Science.gov

Sample records for ozone induces dna

  1. Mechanism of site-specific DNA damage induced by ozone.

    PubMed

    Ito, Kimiko; Inoue, Sumiko; Hiraku, Yusuke; Kawanishi, Shosuke

    2005-08-01

    Ozone has been shown to induce lung tumors in mice. The reactivity of ozone with DNA in an aqueous solution was investigated by a DNA sequencing technique using 32P-labeled DNA fragments. Ozone induced cleavages in the deoxyribose-phosphate backbone of double-stranded DNA, which were reduced by hydroxyl radical scavengers, suggesting the participation of hydroxyl radicals in the cleavages. The ozone-induced DNA cleavages were enhanced with piperidine treatment, which induces cleavages at sites of base modification, but the inhibitory effect of hydroxyl radical scavengers on the piperidine-induced cleavages was limited. Main piperidine-labile sites were guanine and thymine residues. Cleavages at some guanine and thymine residues after piperidine treatment became more predominant with denatured single-stranded DNA. Exposure of calf thymus DNA to ozone resulted in a dose-dependent increase of the 8-oxo-7,8-dihydro-2'-deoxyguanosine formation, which was partially inhibited by hydroxyl radical scavengers. ESR studies using 5,5-dimethylpyrroline-N-oxide (DMPO) showed that aqueous ozone produced the hydroxyl radical adduct of DMPO. In addition, the fluorescein-dependent chemiluminescence was detected during the decomposition of ozone in a buffer solution and the enhancing effect of D2O was observed, suggesting the formation of singlet oxygen. However, no or little enhancing effect of D2O on the ozone-induced DNA damage was observed. These results suggest that DNA backbone cleavages were caused by ozone via the production of hydroxyl radicals, while DNA base modifications were mainly caused by ozone itself and the participation of hydroxyl radicals and/or singlet oxygen in base modifications is small, if any. A possible link of ozone-induced DNA damage to inflammation-associated carcinogenesis as well as air pollution-related carcinogenesis is discussed.

  2. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  3. The early epigenetic response to ozone: impacts on DNA ...

    EPA Pesticide Factsheets

    Epigenetics have been increasingly recognized as a mechanism linking environment and gene expression. Despite awareness of the role of DNA methylation and hydroxymethylation as potential drivers of the response to air pollutants, very little work has been performed investigating the direct epigenetic effects following exposure to ambient air pollution. Thus the purpose of this study was to investigate the early epigenetic response to ozone in comparison to the epigenetic modifier 5-aza-2'-deoxycytidine (5-Aza) in rats. 12 week old, male Long-Evans rats (n=16) were exposed to 4 hours of whole-body 1.0 ppm ozone or air and immediately euthanized. A subset of animals were additionally treated with 5-Aza (n=16) to serve as an epigenetic control to ozone exposure. Neither 5-Aza nor ozone by itself induced changes to the global methylome or hydroxmethylome of the lung measured by ELISA. Despite this finding, ozone exposure induced a significant increase in the activity of the DNA methyltransferase enzymes in the lung which was reversed with 5-Aza treatment. Interestingly, a significant interaction between 5-Aza treatment and ozone exposure was found in a large array of data. The interaction between 5-Aza and ozone produced indicators of pulmonary edema and elevated lung damage. Along with these adverse changes, expression of major epigenetic enzymes (Tet 1-3, Dnmt3 a-b) were found to be perturbed in both the lung and hepatic tissues. While ozone exposure appears to in

  4. Mode of degradation of plasmid DNA with ozone.

    PubMed

    Sawadaishi, K; Miura, K; Ohthuka, E; Ueda, T; Ishizaki, K; Shinriki, N

    1984-01-01

    The ozonization of pBR322 closed circular DNA showed the conversion to open circular DNA. The damaged site was investigated by restriction mapping. The results showed the damage and subsequent cleavage of the DNA strand of ccDNA by ozonization may occur at the region sensitive to nuclease S1.

  5. Ozone-induced inactivation of antioxidant enzymes.

    PubMed

    Lee, Yong-Ki; Mok Kim, Sang; Han, Sanghwa

    2003-10-01

    Ozone is an air pollutant that damages a variety of biomolecules. We investigated ozone-induced inactivation of three major antioxidant enzymes. Cu/Zn superoxide dismutase was inactivated by ozone in a concentration-dependent manner. The concentration of ozone for 50% inactivation was approximately 45 microM when 10 microM Cu/Zn superoxide dismutase was incubated for 30 min in the presence of ozone. SDS-polyacrylamide gel electrophoresis (PAGE) showed that the enzyme was randomly fragmented. Both ascorbate and glutathione were very effective in protecting Cu/Zn superoxide dismutase from ozone-induced inactivation. The other two enzymes, catalase and glutathione peroxidase, were much more resistant to ozone than Cu/Zn superoxide dismutase. The ozone concentrations for 50% inactivation of 10 microM catalase and glutathione peroxidase were 500 and 240 microM, respectively. SDS-PAGE demonstrated that ozone caused formation of high molecular weight aggregates in catalase and dimerization in glutathione peroxidase. Glutathione protected catalase and glutathione peroxidase from ozone but the effective concentrations were much higher than that for Cu/Zn superoxide dismutase. Ascorbate was almost ineffective. The result suggests that, among the three antioxidant enzymes, Cu/Zn superoxide dismutase is a major target for ozone-induced inactivation and both glutathione and ascorbate are very effective in protecting the enzyme from ozone.

  6. Isolation and characterization of cDNA for a plant mitochondrial phosphate translocator (Mpt1): ozone stress induces Mpt1 mRNA accumulation in birch (Betula pendula Roth).

    PubMed

    Kiiskinen, M; Korhonen, M; Kangasjärvi, J

    1997-10-01

    We have isolated by DDRT-PCR (differential-display reverse-transcription polymerase chain reaction) and cDNA library screening a 1.3 kb cDNA corresponding to a strongly ozone-inducible transcript from birch (Betula pendula Roth). Nucleotide sequence analysis suggests that it encodes a mitochondrial phosphate translocator protein (Pic), the first one isolated from plants. The isolated birch mitochondrial phosphate translocator cDNA (designated Mpt1) contains an open reading frame of 1092 bases encoding a 364 amino acid polypeptide. The deduced protein is 66% similar to bovine Pic isoform B. Comparison of the N-terminal amino acid sequence to known mammalian Pic proteins and the existence of an in-frame stop codon upstream of the initiation codon suggest that the isolated cDNA is full-length. Southern hybridization analysis of birch genomic DNA shows that Mpt1 is a single-copy gene. Accumulation of Mpt1 mRNA during oxidative stress imposed by ozone is detectable already at 2 h and it is at maximum ca. 12 h after the beginning of an 8 h ozone exposure (150 ppb). A second O3 peak at 48-56 h did not increase transcript levels further. O3 exposure for 2 h was sufficient for Mpt1 induction. Birch Mpt1 transcript levels remain at moderately low level during leaf development and is lower in roots and leaves when compared to young shoots undergoing wood formation and lignification.

  7. Reconciliation of Halogen-Induced Ozone Loss with the Total-Column Ozone Record

    NASA Technical Reports Server (NTRS)

    Shepherd, T. G.; Plummer, D. A.; Scinocca, J. F.; Hegglin, M. I.; Fioletov, V. E.; Reader, M. C.; Remsberg, E.; von Clarmann, T.; Wang, H. J.

    2014-01-01

    The observed depletion of the ozone layer from the 1980s onwards is attributed to halogen source gases emitted by human activities. However, the precision of this attribution is complicated by year-to-year variations in meteorology, that is, dynamical variability, and by changes in tropospheric ozone concentrations. As such, key aspects of the total-column ozone record, which combines changes in both tropospheric and stratospheric ozone, remain unexplained, such as the apparent absence of a decline in total-column ozone levels before 1980, and of any long-term decline in total-column ozone levels in the tropics. Here we use a chemistry-climate model to estimate changes in halogen-induced ozone loss between 1960 and 2010; the model is constrained by observed meteorology to remove the eects of dynamical variability, and driven by emissions of tropospheric ozone precursors to separate out changes in tropospheric ozone. We show that halogen-induced ozone loss closely followed stratospheric halogen loading over the studied period. Pronounced enhancements in ozone loss were apparent in both hemispheres following the volcanic eruptions of El Chichon and, in particular, Mount Pinatubo, which significantly enhanced stratospheric aerosol loads. We further show that approximately 40% of the long-term non-volcanic ozone loss occurred before 1980, and that long-term ozone loss also occurred in the tropical stratosphere. Finally, we show that halogeninduced ozone loss has declined by over 10% since stratospheric halogen loading peaked in the late 1990s, indicating that the recovery of the ozone layer is well underway.

  8. Acute Ozone-Induced Pulmonary and Systemic Metabolic ...

    EPA Pesticide Factsheets

    Acute ozone exposure increases circulating stress hormones and induces metabolic alterations in animals and humans. We hypothesized that the increase of adrenal-derived stress hormones is necessary for both ozone-induced metabolic effects and lung injury. Male Wistar-Kyoto rats underwent adrenal demedullation (DEMED), total bilateral adrenalectomy (ADREX), or sham surgery (SHAM). After a 4 day recovery, rats were exposed to air or ozone (1ppm), 4h/day for 1 or 2 days. Circulating adrenaline levels dropped to nearly zero in DEMED and ADREX rats relative to air-exposed SHAM. Corticosterone levels tended to be low in DEMED rats and dropped to nearly zero in ADREX rats. Adrenalectomy in air-exposed rats caused modest changes in metabolites and lung toxicity parameters. Ozone-induced hyperglycemia and glucose intolerance were markedly attenuated in DEMED rats with nearly complete reversal in ADREX rats. Ozone increased circulating epinephrine and corticosterone in SHAM but not in DEMED or ADREX rats. Free fatty acids (p=0.15) and branched-chain amino acids increased after ozone exposure in SHAM but not in DEMED or ADREX rats. Lung minute volume was not affected by surgery or ozone but ozone-induced labored breathing was less pronounced in ADREX rats. Ozone-induced increases in lung protein leakage and neutrophilic inflammation were markedly reduced in DEMED and ADREX rats (ADREX>DMED). Ozone-mediated decreases in circulating white blood cells in SHAM were not obser

  9. Acute Ozone-Induced Pulmonary and Systemic Metabolic ...

    EPA Pesticide Factsheets

    Acute ozone exposure increases circulating stress hormones and induces peripheral metabolic alterations in animals and humans. We hypothesized that the increase of adrenal-derived stress hormones is necessary for ozone-induced systemic metabolic effects and lung injury. Male Wistar-Kyoto rats (12 week-old) underwent total bilateral adrenalectomy (ADREX), adrenal demedullation (DEMED) or sham surgery (SHEM). After 4 day recovery, rats were exposed to air or ozone (1ppm), 4h/day for 1 or 2 days. Circulating adrenaline levels dropped to nearly zero in DEMED and ADREX rats relative to air-exposed SHAM. Corticosterone levels tended to be low in DEMED rats and dropped to nearly zero in ADREX rats. Adrenalectomy in air-exposed rats caused modest changes in metabolites and lung toxicity parameters. Ozone-induced hyperglycemia and glucose intolerance were markedly attenuated in DEMED with nearly complete reversal in ADREX rats. Ozone increased circulating epinephrine and corticosterone in SHAM but not in DEMED or ADREX rats. Free fatty acids and branched-chain amino acids tended to increase after ozone exposure in SHAM but not in DEMED or ADREX rats. Lung minute volume was not affected by surgery or ozone but ozone-induced labored breathing was less pronounced in ADREX rats. Ozone-induced increases in lung protein leakage and neutrophilic inflammation were markedly reduced in DEMED and ADREX rats (ADREX>DMED). Ozone-mediated decrease in circulating WBC in SHAM was not

  10. DNA synthesis in pulmonary alveolar macrophages and type II cells: effects of ozone exposure and treatment with alpha-difluoromethylornithine

    SciTech Connect

    Wright, E.S.; White, D.M.; Brady, A.N.; Li, L.C.; D'Arcy, J.B.; Smiler, K.L.

    1987-01-01

    An increase in the number of pulmonary alveolar macrophages (AM) can be induced by a number of toxic insults to the lung, including ozone, an important photochemical oxidant air pollutant. This increase could arise from an influx of monocytes from the vascular or interstitial compartments, or from proliferation of AM in situ. While proliferation of alveolar type II cells after oxidant exposure has been well documented, it is not clear whether AM are also capable of this response. Rats were exposed to air or to 0.12, 0.25, or 0.50 ppm ozone for 1, 2, 3, 7, or 14 d, 20 h/d. The labeling index in both AM and type II cells increased about 10-fold after 2 d of exposure to 0.25 and 0.50 ppm of ozone, but returned to control levels by the end of 1 wk of exposure. These changes closely paralleled the temporal and dose-response characteristics of changes in total lung DNA synthesis. alpha-Difluoromethylornithine (DFMO) administered to rats during a 2-d exposure to 0.50 ppm ozone did not inhibit the ozone-induced increase in labeling index in AM or type II cells, although evidence of inhibition of lung ornithine decarboxylase activity was obtained, and the ozone-induced increase in total lung DNA synthesis was inhibited by 23%. These results suggest that, like type II cells, AM are capable of entering the cell cycle and synthesizing new DNA in situ in response to short-term exposure to environmentally relevant doses of ozone, and that the ozone-induced stimulation of DNA synthesis in these cell types was refractory to inhibition by DFMO.

  11. Increased 8-hydroxyguanine content of chloroplast DNA from ozone-treated plants

    SciTech Connect

    Floyd, R.A.; West, M.S. ); Hogsett, W.E.; Tingey, D.T. )

    1989-10-01

    The mechanism of ozone-mediated plant injury is not known but has been postulated to involve oxygen free radicals. Hydroxyl free radicals react with DNA causing formation of many products, one of which is 8-hydroxyguanine. By using high performance liquid chromatography with electrochemical detection, the 8-hydroxy-2-{prime}-deoxyguanosine (8-OHdG) content of a DNA enzymatic digest can be sensitively quantitated. Beans (Phaseolus vulgaris L.) and peas (Pisum sativum L.) were treated with an ozone regime that caused acute injury. Chloroplast DNA was obtained from plants harvested either immediately after ozone treatment or 24 hours later. Ozone-exposed plants in general had nearly two-fold higher levels of 8-OHdG as compared to control plants. In vitro treatment of DNA in buffer solution with ozone did not cause formation of 8-OHdG in DNA, even though ozone did react directly with the macromolecule per se. Exposure of isolated, illuminated chloroplasts to ozone caused nearly a seven-fold increase in the amount of 8-OHdG in the chloroplast DNA as compared to none-ozone-exposed chloroplasts. These results suggest that ozone exposure to plants causes formation of enhanced levels of oxygen free radicals, thus mediating formation of 8-OHdG in chloroplast DNA. The reaction of ozone with DNA per se did not cause formation of 8-OHdG. Therefore, it is the interaction of ozone with plant cells and isolated chloroplasts which mediates oxygen free radical formation.

  12. ROCK insufficiency attenuates ozone-induced airway hyperresponsiveness in mice.

    PubMed

    Kasahara, David I; Mathews, Joel A; Park, Chan Y; Cho, Youngji; Hunt, Gabrielle; Wurmbrand, Allison P; Liao, James K; Shore, Stephanie A

    2015-10-01

    Ozone causes airway hyperresponsiveness (AHR) and pulmonary inflammation. Rho kinase (ROCK) is a key regulator of smooth muscle cell contraction and inflammatory cell migration. To determine the contribution of the two ROCK isoforms ROCK1 and ROCK2 to ozone-induced AHR, we exposed wild-type, ROCK1(+/-), and ROCK2(+/-) mice to air or ozone (2 ppm for 3 h) and evaluated mice 24 h later. ROCK1 or ROCK2 haploinsufficiency did not affect airway responsiveness in air-exposed mice but significantly reduced ozone-induced AHR, with a greater reduction in ROCK2(+/-) mice despite increased bronchoalveolar lavage (BAL) inflammatory cells in ROCK2(+/-) mice. Compared with wild-type mice, ozone-induced increases in BAL hyaluronan, a matrix protein implicated in ozone-induced AHR, were lower in ROCK1(+/-) but not ROCK2(+/-) mice. Ozone-induced increases in other inflammatory moieties reported to contribute to ozone-induced AHR (IL-17A, osteopontin, TNFα) were not different in wild-type vs. ROCK1(+/-) or ROCK2(+/-) mice. We also observed a dose-dependent reduction in ozone-induced AHR after treatment with the ROCK1/ROCK2 inhibitor fasudil, even though fasudil was administered after induction of inflammation. Ozone increased pulmonary expression of ROCK2 but not ROCK1 or RhoA. A ROCK2 inhibitor, SR3677, reduced contractile forces in primary human airway smooth muscle cells, confirming a role for ROCK2 in airway smooth muscle contraction. Our results demonstrate that ozone-induced AHR requires ROCK. Whereas ROCK1-dependent changes in hyaluronan may contribute to ROCK1's role in O3-induced AHR, the role of ROCK2 is downstream of inflammation, likely at the level of airway smooth muscle contraction.

  13. Ozone pollution and ozone biomonitoring in European cities Part II. Ozone-induced plant injury and its relationship with descriptors of ozone pollution

    NASA Astrophysics Data System (ADS)

    Klumpp, Andreas; Ansel, Wolfgang; Klumpp, Gabriele; Vergne, Phillippe; Sifakis, Nicolas; Sanz, María José; Rasmussen, Stine; Ro-Poulsen, Helge; Ribas, Àngela; Peñuelas, Josep; Kambezidis, Harry; He, Shang; Garrec, Jean Pierre; Calatayud, Vicent

    Within the scope of a biomonitoring study conducted in twelve urban agglomerations in eight European countries, the ozone-sensitive bioindicator plant Nicotiana tabacum cv. Bel-W3 was employed in order to assess the occurrence of phytotoxic ozone effects at urban, suburban, rural and traffic-exposed sites. The tobacco plants were exposed to ambient air for biweekly periods at up to 100 biomonitoring sites from 2000 to 2002. Special emphasis was placed upon methodological standardisation of plant cultivation, field exposure and injury assessment. Ozone-induced leaf injury showed a clearly increasing gradient from northern and northwestern Europe to central and southern European locations. The strongest ozone impact occurred at the exposure sites in Lyon and Barcelona, while in Edinburgh, Sheffield, Copenhagen and Düsseldorf only weak to moderate ozone effects were registered. Between-site differences within local networks were relatively small, but seasonal and inter-annual differences were strong due to the variability of meteorological conditions and related ozone concentrations. The 2001 data revealed a significant relationship between foliar injury degree and various descriptors of ozone pollution such as mean value, AOT20 and AOT40. Examining individual sites of the local monitoring networks separately, however, yielded noticeable differences. Some sites showed no association between ozone pollution and ozone-induced effects, whereas others featured almost linear relationships. This is because the actual ozone flux into the leaf, which is modified by various environmental factors, rather than ambient ozone concentration determines the effects on plants. The advantage of sensitive bioindicators like tobacco Bel-W3 is that the impact of the effectively absorbed ozone dose can directly be measured.

  14. Ozone-induced ethylene release from leaf surfaces

    SciTech Connect

    Rodecap, K.D.; Tingey, D.T.

    1986-01-01

    Ozone-induced stress-ethylene emissions from the adaxial and abaxial leaf surfaces of four plant species (Glycine max (L) Merr. cv. Dare, Lycopersicon esculentum Mill cv. Roma VF, Eucalyptus globulus Labill. and Hedera helix L.) were studied to determine if the stress ethylene diffused through the stomata or cuticle. In plants not exposed to ozone, basal ethylene was detected above both the adaxial and abaxial leaf surfaces of all the plant species examined, indicating that some ethylene can diffuse across the leaf cuticle. Oxone-induced stress ethylene production in all species examined. These data indicate that ozone-induced stress ethylene primarily diffuses from the leaf via the stomata.

  15. Virucidal levels of ozone induce hemolysis and hemoglobin degradation

    SciTech Connect

    Wagner, S.J.; Wagner, K.F.; Friedman, L.I.; Benade, L.F. )

    1991-10-01

    The animal virus, vesicular stomatitis virus (VSV), and the bacterial virus, phi 6, were inactivated by greater than 4 log10 in response to incubation with 13 to 14 mL of 1.4 mmol per L (65 micrograms/mL) to 1.6 mmol per L (75 micrograms/mL) of overlaid ozone in virus-spiked, dilute, red cell suspensions. Virus inactivation was greatly inhibited when ozone was overlaid in the presence of high-hematocrit red cells or, to a lesser degree, high levels of plasma. At hematocrits at which 5 to 6 log10 of VSV were inactivated, ozone caused 30-percent hemolysis, as measured by the loss of total cellular hemoglobin. Unexpectedly, this level of hemolysis could not be observed in supernatants because of the ozone-induced destruction (bleaching) of extracellular hemoglobin. These results suggest that ozone may have little biological specificity for damaging viruses over red cells.

  16. Ozone-induced IL-17A and neutrophilic airway inflammation is orchestrated by the caspase-1-IL-1 cascade.

    PubMed

    Che, Luanqing; Jin, Yan; Zhang, Chao; Lai, Tianwen; Zhou, Hongbin; Xia, Lixia; Tian, Baoping; Zhao, Yun; Liu, Juan; Wu, Yinfang; Wu, Yanping; Du, Jie; Li, Wen; Ying, Songmin; Chen, Zhihua; Shen, Huahao

    2016-01-07

    Ozone is a common environmental air pollutant leading to respiratory illness. The mechanisms regulating ozone-induced airway inflammation remain poorly understood. We hypothesize that ozone-triggered inflammasome activation and interleukin (IL)-1 production regulate neutrophilic airway inflammation through IL-17A. Pulmonary neutrophilic inflammation was induced by extended (72 h) low-dose (0.7 ppm) exposure to ozone. IL-1 receptor 1 (Il1r1)(-/-), Il17a(-/-) mice and the caspase-1 inhibitor acetyl-YVAD-chloromethylketone (Ac-YVAD-cmk) were used for in vivo studies. Cellular inflammation and protein levels in bronchial alveolar lavage fluid (BALF), cytokines, and IL-17A-producing γδT-cells, as well as mitochondrial reactive oxygen species (ROS), mitochondrial DNA (mtDNA) release, and inflammasome activation in lung macrophages were analyzed. Ozone-induced neutrophilic airway inflammation, accompanied an increased production of IL-1β, IL-18, IL-17A, Granulocyte-colony stimulating factor (G-CSF), Interferon-γ inducible protein 10 (IP-10) and BALF protein in the lung. Ozone-induced IL-17A production was predominantly in γδT-cells, and Il17a-knockout mice exhibited reduced airway inflammation. Lung macrophages from ozone-exposed mice exhibited higher levels of mitochondrial ROS, enhanced cytosolic mtDNA, increased caspase-1 activation, and higher production of IL-1β. Il1r1-knockout mice or treatment with Ac-YVAD-cmk decreased the IL-17A production and subsequent airway inflammation. Taken together, we demonstrate that ozone-induced IL-17A and neutrophilic airway inflammation is orchestrated by the caspase-1-IL-1 cascade.

  17. DNA Damage Induced Neuronal Death

    DTIC Science & Technology

    1999-10-01

    Experiments are proposed to examine the molecular mechanism by which mustard chemical warfare agents induce neuronal cell death . DNA damage is the...proposed underlying mechanism of mustard-induced neuronal cell death . We propose a novel research strategy to test this hypothesis by using mice with...perturbed DNA repair to explore the relationship between mustard-induced DNA damage and neuronal cell death . Initial in vitro studies (Years 1, 2 & 3

  18. Ozone-Induced Hypertussive Responses in Rabbits and Guinea Pigs

    PubMed Central

    Clay, Emlyn; Patacchini, Riccardo; Trevisani, Marcello; Preti, Delia; Branà, Maria Pia; Spina, Domenico

    2016-01-01

    Cough remains a major unmet clinical need, and preclinical animal models are not predictive for new antitussive agents. We have investigated the mechanisms and pharmacological sensitivity of ozone-induced hypertussive responses in rabbits and guinea pigs. Ozone induced a significant increase in cough frequency and a decrease in time to first cough to inhaled citric acid in both conscious guinea pigs and rabbits. This response was inhibited by the established antitussive drugs codeine and levodropropizine. In contrast to the guinea pig, hypertussive responses in the rabbit were not inhibited by bronchodilator drugs (β2 agonists or muscarinic receptor antagonists), suggesting that the observed hypertussive state was not secondary to bronchoconstriction in this species. The ozone-induced hypertussive response in the rabbit was inhibited by chronic pretreatment with capsaicin, suggestive of a sensitization of airway sensory nerve fibers. However, we could find no evidence for a role of TRPA1 in this response, suggesting that ozone was not sensitizing airway sensory nerves via activation of this receptor. Whereas the ozone-induced hypertussive response was accompanied by a significant influx of neutrophils into the airway, the hypertussive response was not inhibited by the anti-inflammatory phosphodiesterase 4 inhibitor roflumilast at a dose that clearly exhibited anti-inflammatory activity. In summary, our results suggest that ozone-induced hypertussive responses to citric acid may provide a useful model for the investigation of novel drugs for the treatment of cough, but some important differences were noted between the two species with respect to sensitivity to bronchodilator drugs. PMID:26837703

  19. Ozone-Induced Hypertussive Responses in Rabbits and Guinea Pigs.

    PubMed

    Clay, Emlyn; Patacchini, Riccardo; Trevisani, Marcello; Preti, Delia; Branà, Maria Pia; Spina, Domenico; Page, Clive

    2016-04-01

    Cough remains a major unmet clinical need, and preclinical animal models are not predictive for new antitussive agents. We have investigated the mechanisms and pharmacological sensitivity of ozone-induced hypertussive responses in rabbits and guinea pigs. Ozone induced a significant increase in cough frequency and a decrease in time to first cough to inhaled citric acid in both conscious guinea pigs and rabbits. This response was inhibited by the established antitussive drugs codeine and levodropropizine. In contrast to the guinea pig, hypertussive responses in the rabbit were not inhibited by bronchodilator drugs (β2 agonists or muscarinic receptor antagonists), suggesting that the observed hypertussive state was not secondary to bronchoconstriction in this species. The ozone-induced hypertussive response in the rabbit was inhibited by chronic pretreatment with capsaicin, suggestive of a sensitization of airway sensory nerve fibers. However, we could find no evidence for a role of TRPA1 in this response, suggesting that ozone was not sensitizing airway sensory nerves via activation of this receptor. Whereas the ozone-induced hypertussive response was accompanied by a significant influx of neutrophils into the airway, the hypertussive response was not inhibited by the anti-inflammatory phosphodiesterase 4 inhibitor roflumilast at a dose that clearly exhibited anti-inflammatory activity. In summary, our results suggest that ozone-induced hypertussive responses to citric acid may provide a useful model for the investigation of novel drugs for the treatment of cough, but some important differences were noted between the two species with respect to sensitivity to bronchodilator drugs.

  20. Ozone depletion and UVB radiation: impact on plant DNA damage in southern South America.

    PubMed

    Rousseaux, M C; Ballaré, C L; Giordano, C V; Scopel, A L; Zima, A M; Szwarcberg-Bracchitta, M; Searles, P S; Caldwell, M M; Díaz, S B

    1999-12-21

    The primary motivation behind the considerable effort in studying stratospheric ozone depletion is the potential for biological consequences of increased solar UVB (280-315 nm) radiation. Yet, direct links between ozone depletion and biological impacts have been established only for organisms of Antarctic waters under the influence of the ozone "hole;" no direct evidence exists that ozone-related variations in UVB affect ecosystems of temperate latitudes. Indeed, calculations based on laboratory studies with plants suggest that the biological impact of ozone depletion (measured by the formation of cyclobutane pyrimidine dimers in DNA) is likely to be less marked than previously thought, because UVA quanta (315-400 nm) may also cause significant damage, and UVA is unaffected by ozone depletion. Herein, we show that the temperate ecosystems of southern South America have been subjected to increasingly high levels of ozone depletion during the last decade. We found that in the spring of 1997, despite frequent cloud cover, the passages of the ozone hole over Tierra del Fuego (55 degrees S) caused concomitant increases in solar UV and that the enhanced ground-level UV led to significant increases in DNA damage in the native plant Gunnera magellanica. The fluctuations in solar UV explained a large proportion of the variation in DNA damage (up to 68%), particularly when the solar UV was weighted for biological effectiveness according to action spectra that assume a sharp decline in quantum efficiency with increasing wavelength from the UVB into the UVA regions of the spectrum.

  1. Ozone

    MedlinePlus

    ... reactive form of oxygen. In the upper atmosphere, ozone forms a protective layer that shields us from the sun’s ultraviolet rays. At ground level, ozone is a harmful air pollutant and a primary ...

  2. A comprehensive analysis of oxidative stress in the ozone-induced lung inflammation mouse model.

    PubMed

    Wiegman, Coen H; Li, Feng; Clarke, Colin J; Jazrawi, Elen; Kirkham, Paul; Barnes, Peter J; Adcock, Ian M; Chung, Kian F

    2014-03-01

    Ozone is an oxidizing environmental pollutant that contributes significantly to respiratory health. Exposure to increased levels of ozone has been associated with worsening of symptoms of patients with asthma and COPD (chronic obstructive pulmonary disease). In the present study, we investigated the acute and chronic effects of ozone exposure-induced oxidative stress-related inflammation mechanics in mouse lung. In particular, we investigated the oxidative stress-induced effects on HDAC2 (histone deacetylase 2) modification and activation of the Nrf2 (nuclear factor erythroid-related factor 2) and HIF-1α (hypoxia-inducible factor-1α) signalling pathways. Male C57BL/6 mice were exposed to ozone (3 p.p.m.) for 3 h a day, twice a week for a period of 1, 3 or 6 weeks. Control mice were exposed to normal air. After the last exposure, mice were killed for BAL (bronchoalveolar lavage) fluid and lung tissue collection. BAL total cell counts were elevated at all of the time points studied. This was associated with increased levels of chemokines and cytokines in all ozone-exposed groups, indicating the presence of a persistent inflammatory environment in the lung. Increased inflammation and Lm (mean linear intercept) scores were observed in chronic exposed mice, indicating emphysematous changes were present in lungs of chronic exposed mice. The antioxidative stress response was active (indicated by increased Nrf2 activity and protein) after 1 week of ozone exposure, but this ability was lost after 3 and 6 weeks of ozone exposure. The transcription factor HIF-1α was elevated in 3- and 6-week ozone-exposed mice and this was associated with increased gene expression levels of several HIF-1α target genes including Hdac2 (histone deacetylase 2), Vegf (vascular endothelial growth factor), Keap1 (kelch-like ECH-associated protein 1) and Mif (macrophage migration inhibitory factor). HDAC2 protein was found to be phosphorylated and carbonylated in nuclear and cytoplasm fractions

  3. Ozone

    MedlinePlus

    Ozone is a gas. It can be good or bad, depending on where it is. "Good" ozone occurs naturally about 10 to 30 miles above ... the sun's ultraviolet rays. Part of the good ozone layer is gone. Man-made chemicals have destroyed ...

  4. Nanostructure-induced DNA condensation

    NASA Astrophysics Data System (ADS)

    Zhou, Ting; Llizo, Axel; Wang, Chen; Xu, Guiying; Yang, Yanlian

    2013-08-01

    The control of the DNA condensation process is essential for compaction of DNA in chromatin, as well as for biological applications such as nonviral gene therapy. This review endeavours to reflect the progress of investigations on DNA condensation effects of nanostructure-based condensing agents (such as nanoparticles, nanotubes, cationic polymer and peptide agents) observed by using atomic force microscopy (AFM) and other techniques. The environmental effects on structural characteristics of nanostructure-induced DNA condensates are also discussed.

  5. INHALATION OF OZONE AND DIESEL EXHAUST PARTICLES (DEP) INDUCES ACUTE AND REVERSIBLE CARDIAC GENE EXPRESSION CHANGES

    EPA Science Inventory

    We have recently shown that episodic but not acute exposure to ozone or DEP induces vascular effects that are associated with the loss of cardiac mitochondrial phospholipid fatty acids (DEP 2.0 mg/m3 > ozone, 0.4 ppm). In this study we determined ozone and DEP-induced cardiac gen...

  6. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )

    1993-05-01

    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.

  7. Ozone-Induced Pulmonary Injury and Inflammation are Modulated by Adrenal-Derived Stress Hormones

    EPA Science Inventory

    Ozone exposure promotes pulmonary injury and inflammation. Previously we have characterized systemic changes that occur immediately after acute ozone exposure and are mediated by neuro-hormonal stress response pathway. Both HPA axis and sympathetic tone alterations induce the rel...

  8. Role of neutrophilic inflammation in ozone-induced epithelial alterations in the nasal airways of rats

    NASA Astrophysics Data System (ADS)

    Cho, Hye Youn

    Ozone is a principal oxidant air pollutant in photochemical smog. Epithelial cells lining the centriacinar region of lung and the proximal aspects of nasal passage are primary target sites for ozone-induced injury in laboratory animals. Acute exposure of rats to high ambient concentrations of ozone (e.g., 0.5 ppm) results in neutrophilic inflammation, epithelial hyperplasia and mucous cell metaplasia (MCM) in the nasal transitional epithelium (NTE) lining the proximal nasal airways. The principal purpose of the present study was to investigate the role of pre-metaplastic cellular responses, especially neutrophilic inflammation, in the pathogenesis of ozone-induced MCM in rat NTE. For this purpose, three specific hypotheses-based whole-animal inhalation studies were conducted. Male F344/N rats were exposed in whole-body inhalation chambers to 0 (filtered air) or 0.5 ppm ozone for 1-3 days (8 h/day). Histochemical, immunochemical, molecular and morphometric techniques were used to investigate the ozone-induced cellular and molecular events in the NTE. Two in vitro studies were also conducted to examine the effects of ozone-inducible cytokines (i.e., tumor necrosis factor-alpha; TNF- a, and interleukin-6; IL-6) on mucin gene (rMuc-5AC) expression. Ozone induced a rapid increase of rMuc-5AC mRNA in nasal tissues within hours after the start of exposure. It preceded the appearance of MCM, and persisted with MCM. Ozone-induced neutrophilic inflammation accompanied the mucin gene upregulation, but was resolved when MCM first appeared in the NTE. Antibody-mediated depletion of circulating neutrophils attenuated ozone-induced MCM, although it did not affect the ozone-induced epithelial hyperplasia and mucin mRNA upregulation. In another study, it was found that preexisting neutrophilic rhinitis induced by endotoxin augmented the ozone-induced MCM. However, pre-existing rhinitis did not alter the severity of ozone-induced epithelial hyperplasia and mucin gene upregulation

  9. Ozone therapy ameliorates paraquat-induced lung injury in rats.

    PubMed

    Kaldirim, Umit; Uysal, Bulent; Yuksel, Ramazan; Macit, Enis; Eyi, Yusuf E; Toygar, Mehmet; Tuncer, Salim K; Ardic, Sukru; Arziman, Ibrahim; Aydin, Ibrahim; Oztas, Yesim; Karslioglu, Yildirim; Topal, Turgut

    2014-12-01

    Paraquat (PQ) overdose can cause acute lung injury and death. Ozone therapy (OT) was previously demonstrated to alleviate inflammation and necrosis in various pathologies. We therefore hypothesized that OT has ameliorative and preventive effects on PQ-induced lung damage due to anti-inflammatory and antioxidants properties. Sprague-Dawley rats (n = 24) were separated into three groups: sham, PQ, and PQ+OT groups. 15 mg/kg PQ was administered intraperitoneally in PQ and PQ+OT groups to induce experimental lung injury. One hour after PQ treatment, PQ+OT group was administered a single dose of ozone-oxygen mixture (1 mg/kg/day) by intraperitoneal route for four consecutive days. The animals were sacrificed on fifth day after PQ administration. Blood samples and lung tissues were collected to evaluate the inflammatory processes, antioxidant defense and pulmonary damage. Serum lactate dehydrogenase (LDH) and neopterin levels, tissue oxidative stress parameters, total TGF-β1 levels, and histological injury scores in PQ+OT group were significantly lower than PQ group (P<0.05, PQ vs. PQ+OT). Total antioxidant capacity in PQ+OT group was significantly higher than PQ group (P < 0.05, PQ+OT vs. PQ). These findings suggest that outcome in PQ-induced lung injury may be improved by using OT as an adjuvant therapy.

  10. Ozone-induced stomatal sluggishness changes carbon and water balance of temperate deciduous forests

    NASA Astrophysics Data System (ADS)

    Hoshika, Yasutomo; Katata, Genki; Deushi, Makoto; Watanabe, Makoto; Koike, Takayoshi; Paoletti, Elena

    2015-05-01

    Tropospheric ozone concentrations have increased by 60-100% in the Northern Hemisphere since the 19th century. The phytotoxic nature of ozone can impair forest productivity. In addition, ozone affects stomatal functions, by both favoring stomatal closure and impairing stomatal control. Ozone-induced stomatal sluggishness, i.e., a delay in stomatal responses to fluctuating stimuli, has the potential to change the carbon and water balance of forests. This effect has to be included in models for ozone risk assessment. Here we examine the effects of ozone-induced stomatal sluggishness on carbon assimilation and transpiration of temperate deciduous forests in the Northern Hemisphere in 2006-2009 by combining a detailed multi-layer land surface model and a global atmospheric chemistry model. An analysis of results by ozone FACE (Free-Air Controlled Exposure) experiments suggested that ozone-induced stomatal sluggishness can be incorporated into modelling based on a simple parameter (gmin, minimum stomatal conductance) which is used in the coupled photosynthesis-stomatal model. Our simulation showed that ozone can decrease water use efficiency, i.e., the ratio of net CO2 assimilation to transpiration, of temperate deciduous forests up to 20% when ozone-induced stomatal sluggishness is considered, and up to only 5% when the stomatal sluggishness is neglected.

  11. Ozone-induced stomatal sluggishness changes carbon and water balance of temperate deciduous forests.

    PubMed

    Hoshika, Yasutomo; Katata, Genki; Deushi, Makoto; Watanabe, Makoto; Koike, Takayoshi; Paoletti, Elena

    2015-05-06

    Tropospheric ozone concentrations have increased by 60-100% in the Northern Hemisphere since the 19(th) century. The phytotoxic nature of ozone can impair forest productivity. In addition, ozone affects stomatal functions, by both favoring stomatal closure and impairing stomatal control. Ozone-induced stomatal sluggishness, i.e., a delay in stomatal responses to fluctuating stimuli, has the potential to change the carbon and water balance of forests. This effect has to be included in models for ozone risk assessment. Here we examine the effects of ozone-induced stomatal sluggishness on carbon assimilation and transpiration of temperate deciduous forests in the Northern Hemisphere in 2006-2009 by combining a detailed multi-layer land surface model and a global atmospheric chemistry model. An analysis of results by ozone FACE (Free-Air Controlled Exposure) experiments suggested that ozone-induced stomatal sluggishness can be incorporated into modelling based on a simple parameter (gmin, minimum stomatal conductance) which is used in the coupled photosynthesis-stomatal model. Our simulation showed that ozone can decrease water use efficiency, i.e., the ratio of net CO2 assimilation to transpiration, of temperate deciduous forests up to 20% when ozone-induced stomatal sluggishness is considered, and up to only 5% when the stomatal sluggishness is neglected.

  12. Ozone-induced stomatal sluggishness changes carbon and water balance of temperate deciduous forests

    PubMed Central

    Hoshika, Yasutomo; Katata, Genki; Deushi, Makoto; Watanabe, Makoto; Koike, Takayoshi; Paoletti, Elena

    2015-01-01

    Tropospheric ozone concentrations have increased by 60–100% in the Northern Hemisphere since the 19th century. The phytotoxic nature of ozone can impair forest productivity. In addition, ozone affects stomatal functions, by both favoring stomatal closure and impairing stomatal control. Ozone-induced stomatal sluggishness, i.e., a delay in stomatal responses to fluctuating stimuli, has the potential to change the carbon and water balance of forests. This effect has to be included in models for ozone risk assessment. Here we examine the effects of ozone-induced stomatal sluggishness on carbon assimilation and transpiration of temperate deciduous forests in the Northern Hemisphere in 2006-2009 by combining a detailed multi-layer land surface model and a global atmospheric chemistry model. An analysis of results by ozone FACE (Free-Air Controlled Exposure) experiments suggested that ozone-induced stomatal sluggishness can be incorporated into modelling based on a simple parameter (gmin, minimum stomatal conductance) which is used in the coupled photosynthesis-stomatal model. Our simulation showed that ozone can decrease water use efficiency, i.e., the ratio of net CO2 assimilation to transpiration, of temperate deciduous forests up to 20% when ozone-induced stomatal sluggishness is considered, and up to only 5% when the stomatal sluggishness is neglected. PMID:25943276

  13. A search for relativistic electron induced stratospheric ozone depletion

    NASA Technical Reports Server (NTRS)

    Aikin, Arthur C.

    1994-01-01

    Possible ozone changes at 1 mb associated with the time variation and precipitation of relativistic electrons are investigated by examining the NIMBUS 7 SBUV ozone data set and corresponding temperatures derived from NMC data. No ozone depletion was observed in high-latitude summer when temperature fluctuations are small. In winter more variation in ozone occurs, but large temperature changes make it difficult to identify specific ozone decreases as being the result of relativistic electron precipitation.

  14. Meteorology-induced variations in the spatial behavior of summer ozone pollution in Central California

    SciTech Connect

    Jin, Ling; Harley, Robert A.; Brown, Nancy J.

    2010-06-23

    Cluster analysis was applied to daily 8 h ozone maxima modeled for a summer season to characterize meteorology-induced variations in the spatial distribution of ozone. Principal component analysis is employed to form a reduced dimension set to describe and interpret ozone spatial patterns. The first three principal components (PCs) capture {approx}85% of total variance, with PC1 describing a general spatial trend, and PC2 and PC3 each describing a spatial contrast. Six clusters were identified for California's San Joaquin Valley (SJV) with two low, three moderate, and one high-ozone cluster. The moderate ozone clusters are distinguished by elevated ozone levels in different parts of the valley: northern, western, and eastern, respectively. The SJV ozone clusters have stronger coupling with the San Francisco Bay area (SFB) than with the Sacramento Valley (SV). Variations in ozone spatial distributions induced by anthropogenic emission changes are small relative to the overall variations in ozone amomalies observed for the whole summer. Ozone regimes identified here are mostly determined by the direct and indirect meteorological effects. Existing measurement sites are sufficiently representative to capture ozone spatial patterns in the SFB and SV, but the western side of the SJV is under-sampled.

