release from degradation of the Microthane polyesterurethane covering of some breast implants. In this study, we have assessed the extent of DNA damage in rats treated with a carcinogenic toluenediamine isomer, 2,4-toluenediamine (2,4-TDA), under conditions that result in tumor induction, and in rats implanted with Microthane polyesterurethane foam. Time and dose-dependent formation of adducts was observed in DNA from the liver and mammary gland of rats fed 10, 40, 80 and 180 ppm 2,4-TDA for up to 6 weeks. In assays conducted 1 to 32 weeks after the start of treatment, no adducts were detected in the DNA of T-lymphocytes isolated from the spleens of animals fed 40 or 180 ppm 2,4-TDA, nor was there an increase in mutations at the hprt locus in these lymphocytes. In rats fed 40 or 180 ppm, 2,4-TDA for 6 weeks, adducts were detectable in DNA isolated from liver and mammary gland for 26 to 43 weeks after termination of the treatment. No DNA damage, as assessed by both DNA adduct measurement and induction of T-lymphocyte hprt mutations, was observed in rats up to 42 weeks after receiving subcutaneous implants of polyesterurethane foam (67 or 267 mg/kg). Although 2,4-TDA is clearly capable of damaging DNA, the results of this study are consistent with the conclusion that Microthane foam-containing implants present a minimal risk of genotoxicity through release and subsequent metabolic activation of 2,4-TDA. The study also indicates that DNA adduct formation and mutation induction in lymphocytes are inadequate biomonitors for measuring exposure to toluenediamines. PMID:8628327

  14. Investigating the Role of Adducts in Protein Supercharging with Sulfolane

    NASA Astrophysics Data System (ADS)

    Douglass, Kevin Aart; Venter, Andre R.


    The supercharging effect of sulfolane on cytochrome c (cyt c) during electrospray ionization mass spectrometry (ESI-MS) in the absence of conformational effects was investigated. The addition of sulfolane on the order of 1 mM or greater to denaturing solutions of cyt c results in supercharging independent of protein concentration over the range of 0.1 to 10 μM. While supercharging was observed in the positive mode, no change in the charge state distribution was observed in the negative mode, ruling out polarity-independent factors such as conformational changes or surface tension effects. A series of sulfolane adducts observed with increasing intensity concurrent with increasing charge state suggests that a direct interaction between sulfolane and the charged sites of cyt c plays an important role in supercharging. We propose that charge delocalization occurring through large-scale dipole reordering of the highly polar supercharging reagent reduces the electrostatic barrier for proximal charging along the cyt c amino acid chain. Supporting this claim, supercharging was shown to increase with increasing dipole moment for several supercharging reagents structurally related to sulfolane.

  15. C18 thin-layer chromatographic enhancement of the 32P-postlabeling assay for aromatic or bulky carcinogen-DNA adducts: evaluation of adduct recoveries in comparison with nuclease P1 and butanol methods.


    Reddy, M V


    The suitability of C18 reversed-phase thin-layer chromatography (TLC) for enrichment of adducts in the 32P-postlabeling assay was investigated for structurally diverse classes of DNA adducts derived from benzo[a]pyrene, 2-acetylaminofluorene, benzoquinone, safrole, and mitomycin C. The TLC enrichment involved retention of adducts to the C18 phase followed by elution with organic solvent-water. Adduct patterns obtained by the C18 purification were qualitatively similar to those obtained by the nuclease P1 and butanol procedures, the two commonly used enrichment methods. Adduct recoveries by the C18 method varied for different adducts and were significantly lower than those obtained by the other two techniques. PMID:8314936

  16. Determining efficacy of cancer chemopreventive agents using a cell-free system concomitant with DNA adduction.


    Smith, W A; Gupta, R C


    The large (>2000) and expanding number of natural and synthetic agents with potential cancer chemopreventive properties renders it economically and physically impossible to test each of these agents for their efficacy in the widely accepted 2-year animal bioassay and clinical trials. Therefore, there is a growing need for relevant short-term screening tests to study these compounds such that only the most efficacious ones undergo extensive long-term studies. We have previously reported in a pilot study that the use of a microsome-mediated test system concomitant with DNA adduction is a pertinent and relevant model for rapidly studying the efficacy and mechanisms of cancer chemopreventive agents. We have extended this study to investigate 26 additional agents for their potential chemopreventive abilities by studying their effects on microsome-mediated benzo[a]pyrene (BP)-DNA adduction. These agents had differential effects on the two major adducts of BP-DNA, i.e., BP-7,8-diol-9,10-epoxide (BPDE)-deoxyguanosine (dG) and 9-OH-BP-dG-derived adducts. These agents were therefore categorized into five classes. Three test agents (ellagic acid, genistein and oltipraz) were strong inhibitors of both adducts. These agents diminished BP-DNA adduction by 65-95% and were categorized as Class I agents. Six other agents (benzyl isocyanate, R(+)-1-phenylethyl isocyanate, linoleic acid ethyl ester, (+)-biotin, indole-3-carboxylic acid and beta-carotene) moderately inhibited both BP-DNA adducts (25-64%); these compounds were identified as Class II agents. Six additional test agents inhibited only one adduct selectively and nine others were ineffective; these agents were categorized as Class III and Class IV, respectively. Interestingly, seven test agents enhanced BPDE-dG or 9-OH-BP-dG or both adducts and were categorized as Class V agents. Four of these Class V agents concomitantly inhibited BPDE-dG while enhancing 9-OH-BP-dG. This emphasizes the importance of studying individual DNA

  17. Identification of bound nitro musk-protein adducts in fish liver by gas chromatography-mass spectrometry: biotransformation, dose-response and toxicokinetics of nitro musk metabolites protein adducts in trout liver as biomarkers of exposure.


    Mottaleb, M Abdul; Osemwengie, Lantis I; Islam, M Rafiq; Sovocool, G Wayne


    Ubiquitous occurrences of synthetic nitro musks are evident in the literature. The in vivo analysis of musk xylene (MX) and musk ketone (MK)-protein adducts in trout liver has been performed by gas chromatography-mass spectrometry using selected ion monitoring (GC-SIM-MS). Biotransformation, dose-response and toxicokinetics studies of 2-amino-MX (2-AMX), 2-amino-MK (2-AMK) and 4-amino-MX (4-AMX) metabolites, covalently bound to cysteine amino acids in proteins in fish liver, formed by enzymatic nitro-reduction of MX and MK, have been described. Trouts were exposed to single exposures of 0.010, 0.030, 0.10, and 0.30 mg/g MX and/or MK. Forty-two fish liver samples were collected from exposed- and control-fish subsequent to exposure intervals of 1 day, 3 days, and 7 days and were composited as per exposure schedules and times. Alkaline hydrolysis released bound metabolites from exposed liver composites that were extracted into n-hexane and then concentrated and analyzed by GC-SIM-MS. The presence of the metabolites in liver extracts was confirmed based on agreement of similar mass spectral properties and retention times with standards. In the dose-response study, the maximum adduct formation was 492.0 ng/g for 2-AMX, 505.5 ng/g for 2-AMK and 12588.5 ng/g for 4-AMX in liver at 0.03 mg/g MX and MK fish in 1 day after exposure. For toxicokinetics investigation, the highest amount of the target metabolites was found to be the same concentration as observed in the dose-response study for 1 day after exposure with 0.03 mg/g MX and MK fish and the half-lives of the metabolites were estimated to be 2-9 days based on assumption of first-order kinetics. Average recoveries exceeded 95% with a relative standard deviation (RSD) around 9%, and the limit of detection (LOD) ranged from 0.91 to 3.8 ng/g based on a signal to noise ratio of 10 (S/N=10) could be achieved for the metabolites. No metabolites were detected in the controls and exposed non-hydrolyzed liver extracts. This is

  18. Increased levels of the acetaldehyde-derived DNA adduct N 2-ethyldeoxyguanosine in oral mucosa DNA from Rhesus monkeys exposed to alcohol.


    Balbo, Silvia; Juanes, Rita Cervera; Khariwala, Samir; Baker, Erich J; Daunais, James B; Grant, Kathleen A


    Alcohol is a human carcinogen. A causal link has been established between alcohol drinking and cancers of the upper aerodigestive tract, colon, liver and breast. Despite this established association, the underlying mechanisms of alcohol-induced carcinogenesis remain unclear. Various mechanisms may come into play depending on the type of cancer; however, convincing evidence supports the concept that ethanol's major metabolite acetaldehyde may play a major role. Acetaldehyde can react with DNA forming adducts which can serve as biomarkers of carcinogen exposure and potentially of cancer risk. The major DNA adduct formed from this reaction is N (2)-ethylidenedeoxyguanosine, which can be quantified as its reduced form N (2)-ethyl-dG by LC-ESI-MS/MS. To investigate the potential use of N (2)-ethyl-dG as a biomarker of alcohol-induced DNA damage, we quantified this adduct in DNA from the oral, oesophageal and mammary gland tissues from rhesus monkeys exposed to alcohol drinking over their lifetimes and compared it to controls. N (2)-Ethyl-dG levels were significantly higher in the oral mucosa DNA of the exposed animals. Levels of the DNA adduct measured in the oesophageal mucosa of exposed animals were not significantly different from controls. A correlation between the levels measured in the oral and oesophageal DNA, however, was observed, suggesting a common source of formation of the DNA adducts. N (2) -Ethyl-dG was measured in mammary gland DNA from a small cohort of female animals, but no difference was observed between exposed animals and controls. These results support the hypothesis that acetaldehyde induces DNA damage in the oral mucosa of alcohol-exposed animals and that it may play role in the alcohol-induced carcinogenic process. The decrease of N (2)-ethyl-dG levels in exposed tissues further removed from the mouth also suggests a role of alcohol metabolism in the oral cavity, which may be considered separately from ethanol liver metabolism in the