  15. Stressed lungs: unveiling the role of circulating stress hormones in ozone-induced lung injury and inflammation.

    EPA Science Inventory

    Ozone, a major component of smog generated through the interaction of light and anthropogenic emissions, induces adverse pulmonary, cardiovascular, and systemic health effects upon inhalation. It is generally accepted that ozone-induced lung injury is mediated by its interaction ...

  16. Bioinforrnatics of Gene Expression Profiling Data Provide Mechanistic Understanding of Acute Ozone-Induced Lung injury

    EPA Science Inventory

    Acute ozone-induced pulmonary injury and inflammation are well characterized. A few studies have used gene expression profiling to determine the types of changes induced by ozone; however the mechanisms or the pathways involved are less well understood. We presumed that robust bi...

  17. Acute Ozone-Induced Pulmonary and Systemic Metabolic Effects are Diminished in Adrenalectomized Rats#

    EPA Science Inventory

    Acute ozone exposure increases circulating stress hormones and induces metabolic alterations in animals and humans. We hypothesized that the increase of adrenal-derived stress hormones is necessary for both ozone-induced metabolic effects and lung injury. Male Wistar-Kyoto rats ...

  18. Acute Ozone-Induced Pulmonary and Systemic Metabolic Effects are Diminished in Adrenalectomized Rats

    EPA Science Inventory

    Acute ozone exposure increases circulating stress hormones and induces peripheral metabolic alterations in animals and humans. We hypothesized that the increase of adrenal-derived stress hormones is necessary for ozone-induced systemic metabolic effects and lung injury. Male Wis...

  19. Ozone

    SciTech Connect

    Not Available

    1988-06-01

    The author discusses the debate over whether concern about a hole in the ozone layer in Antarctic is real or science fiction. There is a growing consensus that efforts must be taken to protect the ozone layer. The issue now is not whether chlorofluorocarbons (CFCs) should be controlled and regulated but how much and how soon. The United States has urged that the production of dangerous CFCs, and any other chemicals that affect the ozone layer, be restricted immediately to current levels and that their use be reduced 95 percent over the next decade. The American position was too strong for many European nations and the Japanese. Negotiations at an international conference on the matter broke down. The breakdown is due in part to a more acute concern for environmental matters in the United States than exists in many countries. Meanwhile CFCs are linked to another environmental problem that equally threatens the world - the Greenhouse Effect. The earth is in a natural warming period, but man could be causing it to become even warmer. The Greenhouse Effect could have a catastrophic impact on mankind, although nothing has been proven yet.

  20. Ozone induces glucose intolerance and systemic metabolic effects in young and aged Brown Norway rats.

    PubMed

    Bass, V; Gordon, C J; Jarema, K A; MacPhail, R C; Cascio, W E; Phillips, P M; Ledbetter, A D; Schladweiler, M C; Andrews, D; Miller, D; Doerfler, D L; Kodavanti, U P

    2013-12-15

    Air pollutants have been associated with increased diabetes in humans. We hypothesized that ozone would impair glucose homeostasis by altering insulin signaling and/or endoplasmic reticular (ER) stress in young and aged rats. One, 4, 12, and 24 month old Brown Norway (BN) rats were exposed to air or ozone, 0.25 or 1.0 ppm, 6 h/day for 2 days (acute) or 2 d/week for 13 weeks (subchronic). Additionally, 4 month old rats were exposed to air or 1.0 ppm ozone, 6 h/day for 1 or 2 days (time-course). Glucose tolerance tests (GTT) were performed immediately after exposure. Serum and tissue biomarkers were analyzed 18 h after final ozone for acute and subchronic studies, and immediately after each day of exposure in the time-course study. Age-related glucose intolerance and increases in metabolic biomarkers were apparent at baseline. Acute ozone caused hyperglycemia and glucose intolerance in rats of all ages. Ozone-induced glucose intolerance was reduced in rats exposed for 13 weeks. Acute, but not subchronic ozone increased α2-macroglobulin, adiponectin and osteopontin. Time-course analysis indicated glucose intolerance at days 1 and 2 (2>1), and a recovery 18 h post ozone. Leptin increased day 1 and epinephrine at all times after ozone. Ozone tended to decrease phosphorylated insulin receptor substrate-1 in liver and adipose tissues. ER stress appeared to be the consequence of ozone induced acute metabolic impairment since transcriptional markers of ER stress increased only after 2 days of ozone. In conclusion, acute ozone exposure induces marked systemic metabolic impairments in BN rats of all ages, likely through sympathetic stimulation.

  1. Anti-inflammatory drug (BW755C) inhibits airway hyperresponsiveness induced by ozone in dogs

    SciTech Connect

    Fabbri, L.M.; Aizawa, H.; O'Byrne, P.M.; Bethel, R.A.; Walters, E.H.; Holtzman, M.J.; Nadel, J.A.

    1985-08-01

    To follow up a previous observation that airway hyperresponsiveness induced by ozone is linked to airway inflammation, the authors investigated the effect of BW755C, an anti-inflammatory drug, on ozone-induced hyperresponsiveness in dogs. Airway responsiveness was assessed with dose-response curves of acetylcholine aerosol versus pulmonary resistance in two sets of experiments. In one set (placebo treatment), five dogs were given only saline solution treatment and were studied before treatment or ozone exposure and then after treatment both before and after ozone (3.0 ppm, 2 hours); in another set (BW755C treatment), the same dogs were studied before BW755C treatment or ozone and then after treatment (10 mg/kg intravenously) both before and after ozone. When the dogs were given no BW755C treatment, ozone induced a marked increase in airway responsiveness to acetylcholine. When the dogs were given BW755C, responsiveness was no different during treatment than before treatment but, more importantly, responsiveness did not increase significantly after ozone. The authors conclude that BW755C markedly inhibits ozone-induced airway hyperresponsiveness in dogs, probably by inhibiting the formation of oxygenation products of arachidonic acid.

  2. Impact of dynamically induced ozone mini-hole events on PSC formation and chemical ozone destruction

    NASA Astrophysics Data System (ADS)

    Stenke, A.; Grewe, V.

    2004-01-01

    The impact of ozone mini-holes over the extra-tropics of the northern hemisphere on the heterogeneous ozone chemistry is investigated, based on simulations with the coupled climate-chemistry model ECHAM4.L39(DLR)/CHEM. Ozone mini-holes are synoptic-scale regions of strongly reduced total ozone, directly associated with upper troposphere high pressure systems. The simulated mini-hole events are validated with a mini-hole climatology based on daily ozone measurements with the total ozone mapping spectrometer (TOMS) instrument on the satellite Nimbus-7 between 1979 and 1993. Furthermore, the impact of mini-holes on the stratospheric heterogeneous ozone chemistry is investigated indirectly. For this purpose, polar stratospheric cloud formation inside mini-holes is suppressed during the model simulation. Heterogeneous processes inside mini-holes amount to one third of the heterogeneous ozone destruction in general over northern mid- and high-latitudes during winter (January-April). This ozone perturbation subsides and recovers during summer with an e-folding time of two months.

  3. Acute Ozone-Induced Pulmonary and Systemic Metabolic Effects Are Diminished in Adrenalectomized Rats.

    PubMed

    Miller, Desinia B; Snow, Samantha J; Schladweiler, Mette C; Richards, Judy E; Ghio, Andrew J; Ledbetter, Allen D; Kodavanti, Urmila P

    2016-04-01

    Acute ozone exposure increases circulating stress hormones and induces metabolic alterations in animals. We hypothesized that the increase of adrenal-derived stress hormones is necessary for both ozone-induced metabolic effects and lung injury. Male Wistar-Kyoto rats underwent bilateral adrenal demedullation (DEMED), total bilateral adrenalectomy (ADREX), or sham surgery (SHAM). After a 4 day recovery, rats were exposed to air or ozone (1 ppm), 4 h/day for 1 or 2 days and responses assessed immediately postexposure. Circulating adrenaline levels dropped to nearly zero in DEMED and ADREX rats relative to SHAM. Corticosterone tended to be low in DEMED rats and dropped to nearly zero in ADREX rats. Adrenalectomy in air-exposed rats caused modest changes in metabolites and lung toxicity parameters. Ozone-induced hyperglycemia and glucose intolerance were markedly attenuated in DEMED rats with nearly complete reversal in ADREX rats. Ozone increased circulating epinephrine and corticosterone in SHAM but not in DEMED or ADREX rats. Free fatty acids (P = .15) and branched-chain amino acids increased after ozone exposure in SHAM but not in DEMED or ADREX rats. Lung minute volume was not affected by surgery or ozone but ozone-induced labored breathing was less pronounced in ADREX rats. Ozone-induced increases in lung protein leakage and neutrophilic inflammation were markedly reduced in DEMED and ADREX rats (ADREX > DEMED). Ozone-mediated decreases in circulating white blood cells in SHAM were not observed in DEMED and ADREX rats. We demonstrate that ozone-induced peripheral metabolic effects and lung injury/inflammation are mediated through adrenal-derived stress hormones likely via the activation of stress response pathway.

  4. Jasmonic acid signaling modulates ozone-induced hypersensitive cell death.

    PubMed

    Rao, M V; Lee, H; Creelman, R A; Mullet, J E; Davis, K R

    2000-09-01

    Recent studies suggest that cross-talk between salicylic acid (SA)-, jasmonic acid (JA)-, and ethylene-dependent signaling pathways regulates plant responses to both abiotic and biotic stress factors. Earlier studies demonstrated that ozone (O(3)) exposure activates a hypersensitive response (HR)-like cell death pathway in the Arabidopsis ecotype Cvi-0. We now have confirmed the role of SA and JA signaling in influencing O(3)-induced cell death. Expression of salicylate hydroxylase (NahG) in Cvi-0 reduced O(3)-induced cell death. Methyl jasmonate (Me-JA) pretreatment of Cvi-0 decreased O(3)-induced H(2)O(2) content and SA concentrations and completely abolished O(3)-induced cell death. Cvi-0 synthesized as much JA as did Col-0 in response to O(3) exposure but exhibited much less sensitivity to exogenous Me-JA. Analyses of the responses to O(3) of the JA-signaling mutants jar1 and fad3/7/8 also demonstrated an antagonistic relationship between JA- and SA-signaling pathways in controlling the magnitude of O(3)-induced HR-like cell death.

  5. Ethylene insensitivity modulates ozone-induced cell death in birch.

    PubMed

    Vahala, Jorma; Ruonala, Raili; Keinänen, Markku; Tuominen, Hannele; Kangasjärvi, Jaakko

    2003-05-01

    We have used genotypic variation in birch (Betula pendula Roth) to investigate the roles of ozone (O(3))-induced ethylene (ET), jasmonic acid, and salicylic acid in the regulation of tissue tolerance to O(3). Of these hormones, ET evolution correlated best with O(3)-induced cell death. Disruption of ET perception by transformation of birch with the dominant negative mutant allele etr1-1 of the Arabidopsis ET receptor gene ETR1 or blocking of ET perception with 1-methylcyclopropene reduced but did not completely prevent the O(3)-induced cell death, when inhibition of ET biosynthesis with aminooxyacetic acid completely abolished O(3) lesion formation. This suggests the presence of an ET-signaling-independent but ET biosynthesis-dependent component in the ET-mediated stimulation of cell death in O(3)-exposed birch. Functional ET signaling was required for the O(3) induction of the gene encoding beta-cyanoalanine synthase, which catalyzes detoxification of the cyanide formed during ET biosynthesis. The results suggest that functional ET signaling is required to protect birch from the O(3)-induced cell death and that a decrease in ET sensitivity together with a simultaneous, high ET biosynthesis can potentially cause cell death through a deficient detoxification of cyanide.

  6. Low level ozone exposure induces airways inflammation and modifies cell surface phenotypes in healthy humans

    EPA Science Inventory

    Background: The effects of low level ozone exposure (0.08 ppm) on pulmonary function in healthy young adults are well known, however much less is known about the inflammatory and immuno-modulatory effects oflow level ozone in the airways. Techniques such as induced sputum and flo...

  7. Ozone-induced increase in bean leaf maintenance respiration

    SciTech Connect

    Amthor, J.S.

    1987-01-01

    Rates of respiration by unifoliate leaves of pinto bean (Phaseolus vulgaris) plants, exposed to low levels of ozone, were partitioned into growth and maintenance components using a popular model of plant respiration. The mode can be written as R/W = G/sub R/(dW/dt)/W + m, where R/W is the leaf specific respiration rate, (dW/dt)/W is the leaf specific growth rate, G/sub R/ is the growth coefficient, and m is the maintenance coefficient. In controlled environment growth chamber experiments, plants were treated with one of two levels of ozone: 90 parts per billion (p.p.b., i.e., nl liter/sup -1/), for 6 h d/sup -1/ (+ ozone), or less than 15 p.p.b. (-ozone). The growth coefficient was not affected by ozone. The maintenance coefficient, however, was 10-15% larger in leaves of plants from the + ozone treatment, compared to the-ozone treatment. This difference in the maintenance coefficient was statistically significant. Open-top field chamber experiments were also conducted. As in the growth chamber experiments, ozone dose did not affect the growth coefficient, but increases in ozone resulted in significant increases in the maintenance coefficient. The results of these experiments suggest that one reason ozone inhibits plant growth and productivity is that maintenance respiration increases, probably in order to repair injury.

  8. Lung transcriptional profiling: insights into the mechanisms of ozone-induced pulmonary injury in Wistar Kyoto rats

    EPA Science Inventory

    Acute ozone-induced pulmonary injury and inflammation are well characterized in rats; however, mechanistic understanding of the pathways involved is limited. We hypothesized that acute exposure of healthy rats to ozone will cause transcriptional alterations, and comprehensive ana...

  9. Ozone-induced injury and oxidative stress in bronchiolar epithelium are associated with altered pulmonary mechanics.

    PubMed

    Sunil, Vasanthi R; Vayas, Kinal N; Massa, Christopher B; Gow, Andrew J; Laskin, Jeffrey D; Laskin, Debra L

    2013-06-01

    In these studies, we analyzed the effects of ozone on bronchiolar epithelium. Exposure of rats to ozone (2 ppm, 3 h) resulted in rapid (within 3 h) and persistent (up to 72 h) histological changes in the bronchiolar epithelium, including hypercellularity, loss of cilia, and necrotizing bronchiolitis. Perivascular edema and vascular congestion were also evident, along with a decrease in Clara cell secretory protein in bronchoalveolar lavage, which was maximal 24 h post-exposure. Ozone also induced the appearance of 8-hydroxy-2'-deoxyguanosine, Ym1, and heme oxygenase-1 in the bronchiolar epithelium. This was associated with increased expression of cleaved caspase-9 and beclin-1, indicating initiation of apoptosis and autophagy. A rapid and persistent increase in galectin-3, a regulator of epithelial cell apoptosis, was also observed. Following ozone exposure (3-24 h), increased expression of cyclooxygenase-2, inducible nitric oxide synthase, and arginase-1 was noted in bronchiolar epithelium. Ozone-induced injury and oxidative stress in bronchiolar epithelium were linked to methacholine-induced alterations in pulmonary mechanics. Thus, significant increases in lung resistance and elastance, along with decreases in lung compliance and end tidal volume, were observed at higher doses of methacholine. This indicates that ozone causes an increase in effective stiffness of the lung as a consequence of changes in the conducting airways. Collectively, these studies demonstrate that bronchiolar epithelium is highly susceptible to injury and oxidative stress induced by acute exposure to ozone; moreover, this is accompanied by altered lung functioning.

  10. Ozone induces glucose intolerance and systemic metabolic effects in young and aged brown Norway rats

    SciTech Connect

    Bass, V.; Gordon, C.J.; Jarema, K.A.; MacPhail, R.C.; Cascio, W.E.; Phillips, P.M.; Ledbetter, A.D.; Schladweiler, M.C.; Andrews, D.; Miller, D.; Doerfler, D.L.; Kodavanti, U.P.

    2013-12-15

    Air pollutants have been associated with increased diabetes in humans. We hypothesized that ozone would impair glucose homeostasis by altering insulin signaling and/or endoplasmic reticular (ER) stress in young and aged rats. One, 4, 12, and 24 month old Brown Norway (BN) rats were exposed to air or ozone, 0.25 or 1.0 ppm, 6 h/day for 2 days (acute) or 2 d/week for 13 weeks (subchronic). Additionally, 4 month old rats were exposed to air or 1.0 ppm ozone, 6 h/day for 1 or 2 days (time-course). Glucose tolerance tests (GTT) were performed immediately after exposure. Serum and tissue biomarkers were analyzed 18 h after final ozone for acute and subchronic studies, and immediately after each day of exposure in the time-course study. Age-related glucose intolerance and increases in metabolic biomarkers were apparent at baseline. Acute ozone caused hyperglycemia and glucose intolerance in rats of all ages. Ozone-induced glucose intolerance was reduced in rats exposed for 13 weeks. Acute, but not subchronic ozone increased α{sub 2}-macroglobulin, adiponectin and osteopontin. Time-course analysis indicated glucose intolerance at days 1 and 2 (2 > 1), and a recovery 18 h post ozone. Leptin increased day 1 and epinephrine at all times after ozone. Ozone tended to decrease phosphorylated insulin receptor substrate-1 in liver and adipose tissues. ER stress appeared to be the consequence of ozone induced acute metabolic impairment since transcriptional markers of ER stress increased only after 2 days of ozone. In conclusion, acute ozone exposure induces marked systemic metabolic impairments in BN rats of all ages, likely through sympathetic stimulation. - Highlights: • Air pollutants have been associated with increased diabetes in humans. • Acute ozone exposure produces profound metabolic alterations in rats. • Age influences metabolic risk factors in aging BN rats. • Acute metabolic effects are reversible and repeated exposure reduces these effects. • Ozone

  11. Ozone-Induced Metabolic Impairment is Attenuated in Adrenalectomized Wistar Kyoto Rats

    EPA Science Inventory

    Rationale: Air pollutants have been linked to increased incidence of metabolic syndrome however the mechanisms are poorly understood. We have recently shown that ozone exposure induces significant hyperglycemia together with elevated serum leptin and epinephrine in the Wistar Ky...

  12. THE RELATIONSHIP BETWEEN OZONE-INDUCED LUNG INJURY, ANTIOXIDANT COMPENSATION AND UNDERLYING CARDIOVASCULAR DISEASE (CVD).

    EPA Science Inventory

    Increased levels of oxidants and compromised compensatory response are associated with CVD susceptibility. We hypothesized that rat strains demonstrating genetic CVD will have lower levels of antioxidants and greater ozone-induced pulmonary injury relative to healthy strains. Mal...

  13. Protective role of interleukin-10 in Ozone-induced pulmonary inflammation**

    EPA Science Inventory

    Background: The mechanisms underlying ozone (03)-induced pulmonary inflammation remain unclear. Interleukin-10 (IL-10) is an anti-inflammatory cytokine that is known to inhibit inflammatory mediators. Objectives: We investigated the molecular mechanisms underlying interleuken-10...

  14. Ozone Therapy in the Management of Persistent Radiation-Induced Rectal Bleeding in Prostate Cancer Patients.

    PubMed

    Clavo, Bernardino; Santana-Rodriguez, Norberto; Llontop, Pedro; Gutierrez, Dominga; Ceballos, Daniel; Méndez, Charlin; Rovira, Gloria; Suarez, Gerardo; Rey-Baltar, Dolores; Garcia-Cabrera, Laura; Martínez-Sánchez, Gregorio; Fiuza, Dolores

    2015-01-01

    Introduction. Persistent radiation-induced proctitis and rectal bleeding are debilitating complications with limited therapeutic options. We present our experience with ozone therapy in the management of such refractory rectal bleeding. Methods. Patients (n = 12) previously irradiated for prostate cancer with persistent or severe rectal bleeding without response to conventional treatment were enrolled to receive ozone therapy via rectal insufflations and/or topical application of ozonized-oil. Ten (83%) patients had Grade 3 or Grade 4 toxicity. Median follow-up after ozone therapy was 104 months (range: 52-119). Results. Following ozone therapy, the median grade of toxicity improved from 3 to 1 (p < 0.001) and the number of endoscopy treatments from 37 to 4 (p = 0.032). Hemoglobin levels changed from 11.1 (7-14) g/dL to 13 (10-15) g/dL, before and after ozone therapy, respectively (p = 0.008). Ozone therapy was well tolerated and no adverse effects were noted, except soft and temporary flatulence for some hours after each session. Conclusions. Ozone therapy was effective in radiation-induced rectal bleeding in prostate cancer patients without serious adverse events. It proved useful in the management of rectal bleeding and merits further evaluation.

  15. Ozone Therapy in the Management of Persistent Radiation-Induced Rectal Bleeding in Prostate Cancer Patients

    PubMed Central

    Clavo, Bernardino; Santana-Rodriguez, Norberto; Llontop, Pedro; Gutierrez, Dominga; Ceballos, Daniel; Méndez, Charlin; Rovira, Gloria; Suarez, Gerardo; Rey-Baltar, Dolores; Garcia-Cabrera, Laura; Martínez-Sánchez, Gregorio; Fiuza, Dolores

    2015-01-01

    Introduction. Persistent radiation-induced proctitis and rectal bleeding are debilitating complications with limited therapeutic options. We present our experience with ozone therapy in the management of such refractory rectal bleeding. Methods. Patients (n = 12) previously irradiated for prostate cancer with persistent or severe rectal bleeding without response to conventional treatment were enrolled to receive ozone therapy via rectal insufflations and/or topical application of ozonized-oil. Ten (83%) patients had Grade 3 or Grade 4 toxicity. Median follow-up after ozone therapy was 104 months (range: 52–119). Results. Following ozone therapy, the median grade of toxicity improved from 3 to 1 (p < 0.001) and the number of endoscopy treatments from 37 to 4 (p = 0.032). Hemoglobin levels changed from 11.1 (7–14) g/dL to 13 (10–15) g/dL, before and after ozone therapy, respectively (p = 0.008). Ozone therapy was well tolerated and no adverse effects were noted, except soft and temporary flatulence for some hours after each session. Conclusions. Ozone therapy was effective in radiation-induced rectal bleeding in prostate cancer patients without serious adverse events. It proved useful in the management of rectal bleeding and merits further evaluation. PMID:26357522

  16. Ozone-induced changes in natural organic matter (NOM) structure

    USGS Publications Warehouse

    Westerhoff, P.; Debroux, J.; Aiken, G.; Amy, G.

    1999-01-01

    Hydrophobic organic acids (combined humic and fulvic acids), obtained from an Antarctic Lake with predominantly microbially derived organic carbon sources and two US fiver systems with terrestrial organic carbon sources, were ozonated. Several analyses, including 13C-NMR, UV absorbance, fluorescence, hydrophobic/transphilic classification, and potentiometric titrations, were performed before and after ozonation. Ozonation reduced aromatic carbon content, selectively reducing phenolic carbon content. Ozonation of the samples resulted in increased aliphatic, carboxyl, plus acetal and ketal anomeric carbon content and shifted towards less hydrophobic compounds.Hydrophobic organic acids (combined humic and fulvic acids), obtained from an Antarctic Lake with predominantly microbially derived organic carbon sources and two US river systems with terrestrial organic carbon sources, were ozonated. Several analyses, including 13C-NMR, UV absorbance, fluorescence, hydrophobic/transphilic classification, and potentiometric titrations, were performed before and after ozonation. Ozonation reduced aromatic carbon content, selectively reducing phenolic carbon content. Ozonation of the samples resulted in increased aliphatic, carboxyl, plus acetal and ketal anomeric carbon content and shifted towards less hydrophobic compounds.

  17. Ozone Induced Impairment of Systemic Metabolic Processes: Influence of Prior Ozone Exposure and Metformin Pre-treatment on Aged Wistar Kyoto (WKY) Rats.

    EPA Science Inventory

    SOT2014 Abstract for presentation: March 23-27, 2014; Phoenix, AZ Ozone Induced Impairment of Systemic Metabolic Processes: Influence of Prior Ozone Exposure and Metformin Pre-treatment on Aged Wistar Kyoto (WKY) Rats. V. Bass, D. Andrews, J. Richards, M. Schladweiler, A. Ledb...

  18. DNA strand breaks in human nasal respiratory epithelium are induced upon exposure to urban pollution

    SciTech Connect

    Calderon-Garciduenas, L.; Osnaya-Brizuela, N.; Ramirez-Martinez, L.

    1996-02-01

    All organisms have the ability to respond and adapt to a myriad of environmental insults. The human respiratory epithelium, when exposed to oxidant gases in photochemical smog, is at risk of DNA damage and requires efficient cellular adaptative responses to resist the environmentally induced cell damage. Ozone and its reaction products induce in vitro and in vivo DNA single strand breaks (SSBs) in respiratory epithelial cells and alveolar macrophages. To determine if exposure to a polluted atmosphere with ozone as the main criteria pollutant of 19 children and 13 adult males who lived in a low-polluted Pacific port, 69 males and 16 children who were permanent residents of Southwest Metropolitan Mexico City (SWMMC), and 22 young males newly arrived to SWMMC and followed for 12 weeks. Respiratory symptoms, nasal cytology and histopathology, cell viabilities, and single-cell gel electrophoresis were investigated. Atmospheric pollutant data were obtained from a fixed-site monitoring station. SWMMC volunteers spent >7 hr/day outdoors and all had upper respiratory symptoms. A significant difference in the numbers of DNA-damaged nasal cells was observed between control and chronically exposed subjects, both in children (p<0.00001) and in adults (p>0.01). SSBs in newly arrived subjects quickly increased upon arrival to the city, from 39.8 {+-}8.34% in the first week to 67.29 {+-}2.35 by week 2. Thereafter, the number of cells with SSBs remained stable in spite of the continuous increase in cumulative ozone, suggesting a threshold for cumulative DNA nasal damage. Exposure to a polluted urban atmosphere induces SSBs in human nasal respiratory epithelium, and nasal SSBs could serve as a biomarker of ozone exposure. Further, because DNA strand breaks are a threat to cell viability and genome integrity and appear to be a critical lesion responsible for p53 induction, nasal SSBs should be evaluated in ozone-exposed individuals. 43 refs., 5 figs., 4 tabs.

  19. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  20. Elevated Ozone Modulates Herbivore-Induced Volatile Emissions of Brassica nigra and Alters a Tritrophic Interaction.

    PubMed

    Khaling, Eliezer; Li, Tao; Holopainen, Jarmo K; Blande, James D

    2016-05-01

    Plants damaged by herbivores emit volatile organic compounds (VOCs) that are used by parasitoids for host location. In nature, however, plants are exposed to multiple abiotic and biotic stresses of varying intensities, which may affect tritrophic interactions. Here, we studied the effects of ozone exposure and feeding by Pieris brassicae larvae on the VOCs emitted by Brassica nigra and the effects on oriented flight of the parasitoid Cotesia glomerata. We also investigated the oriented flight of C. glomerata in a wind-tunnel with elevated ozone levels. Herbivore-feeding induced the emission of several VOCs, while ozone alone had no significant effect. However, exposure to 120 ppb ozone, followed by 24 hr of herbivore-feeding, induced higher emissions of all VOCs as compared to herbivore-feeding alone. In accordance, herbivore-damaged plants elicited more oriented flights than undamaged plants, whereas plants exposed to 120 ppb ozone and 24 hr of herbivore-feeding elicited more oriented flights than plants subjected to herbivore-feeding alone. Ozone enrichment of the wind-tunnel air appeared to negatively affect orientation of parasitoids at 70 ppb, but not at 120 ppb. These results suggest that the combination of ozone and P. brassicae-feeding modulates VOC emissions, which significantly influence foraging efficiency of C. glomerata.

  1. Stratospheric Ozone-induced Indirect Radiative Effects on Antarctic Sea Ice

    NASA Astrophysics Data System (ADS)

    Hu, Y.; Xia, Y.; LIU, J.; Huang, Y.

    2015-12-01

    Recent studies demonstrated that the Antarctic Ozone Hole has important influences on Antarctic sea ice. While all these have focused on stratospheric ozone-induced dynamic effects on sea ice, here we show results that ozone-induced indirect radiative effects have important influences on Antarctic sea ice. Our simulations demonstrate that the recovery of the Antarctic Ozone Hole causes equatorward shift of clouds over the Southern Ocean. The cloud-band shift leads to reduction of downward infrared radiation, which causes surface cooling. On the other hand, it also causes increasing solar radiation on the surface. However, the increase in solar radiation is offset by surface reflection due to increasing sea ice. As a result solar radiation absorbed by the surface is reduced, which also causes surface cooling. Therefore, the overall ozone-induced cloud radiative effect is to cool the surface and causes expansion of sea ice around the Antarctic. As shown in previous studies, the cloud-band shift is associated with the equatorward shift of the westerly jet stream around the Antarctic. Our simulations also demonstrate increasing snow rate near the sea ice edge, which also contributes to Antarctic sea-ice expansion. The ozone-induced cloud radiative effect would mitigate Antarctic sea-ice melting due to greenhouse warming in the 21st century.

  2. Uric acid protects erythrocytes from ozone-induced changes.

    PubMed

    Meadows, J; Smith, R C

    1987-08-01

    Uric acid effectively reduced hemolysis and methemoglobin formation in bovine and swine erythrocytes bubbled with ozone in vitro. In bovine erythrocytes, formation of thiobarbituric acid-reactive material was inhibited by uric acid, but there was little immediate protection for the swine cells. Antioxidant protection was due to preferential degradation of the uric acid by ozone. These results provide evidence to support the hypothesis that in plasma, uric acid can provide antioxidant protection for erythrocytes.

  3. A review of ozone-induced effects on the forests of central Mexico.

    PubMed

    de Bauer, María de Lourdes; Hernández-Tejeda, Tomás

    2007-06-01

    The first report on oxidant-induced plant damage in the Valley of Mexico was presented over 30 years ago. Ozone is known to occur in the Mexico City Metropolitan Area and elsewhere as the cause of chlorotic mottling on pine needles that are 2 years old or older as observed in 1976 on Pinus hartwegii and Pinus leiophylla. Visible evidences for the negative effects of ozone on the vegetation of central Mexico include foliar injury expressed as chlorotic mottling and premature defoliation on pines, a general decline of sacred fir, visible symptoms on native forest broadleaved species (e.g. Mexican black cherry). Recent investigations have also indicated that indirect effects are occurring such as limited root colonization by symbiotic fungi on ozone-damaged P. hartwegii trees and a negative influence of the pollutant on the natural regeneration of this species. The negative ozone-induced effects on the vegetation will most likely continue to increase.

  4. Comparison of ozone and HO· induced conversion of effluent organic matter (EfOM) using ozonation and UV/H2O2 treatment.

    PubMed

    Audenaert, W T M; Vandierendonck, D; Van Hulle, S W H; Nopens, I

    2013-05-01

    This study experimentally examined the impact of oxidation on the properties of effluent organic matter (EfOM) using two different oxidation techniques: ozonation and UV/H2O2 treatment. Multiple surrogates for EfOM related to its spectral properties, molecular size, concentration, polarity and biodegradability were used to study the oxidant induced conversions. Spectral calculations as differential absorbance spectra (DAS) and absorbance slope index (ASI) were applied for the first time to describe EfOM oxidation and proved to be useful to unravel differences in working mechanism between ozone and hydroxyl radical (HO) induced transformation of EfOM. Effluent ozonation inherently led to significant HO production as a result of electron transfers between ozone and electron rich moieties of EfOM. HO production increased as function of ozone dose and was strongly correlated to UV absorption at 254 nm (UV254). During the UV moderated process, pseudo steady-state behaviour of the HO concentration was observed. Ozone decomposition was extremely sensitive to EfOM reactivity. Most likely, the degree of dissociation of EfOM controlled its reactivity towards ozone. The pH effect was quantified by calculating the pseudo-first order decay constant for ozone as function of reaction time and pH. Treatment with both processes led to more oxygen rich, less hydrophobic and more biodegradable EfOM.

  5. Effect of ozone exposure on antigen-induced airway hyperresponsiveness in guinea pigs

    SciTech Connect

    Vargas, M.H.; Segura, P.; Campos, M.G.; Hong, E.; Montano, L.M.

    1994-12-31

    Airway hyperresponsiveness can be induced by several stimuli including antigen and ozone, both of which may be present in the air of polluted cities. Though the effect of ozone on the bronchoconstrictor response to antigen has been well described, the combined effect of these stimuli on airway hyperresponsiveness has not yet been studied. Sensitized guinea pigs with or without ozone exposure for 1 h at 3 ppm, 18 h prior to study, were challenged with a dose-response curve to histamine (0.01-1.8 {mu}g/kg, iv), and then by a second histamine dose-response curve 1 h later. Airway responses were measured as the increase in pulmonary insufflation pressure. In sensitized guinea pigs, the histamine ED50 significantly decreased after antigen challenge, demonstrating the development of airway hyperresponsiveness. Sensitized guinea pigs exposed to ozone showed airway hyperresponsiveness to histamine when compared with nonexposed animals, and such hyperresponsiveness was further enhanced after antigen challenge. We conclude that in this guinea pig model of acute allergic bronchoconstriction both antigen challenge and ozone induce airway hyperresponsiveness, while ozone exposure does not modify the development of antigen-induced hyperresponsiveness. 25 refs., 1 fig., 1 tab.

  6. Effect of ozonated oil and chlorhexidine gel on plaque induced gingivitis: A randomized control clinical trial

    PubMed Central

    Indurkar, Maya Sanjeev; Verma, Renu

    2016-01-01

    Background: Several chemotherapeutic agents have been developed to prevent gingivitis and its progression into periodontitis. In this present study, the efficacy of ozonated oil and chlorhexidine gel was assessed and compared on plaque induced gingivitis. Aim: To evaluate the effect of ozonated oil on plaque induced gingivitis and to compare its efficacy with chlorhexidine gel. Materials and Methods: A total of 20 subjects, aged from 18 to 65 years, with plaque-induced gingivitis were selected from the outpatient Department of Periodontology, Government Dental College and Hospital, Aurangabad, for this study. They were divided randomly into the test or ozonated oil group (Group I) and the control or chlorhexidine gel group (Group II) with 10 subjects in each group. Subjects were randomly assigned to massage their gingiva thrice a day for 3 weeks with ozonated oil (test), and chlorhexidine gel (control). Plaque index and gingival index scores were recorded for the 20 subjects at baseline and after 3 weeks. Results: Ozonated oil (Group I) and chlorhexidine gel (Group II) groups showed statistically significant differences with respect to plaque index and gingival index, from the baseline to 3 weeks (P < 0.001 in both). But the difference between Group I and Group II, at the end of the study period, was not statistically significant with respect to the plaque index and gingival index. Conclusions: The ozonated oil and chlorhexidine gel, both can be used as an effective agent in maintaining and improving gingival health. PMID:27041835

  7. Does intraperitoneal medical ozone preconditioning and treatment ameliorate the methotrexate induced nephrotoxicity in rats?

    PubMed

    Aslaner, Arif; Çakır, Tuğrul; Çelik, Betül; Doğan, Uğur; Mayir, Burhan; Akyüz, Cebrail; Polat, Cemal; Baştürk, Ahmet; Soyer, Vural; Koç, Süleyman; Şehirli, Ahmet Özer

    2015-01-01

    Methotrexate is a chemotherapeutic agent used for many cancer treatments. It leads to toxicity with its oxidative injury. The purpose of our study is investigating the medical ozone preconditioning and treatment has any effect on the methotrexate-induced kidneys by activating antioxidant enzymes in rats. Eighteen rats were divided into three equal groups; control, Mtx without and with medical ozone. Nephrotoxicity was performed with a single dose of 20 mg/kg Mtx intraperitoneally at the fifteenth day of experiment on groups 2 and 3. Medical ozone preconditioning was performed at a dose of 25 mcg/ml (5 ml) intraperitoneally everyday in the group 3 and treated with medical ozone for five more days while group 2 was received only 5 ml of saline everyday for twenty days. All rats were sacrificed at the end of third week and the blood and kidney tissue samples were obtained to measure the levels of TNF-α, IL-1β, malondialdehyde, glutathione and myeloperoxidase. Kidney injury score was evaluated histolopatologically. Medical ozone preconditioning and treatment ameliorated the biochemical parameters and kidney injury induced by Mtx. There was significant increase in tissue MDA, MPO activity, TNF-α and IL-1β (P<0.05) and significant decrease in tissue GSH and histopathology (P<0.05) after Mtx administration. The preconditioning and treatment with medical ozone ameliorated the nephrotoxicity induced by Mtx in rats by activating antioxidant enzymes and prevented renal tissue.

  8. Does intraperitoneal medical ozone preconditioning and treatment ameliorate the methotrexate induced nephrotoxicity in rats?

    PubMed Central

    Aslaner, Arif; Çakır, Tuğrul; Çelik, Betül; Doğan, Uğur; Mayir, Burhan; Akyüz, Cebrail; Polat, Cemal; Baştürk, Ahmet; Soyer, Vural; Koç, Süleyman; Şehirli, Ahmet Özer

    2015-01-01

    Methotrexate is a chemotherapeutic agent used for many cancer treatments. It leads to toxicity with its oxidative injury. The purpose of our study is investigating the medical ozone preconditioning and treatment has any effect on the methotrexate-induced kidneys by activating antioxidant enzymes in rats. Eighteen rats were divided into three equal groups; control, Mtx without and with medical ozone. Nephrotoxicity was performed with a single dose of 20 mg/kg Mtx intraperitoneally at the fifteenth day of experiment on groups 2 and 3. Medical ozone preconditioning was performed at a dose of 25 mcg/ml (5 ml) intraperitoneally everyday in the group 3 and treated with medical ozone for five more days while group 2 was received only 5 ml of saline everyday for twenty days. All rats were sacrificed at the end of third week and the blood and kidney tissue samples were obtained to measure the levels of TNF-α, IL-1β, malondialdehyde, glutathione and myeloperoxidase. Kidney injury score was evaluated histolopatologically. Medical ozone preconditioning and treatment ameliorated the biochemical parameters and kidney injury induced by Mtx. There was significant increase in tissue MDA, MPO activity, TNF-α and IL-1β (P<0.05) and significant decrease in tissue GSH and histopathology (P<0.05) after Mtx administration. The preconditioning and treatment with medical ozone ameliorated the nephrotoxicity induced by Mtx in rats by activating antioxidant enzymes and prevented renal tissue. PMID:26550330

  9. Classical and alternative macrophage activation in the lung following ozone-induced oxidative stress

    SciTech Connect

    Sunil, Vasanthi R.; Patel-Vayas, Kinal; Shen, Jianliang; Laskin, Jeffrey D.; Laskin, Debra L.

    2012-09-01

    Ozone is a pulmonary irritant known to cause oxidative stress, inflammation and tissue injury. Evidence suggests that macrophages play a role in the pathogenic response; however, their contribution depends on the mediators they encounter in the lung which dictate their function. In these studies we analyzed the effects of ozone-induced oxidative stress on the phenotype of alveolar macrophages (AM). Exposure of rats to ozone (2 ppm, 3 h) resulted in increased expression of 8-hydroxy-2′-deoxyguanosine (8-OHdG), as well as heme oxygenase-1 (HO-1) in AM. Whereas 8-OHdG was maximum at 24 h, expression of HO-1 was biphasic increasing after 3 h and 48–72 h. Cleaved caspase-9 and beclin-1, markers of apoptosis and autophagy, were also induced in AM 24 h post-ozone. This was associated with increased bronchoalveolar lavage protein and cells, as well as matrix metalloproteinase (MMP)-2 and MMP-9, demonstrating alveolar epithelial injury. Ozone intoxication resulted in biphasic activation of the transcription factor, NFκB. This correlated with expression of monocyte chemotactic protein‐1, inducible nitric oxide synthase and cyclooxygenase‐2, markers of proinflammatory macrophages. Increases in arginase-1, Ym1 and galectin-3 positive anti-inflammatory/wound repair macrophages were also observed in the lung after ozone inhalation, beginning at 24 h (arginase-1, Ym1), and persisting for 72 h (galectin-3). This was associated with increased expression of pro-surfactant protein-C, a marker of Type II cell proliferation and activation, important steps in wound repair. These data suggest that both proinflammatory/cytotoxic and anti-inflammatory/wound repair macrophages are activated early in the response to ozone-induced oxidative stress and tissue injury. -- Highlights: ► Lung macrophages are highly sensitive to ozone induced oxidative stress. ► Ozone induces autophagy and apoptosis in lung macrophages. ► Proinflammatory and wound repair macrophages are activated

  10. Significant light induced ozone loss on biomass burning aerosol: Evidence from chemistry-transport modeling based on new laboratory studies

    NASA Astrophysics Data System (ADS)

    Konovalov, I. B.; Beekmann, M.; D'Anna, B.; George, C.

    2012-09-01

    Recent laboratory studies indicated that a photo-induced heterogeneous reaction of ozone on the surface of aerosol containing humic like substances (HULIS) has the potential to affect the ozone budget in biomass burning plumes. To evaluate atmospheric significance of such heterogeneous light induced ozone loss, this process has been taken into account in the simulation of the extreme air pollution episode in the Moscow region during the 2010 mega fire event in western Russia. Results of the numerical experiments performed with the CHIMERE chemistry transport model indicate that photo induced removal of ozone could lead to significant (reaching several tens of percent) episodic decrease of the ozone concentration. The simulations also show that while wildfires provide reactive surface for the considered reaction, they strongly inhibit the photo-induced heterogeneous ozone loss by attenuating actinic fluxes through the “shielding” aerosol effect. The present results are calling for additional experimental and modelling studies.

  11. Intercontinental trans-boundary contributions to ozone-induced crop yield losses in the Northern Hemisphere

    NASA Astrophysics Data System (ADS)

    Hollaway, M. J.; Arnold, S. R.; Challinor, A. J.; Emberson, L. D.

    2011-08-01

    burning emissions may make important contributions to ozone-induced crop yield reductions. Our results demonstrate that local air quality and emission control strategies have the potential to partly alleviate ozone-induced crop yield loss in continents downstream, in addition to effectively mitigating local ozone-induced yield losses.