  19. Simultaneous Detection of Multiple DNA Adducts in Human Lung Samples by Isotope-Dilution UPLC-MS/MS

    PubMed Central


    Recent studies have demonstrated that various DNA adducts can be detected in human tissues and fluids using liquid chromatography connected to tandem mass spectrometry (LC-MS/MS). However, the utility of a single DNA adduct as a biomarker in risk assessment is debatable because humans are exposed to many genotoxicants. We established a method to measure DNA adducts derived from 16 ubiquitous genotoxicants and developed an analytical technique for their simultaneous quantification by ultra performance liquid chromatography (UPLC)-MS/MS. Methods for the enrichment of the analytes from DNA hydrolysates and chromatographic separation preceding mass spectrometric analysis were optimized, and the resultant technique was used for the simultaneous analysis of the 16 DNA adducts in human lung biopsy specimens. Eleven adducts (formed by benzo[a]pyrene, 1-methylpyrene, 4-aminobiphenyl, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine, 1-methoxy-3-indolylmethylglucosinolate, 5-hydroxymethylfurfural, and malondialdehyde) were not detected in any tissue sample (limits of detection: 0.02–7.1 adducts/108 nucleosides). 3,N4-etheno-2′-deoxycytidine and 1,N6-etheno-2′-deoxyadenosine, formed from 2,3-epoxyaldehydes of endogenous lipid peroxidation products, were present in all subjects (16.9–115.3 and 27.2–179/108 nucleosides, respectively). The same was true for N2-(trans-methylisoeugenol-3′-yl)-2′-deoxyguanosine, the major adduct of methyleugenol (1.7–23.7/108 nucleosides). A minor adduct of methyleugenol and two adducts of furfuryl alcohol were detected in several pulmonary specimens. Taken together, we developed a targeted approach for the simultaneous mass spectrometric analyses of 16 DNA adducts, which can be easily extended by adducts formed from other mutagens. The method allowed one to detect adducts of furfuryl alcohol and methyleugenol in samples of human lung. PMID:25423194

  20. Simultaneous detection of multiple DNA adducts in human lung samples by isotope-dilution UPLC-MS/MS.


    Monien, Bernhard H; Schumacher, Fabian; Herrmann, Kristin; Glatt, Hansruedi; Turesky, Robert J; Chesné, Christophe


    Recent studies have demonstrated that various DNA adducts can be detected in human tissues and fluids using liquid chromatography connected to tandem mass spectrometry (LC-MS/MS). However, the utility of a single DNA adduct as a biomarker in risk assessment is debatable because humans are exposed to many genotoxicants. We established a method to measure DNA adducts derived from 16 ubiquitous genotoxicants and developed an analytical technique for their simultaneous quantification by ultra performance liquid chromatography (UPLC)-MS/MS. Methods for the enrichment of the analytes from DNA hydrolysates and chromatographic separation preceding mass spectrometric analysis were optimized, and the resultant technique was used for the simultaneous analysis of the 16 DNA adducts in human lung biopsy specimens. Eleven adducts (formed by benzo[a]pyrene, 1-methylpyrene, 4-aminobiphenyl, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine, 1-methoxy-3-indolylmethylglucosinolate, 5-hydroxymethylfurfural, and malondialdehyde) were not detected in any tissue sample (limits of detection: 0.02-7.1 adducts/10(8) nucleosides). 3,N(4)-etheno-2'-deoxycytidine and 1,N(6)-etheno-2'-deoxyadenosine, formed from 2,3-epoxyaldehydes of endogenous lipid peroxidation products, were present in all subjects (16.9-115.3 and 27.2-179/10(8) nucleosides, respectively). The same was true for N(2)-(trans-methylisoeugenol-3'-yl)-2'-deoxyguanosine, the major adduct of methyleugenol (1.7-23.7/10(8) nucleosides). A minor adduct of methyleugenol and two adducts of furfuryl alcohol were detected in several pulmonary specimens. Taken together, we developed a targeted approach for the simultaneous mass spectrometric analyses of 16 DNA adducts, which can be easily extended by adducts formed from other mutagens. The method allowed one to detect adducts of furfuryl alcohol and methyleugenol in samples of human lung. PMID:25423194

  1. Silver adducts of four-branched histidine rich peptides exhibit synergistic antifungal activity.


    Leng, Qixin; Woodle, Martin C; Liu, Yijia; Mixson, A James


    Previously, a four branched histidine-lysine rich peptide, H3K4b, was shown to demonstrate selective antifungal activity with minimal antibacterial activity. Due to the potential breakdown from proteases, H3K4b was further evaluated in the current study by varying the D- and l-amino acid content in its branches. Whereas analogues of H3K4b that selectively replaced l-amino acids (H3k4b, h3K4b) had improved antifungal activity, the all d-amino acid analogue, h3k4b, had reduced activity, suggesting that partial breakdown of the peptide may be necessary. Moreover, because histidines form coordination bonds with the silver ion, we examined whether silver adducts can be formed with these branched histidine-lysine peptides, which may improve antifungal activity. For Candida albicans, the silver adduct of h3K4b or H3k4b reduced the MIC compared to peptide and silver ions alone by 4- and 5-fold, respectively. For Aspergillus fumigatus, the silver adducts showed even greater enhancement of activity. Although the silver adducts of H3k4b or h3K4b showed synergistic activity, the silver adduct with the all l-amino acid H3K4b surprisingly showed the greatest synergistic and growth inhibition of A. fumigatus: the silver adduct of H3K4b reduced the MIC compared to the peptide and silver ions alone by 30- and 26-fold, respectively. Consistent with these antifungal efficacy results, marked increases in free oxygen radicals were produced with the H3K4b and silver combination. These studies suggest that there is a balance between stability and breakdown for optimal antifungal activity of the peptide alone and for the peptide-silver adduct. PMID:27387239

  2. Synthesis of an oligodeoxyribonucleotide adduct of mitomycin C by the postoligomerization method via a triamino mitosene.


    Champeil, Elise; Paz, Manuel M; Ladwa, Sweta; Clement, Cristina C; Zatorski, Andrzej; Tomasz, Maria


    The cancer chemotherapeutic agent mitomycin C (MC) alkylates and cross-links DNA monofunctionally and bifunctionally in vivo and in vitro, forming six major MC-deoxyguanosine adducts of known structures. The synthesis of one of the monoadducts (8) by the postoligomerization method was accomplished both on the nucleoside and oligonucleotide levels, the latter resulting in the site-specific placement of 8 in a 12-mer oligodeoxyribonucleotide 26. This is the first application of this method to the synthesis of a DNA adduct of a complex natural product. Preparation of the requisite selectively protected triaminomitosenes 14 and 24 commenced with removal of the 10-carbamoyl group from MC, followed by reductive conversion to 10-decarbamoyl-2,7-diaminomitosene 10. This substance was transformed to 14 or 24 in several steps. Both were successfully coupled to the 2-fluoro-O(6)-(2-trimethylsilylethyl)deoxyinosine residue of the 12-mer oligonucleotide. The N(2)-phenylacetyl protecting group of 14 after its coupling to the 12-mer oligonucleotide could not be removed by penicillinamidase as expected. Nevertheless, the Teoc protecting group of 24 after coupling to the 12-mer oligonucleotide was removed by treatment with ZnBr2 to give the adducted oligonucleotide 26. However, phenylacetyl group removal was successful on the nucleoside-level synthesis of adduct 8. Proof of the structure of the synthetic nucleoside adduct included HPLC coelution and identical spectral properties with a natural sample, and (1)H NMR. Structure proof of the adducted oligonucleotide 26 was provided by enzymatic digestion to nucleosides and authentic adduct 8, as well as MS and MS/MS analysis. PMID:18588303

  3. Theoretical characterization of dihydrogen adducts with halide anions

    NASA Astrophysics Data System (ADS)

    Vitillo, Jenny G.; Damin, Alessandro; Zecchina, Adriano; Ricchiardi, Gabriele


    The interaction between a hydrogen molecule and the halide anions F-, Cl-, Br-, and I- has been studied at different levels of theory and with different basis sets. The most stable configurations of the complexes have a linear geometry, while the t-shaped complexes are saddle points on the potential energy surface, opposite to what is observed for alkali cations. An electrostatic analysis conducted on the resulting adducts has highlighted the predominance of the electrostatic term in the complexation energy and, in particular, of the quadrupole- and dipole-polarizability dependent contributions. Another striking difference with respect to the positive ions, is the fact that although the binding energies have similar values (ranging between 25 and 3kJ/mol for F- and I-, respectively), the vibrational shift of the ν˜H-H and in general the perturbation of the hydrogen molecule in complexes are much greater in the complexes with anions (Δν˜H-H ranges between -720 and -65cm-1). Another difference with respect to the interaction with cations is a larger charge transfer from the anion to the hydrogen molecule. The Δν˜ is the result of the cooperative role of the electrostatics and of the charge transfer in the interaction. The correlation between binding energies and vibrational shift is far from linear, contrary to what is observed for cation complexes, in accordance with the higher polarizability and dynamic polarizability of the molecule along the molecular axis. The observed correlation may be valuable in the interpretation of spectra and thermodynamic properties of adsorbed H2 in storage materials.

  4. Factors that influence the mutagenic patterns of DNA adducts from chemical carcinogens.


    Seo, K Y; Jelinsky, S A; Loechler, E L


    Carcinogens are generally mutagens, which is understandable given that tumor cells grow uncontrollably because they have mutations in critical genes involved in growth control. Carcinogens often induce a complex pattern of mutations (e.g., GC-->TA, GC-->AT, etc.). These mutations are thought to be initiated when a DNA polymerase encounters a carcinogen-DNA adduct during replication. In principle, mutational complexity could be due to either a collection of different adducts each inducing a single kind of mutation (Hypothesis 1a), or a single adduct inducing different kinds of mutations (Hypothesis 1b). Examples of each are discussed. Regarding Hypothesis 1b, structural factors (e.g., DNA sequence context) and biological factors (e.g., differing DNA polymerases) that can affect the pattern of adduct mutagenesis are discussed. This raises the question: how do structural and biological factors influence the pattern of adduct mutagenesis. For structural factors, three possibilities are considered: (Hypothesis 2a) a single conformation of an adduct giving rise to multiple mutations -- dNTP insertion by DNA polymerase being influenced by (e.g.) the surrounding DNA sequence context; (Hypothesis 2b) a variation on this ("dislocation mutagenesis"); or (Hypothesis 2c) a single adduct adopting multiple conformations, each capable of giving a different pattern of mutations. Hypotheses 2a, 2b and 2c can each in principle rationalize many mutational results, including how the pattern of adduct mutagenesis might be influenced by factors, such as DNA sequence context. Five lines of evidence are discussed suggesting that Hypothesis 2c can be correct for base substitution mutagenesis. For example, previous work from our laboratory was interpreted to indicate that [+ta]-B[a]P-N(2)-dG in a 5'-CGG sequence context (G115) could be trapped in a conformation giving predominantly G-->T mutations, but heating caused the adduct to equilibrate to its thermodynamic mixture of conformations