  12. Uric acid protects membranes and linolenic acid from ozone-induced oxidation.

    PubMed

    Meadows, J; Smith, R C; Reeves, J

    1986-05-29

    Aqueous preparations of linolenic acid, bovine serum albumin, and bovine erythrocyte membrane fragments were bubbled with ozone in the presence or absence of uric acid. Ozonation of the membrane fragments or the bovine serum albumin did not result in protein degradation. After 15 min of ozonation, the absorbance of the thiobarbituric acid-reactive material increased by 0.34 in the linolenic acid preparation and by 0.08 in the suspension of membrane fragments. In the presence of uric acid, these changes in absorbance were reduced to 0.14 for the fatty acid and to 0.01 for the membrane fragments. This result indicates that uric acid protects lipids from ozone-induced oxidation.

  13. The protective effect of intraperitoneal medical ozone preconditioning and treatment on hepatotoxicity induced by methotrexate.

    PubMed

    Aslaner, Arif; Çakır, Tuğrul; Çelik, Betül; Doğan, Uğur; Akyüz, Cebrail; Baştürk, Ahmet; Polat, Cemal; Gündüz, Umut; Mayir, Burhan; Şehirli, Ahmet Özer

    2015-01-01

    The aim of this study is to determine the effects of medical ozone preconditioning and treatment on the methotrexate acute induced hepatotoxicity in rats that has not reports elsewhere. Eighteen rats were randomly assigned into three equal groups; control, Mtx and Mtx with ozone. Hepatotoxicity was performed with a single dose of 20 mg/kg Mtx to group 2 and group 3 at the fifteenth day. The medical ozone preconditioning was administered intraperitonealy in group 3 for fifteen days and more five days after inducing Mtx. The other rats of the group 1 and 2 received saline injection. At the twentyfirst day the blood and the liver tissue samples were obtained to measure the levels of liver enzymes ALT and AST, proinflamatory cytokines TNF-α, IL-1β, malondialdehyde, glutathione and myeloperoxidase. And the histolopatological examination was evaluated for injury score. In our study Mtx administration caused a significant increase on the liver enzymes ALT and AST, the tissue MDA and MPO activity and significant decrease in the tissue GSH. Moreover the both pro-inflammatory cytokines were significantly increased in the Mtx group. Medical ozone preconditioning and treatment reversed all these biochemical parameters and histopathological changes of the hepatotoxicity induced by Mtx. We conclude that medical ozone ameliorates Mtx induced hepatotoxicity in rats.

  14. The protective effect of intraperitoneal medical ozone preconditioning and treatment on hepatotoxicity induced by methotrexate

    PubMed Central

    Aslaner, Arif; Çakır, Tuğrul; Çelik, Betül; Doğan, Uğur; Akyüz, Cebrail; Baştürk, Ahmet; Polat, Cemal; Gündüz, Umut; Mayir, Burhan; Şehirli, Ahmet Özer

    2015-01-01

    The aim of this study is to determine the effects of medical ozone preconditioning and treatment on the methotrexate acute induced hepatotoxicity in rats that has not reports elsewhere. Eighteen rats were randomly assigned into three equal groups; control, Mtx and Mtx with ozone. Hepatotoxicity was performed with a single dose of 20 mg/kg Mtx to group 2 and group 3 at the fifteenth day. The medical ozone preconditioning was administered intraperitonealy in group 3 for fifteen days and more five days after inducing Mtx. The other rats of the group 1 and 2 received saline injection. At the twentyfirst day the blood and the liver tissue samples were obtained to measure the levels of liver enzymes ALT and AST, proinflamatory cytokines TNF-α, IL-1β, malondialdehyde, glutathione and myeloperoxidase. And the histolopatological examination was evaluated for injury score. In our study Mtx administration caused a significant increase on the liver enzymes ALT and AST, the tissue MDA and MPO activity and significant decrease in the tissue GSH. Moreover the both pro-inflammatory cytokines were significantly increased in the Mtx group. Medical ozone preconditioning and treatment reversed all these biochemical parameters and histopathological changes of the hepatotoxicity induced by Mtx. We conclude that medical ozone ameliorates Mtx induced hepatotoxicity in rats. PMID:26550257

  15. Involvement of superoxide in ozone-induced airway hyperresponsiveness in anesthetized cats

    SciTech Connect

    Takahashi, T.; Miura, M.; Katsumata, U.; Ichinose, M.; Kimura, K.; Inoue, H.; Takishima, T.; Shirato, K. )

    1993-07-01

    To determine whether oxygen radical scavengers inhibit ozone-induced airway hyperresponsiveness, we examined the protective effect of polyethylene glycol-superoxide dismutase (PEG-SOD) and PEG-catalase (PEG-CAT) on ozone-induced airway hyperresponsiveness in cat airways. Twenty-five cats divided into five groups were anesthetized and mechanically ventilated. There was no difference between the groups in baseline airway responsiveness to inhaled acetylcholine (ACh). In the control group, AChPC, the concentration required to produce a doubling increase in baseline pulmonary resistance, was significantly reduced by ozone exposure (2.0 ppm for 2 h); the ratios of AChPC before ozone exposure to after ozone exposure (AChPC ratio) were 14.8 +/- 5.7 (p < 0.001) and 4.80 +/- 1.6 (p < 0.01) 30 and 120 min after exposure, respectively. Local administration of PEG-SOD (2,000 U/kg) into airways partially but significantly prevented ozone-induced airway hyperresponsiveness. The AChPC ratios were 6.2 +/- 1.4 and 1.5 +/- 0.2 30 and 120 min after exposure, respectively, which were significantly different from those of the control group (p < 0.05), whereas PEG-CAT pretreatment (6,000 U/kg) was without effect. Combined pretreatment with PEG-SOD and PEG-CAT had no additional protective effect compared with PEG-SOD alone. PEG-SOD had no direct effect on airway responsiveness to ACh. These results suggest that superoxide may be involved in ozone-induced airway hyperresponsiveness.

  16. Influence of ozone on induced resistance in soybean to the Mexican bean beetle (Coleoptera: Coccinellidae)

    SciTech Connect

    Lin, Hengchen; Kogan, M. ); Endress, A.G. )

    1990-08-01

    The influence of ozone (O{sub 3}) on induced resistance in soybean, Glycine max (L.) Merr., cv. Williams 82, was investigated. Feeding by larval soybean looper, Pseudoplusia includens (Walker), was used to induce resistance, and the feeding preference of the Mexican bean beetle, Epilachna varivetis Mulsant, was used to indicate induced resistance. Greenhouse grown soybean plants at the V9 growth stage (eight open trifoliolates) were used in all experiments. One day following feeding injury by the soybean looper, the injured plants and the uninjured controls were exposed to three concentrations of ozone in transparent mylar chambers; level in ambient air (about 0.025 ppm), 0.06 ppm, or 0.1 ppm. Plants were exposed for 5 h a day for a period of 2-4 d. Ozone exposure at the levels used in this study produced no visible injuries to leaves. Low doses (up to 4-d-exposure to 0.06 ppm or 2-d exposure to 0.1 ppm) of ozone overrode the resistance in soybean that had been induced by the feeding of soybean looper larvae. Higher doses (3- or 4-d exposure to 0.1 ppm) of ozone actually resulted in a greater acceptability by the Mexican bean beetle of plants injured by the soybean looper than of uninjured plants. Doses of ozone used in these experiments did not significantly alter the feeding preference of the Mexican bean beetle for the uninjured plants. Because ozone pollution and herbivore injury are commonly experienced by plants in nature, the results of this study add another perspective to insect-plant interactions.

  17. Evaluation of lightning-induced tropospheric ozone enhancements observed by ozone lidar and simulated by WRF/Chem

    NASA Astrophysics Data System (ADS)

    Wang, Lihua; Follette-Cook, Melanie B.; Newchurch, M. J.; Pickering, Kenneth E.; Pour-Biazar, Arastoo; Kuang, Shi; Koshak, William; Peterson, Harold

    2015-08-01

    High spatial- and temporal-resolution ozone lidar profiles, in conjunction with ozonesonde and satellite observations, are well suited to characterize short-term ozone variations due to different physical and chemical processes, such as the impact of lightning-generated NOx (LNOx) on tropospheric ozone. This work presents the hourly variation of tropospheric-ozone profiles measured by an ozone lidar at the University of Alabama in Huntsville, on July 14, 18, and 27, 2011. These ozone lidar data are compared with two WRF/Chem simulations, one with lightning NO (LNO) emissions and the other without. On July 14, 2011, the ozone lidar observed an ozone laminar structure with elevated ozone concentrations of 65∼80 ppbv below 2 km, low ozone (50∼65) ppbv between 2 and 5 km, and high ozone up to 165 ppbv between 5 and 12 km AGL. WRF/Chem simulations, in conjunction with backward trajectory analysis, suggest that lightning events occurring within upwind regions resulted in an ozone enhancement of 28 ppbv at 7.5 km AGL over Huntsville. On July 27, LNO emissions were transported to Huntsville from upwind and account for 75% of NOx and an 8.3 ppbv of ozone enhancement at ∼10 km; the model overestimates ozone between 2.5 and 5 km AGL.

  18. Quantitative Imaging of Ozone Vapor Using Photofragmentation Laser-Induced Fluorescence (LIF).

    PubMed

    Larsson, Kajsa; Hot, Dina; Ehn, Andreas; Lantz, Andreas; Weng, Wubin; Aldén, Marcus; Bood, Joakim

    2017-01-01

    In the present work, the spectral properties of gaseous ozone (O3) have been investigated aiming to perform quantitative concentration imaging of ozone by using a single laser pulse at 248 nm from a KrF excimer laser. The O3 molecule is first photodissociated by the laser pulse into two fragments, O and O2. Then the same laser pulse electronically excites the O2 fragment, which is vibrationally hot, whereupon fluorescence is emitted. The fluorescence intensity is found to be proportional to the concentration of ozone. Both emission and absorption characteristics have been investigated, as well as how the laser fluence affects the fluorescence signal. Quantitative ozone imaging data have been achieved based on calibration measurements in known mixtures of O3. In addition, a simultaneous study of the emission intensity captured by an intensified charge-coupled device (ICCD) camera and a spectrograph has been performed. The results show that any signal contribution not stemming from ozone is negligible compared to the strong fluorescence induced by the O2 fragment, thus proving interference-free ozone imaging. The single-shot detection limit has been estimated to ∼400 ppm. The authors believe that the presented technique offers a valuable tool applicable in various research fields, such as plasma sterilization, water and soil remediation, and plasma-assisted combustion.

  19. Ozone-induced augmentation of eicosanoid metabolism in epithelial cells from bovine trachea.

    PubMed

    Leikauf, G D; Driscoll, K E; Wey, H E

    1988-02-01

    Epithelial injury and inflammation have been implicated in ozone-induced airway hyperresponsiveness. Because ozone is relatively insoluble and highly reactive, toxicologic effects of this compound may be limited to the plasma membranes of airway epithelium. We hypothesize that oxidant damage to epithelium may result in elaboration of various eicosanoids, which are known to alter airway smooth muscle responsiveness and epithelial cell functions (including ion transport). To examine eicosanoid metabolism after exposure to 0.1 to 10.0 ppm ozone, epithelial cells derived from bovine trachea were isolated and grown to confluency. Bovine tracheal cells in culture expressed differentiated features characteristic of epithelial cells, including a plasma membrane with a specialized polar morphology, an extensive network of filaments that were connected through intercellular junctional complexes, and keratin-containing monofilaments as determined by indirect immunofluorescent localization. Monolayers were alternately exposed to ozone and culture medium for 2 h in a specially designed in vitro chamber using a rotating inclined platform. Eicosanoid products were measured by the release of [3H]-labeled products from cells incubated with [3H]-arachidonic acid for 24 h before exposure and by the release of immunoreactive products into the cell supernatant. Both methods revealed ozone-induced increases in cyclooxygenase and lipoxygenase product formation with significant increases in prostaglandins E2, F2 alpha, 6-keto F1 alpha, and leukotriene B4. Release rates of immunoreactive products were dose-dependent, and ozone concentrations as low as 0.1 ppm produced an increase in prostaglandin F2 alpha. These findings are consistent with the hypothesis that ozone can augment eicosanoid metabolism in airway epithelial cells.

  20. Effects of ozone oxidative preconditioning on radiation-induced organ damage in rats

    PubMed Central

    Gultekin, Fatma Ayca; Bakkal, Bekir Hakan; Guven, Berrak; Tasdoven, Ilhan; Bektas, Sibel; Can, Murat; Comert, Mustafa

    2013-01-01

    Because radiation-induced cellular damage is attributed primarily to harmful effects of free radicals, molecules with direct free radical scavenging properties are particularly promising as radioprotectors. It has been demonstrated that controlled ozone administration may promote an adaptation to oxidative stress, preventing the damage induced by reactive oxygen species. Thus, we hypothesized that ozone would ameliorate oxidative damage caused by total body irradiation (TBI) with a single dose of 6 Gy in rat liver and ileum tissues. Rats were randomly divided into groups as follows: control group; saline-treated and irradiated (IR) groups; and ozone oxidative preconditioning (OOP) and IR groups. Animals were exposed to TBI after a 5-day intraperitoneal pretreatment with either saline or ozone (1 mg/kg/day). They were decapitated at either 6 h or 72 h after TBI. Plasma, liver and ileum samples were obtained. Serum AST, ALT and TNF-α levels were elevated in the IR groups compared with the control group and were decreased after treatment with OOP. TBI resulted in a significant increase in the levels of MDA in the liver and ileal tissues and a decrease of SOD activities. The results demonstrated that the levels of MDA liver and ileal tissues in irradiated rats that were pretreated with ozone were significantly decreased, while SOD activities were significantly increased. OOP reversed all histopathological alterations induced by irradiation. In conclusion, data obtained from this study indicated that ozone could increase the endogenous antioxidant defense mechanism in rats and there by protect the animals from radiation-induced organ toxicity. PMID:22915786

  1. Numerical Analysis of Etoposide Induced DNA Breaks

    PubMed Central

    Muslimović, Aida; Nyström, Susanne; Gao, Yue; Hammarsten, Ola

    2009-01-01

    Background Etoposide is a cancer drug that induces strand breaks in cellular DNA by inhibiting topoisomerase II (topoII) religation of cleaved DNA molecules. Although DNA cleavage by topoisomerase II always produces topoisomerase II-linked DNA double-strand breaks (DSBs), the action of etoposide also results in single-strand breaks (SSBs), since religation of the two strands are independently inhibited by etoposide. In addition, recent studies indicate that topoisomerase II-linked DSBs remain undetected unless topoisomerase II is removed to produce free DSBs. Methodology/Principal Findings To examine etoposide-induced DNA damage in more detail we compared the relative amount of SSBs and DSBs, survival and H2AX phosphorylation in cells treated with etoposide or calicheamicin, a drug that produces free DSBs and SSBs. With this combination of methods we found that only 3% of the DNA strand breaks induced by etoposide were DSBs. By comparing the level of DSBs, H2AX phosphorylation and toxicity induced by etoposide and calicheamicin, we found that only 10% of etoposide-induced DSBs resulted in histone H2AX phosphorylation and toxicity. There was a close match between toxicity and histone H2AX phosphorylation for calicheamicin and etoposide suggesting that the few etoposide-induced DSBs that activated H2AX phosphorylation were responsible for toxicity. Conclusions/Significance These results show that only 0.3% of all strand breaks produced by etoposide activate H2AX phosphorylation and suggests that over 99% of the etoposide induced DNA damage does not contribute to its toxicity. PMID:19516899

  2. Effects of N-Acetylcysteine in Ozone-Induced Chronic Obstructive Pulmonary Disease Model

    PubMed Central

    Seiffert, Joanna M.; Zhu, Jie; Clarke, Colin; Chang, Yan; Bhavsar, Pank; Adcock, Ian; Zhang, Junfeng; Zhou, Xin; Chung, Kian Fan

    2013-01-01

    Introduction Chronic exposure to high levels of ozone induces emphysema and chronic inflammation in mice. We determined the recovery from ozone-induced injury and whether an antioxidant, N-acetylcysteine (NAC), could prevent or reverse the lung damage. Methods Mice were exposed to ozone (2.5 ppm, 3 hours/12 exposures, over 6 weeks) and studied 24 hours (24h) or 6 weeks (6W) later. Nac (100 mg/kg, intraperitoneally) was administered either before each exposure (preventive) or after completion of exposure (therapeutic) for 6 weeks. Results After ozone exposure, there was an increase in functional residual capacity, total lung volume, and lung compliance, and a reduction in the ratio of forced expiratory volume at 25 and 50 milliseconds to forced vital capacity (FEV25/FVC, FEV50/FVC). Mean linear intercept (Lm) and airway hyperresponsiveness (AHR) to acetylcholine increased, and remained unchanged at 6W after cessation of exposure. Preventive NAC reduced the number of BAL macrophages and airway smooth muscle (ASM) mass. Therapeutic NAC reversed AHR, and reduced ASM mass and apoptotic cells. Conclusion Emphysema and lung function changes were irreversible up to 6W after cessation of ozone exposure, and were not reversed by NAC. The beneficial effects of therapeutic NAC may be restricted to the ASM. PMID:24260479

  3. Allostery through protein-induced DNA bubbles

    SciTech Connect

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.

    2015-03-12

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resulting melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.

  4. Allostery through protein-induced DNA bubbles

    DOE PAGES

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; ...

    2015-03-12

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resultingmore » melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.« less

  5. Variability in Ozone-Induced Pulmonary Injury and Inflammation in Healthy and Cardiovascular Compromised Rat Models

    EPA Science Inventory

    The molecular bases for variability in air pollutant-induced pulmonary injury due to underlying cardiovascular (CVD) and/or metabolic diseases are unknown. We hypothesized that healthy and genetic CVD-prone rat models will exhibit exacerbated response to acute ozone exposure depe...

  6. METAL-INDUCED LATE PULMONARY INJURY IS REDUCED BY OZONE (O3) COEXPOSURE

    EPA Science Inventory

    METAL-INDUCED LATE PULMONARY INJURY IS REDUCED BY OZONE (O3) COEXPOSURE. UP Kodavanti, MCJ Schladweiler, WP Watkinson, JP Nolan, PA Evansky, ER Lappi, G Ross, JH Richards, and DL Costa. NHEERL, ORD, US Environmental Protection Agency, Research Triangle Park, NC USA.
    Ambient ...

  7. OZONE-INDUCED RESPIRATORY SYMPTOMS: EXPOSURE-RESPONSE MODELS AND ASSOCIATION WITH LUNG FUNCTION

    EPA Science Inventory

    Ozone-induced respiratory symptoms are known to be functions of concentration, minute ventilation, and duration of exposure. The purposes of this study were to identify an exposure-response model for symptoms, to determine whether response was related to age, and to assess the re...

  8. EFFECT OF ANTIOXIDANT SUPPLEMENTATION ON OZONE-INDUCED LUNG INJURY IN HUMAN SUBJECTS

    EPA Science Inventory

    Epidemiological, in vitro and animal studies suggest that dietary antioxidants can modulate the cellular and physiologic effects of ozone (O3) inhalation in humans. To determine whether antioxidants can influence human susceptibility to O3-induced changes in lung function and a...

  9. SUBCHRONIC EPISODIC EXPOSURE OF RATS TO DIESEL PLUS OZONE INDUCES MINIMAL CARDIOPULMONARY EFFECTS

    EPA Science Inventory

    Diesel exhaust (DE) emissions contribute to near-road air pollution and have been shown to induce a variety of cardiovascular and pulmonary abnormalities in animals and humans. Since high ozone concentrations are often associated with increased traffic-related emissions, we postu...

  10. Inhaled Ozone (O3)-Induces Changes in Serum Metabolomic and Liver Transcriptomic Profiles in Rats

    EPA Science Inventory

    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (03) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that 03 exposure will cause systemic changes in metab...

  11. Mechanisms of Action Involved in Ozone Therapy: Is healing induced via a mild oxidative stress?

    PubMed Central

    2011-01-01

    The potential mechanisms of action of ozone therapy are reviewed in this paper. The therapeutic efficacy of ozone therapy may be partly due the controlled and moderate oxidative stress produced by the reactions of ozone with several biological components. The line between effectiveness and toxicity of ozone may be dependent on the strength of the oxidative stress. As with exercise, it is well known that moderate exercise is good for health, whereas excessive exercise is not. Severe oxidative stress activates nuclear transcriptional factor kappa B (NFκB), resulting in an inflammatory response and tissue injury via the production of COX2, PGE2, and cytokines. However, moderate oxidative stress activates another nuclear transcriptional factor, nuclear factor-erythroid 2-related factor 2 (Nrf2). Nrf2 then induces the transcription of antioxidant response elements (ARE). Transcription of ARE results in the production of numerous antioxidant enzymes, such as SOD, GPx, glutathione-s-transferase(GSTr), catalase (CAT), heme-oxygenase-1 (HO-1), NADPH-quinone-oxidoreductase (NQO-1), phase II enzymes of drug metabolism and heat shock proteins (HSP). Both free antioxidants and anti-oxidative enzymes not only protect cells from oxidation and inflammation but they may be able to reverse the chronic oxidative stress. Based on these observations, ozone therapy may also activate Nrf2 via moderate oxidative stress, and suppress NFκB and inflammatory responses. Furthermore, activation of Nrf2 results in protection against neurodegenerative diseases, such as Alzheimer's and Parkinson's diseases. Mild immune responses are induced via other nuclear transcriptional factors, such as nuclear factor of activated T-cells (NFAT) and activated protein-1 (AP-1). Additionally, the effectiveness of ozone therapy in vascular diseases may also be explained by the activation of another nuclear transcriptional factor, hypoxia inducible factor-1α (HIF-1a), which is also induced via moderate

  12. Mechanisms of Action Involved in Ozone Therapy: Is healing induced via a mild oxidative stress?

    PubMed

    Sagai, Masaru; Bocci, Velio

    2011-12-20

    The potential mechanisms of action of ozone therapy are reviewed in this paper. The therapeutic efficacy of ozone therapy may be partly due the controlled and moderate oxidative stress produced by the reactions of ozone with several biological components. The line between effectiveness and toxicity of ozone may be dependent on the strength of the oxidative stress. As with exercise, it is well known that moderate exercise is good for health, whereas excessive exercise is not.Severe oxidative stress activates nuclear transcriptional factor kappa B (NFκB), resulting in an inflammatory response and tissue injury via the production of COX2, PGE2, and cytokines. However, moderate oxidative stress activates another nuclear transcriptional factor, nuclear factor-erythroid 2-related factor 2 (Nrf2). Nrf2 then induces the transcription of antioxidant response elements (ARE). Transcription of ARE results in the production of numerous antioxidant enzymes, such as SOD, GPx, glutathione-s-transferase(GSTr), catalase (CAT), heme-oxygenase-1 (HO-1), NADPH-quinone-oxidoreductase (NQO-1), phase II enzymes of drug metabolism and heat shock proteins (HSP). Both free antioxidants and anti-oxidative enzymes not only protect cells from oxidation and inflammation but they may be able to reverse the chronic oxidative stress. Based on these observations, ozone therapy may also activate Nrf2 via moderate oxidative stress, and suppress NFκB and inflammatory responses. Furthermore, activation of Nrf2 results in protection against neurodegenerative diseases, such as Alzheimer's and Parkinson's diseases. Mild immune responses are induced via other nuclear transcriptional factors, such as nuclear factor of activated T-cells (NFAT) and activated protein-1 (AP-1).Additionally, the effectiveness of ozone therapy in vascular diseases may also be explained by the activation of another nuclear transcriptional factor, hypoxia inducible factor-1α (HIF-1a), which is also induced via moderate oxidative

  13. Preexposure to ozone blocks the antigen-induced late asthmatic response of the canine peripheral airways

    SciTech Connect

    Turner, C.R.; Kleeberger, S.R.; Spannhake, E.W. )

    1989-01-01

    The influence of exposure of the airways to ozone on acute allergic responsiveness has been investigated in several species. Little is known, however, about the effect of this environmental pollutant on the late asthmatic response (LAR) in animals in which it is exhibited. The purpose of this study was to evaluate this effect in the canine peripheral airways and to assess the potential role of mast cells in modulating the effect. A series of experiments on seven mongrel dogs demonstrated that the numbers of mast cells at the base of the epithelial region of small subsegmental airways exposed to 1 ppm ozone for 5 min were significantly (p less than .01) increased 3 h following exposure compared to air exposed or nonexposed control airways. In a second series of experiments performed on eight additional mongrel dogs with inherent sensitivity to Ascaris suum antigen, antigen aerosol was administered to the sublobar segment 3 h following ozone preexposure when mast cell numbers were presumed to be increased. These experiments were performed to determine whether ozone preexposure could enhance the late-phase response to antigen by virtue of acutely increasing the number of mast cells available to bind the antigen. Four of the eight dogs tested displayed a late-phase response to antigen following air-sham preexposure. In these four dogs, simultaneous ozone preexposure of a contralateral lobe completely blocked the late-phase response to antigen. These results indicate that the consequences of a single exposure to ozone persist beyond its effects on acute antigen-induced bronchoconstriction and extend to the complex processes involved with the late response. This attenuating effect of ozone is seen under conditions where mast-cell numbers in the airways are increased above baseline levels.

  14. Inflammatory and Repair Pathways Induced in Human Bronchoalveolar Lavage Cells with Ozone Inhalation

    PubMed Central

    Wong, Hofer; Tenney, Rachel; Chen, Chun; Stiner, Rachel; Balmes, John R.; Paquet, Agnès C.; Arjomandi, Mehrdad

    2015-01-01

    Background Inhalation of ambient levels of ozone causes airway inflammation and epithelial injury. Methods To examine the responses of airway cells to ozone-induced oxidative injury, 19 subjects (7 with asthma) were exposed to clean air (0ppb), medium (100ppb), and high (200ppb) ambient levels of ozone for 4h on three separate occasions in a climate-controlled chamber followed by bronchoscopy with bronchoalveolar lavage (BAL) 24h later. BAL cell mRNA expression was examined using Affymetrix GeneChip Microarray. The role of a differentially expressed gene (DEG) in epithelial injury was evaluated in an in vitro model of injury [16HBE14o- cell line scratch assay]. Results Ozone exposure caused a dose-dependent up-regulation of several biologic pathways involved in inflammation and repair including chemokine and cytokine secretion, activity, and receptor binding; metalloproteinase and endopeptidase activity; adhesion, locomotion, and migration; and cell growth and tumorigenesis regulation. Asthmatic subjects had 1.7- to 3.8-fold higher expression of many DEGs suggestive of increased proinflammatory and matrix degradation and remodeling signals. The most highly up-regulated gene was osteopontin, the protein level of which in BAL fluid increased in a dose-dependent manner after ozone exposure. Asthmatic subjects had a disproportionate increase in non-polymerized osteopontin with increasing exposure to ozone. Treatment with polymeric, but not monomeric, osteopontin enhanced the migration of epithelial cells and wound closure in an α9β1 integrin-dependent manner. Conclusions Expression profiling of BAL cells after ozone exposure reveals potential regulatory genes and pathways activated by oxidative stress. One DEG, osteopontin, promotes epithelial wound healing in an in vitro model of injury. PMID:26035830

  15. Protein-induced bending and DNA cyclization.

    PubMed

    Kahn, J D; Crothers, D M

    1992-07-15

    We have applied T4 ligase-mediated DNA cyclization kinetics to protein-induced bending in DNA. The presence and direction of a static bend can be inferred from J factors for cyclization of 150- to 160-base-pair minicircles, which include a catabolite activator protein binding site phased against a sequence-directed bend. We demonstrate a quasi-thermodynamic linkage between cyclization and protein binding; we find that properly phased DNAs bind catabolite activator protein approximately 200-fold more tightly as circles than as linear molecules. The results unambiguously distinguish DNA bends from isotropically flexible sites and can explain cooperative binding by proteins that need not contact each other.

  16. DNA strand breaks in human nasal respiratory epithelium are induced upon exposure to urban pollution.

    PubMed Central

    Calderon-Garciduenas, L; Osnaya-Brizuela, N; Ramirez-Martinez, L; Villarreal-Calderon, A

    1996-01-01

    All organisms have the ability to respond and adapt to a myriad of environmental insults. The human respiratory epithelium, when exposed to oxidant gases in photochemical smog, is at risk of DNA damage and requires efficient cellular adaptative responses to resist the environmentally induced cell damage. Ozone and its reaction products induce in vitro and in vivo DNA single strand breaks (SSBs) in respiratory epithelial cells and alveolar macrophages. To determine if exposure to a polluted atmosphere with ozone as the main criteria pollutant induces SSBs in nasal epithelium, we studied 139 volunteers, including a control population of 19 children and 13 adult males who lived in a low-polluted Pacific port, 69 males and 16 children who were permanent residents of Southwest Metropolitan Mexico City (SWMMC), and 22 young males newly arrived to SWMMC and followed for 12 weeks. Respiratory symptoms, nasal cytology and histopathology, cell viabilities, and single-cell gel electrophoresis were investigated. Atmospheric pollutant data were obtained from a fixed-site monitoring station. SWMMC volunteers spent >7 hr/day outdoors and all had upper respiratory symptoms. A significant difference in the numbers of DNA-damaged nasal cells was observed between control and chronically exposed subjects, both in children (p<0.00001) and in adults (p<0.01). SSBs in newly arrived subjects quickly increased upon arrival to the city, from 39.8 +/- 8.34% in the first week to 67.29 +/- 2.35 by week 2. Thereafter, the number of cells with SSBs remained stable in spite of the continuous increase in cumulative ozone, suggesting a threshold for cumulative DNA nasal damage. Exposure to a polluted urban atmosphere induces SSBs in human nasal respiratory epithelium, and nasal SSBs could serve as a biomarker of ozone exposure. Further, because DNA strand breaks are a threat to cell viability and genome integrity and appear to be a critical lesion responsible for p53 induction, nasal SSBs should be

  17. DNA strand breaks in human nasal respiratory epithelium are induced upon exposure to urban pollution.

    PubMed

    Calderon-Garciduenas, L; Osnaya-Brizuela, N; Ramirez-Martinez, L; Villarreal-Calderon, A

    1996-02-01

    All organisms have the ability to respond and adapt to a myriad of environmental insults. The human respiratory epithelium, when exposed to oxidant gases in photochemical smog, is at risk of DNA damage and requires efficient cellular adaptative responses to resist the environmentally induced cell damage. Ozone and its reaction products induce in vitro and in vivo DNA single strand breaks (SSBs) in respiratory epithelial cells and alveolar macrophages. To determine if exposure to a polluted atmosphere with ozone as the main criteria pollutant induces SSBs in nasal epithelium, we studied 139 volunteers, including a control population of 19 children and 13 adult males who lived in a low-polluted Pacific port, 69 males and 16 children who were permanent residents of Southwest Metropolitan Mexico City (SWMMC), and 22 young males newly arrived to SWMMC and followed for 12 weeks. Respiratory symptoms, nasal cytology and histopathology, cell viabilities, and single-cell gel electrophoresis were investigated. Atmospheric pollutant data were obtained from a fixed-site monitoring station. SWMMC volunteers spent >7 hr/day outdoors and all had upper respiratory symptoms. A significant difference in the numbers of DNA-damaged nasal cells was observed between control and chronically exposed subjects, both in children (p<0.00001) and in adults (p<0.01). SSBs in newly arrived subjects quickly increased upon arrival to the city, from 39.8 +/- 8.34% in the first week to 67.29 +/- 2.35 by week 2. Thereafter, the number of cells with SSBs remained stable in spite of the continuous increase in cumulative ozone, suggesting a threshold for cumulative DNA nasal damage. Exposure to a polluted urban atmosphere induces SSBs in human nasal respiratory epithelium, and nasal SSBs could serve as a biomarker of ozone exposure. Further, because DNA strand breaks are a threat to cell viability and genome integrity and appear to be a critical lesion responsible for p53 induction, nasal SSBs should be

  18. DNA bulky adducts in a Mediterranean population correlate with environmental ozone concentration, an indicator of photochemical smog.

    PubMed

    Palli, Domenico; Saieva, Calogero; Grechi, Daniele; Masala, Giovanna; Zanna, Ines; Barbaro, Antongiulio; Decarli, Adriano; Munnia, Armelle; Peluso, Marco

    2004-03-01

    Ozone (O(3)), the major oxidant component in photochemical smog, mostly derives from photolysis of nitrogen dioxide. O(3) may have biologic effects directly and/or via free radicals reacting with other primary pollutants and has been reported to influence daily mortality and to increase lung cancer risk. Although DNA damage may be caused by ozone itself, only other photochemical reaction products (as oxidised polycyclic aromatic hydrocarbons) may form bulky DNA adducts, a reliable biomarker of genotoxic damage and cancer risk, showing a seasonal trend. In a large series consisting of 320 residents in the metropolitan area of Florence, Italy, enrolled in a prospective study for the period 1993-1998 (206 randomly sampled volunteers, 114 traffic-exposed workers), we investigated the correlation between individual levels of DNA bulky adducts and a cumulative O(3) exposure score. The average O(3) concentrations were calculated for different time windows (0-5 to 0-90 days) prior to blood drawing for each participant, based on daily measurements provided by the local monitoring system. Significant correlations between DNA adduct levels and O3 cumulative exposure scores in the last 2-8 weeks before enrollment emerged in never smokers. Correlations were highest in the subgroup of never smokers residing in the urban area and not occupationally exposed to vehicle traffic pollution, with peak values for average concentrations 4-6 weeks before enrollment (r = 0.34). Our current findings indicate that DNA adduct formation may be modulated by individual characteristics and by the cumulative exposure to environmental levels of ozone in the last 4-6 weeks, possibly through ozone-associated reactive pollutants.

  19. Oxidized modification of fragments D and E from fibrinogen induced by ozone.

    PubMed

    Rosenfeld, M A; Leonova, V B; Shchegolikhin, A N; Razumovskii, S D; Konstantinova, M L; Bychkova, A V; Kovarskii, A L

    2010-10-01

    Ozone-induced free-radical oxidation of fragments D and E from fibrinogen has been studied. The methods of elastic and dynamic light scattering in combination with electrophoresis of unreduced samples have shown the acceleration of enzymatic covalent crosslinking of molecules of oxidation-modified fragment D under the action of factor XIIIa. UV and IR spectroscopy shows that free-radical oxidation of amino acid residues of polypeptide chains catalyzed by ozone affects the cyclic and amino groups, giving rise to generation of mainly oxygen-containing products. Comparison of the IR spectra obtained for the oxidation-modified D and E fragments revealed more significant transformation of functional groups for the D fragment. EPR spectroscopy showed that the rotational correlation time of spin labels bound to the ozonized proteins decreased in comparison with the non-ozonized proteins. The rotation correlation time of the radicals covalently bound to the ozonized D and E fragments suggests that D fragment of fibrinogen is more sensitive to free-radical oxidation followed by local structural changes. Possible causes of different degrees of oxidation for fragments D and E are discussed.

  20. Involvement of abscisic acid in ozone-induced puerarin production of Pueraria thomsnii Benth. suspension cell cultures.

    PubMed

    Sun, Lina; Su, Hu; Zhu, Yun; Xu, Maojun

    2012-01-01

    Exposure to ozone induced a rapid increase in the levels of the sesquiterpene phytohormone abscisic acid (ABA) and the isoflavone puerarin in suspension cell cultures of Pueraria thomsnii Benth. The observed increases in ABA and puerarin were dependent on the concentration of ozone applied to P. thomsnii cell cultures. In order to examine the role of ABA in ozone-induced puerarin production, cell suspensions were pretreated with the ABA biosynthetic inhibitor fluridone. Following ozone exposure, fluridone treatment suppressed ABA accumulation suggesting ABA was normally synthesized de novo through the carotenoid pathway. Fluridone also blocked ozone-induced puerarin production, which could be reversed through application of exogenous ABA. However, in the absence of ozone, ABA itself had no effect on puerarin accumulation in the suspension cells. Taken together, the data indicate that ozone is an efficient elicitor of puerarin production and may be particularly applicable for improving puerarin production in plant cell cultures. Furthermore, we demonstrate that ABA is one factor associated with ozone-induced puerarin production in P. thomsnii cell cultures.

  1. Inhibitory effect of hydrogen sulfide on ozone-induced airway inflammation, oxidative stress, and bronchial hyperresponsiveness.

    PubMed

    Zhang, Pengyu; Li, Feng; Wiegman, Coen H; Zhang, Min; Hong, Yan; Gong, Jicheng; Chang, Yan; Zhang, Junfeng Jim; Adcock, Ian; Chung, Kian Fan; Zhou, Xin

    2015-01-01

    Exposure to ozone has been associated with airway inflammation, oxidative stress, and bronchial hyperresponsiveness. The goal of this study was to examine whether these adverse effects of ozone could be prevented or reversed by hydrogen sulfide (H2S) as a reducing agent. The H2S donor sodium (NaHS) (2 mg/kg) or vehicle (PBS) was intraperitoneally injected into mice 1 hour before and after 3-hour ozone (2.5 ppm) or air exposure, and the mice were studied 24 hours later. Preventive and therapeutic treatment with NaHS reduced the ozone-induced increases in the total cells, including neutrophils and macrophages; this treatment also reduced levels of cytokines, including TNF-α, chemokine (C-X-C motif) ligand 1, IL-6, and IL-1β levels in bronchial alveolar lavage fluid; inhibited bronchial hyperresponsiveness; and attenuated ozone-induced increases in total malondialdehyde in bronchoalveolar lavage fluid and decreases in the ratio of reduced glutathione/oxidized glutathione in the lung. Ozone exposure led to decreases in the H2S production rate and in mRNA and protein levels of cystathionine-β-synthetase and cystathionine-γ-lyase in the lung. These effects were prevented and reversed by NaHS treatment. Furthermore, NaHS prevented and reversed the phosphorylation of p38 mitogen-activated protein kinase and heat shock protein 27. H2S may have preventive and therapeutic value in the treatment of airway diseases that have an oxidative stress basis.

  2. ACUTE OZONE-INDUCED INFLAMMATORY GENE EXPRESSION IN THE RAT LUNG IS NOT RELATED TO LEVELS OF ANTIOXIDANTS IN THE LAVAGE FLUID

    EPA Science Inventory

    ABSTRACT BODY: Ozone causes oxidative stress and lung inflammation. We hypothesized that rat strains with or without genetic susceptibility to cardiovascular disease will have different antioxidant levels in alveolar lining, and that ozone induced inflammatory gene expression wil...

  3. Ozone-induced loss of neuronal M{sub 2} muscarinic receptor function is prevented by cyclophosphamide

    SciTech Connect

    Gambone, L.M.; Elbon, C.L.; Fryer, A.D.

    1994-09-01

    The authors tested the hypothesis that inflammatory cells mediate the loss of neuronal M{sub 2} muscarinic receptors in the lung after ozone exposure. Pathogen-free guinea pigs treated with cyclophosphamide (30 mg {center_dot} kg{sup {minus}1} {center_dot} day{sup {minus}1} ip for 7 days) before exposure to ozone were compared with untreated ozone-exposed animals. This dose of cyclophosphamide significantly reduced leukocytes in peripheral blood and bronchoalveolar lavage fluid. Twenty-four hours after ozone, muscarinic receptor function was tested in anesthetized animals. In air-exposed guinea pigs, vagally induced bronchoconstriction was attenuated by the muscarinic agonist pilocarpine (0.1-100 {mu}g/kg iv) and potentiated by the selective M{sub 2} antagonist gallamine (0.1-10 mg/kg iv), indicating that the neuronal M{sub 2} muscarinic receptors were functioning. These responses were significantly reduced after ozone, indicating loss of neuronal M{sub 2} muscarinic receptor function. However, in those animals treated with cyclophosphamide, M{sub 2} muscarinic receptor function was not altered by ozone. These data suggest that ozone-induced loss of neuronal muscarinic receptor function is mediated via inflammatory cells and that the link between ozone-induced hyperresponsiveness and inflammation may be the neuronal M{sub 2} muscarinic receptor. 27 refs., 9 figs.

  4. Dual p38/JNK mitogen activated protein kinase inhibitors prevent ozone-induced airway hyperreactivity in guinea pigs.

    PubMed

    Verhein, Kirsten C; Salituro, Francesco G; Ledeboer, Mark W; Fryer, Allison D; Jacoby, David B

    2013-01-01

    Ozone exposure causes airway hyperreactivity and increases hospitalizations resulting from pulmonary complications. Ozone reacts with the epithelial lining fluid and airway epithelium to produce reactive oxygen species and lipid peroxidation products, which then activate cell signaling pathways, including the mitogen activated protein kinase (MAPK) pathway. Both p38 and c-Jun NH2 terminal kinase (JNK) are MAPK family members that are activated by cellular stress and inflammation. To test the contribution of both p38 and JNK MAPK to ozone-induced airway hyperreactivity, guinea pigs were pretreated with dual p38 and JNK MAPK inhibitors (30 mg/kg, i.p.) 60 minutes before exposure to 2 ppm ozone or filtered air for 4 hours. One day later airway reactivity was measured in anesthetized animals. Ozone caused airway hyperreactivity one day post-exposure, and blocking p38 and JNK MAPK completely prevented ozone-induced airway hyperreactivity. Blocking p38 and JNK MAPK also suppressed parasympathetic nerve activity in air exposed animals, suggesting p38 and JNK MAPK contribute to acetylcholine release by airway parasympathetic nerves. Ozone inhibited neuronal M2 muscarinic receptors and blocking both p38 and JNK prevented M2 receptor dysfunction. Neutrophil influx into bronchoalveolar lavage was not affected by MAPK inhibitors. Thus p38 and JNK MAPK mediate ozone-induced airway hyperreactivity through multiple mechanisms including prevention of neuronal M2 receptor dysfunction.

  5. Ozone-induced tolerance to hyperoxia in rats

    SciTech Connect

    Jackson, R.M.; Frank, L.

    1984-03-01

    Preexposure of adult rats to ozone (0.8 +/- 0.1 ppm for 7 days) has been found to produce a marked degree of tolerance to hyperoxia (greater than 95% O2). The survival of O/sub 3/-preexposed rats in hyperoxia for 168 h was 28 of 32 (88%) compared with a rate of 2 of 18 (11%) for nonpreexposed rats. Total lung superoxide dismutase (SOD), glutathione peroxidase (GP), glucose 6-phosphate dehydrogenase (G6-PD), and catalase (CAT) activities were all significantly increased after O/sub 3/ preexposure and after the subsequent hyperoxic challenge. Probable mechanisms accounting for the markedly improved survival in hyperoxia after O/sub 3/ preexposure include both increased lung antioxidant enzyme and repair of structural damage by proliferation of alveolar lining cells. The demonstration of cross-tolerance between the atmospheric oxidants O/sub 3/ and O/sub 2/ suggests that there are similarities in the lung's adaptation to both oxidants.

  6. Light-Induced Dielectrophoretic Manipulation of DNA

    PubMed Central

    Hoeb, Marco; Rädler, Joachim O.; Klein, Stefan; Stutzmann, Martin; Brandt, Martin S.

    2007-01-01

    Light-induced dielectrophoretic movement of polystyrene beads and λ-DNA is studied using thin films of amorphous hydrogenated silicon as local photoaddressable electrodes with a diameter of 4 μm. Positive (high-field seeking) dielectrophoretic movement is observed for both types of objects. The absence of strong negative (low-field seeking) dielectrophoresis of DNA at high frequencies is in agreement with the similarity of the dielectric constants of DNA and water, the real part of the dielectric function. The corresponding imaginary part of the dielectric function governed by the conductivity of DNA can be determined from a comparison of the frequency dependence of the dielectrophoretic drift velocity with the Clausius-Mossotti relation. PMID:17483160

  7. Ozone therapy ameliorates tubulointerstitial inflammation by regulating TLR4 in adenine-induced CKD rats.

    PubMed

    Chen, Zhiyuan; Liu, Xiuheng; Yu, Gang; Chen, Hui; Wang, Lei; Wang, Zhishun; Qiu, Tao; Weng, Xiaodong

    2016-06-01

    Tubulointerstitium inflammation is a common pathway aggravating chronic kidney disease (CKD) progression and the mechanism is partly associated with excessive activation of toll-like receptor 4 (TLR4) in tubulointerstitium. Ozone therapy is demonstrated to alleviate inflammation in some experiments. The aim of this study is to examine whether ozone therapy could ameliorate chronic tubulointerstitium inflammation by suppressing TLR4 in adenine-induced CKD rats. Sprague-Dawley rats were fed with 0.75% adenine-containing diet to induce CKD and tubulointerstitium inflammation injury. Ozone therapy (1.1 mg/kg) was simultaneously administrated by rectal insufflations (i.r.). After 4 weeks, serum and kidney samples were collected for detection. Renal function and systemic electrolyte were detected. Renal pathological changes were assessed by hematoxylin-eosin (H&E) staining and Masson trichrome (MT) staining. Immunohistochemistry, Western blot and Real-time PCR were applied to evaluate tubulointerstitium inflammation as well as the expression of TLR4 and phosphorylated nuclear factor kappa B P65 (p-NF-κB P65) in rats. The results showed ozone therapy improved serious renal insufficiency, systemic electrolyte disorder and tubulointerstitium morphology damages in adenine-induced CKD rats. In addition, ozone therapy suppressed excessive activation of TLR4 and p-NF-κB P65 in the tubulointerstitium of adenine-induced CKD rats, accompanied by the reduction of inflammation-related cytokines including monocyte chemoattractant protein-1 (MCP-1), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6). The protein expression of TLR4 was positively correlated with the protein expression levels of MCP-1 (r = 0.7863, p < 0.01) and TNF-α (r = 0.7547, p < 0.01) in CKD rats. These findings indicated ozone therapy could attenuate tubulointerstitium inflammation injury in adenine-induced CKD rats and the mechanism might associate with the

  8. Ozone-induced changes in the expression of the genes encoding regulatory enzymes for polyamine, ethylene and phenylpropanoid metabolisms in ozone tolerant and sensitive birch (Betula pendula Roth) clones

    SciTech Connect

    Talvinen, J.; Pellinen, R.; Eloranta, T.; Kangasjaervi, J. ); Julkunen-Tiitto, R. ); Karjalainen, R. )

    1993-05-01

    Increase in the atmospheric ozone concentration has been shown to affect plant growth in several ways; from decreased photosynthetic activity to visible dames and in some extreme situations even to tissue death. Plants protect themselves from the damaging effect of ozone by inducing several physiological reactions. For example, increases in ethylene production, polyamine and phenylpropanoid synthesis have been observed in stress reaction induced by increased atmospheric ozone. similar changes, which are often called general stress reactions, are induced by several other biotic and which are often called general stress reactions, are induced by several other biontic and abiotic factors, e.g., plant pathogens. It has been shown previously that the production of stress ethylene can partly be responsible for the ozone damage formation in plants. Induction of stress-polyamine synthesis can prevent ethylene formation and is higher in some ozone-tolerant plants. We have exposed ozone sensitive and resistant birch clones to ozone (150 ppb. 8 hours) to analyze ozone-induced changes in the phenylpropanoid and polyamine metabolisms and gene expression. The polyamine and phenylpropanoid contents of the experimental material are currently being analyzed and the results will be presented. We have also cloned by PCR gene probes for birch ACC-synthase, arginine decarboxylase (ADC) and phenylalanine ammoniumlyase (PAL) genes. Results will be presented where the probes have been used to analyze ozone-induced expression of the genes in the birch clones.

  9. Effects of ozone and endotoxin coexposure on rat airway epithelium: potentiation of toxicant-induced alterations.

    PubMed Central

    Wagner, J G; Hotchkiss, J A; Harkema, J R

    2001-01-01

    Tropospheric ozone is the major oxidizing component in photochemical smog and is one of the most pervasive problems to human health of the criteria air pollutants for which the National Ambient Air Quality Standards have been designated by the Clean Air Act. Although many adverse health effects of ozone exposure have been documented in both humans and laboratory animals, controversy surrounds the establishment and implementation of ozone standards set forth by the U.S. Environmental Protection Agency. Because people are commonly exposed to more than one air pollutant at a time, studies that examine coexposures to airborne materials may be more relevant for assessing their risks to human health. Airborne biogenic substances such as pollens, spores, and bacterial products are ubiquitous in the environment, and when inhaled can cause adverse respiratory symptoms. One such biogenic agent, bacterial endotoxin, is a potent stimulus of airway inflammation and is a ubiquitous airborne contaminant commonly found in domestic, agricultural, and industrial settings. Little is known about the interaction of exposures to biogenic substances and criteria air pollutants such as ozone. In the last few years we have performed a series of studies in rodents that examined the biologic responses of the respiratory epithelium after airway exposures to both endotoxin and ozone. When exposed to ozone (0.5 ppm 8 hr/day for 3 days), Fischer rats develop lesions in the nasal transitional epithelium, whereas intranasal instillation of endotoxin (20 microg) elicits epithelial lesions in the respiratory epithelium of the nose and conducting airways. Our studies were designed to examine how exposure to one toxicant may affect the airway epithelial lesions induced by the other toxicant. We investigated the potential role of acute inflammation in the enhancement of airway epithelial lesions after exposure of these two toxicants in neutrophil-sufficient and neutrophil-deficient rodents. A summary

  10. Effects of ozone (O3) therapy on cisplatin-induced ototoxicity in rats.

    PubMed

    Koçak, Hasan Emre; Taşkın, Ümit; Aydın, Salih; Oktay, Mehmet Faruk; Altınay, Serdar; Çelik, Duygu Sultan; Yücebaş, Kadir; Altaş, Bengül

    2016-12-01

    The aim of this study is to investigate the effect of rectal ozone and intratympanic ozone therapy on cisplatin-induced ototoxicity in rats. Eighteen female Wistar albino rats were included in our study. External auditory canal and tympanic membrane examinations were normal in all rats. The rats were randomly divided into three groups. Initially, all the rats were tested with distortion product otoacoustic emissions (DPOAE), and emissions were measured normally. All rats were injected with 5-mg/kg/day cisplatin for 3 days intraperitoneally. Ototoxicy had developed in all rats, as confirmed with DPOAE after 1 week. Rectal and intratympanic ozone therapy group was Group 1. No treatment was administered for the rats in Group 2 as the control group. The rats in Group 3 were treated with rectal ozone. All the rats were tested with DPOAE under general anesthesia, and all were sacrificed for pathological examination 1 week after ozone administration. Their cochleas were removed. The outer hair cell damage and stria vascularis damage were examined. In the statistical analysis conducted, a statistically significant difference between Group 1 and Group 2 was observed in all frequencies according to the DPOAE test. In addition, between Group 2 and Group 3, a statistically significant difference was observed in the DPOAE test. However, a statistically significant difference was not observed between Group 1 and Group 3 according to the DPOAE test. According to histopathological scoring, the outer hair cell damage score was statistically significantly high in Group 2 compared with Group 1. In addition, the outer hair cell damage score was also statistically significantly high in Group 2 compared with Group 3. Outer hair cell damage scores were low in Group 1 and Group 3, but there was no statistically significant difference between these groups. There was no statistically significant difference between the groups in terms of stria vascularis damage score examinations

  11. Gender differences in ozone-induced pulmonary and metabolic health effects

    EPA Science Inventory

    SOT 2015 abstractGender differences in ozone-induced pulmonary and metabolic health effectsU.P. Kodavanti1, V.L. Bass2, M.C. Schladweiler1, C.J. Gordon3, K.A. Jarema3, P. Phillips3, A.D. Ledbetter1, D.B. Miller4, S. Snow5, J.E. Richards1. 1 EPHD, NHEERL, USEPA, Research Triangle ...

  12. Sex differences in diet and inhaled ozone (O3) induced metabolic impairment

    EPA Science Inventory

    APS 2015 abstract Sex differences in diet and inhaled ozone (O3) induced metabolic impairment U.P. Kodavanti1, V.L. Bass2, M.C. Schladweiler1, C.J. Gordon3, K.A. Jarema1, P. Phillips1, A.D. Ledbetter1, D.B. Miller4, S. Snow5, J.E. Richards1. 1 EPHD, NHEERL, USEPA, Research Triang...

  13. Seasonal development of ozone-induced foliar injury on tall milkweed (Asclepias exaltata) in Great Smoky Mountains National Park.

    PubMed

    Souza, Lara; Neufeld, Howard S; Chappelka, Arthur H; Burkey, Kent O; Davison, Alan W

    2006-05-01

    The goals of this study were to document the development of ozone-induced foliar injury, on a leaf-by-leaf basis, and to develop ozone exposure relationships for leaf cohorts and individual tall milkweeds (Asclepias exaltata L.) in Great Smoky Mountains National Park. Plants were classified as either ozone-sensitive or insensitive based on the amount of foliar injury. Sensitive plants developed injury earlier in the season and to a greater extent than insensitive plants. Older leaf cohorts were more likely to belong to high injury classes by the end of each of the two growing seasons. In addition, leaf loss was more likely for older cohorts (2000) and lower leaf positions (2001) than younger cohorts and upper leaves, respectively. Most leaves abscised without prior ozone-like stippling or chlorosis. Failure to take this into account can result in underestimation of the effects of ozone on these plants.

  14. Therapeutic effect of ozone and rutin on adriamycin-induced testicular toxicity in an experimental rat model.

    PubMed

    Salem, E A; Salem, N A; Hellstrom, W J

    2017-02-01

    To evaluate the cytoprotective effects of rutin, ozone and their combination on adriamycin (ADR)-induced testicular toxicity, 50 male albino rats were classified into five groups of ten animals each as follows: placebo group; ADR group; ADR + rutin group; ADR + ozone group and ADR + rutin + ozone group. Sperm functions, testosterone (T), luteinising hormone (LH), follicle stimulating hormone (FSH), testicular enzymes, oxidant/antioxidant status, C-reactive protein, monocyte chemoattractant proteins-1 and leukotriene B4 were determined. After ADR injection, a decline in sperm functions was observed. FSH and LH levels were increased, T level and testicular enzymes were decreased, significant enhancement in oxidative stress with subsequent depletion in antioxidants was detected and inflammatory markers were significantly elevated. Treatment with rutin and/or ozone, however, improved the aforementioned parameters. Ozone therapy alone almost completely reversed the toxic effects of ADR and restored all parameters to normal levels.

  15. Executive Summary: variation in susceptibility to ozone-induced health effects in rodent models of cardiometabolic disease.

    PubMed

    Dye, Janice A; Costa, Daniel L; Kodavanti, Urmila P

    2015-01-01

    Seven million premature deaths occur annually due to air pollution worldwide, of which ∼80% are attributed to exacerbation of cardiovascular disease (CVD), necessitating greater attention to understanding the causes of susceptibility to air pollution in this sector of population. We used rat models of CVD with or without obesity and compared them to healthy strains to examine the risk factors of ozone-induced lung injury and inflammation. We examined functional, biochemical and molecular changes in several organs to evaluate how physiological factors as well as compensatory antioxidant reserves modulate processes by which ozone injury is influenced by underlying disease. In this study, we highlight key findings of this series of reports. We show that underlying cardiopulmonary insufficiency in genetically predisposed rats appears to increase the effective ozone dose; thus dosimetry is one factor contributing to exacerbated ozone effects. We further show that antioxidant reserve in airway lining fluid modulates ozone-induced damage such that strains with the least antioxidant reserve incur the greatest injury. And finally, we show that the inflammatory response to ozone is governed by a cluster of genes involved in regulating cytokine release, trafficking of inflammatory cells and processes related to cellular apoptosis and growth. All such processes are influenced not only by ozone dosimetry and the lung antioxidant milieu but also by the strain-specific genetic factors. In using a comprehensive systems biology research approach, our data reveal key risk factors for--and strategies to reduce risk of--air pollution mortality among those with CVD.

  16. Lung transcriptional profiling: insights into the mechanisms of ozone-induced pulmonary injury in Wistar Kyoto rats.

    PubMed

    Ward, William O; Ledbetter, Allen D; Schladweiler, Mette C; Kodavanti, Urmila P

    2015-01-01

    Acute ozone-induced pulmonary injury and inflammation are well characterized in rats; however, mechanistic understanding of the pathways involved is limited. We hypothesized that acute exposure of healthy rats to ozone will cause transcriptional alterations, and comprehensive analysis of these changes will allow us to better understand the mechanism of pulmonary injury and inflammation. Male Wistar Kyoto rats (10-12 week) were exposed to air, or ozone (0.25, 0.5 or 1.0 ppm) for 4 h and pulmonary injury and inflammation were assessed at 0-h or 20-h (n = 8/group). Lung gene expression profiling was assessed at 0-h (air and 1.0 ppm ozone, n = 3-4/group). At 20-h bronchoalveolar lavage, fluid protein and neutrophils increased at 1 ppm ozone. Numerous genes involved in acute inflammatory response were up-regulated along with changes in genes involved in cell adhesion and migration, steroid metabolism, apoptosis, cell cycle control and cell growth. A number of NRF2 target genes were also induced after ozone exposure. Based on expression changes, Rela, SP1 and TP3-mediated signaling were identified to be mediating downstream changes. Remarkable changes in the processes of endocytosis provide the insight that ozone-induced lung injury and inflammation are likely initiated by changes in cell membrane components and receptors likely from oxidatively modified lung lining lipids and proteins. In conclusion, ozone-induced injury and inflammation are preceded by changes in gene targets for cell adhesion/migration, apoptosis, cell cycle control and growth regulated by Rela, SP1 and TP53, likely mediated by the process of endocytosis and altered steroid receptor signaling.

  17. Ozone-induced airway epithelial cell death, the neurokinin-1 receptor pathway, and the postnatal developing lung

    PubMed Central

    Murphy, Shannon R.; Oslund, Karen L.; Hyde, Dallas M.; Miller, Lisa A.; Van Winkle, Laura S.

    2014-01-01

    Children are uniquely susceptible to ozone because airway and lung growth continue for an extensive period after birth. Early-life exposure of the rhesus monkey to repeated ozone cycles results in region-specific disrupted airway/lung growth, but the mediators and mechanisms are poorly understood. Substance P (SP), neurokinin-1 receptor (NK-1R); and nuclear receptor Nur77 (NR4A1) are signaling pathway components involved in ozone-induced cell death. We hypothesize that acute ozone (AO) exposure during postnatal airway development disrupts SP/NK-1R/Nur77 pathway expression and that these changes correlate with increased ozone-induced cell death. Our objectives were to 1) spatially define the normal development of the SP/NK-1R/Nur77 pathway in conducting airways; 2) compare how postnatal age modulates responses to AO exposure; and 3) determine how concomitant, episodic ozone exposure modifies age-specific acute responses. Male infant rhesus monkeys were assigned at age 1 mo to two age groups, 2 or 6 mo, and then to one of three exposure subgroups: filtered air (FA), FA+AO (AO: 8 h/day × 2 days), or episodic biweekly ozone exposure cycles (EAO: 8 h/day × 5 days/14-day cycle+AO). O3 = 0.5 ppm. We found that 1) ozone increases SP/NK-1R/Nur77 pathway expression in conducting airways, 2) an ozone exposure cycle (5 days/cycle) delivered early at age 2 mo resulted in an airway that was hypersensitive to AO exposure at the end of 2 mo, and 3) continued episodic exposure (11 cycles) resulted in an airway that was hyposensitive to AO exposure at 6 mo. These observations collectively associate with greater overall inflammation and epithelial cell death, particularly in early postnatal (2 mo), distal airways. PMID:25063800

  18. The degradation mechanism of phenol induced by ozone in wastes system.

    PubMed

    Youmin, Sun; Xiaohua, Ren; Zhaojie, Cui; Guiqin, Zhang

    2012-08-01

    A distinct understanding for the degradation mechanism of phenol induced by ozone is very essential because the ozonation process, one of the advanced oxidation processes (AOPs), is attractive and popular in wastewater treatment. In the present work, the detailed reactions of ozone and phenol are investigated employing the density functional theory B3LYP method with the 6-311++G (d, p) basis set. The profiles of the potential energy surface are constructed and the possible reaction pathways are indicated. These detailed calculation results suggest two degradation reaction mechanisms. One is phenolic H atom abstraction mechanism, and the other is cyclo-addition and ring-opening mechanism. Considering the effect of solvent water, the calculated energy barriers and reaction enthalpies for the reaction of O3 and phenol in water phase are both lower than those in gas phase, though the degradation mechanisms are not changed. This reveals that these degradation reactions are more favorable in the water solvent. The main reaction products are C(6)H(5)OO· radical, a crucial precursor for forming PCDD/Fs and one ring-opening product, which are in good agreement with the experimental observations.

  19. Ozone-induced dissociation: elucidation of double bond position within mass-selected lipid ions.

    PubMed

    Thomas, Michael C; Mitchell, Todd W; Harman, David G; Deeley, Jane M; Nealon, Jessica R; Blanksby, Stephen J

    2008-01-01

    Ions formed from lipids during electrospray ionization of crude lipid extracts have been mass-selected within a quadrupole linear ion trap mass spectrometer and allowed to react with ozone vapor. Gas-phase ion-molecule reactions between unsaturated lipid ions and ozone are found to yield two primary product ions for each carbon-carbon double bond within the molecule. The mass-to-charge ratios of these chemically induced fragments are diagnostic of the position of unsaturation within the precursor ion. This novel analytical technique, dubbed ozone-induced dissociation (OzID), can be applied both in series and in parallel with conventional collision-induced dissociation (CID) to provide near-complete structural assignment of unknown lipids within complex mixtures without prior fractionation or derivatization. In this study, OzID is applied to a suite of complex lipid extracts from sources including human lens, bovine kidney, and commercial olive oil, thus demonstrating the technique to be applicable to a broad range of lipid classes including both neutral and acidic glycerophospholipids, sphingomyelins, and triacylglycerols. Gas-phase ozonolysis reactions are also observed with different types of precursor ions including [M+H]+, [M+Li]+, [M+Na]+, and [M-H]-: in each case yielding fragmentation data that allow double bond position to be unambiguously assigned. Within the human lens lipid extract, three sphingomyelin regioisomers, namely SM(d18:0/15Z-24:1), SM(d18:0/17Z-24:1), and SM(d18:0/19Z-24:1), and a novel phosphatidylethanolamine alkyl ether, GPEtn(11Z-18:1e/9Z-18:1), are identified using a combination of CID and OzID. These discoveries demonstrate that lipid identification based on CID alone belies the natural structural diversity in lipid biochemistry and illustrate the potential of OzID as a complementary approach within automated, high-throughput lipid analysis protocols.

  20. Ozone-Induced Rice Grain Yield Loss Is Triggered via a Change in Panicle Morphology That Is Controlled by ABERRANT PANICLE ORGANIZATION 1 Gene.

    PubMed

    Tsukahara, Keita; Sawada, Hiroko; Kohno, Yoshihisa; Matsuura, Takakazu; Mori, Izumi C; Terao, Tomio; Ioki, Motohide; Tamaoki, Masanori

    2015-01-01

    Rice grain yield is predicted to decrease in the future because of an increase in tropospheric ozone concentration. However, the underlying mechanisms are unclear. Here, we investigated the responses to ozone of two rice (Oryza Sativa L.) cultivars, Sasanishiki and Habataki. Sasanishiki showed ozone-induced leaf injury, but no grain yield loss. By contrast, Habataki showed grain yield loss with minimal leaf injury. A QTL associated with grain yield loss caused by ozone was identified in Sasanishiki/Habataki chromosome segment substitution lines and included the ABERRANT PANICLE ORGANIZATION 1 (APO1) gene. The Habataki allele of the APO1 locus in a near-isogenic line also resulted in grain yield loss upon ozone exposure, suggesting APO1 involvement in ozone-induced yield loss. Only a few differences in the APO1 amino acid sequences were detected between the cultivars, but the APO1 transcript level was oppositely regulated by ozone exposure: i.e., it increased in Sasanishiki and decreased in Habataki. Interestingly, the levels of some phytohormones (jasmonic acid, jasmonoyl-L-isoleucine, and abscisic acid) known to be involved in attenuation of ozone-induced leaf injury tended to decrease in Sasanishiki but to increase in Habataki upon ozone exposure. These data indicate that ozone-induced grain yield loss in Habataki is caused by a reduction in the APO1 transcript level through an increase in the levels of phytohormones that reduce leaf damage.

  1. The Effects of Volcano-Induced Ozone Depletion on Short-lived Climate Forcing in the Arctic

    NASA Astrophysics Data System (ADS)

    Ward, P. L.

    2012-12-01

    Photodissociation of oxygen maintains the stratopause ~50°C warmer than the tropopause. Photodissociation of ozone warms the lower stratosphere, preventing most of this high-energy DNA-damaging solar radiation from reaching the troposphere. Ozone depletion allows more UV energy to reach the lower troposphere causing photodissociation of anthropogenic ozone and nitrogen dioxide. UV energy also penetrates the ocean >10 m where it is absorbed more efficiently than infrared radiation that barely penetrates the surface. Manmade chlorofluorocarbons caused ozone depletion from 1965 to 1994 with slow recovery predicted over the next 50+ years. But the lowest levels of ozone followed the eruptions of Pinatubo (1991 VEI=6), Eyjafjallajökull (2010 VEI=4), and Grímsvötn (2011 VEI=4). Each of the relatively small, basaltic eruptions in Iceland caused more ozone depletion than the long-term effects of chlorofluorocarbons, although total ozone appears to return to pre-eruption levels within a decade. Ozone depletion by 20% increases energy flux thru the lowermost troposphere by 0.7 W m-2 for overhead sun causing temperatures in the lower stratosphere to drop >2°C since 1958 in steps after the 3 largest volcanic eruptions: Agung 1963, El Chichón 1982, and Pinatubo. Temperatures at the surface increased primarily in the regions and at the times of the greatest observed ozone depletion. The greatest warming observed was along the Western Antarctic Peninsula (65.4°S) where minimum temperatures rose 6.7°C from 1951 to 2003 while maximum temperatures remained relatively constant. Minimum total column ozone in September-October was 40-56% lower than in 1972 almost every year since 1987, strongly anti-correlated with observed minimum temperatures. Sea ice decreased 10%, 7 ice shelves separated, 87% of the glaciers retreated and the Antarctic Circumpolar Current warmed. Elsewhere under the ozone hole, warming of continental Antarctica was limited by the high albedo (0.86) of

  2. Variability in ozone-induced pulmonary injury and inflammation in healthy and cardiovascular-compromised rat models.

    PubMed

    Kodavanti, Urmila P; Ledbetter, Allen D; Thomas, Ronald F; Richards, Judy E; Ward, William O; Schladweiler, Mette C; Costa, Daniel L

    2015-01-01

    The molecular bases for variability in air pollutant-induced pulmonary injury due to underlying cardiovascular (CVD) and/or metabolic diseases are unknown. We hypothesized that healthy and genetic CVD-prone rat models will exhibit exacerbated response to acute ozone exposure dependent on the type and severity of disease. Healthy male 12-14-week-old Wistar Kyoto (WKY), Wistar (WS) and Sprague Dawley (SD); and CVD-compromised spontaneously hypertensive (SH), Fawn-Hooded hypertensive (FHH), stroke-prone spontaneously hypertensive (SHSP), obese spontaneously hypertensive heart failure (SHHF) and obese JCR (JCR) rats were exposed to 0.0, 0.25, 0.5, or 1.0 ppm ozone for 4 h; pulmonary injury and inflammation were analyzed immediately following (0-h) or 20-h later. Baseline bronchoalveolar lavage fluid (BALF) protein was higher in CVD strains except for FHH when compared to healthy. Ozone-induced increases in protein and inflammation were concentration-dependent within each strain but the degree of response varied from strain to strain and with time. Among healthy rats, SD were least affected. Among CVD strains, lean rats were more susceptible to protein leakage from ozone than obese rats. Ozone caused least neutrophilic inflammation in SH and SHHF while SHSP and FHH were most affected. BALF neutrophils and protein were poorly correlated when considering the entire dataset (r = 0.55). The baseline and ozone-induced increases in cytokine mRNA varied markedly between strains and did not correlate with inflammation. These data illustrate that the degree of ozone-induced lung injury/inflammation response is likely influenced by both genetic and physiological factors that govern the nature of cardiovascular compromise in CVD models.

  3. Does ozone enhance the remineralizing potential of nanohydroxyapatite on artificially demineralized enamel? A laser induced fluorescence study

    NASA Astrophysics Data System (ADS)

    Srinivasan, Samuelraj; Prabhu, Vijendra; Chandra, Subhash; Koshy, Shalini; Acharya, Shashidhar; Mahato, Krishna K.

    2014-02-01

    The present era of minimal invasive dentistry emphasizes the early detection and remineralization of initial enamel caries. Ozone has been shown to reverse the initial demineralization before the integrity of the enamel surface is lost. Nano-hydroxyapatite is a proven remineralizing agent for early enamel caries. In the present study, the effect of ozone in enhancing the remineralizing potential of nano-hydroxyapatite on artificially demineralized enamel was investigated using laser induced fluorescence. Thirty five sound human premolars were collected from healthy subjects undergoing orthodontic treatment. Fluorescence was recorded by exciting the mesial surfaces using 325 nm He-Cd laser with 2 mW power. Tooth specimens were subjected to demineralization to create initial enamel caries. Following which the specimens were divided into three groups, i.e ozone (ozonated water for 2 min), without ozone and artificial saliva. Remineralization regimen was followed for 3 weeks. The fluorescence spectra of the specimens were recorded from all the three experimental groups at baseline, after demineralization and remineralization. The average spectrum for each experimental group was used for statistical analysis. Fluorescence intensities of Ozone treated specimens following remineralization were higher than that of artificial saliva, and this difference was found to be statistically significant (P<0.0001). In a nutshell, ozone enhanced the remineralizing potential of nanohydroxyapatite, and laser induced fluorescence was found to be effective in assessing the surface mineral changes in enamel. Ozone can be considered an effective agent in reversing the initial enamel caries there by preventing the tooth from entering into the repetitive restorative cycle.

  4. Role of neutralizing anti-murine interleukin-17A monoclonal antibody on chronic ozone-induced airway inflammation in mice.

    PubMed

    Zhang, Min; Fei, Xia; Zhang, Guo-Qing; Zhang, Peng-Yu; Li, Feng; Bao, Wu-Ping; Zhang, Ying-Ying; Zhou, Xin

    2016-10-01

    Exposure to ozone has led to airway inflammation and airway hyperresponsiveness, which potential mechanisms relate to ozone-induced oxidative stress. IL-17 is a growing target for autoimmune and inflammatory diseases. The aim of the study was to examine the inhibitory effects of anti-murine interleukin-17A monoclonal antibody (IL-17mAb) on adverse effects of ozone which are noted above. After C57/BL6 mice were exposed to ozone (2.5ppm; 3h) for 12 times over 6 weeks, IL-17mAb, PBS was intraperitoneally injected into mice 1h after ozone or air exposure for 6 weeks and mice were studied 24h after final exposure, monitoring bronchial responsiveness, airway inflammatory cells, lung histology, levels of neutrophil-related chemokine and proinflammatory cytokines in bronchoalveolar lavage (BAL) fluid and serum, the expression of IL-17A mRNA and protein, glucocorticoid receptors (GR), and the phosphorylation of p38MAPK in lung tissues. The administration of IL-17mAb reduced the ozone-induced increases in total cells, especially neutrophils; decreased levels of cytokines, including IL-8 in BAL fluid, IL-8 and IL-17A in serum; mitigated the severity of airway hyperresponsiveness; attenuated lung inflammation scores and histologic analysis confirmed the suppression of lung inflammation, compared with the administration of a control PBS. Exposure to ozone results in increases in IL-17A production rate, mRNA and protein levels of IL-17A and the protein level of GR. These effects were halted and reversed by IL-17mAb treatment. Furthermore, IL-17mAb also reduced the phosphorylation of p38MAPK. Therefore, we conclude that IL-17mAb may be a useful therapy in ozone-related diseases, including COPD.

  5. Ligand inducible assembly of a DNA tetrahedron.

    PubMed

    Dohno, Chikara; Atsumi, Hiroshi; Nakatani, Kazuhiko

    2011-03-28

    Here we show that a small synthetic ligand can be used as a key building component for DNA nanofabrication. Using naphthyridinecarbamate dimer (NCD) as a molecular glue for DNA hybridization, we demonstrate NCD-triggered formation of a DNA tetrahedron.

  6. Effect of Obesity on Acute Ozone-Induced Changes in Airway Function, Reactivity, and Inflammation in Adult Females

    PubMed Central

    Bennett, William D.; Ivins, Sally; Alexis, Neil E.; Wu, Jihong; Bromberg, Philip A.; Brar, Sukhdev S.; Travlos, Gregory; London, Stephanie J.

    2016-01-01

    We previously observed greater ozone-induced lung function decrements in obese than non-obese women. Animal models suggest that obesity enhances ozone-induced airway reactivity and inflammation. In a controlled exposure study, we compared the acute effect of randomized 0.4ppm ozone and air exposures (2 h with intermittent light exercise) in obese (N = 20) (30induced-sputum (4h post-exposures and on 24h pre-exposure training day, no exercise): measures of C reactive protein (CRP) (blood only), leptin (blood only), adiponectin, interleukins IL-6, IL-1b, and IL-8, and tumor necrosis factor alpha, and sputum cell differential cell counts. The pre- to post-exposure decrease in forced vital capacity after ozone (adjusted for the change after air exposure) was significantly greater in the obese group (12.5+/-7.5 vs. 8.0+/-5.8%, p<0.05). Post ozone exposure, 6 obese and 6 non-obese subjects responded to methacholine at ≤ 10mg/ml (the maximum dose); the degree of hyperresponsiveness was similar for the two groups. Both BMI groups showed similar and significant ozone-induced increases in sputum neutrophils. Plasma IL-6 was increased by exercise (4 hr post air exposure vs. pre) only in the obese but returned to pre-air exposure levels at 20hr post-exposure. Plasma IL-6 was significantly increased at 4hr post ozone exposure in both groups and returned to pre-exposure levels by 20h post-exposure. These results confirm our previous findings of greater post-ozone spirometric decrements in obese young women. However, acute ozone-induced airway reactivity to methacholine and airway inflammation did not differ by obesity at the exposure and exercise levels used. PMID:27513854

  7. DNA-PK is Involved in Repairing a Transient Surge of DNA BreaksInduced by Deceleration of DNA Replication.

    SciTech Connect

    Shimura, Tsutomu; Martin, Melvenia M.; Torres, Michael J.; Gu,Cory; Pluth, Janice M.; DiBernardi, Maria A.; McDonald, Jeffrey S.; Aladjem, Mirit I.

    2006-09-25

    ells that suffer substantial inhibition of DNA replication halt their cell cycle via a checkpoint response mediated by the PI3 kinases ATM and ATR. It is unclear how cells cope with milder replication insults, which are under the threshold for ATM and ATR activation. A third PI3 kinase, DNA-dependent protein kinase (DNA-PK), is also activated following replication inhibition, but the role DNA-PK might play in response to perturbed replication is unclear, since this kinase does not activate the signaling cascades involved in the S-phase checkpoint. Here we report that mild, transient drug-induced perturbation of DNA replication rapidly induced DNA breaks that promptly disappeared in cells that contained a functional DNA-PK whereas such breaks persisted in cells that were deficient in DNA-PK activity. After the initial transient burst of DNA breaks, cells with a functional DNA-PK did not halt replication and continued to synthesize DNA at a slow pace in the presence of replication inhibitors. In contrast, DNA-PK deficient cells subject to low levels of replication inhibition halted cell cycle progression via an ATR-mediated S-phase checkpoint. The ATM kinase was dispensable for the induction of the initial DNA breaks. These observations suggest that DNA-PK is involved in setting a high threshold for the ATR-Chkl-mediated S-phase checkpoint by promptly repairing DNA breaks that appear immediately following inhibition of DNA replication.

  8. Ozone-induced changes in photosynthesis and photorespiration of hybrid poplar in relation to the developmental stage of the leaves.

    PubMed

    Bagard, Matthieu; Le Thiec, Didier; Delacote, Emilien; Hasenfratz-Sauder, Marie-Paule; Banvoy, Jacques; Gérard, Joëlle; Dizengremel, Pierre; Jolivet, Yves

    2008-12-01

    Young poplar trees (Populus tremula Michx. x Populus alba L. clone INRA 717-1B4) were subjected to 120 ppb of ozone for 35 days in phytotronic chambers. Treated trees displayed precocious leaf senescence and visible symptoms of injury (dark brown/black upper surface stippling) exclusively observed on fully expanded leaves. In these leaves, ozone reduced parameters related to photochemistry (Chl content and maximum rate of photosynthetic electron transport) and photosynthetic CO(2) fixation [net CO(2) assimilation, Rubisco (ribulose-1,5-bisphosphate carboxylase oxygenase) activity and maximum velocity of Rubisco for carboxylation]. In fully expanded leaves, the rate of photorespiration as estimated from Chl fluorescence was markedly impaired by the ozone treatment together with the activity of photorespiratory enzymes (Rubisco and glycolate oxidase). Immunoblot analysis revealed a decrease in the content of serine hydroxymethyltransferase in treated mature leaves, while the content of the H subunit of the glycine decarboxylase complex was not modified. Leaves in the early period of expansion were exempt from visible symptoms of injury and remained unaffected as regards all measured parameters. Leaves reaching full expansion under ozone exposure showed potential responses of protection (stimulation of mitochondrial respiration and transitory stomatal closure). Our data underline the major role of leaf phenology in ozone sensitivity of photosynthetic processes and reveal a marked ozone-induced inhibition of photorespiration.

  9. Structural changes of linear DNA molecules induced by cisplatin

    SciTech Connect

    Liu, Zhiguo; Liu, Ruisi; Zhou, Zhen; Zu, Yuangang; Xu, Fengjie

    2015-02-20

    Interaction between long DNA molecules and activated cisplatin is believed to be crucial to anticancer activity. However, the exact structural changes of long DNA molecules induced by cisplatin are still not very clear. In this study, structural changes of long linear double-stranded DNA (dsDNA) and short single-stranded DNA (ssDNA) induced by activated cisplatin have been investigated by atomic force microscopy (AFM). The results indicated that long DNA molecules gradually formed network structures, beads-on-string structures and their large aggregates. Electrostatic and coordination interactions were considered as the main driving forces producing these novel structures. An interesting finding in this study is the beads-on-string structures. Moreover, it is worth noting that the beads-on-string structures were linked into the networks, which can be ascribed to the strong DNA–DNA interactions. This study expands our knowledge of the interactions between DNA molecules and cisplatin. - Highlights: • We investigate structural changes of dsDNA and ssDNA induced by cisplatin. • AFM results indicated long dsDNA formed network, beads-on-string and aggregates. • ssDNA can form very similar structures as those of long linear dsDNA. • A possible formation process of theses novel structure is proposed.

  10. Radiation-induced degradation of DNA bases

    NASA Astrophysics Data System (ADS)

    Douki, T.; Delatour, T.; Martini, R.; Cadet, J.

    1999-01-01

    Radio-induced degradation of DNA involves radical processes. A series of lesions among the major bases degradation products has been measured in isolated DNA exposed to gamma radiation in aerated aqueous solution. Degradation can be accounted for by the formation of hydroxyl radicals upon radiolysis of water (indirect effect). The four bases are degraded in high yield. Direct effect has been mimicked by photo-induced electron abstraction from the bases producing their radical cation. Quantification of the modified bases showed that guanine is the preferential target. This can be explained by its lower oxidation potential and charge transfer phenomena. La décomposition radio-induite de l'ADN fait intervenir des processus radicalaires. Une série de lésions choisies parmi les produits majeurs de dégradation des bases a été mesurée dans de l'ADN isolé exposé au rayonnement en solution aqueuse aérée. Les modifications sont alors dues aux radicaux hydroxyles produits par la radiolyse de l'eau (effet indirect) et les quatre bases sont efficacement dégradées. L'arrachement d'électrons aux bases par photosensibilisation pour produire leur radical cation, a été utilisé comme modèle de l'effet direct. La quantification des bases modifiées montre que la guanine est préférentiellement dégradée. Cette observation peut s'expliquer par le plus faible potentiel d'oxydation de cette base ainsi que par les phénomènes de transfert de charge vers les guanines.

  11. A role for oxalic acid generation in ozone-induced signallization in Arabidopis cells.

    PubMed

    Tran, Daniel; Kadono, Takashi; Molas, Maria Lia; Errakhi, Rafik; Briand, Joël; Biligui, Bernadette; Kawano, Tomonori; Bouteau, François

    2013-03-01

    Ozone (O(3) ) is an air pollutant with an impact increasingly important in our industrialized world. It affects human health and productivity in various crops. We provide the evidences that treatment of Arabidopsis thaliana with O(3) results in ascorbate-derived oxalic acid production. Using cultured cells of A. thaliana as a model, here we further showed that oxalic acid induces activation of anion channels that trigger depolarization of the cell, increase in cytosolic Ca(2+) concentration, generation of reactive oxygen species and cell death. We confirmed that O(3) reacts with ascorbate in the culture, thus resulting in production of oxalic acid and this could be part of the O(3) -induced signalling pathways that trigger programmed cell death.

  12. Cell death induced by ozone and various non-thermal plasmas: therapeutic perspectives and limitations

    PubMed Central

    Lunov, Oleg; Zablotskii, Vitalii; Churpita, Olexander; Chánová, Eliška; Syková, Eva; Dejneka, Alexandr; Kubinová, Šárka

    2014-01-01

    Non-thermal plasma has been recognized as a promising tool across a vast variety of biomedical applications, with the potential to create novel therapeutic methods. However, the understanding of the molecular mechanisms behind non-thermal plasma cellular effects remains a significant challenge. In this study, we show how two types of different non-thermal plasmas induce cell death in mammalian cell cultures via the formation of multiple intracellular reactive oxygen/nitrogen species. Our results showed a discrepancy in the superoxide accumulation and lysosomal activity in response to air and helium plasma, suggesting that triggered signalling cascades might be grossly different between different plasmas. In addition, the effects of ozone, a considerable component of non-thermal plasma, have been simultaneously evaluated and have revealed much faster and higher cytotoxic effects. Our findings offer novel insight into plasma-induced cellular responses, and provide a basis for better controlled biomedical applications. PMID:25410636

  13. Cell death induced by ozone and various non-thermal plasmas: therapeutic perspectives and limitations

    NASA Astrophysics Data System (ADS)

    Lunov, Oleg; Zablotskii, Vitalii; Churpita, Olexander; Chánová, Eliška; Syková, Eva; Dejneka, Alexandr; Kubinová, Šárka

    2014-11-01

    Non-thermal plasma has been recognized as a promising tool across a vast variety of biomedical applications, with the potential to create novel therapeutic methods. However, the understanding of the molecular mechanisms behind non-thermal plasma cellular effects remains a significant challenge. In this study, we show how two types of different non-thermal plasmas induce cell death in mammalian cell cultures via the formation of multiple intracellular reactive oxygen/nitrogen species. Our results showed a discrepancy in the superoxide accumulation and lysosomal activity in response to air and helium plasma, suggesting that triggered signalling cascades might be grossly different between different plasmas. In addition, the effects of ozone, a considerable component of non-thermal plasma, have been simultaneously evaluated and have revealed much faster and higher cytotoxic effects. Our findings offer novel insight into plasma-induced cellular responses, and provide a basis for better controlled biomedical applications.

  14. Regulation of ozone-induced lung inflammation and injury by the β-galactoside-binding lectin galectin-3

    SciTech Connect

    Sunil, Vasanthi R.; Francis, Mary; Vayas, Kinal N.; Cervelli, Jessica A.; Choi, Hyejeong; Laskin, Jeffrey D.; Laskin, Debra L.