  5. Protein adducts as dosimeters of human exposure to styrene, styrene-7,8-oxide, and benzene.


    Rappaport, S M; Yeowell-O'Connell, K


    Cysteinyl adducts of hemoglobin (Hb) and albumin (Alb) formed via reactions with reactive species were measured in 48 subjects exposed to styrene (0.24-55.2 ppm) and to styrene-7,8-oxide (SO) (2.65-107 ppb) in a factory producing boats in the USA. Hb and Alb adducts were also investigated among 88 workers exposed to benzene (0-138 ppm) in several Chinese factories. The particular adducts were S-(2-hydroxy-1-phenylethyl) cysteine, from reactions of SO with Alb (designated SO-Alb), and S-phenylcysteine, from reactions of the CYP450 benzene metabolite, benzene oxide (BO), with Hb and Alb (designated BO-Hb and BO-Alb, respectively). The relationships between adduct levels and exposures were investigated in both studies. The estimated slopes varied considerably among the particular combinations of adduct and agent to which the workers were exposed, ranging from 0.815 pmol BO-Hb/g Hb per ppm benzene to 24400 pmol SO-Alb/g Alb per ppm SO. We used these estimated slopes, along with kinetic constants, to predict the systemic doses of SO and BO in humans per mg of styrene, SO or benzene per kg body weight, under certain assumptions. Using RX to signify the particular electrophile (SO or BO) the doses of RX to the blood per unit of dose varied between 2.21 and 4110 nM RX-h/mg agent per kg b.w. The dose of RX to the blood arising from inhalation of SO was almost 2000 times that of styrene (i.e. 4110 vs. 2.21 nM RX/mg agent per kg b.w.) and 430-781 times that of benzene (i.e. 4110 vs. 5.26-9.55 nM RX/mg agent per kg b.w.), depending upon the study. Comparable estimates of the blood dose of BO were obtained from adducts of Hb and Alb and two independent studies of BO-Alb yielded similar dose estimates. These results point to the utility of protein adducts as dosimeters of reactive electrophilic species in occupational studies. Finally, significant levels of background adducts of SO and BO with Hb and Alb were observed among workers, among control subjects and in commercial human

  6. Cisplatin intrastrand adducts sensitize DNA to base damage by hydrated electrons.


    Behmand, B; Wagner, J R; Sanche, L; Hunting, D J


    The oligonucleotide TTTTTGTGTTT with or without a cisplatin adduct was reacted with hydrated electrons generated by ionizing radiation. Hydroxyl radicals were quenched with ethylenediaminetetraacetic acid (EDTA), and the solutions were bubbled with wet nitrogen to eliminate oxygen, a scavenger of hydrated electrons. Prior to irradiation, the structure of the initial cisplatin adduct was identified by mass spectrometry as G-cisplatin-G. Radiation damage to DNA bases was quantified by high-performance liquid chromatography (HPLC), after enzymatic digestion of the TTTTTGTGTTT-cisplatin complex to deoxyribonucleosides. The masses of the platinum adducts following digestion and separation by HPLC were measured by mass spectrometry. Our results demonstrate that hydrated electrons induce damage to thymines as well as detachment of the cisplatin moiety from both guanines in the oligonucleotide. This detachment regenerates both unmodified guanine and damaged guanine, in equimolar amounts. At 1000 Gy, a net average of 2.5 thymines and 1 guanine are damaged for each platinum lost from the oligonucleotide. Given the extensive base damage that occurs for each cisplatin adduct lost, it is clear that, prior to undergoing detachment, these adducts must catalyze several cycles of reactions of hydrated electrons with DNA bases. It is likely that a single reaction leads to the loss of the cisplatin adduct and the damage observed on the guanine base; however, the damage to the thymine bases must require the continued presence of the cisplatin adduct, acting as a catalyst. To our knowledge, this is the first time that platinum-DNA adducts have been shown to have catalytic activity. We propose two pathways for the interaction of hydrated electrons with TTTTTGTGTTT-cisplatin: (1) the hydrated electron is initially captured by a thymine base and transferred by base to base electron hopping to the guanine site, where the cisplatin moiety detaches from the oligonucleotide via dissociative

  7. Brevetoxin Forms Covalent DNA Adducts in Rat Lung Following Intratracheal Exposure

    PubMed Central

    Radwan, Faisal F.Y.; Ramsdell, John S.


    Background Human exposure to brevetoxins produced by the red tide organism, Karenia brevis, is an increasing public health concern. Using in vitro exposure of rat liver cells to brevetoxin B (PbTx-2), the primary toxin product of K. brevis, we previously showed that it formed C27,28-epoxy brevetoxin metabolites capable of covalently binding to nucleic acids, a common initiation step for carcinogenesis. Objective This study was undertaken to evaluate nucleic acid adduction in lung following in vitro and in vivo brevetoxin exposures. Methods To clarify reactions of brevetoxin epoxide with DNA, we analyzed reaction products of PbTx-6 (a C27,28 epoxide metabolite of brevetoxin B) with nucleosides. We also analyzed adducts from nucleic acid hydrolysates of isolated rat lung cells treated with PbTx-2 or PbTx-6 in vitro and lung tissue from rats after intratracheal exposure to PbTx-2 or PbTx-6 at 45 μg toxin/kg body weight. Results Our results indicate that PbTx-2 forms DNA adducts with cytidine after treatment of isolated lung cells, and forms DNA adducts with adenosine and guanosine after intratracheal exposure. Conclusions These results are consistent with metabolic activation of highly reactive brevetoxin intermediates that bind to nucleic acid. These findings provide a basis for monitoring exposure and assessing the hazard associated with depurination of brevetoxin–nucleotide adducts in lung tissue. PMID:18629316