    2015-04-15

    Macrophages play a dual role in ozone toxicity, contributing to both pro- and anti-inflammatory processes. Galectin-3 (Gal-3) is a lectin known to regulate macrophage activity. Herein, we analyzed the role of Gal-3 in the response of lung macrophages to ozone. Bronchoalveolar lavage (BAL) and lung tissue were collected 24–72 h after exposure (3 h) of WT and Gal-3{sup -/-} mice to air or 0.8 ppm ozone. In WT mice, ozone inhalation resulted in increased numbers of proinflammatory (Gal-3{sup +}, iNOS{sup +}) and anti-inflammatory (MR-1{sup +}) macrophages in the lungs. While accumulation of iNOS{sup +} macrophages was attenuated in Gal-3{sup -/-} mice, increased numbers of enlarged MR-1{sup +} macrophages were noted. This correlated with increased numbers of macrophages in BAL. Flow cytometric analysis showed that these cells were CD11b{sup +} and consisted mainly (> 97%) of mature (F4/80{sup +}CD11c{sup +}) proinflammatory (Ly6GLy6C{sup hi}) and anti-inflammatory (Ly6GLy6C{sup lo}) macrophages. Increases in both macrophage subpopulations were observed following ozone inhalation. Loss of Gal-3 resulted in a decrease in Ly6C{sup hi} macrophages, with no effect on Ly6C{sup lo} macrophages. CD11b{sup +}Ly6G{sup +}Ly6C{sup +} granulocytic (G) and monocytic (M) myeloid derived suppressor cells (MDSC) were also identified in the lung after ozone. In Gal-3{sup -/-} mice, the response of G-MDSC to ozone was attenuated, while the response of M-MDSC was heightened. Changes in inflammatory cell populations in the lung of ozone treated Gal-3{sup -/-} mice were correlated with reduced tissue injury as measured by cytochrome b5 expression. These data demonstrate that Gal-3 plays a role in promoting proinflammatory macrophage accumulation and toxicity in the lung following ozone exposure. - Highlights: • Multiple monocytic-macrophage subpopulations accumulate in the lung after ozone inhalation. • Galectin-3 plays a proinflammatory role in ozone-induced lung injury. • In the

  15. Acute ozone-induced lung injury in rats: Structural-functional relationships of developing alveolar edema

    SciTech Connect

    Paterson, J.F.; Hammond, M.D.; Montgomery, M.R.; Sharp, J.T.; Farrier, S.E.; Balis, J.U. )

    1992-11-01

    As part of a study on the effects of acute ozone stress on the lung surfactant system, we correlated morphometric, biochemical, and functional indices of lung injury using male rats exposed to 3 ppm ozone for 1, 2, 4, and 8 hr. Evaluation of lung mechanics, using the Pulmonary Evaluation and Diagnostic Laboratory System, revealed a significant decrease in dynamic lung compliance (ml/cmH[sub 2]O/kg) from a control value of 0.84 [plus minus] 0.02 (SEM) to 0.72 [plus minus] 0.04 and 0.57 [plus minus] 0.06 at 4 and 8 hr, respectively. At 2 hr there was a transient increase in PaO[sub 2] to 116 torr (control = 92 torr) followed by a decrease at 4 hr (65 torr) and 8 hr (55 torr). Morphometry of lung tissue, fixed by perfusion of fixative via the pulmonary artery at 12 cm H[sub 2]O airway distending pressure, demonstrated an increase in the area of the intravascular compartment at 8 hr, in association with a 65 and 39% replacement of the alveolar area by fluid in ventral and dorsal lung regions, respectively. There was a positive correlation (r = 0.966) between alveolar edema and transudated proteins in lavage fluid. A stepwise multiple regression model, with edema as the dependent variable, suggested that pulmonary vasodilatation, hypoxemia, and depletion of surfactant tubular myelin in lavage fluid were indices for predicting alveolar edema. In a second model, with lavage protein concentration as the dependent variable, decreasing dynamic compliance and hypoxemia were predictors of progressive, intraalveolar transudation of plasma proteins. The above structural-functional relationships support the concept that ozone-induced high-protein alveolar edema is pathogenetically linked to pulmonary hyperemia, deficiency of surfactant tubular myelin, and associated lung dysfunctions.

  16. Influence of high carbohydrate versus high fat diet in ozone induced pulmonary injury and systemic metabolic impairment in a Brown Norway (BN) rat model of healthy aging

    EPA Science Inventory

    Rationale: Air pollution has been recently linked to the increased prevalence of metabolic syndrome. It has been postulated that dietary risk factors might exacerbate air pollution-induced metabolic impairment. We have recently reported that ozone exposure induces acute systemic ...

  17. UV and ionizing radiations induced DNA damage, differences and similarities

    NASA Astrophysics Data System (ADS)

    Ravanat, Jean-Luc; Douki, Thierry

    2016-11-01

    Both UV and ionizing radiations damage DNA. Two main mechanisms, so-called direct and indirect pathways, are involved in the degradation of DNA induced by ionizing radiations. The direct effect of radiation corresponds to direct ionization of DNA (one electron ejection) whereas indirect effects are produced by reactive oxygen species generated through water radiolysis, including the highly reactive hydroxyl radicals, which damage DNA. UV (and visible) light damages DNA by again two distinct mechanisms. UVC and to a lesser extend UVB photons are directly absorbed by DNA bases, generating their excited states that are at the origin of the formation of pyrimidine dimers. UVA (and visible) light by interaction with endogenous or exogenous photosensitizers induce the formation of DNA damage through photosensitization reactions. The excited photosensitizer is able to induce either a one-electron oxidation of DNA (type I) or to produce singlet oxygen (type II) that reacts with DNA. In addition, through an energy transfer from the excited photosensitizer to DNA bases (sometime called type III mechanism) formation of pyrimidine dimers could be produced. Interestingly it has been shown recently that pyrimidine dimers are also produced by direct absorption of UVA light by DNA, even if absorption of DNA bases at these wavelengths is very low. It should be stressed that some excited photosensitizers (such as psoralens) could add directly to DNA bases to generate adducts. The review will described the differences and similarities in terms of damage formation (structure and mechanisms) between these two physical genotoxic agents.

  18. Histopathological changes in retinas and F-ERG features of streptozotocin-induced diabetic rats treated with ozone

    PubMed Central

    Xie, Ting-Yu; Li, Qin; Chen, Xue-Yi

    2016-01-01

    AIM To study the histopathological changes in the retina and flash electroretinogram (F-ERG) features of ozone-treated streptozotocin (STZ)-induced diabetic rats. METHODS Seventy male Sprague Dawley rats were grouped as follows: blank group (GB, n=10), model control group (GM, n=18), ozone group (GO3, n=19), and oxygen group (GO2, n=18). The model was induced by single intraperitoneal injection of STZ. Ozone or oxygen enteroclysm was given twice per week for 4wk. F-ERG and histopathological examinations were performed one month after treatment. RESULTS Under dark adaption, as compared to GB, the other groups each had differential decreases in the a-wave amplitudes (P<0.05); the latencies were delayed in GM, GO2, and GO3 rats (P<0.05). Similar results were observed under light adaption, with the exception that the a-wave of the amplitudes (F=0.28, P>0.05). There were significant differences in the apoptosis index among the groups (P<0.05). Under ozone treatment, apoptosis was decreased in GO3 as compared to GM and GO2. CONCLUSION Ozone administration alleviates nerve damage and reduces pathology and apoptosis in the retinas of diabetic rats. PMID:27366680

  19. Glutathione deficient C57BL/6J mice are not sensitized to ozone-induced lung injury.

    PubMed

    Johansson, Elisabet; Wesselkamper, Scott C; Shertzer, Howard G; Leikauf, George D; Dalton, Timothy P; Chen, Ying

    2010-05-28

    In this study we examined the role of the antioxidant glutathione (GSH) in pulmonary susceptibility to ozone toxicity, utilizing GSH deficient C57BL/6J mice that lack the expression of glutamate-cysteine ligase modifier subunit (GCLM). Gclm(-/-) knockout mice had 70% GSH depletion in the lung. Gclm(+/+) wild-type and Gclm(-/-) mice were exposed to either 0.3 ppm ozone or filtered air for 48h. Ozone-induced lung hyperpermeability, as measured by total protein concentration in bronchoalveolar lavage fluid, was surprisingly lower in Gclm(-/-) mice than in wild-type mice. Lung hyperpermeability did not correlate with the degree of neutrophilia or with inflammatory gene expression. Pulmonary antioxidant response to ozone, assessed by increased mRNA levels of metallothionein 1 and 2, alpha-tocopherol transporter protein, and solute carrier family 23 member 2 (sodium-dependent vitamin C transporter) was greater in Gclm(-/-) mice than in Gclm(+/+) mice. These results suggest that compensatory augmentation of antioxidant defenses in Gclm(-/-) mice may confer increased resistance to ozone-induced lung injury.

  20. Acrylonitrile-induced oxidative DNA damage in rat astrocytes.

    PubMed

    Pu, Xinzhu; Kamendulis, Lisa M; Klaunig, James E

    2006-10-01

    Chronic administration of acrylonitrile results in a dose-related increase in astrocytomas in rat brain, but the mechanism of acrylonitrile carcinogenicity is not fully understood. The potential of acrylonitrile or its metabolites to induce direct DNA damage as a mechanism for acrylonitrile carcinogenicity has been questioned, and recent studies indicate that the mechanism involves the induction of oxidative stress in rat brain. The present study examined the ability of acrylonitrile to induce DNA damage in the DI TNC1 rat astrocyte cell line using the alkaline Comet assay. Oxidized DNA damage also was evaluated using formamidopyrimidine DNA glycosylase treatment in the modified Comet assay. No increase in direct DNA damage was seen in astrocytes exposed to sublethal concentrations of acrylonitrile (0-1.0 mM) for 24 hr. However, acrylonitrile treatment resulted in a concentration-related increase in oxidative DNA damage after 24 hr. Antioxidant supplementation in the culture media (alpha-tocopherol, (-)-epigallocathechin-3 gallate, or trolox) reduced acrylonitrile-induced oxidative DNA damage. Depletion of glutathione using 0.1 mM DL-buthionine-[S,R]-sulfoximine increased acrylonitrile-induced oxidative DNA damage (22-46%), while cotreatment of acrylonitrile with 2.5 mM L-2-oxothiazolidine-4-carboxylic acid, a precursor for glutathione biosynthesis, significantly reduced acrylonitrile-induced oxidative DNA damage (7-47%). Cotreatment of acrylonitrile with 0.5 mM 1-aminobenzotriazole, a suicidal inhibitor of cytochrome P450, prevented the oxidative DNA damage produced by acrylonitrile. Cyanide (0.1-0.5 mM) increased oxidative DNA damage (44-160%) in astrocytes. These studies demonstrate that while acrylonitrile does not directly damage astrocyte DNA, it does increase oxidative DNA damage. The oxidative DNA damage following acrylonitrile exposure appears to arise mainly through the P450 metabolic pathway; moreover, glutathione depletion may contribute to the

  1. Ozone Therapy in Ethidium Bromide-Induced Demyelination in Rats: Possible Protective Effect.

    PubMed

    Salem, Neveen A; Assaf, Naglaa; Ismail, Manal F; Khadrawy, Yasser A; Samy, Mohga

    2016-08-01

    Multiple sclerosis, an autoimmune inflammatory disease of the central nervous system, is characterized by excessive demyelination. The study aimed to investigate the possible protective effect of ozone (O3) therapy in ethidium bromide (EB)-induced demyelination in rats either alone or in combination with corticosteroids in order to decrease the dose of steroid therapy. Rats were divided into Group (1) normal control rats received saline, Group (2) Sham-operated rats received saline, Group (3) Sham-operated rats received vehicle (oxygen), Group (4) EB-treated rats received EB, Group (5) EB-treated rats received O3, Group (6) EB-treated rats received methylprednisolone (MP), and Group (7) EB-treated rats received half the dose of MP concomitant with O3. EB-treated rats showed a significant increase in the number of footfalls in the grid walk test, decreased brain GSH, and paraoxonase-1 enzyme activity, whereas brain MDA, TNF-α, IL-1β, INF-γ, Cox-2 immunoreactivity, and p53 protein levels were increased. A significant decline in brain serotonin, dopamine, norepinephrine, and MBP immunoreactivity was also reported. Significant improvement of the above-mentioned parameters was demonstrated with the administration of either MP or O3, whereas best amelioration was achieved by combining half the dose of MP with ozone.

  2. Oxidized lipids and lipid-mediators are involved in cardiovascular injury induced by diesel exhaust particles and ozone

    EPA Science Inventory

    The mechanisms by which air pollutants induce cardiac and vascular injuries are unknown. We hypothesized that these injuries involve alterations in'aortic membrane lipids and lipid-mediators. We exposed male Wistar Kyoto rats (12-15 wk old), nose-only to air, ozone (03; 0.5 ppm),...

  3. Mitochondrial DNA exhibits resistance to induced point and deletion mutations

    PubMed Central

    Valente, William J.; Ericson, Nolan G.; Long, Alexandra S.; White, Paul A.; Marchetti, Francesco; Bielas, Jason H.

    2016-01-01

    The accumulation of somatic mitochondrial DNA (mtDNA) mutations contributes to the pathogenesis of human disease. Currently, mitochondrial mutations are largely considered results of inaccurate processing of its heavily damaged genome. However, mainly from a lack of methods to monitor mtDNA mutations with sufficient sensitivity and accuracy, a link between mtDNA damage and mutation has not been established. To test the hypothesis that mtDNA-damaging agents induce mtDNA mutations, we exposed MutaTMMouse mice to benzo[a]pyrene (B[a]P) or N-ethyl-N-nitrosourea (ENU), daily for 28 consecutive days, and quantified mtDNA point and deletion mutations in bone marrow and liver using our newly developed Digital Random Mutation Capture (dRMC) and Digital Deletion Detection (3D) assays. Surprisingly, our results demonstrate mutagen treatment did not increase mitochondrial point or deletion mutation frequencies, despite evidence both compounds increase nuclear DNA mutations and demonstrated B[a]P adduct formation in mtDNA. These findings contradict models of mtDNA mutagenesis that assert the elevated rate of mtDNA mutation stems from damage sensitivity and abridged repair capacity. Rather, our results demonstrate induced mtDNA damage does not readily convert into mutation. These findings suggest robust mitochondrial damage responses repress induced mutations after mutagen exposure. PMID:27550180

  4. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  5. Oxidatively induced DNA damage and its repair in cancer.

    PubMed

    Dizdaroglu, Miral

    2015-01-01

    Oxidatively induced DNA damage is caused in living organisms by endogenous and exogenous reactive species. DNA lesions resulting from this type of damage are mutagenic and cytotoxic and, if not repaired, can cause genetic instability that may lead to disease processes including carcinogenesis. Living organisms possess DNA repair mechanisms that include a variety of pathways to repair multiple DNA lesions. Mutations and polymorphisms also occur in DNA repair genes adversely affecting DNA repair systems. Cancer tissues overexpress DNA repair proteins and thus develop greater DNA repair capacity than normal tissues. Increased DNA repair in tumors that removes DNA lesions before they become toxic is a major mechanism for development of resistance to therapy, affecting patient survival. Accumulated evidence suggests that DNA repair capacity may be a predictive biomarker for patient response to therapy. Thus, knowledge of DNA protein expressions in normal and cancerous tissues may help predict and guide development of treatments and yield the best therapeutic response. DNA repair proteins constitute targets for inhibitors to overcome the resistance of tumors to therapy. Inhibitors of DNA repair for combination therapy or as single agents for monotherapy may help selectively kill tumors, potentially leading to personalized therapy. Numerous inhibitors have been developed and are being tested in clinical trials. The efficacy of some inhibitors in therapy has been demonstrated in patients. Further development of inhibitors of DNA repair proteins is globally underway to help eradicate cancer.

  6. DNA induced chirality and helical twist in achiral liquid crystals

    NASA Astrophysics Data System (ADS)

    Garvey, Alfred; Basu, Rajratan; Kinnamon, Daniel

    A small quantity of DNA sample (Deoxyribonucleic acid -cellulose double-stranded from calf thymus DNA in lyophilized powder form) was doped in an achiral liquid crystal (LC), and the mixture was found to exhibit a weak degree of chirality. The induced chirality in the LC was probed by means of the electroclinic effect in the LC's smectic-A phase, which showed significant pretransitional behavior on approaching the smectic- A-smectic- C transition temperature from above. The same DNA was doped in an achiral nematic LC and the mixture was found to exhibit an average mechanical twist over macroscopic dimensions. The double-stranded DNA-induced chiral pitch length P was determined by measuring the radius of curvature of reverse twist disclination lines in 90o nematic twist cells. In the LC +DNA mixture, the LC's benzene rings interact with the nucleobases of the DNA through π - π stacking, which induces a molecular conformational deracemization in the LC.

  7. Ozone-induced inhibition of theophylline elimination in rabbits: effect of age and sex

    SciTech Connect

    Canada, A.T.; Calabrese, E.J.

    1985-10-01

    The effect of age and sex on the elimination of theophylline in New Zealand White rabbits was investigated following exposure to 0.3 ppm of ozone (OT) for 3.75 hr/day over 5 consecutive days. Animals were given air alone 5 to 7 days before and after the 5 days of OT exposure. The elimination half-life of theophylline was significantly prolonged on Days 1 and 5 of OT exposure in the rabbits greater than 2 years old, with no effect being seen in those 3 to 4 months old. No OT-induced change was seen in the apparent volume of distribution to account for the observed change in theophylline elimination half-life. The female rabbit in particular demonstrated this age-related effect; while in the male, variability prevented the observed difference from reaching significance. The results indicated inhibition of theophylline elimination by O3 in the rabbit depends on age and sex.

  8. Mitochondrial DNA damage by bleomycin induces AML cell death.

    PubMed

    Yeung, ManTek; Hurren, Rose; Nemr, Carine; Wang, Xiaoming; Hershenfeld, Samantha; Gronda, Marcela; Liyanage, Sanduni; Wu, Yan; Augustine, Jeevan; Lee, Eric A; Spagnuolo, Paul A; Southall, Noel; Chen, Catherine; Zheng, Wei; Jeyaraju, Danny V; Minden, Mark D; Laposa, Rebecca; Schimmer, Aaron D

    2015-06-01

    Mitochondria contain multiple copies of their own 16.6 kb circular genome. To explore the impact of mitochondrial DNA (mtDNA) damage on mitochondrial (mt) function and viability of AML cells, we screened a panel of DNA damaging chemotherapeutic agents to identify drugs that could damage mtDNA. We identified bleomycin as an agent that damaged mtDNA in AML cells at concentrations that induced cell death. Bleomycin also induced mtDNA damage in primary AML samples. Consistent with the observed mtDNA damage, bleomycin reduced mt mass and basal oxygen consumption in AML cells. We also demonstrated that the observed mtDNA damage was functionally important for bleomycin-induced cell death. Finally, bleomycin delayed tumor growth in xenograft mouse models of AML and anti-leukemic concentrations of the drug induced mtDNA damage in AML cells preferentially over normal lung tissue. Taken together, mtDNA-targeted therapy may be an effective strategy to target AML cells and bleomycin could be useful in the treatment of this disease.

  9. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  10. Induced DNA repair pathway in mammalian cells

    SciTech Connect

    Overberg, R.

    1985-01-01

    The survival of cultured rat kangaroo cells (PtK-2) and human xeroderma pigmentosum cells incubated with 5 ..mu..M cycloheximide subsequent to ultraviolet irradiation is lower than that of cells incubated without cycloheximide. The drop in survival is considerably larger than that produced by incubation of unirradiated cells with cycloheximide. The phenomenon was also observed when PtK-2 cells were incubated with emetine, another protein synthesis inhibitor, or with 5,6-dichloro-1-..beta..-D-ribofuranosylbenzimidazole, a RNA synthesis inhibitor. PtK cells which received a preliminary UV treatment followed by an incubation period without cycloheximide and then a second irradiation and 24 hour incubation with cycloheximide, survived the effects of the second irradiation better than cells which were incubated in the presence of cycloheximide after the first and second UV irradiation. The application of cycloheximide for 24 hours after UV irradiation of PtK cells resulted in one-half as many 6-thioguanine resistant cells as compared to the number of 6-thioguanine resistant cells found when cycloheximide was not used. These experiments indicate that a UV-inducible cycloheximide-sensitive DNA repair pathway is present in PtK and xeroderma pigmentosum cells, which is error-prone in PtK cells.

  11. Minimal influence of G-protein null mutations on ozone-induced changes in gene expression, foliar injury, gas-exchange and peroxidase activity in Arabidopsis thaliana L

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ozone uptake by plants leads to an increase in reactive oxygen species (ROS) in the intercellular space of leaves and induces signalling processes reported to involve the membrane-bound heterotrimeric G-protein complex. Therefore, potential G-protein-mediated response mechanisms to ozone were compar...

  12. Oxidant-induced DNA damage of target cells.

    PubMed Central

    Schraufstätter, I; Hyslop, P A; Jackson, J H; Cochrane, C G

    1988-01-01

    In this study we examined the leukocytic oxidant species that induce oxidant damage of DNA in whole cells. H2O2 added extracellularly in micromolar concentrations (10-100 microM) induced DNA strand breaks in various target cells. The sensitivity of a specific target cell was inversely correlated to its catalase content and the rate of removal of H2O2 by the target cell. Oxidant species produced by xanthine oxidase/purine or phorbol myristate acetate-stimulated monocytes induced DNA breakage of target cells in proportion to the amount of H2O2 generated. These DNA strand breaks were prevented by extracellular catalase, but not by superoxide dismutase. Cytotoxic doses of HOCl, added to target cells, did not induce DNA strand breakage, and myeloperoxidase added extracellularly in the presence of an H2O2-generating system, prevented the formation of DNA strand breaks in proportion to its H2O2 degrading capacity. The studies also indicated that H2O2 formed hydroxyl radical (.OH) intracellularly, which appeared to be the most likely free radical responsible for DNA damage: .OH was detected in cells exposed to H2O2; the DNA base, deoxyguanosine, was hydroxylated in cells exposed to H2O2; and intracellular iron was essential for induction of DNA strand breaks. PMID:2843565

  13. Alleviation of Antioxidant Defense System by Ozonized Olive Oil in DNBS-Induced Colitis in Rats

    PubMed Central

    Bayoumi, Fatehia A.; Ahmed, Naglaa G.

    2014-01-01

    The aim of the study was to evaluate the potential protective effect of ozonized olive oil (OZO) in 2,4-dinitrobenzene sulphuric acid (DNBS) induced colitis in rats and to elucidate the role of some antioxidant defense system (superoxide dismutase “SOD,” glutathione peroxidase “GSH-Px,” and catalase “CAT”) in these effects. The physicochemical parameters including viscosity, peroxide, and acid values of olive oil and OZO were evaluated. The animals were divided into several groups and the colitis was induced in the rats by intracolonic instillation of DNBS at dose of 15 mg/rat. Olive oil (OO) at dose of 6 mg/kg and OZO at doses of 3 and 6 mg/kg was administered orally for 7 days, starting the day before induction of colitis. Our results showed that macroscopic and microscopic damage scores were significantly reduced in a dose response manner in rats pretreated with OZO only. In contrast, CAT, GSH-Px, and SOD activities were significantly increased in the distal colon of inflamed animals pretreated with OZO with respect to control group dose dependently. Results demonstrate that OZO pretreatment exerts protective effects in DNBS induced colitis in rats and provide evidence that the protective effects of OZO are mediated by stimulation of some antioxidant enzymes. PMID:25276059

  14. Analysis of DNA-protein complexes induced by chemical carcinogens

    SciTech Connect

    Costa, M. )

    1990-11-01

    DNA-protein complexes induced in intact cells by chromate have been isolated and compared with those formed by other agents such as cis-platinum. Actin has been identified as one of the major proteins that is complexed to the DNA by chromate based upon a number of criteria including, a molecular weight and isoelectric point identical to actin, positive reaction with actin polyclonal antibody, and proteolytic mapping. Chromate and cis-platinum both complex proteins of very similar molecular weight and isoelectric points and these complexes can be disrupted by exposure to chelating or reducing agents. These results suggest that the metal itself is participating in rather than catalyzing the formation of a DNA-protein complex. An antiserum which was raised to chromate-induced DNA-protein complexes reacted primarily with a 97,000 protein that could not be detected by silver staining. Western blots and slot blots were utilized to detect p97 DNA-protein complexes formed by cis-platinum, UV, formaldehyde, and chromate. Other work in this area, involving studying whether DNA-protein complexes are formed in actively transcribed DNA compared with genetically inactive DNA, is discussed. Methods to detect DNA-protein complexes, the stability and repair of these lesions, and characterization of DNA-protein complexes are reviewed. Nuclear matrix proteins have been identified as a major substrate for the formation of DNA-protein complexes and these findings are also reviewed.

  15. DNA strand scission induced by adriamycin and aclacinomycin A.

    PubMed

    Someya, A; Tanaka, N

    1979-08-01

    The binding of adriamycin and aclacinomycin A with PM2 DNA, and the consequent cleavage of DNA have been demonstrated by agarose gel electrophoresis, using an ethidium bromide assay. Adriamycin was observed to induce a single strand scission of DNA in the presence of a reducing agent, but aclacinomycin A caused much less degree of DNA breaks. The DNA cleavage was enhanced by Cu2+ and Fe2+, but not significantly by Ni2+, Zn2+, Mg2+ and Ca2+, suggesting that reduction and auto-oxidation of the quinone moiety and H2O2 production participate in the DNA-cutting effect. The DNA degradation was dependent upon concentrations of the anthracyclines and CuCl2. The degree of DNA cleavage at 0.04 mM adriamycin was similar to that at 0.4 mM aclacinomycin A in the presence of 1 mM NADPH and 0.4 mM CuCl2. DNA was degraded to small fragments at 0.4 mM adriamycin and 0.2 mM CuCl2. The anthracycline-induced DNA cleavage was stimulated by H2O2, but partially inhibited by potassium iodide, superoxide dismutase, catalase and nitrogen gas atmosphere. The results suggested that both free radical of anthracycline quinones and hydroxyl radical directly react with DNA strands.

  16. Light induced heterogeneous ozone processing on the pesticides adsorbed on silica particles

    NASA Astrophysics Data System (ADS)

    Socorro, J.; Désert, M.; Quivet, E.; Gligorovski, S.; Wortham, H.

    2013-12-01

    In France, in 2010, the sales of pesticides reached 1.8 billion euros for 61 900 tons of active ingredients, positioning France as a first European consumer of pesticides, as reported by the European Crop Protection Association. About 19 million hectares of crops are sprayed annually with pesticides, i.e., 35% of the total surface area of France. This corresponds to an average pesticide dose of 3.2 kg ha-1. The consumption of herbicide and fungicide is favoured in comparison to the use of insecticides in France and the other European countries, as well. The partitioning of pesticides between the gas and particulate phases influences the atmospheric fate of these compounds such as their photo-chemical degradation. There is much uncertainty concerning the behavior of the pesticides in the atmosphere. Especially, there is a gap of knowledge concerning the degradation of the pesticides induced by heterogeneous reactions in absence and especially in presence of solar light. Considering that most of the pesticides currently used are semi-volatile, it is of crucial importance to investigate the heterogeneous reactivity of particulate pesticides with light and with atmospheric oxidants such as ozone and OH radical. The aim of the present work is to evaluate the light induced heterogeneous ozonation of suspended pesticide particles. 8 pesticides (cyprodinil, deltamethrin, difenoconazole, fipronil, oxadiazon, pendimethalin, permethrin and tetraconazole) were chosen for their physico-chemical properties and their concentration levels in the PACA (Région Provence-Alpes-Côte d'Azur) region, France. Silica particles with well-known properties were chosen as model particles of atmospheric relevance. Kinetic rate constants were determined to allow estimate the atmospheric lifetimes relating to ozone. The rate constants were determined as follows: k = (6.6 × 0.2) 10-19, (7.2 × 0.3) 10-19, (5.1 × 0.5) 10-19, (3.9 × 0.3) 10-19 [cm3 molecules-1 s-1] for Cyprodinil

  17. The early epigenetic response to ozone: impacts on DNA methylation and hydroxymethylation.

    EPA Science Inventory

    Epigenetics have been increasingly recognized as a mechanism linking environment and gene expression. Despite awareness of the role of DNA methylation and hydroxymethylation as potential drivers of the response to air pollutants, very little work has been performed investigating ...

  18. Resistin deficiency in mice has no effect on pulmonary responses induced by acute ozone exposure

    PubMed Central

    Razvi, Shehla S.; Richards, Jeremy B.; Malik, Farhan; Cromar, Kevin R.; Price, Roger E.; Bell, Cynthia S.; Weng, Tingting; Atkins, Constance L.; Spencer, Chantal Y.; Cockerill, Katherine J.; Alexander, Amy L.; Blackburn, Michael R.; Alcorn, Joseph L.; Haque, Ikram U.

    2015-01-01

    Acute exposure to ozone (O3), an air pollutant, causes pulmonary inflammation, airway epithelial desquamation, and airway hyperresponsiveness (AHR). Pro-inflammatory cytokines—including IL-6 and ligands of chemokine (C-X-C motif) receptor 2 [keratinocyte chemoattractant (KC) and macrophage inflammatory protein (MIP)-2], TNF receptor 1 and 2 (TNF), and type I IL-1 receptor (IL-1α and IL-1β)—promote these sequelae. Human resistin, a pleiotropic hormone and cytokine, induces expression of IL-1α, IL-1β, IL-6, IL-8 (the human ortholog of murine KC and MIP-2), and TNF. Functional differences exist between human and murine resistin; yet given the aforementioned observations, we hypothesized that murine resistin promotes O3-induced lung pathology by inducing expression of the same inflammatory cytokines as human resistin. Consequently, we examined indexes of O3-induced lung pathology in wild-type and resistin-deficient mice following acute exposure to either filtered room air or O3. In wild-type mice, O3 increased bronchoalveolar lavage fluid (BALF) resistin. Furthermore, O3 increased lung tissue or BALF IL-1α, IL-6, KC, TNF, macrophages, neutrophils, and epithelial cells in wild-type and resistin-deficient mice. With the exception of KC, which was significantly greater in resistin-deficient compared with wild-type mice, no genotype-related differences in the other indexes existed following O3 exposure. O3 caused AHR to acetyl-β-methylcholine chloride (methacholine) in wild-type and resistin-deficient mice. However, genotype-related differences in airway responsiveness to methacholine were nonexistent subsequent to O3 exposure. Taken together, these data demonstrate that murine resistin is increased in the lungs of wild-type mice following acute O3 exposure but does not promote O3-induced lung pathology. PMID:26386120

  19. DNA bending induced by cruciform formation.

    PubMed

    Gough, G W; Lilley, D M

    Cruciform structures in DNA are of considerable interest, both as extreme examples of sequence-dependent structural heterogeneity and as models for four-way junctions such as the Holliday junction of homologous genetic recombination. Cruciforms are of lower thermodynamic stability than regular duplex DNA, and have been observed only in negatively supercoiled molecules, where the unfavourable free energy of formation is offset by the topological relaxation of the torsionally stressed molecule. From an experimental viewpoint this can be a disadvantage, as cruciform structures can be studied only in relatively large supercoiled DNA circles, and are destabilized when a break is introduced at any point. We therefore set out to construct a pseudo-cruciform junction--by generating hereroduplex formation between two inverted repeat sequences. Stereochemically, this should closely resemble a true cruciform but remain stable in a linear DNA fragment. We have now created such a junction and find that it has the expected sensitivities to endonucleases. These DNA fragments exhibit extremely anomalous gel electrophoretic mobility, the extent of which depends on the relative position of the pseudo-cruciform along the length of the molecule. Our results are very similar to those obtained by Wu and Crothers using kinetoplast DNA, and we conclude that the pseudo-cruciform junction introduces a bend in the linear DNA molecule.

  20. Inhaled ozone (O{sub 3})-induces changes in serum metabolomic and liver transcriptomic profiles in rats

    SciTech Connect

    Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.; Ward, William O.; Vallanat, Beena D.; Andrews, Debora L.; Schladweiler, Mette C.; Snow, Samantha J.; Bass, Virginia L.; Richards, Judy E.; Ghio, Andrew J.; Cascio, Wayne E.; Ledbetter, Allen D.; Kodavanti, Urmila P.

    2015-07-15

    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O{sub 3}) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O{sub 3} exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O{sub 3} at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0 ppm O{sub 3}, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O{sub 3} increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O{sub 3} increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O{sub 3}. In conclusion, short-term O{sub 3} exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. - Highlights: • Ozone, an ubiquitous air pollutant induces acute systemic metabolic derangement. • Serum metabolomic approach provides novel insights in ozone-induced changes. • Ozone exposure induces leptinemia

  1. Ultraviolet-B- and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana

    SciTech Connect

    Rao, M.V.; Paliyath, G.; Ormrod, D.P.

    1996-01-01

    Earlier studies with Arabidopsis thaliana exposed to ultraviolet B (UV-B) and ozone (O{sub 3}) have indicated the differential responses of superoxide dismutase and glutathione reductase. In this study, we have investigated whether A. thaliana genotype Landsberg erecta and its flavonoid-deficient mutant transparent testa (tt5) is capable of metabolizing UV-B- and O{sub 3}-induced activated oxygen species by invoking similar antioxidant enzymes. UV-B exposure preferentially enhanced guaiacol-peroxidases, ascorbate peroxidase, and peroxidases specific to coniferyl alcohol and modified the substrate affinity of ascorbate peroxidase. O{sub 3} exposure enhanced superoxide dismutase, peroxidases, glutathione reductase, and ascorbate peroxidase to a similar degree and modified the substrate affinity of both glutathione reductase and ascorbate peroxidase. Both UV-B and O{sub 3} exposure enhanced similar Cu,Zn-superoxide dismutase isoforms. New isoforms of peroxidases and ascorbate peroxidase were synthesized in tt5 plants irradiated with UV-B. UV-B radiation, in contrast to O{sub 3}, enhanced the activation oxygen species by increasing membrane-localized NADPH-oxidase activity and decreasing catalase activities. These results collectively suggest that (a) UV-B exposure preferentially induces peroxidase-related enzymes, whereas O{sub 3} exposure invokes the enzymes of superoxide dismutase/ascorbate-glutathione cycle, and (b) in contrast to O{sub 3}, UV-B exposure generated activated oxygen species by increasing NADPH-oxidase activity. 10 figs., 4 tabs.

  2. Effects of Exercise on Oxidative Stress in Rats Induced by Ozone

    PubMed Central

    Martinez-Campos, Catalina; Lara-Padilla, Eleazar; Bobadilla-Lugo, Rosa Amalia; Kross, Robert David; Villanueva, Cleva

    2012-01-01

    Oxidative stress (OS) induced by acute exercise is reduced by chronic exercise. Ozone (O3) exposure produces OS. The aim of this study was to determine if aerobic exercise (AE) reduced OS produced by O3. A pilot experiment was performed with male Wistar rats submitted to AE (trained to swim 90 min/day). Adaptation to exercise was demonstrated three weeks after training by means of changes in reduced nitrates (NOx) in plasma. Therefore, two-week training was chosen for the following experiments. Six of twelve trained rats were exposed to O3 (0.5 ppm, 4 h/day, one hour before exercise). Two groups of sedentary animals (n = 6 each) were used as controls, one of which was exposed to O3. At the end of the experiments NOx, 8-isoprostane (8-IP), malondialdehyde (MDA), superoxide dismutase (SOD) activity, and carbonyls (CBs) were measured in plasma. CBs did not change in any group. O3-induced OS was manifested by reduced NOx and SOD activity, as well as increased 8-IP and MDA. Exercise significantly blocked O3 effects although SOD was also decreased by exercise (a greater drop occurring in the O3 group). It is concluded that AE protects against OS produced by O3 and the effect is independent of SOD. PMID:22619585

  3. γδ T Cells Are Required for M2 Macrophage Polarization and Resolution of Ozone-Induced Pulmonary Inflammation in Mice.

    PubMed

    Mathews, Joel A; Kasahara, David I; Ribeiro, Luiza; Wurmbrand, Allison P; Ninin, Fernanda M C; Shore, Stephanie A

    2015-01-01

    We examined the role of γδ T cells in the induction of alternatively activated M2 macrophages and the resolution of inflammation after ozone exposure. Wildtype (WT) mice and mice deficient in γδ T cells (TCRδ-/- mice) were exposed to air or to ozone (0.3 ppm for up to 72h) and euthanized immediately or 1, 3, or 5 days after cessation of exposure. In WT mice, M2 macrophages accumulated in the lungs over the course of ozone exposure. Pulmonary mRNA abundance of the M2 genes, Arg1, Retnla, and Clec10a, also increased after ozone. In contrast, no evidence of M2 polarization was observed in TCRδ-/- mice. WT but not TCRδ-/- mice expressed the M2c polarizing cytokine, IL-17A, after ozone exposure and WT mice treated with an IL-17A neutralizing antibody exhibited attenuated ozone-induced M2 gene expression. In WT mice, ozone-induced increases in bronchoalveolar lavage neutrophils and macrophages resolved quickly after cessation of ozone exposure returning to air exposed levels within 3 days. However, lack of M2 macrophages in TCRδ-/- mice was associated with delayed clearance of inflammatory cells after cessation of ozone and increased accumulation of apoptotic macrophages in the lungs. Delayed restoration of normal lung architecture was also observed in TCRδ-/- mice. In summary, our data indicate that γδ T cells are required for the resolution of ozone-induced inflammation, likely because γδ T cells, through their secretion of IL-17A, contribute to changes in macrophage polarization that promote clearance of apoptotic cells.

  4. OZONE-INDUCED RESPIRATORY SYMPTOMS AND LUNG FUNCTION DECREMENTS IN HUMANS: EXPOSURE-RESPONSE MODELS

    EPA Science Inventory

    Short duration exposure to ozone (<8 hr) is known to result in lung function decrements and respiratory symptoms in humans. The magnitudes of these responses are functions of ozone concentration (C), activity level measured by minute ventilation (Ve), duration of exposure (T), a...

  5. Platelet adhesion and protein adsorption on silicone rubber surface by ozone-induced grafted polymerization with carboxybetaine monomer.

    PubMed

    Zhou, Jun; Yuan, Jiang; Zang, Xiaopeng; Shen, Jian; Lin, Sicong

    2005-03-10

    Platelet adhesion and protein adsorption on the silicone rubber film grafted with N,N'-dimethyl-N-methacryloyloxyethyl-N-(2-carboxyethyl) ammonium (DMMCA) was studied. The grafting was carried out by means of ozone-induced method and was confirmed by ATR-FTIR and XPS investigations. The grafted films possessed relatively hydrophilic surface revealed by contact angle measurement. The blood compatibility of the grafted film was evaluated in vitro by platelet adhesion in platelet-rich plasma (PRP) and protein absorption in bovine fibrinogen (BFG) using silicone film as the reference. No substantial platelet adhesion was observed for the grafted films incubated in PRP for 60 and 180 min. The protein absorption was also significantly reduced after incubated in bovine fibrinogen for 60 min. Both the results indicated that the blood compatibility of silicone rubber was greatly improved by ozone-induced grafting of carboxybetaine zwitterionic polymer onto its surface.

  6. Diet-induced obesity causes innate airway hyperresponsiveness to methacholine and enhances ozone-induced pulmonary inflammation.

    PubMed

    Johnston, Richard A; Theman, Todd A; Lu, Frank L; Terry, Raya D; Williams, Erin S; Shore, Stephanie A

    2008-06-01

    We previously reported that genetically obese mice exhibit innate airway hyperresponsiveness (AHR) and enhanced ozone (O(3))-induced pulmonary inflammation. Such genetic deficiencies in mice are rare in humans, and they may not be representative of human obesity. Thus the purpose of this study was to determine the pulmonary phenotype of mice with diet-induced obesity (DIO), which more closely mimics the cause of human obesity. Therefore, wild-type C57BL/6 mice were reared from the time of weaning until at least 30 wk of age on diets in which either 10 or 60% of the calories are derived from fat in the form of lard. Body mass was approximately 40% greater in mice fed 60 vs. 10% fat diets. Baseline airway responsiveness to intravenous methacholine, measured by forced oscillation, was greater in mice fed 60 vs. 10% fat diets. We also examined lung permeability and inflammation after exposure to room air or O(3) (2 parts/million for 3 h), an asthma trigger. Four hours after the exposure ended, O(3)-induced increases in bronchoalveolar lavage fluid protein, interleukin-6, KC, macrophage inflammatory protein-2, interferon-gamma-inducible protein-10, and eotaxin were greater in mice fed 60 vs. 10% fat diets. Innate AHR and augmented responses to O(3) were not observed in mice raised from weaning until 20-22 wk of age on a 60% fat diet. These results indicate that mice with DIO exhibit innate AHR and enhanced O(3)-induced pulmonary inflammation, similar to genetically obese mice. However, mice with DIO must remain obese for an extended period of time before this pulmonary phenotype is observed.

  7. Elevation of susceptibility to ozone-induced acute tracheobronchial injury in transgenic mice deficient in Clara cell secretory protein

    SciTech Connect

    Plopper, C.G. . E-mail: cgplopper@ucdavis.edu; Mango, G.W.; Hatch, G.E.; Wong, V.J.; Toskala, E.; Reynolds, S.D.; Tarkington, B.K.; Stripp, B.R.

    2006-05-15

    Increases in Clara cell abundance or cellular expression of Clara cell secretory protein (CCSP) may cause increased tolerance of the lung to acute oxidant injury by repeated exposure to ozone (O{sub 3}). This study defines how disruption of the gene for CCSP synthesis affects the susceptibility of tracheobronchial epithelium to acute oxidant injury. Mice homozygous for a null allele of the CCSP gene (CCSP-/-) and wild type (CCSP+/+) littermates were exposed to ozone (0.2 ppm, 8 h; 1 ppm, 8 h) or filtered air. Injury was evaluated by light and scanning electron microscopy, and the abundance of necrotic, ciliated, and nonciliated cells was estimated by morphometry. Proximal and midlevel intrapulmonary airways and terminal bronchioles were evaluated. There was no difference in airway epithelial composition between CCSP+/+ and CCSP-/- mice exposed to filtered air, and exposure to 0.2 ppm ozone caused little injury to the epithelium of both CCSP+/+ and CCSP-/- mice. After exposure to 1.0 ppm ozone, CCSP-/- mice suffered from a greater degree of epithelial injury throughout the airways compared to CCSP+/+ mice. CCSP-/- mice had both ciliated and nonciliated cell injury. Furthermore, lack of CCSP was associated with a shift in airway injury to include proximal airway generations. Therefore, we conclude that CCSP modulates the susceptibility of the epithelium to oxidant-induced injury. Whether this is due to the presence of CCSP on the acellular lining layer surface and/or its intracellular distribution in the secretory cell population needs to be defined.

  8. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE PAGES

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  9. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  10. Herpes simplex virus induces the replication of foreign DNA

    SciTech Connect

    Danovich, R.M.; Frenkel, N.

    1988-08-01

    Plasmids containing the simian virus 40 (SV40) DNA replication origin and the large T gene are replicated in Vero monkey cells but not in rabbit skin cells. Efficient replication of the plasmids was observed in rabbit cells infected with herpes simplex virus type 1 (HSV-1) and HSV-2. The HSV-induced replication required the large T antigen and the SV40 replication origin. However, it produced concatemeric molecules resembling replicative intermediates of HSV DNA and was sensitive to phosphonoacetate at concentrations known to inhibit the HSV DNA polymerase. Therefore, it involved the HSV DNA polymerase itself or a viral gene product(s) which was expressed following the replication of HSV DNA. Analyses of test plasmids lacking SV40 or HSV DNA sequences showed that, under some conditions. HSV also induced low-level replication of test plasmids containing no known eucaryotic replication origins. Together, these results show that HSV induces a DNA replicative activity which amplifies foreign DNA. The relevance of these findings to the putative transforming potential of HSV is discussed.

  11. Ozone-induced reductions in below-ground biomass: an anatomical approach in potato.

    PubMed

    Asensi-Fabado, Amparo; García-Breijo, Francisco J; Reig-Armiñana, José

    2010-07-01

    Potato plants were grown in open-top chambers under three ozone concentrations during two complete cropping seasons (93 and 77 d in 2004 and 2005, respectively). The effects of chronic exposure to ozone on leaf anatomy, cell ultrastructure and crop yield were studied. Severe cell damage was found, even at ambient ozone levels, mainly affecting the spongy parenchyma and areas near the stomata. Damage to the cell wall caused loss of cell contact, and loss of turgor pressure due to tonoplast disintegration, contributed to cell collapse. Phloem sieve plates were obstructed by callose accumulation, and damaged mesophyll cells increased their starch stores. Tuber yield fell sharply (24-44%), due to the biggest tubers becoming smaller, which affected commercial yield. These anatomical findings show the mechanisms of ozone effect on assimilate partitioning, and thus crop yield decrease, in potato. Further implications of ozone causing reductions in below-ground biomass are also discussed.

  12. Impact of diet on ozone-induced pulmonary and systemic effects in female Brown Norway (BN) rats

    EPA Science Inventory

    Impact of diet on ozone-induced pulmonary and systemic effects in female Brown Norway (BN) ratsV.L. Bass1, M.C. Schladweiler2, S. Snow5, C.J. Gordon4, K.A. Jarema4, P. Phillips4, A.D. Ledbetter2, D.B. Miller3, J.E. Richards2, U.P. Kodavanti2. 1. SPH, UNC, Chapel Hill2. EPHD, NHE...

  13. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.

    1986-05-01

    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  14. A Green Solvent Induced DNA Package

    NASA Astrophysics Data System (ADS)

    Satpathi, Sagar; Sengupta, Abhigyan; Hridya, V. M.; Gavvala, Krishna; Koninti, Raj Kumar; Roy, Bibhisan; Hazra, Partha

    2015-03-01

    Mechanistic details of DNA compaction is essential blue print for gene regulation in living organisms. Many in vitro studies have been implemented using several compaction agents. However, these compacting agents may have some kinds of cytotoxic effects to the cells. To minimize this aspect, several research works had been performed, but people have never focused green solvent, i.e. room temperature ionic liquid as DNA compaction agent. To the best of our knowledge, this is the first ever report where we have shown that guanidinium tris(pentafluoroethyl)trifluorophosphate (Gua-IL) acts as a DNA compacting agent. The compaction ability of Gua-IL has been verified by different spectroscopic techniques, like steady state emission, circular dichroism, dynamic light scattering and UV melting. Notably, we have extensively probed this compaction by Gua-IL through field emission scanning electron microscopy (FE-SEM) and fluorescence microscopy images. We also have discussed the plausible compaction mechanism process of DNA by Gua-IL. Our results suggest that Gua-IL forms a micellar kind of self aggregation above a certain concentration (>=1 mM), which instigates this compaction process. This study divulges the specific details of DNA compaction mechanism by a new class of compaction agent, which is highly biodegradable and eco friendly in nature.

  15. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  16. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-01-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  17. Dynamic evaluation of a regional air quality model: Assessing the emissions-induced weekly ozone cycle

    NASA Astrophysics Data System (ADS)

    Pierce, Thomas; Hogrefe, Christian; Trivikrama Rao, S.; Porter, P. Steven; Ku, Jia-Yeong

    2010-09-01

    Air quality models are used to predict changes in pollutant concentrations resulting from envisioned emission control policies. Recognizing the need to assess the credibility of air quality models in a policy-relevant context, we perform a dynamic evaluation of the Community Multiscale Air Quality (CMAQ) modeling system for the "weekend ozone effect" to determine if observed changes in ozone due to weekday-to-weekend (WDWE) reductions in precursor emissions can be accurately simulated. The weekend ozone effect offers a unique opportunity for dynamic evaluation, as it is a widely documented phenomenon that has persisted since the 1970s. In many urban areas of the Unites States, higher ozone has been observed on weekends than weekdays, despite dramatically reduced emissions of ozone precursors (nitrogen oxides [NO x] and volatile organic compounds [VOCs]) on weekends. More recent measurements, however, suggest shifts in the spatial extent or reductions in WDWE ozone differences. Using 18 years (1988-2005) of observed and modeled ozone and temperature data across the northeastern United States, we re-examine the long-term trends in the weekend effect and confounding factors that may be complicating the interpretation of this trend and explore whether CMAQ can replicate the temporal features of the observed weekend effect. The amplitudes of the weekly ozone cycle have decreased during the 18-year period in our study domain, but the year-to-year variability in weekend minus weekday (WEWD) ozone amplitudes is quite large. Inter-annual variability in meteorology appears to influence WEWD differences in ozone, as well as WEWD differences in VOC and NO x emissions. Because of the large inter-annual variability, modeling strategies using a single episode lasting a few days or a few episodes in a given year may not capture the WEWD signal that exists over longer time periods. The CMAQ model showed skill in predicting the absolute values of ozone concentrations during the

  18. Prophylactic Ozone Administration Reduces Intestinal Mucosa Injury Induced by Intestinal Ischemia-Reperfusion in the Rat

    PubMed Central

    Onal, Ozkan; Yetisir, Fahri; Sarer, A. Ebru Salman; Zeybek, N. Dilara; Onal, C. Oztug; Yurekli, Banu; Celik, H. Tugrul; Sirma, Ayse; Kılıc, Mehmet

    2015-01-01

    Objectives. Intestinal ischemia-reperfusion injury is associated with mucosal damage and has a high rate of mortality. Various beneficial effects of ozone have been shown. The aim of the present study was to show the effects of ozone in ischemia reperfusion model in intestine. Material and Method. Twenty eight Wistar rats were randomized into four groups with seven rats in each group. Control group was administered serum physiologic (SF) intraperitoneally (ip) for five days. Ozone group was administered 1 mg/kg ozone ip for five days. Ischemia Reperfusion (IR) group underwent superior mesenteric artery occlusion for one hour and then reperfusion for two hours. Ozone + IR group was administered 1 mg/kg ozone ip for five days and at sixth day IR model was applied. Rats were anesthetized with ketamine∖xyzlazine and their intracardiac blood was drawn completely and they were sacrificed. Intestinal tissue samples were examined under light microscope. Levels of superoxide dismutase (SOD), catalase (CAT), glutathioneperoxidase (GSH-Px), malondyaldehide (MDA), and protein carbonyl (PCO) were analyzed in tissue samples. Total oxidant status (TOS), and total antioxidant capacity (TAC) were analyzed in blood samples. Data were evaluated statistically by Kruskal Wallis test. Results. In the ozone administered group, degree of intestinal injury was not different from the control group. IR caused an increase in intestinal injury score. The intestinal epithelium maintained its integrity and decrease in intestinal injury score was detected in Ozone + IR group. SOD, GSH-Px, and CAT values were high in ozone group and low in IR. TOS parameter was highest in the IR group and the TAC parameter was highest in the ozone group and lowest in the IR group. Conclusion. In the present study, IR model caused an increase in intestinal injury.In the present study, ozone administration had an effect improving IR associated tissue injury. In the present study, ozone therapy prevented

  19. Coumarin-Induced DNA Ligation, Rearrangement to DNA Interstrand Crosslinks, and Photorelease of Coumarin Moiety.

    PubMed

    Sun, Huabing; Fan, Heli; Eom, Hyeyoung; Peng, Xiaohua

    2016-11-03

    Coumarin moieties react with thymine and cytosine in DNA by photoinduced [2+2] cycloaddition, which allows quantitative DNA interstrand crosslink (ICL) formation. Here, we report the application of coumarin analogues for DNA photoligation and the rearrangement of coumarin-induced ligation to ICL products. Both DNA sequences and the linker units at position 4 of the coumarin moieties affected coumarin-induced DNA photoligation. A flexible linker unit favored DNA ICL formation but led to inefficient photoligation, whereas coumarins without linker units greatly increased DNA photoligation efficiency. DNA photoligation induced by the coumarin moiety was photoswitchable. Ligation products were formed between coumarin and dT or dC upon 350 nm irradiation but reverted to the original single-stranded oligodeoxyribonucleotides (ODNs) upon 254 nm irradiation. Rearrangement of ligated ODNs into ICL products occurred during the switchable (350 nm/254 nm) processes. Additionally, photoinduced cleavage of coumarin 3 occurred with dC-3 cycloadducts upon 254 nm irradiation, which was confirmed by mass spectrometry analysis.

  20. DNA mesophases induced by spermidine: structural properties and biological implications.

    PubMed Central

    Pelta, J; Durand, D; Doucet, J; Livolant, F

    1996-01-01

    Conditions of formation of DNA aggregates by the addition of spermidine were determined with 146 base pair DNA fragments as a function of spermidine and NaCl concentration. Two different phases of spermidine-DNA complexes are obtained: a cholesteric liquid crystalline phase with a large helical pitch, with interhelix distances ranging from 31.6 to 32.6 A, and a columnar hexagonal phase with a restricted fluidity in which DNA molecules are more closely packed (29.85 +/- 0.05 A). In both phases, the DNA molecule retains its B form. These phases are always observed in equilibrium with the dilute isotropic solution, and their phase diagram is defined for a DNA concentration of 1 mg/ml. DNA liquid crystalline phases induced by spermidine are compared with the DNA mesophases already described in concentrated solutions in the absence of spermidine. We propose that the liquid crystalline character of the spermidine DNA complexes is involved in the stimulation of the functional properties of the DNA reported in numerous experimental articles, and we discuss how the nature of the phase could regulate the degree of activity of the molecule. Images FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 8 FIGURE 10 PMID:8804588

  1. Role of tachykinins in ozone-induced acute lung injury in guinea pigs

    SciTech Connect

    Tepper, J.S.; Costa, D.L.; Fitzgerald, S.; Doerfler, D.L.; Bromberg, P.A. )

    1993-09-01

    To examine the hypothesis that the acute reversible changes caused by ozone (O3) exposure are mediated by tachykinin release, guinea pigs were depleted of tachykinins by use of repeated capsaicin (CAP) injections before O3 exposure in an attempt to prevent O3-induced functional changes. Unexpectedly, CAP pretreatment caused divergent results in the functional responses to O3. Ventilatory measurements obtained from CAP-pretreated O3-exposed (CAP-O3) animals were exacerbated rather than diminished compared with the effects of O3 alone. Similarly, lavage fluid protein accumulation was enhanced in the CAP-O3 group compared with the O3-exposed group. In better agreement with our initial hypothesis, the CAP-O3 group was less responsive than the O3-exposed animals to histamine aerosol challenge. Additionally, Evans blue dye accumulation, a hallmark of tachykinin release, was increased in O3-exposed animals and was partially blocked in the CAP-O3 group. These data suggest that tachykinin-containing sensory fibers are unlikely to mediate the acute effects of O3 exposure on tidal breathing and lavage fluid protein accumulation but may play a role in causing post-O3 airway hyperreactivity and protein extravasation into the trachea.

  2. Ozone-induced dissociation on a modified tandem linear ion-trap: observations of different reactivity for isomeric lipids.

    PubMed

    Poad, Berwyck L J; Pham, Huong T; Thomas, Michael C; Nealon, Jessica R; Campbell, J Larry; Mitchell, Todd W; Blanksby, Stephen J

    2010-12-01

    Ozone-induced dissociation (OzID) exploits the gas-phase reaction between mass-selected lipid ions and ozone vapor to determine the position(s) of unsaturation. In this contribution, we describe the modification of a tandem linear ion-trap mass spectrometer specifically for OzID analyses wherein ozone vapor is supplied to the collision cell. This instrumental configuration provides spatial separation between mass-selection, the ozonolysis reaction, and mass-analysis steps in the OzID process and thus delivers significant enhancements in speed and sensitivity (ca. 30-fold). These improvements allow spectra revealing the double-bond position(s) within unsaturated lipids to be acquired within 1 s: significantly enhancing the utility of OzID in high-throughput lipidomic protocols. The stable ozone concentration afforded by this modified instrument also allows direct comparison of relative reactivity of isomeric lipids and reveals reactivity trends related to (1) double-bond position, (2) substitution position on the glycerol backbone, and (3) stereochemistry. For cis- and trans-isomers, differences were also observed in the branching ratio of product ions arising from the gas-phase ozonolysis reaction, suggesting that relative ion abundances could be exploited as markers for double-bond geometry. Additional activation energy applied to mass-selected lipid ions during injection into the collision cell (with ozone present) was found to yield spectra containing both OzID and classical-CID fragment ions. This combination CID-OzID acquisition on an ostensibly simple monounsaturated phosphatidylcholine within a cow brain lipid extract provided evidence for up to four structurally distinct phospholipids differing in both double-bond position and sn-substitution.

  3. Protective effects of medical ozone combined with traditional Chinese medicine against chemically-induced hepatic injury in dogs

    PubMed Central

    Li, Li-Jie; Yang, Yun-Gao; Zhang, Zhi-Ling; Nie, Sui-Feng; Li, Ze; Li, Feng; Hua, He-Yu; Hu, Yan-Jun; Zhang, Hong-Shuan; Guo, Ya-Bing

    2007-01-01

    AIM: To investigate the protective effect of medical ozone (O3) combined with Traditional Chinese Medicine (TCM) Yigan Fuzheng Paidu Capsules (YC) against carbon tetrachloride (CCl4)-induced hepatic injury in dogs. METHODS: Thirty healthy dogs were divided randomly into five groups (n = 6 in each group), namely control, oleanolic acid tablet (OAT), O3, YC and O3 + YC, given either no particular pre-treatment, oral OAT, medical ozone rectal insulfflation every other day, oral YC, or oral YC plus medical ozone rectal insulfflation every other day, respectively, for 30 consecutive days. After pre-treatment, acute hepatic injury was induced in all dogs with a single-dose intraperitoneal injection of CCl4. General condition and survival time were recorded. The biochemical and hematological indexes of alanine aminotransferase (ALT), aspartate aminotransferase/alanine aminotransferase (AST/ALT), serum total bilirubin (TBIL), prothrombin time (PT), blood ammonia (AMMO), and blood urea nitrogen (BUN) were measured after CCl4 injection. Hepatic pathological changes were also observed. RESULTS: Compared to the other four groups, the changes of group O3 + YC dogs’ general conditions (motoricity, mental state, eating, urination and defecation) could be better controlled. In group O3 + YC the survival rates were higher (P < 0.05 vs group control). AST/ALT values were kept within a normal level in group O3 + YC. Hepatic histopathology showed that hepatic injury in group O3 + YC was less serious than those in the other four groups. CONCLUSION: Medical ozone combined with TCM YC could exert a protective effect on acute liver injury induced by CCl4. PMID:18023088

  4. Phosphoinositide 3-kinase inhibitors induce DNA damage through nucleoside depletion

    PubMed Central

    Juvekar, Ashish; Hu, Hai; Yadegarynia, Sina; Lyssiotis, Costas A.; Ullas, Soumya; Lien, Evan C.; Bellinger, Gary; Son, Jaekyoung; Hok, Rosanna C.; Seth, Pankaj; Daly, Michele B.; Kim, Baek; Scully, Ralph; Asara, John M.; Cantley, Lewis C.; Wulf, Gerburg M.

    2016-01-01

    We previously reported that combining a phosphoinositide 3-kinase (PI3K) inhibitor with a poly-ADP Rib polymerase (PARP)-inhibitor enhanced DNA damage and cell death in breast cancers that have genetic aberrations in BRCA1 and TP53. Here, we show that enhanced DNA damage induced by PI3K inhibitors in this mutational background is a consequence of impaired production of nucleotides needed for DNA synthesis and DNA repair. Inhibition of PI3K causes a reduction in all four nucleotide triphosphates, whereas inhibition of the protein kinase AKT is less effective than inhibition of PI3K in suppressing nucleotide synthesis and inducing DNA damage. Carbon flux studies reveal that PI3K inhibition disproportionately affects the nonoxidative pentose phosphate pathway that delivers Rib-5-phosphate required for base ribosylation. In vivo in a mouse model of BRCA1-linked triple-negative breast cancer (K14-Cre BRCA1f/fp53f/f), the PI3K inhibitor BKM120 led to a precipitous drop in DNA synthesis within 8 h of drug treatment, whereas DNA synthesis in normal tissues was less affected. In this mouse model, combined PI3K and PARP inhibition was superior to either agent alone to induce durable remissions of established tumors. PMID:27402769

  5. The Cartography of UV-induced DNA Damage Formation and DNA Repair.

    PubMed

    Hu, Jinchuan; Adar, Sheera

    2017-01-01

    DNA damage presents a barrier to DNA-templated biochemical processes, including gene expression and faithful DNA replication. Compromised DNA repair leads to mutations, enhancing the risk for genetic diseases and cancer development. Conventional experimental approaches to study DNA damage required a researcher to choose between measuring bulk damage over the entire genome, with little or no resolution regarding a specific location, and obtaining data specific to a locus of interest, without a global perspective. Recent advances in high-throughput genomic tools overcame these limitations and provide high-resolution measurements simultaneously across the genome. In this review, we discuss the available methods for measuring DNA damage and their repair, focusing on genomewide assays for pyrimidine photodimers, the major types of damage induced by ultraviolet irradiation. These new genomic assays will be a powerful tool in identifying key components of genome stability and carcinogenesis.

  6. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  7. Ozone induces impairment of adrenergic relaxation in thoracic guinea pig tracheas.

    PubMed

    Sommer, B; Vargas, M H; Campos, M G; Montaño, L M

    2001-01-01

    The effect of ozone on airway relaxation mechanisms has been seldom studied. We exposed guinea pigs to ozone (0.3, 0.6 or 1.2 ppm for 4 h) and studied the in vitro tracheal responses to isoproterenol and nitroprusside, looking for differences between cervical and thoracic regions. We found that ozone did not alter responses to nitroprusside, whereas it produced a concentration-dependent decrease in the responses to isoproterenol in thoracic but not cervical tracheas. Thus, in isolated organ studies care should be taken to avoid mixing cervical and thoracic tracheal regions, at least when adrenergic responses are to be evaluated.

  8. Assessment of ethylene diurea-induced protection in plants against ozone phytotoxicity.

    PubMed

    Singh, Aditya Abha; Singh, Shalini; Agrawal, Madhoolika; Agrawal, Shashi Bhushan

    2015-01-01

    possesses great utility for screening plant sensitivity under field conditions in areas that experience high 0 3 concentrations, because EDU prevents 0 3 toxicity only in 0 3 sensitive plants. Ozone-resistant plants do not respond positively to EDU applications. However, EDU application dose and frequency must be standardized before it can be effectively and widely used for screening 0 3 sensitivity in plants. EDU acts primarily by enhancing biochemical plant defense and delaying Or induced senescence, thereby reducing chlorophyll loss, and maintaining physiological efficiency and primary metabolites; these actions enhance growth, biomass and yield of plants. We believe that future studies are needed to better address the EDU dose response relationship for many plant species, and to screen for new cultivars that can resist 0 3 stress. Although some research on the physiological and biochemical mechanisms of action of EDU have been performed, the new 'omics' tools have not been utilized to evaluate EDUs mechanism of action. Such data are needed, as is gene expression and proteome profiling studies on EDU-treated and -untreated plants.

  9. Harnessing DNA-induced immune responses for improving cancer vaccines

    PubMed Central

    Herrada, Andrés A.; Rojas-Colonelli, Nicole; González-Figueroa, Paula; Roco, Jonathan; Oyarce, César; Ligtenberg, Maarten A.; Lladser, Alvaro

    2012-01-01

    DNA vaccines have emerged as an attractive strategy to promote protective cellular and humoral immunity against the encoded antigen. DNA vaccines are easy to generate, inexpensive to produce and purify at large-scale, highly stable and safe. In addition, plasmids used for DNA vaccines act as powerful “danger signals” by stimulating several DNA-sensing innate immune receptors that promote the induction of protective adaptive immunity. The induction of tumor-specific immune responses represents a major challenge for DNA vaccines because most of tumor-associated antigens are normal non-mutated self-antigens. As a consequence, induction of potentially self-reactive T cell responses against such poorly immunogenic antigens is controlled by mechanisms of central and peripheral tolerance as well as tumor-induced immunosuppression. Although several DNA vaccines against cancer have reached clinical testing, disappointing results have been observed. Therefore, the development of new adjuvants that strongly stimulate the induction of antitumor T cell immunity and counteract immune-suppressive regulation is an attractive approach to enhance the potency of DNA vaccines and overcome tumor-associated tolerance. Understanding the DNA-sensing signaling pathways of innate immunity that mediate the induction of T cell responses elicited by DNA vaccines represents a unique opportunity to develop novel adjuvants that enhance vaccine potency. The advance of DNA adjuvants needs to be complemented with the development of potent delivery systems, in order to step toward successful clinical application. Here, we briefly discuss recent evidence showing how to harness DNA-induced immune response to improve the potency of cancer vaccines and counteract tumor-associated tolerance. PMID:23111166

  10. Mast cells modulate acute ozone-induced inflammation of the murine lung

    SciTech Connect

    Kleeberger, S.R.; Seiden, J.E.; Levitt, R.C.; Zhang, L.Y. )

    1993-11-01

    We hypothesized that mast cells modulate lung inflammation that develops after acute ozone (O3) exposure. Two tests were done: (1) genetically mast-cell-deficient (WBB6F1-W/Wv, WCB6F1-SI/SId) and bone-marrow-transplanted W/Wv mice were exposed to O3 or filtered air, and the inflammatory responses were compared with those of mast-cell-sufficient congenic mice (WBB6F1-(+)/+, WCB6F1-(+)/+); (2) genetically O3-susceptible C57BL/6J mice were treated pharmacologically with putative mast-cell modulators or vehicle, and the O3-induced inflammatory responses were compared. Mice were exposed to 1.75 ppm O3 or air for 3 h, and lung inflammation was assessed by bronchoalveolar lavage (BAL) 6 and 24 h after exposure. Relative to O3-exposed W/Wv and SI/SId mice, the mean numbers of lavageable polymorphonuclear leukocytes (PMNs) and total BAL protein concentration (a marker of permeability) were significantly greater in the respective O3-exposed normal congenic +/+ mice (p < 0.05). Mast cells were reconstituted in W/Wv mice by transplantation of bone marrow cells from congenic +/+ mice, and O3-induced lung inflammation was assessed in the mast-cell-replete W/Wv mice. After O3 exposure, the changes in lavageable PMNs and total protein of mast-cell-replete W/Wv mice were not different from age-matched normal +/+ control mice, and they were significantly greater than those of sham-transplanted W/Wv mice (p < 0.05). Genetically susceptible C57BL/6J mice were pretreated with a mast-cell stabilizer (nedocromil sodium), secretagogue (compound 48/80), or vehicle, and the mice were exposed to O3.

  11. Hypoxia-induced pulmonary arterial hypertension augments lung injury and airway reactivity caused by ozone exposure.

    PubMed

    Zychowski, Katherine E; Lucas, Selita N; Sanchez, Bethany; Herbert, Guy; Campen, Matthew J

    2016-08-15

    Ozone (O3)-related cardiorespiratory effects are a growing public health concern. Ground level O3 can exacerbate pre-existing respiratory conditions; however, research regarding therapeutic interventions to reduce O3-induced lung injury is limited. In patients with chronic obstructive pulmonary disease, hypoxia-associated pulmonary hypertension (HPH) is a frequent comorbidity that is difficult to treat clinically, yet associated with increased mortality and frequency of exacerbations. In this study, we hypothesized that established HPH would confer vulnerability to acute O3 pulmonary toxicity. Additionally, we tested whether improvement of pulmonary endothelial barrier integrity via rho-kinase inhibition could mitigate pulmonary inflammation and injury. To determine if O3 exacerbated HPH, male C57BL/6 mice were subject to either 3 weeks continuous normoxia (20.9% O2) or hypoxia (10.0% O2), followed by a 4-h exposure to either 1ppm O3 or filtered air (FA). As an additional experimental intervention fasudil (20mg/kg) was administered intraperitoneally prior to and after O3 exposures. As expected, hypoxia significantly increased right ventricular pressure and hypertrophy. O3 exposure in normoxic mice caused lung inflammation but not injury, as indicated by increased cellularity and edema in the lung. However, in hypoxic mice, O3 exposure led to increased inflammation and edema, along with a profound increase in airway hyperresponsiveness to methacholine. Fasudil administration resulted in reduced O3-induced lung injury via the enhancement of pulmonary endothelial barrier integrity. These results indicate that increased pulmonary vascular pressure may enhance lung injury, inflammation and edema when exposed to pollutants, and that enhancement of pulmonary endothelial barrier integrity may alleviate such vulnerability.

  12. An inducible long noncoding RNA amplifies DNA damage signaling

    PubMed Central

    Schmitt, Adam M.; Garcia, Julia T.; Hung, Tiffany; Flynn, Ryan A.; Shen, Ying; Qu, Kun; Payumo, Alexander Y.; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K.; Attardi, Laura D.; Chang, Howard Y.

    2016-01-01

    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently exquisite regulation but mostly unknown functions. Here we demonstrate a role of lncRNAs in guiding organismal DNA damage response. DNA damage activates transcription of DINO (Damage Induced NOncoding) via p53. DINO is required for p53-dependent gene expression, cell cycle arrest, and apoptosis in response to DNA damage, and DINO expression suffice to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO binds to and promotes p53 protein stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampens p53 signaling and ameliorates acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks. PMID:27668660

  13. Single-molecule visualization of ROS-induced DNA damage in large DNA molecules.

    PubMed

    Lee, Jinyong; Kim, Yongkyun; Lim, Sangyong; Jo, Kyubong

    2016-02-07

    We present a single molecule visualization approach for the quantitative analysis of reactive oxygen species (ROS) induced DNA damage, such as base oxidation and single stranded breaks in large DNA molecules. We utilized the Fenton reaction to generate DNA damage with subsequent enzymatic treatment using a mixture of three types of glycosylases to remove oxidized bases, and then fluorescent labeling on damaged lesions via nick translation. This single molecule analytical platform provided the capability to count one or two damaged sites per λ DNA molecule (48.5 kb), which were reliably dependent on the concentrations of hydrogen peroxide and ferrous ion at the micromolar level. More importantly, the labeled damaged sites that were visualized under a microscope provided positional information, which offered the capability of comparing DNA damaged sites with the in silico genomic map to reveal sequence specificity that GTGR is more sensitive to oxidative damage. Consequently, single DNA molecule analysis provides a sensitive analytical platform for ROS-induced DNA damage and suggests an interesting biochemical insight that the genome primarily active during the lysogenic cycle may have less probability for oxidative DNA damage.

  14. Induced pluripotent stem cells with a pathological mitochondrial DNA deletion

    PubMed Central

    Cherry, Anne B. C.; Gagne, Katelyn E.; McLoughlin, Erin M.; Baccei, Anna; Gorman, Bryan; Hartung, Odelya; Miller, Justine D.; Zhang, Jin; Zon, Rebecca L.; Ince, Tan A.; Neufeld, Ellis J.; Lerou, Paul H.; Fleming, Mark D.; Daley, George Q.; Agarwal, Suneet

    2013-01-01

    In congenital mitochondrial DNA (mtDNA) disorders, a mixture of normal and mutated mtDNA (termed heteroplasmy) exists at varying levels in different tissues, which determines the severity and phenotypic expression of disease. Pearson marrow pancreas syndrome (PS) is a congenital bone marrow failure disorder caused by heteroplasmic deletions in mtDNA. The cause of the hematopoietic failure in PS is unknown, and adequate cellular and animal models are lacking. Induced pluripotent stem (iPS) cells are particularly amenable for studying mtDNA disorders, as cytoplasmic genetic material is retained during direct reprogramming. Here we derive and characterize iPS cells from a patient with PS. Taking advantage of the tendency for heteroplasmy to change with cell passage, we isolated isogenic PS-iPS cells without detectable levels of deleted mtDNA. We found that PS-iPS cells carrying a high burden of deleted mtDNA displayed differences in growth, mitochondrial function, and hematopoietic phenotype when differentiated in vitro, compared to isogenic iPS cells without deleted mtDNA. Our results demonstrate that reprogramming somatic cells from patients with mtDNA disorders can yield pluripotent stem cells with varying burdens of heteroplasmy that might be useful in the study and treatment of mitochondrial diseases. PMID:23400930

  15. OZONE CONTACTOR FLOW VISUALIZATION AND CHARACTERIZATION USING 3-DIMENSIONAL LASER INDUCED FLUORESCENCE

    EPA Science Inventory

    Hydrodynamics of ozone contactors have a crucial impact on efficient inactivation of pathogens such as Cryptosporidium as well as control of disinfection byproducts such as bromate. Improper mixing behaviors including short-circuiting, internal recirculation and presence...

  16. DNA packaging induced by micellar aggregates: a novel in vitro DNA condensation system.

    PubMed

    Ghirlando, R; Wachtel, E J; Arad, T; Minsky, A

    1992-08-11

    Evidence for a conceptually novel DNA packaging process is presented. X-ray scattering, electron microscopy, and circular dichroism measurements indicate that in the presence of positively charged micellar aggregates and flexible anionic polymers, such as negatively charged polypeptides or single-stranded RNA species, a complex is formed in which DNA molecules are partially embedded within a micellar scaffold and partially condensed into highly packed chiral structures. Based on studies of micelle-DNA and micelle-flexible anionic polymer systems, as well as on the known effects of a high charge density upon the micellar organization, a DNA packaging model is proposed. According to this model, the DNA induces the elongation of the micelles into rodlike aggregates, forming a closely packed matrix in which the DNA molecules are immobilized. In contrast, the flexible anionic polymers stabilize clusters of spherical micelles which are proposed to effect a capping of the rodlike micelles, thus arresting their elongation and creating surfactant-free segments of the DNA that are able to converge and collapse. Thus, unlike other in vitro DNA packaging systems, in which condensation follows encounters between charge-neutralized DNA molecules, a prepackaging phase where the DNA is immobilized within a matrix is proposed in this case. Cellular and nuclear membranes have been implicated in DNA packaging processes in vivo, and negatively charged polyelectrolytes were shown to be involved in the processes. These observations, combined with the basic tenets of the DNA condensation system described here, allow for the progression to the study of more elaborate model systems and thus might lead to insights into the nature and roles of the intricate in vivo DNA-membrane complexes.

  17. Ozone-Induced Type 2 Immunity in Nasal Airways. Development and Lymphoid Cell Dependence in Mice.

    PubMed

    Ong, Chee Bing; Kumagai, Kazuyoshi; Brooks, Phillip T; Brandenberger, Christina; Lewandowski, Ryan P; Jackson-Humbles, Daven N; Nault, Rance; Zacharewski, Timothy R; Wagner, James G; Harkema, Jack R

    2016-03-01

    Inhalation exposures to ozone commonly encountered in photochemical smog cause airway injury and inflammation. Elevated ambient ozone concentrations have been epidemiologically associated with nasal airway activation of neutrophils and eosinophils. In the present study, we elucidated the temporal onset and lymphoid cell dependency of eosinophilic rhinitis and associated epithelial changes in mice repeatedly exposed to ozone. Lymphoid cell-sufficient C57BL/6 mice were exposed to 0 or 0.5 parts per million (ppm) ozone for 1, 2, 4, or 9 consecutive weekdays (4 h/d). Lymphoid cell-deficient, Rag2(-/-)Il2rg(-/-) mice were similarly exposed for 9 weekdays. Nasal tissues were taken at 2 or 24 hours after exposure for morphometric and gene expression analyses. C57BL/6 mice exposed to ozone for 1 day had acute neutrophilic rhinitis, with airway epithelial necrosis and overexpression of mucosal Ccl2 (MCP-1), Ccl11 (eotaxin), Cxcl1 (KC), Cxcl2 (MIP-2), Hmox1, Il1b, Il5, Il6, Il13, and Tnf mRNA. In contrast, 9-day ozone exposure elicited type 2 immune responses in C57BL/6 mice, with mucosal mRNA overexpression of Arg1, Ccl8 (MCP-2), Ccl11, Chil4 (Ym2), Clca1 (Gob5), Il5, Il10, and Il13; increased density of mucosal eosinophils; and nasal epithelial remodeling (e.g., hyperplasia/hypertrophy, mucous cell metaplasia, hyalinosis, and increased YM1/YM2 proteins). Rag2(-/-)Il2rg(-/-) mice exposed to ozone for 9 days, however, had no nasal pathology or overexpression of transcripts related to type 2 immunity. These results provide a plausible paradigm for the activation of eosinophilic inflammation and type 2 immunity found in the nasal airways of nonatopic individuals subjected to episodic exposures to high ambient ozone.

  18. Long-Term Ozone Exposure Attenuates 1-Nitronaphthalene–Induced Cytotoxicity in Nasal Mucosa

    PubMed Central

    Lee, Myong Gyong; Wheelock, Åsa M.; Boland, Bridget; Plopper, Charles G.

    2008-01-01

    1-Nitronaphthalene (1-NN) and ozone are cytotoxic air pollutants commonly found as components of photochemical smog. The mechanism of toxicity for 1-NN involves bioactivation by cytochrome P450s and subsequent adduction to proteins. Previous studies have shown that 1-NN toxicity in the lung is considerably higher in rats after long-term exposure to ozone compared with the corresponding filtered air–exposed control rats. The aim of the present study was to establish whether long-term exposure to ozone alters the susceptibility of nasal mucosa to the bioactivated toxicant, 1-NN. Adult male Sprague-Dawley rats were exposed to filtered air or 0.8 ppm ozone for 8 hours per day for 90 days, followed by a single treatment with 0, 12.5, or 50.0 mg/kg 1-NN by intraperitoneal injection. The results of the histopathologic analyses show that the nasal mucosa of rats is a target of systemic 1-NN, and that long-term ozone exposure markedly lessens the severity of injury, as well as the protein adduct formation by reactive 1-NN metabolites. The antagonistic effects were primarily seen in the nasal transitional epithelium, which corresponds to the main site of histologic changes attributed to ozone exposure (goblet cell metaplasia and hyperplasia). Long-term ozone exposure did not appear to alter susceptibility to 1-NN injury in other nasal regions. This study shows that long-term ozone exposure has a protective effect on the susceptibility of nasal transitional epithelium to subsequent 1-NN, a result that clearly contrasts with the synergistic toxicological effect observed in pulmonary airway epithelium in response to the same exposure regimen. PMID:17901409

  19. Dynamic DNA Methylation Regulates Levodopa-Induced Dyskinesia

    PubMed Central

    Figge, David A.; Eskow Jaunarajs, Karen L.

    2016-01-01

    Levodopa-induced dyskinesia (LID) is a persistent behavioral sensitization that develops after repeated levodopa (l-DOPA) exposure in Parkinson disease patients. LID is a consequence of sustained changes in the transcriptional behavior of striatal neurons following dopaminergic stimulation. In neurons, transcriptional regulation through dynamic DNA methylation has been shown pivotal to many long-term behavioral modifications; however, its role in LID has not yet been explored. Using a rodent model, we show LID development leads to the aberrant expression of DNA demethylating enzymes and locus-specific changes to DNA methylation at the promoter regions of genes aberrantly transcribed following l-DOPA treatment. Looking for dynamic DNA methylation in LID genome-wide, we used reduced representation bisulfite sequencing and found an extensive reorganization of the dorsal striatal methylome. LID development led to significant demethylation at many important regulatory areas of aberrantly transcribed genes. We used pharmacologic treatments that alter DNA methylation bidirectionally and found them able to modulate dyskinetic behaviors. Together, these findings demonstrate that l-DOPA induces widespread changes to striatal DNA methylation and that these modifications are required for the development and maintenance of LID. SIGNIFICANCE STATEMENT Levodopa-induced dyskinesia (LID) develops after repeated levodopa (l-DOPA) exposure in Parkinson disease patients and remains one of the primary obstacles to effective treatment. LID behaviors are a consequence of striatal neuron sensitization due to sustained changes in transcriptional behavior; however, the mechanisms responsible for the long-term maintenance of this cellular priming remain uncertain. Regulation of dynamic DNA methylation has been shown pivotal to the maintenance of several long-term behavioral modifications, yet its role in LID has not yet been explored. In this work, we report a pivotal role for the

  20. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  1. Genomic DNA transposition induced by human PGBD5

    PubMed Central

    Henssen, Anton G; Henaff, Elizabeth; Jiang, Eileen; Eisenberg, Amy R; Carson, Julianne R; Villasante, Camila M; Ray, Mondira; Still, Eric; Burns, Melissa; Gandara, Jorge; Feschotte, Cedric; Mason, Christopher E; Kentsis, Alex

    2015-01-01

    Transposons are mobile genetic elements that are found in nearly all organisms, including humans. Mobilization of DNA transposons by transposase enzymes can cause genomic rearrangements, but our knowledge of human genes derived from transposases is limited. In this study, we find that the protein encoded by human PGBD5, the most evolutionarily conserved transposable element-derived gene in vertebrates, can induce stereotypical cut-and-paste DNA transposition in human cells. Genomic integration activity of PGBD5 requires distinct aspartic acid residues in its transposase domain, and specific DNA sequences containing inverted terminal repeats with similarity to piggyBac transposons. DNA transposition catalyzed by PGBD5 in human cells occurs genome-wide, with precise transposon excision and preference for insertion at TTAA sites. The apparent conservation of DNA transposition activity by PGBD5 suggests that genomic remodeling contributes to its biological function. DOI: http://dx.doi.org/10.7554/eLife.10565.001 PMID:26406119

  2. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    PubMed Central

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna

    2016-01-01

    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex. PMID:27339811

  3. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    NASA Astrophysics Data System (ADS)

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna

    2016-06-01

    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex.

  4. Ozone-induced changes in host-plant suitability: interactions of Keiferia lycopersicella and Lycopersicon esculentum

    SciTech Connect

    Trumble, J.T.; Hare, J.D.; Musselman, R.C.; McCool, P.M.

    1987-01-01

    Tomato pinworms, Keiferia lycopersicella (Walsingham), survived better and developed faster on tomato plants, Lycopersicon esculentum Mill., damaged by ozone than on plants not subjected to ozone fumigation. Other measures of fitness, including survival during pupation, sex ratio of adults, female longevity, and fecundity, were not affected. Analyses of ozonated foliage at zero, two and seven days following fumigation demonstrated a transient but significant increase (18-24%) in soluble protein concentration. Although the concentration of the total free amino acids in ozonated foliage did not increase significantly, significant changes were observed in at least 10 specific amino acids, some of which are critical for either insect development or the production of plant defensive chemicals. A reduction in total nitrogen in ozonated foliage at seven days postfumigation indicated that nitrogen was being translocated to other portions of the plant. The implications of increases in assimilable forms of nitrogen in ozonated foliage, which lead to improved host-plant suitability for insect herbivores, are discussed both in relation to some current ecological theories and in regard to pest-management strategies. 59 references, 1 figure, 4 tables.

  5. Probability distribution analysis of force induced unzipping of DNA

    NASA Astrophysics Data System (ADS)

    Kumar, Sanjay; Giri, Debaprasad

    2006-07-01

    We present a semimicroscopic model of dsDNA by incorporating the directional nature of hydrogen bond to describe the force induced unzipping transition. Using exact enumeration technique, we obtain the force-temperature and the force-extension curves and compare our results with the other models of dsDNA. The model proposed by us is rich enough to describe the basic mechanism of dsDNA unzipping and predicts the existence of an "eye phase." We show oscillations in the probability distribution function during unzipping. Effects of stacking energies on the melting profile have also been studied.

  6. Inducible repair of oxidative DNA damage in Escherichia coli.

    PubMed

    Demple, B; Halbrook, J

    Hydrogen peroxide is lethal to many cell types, including the bacterium Escherichia coli. Peroxides yield transient radical species that can damage DNA and cause mutations. Such partially reduced oxygen species are occasionally released during cellular respiration and are generated by lethal and mutagenic ionizing radiation. Because cells live in an environment where the threat of oxidative DNA damage is continual, cellular mechanisms may have evolved to avoid and repair this damage. Enzymes are known which evidently perform these functions. We report here that resistance to hydrogen peroxide toxicity can be induced in E. coli, that this novel induction is specific and occurs, in part, at the level of DNA repair.

  7. Enantioselective DNA condensation induced by heptameric lanthanum helical supramolecular enantiomers.

    PubMed

    Bao, Fei-Fei; Xu, Xin-Xin; Zhou, Wen; Pang, Chun-Yan; Li, Zaijun; Gu, Zhi-Guo

    2014-09-01

    DNA condensation induced by a pair of heptameric La(III) helical enantiomers M-[La7(S-L)6(CO3)(NO3)6(OCH3)(CH3OH)7]·2CH3OH·5H2O and P-[La7(R-L)6(CO3)(NO3)6(OCH3)(CH3OH)5(H2O)2]·2CH3OH·4H2O (M-La and P-La, L=2-(2-hydroxybenzylamino)-3-carbamoylpropanoic acid) has been investigated by UV/vis spectroscopy, fluorescence spectroscopy, CD spectroscopy, EMSA, RALS, DLS, and SEM. The enantiomers M-La and P-La could induce CT-DNA condensation at a low concentration as observed in UV/vis spectroscopy. DNA condensates possessed globular nanoparticles with nearly homogeneous sizes in solid state determined by SEM (ca. 250 nm for M-La and ca. 200 nm for P-La). The enantiomers bound to DNA through electrostatic attraction and hydrogen bond interactions in a major groove, and rapidly condensed free DNA into its compact state. DNA decompaction has been acquired by using EDTA as disassembly agent, and analyzed by UV/vis spectroscopy, CD spectroscopy and EMSA. Moreover, the enantiomers M-La and P-La displayed discernible discrimination in DNA interaction and DNA condensation, as well as DNA decondensation. Our study suggested that lanthanum(III) enantiomers M-La and P-La were efficient DNA packaging agents with potential applications in gene delivery.