  8. DNA isolation and sample preparation for quantification of adduct levels by accelerator mass spectrometry.


    Dingley, Karen H; Ubick, Esther A; Vogel, John S; Ognibene, Ted J; Malfatti, Michael A; Kulp, Kristen; Haack, Kurt W


    Accelerator mass spectrometry (AMS) is a highly sensitive technique used for the quantification of adducts following exposure to carbon-14- or tritium-labeled chemicals, with detection limits in the range of one adduct per 10(11)-10(12) nucleotides. The protocol described in this chapter provides an optimal method for isolating and preparing DNA samples to measure isotope-labeled DNA adducts by AMS. When preparing samples, special precautions must be taken to avoid cross-contamination of isotope among samples and produce a sample that is compatible with AMS. The DNA isolation method described is based upon digestion of tissue with proteinase K, followed by extraction of DNA using Qiagen isolation columns. The extracted DNA is precipitated with isopropanol, washed repeatedly with 70 % ethanol to remove salt, and then dissolved in water. DNA samples are then converted to graphite or titanium hydride and the isotope content measured by AMS to quantify adduct levels. This method has been used to reliably generate good yields of uncontaminated, pure DNA from animal and human tissues for analysis of adduct levels. PMID:24623226

  9. Serine Protease Catalysis: A Computational Study of Tetrahedral Intermediates and Inhibitory Adducts.


    Ngo, Phong D; Mansoorabadi, Steven O; Frey, Perry A


    Peptide boronic acids and peptidyl trifluoromethyl ketones (TFKs) inhibit serine proteases by forming monoanionic, tetrahedral adducts to serine in the active sites. Investigators regard these adducts as analogs of monoanionic, tetrahedral intermediates. Density functional theory (DFT) calculations and fractional charge analysis show that tetrahedral adducts of model peptidyl TFKs are structurally and electrostatically very similar to corresponding tetrahedral intermediates. In contrast, the DFT calculations show the structures and electrostatic properties of analogous peptide boronate adducts to be significantly different. The peptide boronates display highly electrostatically positive boron, with correspondingly negative ligands in the tetrahedra. In addition, the computed boron-oxygen and boron-carbon bond lengths in peptide boronates (which are identical or very similar to the corresponding bonds in a peptide boronate adduct of α-lytic protease determined by X-ray crystallography at subangstrom resolution) are significantly longer than the corresponding bond lengths in model tetrahedral intermediates. Since protease-peptidyl TFKs incorporate low-barrier hydrogen bonds (LBHBs) between an active site histidine and aspartate, while the protease-peptide boronates do not, these data complement the spectroscopic and chemical evidence for the participation of LBHBs in catalysis by serine proteases. Moreover, while the potency of these classes of inhibitors can be correlated to the structures of the peptide moieties, the present results indicate that the strength of their bonds to serine contribute significantly to their inhibitory properties. PMID:27387593

  10. Mass spectrometric characterization of human hemoglobin adducts formed in vitro by hexahydrophthalic anhydride.


    Kristiansson, Monica H; Jönsson, Bo A G; Lindh, Christian H


    Primary structural information of anhydride binding to endogenous proteins is of interest in order to determine the mechanism causing the type-I allergy seen in many anhydride-exposed workers. In addition, studies on specific protein adducts may generate new methods for biological monitoring. In this study, the binding of hexahydrophthalic anhydride (HHPA) to human hemoglobin (Hb) in vitro was investigated. The in vitro synthesized conjugates were analyzed using a hybrid quadrupole-time-of-flight mass spectrometer (Q-TOF) with electrospray ionization (ESI) to determine the number of HHPA adducts per Hb molecule. Structural information on the locations of the adducts was obtained through nanospray Q-TOF, liquid chromatography-ESI mass spectrometric analysis, and gas chromatography/mass spectrometric analysis of Pronase E and tryptic digests. Up to six adducts were found on the alpha-chain and five on the beta-chain. The HHPA-adducts were localized to the N-terminal valine of the alpha- and beta-chains of Hb and to lysine residues at positions 7, 11, 16, and 40 of the alpha-chain and 8, 17, 59, 66, and 144 of the beta-chain. These results will constitute a basis for studies on structure-activity relationships as well as for development of methods for biological monitoring of acid anhydrides. PMID:11952343

  11. Metabolic stability of superoxide adducts derived from newly developed cyclic nitrone spin traps.


    Bézière, Nicolas; Hardy, Micael; Poulhès, Florent; Karoui, Hakim; Tordo, Paul; Ouari, Olivier; Frapart, Yves-Michel; Rockenbauer, Antal; Boucher, Jean-Luc; Mansuy, Daniel; Peyrot, Fabienne


    Reactive oxygen species are by-products of aerobic metabolism involved in the onset and evolution of various pathological conditions. Among them, the superoxide radical is of special interest as the origin of several damaging species such as H2O2, hydroxyl radical, or peroxynitrite (ONOO(-)). Spin trapping coupled with ESR is a method of choice to characterize these species in chemical and biological systems and the metabolic stability of the spin adducts derived from reaction of superoxide and hydroxyl radicals with nitrones is the main limit to the in vivo application of the method. Recently, new cyclic nitrones bearing a triphenylphosphonium or permethylated β-cyclodextrin moiety have been synthesized and their spin adducts demonstrated increased stability in buffer. In this article, we studied the stability of the superoxide adducts of four new cyclic nitrones in the presence of liver subcellular fractions and biologically relevant reductants using an original setup combining a stopped-flow device and an ESR spectrometer. The kinetics of disappearance of the spin adducts were analyzed using an appropriate simulation program. Our results highlight the interest of the new spin trapping agents CD-DEPMPO and CD-DIPPMPO for specific detection of superoxide with high stability of the superoxide adducts in the presence of liver microsomes. PMID:24161442

  12. Supramolecular adducts based on weak interactions between the trimeric Lewis acid complex (perfluoro-ortho-phenylene)mercury and polypnictogen complexes.