  8. Electrochemical DNA biosensor for detection of DNA damage induced by hydroxyl radicals.

    PubMed

    Hájková, Andrea; Barek, Jiří; Vyskočil, Vlastimil

    2017-03-01

    A simple electrochemical DNA biosensor based on a glassy carbon electrode (GCE) was prepared by adsorbing double-stranded DNA (dsDNA) onto the GCE surface and subsequently used for the detection of dsDNA damage induced by hydroxyl radicals. Investigation of the mutual interaction between hydroxyl radicals and dsDNA was conducted using a combination of several electrochemical detection techniques: square-wave voltammetry for direct monitoring the oxidation of dsDNA bases, and cyclic voltammetry and electrochemical impedance spectroscopy as indirect electrochemical methods making use of the redox-active indicator [Fe(CN)6](4-/3-). Hydroxyl radicals were generated electrochemically on the surface of a boron-doped diamond electrode and chemically (via the Fenton's reaction or the auto-oxidation of Fe(II)). The extent of dsDNA damage by electrochemically generated hydroxyl radicals depended on the current density applied to the generating electrode: by applying 5, 10, and 50mAcm(-2), selected relative biosensor responses decreased after 3min incubation from 100% to 38%, 27%, and 3%, respectively. Chemically generated hydroxyl radicals caused less pronounced dsDNA damage, and their damaging activity depended on the form of Fe(II) ions: decreases to 49% (Fenton's reaction; Fe(II) complexed with EDTA) and 33% (auto-oxidation of Fe(II); Fe(II) complexed with dsDNA) were observed after 10min incubation.

  9. Modulation of irinotecan-induced genomic DNA damage by theanine.

    PubMed

    Attia, Sabry

    2012-05-01

    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity.

  10. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-Replication

    DTIC Science & Technology

    2005-04-01

    ml a that sustained rereplication leads to a dramatic decrease factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and...significant decrease in cell viability and a cellular DNA damage response. Strikingly, we have observed DNA damage in the absence of a classical...genome re-replicates. In this reporting period, we have shown that re-replication induces a rapid and significant decrease in cell viability and a

  11. Tissue culture-induced DNA methylation polymorphisms in repetitive DNA of tomato calli and regenerated plants.

    PubMed

    Smulders, M J; Rus-Kortekaas, W; Vosman, B

    1995-12-01

    The propagation of plants through tissue culture can induce a variety of genetic and epigenetic changes. Variation in DNA methylation has been proposed as a mechanism that may explain at least a part of these changes. In the present study, the methylation of tomato callus DNA was compared with that of leaf DNA, from control or regenerated plants, at MspI/HpaII sites around five middle-repetitive sequences. Although the methylation of the internal cytosine in the recognition sequence CCGG varied from zero to nearly full methylation, depending on the probe used, no differences were found between callus and leaf DNA. For the external cytosine, small differences were revealed between leaf and callus DNA with two probes, but no polymorphisms were detected among DNA samples of calli or DNA samples of leaves of regenerated plants. When callus DNA cut with HindIII was studied with one of the probes, H9D9, most of the signal was found in high-molecular-weight DNA, as opposed to control leaf DNA where almost all the signal was in a fragment of 530 bp. Also, an extra fragment of 630 bp was found in the callus DNA that was not present in control leaf DNA. Among leaves of plants regenerated from tissue culture, the 630-bp fragment was found in 10 of 68 regenerated plants. This 630-bp fragment was present among progeny of only 4 of these 10 plants after selfing, i.e. it was partly inherited. In these cases, the fragment was not found in all progeny plants, indicating heterozygosity of the regenerated plants. The data are interpreted as indicating that a HindIII site becomes methylated in callus tissue, and that some of this methylation persists in regenerated plants and is partly transmitted to their progeny.

  12. Expression of the dnaN and dnaQ genes of Escherichia coli is inducible by mitomycin C.

    PubMed

    Kaasch, M; Kaasch, J; Quiñones, A

    1989-10-01

    The dnaN and dnaQ genes encode the beta subunit and the epsilon subunit of the DNA polymerase III holoenzyme. Using translational fusions to lacZ we found that DNA damage caused by mitomycin C induces expression of the dnaA and dnaQ genes. This induction was not observed in lexA and recA mutants which block the induction of the SOS response, suggesting a relationship between the mechanism(s) of genetic control of DNA polymerase III holoenzyme and the SOS regulatory network. Nevertheless, there is evidence that the mitomycin C induction of dnaN and dnaQ is not a simple lexA-regulated process, because nalidixic acid (an excellent SOS inducer) does not increase dnaN and dnaQ gene expression, and the time course of induction is abnormally slow.

  13. Light-induced multiphase chemistry of gas phase ozone on aqueous pyruvic and oxalic acids: Aerosol chamber study

    NASA Astrophysics Data System (ADS)

    Gligorovski, S.; Grgic, I.; Net, S.; Böge, O.; Iinuma, Y.; Kahnt, A.; Scheinhardt, S.; Herrmann, H.; Wortham, H.

    2010-12-01

    The light-absorbing organic compounds present in and on condensed aerosol particles interacting with trace gases such as ozone can initiate a new and potentially important photo-induced multiphase chemistry. However, investigations of light induced multiphase processes are very scarce at present. We have launched the idea of pyruvic acid (PA) acting as a photosensitizer in the multiphase reactions between gas-phase ozone and aqueous oxalic acid (OA). The performed photochemical batch experiments yielded a complex suite of organic molecules which resulted primarily from the oligomerization of OA/PA and subsequent reactions, including decarboxylation and cycloadition (Grgic et al., 2010). In the atmosphere, pyruvic acid will always be accompanied by other carboxylic acids (and also other organics) which are constituents of either aerosol particles or aqueous droplets the effects of a possible photochemistry triggered by pyruvic acid should be experimentally studied in depth and under natural conditions as far as possible. Hence, in a very recent study experiments in the aerosol chamber facility LEAK at IFT, Leipzig, were performed to verify the influence of pyruvic on the multiphase (photo)oxidation of oxalic acid. The aim of these experiments was to study the multiphase photo-induced oxidation reactions with airborne deliquescent particles to demonstrate the applicability of the reactions mentioned above under more realistic conditions than in a batch reactor. State of the art sampling and analytical tools were applied for the analysis of the ongoing chamber runs and the formed particulate products which include denuder sampling, carbonyl compound derivatisation, PTR-MS measurements, GC-MS measurements and HPLC-MS and CE-MS for the particle phase. First results from these joint complex chamber experiments will be presented and discussed. Reference: Grgić I., Nieto-Gligorovski L.I., Net S., Temime-Roussel B., Gligorovski S., Wortham H. Light induced multiphase

  14. Hydroxyl radical Thymine adduct induced DNA damages

    NASA Astrophysics Data System (ADS)

    Schyman, Patric; Eriksson, Leif A.; Zhang, Ru bo; Laaksonen, Aatto

    2008-06-01

    DNA damages caused by a 5-hydroxy-5,6-dihydrothymine-6-yl radical (5-OHT-6yl) abstracting a C2‧ hydrogen from a neighboring sugar (inter-H abstraction) have been theoretically investigated using hybrid DFT in gas phase and in water solution. The inter-H abstraction was here shown to be comparable in energy (24 kcal mol-1) with the intra-H abstraction in which the 5-OHT-6yl abstracts a C2‧ hydrogen from its own sugar. The effect of a neutrally or a negatively charged phosphate group was also studied and the results show no significant impact on the activation energy of the hydrogen abstraction whereas base release and strand break reactions are affected.

  15. Clerocidin selectively modifies the gyrase-DNA gate to induce irreversible and reversible DNA damage

    PubMed Central

    Pan, Xiao Su; Dias, Miriam; Palumbo, Manlio; Fisher, L. Mark

    2008-01-01

    Clerocidin (CL), a microbial diterpenoid, reacts with DNA via its epoxide group and stimulates DNA cleavage by type II DNA topoisomerases. The molecular basis of CL action is poorly understood. We establish by genetic means that CL targets DNA gyrase in the Gram-positive bacterium Streptococcus pneumoniae, and promotes gyrase-dependent single- and double-stranded DNA cleavage in vitro. CL-stimulated DNA breakage exhibited a strong preference for guanine preceding the scission site (−1 position). Mutagenesis of −1 guanines to A, C or T abrogated CL cleavage at a strong pBR322 site. Surprisingly, for double-strand breaks, scission on one strand consistently involved a modified (piperidine-labile) guanine and was not reversed by heat, salt or EDTA, whereas complementary strand scission occurred at a piperidine-stable −1 nt and was reversed by EDTA. CL did not induce cleavage by a mutant gyrase (GyrA G79A) identified here in CL-resistant pneumococci. Indeed, mutations at G79 and at the neighbouring S81 residue in the GyrA breakage-reunion domain discriminated poisoning by CL from that of antibacterial quinolones. The results suggest a novel mechanism of enzyme inhibition in which the −1 nt at the gyrase-DNA gate exhibit different CL reactivities to produce both irreversible and reversible DNA damage. PMID:18723572

  16. Oxygen-induced changes in mitochondrial DNA and DNA repair enzymes in aging rat lens.

    PubMed

    Zhang, Yi; Ouyang, Shan; Zhang, Lan; Tang, Xianling; Song, Zhen; Liu, Ping

    2010-01-01

    The treatment of patients with hyperbaric oxygen (HBO), vitrectomy and loss of vitreous gel during aging is associated with a high risk of subsequent development of nuclear cataract. Many studies proved that oxidation is the key reason of nuclear cataract. Reactive oxygen species (ROS) are formed in mitochondria as a by-product of normal metabolism and as a consequence of exposure to environmental compounds. Therefore, mitochondrial DNA (mtDNA) is at particularly high risk of ROS-induced damage. Oxidative damage to mtDNA has been implicated as a causative factor in a wide variety of degenerative diseases and aging. However, the effect of mtDNA damage to the lens has not been studied. The goals of the study were to identify if there was increased mtDNA damage in lens when the eye were exposed to hyperoxic or hypoxic conditions and also to evaluate the changes in gene expression of mtDNA base excision repair (mtBER) enzymes. Our data have shown that the damage of mtDNA, the expression of mtBER enzymes and the level of 8-OHdG in lens increased after inspired hyperoxia, which is likely associated with oxidative stress. However, there was no effect to mtDNA and mtBER enzymes in lens after inspired hypoxia. Nuclear cataract appeared rapidly at 14 month old rats in hyperoxia group, and lens kept transparency in other groups.

  17. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  18. EGFR induces DNA decomposition via phosphodiester bond cleavage

    PubMed Central

    Tong, Yongpeng; Li, Shuiming; Huang, Chunliu

    2017-01-01

    EGFR may induce DNA degradation. This activity had not been previously described as an EGRF function. To confirm this unexpected activity, testing of EGFR in the presence of ATP and either 5A, 5C, 5G, 5T, or 5U oligonucleotides was performed. HPLC-MS analysis demonstrated that 5A and 5U levels significantly decreased in the presence of EGFR. Furthermore, fragments 4A and 4U were produced in 5A+EGFR+ATP and in 5U+EGFR+ATP reaction mixtures, respectively, but not in EGFR-negative controls. Degradation of Poly(A), Poly(C), Poly(G), Poly(I), Poly(T), and Poly(U) oligomers in the presence of EGFR and ATP correlated with the lower ability of reaction products to pair with complementary oligonucleotides. Gel electrophoresis showed that breakdown products migrated more quickly than controls, especially after addition of paired (complementary) oligomers, Poly(A) and Poly(U). Furthermore, λ DNA reaction products also migrated more quickly after incubation with EGFR. The results suggest that EGFR can induce breakage of certain types of nucleotide phosphodiester bonds, especially within the A residues of DNA or U residues of RNA, to induce DNA or RNA decomposition, respectively. This activity may be important in EGRF signaling, DNA degradation, or repair in normal or cancer cell activities. PMID:28272528

  19. Inflammation-Induced Cell Proliferation Potentiates DNA Damage-Induced Mutations In Vivo

    PubMed Central

    Kiraly, Orsolya; Gong, Guanyu; Olipitz, Werner; Muthupalani, Sureshkumar; Engelward, Bevin P.

    2015-01-01

    Mutations are a critical driver of cancer initiation. While extensive studies have focused on exposure-induced mutations, few studies have explored the importance of tissue physiology as a modulator of mutation susceptibility in vivo. Of particular interest is inflammation, a known cancer risk factor relevant to chronic inflammatory diseases and pathogen-induced inflammation. Here, we used the fluorescent yellow direct repeat (FYDR) mice that harbor a reporter to detect misalignments during homologous recombination (HR), an important class of mutations. FYDR mice were exposed to cerulein, a potent inducer of pancreatic inflammation. We show that inflammation induces DSBs (γH2AX foci) and that several days later there is an increase in cell proliferation. While isolated bouts of inflammation did not induce HR, overlap between inflammation-induced DNA damage and inflammation-induced cell proliferation induced HR significantly. To study exogenously-induced DNA damage, animals were exposed to methylnitrosourea, a model alkylating agent that creates DNA lesions relevant to both environmental exposures and cancer chemotherapy. We found that exposure to alkylation damage induces HR, and importantly, that inflammation-induced cell proliferation and alkylation induce HR in a synergistic fashion. Taken together, these results show that, during an acute bout of inflammation, there is a kinetic barrier separating DNA damage from cell proliferation that protects against mutations, and that inflammation-induced cell proliferation greatly potentiates exposure-induced mutations. These studies demonstrate a fundamental mechanism by which inflammation can act synergistically with DNA damage to induce mutations that drive cancer and cancer recurrence. PMID:25647331

  20. Enhanced phagocytosis by alveolar macrophages induced by short-term ozone insult

    SciTech Connect

    Christman, C.A.; Schwartz, L.W.

    1982-08-01

    In vitro phagocytosis of inert microspheres by the alveolar macrophage (AM) was evaluated after in vivo exposure to 0.8 ppm ozone for 3, 7, or 20 days. AM were collected by bronchoalveolar lavage from rats, allowed to adhere to glass, and incubated with carbon-coated latex microspheres. The percentages of phagocytic cells were determined by light microscopy after 0.25, 0.5, 1, 2, 4, 8, and 24 hr of incubation. Morphological features of AM were evaluated by scanning electron microscopy (SEM) and an index of cell spreading was determined by image analysis of SEM photomicrographs. An enhanced phagocytic activity was observed after ozone exposure, with the greatest increase on Day 3. This enhanced phagocytic activity correlated with an increase in cell spreading. The results, which suggest that prolonged ozone insult produces an altered AM population, support previous morphological observations.

  1. Volcanic-aerosol-induced changes in stratospheric ozone following the eruption of Mount Pinatubo

    NASA Technical Reports Server (NTRS)

    Grant, W. B.; Browell, E. V.; Fishman, J.; Brackett, V. G.; Fenn, M. A.; Butler, C. F.; Nganga, D.; Minga, A.; Cros, B.; Mayor, S. D.

    1994-01-01

    Measurements of lower stratospheric ozone in the Tropics using electrochemical concentrations cell (ECC) sondes and the airborne UV Differential Absorption Lidar (DIAL) system after the eruption of Mt. Pinatubo are compared with the Stratospheric Aerosol and Gas Experiment 2 (SAGE 2) and ECC sonde measurements from below the eruption to determine what changes have occurred as a result. Aerosol data from the Advanced Very High Resolution Radiometer (AVHRR) and the visible and IR wavelengths of the lidar system are used to examine the relationship between aerosols and ozone changes. Ozone decreases of 30 percent at altitudes between 19 and 26 km, partial column (16-28 km) decreases of about 27 D.U., and slight increases (5.4 D.U.) between 28 and 31 km are found in comparison with SAGE 2 climatological values.

  2. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    NASA Astrophysics Data System (ADS)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-12-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 . 10-14 cm2 and 7.06 . 10-14 cm2. The highest cross section was found for 5'-TT(ATA)3TT and 5'-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy.

  3. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    PubMed Central

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

  4. Salmon DNA Accelerates Bone Regeneration by Inducing Osteoblast Migration

    PubMed Central

    Sato, Ayako; Kajiya, Hiroshi; Mori, Nana; Sato, Hironobu; Fukushima, Tadao; Kido, Hirofumi

    2017-01-01

    The initial step of bone regeneration requires the migration of osteogenic cells to defective sites. Our previous studies suggest that a salmon DNA-based scaffold can promote the bone regeneration of calvarial defects in rats. We speculate that the salmon DNA may possess osteoinductive properties, including the homing of migrating osteogenic cells. In the present study, we investigated the influence of the salmon DNA on osteoblastic differentiation and induction of osteoblast migration using MG63 cells (human preosteoblasts) in vitro. Moreover, we analyzed the bone regeneration of a critical-sized in vivo calvarial bone defect (CSD) model in rats. The salmon DNA enhanced both mRNA and protein expression of the osteogenesis-related factors, runt-related transcription factor 2 (Runx2), alkaline phosphatase, and osterix (OSX) in the MG63 cells, compared with the cultivation using osteogenic induction medium alone. From the histochemical and immunohistochemical assays using frozen sections of the bone defects from animals that were implanted with DNA disks, many cells were found to express aldehyde dehydrogenase 1, one of the markers for mesenchymal stem cells. In addition, OSX was observed in the replaced connective tissue of the bone defects. These findings indicate that the DNA induced the migration and accumulation of osteogenic cells to the regenerative tissue. Furthermore, an in vitro transwell migration assay showed that the addition of DNA enhanced an induction of osteoblast migration, compared with the medium alone. The implantation of the DNA disks promoted bone regeneration in the CSD of rats, compared with that of collagen disks. These results indicate that the salmon DNA enhanced osteoblastic differentiation and induction of migration, resulting in the facilitation of bone regeneration. PMID:28060874

  5. DNA lesions, inducible DNA repair, and cell division: Three key factors in mutagenesis and carcinogenesis

    SciTech Connect

    Ames, B.N.; Shigenaga, M.K.; Gold, L.S.

    1993-12-01

    DNA lesions that escape repair have a certain probability of giving rise to mutations when the cell divides. Endogenous DNA damage is high: 10{sup 6} oxidative lesions are present per rat cell. An exogenous mutagen produces an increment in lesions over the background rate of endogenous lesions. The effectiveness of a particular lesion depends on whether it is excised by a DNA repair system and the probability that it gives rise to a mutation when the cell divides. When the cell divides, an unrepaired DNA lesion has a certain probability of giving rise to a mutation. Thus, an important factor in the mutagenic effect of an exogenous agent whether it is genotoxic or non-genotoxic, is the increment it causes over the background cell division rate (mitogenesis) in cells that appear to matter most in cancer, the stem cells, which are not on their way to being discarded. Increasing their cell division rate increases by high doses of chemicals. If both the rate of DNA lesions and cell division are increased, then there will be a multiplicative effect on mutagenesis (and carcinogenesis), for example, by high doses of a mutagen that also increases mitogenesis through cell killing. The defense system against reactive electrophilic mutagens, such as the glutathione transferases, are also almost all inducible and buffer cells against increments in active forms of chemicals that can cause DNA lesions. A variety of DNA repair defense systems, almost all inducible, buffer the cell against any increment in DNA lesions. Therefore, the effect of a particular chemical insult depends on the level of each defense, which in turn depends on the past history of exposure. Exogenous agents can influence the induction and effectiveness of these defenses. Defenses can be partially disabled by lack of particular micronutrients in the diet (e.g., antioxidants).

  6. Ozone-induced elevation of creatine kinase activity in blood plasma of rats

    SciTech Connect

    Veninga, T.S.; Fidler, V.

    1986-10-01

    Rats exposed to three different low concentrations of ozone for 2 hr show alterations in blood plasma creatinine kinase activity comparable to those previously observed in mice. The reactions are explained as compensatory, possibly being involved in the initial phase of adaptation development.

  7. From climate change to molecular response: redox proteomics of ozone-induced responses in soybean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ozone (O3) causes significant agricultural losses with soybean being highly sensitive to this oxidant. Here we assess the effect of elevated seasonal O3 exposure on the total and redox proteomes of soybean. To understand the molecular responses to O3 exposure, soybean grown at the Soybean Free Air C...

  8. CORONA-INDUCED OZONATION COUPLED WITH PHOTOOXIDATION: AN ENVIRONMENTALLY FRIENDLY AND COST-EFFECTIVE METHOD

    EPA Science Inventory

    We have developed a process that uses surface corona for the production of ozone by passing air or oxygen through a high voltage electrical discharge and the emitted ultraviolet light is being used to activate a photocatalyst. A thin film of nanostructured TiO2 with primary part...

  9. Ozone Induces Glucose Intolerance and Systemic Metabolic Effects in Young and Aged Brown Norway Rats

    EPA Science Inventory

    Air pollutants have been associated with increased diabetes in humans. We hypothesized that ozone could impair glucose homeostasis by altering insulin signaling and/or endoplasmic reticular (ER) stress in very young and aged rats. Brown Norway (BN) rats, 1,4, 12, and 24 months ol...

  10. Diesel Exhaust Modulates Ozone-induced Lung Function Decrements in Healthy Human Volunteers

    EPA Science Inventory

    The potential effects of combinations of dilute whole diesel exhaust (DE) and ozone (03), each a common component of ambient airborne pollutant mixtures, on lung function were examined. Healthy young human volunteers were exposed for 2 hr to pollutants while exercising (~50 L/min...

  11. Coconut, Fish, and Olive Oil-Rich Diets Modify Ozone-Induced Metabolic Effects

    EPA Science Inventory

    Pulmonary health effects of ozone (O3) exposure are well known; however, the cardiovascular and metabolic consequences are still under investigation. Fish oil (FO) and olive oil (OO) dietary supplementation have several cardioprotective benefits, but it is not established if thes...

  12. Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity

    PubMed Central

    Pan, Yanchun; Daito, Takuji; Sasaki, Yo; Chung, Yong Hee; Xing, Xiaoyun; Pondugula, Santhi; Swamidass, S. Joshua; Wang, Ting; Kim, Albert H.; Yano, Hiroko

    2016-01-01

    Although epigenetic abnormalities have been described in Huntington’s disease (HD), the causal epigenetic mechanisms driving neurodegeneration in HD cortex and striatum remain undefined. Using an epigenetic pathway-targeted drug screen, we report that inhibitors of DNA methyltransferases (DNMTs), decitabine and FdCyd, block mutant huntingtin (Htt)-induced toxicity in primary cortical and striatal neurons. In addition, knockdown of DNMT3A or DNMT1 protected neurons against mutant Htt-induced toxicity, together demonstrating a requirement for DNMTs in mutant Htt-triggered neuronal death and suggesting a neurodegenerative mechanism based on DNA methylation-mediated transcriptional repression. Inhibition of DNMTs in HD model primary cortical or striatal neurons restored the expression of several key genes, including Bdnf, an important neurotrophic factor implicated in HD. Accordingly, the Bdnf promoter exhibited aberrant cytosine methylation in mutant Htt-expressing cortical neurons. In vivo, pharmacological inhibition of DNMTs in HD mouse brains restored the mRNA levels of key striatal genes known to be downregulated in HD. Thus, disturbances in DNA methylation play a critical role in mutant Htt-induced neuronal dysfunction and death, raising the possibility that epigenetic strategies targeting abnormal DNA methylation may have therapeutic utility in HD. PMID:27516062

  13. Mitochondrial DNA damage induces apoptosis in senescent cells

    PubMed Central

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F

    2013-01-01

    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV–HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells. PMID:23868060

  14. Mitochondrial DNA damage induces apoptosis in senescent cells.

    PubMed

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F

    2013-07-18

    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV-HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells.

  15. Pyrosequencing: Applicability for Studying DNA Damage-induced Mutagenesis

    PubMed Central

    Minko, Irina G.; Earley, Lauriel F.; Larlee, Kimberly E.; Lin, Ying-Chih; Lloyd, R. Stephen

    2014-01-01

    Site-specifically modified DNAs are routinely used in the study of DNA damage-induced mutagenesis. These analyses involve the creation of DNA vectors containing a lesion at a predetermined position, DNA replication, and detection of mutations at the target site. The final step has previously required the isolation of individual DNA clones, hybridization with radioactively-labeled probes, and verification of mutations by Sanger sequencing. In search for an alternative procedure that would allow direct quantification of sequence variants in a mixed population of DNA molecules, we evaluated the applicability of pyrosequencing to site-specific mutagenesis assays. The progeny DNAs were analyzed that originated from replication of N6-(deoxy-D-erythro-pentofuranosyl)-2,6-diamino-3,4-dihydro-4-oxo-5-N-methylformamidopyrimidine (MeFapy-dG)-containing vectors in primate cells, with the lesion being positioned in the 5′-GCNGG-3′ sequence context. Pyrosequencing detected ~8% G to T transversions and ~3.5% G to A transitions, a result that was in excellent agreement with frequencies previously measured by the standard procedure [Earley et al., 2013]. However, ~3.5% G to C transversions and ~2.0% deletions could not be detected by pyrosequencing. Consistent with these observations, the sensitivity of pyrosequencing for measuring the single deoxynucleotide variants differed depending on the deoxynucleotide identity, and in the given sequence contexts, was determined to be ~1-2% for A and T and ~5% for C. Pyrosequencing of other DNA isolates that were obtained following replication of MeFapy-dG-containing vectors in primate cells or Escherichia coli, identified several additional limitations. Collectively, our data demonstrated that pyrosequencing can be used for studying DNA damage-induced mutagenesis as an effective complementary experimental approach to current protocols. PMID:24962778

  16. Diesel exhaust modulates ozone-induced lung function decrements in healthy human volunteers

    PubMed Central

    2014-01-01

    The potential effects of combinations of dilute whole diesel exhaust (DE) and ozone (O3), each a common component of ambient airborne pollutant mixtures, on lung function were examined. Healthy young human volunteers were exposed for 2 hr to pollutants while exercising (~50 L/min) intermittently on two consecutive days. Day 1 exposures were either to filtered air, DE (300 μg/m3), O3 (0.300 ppm), or the combination of both pollutants. On Day 2 all exposures were to O3 (0.300 ppm), and Day 3 served as a followup observation day. Lung function was assessed by spirometry just prior to, immediately after, and up to 4 hr post-exposure on each exposure day. Functional pulmonary responses to the pollutants were also characterized based on stratification by glutathione S-transferase mu 1 (GSTM1) genotype. On Day 1, exposure to air or DE did not change FEV1 or FVC in the subject population (n = 15). The co-exposure to O3 and DE decreased FEV1 (17.6%) to a greater extent than O3 alone (9.9%). To test for synergistic exposure effects, i.e., in a greater than additive fashion, FEV1 changes post individual O3 and DE exposures were summed together and compared to the combined DE and O3 exposure; the p value was 0.057. On Day 2, subjects who received DE exposure on Day 1 had a larger FEV1 decrement (14.7%) immediately after the O3 exposure than the individuals’ matched response following a Day 1 air exposure (10.9%). GSTM1 genotype did not affect the magnitude of lung function changes in a significant fashion. These data suggest that altered respiratory responses to the combination of O3 and DE exposure can be observed showing a greater than additive manner. In addition, O3-induced lung function decrements are greater with a prior exposure to DE compared to a prior exposure to filtered air. Based on the joint occurrence of these pollutants in the ambient environment, the potential exists for interactions in more than an additive fashion affecting lung physiological

  17. Baseline Chromatin Modification Levels May Predict Interindividual Variability in Ozone-Induced Gene Expression

    PubMed Central

    McCullough, Shaun D.; Bowers, Emma C.; On, Doan M.; Morgan, David S.; Dailey, Lisa A.; Hines, Ronald N.; Devlin, Robert B.; Diaz-Sanchez, David

    2016-01-01

    Traditional toxicological paradigms have relied on factors such as age, genotype, and disease status to explain variability in responsiveness to toxicant exposure; however, these are neither sufficient to faithfully identify differentially responsive individuals nor are they modifiable factors that can be leveraged to mitigate the exposure effects. Unlike these factors, the epigenome is dynamic and shaped by an individual’s environment. We sought to determine whether baseline levels of specific chromatin modifications correlated with the interindividual variability in their ozone (O3)-mediated induction in an air–liquid interface model using primary human bronchial epithelial cells from a panel of 11 donors. We characterized the relationship between the baseline abundance of 6 epigenetic markers with established roles as key regulators of gene expression—histone H3 lysine 4 trimethylation (H3K4me3), H3K27 acetylation (H3K27ac), pan-acetyl H4 (H4ac), histone H3K27 di/trimethylation (H3K27me2/3), unmodified H3, and 5-hydroxymethylcytosine (5-hmC)—and the variability in the O3-induced expression of IL-8, IL-6, COX2, and HMOX1. Baseline levels of H3K4me3, H3K27me2/3, and 5-hmC, but not H3K27ac, H4ac, and total H3, correlated with the interindividual variability in O3-mediated induction of HMOX1 and COX2. In contrast, none of the chromatin modifications that we examined correlated with the induction of IL-8 and IL-6. From these findings, we propose an “epigenetic seed and soil” model in which chromatin modification states between individuals differ in the relative abundance of specific modifications (the “soil”) that govern how receptive the gene is to toxicant-mediated cellular signals (the “seed”) and thus regulate the magnitude of exposure-related gene induction. PMID:26719369

  18. Using DNA origami nanostructures to determine absolute cross sections for UV photon-induced DNA strand breakage.

    PubMed

    Vogel, Stefanie; Rackwitz, Jenny; Schürman, Robin; Prinz, Julia; Milosavljević, Aleksandar R; Réfrégiers, Matthieu; Giuliani, Alexandre; Bald, Ilko

    2015-11-19

    We have characterized ultraviolet (UV) photon-induced DNA strand break processes by determination of absolute cross sections for photoabsorption and for sequence-specific DNA single strand breakage induced by photons in an energy range from 6.50 to 8.94 eV. These represent the lowest-energy photons able to induce DNA strand breaks. Oligonucleotide targets are immobilized on a UV transparent substrate in controlled quantities through attachment to DNA origami templates. Photon-induced dissociation of single DNA strands is visualized and quantified using atomic force microscopy. The obtained quantum yields for strand breakage vary between 0.06 and 0.5, indicating highly efficient DNA strand breakage by UV photons, which is clearly dependent on the photon energy. Above the ionization threshold strand breakage becomes clearly the dominant form of DNA radiation damage, which is then also dependent on the nucleotide sequence.

  19. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; van Dilla, M.A.; Lake, S.; Wyrobek, A.J.

    1983-09-01

    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular x-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to x-ray-induced DNA content variability. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artifically enriched in one population.

  20. Studies on the biological effects of ozone: 2. Induction of tumor necrosis factor (TNF-alpha) on human leucocytes

    SciTech Connect

    Paulesu, L.; Luzzi, E.; Bocci, V. )

    1991-10-01

    The effect of ozone as a probable inducer of tumor necrosis factor (TNF-alpha) has been investigated on human blood and on Ficoll-purified blood mononuclear cells (PBMC). Samples were exposed at different ozone concentrations ranging from 2.2 to 108 micrograms/ml and incubated at 37 degrees C in an 95% air-5% CO2 atmosphere. At predetermined times, all cell supernatants were tested for TNF activity and some PBMC cultures were examined for DNA synthesis. The authors have shown that ozone concentration is critical in terms of TNF production and of cell mitogenesis and that, owing to the presence of erythrocytes, higher ozone concentrations are required to be effective in blood than in PBMC. Because ozonization of blood is a procedure followed in several European countries for the treatment of viral diseases and tumors, the release of factors with antiviral and immunomodulatory activities by leukocytes may explain the mechanism of action of ozone and of autohemotherapy.

  1. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  2. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.

    PubMed

    Englander, Ella W

    2013-08-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons.

  3. Ozone oxidative postconditioning ameliorates joint damage and decreases pro-inflammatory cytokine levels and oxidative stress in PG/PS-induced arthritis in rats.

    PubMed

    Vaillant, Jaqueline Dranguet; Fraga, Angela; Díaz, María Teresa; Mallok, A; Viebahn-Hänsler, Renate; Fahmy, Ziad; Barberá, Ariana; Delgado, Liván; Menéndez, Silvia; Fernández, Olga Sonia León

    2013-08-15

    Rheumatoid Arthritis (RA) is the most prevalent chronic condition present in ~1% of the adult population. Many pro-inflammatory mediators are increased in RA, including Reactive Oxygen Species such as nitric oxide NO, pro-inflammatory cytokines as tumor necrosis factor alpha (TNF-α), interleukin-1beta (IL-1β) and other molecules. Ozone oxidative postconditioning has regulatory effects on some pathological targets associated with RA. Thus, the aim of this study was to investigate the efficacy of ozone therapy in PG/PS-induced arthritis in rats in point of joints inflammation and morphology. Moreover, cytokines, nitric oxide and oxidative stress levels in spleen homogenates were evaluated. Ozone treatment ameliorated joint damage, reduced TNF-α concentrations as well as TNF-α and IL-1β mRNA levels. Besides, cellular redox balance, nitric oxide and fructolysine levels were reestablished after ozone oxidative postconditioning. It was concluded that pleiotropic ozone's effects clarify its therapeutic efficacy in RA. Decreasing inflammation and joint injury, reduction of pro-inflammatory cytokines, TNF-α and IL-1β transcripts and re-establishment of cellular redox balance after ozone treatment were demonstrated.

  4. Identification and characterization of MOR-CP, a cysteine protease induced by ozone and developmental senescence in maize (Zea mays L.) leaves.

    PubMed

    Ahmad, Rafiq; Zuily-Fodil, Yasmine; Passaquet, Chantal; Bethenod, Olivier; Roche, Romain; Repellin, Anne

    2014-08-01

    Among the different classes of endoproteases, cysteine proteases are consistently associated with senescence, defense signaling pathways and cellular responses to abiotic stresses. The objectives of this work were to study the effects of various concentrations of ozone on gene expression and enzymatic activity for papain-like cysteine proteases (PLCPs), in the leaves of maize plants grown under field conditions. Leaves from ranks 12 and 10 (cob leaf) were harvested regularly over a long-term artificial ozone fumigation experiment (50 d). Tissues were tested for transcriptional and activity changes concerning cysteine proteases, using qRT-PCR for the newly identified ozone-responsive PLCP gene (Mor-CP) and synthetic oligopeptide Boc-Val-Leu-Lys-AMC as a PLCP-specific substrate, respectively. Results showed that developmental senescence induced a significant and progressive rise in CP activity, only in the older leaves 10 and had no effect on Mor-CP gene expression levels. On the other hand, ozone dramatically enhanced Mor-CP mRNA levels and global PLCP enzymatic activity in leaves 12 and 10, particularly toward the end of the treatment. Ozone impact was more pronounced in the older leaves 10. Together, these observations concurred to conclude that ozone stress enhances natural senescence processes, such as those related to proteolysis.

  5. Multiomic Analysis of the UV-Induced DNA Damage Response.

    PubMed

    Boeing, Stefan; Williamson, Laura; Encheva, Vesela; Gori, Ilaria; Saunders, Rebecca E; Instrell, Rachael; Aygün, Ozan; Rodriguez-Martinez, Marta; Weems, Juston C; Kelly, Gavin P; Conaway, Joan W; Conaway, Ronald C; Stewart, Aengus; Howell, Michael; Snijders, Ambrosius P; Svejstrup, Jesper Q

    2016-05-11

    In order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanoma-associated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.

  6. Current-induced enhancement of DNA bubble creation

    NASA Astrophysics Data System (ADS)

    Gu, Lei; Fu, Hua-Hua

    2016-05-01

    Current-induced heating of short double-stranded DNA chains is studied within a two-probe transport setup by using the Langevin approach. The electrons are modeled by a tight-binding Hamiltonian. The DNA atomic motion is described by the Peyrard-Bishop-Dauxois atomic potential, coupled with electrons through the Holstein interaction. The solvent environment is accounted for as a classical heat bath. Voltage biases of 0.1˜ 0.5 {{V}} can effectively break the base pairs and lead to the melting transition, which can be detected from the resulting significant reduction of the conductance. When the bias increases, the opening of base pairs near the leads with higher chemical potential is suppressed and bubble (localized separation of the double strand) formation becomes asymmetric. Our results suggest that the voltage bias can excite the base pairs, hence increases the chemical activity of DNA.

  7. Low-energy plasma immersion ion implantation to induce DNA transfer into bacterial E. coli

    NASA Astrophysics Data System (ADS)

    Sangwijit, K.; Yu, L. D.; Sarapirom, S.; Pitakrattananukool, S.; Anuntalabhochai, S.

    2015-12-01

    Plasma immersion ion implantation (PIII) at low energy was for the first time applied as a novel biotechnology to induce DNA transfer into bacterial cells. Argon or nitrogen PIII at low bias voltages of 2.5, 5 and 10 kV and fluences ranging from 1 × 1012 to 1 × 1017 ions/cm2 treated cells of Escherichia coli (E. coli). Subsequently, DNA transfer was operated by mixing the PIII-treated cells with DNA. Successes in PIII-induced DNA transfer were demonstrated by marker gene expressions. The induction of DNA transfer was ion-energy, fluence and DNA-size dependent. The DNA transferred in the cells was confirmed functioning. Mechanisms of the PIII-induced DNA transfer were investigated and discussed in terms of the E. coli cell envelope anatomy. Compared with conventional ion-beam-induced DNA transfer, PIII-induced DNA transfer was simpler with lower cost but higher efficiency.

  8. Silica radical-induced DNA damage and lipid peroxidation.

    PubMed Central

    Shi, X; Mao, Y; Daniel, L N; Saffiotti, U; Dalal, N S; Vallyathan, V

    1994-01-01

    In recent years, more attention has been given to the mechanism of disease induction caused by the surface properties of minerals. In this respect, specific research needs to be focused on the biologic interactions of oxygen radicals generated by mineral particles resulting in cell injury and DNA damage leading to fibrogenesis and carcinogenesis. In this investigation, we used electron spin resonance (ESR) and spin trapping to study oxygen radical generation from aqueous suspensions of freshly fractured crystalline silica. Hydroxyl radical (.OH), superoxide radical (O2.-) and singlet oxygen (1O2) were all detected. Superoxide dismutase (SOD) partially inhibited .OH yield, whereas catalase abolished .OH generation. H2O2 enhanced .OH generation while deferoxamine inhibited it, indicating that .OH is generated via a Haber-Weiss type reaction. These spin trapping measurements provide the first evidence that aqueous suspensions of silica particles generate O2.- and 1O2. Oxygen consumption measurements indicate that freshly fractured silica uses molecular oxygen to generate O2.- and 1O2. Electrophoretic assays of in vitro DNA strand breakages showed that freshly fractured silica induced DNA strand breakage, which was inhibited by catalase and enhanced by H2O2. In an argon atmosphere, DNA damage was suppressed, showing that molecular oxygen is required for the silica-induced DNA damage. Incubation of freshly fractured silica with linoleic acid generated linoleic acid-derived free radicals and caused dose-dependent lipid peroxidation as measured by ESR spin trapping and malondialdehyde formation. SOD, catalase, and sodium benzoate inhibited lipid peroxidation by 49, 52, and 75%, respectively, again showing the role of oxygen radicals in silica-induced lipid peroxidation.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 7. PMID:7705289

  9. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    Smetanina, N M; Pustovalova, M V; Osipov, A N

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells.

  10. Plant phenology, growth and nutritive quality of Briza maxima: responses induced by enhanced ozone atmospheric levels and nitrogen enrichment.

    PubMed

    Sanz, J; Bermejo, V; Muntifering, R; González-Fernández, I; Gimeno, B S; Elvira, S; Alonso, R

    2011-02-01

    An assessment of the effects of tropospheric ozone (O(3)) levels and substrate nitrogen (N) supplementation, singly and in combination, on phenology, growth and nutritive quality of Briza maxima was carried out. Two serial experiments were developed in Open-Top Chambers (OTC) using three O(3) and three N levels. Increased O(3) exposure did not affect the biomass-related parameters, but enhanced senescence, increased fiber foliar content (especially lignin concentration) and reduced plant life span; these effects were related to senescence acceleration induced by the pollutant. Added N increased plant biomass production and improved nutritive quality by decreasing foliar fiber concentration. Interestingly, the effects of N supplementation depended on meteorological conditions and plant physiological activity. N supplementation counteracted the O(3)-induced senescence but did not modify the effects on nutritive quality. Nutritive quality and phenology should be considered in new definitions of the O(3) limits for the protection of herbaceous vegetation.

  11. Adjuvant aqueous ozone in the treatment of bisphosphonate induced necrosis of the jaws: report of two cases and long-term follow-up.

    PubMed

    Brozoski, M A; Lemos, C A; Da Graça Naclério-Homem, M; Deboni, M C Z

    2014-01-01

    Bisphosphonate induced necrosis of the jaws (BONJ) does not have a unique protocol of treatment and many therapeutic approaches have been arising in oral medicine with debatable results. A male and a female attended the University Oral Surgery Clinic presenting oral bone lesions induced by intravenous and oral bisphosphonates respectively as complications of dental extraction. Treatment included daily mouthwashes and weekly intra oral irrigations with 4 mg/L of aqueous-ozone, antibiotic therapy and sequential superficial debridment for sequestrectomies. Long-standing follow-ups showed complete mucosa covering of exposed bone area and resolution of purulent secretion. Antibacterial and antifungal properties of aqueous ozone may have played important roles in the treatment. The outcome measured intra oral examination and panoramic radiographs of the affected bone. The application of aqueous ozone daily mouthwashes and weekly professional irrigation were safe; free from adverse effects, easily of handling and worked as an important adjuvant therapeutic strategy for the treatment of BONJ.