    Fleischmann, Martin; Jones, James S; Balázs, Gábor; Gabbaï, François P; Scheer, Manfred


    Reactions of the trinuclear Lewis acid perfluoro-ortho-phenylene)mercury [(o-HgC6F4)3] (1) with the polypnictogen complex [CpMo(CO)2(η(3)-P3)] (2) containing a cyclo-P3 ligand and the series of E2 complexes [{CpMo(CO)2}2(μ,η(2):η(2)-E2)] (E = P(3a), As(3b), Sb(3c), Bi(3d)) are reported. In all cases, the reaction products show very weak interactions between the En ligand complexes and the Lewis acid 1, as evidenced by their highly dynamic behaviour in solution and the formation of adducts in the solid state showing HgE contacts below the respective sum of the van der Waals radii. The complexes 2 (P3), 3a (P2) and 3b (As2) show interactions of only one pnictogen atom with all three Hg atoms of 1. The complex 3c (Sb2) forms two adducts with 1 showing either a side-on coordination of the Sb2 dumbbell towards Hg or an end-on coordination of both Sb atoms towards two independent molecules of 1. The Bi2 complex 3d shows an almost parallel alignment of the Bi2 dumbbell situated above the center of the planar Lewis acid 1. The arrangements of the E2 complex series towards 1 are rationalized with the help of electrostatic potential maps obtained by DFT calculations. Finally the structural characterizations of a new modification of the free Sb2 complex 3c, the Bi2 complex 3d, the starting material of its preparation [Bi{CpMo(CO)3}3] (4) and an unprecedented 'Cr4As5' cluster 5 are presented. PMID:27461890

  13. gamma-Diketone neuropathy: axon atrophy and the role of cytoskeletal protein adduction.


    LoPachin, Richard M; DeCaprio, Anthony P


    Multifocal giant neurofilamentous axonal swellings and secondary distal degeneration have been historically considered the hallmark features of gamma-diketone neuropathy. Accordingly, research conducted over the past 25 years has been directed toward discerning mechanisms of axonal swelling. However, this neuropathological convention has been challenged by recent observations that swollen axons were an exclusive product of long-term 2.5-hexanedione (HD) intoxication at lower daily dose-rates (e.g., 175 mg/kg/day); that is, higher HD dose-rates (e.g., 400 mg/kg/day) produced neurological deficits in the absence of axonal swellings. The observation that neurological toxicity can be expressed without axonal swelling suggests that this lesion is not an important pathophysiological event. Instead, several research groups have now shown that axon atrophy is prevalent in nervous tissues of laboratory animals intoxicated over a wide range of HD dose-rates. The well-documented nerve conduction defects associated with axon atrophy, in conjunction with the temporal correspondence between this lesion and the onset of neurological deficits, strongly suggest that atrophy has pathophysiological significance. In this commentary, we present evidence that supports a pathognomonic role for axon atrophy in gamma-diketone neuropathy and suggests that the functional consequences of this lesion mediate the corresponding neurological toxicity. Previous research has demonstrated that HD interacts with proteins via formation of pyrrole adducts. We therefore discuss the possibility that this chemical process is essential to the mechanism of atrophy. Evidence presented in this review suggests that "distal axonopathy" is an inaccurate classification and future nosological schemes should be based on the apparent primacy of axon atrophy. PMID:15289087


    EPA Science Inventory

    A simple and rapid procedure for estimating binding of radiolabelled material to DNA and protein is described. Protein was extracted from lysed rabbit alveolar macrophages with chloroform: iso-amyl-alcohol:phenol extraction. Nucleic acids were precipitated from the lysate, and hy...


    EPA Science Inventory

    The high use of nitro musk xylene (MX) and musk ketone (MK) as fragrances, and their persistence and bioaccumulation potential make them ubiquitous environmental contaminants. The 4-amino-MX (AMX) and 2-amino-MK (AMK) metabolites have been detected in trout fish hemoglobin (Hb) s...

  16. Nuclease S1-mediated enhancement of the 32P-postlabeling assay for aromatic carcinogen-DNA adducts.


    Reddy, M V


    Treatment of DNA digests with nuclease P1 prior to 32P-labeling of adducts has previously been shown to enhance the sensitivity of the 32P-postlabeling assay for the detection of aromatic carcinogen-DNA adducts. The enhancement was based on the ability of nuclease P1 to remove the 3'-phosphate from normal nucleotides but not the corresponding phosphate from most aromatic adducted nucleotides. We investigated the utility of another 3'-dephosphorylating enzyme, nuclease S1, for this purpose, and found it to be as effective as nuclease P1. The recovery of DNA adducts derived from benzo[a]-pyrene (B[a]P), benzoquinone (BQ) and 2-acetylaminofluorene (AAF) was comparable after enhancement with either enzyme. Some differences were, however, observed. Recovery of a minor B[a]P adduct was 1.5 times higher by the S1 procedure. Among minor adducts of BQ, two showed higher values (2.8- and 6.1-fold) by the S1 procedure and one by the P1 procedure (2.4-fold). The major AAF adduct, deoxyguanosine-C8-AF, exhibited poorer recovery (1-11%) by either procedure, while the minor adducts, deoxyguanosine-N2-AAF and deoxyguanosine-C8-AAF, showed better recovery (2-3 times) than by the enhancement procedure involving extraction of adducts into butanol. Our results show that the nuclease S1 assay can complement the nuclease P1 assay, with improved recoveries for some adducts. Considering the complexity of the postlabeling assay, this additional variant may prove useful in unequivocal detection of DNA adducts. PMID:1893535

  17. Tyrosine-Lipid Peroxide Adducts from Radical Termination: Para-Coupling and Intramolecular Diels-Alder Cyclization

    PubMed Central

    Shchepin, Roman; Möller, Matias N.; Kim, Hye-young H.; Hatch, Duane M.; Bartesaghi, Silvina; Kalyanaraman, Balaraman; Radi, Rafael


    Free radical co-oxidation of polyunsaturated lipids with tyrosine or phenolic analogs of tyrosine gave rise to lipid peroxide-tyrosine (phenol) adducts in both aqueous micellar and organic solutions. The novel adducts were isolated and characterized by 1D and 2D NMR as well as by mass spectrometry. The spectral data suggest that the polyunsaturated lipid peroxyl radicals give stable peroxide coupling products exclusively at the para position of the tyrosyl (phenoxy) radicals. These adducts have characteristic 13C chemical shifts at 185 ppm due to the cross-conjugated carbonyl of the phenol-derived cyclohexadienone. The primary peroxide adducts subsequently undergo intramolecular Diels-Alder (IMDA) cyclization, affording a number of diastereomeric tricyclic adducts that have characteristic carbonyl 13C chemical shifts at ~198 ppm. All NMR HMBC and HSQC correlations support the structure assignment of the primary and Diels-Alder adducts, as does MS collision induced dissociation. Kinetic rate constants and activation parameters for the IMDA reaction were determined and the primary adducts were reduced with cuprous ion giving a phenol-derived 4-hydroxycyclohexa-2,5-dienone. No products from adduction of peroxyls at the phenolic ortho position were found either in the primary or the cuprous reduction product mixtures. These studies provide a framework for understanding the nature of lipid-protein adducts formed by peroxyl-tyrosyl radical-radical termination processes. Coupling of lipid peroxyl radicals with tyrosyl radicals leads to cyclohexenone and cyclohexadienone adducts which are of interest in and of themselves since, as electrophiles, they are likely targets for protein nucleophiles. One consequence of lipid peroxyl reactions with tyrosyls may therefore be protein-protein crosslinks via interprotein Michael adducts. PMID:21090613

  18. Identification of DNA--cisplatin adducts in a blind trial of in situ scanning tunneling microscopy.


    Jeffrey, A M; Jing, T W; DeRose, J A; Vaught, A; Rekesh, D; Lu, F X; Lindsay, S M


    Scanning tunneling microscopy (STM) reveals nanometer scale details of hydrated DNA but the interpretation of the images is controversial because of substrate artifacts and the lack of a theory for image contrast. We demonstrate that we have overcome these problems by identifying five DNA samples by their STM images alone in a blinded trial. The samples were single-stranded and double-stranded DNA with and without covalent modification by the anti-tumor drug cisplatin. The cisplatin adducts were distinguished by substantial kinking at the drug binding site. The oligomers were 20 bases in length, which was too short to permit the kinking angle to be determined with precision. However, models with a 45 degree kink gave a better fit to the images of the duplex adducts than models with a 90 degrees kink. A variety of structures was observed for the single-stranded adducts. PMID:8290350

  19. The influence of antagonist muscle electrical stimulation on maximal hip adduction force

    PubMed Central

    Nakano, Sota; Wada, Chikamune


    [Purpose] The aim of this study was to determine whether electrical stimulation of the tensor fascia lata muscle decreases voluntary maximum resistance to passive abduction motion in participants without disease of the central nervous system. [Subjects] The participants were 16 healthy men. [Methods] The hip joint was moved from 10° adduction to 0° adduction with an angular velocity of 7°/s. During the passive leg motion, the subject was asked to resist the motion with maximum force. Two experimental conditions were prepared: (1) electrical stimulation provided to the tensor fascia lata muscle during the passive motion; and (2) no electrical stimulation provided. [Results] The force was 10.2 ± 3.5 kgf with electrical stimulation and 12.2 ± 3.8 kgf without electrical stimulation. [Conclusion] The results suggested that the maximum hip adduction force decreased in participants because of electrical stimulation of the tensor fascia lata muscle. PMID:26957742

  20. Atomic-resolution structure of an N5 flavin adduct in D-arginine dehydrogenase.


    Fu, Guoxing; Yuan, Hongling; Wang, Siming; Gadda, Giovanni; Weber, Irene T


    D-Arginine dehydrogenase (DADH) catalyzes the flavin-dependent oxidative deamination of D-arginin