  12. Considerations for evaluating ultraviolet radiation-induced genetic damage relative to Antarctic ozone depletion.

    PubMed Central

    Karentz, D

    1994-01-01

    Springtime ozone depletion over the Antarctic results in increased UVB in local marine environments. It has been established that decreases in primary productivity occur with decreases in ozone concentrations, but the impact of increased UVB on the functioning and stability of the ecosystem has not yet been determined. Very little has been done to evaluate the potential for genetic damage caused by the increase in UVB, and this type of damage is most significant relative to the fitness and maintenance of populations. An essential problem in evaluating genotoxic effects is the lack of appropriate techniques to sample and quantify genetic damage in field populations under ambient UVB levels. In addition, it is currently not feasible to estimate exposure levels for organisms in their natural habitats. PMID:7713036

  13. Dielectric Barrier Discharge Plasma-Induced Photocatalysis and Ozonation for the Treatment of Wastewater

    NASA Astrophysics Data System (ADS)

    Mok, Young Sun; Jo, Jin-Oh; Lee, Heon-Ju

    2008-02-01

    The physicochemical processes of dielectric barrier discharge (DBD) such as in-situ formation of chemically active species and emission of ultraviolet (UV)/visible light were utilized for the treatment of a simulated wastewater formed with Acid Red 4 as the model organic contaminant. The chemically active species (mostly ozone) produced in the DBD reactor were well distributed in the wastewater using a porous gas diffuser, thereby increasing the gas-liquid contact area. For the purpose of making the best use of the light emission, a titanium oxide-based photocatalyst was incorporated in the wastewater treating system. The experimental parameters chosen were the voltage applied to the DBD reactor, the initial pH of the wastewater, and the concentration of hydrogen peroxide added to the wastewater. The results have clearly shown that the present system capable of degrading organic contaminants in two ways (photocatalysis and ozonation) may be a promising wastewater treatment technology.

  14. Increased expression of Bcl-2 during mucous cell metaplasia induced by endotoxin and ozone

    SciTech Connect

    Tesfaigzi, J.; Ray, L.M.; Hotchkiss, J.A.

    1995-12-01

    Apoptosis or programmed cell death is accompanied by characteristic morphological changes that distinguish apoptosis from other forms of cell death. These changes include DNA fragmentation, chromatin condensation, cell shrinkage, cell surface pseudopodia, and finally the cellular collapse into membrane-enclosed apoptotic bodies which are rapidly engulfed by macrophages or neighboring cells. Although the morphological features of apoptotic cells are well studied, the biochemical events that control apoptosis are not understood. Programmed cell death is triggered by a variety of pathways that are initiated by different stimuli including noxious agents, DNA damage, the activation of TNF receptors, or the withdrawl of growth factors. The central process of programmed cell death involves a cascade of biochemical events that begins with the initiation of a family of cysteine proteases, including the interleukin-1-{Beta}-converting enzyme, CPP-32, and Apopain. The ratio of Bax, a death-inducer gene, to Bcl-2, an apoptosis suppressor gene, determines whether or not the main apoptotic pathyway is blocked. Apoptosis is suppressed if the ratio of Bcl-2/Bax is > 1, and cells undergo apoptosis if the ratio is < 1. The overexpression of Bcl-2 has been shown to block the apoptotic program triggered by a variety of agents. Therefore, Bcl-2 must be involved in blocking the central pathway of the cell death program. In conclusion, this study showed that high levels of Bcl-2 were detected in some mucous cells at specific time points during mucous cell metaplasia, and this expression was reduced at later time points or was absent after remodeling of this epithelium.

  15. Fullerenes Can Induce Toxic Physical Changes of DNA

    NASA Astrophysics Data System (ADS)

    Czerwinski, Fabian; Oddershede, Lene B.

    2008-03-01

    Fullerenes are fascinating symmetric carbon nanostructures. Nowadays, they are widely used because of their characteristic physical and chemical properties. Until now research has mainly been focused on commercial applications of fullerenes. Only a few investigations have addressed the potential biological hazards, one of which is that fullerenes are believed to alter the elastic properties of DNA upon binding. In our experiments we use optical tweezers with sub-piconewton and nanometer resolution to probe the structural changes and the potential damages which fullerenes might induce on single DNA molecules. Therefore, force-extension relations can be obtained under physiological conditions while varying the concentration of different types of fullerenes. It has theoretically been predicted [1], that certain fullerenes can function as a minor-groove binder to double-stranded DNA, thus altering its elastic properties significantly. Fullerenes are capable of causing severe damage inside living organisms by forming DNA regions which are not accessible for proper enzymatic functions. A further goal of the study is to establish fullerenes as a tool for a more detailed investigation of DNA-protein interactions, such as the trafficing of polymerases or the packing by procaryotic proteins. [1] Zhao X, Striolo A, and Cummings PT: C60 Binds to and Deforms Nucleotides. BiophysJ (89):3856-62, 2005.

  16. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; Van Dilla, M.A.; Lake, S.; Wyrobek, A.J.

    1983-09-01

    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular X-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to X-ray-induced DNA content variability. In the range between 0 and 600 rad the dose dependence of the square of CV of the DNA content variability, delta CV2D, is described by delta CV2D . Bx + Cx2, with 0 less than or equal to B less than or equal to 0.23 X 10(-2) and C . (0.44 +/- 0.06) X 10(-4). The dose x is measured in rad and delta CVD is expressed in percent. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artificially enriched in one population.

  17. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    PubMed

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV.

  18. Surface-enhanced Raman scattering spectroscopy of topotecan-DNA complexes: Binding to DNA induces topotecan dimerization

    NASA Astrophysics Data System (ADS)

    Mochalov, K. E.; Strel'Tsov, S. A.; Ermishov, M. A.; Grokhovskii, S. L.; Zhuze, A. L.; Ustinova, O. A.; Sukhanova, A. V.; Nabiev, I. R.; Oleinikov, V. A.

    2002-09-01

    The interaction of topotecan (TPT), antitumor inhibitor of human DNA topoisomerase I, with calf thymus DNA was studied by surface-enhanced Raman scattering (SERS) spectroscopy. The SERS spectra of TPT are found to depend on its concentration in solution, which is associated with the dimerization of TPT. The spectral signatures of dimerization are identified. It is shown that binding to DNA induces the formation of TPT dimers. The formation of DNA-TPT-TPT-DNA complexes is considered as one of the possible mechanisms of human DNA topoisomerase I inhibition.

  19. Ozone Induces a Proinflammatory Response in Primary Human Bronchial Epithelial Cells Through Mitogen-Activated Protein Kinase Activation Without Nuclear Factor-kB Activation

    EPA Science Inventory

    Ground-level ozone (O3) is a ubiquitous environmental air pollutant that is a potent inducer of airway inflammation and has been linked with both respiratory and cardiovascular morbidity and mortality. Some studies using transformed or immortalized cells have attributed O3-medi...

  20. Acute Ozone (O3) Exposure Accelerates Diet-Induced Pulmonary Injury and Metabolic Alterations in a Rat Model of Type II Diabetes

    EPA Science Inventory

    Abstract for Society of Toxicology, March 22-25, 2015, San Diego, CAAcute Ozone (O3) Exposure Accelerates Diet-Induced Pulmonary Injury and Metabolic Alterations in a Rat Model of Type II DiabetesS.J. Snow1,3, D. Miller2, V. Bass2, M. Schladweiler3, A. Ledbetter3, J. Richards3, C...

  1. UV-inducible DNA repair in the cyanobacteria Anabaena spp

    SciTech Connect

    Levine, E.; Thiel, T.

    1987-09-01

    Strains of the filamentous cyanobacteria Anabaena spp. were capable of very efficient photoreactivation of UV irradiation-induced damage to DNA. Cells were resistant to several hundred joules of UV irradiation per square meter under conditions that allowed photoreactivation, and they also photoreactivated UV-damaged cyanophage efficiently. Reactivation of UV-irradiated cyanophage (Weigle reactivation) also occurred; UV irradiation of host cells greatly enhanced the plaque-forming ability of irradiated phage under nonphotoreactivating conditions. Postirradiation incubation of the host cells under conditions that allowed photoreactivation abolished the ability of the cells to perform Weigle reactivation of cyanophage N-1. Mitomycin C also induced Weigle reactivation of cyanophage N-1, but nalidixic acid did not. The inducible repair system (defined as the ability to perform Weigle reactivation of cyanophages) was relatively slow and inefficient compared with photoreactivation.

  2. Thermal stability of DNA adducts induced by cyanomorpholinoadriamycin in vitro.

    PubMed Central

    Cullinane, C; Phillips, D R

    1993-01-01

    The Adriamycin derivative, cyanomorpholinoadriamycin (CMA) was reacted with DNA in vitro to form apparent interstrand crosslinks. The extent of interstrand crosslink formation was monitored by a gel electrophoresis assay and maximal crosslinking of DNA was observed within 1 hr with 5 microM of drug. The interstrand crosslinks were heat labile, with a midpoint melting temperature of 70 degrees C (10 min exposure to heat) in 45% formamide. When CMA-induced adducts were detected as blockages of lambda-exonuclease, 12 blockage sites were observed with 8 being prior to 5'-GG sequences, one prior to 5'-CC, one prior to 5'-GC and 2 at unresolved combinations of these sequences. These exonuclease-detected blockages reveal the same sites of CMA-induced crosslinking as detected by in vitro transcription footprinting and primer-extension blockages on single strand DNA, where the blockages at 5'-GG and 5'-CC were identified as sites of intrastrand crosslinking and the 5'-GC blockage as a probable site of interstrand crosslinking. The thermal stability of both types of crosslink (10 min exposure to heat) ranged from 63-70 degrees C at individual sites. High levels of adduct were detected with poly (dG-dC) but not with poly (dI-dC). These results suggest adduct formation involving an aminal linkage between the 3 position of the morpholino moiety and N2 of guanine. Images PMID:8493102

  3. Assay to detect chemically induced DNA repair in rat spermatocytes

    SciTech Connect

    Working, P.K.; Butterworth, B.E.

    1984-01-01

    An in vivo/in vitro DNA repair assay has been developed to quantitate chemically induced unscheduled DNA synthesis (UDS) in rat spermatocytes utilizing autoradiography. Male Fischer-344 rats were treated by i.p. injection or gavage with a variety of genotoxic agents dissolved in dimethyl sulfoxide, corn oil, or water. At selected times after treatment, spermatocytes were isolated by trypsin digestion of testes and cultured for 24 hr in the presence of /sup 3/H-thymidine. The direct-acting genotoxicants methyl methanesulfonate (MMS) and ethyl methanesulfonate and the chemotherapeutic agent cyclophosphamide (CPA) produced positive UDS responses in spermatocyes isolated l hr after i.p. injection. Other known genotoxicants--including dimethylnitrosamine, aflatoxin B/sub 1/, 2-acetylaminofluorene, 2, 6-dinitrotoluene, and l,6-dinitropyrene--failed to induce UDS, even with routes of administration and at times of exposure known to produce a positive response in hepatocytes. These results demonstrate that the in vivo/in vitro spermatocyte DNA repair assay may be useful as a predictive screen for germ cell mutagens.

  4. Ozone Basics

    EPA Pesticide Factsheets

    Learn the difference between good (stratospheric) and bad (tropospheric) ozone, how bad ozone affects our air quality, health, and environment, and what EPA is doing about it through regulations and standards.

  5. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1.

  6. Quantitation of DNA Adducts Induced by 1,3-Butadiene

    NASA Astrophysics Data System (ADS)

    Sangaraju, Dewakar; Villalta, Peter W.; Wickramaratne, Susith; Swenberg, James; Tretyakova, Natalia

    2014-07-01

    Human exposure to 1,3-butadiene (BD) present in automobile exhaust, cigarette smoke, and forest fires is of great concern because of its potent carcinogenicity. The adverse health effects of BD are mediated by its epoxide metabolites such as 3,4-epoxy-1-butene (EB), which covalently modify genomic DNA to form promutagenic nucleobase adducts. Because of their direct role in cancer, BD-DNA adducts can be used as mechanism-based biomarkers of BD exposure. In the present work, a mass spectrometry-based methodology was developed for accurate, sensitive, and precise quantification of EB-induced N-7-(1-hydroxy-3-buten-2-yl) guanine (EB-GII) DNA adducts in vivo. In our approach, EB-GII adducts are selectively released from DNA backbone by neutral thermal hydrolysis, followed by ultrafiltration, offline HPLC purification, and isotope dilution nanoLC/ESI+-HRMS3 analysis on an Orbitrap Velos mass spectrometer. Following method validation, EB-GII lesions were quantified in human fibrosarcoma (HT1080) cells treated with micromolar concentrations of EB and in liver tissues of rats exposed to sub-ppm concentrations of BD (0.5-1.5 ppm). EB-GII concentrations increased linearly from 1.15 ± 0.23 to 10.11 ± 0.45 adducts per 106 nucleotides in HT1080 cells treated with 0.5-10 μM DEB. EB-GII concentrations in DNA of laboratory rats exposed to 0.5, 1.0, and 1.5 ppm BD were 0.17 ± 0.05, 0.33 ± 0.08, and 0.50 ± 0.04 adducts per 106 nucleotides, respectively. We also used the new method to determine the in vivo half-life of EB-GII adducts in rat liver DNA (2.20 ± 0.12 d) and to detect EB-GII in human blood DNA. To our knowledge, this is the first application of nanoLC/ESI+-HRMS3 Orbitrap methodology to quantitative analysis of DNA adducts in vivo.

  7. Bisdemethoxycurcumin induces DNA damage and inhibits DNA repair associated protein expressions in NCI-H460 human lung cancer cells.

    PubMed

    Yu, Chien-Chih; Yang, Su-Tso; Huang, Wen-Wen; Peng, Shu-Fen; Huang, An-Cheng; Tang, Nou-Ying; Liu, Hsin-Chung; Yang, Mei-Due; Lai, Kuang-Chi; Chung, Jing-Gung

    2015-08-30

    Nonsmall cell lung carcinoma (NSCLC) is a devastating primary lung tumor resistant to conventional therapies. Bisdemethoxycurcumin (BDMC) is one of curcumin derivate from Turmeric and has been shown to induce NSCLC cell death. Although there is one report to show BDMC induced DNA double strand breaks, however, no available information to show BDMC induced DNA damage action with inhibited DNA repair protein in lung cancer cells in detail. In this study, we tested BDMC-induced DNA damage and condensation in NCI-H460 cells by using Comet assay and DAPI staining examinations, respectively and we found BDMC induced DNA damage and condension. Western blotting was used to examine the effects of BDMC on protein expression associated with DNA damage and repair and results indicated that BDMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DDR), O6-methylguanine-DNA methyltransferase, DNA repair proteins breast cancer 1, early onset, mediator of DNA damage checkpoint 1 but activate phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Confocal laser systems microscopy was used for examining the protein translocation and results show that BDMC increased the translocation of p-p53 and p-H2A.X (phospho Ser140) from cytosol to nuclei in NCI-H460 cells. In conclusion, BDMC induced DNA damage and condension and affect DNA repair proteins in NCI-H460 cells in vitro. © 2015 Wiley Periodicals, Inc. Environ Toxicol, 2015.

  8. Dynamical DNA accessibility induced by chromatin remodeling and protein binding

    NASA Astrophysics Data System (ADS)

    Montel, F.; Faivre-Moskalenko, C.; Castelnovo, M.

    2014-11-01

    Chromatin remodeling factors are enzymes being able to alter locally chromatin structure at the nucleosomal level and they actively participate in the regulation of gene expression. Using simple rules for individual nucleosome motion induced by a remodeling factor, we designed simulations of the remodeling of oligomeric chromatin, in order to address quantitatively collective effects in DNA accessibility upon nucleosome mobilization. Our results suggest that accessibility profiles are inhomogeneous thanks to borders effects like protein binding. Remarkably, we show that the accessibility lifetime of DNA sequence is roughly doubled in the vicinity of borders as compared to its value in bulk regions far from the borders. These results are quantitatively interpreted as resulting from the confined diffusion of a large nucleosome depleted region.

  9. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  10. Investigation of the influence on conformational transition of DNA induced by cationic lipid vesicles

    NASA Astrophysics Data System (ADS)

    Zhang, Zheling; Huang, Weimin; Wang, Erkang; Dong, Shaojun

    2003-01-01

    Recent studies have focused on the structural features of DNA-lipid assemblies. In this paper we take nile blue A (NBA) as a probe molecule to study the influence of the conformational transition of DNA induced by didodecyldimethylammonium bromide (DDAB) cationic vesicles to the interaction between DNA and the probe molecules. We find that upon binding to DNA, a secondary conformational transition of DNA induced by the cationic liposome from the native B-form to the C-form resulted in the change of binding modes of NBA to DNA and different complexes are formed between DNA, DDAB and NBA.

  11. Novel DNA damage checkpoint in mitosis: Mitotic DNA damage induces re-replication without cell division in various cancer cells.

    PubMed

    Hyun, Sun-Yi; Rosen, Eliot M; Jang, Young-Joo

    2012-07-06

    DNA damage induces multiple checkpoint pathways to arrest cell cycle progression until damage is repaired. In our previous reports, when DNA damage occurred in prometaphase, cells were accumulated in 4 N-DNA G1 phase, and mitosis-specific kinases were inactivated in dependent on ATM/Chk1 after a short incubation for repair. We investigated whether or not mitotic DNA damage causes cells to skip-over late mitotic periods under prolonged incubation in a time-lapse study. 4 N-DNA-damaged cells re-replicated without cell division and accumulated in 8 N-DNA content, and the activities of apoptotic factors were increased. The inhibition of DNA replication reduced the 8 N-DNA cell population dramatically. Induction of replication without cell division was not observed upon depletion of Chk1 or ATM. Finally, mitotic DNA damage induces mitotic slippage and that cells enter G1 phase with 4 N-DNA content and then DNA replication is occurred to 8 N-DNA content before completion of mitosis in the ATM/Chk1-dependent manner, followed by caspase-dependent apoptosis during long-term repair.

  12. Effects of azithromycin on ozone-induced airway neutrophilia and cytokine release.

    PubMed

    Criqui, G I; Solomon, C; Welch, B S; Ferrando, R E; Boushey, H A; Balmes, J R

    2000-05-01

    Exposure of humans to ozone causes increased neutrophils and inflammatory cytokines in airway lining fluid. Recent research shows that macrolide antibiotics may reduce interleukin (IL)-8 production by bronchial epithelial cells and inhibit neutrophil chemotaxis. A double-blind, cross-over study was performed in which 12 healthy subjects underwent two separate 4-h exposures to 0.2 parts per million ozone while exercising intermittently. In the 73.5 h before exposure, subjects were pretreated with either 1,250 mg azithromycin or placebo. Sputum induction conducted 74 h pre- and 18 h post-exposure was used to measure total cells, per cent neutrophils, IL-6, and IL-8. There were significant (p<0.05) pre- to post-exposure increases in total cells, neutrophils, IL-6 and IL-8 in both the azithromycin and placebo arms. However, no significant differences were found between azithromycin and placebo conditions in the post- minus pre-exposure value for these variables. The results suggest that in healthy subjects, in the design used, azithromycin, in usual clinical doses, does not have anti-inflammatory effects on human airways as indicated in the measured variables.

  13. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  14. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  15. Total ozone, ozone vertical distributions, and stratospheric temperatures at South Pole, Antarctica, in 1986 and 1987

    NASA Technical Reports Server (NTRS)

    Komhyr, W. D.; Grass, R. D.; Reitelbach, P. J.; Franchois, P. R.; Kuester, S. E.

    1988-01-01

    Seventy-six electrochemical cell (ECC) ozonesondes were flown at South Pole, Antarctica, during 1987 in a continuing program to document year-round changes in Antarctica ozone that are dynamically and photochemically induced. Dobson spectrophotometer total ozone observations were also made. For the twilight months of March and September when Dobson instrument observations cannot be made at South Pole, total ozone amounts were deduced from the ECC ozonesonde soundings. ECC sonde total ozone data obtained during the polar night (April to August), supplemented the sparse total ozone data obtained from Dobson instrument moon observations. Similar ozone profile and total ozone observations were made at South Pole in 1986.

  16. Ozone therapy could attenuate tubulointerstitial injury in adenine-induced CKD rats by mediating Nrf2 and NF-κB

    PubMed Central

    Yu, Gang; Liu, Xiuheng; Chen, Zhiyuan; Chen, Hui; Wang, Lei; Wang, Zhishun; Qiu, Tao; Weng, Xiaodong

    2016-01-01

    Objective(s): This study aims to determine the effects of ozone therapy on restoring impaired Nrf2 activation to ameliorate chronic tubulointerstitial injury in rats with adenine-induced CKD. Materials and Methods: Sprague–Dawley rats were fed with 0.75% adenine-containing diet to induce CKD and chronic tubulointerstitial injury. Ozone therapy was administered by rectal insufflation. After 4 weeks, serum and kidney samples were collected and analyzed. Renal function and systemic electrolyte level were detected. Pathological changes in kidney were assessed by hematoxylin–eosin staining and Masson trichrome staining. Nrf2 activation was detected by immunohistochemistry and Western blot analyses. The levels of SOD, CAT, GSH, PCO, and MDA were detected in the kidney. Immunohistochemistry, Western blot, and real-time PCR analyses were performed to evaluate the activation of the nuclear factor kappa B (NF-κB) P65 pathway and inflammation infiltration in the tubulointerstitium of the rats. Results: Ozone therapy improved severe renal insufficiency and tubulointerstitial morphology injury as well as restored Nrf2 activation and inhibited the NF-κB pathway in rats with adenine-induced CKD. Ozone therapy also up-regulated anti-oxidation enzymes (SOD, CAT, and GSH) and down-regulated oxidation products (PCO and MDA), as well as inflammatory cytokines (IL-1β, IL-6, TNF-α, and ICAM-1) in the kidney. Conclusion: These findings indicated that ozone therapy could attenuate tubulointerstitial injury in rats with adenine-induced CKD by mediating Nrf2 and NF-κB. PMID:27872711

  17. Interannual Variability of the Antarctic Ozone Hole in a GCM. Part II: A Comparison of Unforced and QBO-Induced Variability.

    NASA Astrophysics Data System (ADS)

    Shindell, Drew T.; Rind, David; Balachandran, Nambath

    1999-06-01

    Simulations were performed with the Goddard Institute for Space Studies GCM including a prescribed quasi-biennial oscillation (QBO), applied at a constant maximum value, and a physically realistic parameterization of the heterogeneous chemistry responsible for severe polar ozone loss. While the QBO is primarily a stratospheric phenomenon, in this model the QBO modulates the amount and propagation of planetary wave energy in the troposphere as well as in the stratosphere. Dynamical activity is greater in the easterly than in the unforced case, while westerly years are dynamically more quiescent. By altering zonal winds and potential vorticity, the QBO forcing changes the refraction of planetary waves beginning in midwinter, causing the lower-stratospheric zonal average temperatures at Southern Hemisphere high latitudes to be 3-5 K warmer in the easterly phase than in the westerly during the late winter and early spring. Ozone loss varies nonlinearly with temperature, due to the sharp threshold for formation of heterogeneous chemistry surfaces, so that the mean daily total mass of ozone depleted in this region during September was 8.7 × 1010 kg in the QBO easterly maximum, as compared with 12.0 × 1010 kg in the westerly maximum and 10.3 × 1010 kg in the unforced case. Through this mechanism, the midwinter divergence of the Eliassen-Palm flux is well correlated with the subsequent springtime total ozone loss (R2 = 0.6). The chemical ozone loss differences are much larger than QBO-induced transport differences in our model.Inclusion of the QBO forcing also increased the maximum variability in total ozone loss from the 20% value found in the unforced runs to 50%. These large variations in ozone depletion are very similar in size to the largest observed variations in the severity of the ozone hole. The results suggest that both random variability and periodic QBO forcing are important components, perhaps explaining some of the difficulties encountered in previous

  18. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  19. Osmotically induced reversible transitions in lipid-DNA mesophases.

    PubMed

    Danino, Dganit; Kesselman, Ellina; Saper, Gadiel; Petrache, Horia I; Harries, Daniel

    2009-04-08

    We follow the effect of osmotic pressure on isoelectric complexes that self-assemble from mixtures of DNA and mixed neutral and cationic lipids. Using small angle x-ray diffraction and freeze-fracture cryo-electron microscopy, we find that lamellar complexes known to form in aqueous solutions can reversibly transition to hexagonal mesophases under high enough osmotic stress exerted by adding a neutral polymer. Using molecular spacings derived from x-ray diffraction, we estimate the reversible osmotic pressure-volume (Pi-V) work needed to induce this transition. We find that the transition free energy is comparable to the work required to elastically bend lipid layers around DNA. Consistent with this, the required work is significantly lowered by an addition of hexanol, which is known to soften lipid bilayers. Our findings not only help to resolve the free-energy contributions associated with lipid-DNA complex formation, but they also demonstrate the importance that osmotic stress can have to the macromolecular phase geometry in realistic biological environments.

  20. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-replication

    DTIC Science & Technology

    2007-04-01

    replication in yeast cells. We have demonstrated that re-replication induces a rapid and significant decrease in cell viability and a cellular DNA damage...Ura 50 ng/ml factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and resuspended in 50 ng/ml 46-diamidino-2-phenylindole... decrease plating efficiency (Figure 1B). Both the pGAL1-ntcdc6 rerep- licating strain and pGAL1 control strain grew with similar efficiency when

  1. RNase H enables efficient repair of R-loop induced DNA damage

    PubMed Central

    Amon, Jeremy D; Koshland, Douglas

    2016-01-01

    R-loops, three-stranded structures that form when transcripts hybridize to chromosomal DNA, are potent agents of genome instability. This instability has been explained by the ability of R-loops to induce DNA damage. Here, we show that persistent R-loops also compromise DNA repair. Depleting endogenous RNase H activity impairs R-loop removal in Saccharomyces cerevisiae, causing DNA damage that occurs preferentially in the repetitive ribosomal DNA locus (rDNA). We analyzed the repair kinetics of this damage and identified mutants that modulate repair. We present a model that the persistence of R-loops at sites of DNA damage induces repair by break-induced replication (BIR). This R-loop induced BIR is particularly susceptible to the formation of lethal repair intermediates at the rDNA because of a barrier imposed by RNA polymerase I. DOI: http://dx.doi.org/10.7554/eLife.20533.001 PMID:27938663

  2. Possible Ozone-Induced Long-Term Changes in Planetary Wave Activity in Late Winter.

    NASA Astrophysics Data System (ADS)

    Hu, Yongyun; Kit Tung, Ka

    2003-09-01

    Using NCEP-NCAR reanalysis data, decadal trends in planetary wave activity in Northern Hemisphere high latitudes (50°-90°N) in late winter and early spring (January-February-March) were studied. Results show that wave activity in both the stratosphere and the troposphere has been largely reduced and exhibits statistically significant downward trends since the 1980s. In the stratosphere, the wave activity is decreased by about 30%, which is mainly due to less Eliassen-Palm (E-P) flux from the troposphere into the stratosphere. In the troposphere, the vertical E-P flux is reduced by about 30%, while equatorward horizontal E-P flux is increased by 130%. This suggests a significant refraction of planetary waves away from the high latitudes. The significant negative trends in wave activity in late winter are in contrast to the authors' previous finding of no significant changes in planetary wave activity in early winter.The timing of the significant decline in wave activity, which starts from the early 1980s and exists only in late winter and springtime, suggests that such a decrease of wave activity is possibly a result of stratospheric ozone depletion in the Arctic. Therefore, a mechanism is proposed whereby Arctic ozone depletion leads to an enhanced meridional temperature gradient near the subpolar stratosphere, strengthening westerly winds. The strengthened winds refract planetary waves toward low latitudes and cause the reduction in wave activity in high latitudes.Decreasing vertical E-P fluxes are found to extend to near the surface. At 850 mb, vertical E-P fluxes have been reduced by about 10% since 1979. Such a reduction in wave activity might be responsible for the observed late-winter and springtime warming over Northern Hemisphere high-latitude continents during the last two decades.

  3. Kaempferol induces DNA damage and inhibits DNA repair associated protein expressions in human promyelocytic leukemia HL-60 cells.

    PubMed

    Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung

    2015-01-01

    Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60

  4. Oxidative stress induces DNA damage and inhibits the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene in human peripheral mononuclear leukocytes.

    PubMed

    Pero, R W; Anderson, M W; Doyle, G A; Anna, C H; Romagna, F; Markowitz, M; Bryngelsson, C

    1990-08-01

    Human mononuclear leukocytes were exposed to prooxidants such as H2O2, phorbol-12-myristate-13-acetate, and 4-nitroquinoline-N-oxide, and the effects on induction of DNA damage and repair were evaluated. ADP ribosylation was activated by prooxidant exposure and the response was bimodal with peaks of activation occurring at about 30 min and 4-5 h. Other evidence for prooxidant-induced DNA damage was provided by nucleoid sedimentation assays. Unscheduled DNA synthesis (UDS) was only slightly induced by prooxidant exposure which suggested that either the DNA lesions were repaired by a short patch mechanism involving little UDS, or the repair process was inhibited by prooxidant exposures, or some combination of both. This point was clarified by the fact that the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene, an inducer of large patch DNA repair, was inhibited in a dose-dependent manner by exposure to H2O2 and the inhibition was dependent on ADP ribosylation. In contrast, the repair of DNA strand breaks induced by prooxidant exposures as identified above were complete within about 8 h and the repair was independent of ADP ribosylation. Both ADP ribosylation and N-acetoxy-2-acetylaminofluorene-induced UDS were shown to be up- and down-regulated by the redox state of human mononuclear leukocytes indicating a unique mechanism of cellular control over DNA repair.

  5. Histone Acetylation Induced Transformation of B-DNA to Z-DNA in Cells Probed through FT-IR Spectroscopy.

    PubMed

    Zhang, Fengqiu; Huang, Qing; Yan, Jingwen; Chen, Zhu

    2016-04-19

    A nucleosome is made up of DNA and histones, and acetylation of histones perturbs the interaction of DNA and histones and thus affects the chromatin conformation and function. However, whether or how acetylation induces DNA conformation changes is still elusive. In this work, we applied FT-IR spectroscopy to monitor the DNA signals in cells as the histone acetylation was regulated by trichostatin A (TSA), a reversible inhibitor to histone deacetylases (HDACs). Our results unambiguously demonstrate the significant transformation of B-DNA to Z-DNA upon histone acetylation in the TSA treated HeLa cells. This is the first report providing the explicit experimental evidence for such a B-Z transformation of DNA in the epigenetic states of cells.

  6. PYR/RCAR receptors contribute to ozone-, reduced air humidity-, darkness-, and CO2-induced stomatal regulation.

    PubMed

    Merilo, Ebe; Laanemets, Kristiina; Hu, Honghong; Xue, Shaowu; Jakobson, Liina; Tulva, Ingmar; Gonzalez-Guzman, Miguel; Rodriguez, Pedro L; Schroeder, Julian I; Broschè, Mikael; Kollist, Hannes

    2013-07-01

    Rapid stomatal closure induced by changes in the environment, such as elevation of CO2, reduction of air humidity, darkness, and pulses of the air pollutant ozone (O3), involves the SLOW ANION CHANNEL1 (SLAC1). SLAC1 is activated by OPEN STOMATA1 (OST1) and Ca(2+)-dependent protein kinases. OST1 activation is controlled through abscisic acid (ABA)-induced inhibition of type 2 protein phosphatases (PP2C) by PYRABACTIN RESISTANCE/REGULATORY COMPONENTS OF ABA RECEPTOR (PYR/RCAR) receptor proteins. To address the role of signaling through PYR/RCARs for whole-plant steady-state stomatal conductance and stomatal closure induced by environmental factors, we used a set of Arabidopsis (Arabidopsis thaliana) mutants defective in ABA metabolism/signaling. The stomatal conductance values varied severalfold among the studied mutants, indicating that basal ABA signaling through PYR/RCAR receptors plays a fundamental role in controlling whole-plant water loss through stomata. PYR/RCAR-dependent inhibition of PP2Cs was clearly required for rapid stomatal regulation in response to darkness, reduced air humidity, and O3. Furthermore, PYR/RCAR proteins seem to function in a dose-dependent manner, and there is a functional diversity among them. Although a rapid stomatal response to elevated CO2 was evident in all but slac1 and ost1 mutants, the bicarbonate-induced activation of S-type anion channels was reduced in the dominant active PP2C mutants abi1-1 and abi2-1. Further experiments with a wider range of CO2 concentrations and analyses of stomatal response kinetics suggested that the ABA signalosome partially affects the CO2-induced stomatal response. Thus, we show that PYR/RCAR receptors play an important role for the whole-plant stomatal adjustments and responses to low humidity, darkness, and O3 and are involved in responses to elevated CO2.

  7. Effect of homologous tumor DNA on the evolution of SV40-induced hamster sarcoma.

    PubMed

    Nastac, E; Stoian, M; Iosipenco, M; Suru, M; Hozoc, M; Repanovici, R

    1985-01-01

    DNA extracted from SV40-induced hamster sarcoma (SV40--HS DNA) increased the survival length of animals carrying the homologous tumor and--in some cases--inhibited the development of the tumor. The efficacy of the preparation was directly proportional to the number of administrations; it did not necessarily depend on the amount of SV40--HS DNA per dose. SV40 DNA had no favourable effect on the evolution of the SV40-induced tumor, which suggests that viral DNA does not represent the active component of the SV40--HS DNA preparations. Some possible mechanisms of the effect of homologous tumor preparations are discussed.

  8. A kinetic analysis of strand breaks on large DNA induced by cigarette smoke extract

    NASA Astrophysics Data System (ADS)

    Kurita, Hirofumi; Takata, Tatsuya; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira

    2010-06-01

    We report a kinetic analysis of strand breakages on large DNA molecules induced by cigarette smoke extract (CSE), an extract of soluble cigarette smoke components. Previously, this DNA damage was analyzed by agarose gel electrophoresis, whereas we used fluorescence to kinetically analyze damage to individual DNA molecules. CSE caused a marked change in length of DNA molecules. The rate of CSE-induced double-strand breakage on large random-coiled DNA molecules was determined using a simple theoretical model, allowing the facile estimation of the rate of double-strand breaks on large DNA molecules.

  9. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi

    2015-01-01

    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  10. DNA and redox state induced conformational changes in the DNA-binding domain of the Myb oncoprotein.

    PubMed Central

    Myrset, A H; Bostad, A; Jamin, N; Lirsac, P N; Toma, F; Gabrielsen, O S

    1993-01-01

    The DNA-binding domain of the oncoprotein Myb comprises three imperfect repeats, R1, R2 and R3. Only R2 and R3 are required for sequence-specific DNA-binding. Both are assumed to contain helix-turn-helix (HTH)-related motifs, but multidimensional heteronuclear NMR spectroscopy revealed a disordered structure in R2 where the second HTH helix was predicted [Jamin et al. (1993) Eur. J. Biochem., 216, 147-154]. We propose that the disordered region folds into a 'recognition' helix and generates a full HTH-related motif upon binding to DNA. This would move Cys43 into the hydrophobic core of R2. We observed that Cys43 was accessible to N-ethylmaleimide alkylation in the free protein, but inaccessible in the DNA complex. Mutant proteins with charged (C43D) or polar (C43S) side chains in position 43 bound DNA with reduced affinity, while hydrophobic replacements (C43A, C43V and C43I) gave unaltered or improved DNA-binding. Specific DNA-binding enhanced protease resistance dramatically. Fluorescence emission spectra and quenching experiments supported a DNA-induced conformational change. Moreover, reversible oxidation of Cys43 had an effect similar to the inactivating C43D mutation. The highly oxidizable Cys43 could function as a molecular sensor for a redox regulatory mechanism turning specific DNA-binding on or off by controlling the DNA-induced conformational change in R2. Images PMID:8223472

  11. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.

    PubMed

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury.

  12. Repair of oxidatively induced DNA damage by DNA glycosylases: Mechanisms of action, substrate specificities and excision kinetics.

    PubMed

    Dizdaroglu, Miral; Coskun, Erdem; Jaruga, Pawel

    Endogenous and exogenous reactive species cause oxidatively induced DNA damage in living organisms by a variety of mechanisms. As a result, a plethora of mutagenic and/or cytotoxic products are formed in cellular DNA. This type of DNA damage is repaired by base excision repair, although nucleotide excision repair also plays a limited role. DNA glycosylases remove modified DNA bases from DNA by hydrolyzing the glycosidic bond leaving behind an apurinic/apyrimidinic (AP) site. Some of them also possess an accompanying AP-lyase activity that cleaves the sugar-phosphate chain of DNA. Since the first discovery of a DNA glycosylase, many studies have elucidated the mechanisms of action, substrate specificities and excision kinetics of these enzymes present in all living organisms. For this purpose, most studies used single- or double-stranded oligodeoxynucleotides with a single DNA lesion embedded at a defined position. High-molecular weight DNA with multiple base lesions has been used in other studies with the advantage of the simultaneous investigation of many DNA base lesions as substrates. Differences between the substrate specificities and excision kinetics of DNA glycosylases have been found when these two different substrates were used. Some DNA glycosylases possess varying substrate specificities for either purine-derived lesions or pyrimidine-derived lesions, whereas others exhibit cross-activity for both types of lesions. Laboratory animals with knockouts of the genes of DNA glycosylases have also been used to provide unequivocal evidence for the substrates, which had previously been found in in vitro studies, to be the actual substrates in vivo as well. On the basis of the knowledge gained from the past studies, efforts are being made to discover small molecule inhibitors of DNA glycosylases that may be used as potential drugs in cancer therapy.

  13. Delayed climate change in the Southern Hemisphere induced by stratospheric ozone recovery, as projected by the CMIP5 models (Invited)

    NASA Astrophysics Data System (ADS)

    Polvani, L. M.; Barnes, E. A.

    2013-12-01

    Stratospheric ozone is expected to recover in the second half of this century, due to the regulation of ozone depleting substances by the Montreal Protocol. Targeted modeling studies have suggested that the climate response to ozone recovery will greatly oppose the climate response to increasing greenhouse-gases (GHG); owever, the extent of this cancellation remains unclear, as few such studies are available. Here, we analyze the much larger set of models participating in the Coupled Model Intercomparison Project, phase 5 (CMIP5), all of which include stratospheric ozone depletion and recovery. We show that the closing of the ozone hole will cause a delay in summer-time (DJF) Southern Hemisphere climate change, between now and mid-century. Specifically, we find that the position of the jet stream, the width of the subtropical dry-zones, the seasonality of surface temperatures, and sea ice concentrations all exhibit significantly reduced summer-time trends over the first half of the 21st Century as a consequence of ozone recovery. Beyond mid-century, forcing from GHG emissions begins to dominate the climate response. We also compare the relative influences of future GHG emissions and historic ozone depletion, and find that the simulated DJF tropospheric circulation changes in the Southern Hemisphere between 1965-2005 -- driven primarily by ozone depletion -- are larger than the projected changes in any future scenario over the entire 21st Century.

  14. Perchlorate content of plant foliage reflects a wide range of species-dependent accumulation but not ozone-induced biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Perchlorate interferes with uptake of iodide in humans. Emission inventories do not explain observed distributions. Ozone is implicated in the natural origin of perchlorate, and has increased since pre-industrial times. Ozone produces perchlorate in vitro from chloride, and plant tissues contain chl...

  15. The glutathione-S-transferase Mu 1 null genotype modulates ozone-induced airway inflammation in humans*

    EPA Science Inventory

    Background: The Glutathione-S-Transferase Mu 1 null genotype has been reported to be a risk factor for acute respiratory disease associated with increases in ambient air ozone. Ozone is known to cause an immediate decrease in lung function and increased airway inflammation. Howev...

  16. DNA fragment sizing and sorting by laser-induced fluorescence

    DOEpatents

    Hammond, Mark L.; Jett, James H.; Keller, Richard A.; Marrone, Babetta L.; Martin, John C.

    1996-01-01

    A method is provided for sizing DNA fragments using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA piece or the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is linearly related to the fragment length. The distribution of DNA fragment sizes forms a characterization of the DNA piece for use in forensic and research applications.

  17. Corticosteroid administration modifies ozone-induced increases in sheep airway blood flow

    SciTech Connect

    Gunther, R.A.; Yousef, M.A.; Schelegle, E.S.; Cross, C.E. )

    1992-09-01

    Recently, we have shown that exposure of intubated conscious sheep to 3 to 4 ppm ozone (O3) for 3 h increases bronchial blood flow (Qbr). The purpose of the present study was to assess the potential role of corticosteroids in modulating this increase. Six nasally intubated sheep were exposed to filtered room air, 3.5 ppm O3 on two separate occasions, and 3.5 ppm O3 plus methyl-prednisone, for 3 h. Qbr was measured using a chronically implanted 20 MHz pulsed Doppler flow probe. Qbr, mean aortic pressure, cardiac output, pulmonary artery pressure, arterial blood gases, and core temperature were monitored. After 3 h of 3.5 ppm O3, Qbr increased from 3.2 +/- 0.5 (mean +/- SEM) to 8.5 +/- 1.6 KHz, whereas bronchial vascular resistance (BVR) decreased from the baseline value of 43.6 +/- 8.0 to 15.0 +/- 3 mm Hg/KHz. With corticosteroids, baseline Qbr was 3.2 +/- 0.6 and BVR was 44.2 +/- 9.7; after 3 h of 3.5 ppm O3, Qbr was 3.3 +/- 0.5 KHz and BVR was 39.0 +/- 8.0 mm Hg/KHz. The two 3.5-ppm O3 exposures without corticosteroids were impressively reproducible. Except for Qbr and BVR, no other measured cardiovascular parameters were affected by O3. The results indicate that corticosteroids are capable of interfering with mediator, neurohumoral, or inflammatory cell mechanisms responsible for vasodilation of the airway microcirculation after O3 exposure, but do not specifically address the specific processes whereby this attenuation occurs.

  18. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  19. Ozone enhances diesel exhaust particles (DEP)-induced interleukin-8 (IL-8) gene expression in human airway epithelial cells through activation of nuclear factors- kappaB (NF-kappaB) and IL-6 (NF-IL6).

    PubMed

    Kafoury, Ramzi M; Kelley, James

    2005-12-01

    Ozone, a highly reactive oxidant gas is a major component of photochemical smog. As an inhaled toxicant, ozone induces its adverse effects mainly on the lung. Inhalation of particulate matter has been reported to cause airway inflammation in humans and animals. Furthermore, epidemiological evidence has indicated that exposure to particulate matter (PM[2.5-10]), including diesel exhaust particles (DEP) has been correlated with increased acute and chronic respiratory morbidity and exacerbation of asthma. Previously, exposure to ozone or particulate matter and their effect on the lung have been addressed as separate environmental problems. Ozone and particulate matter may be chemically coupled in the ambient air. In the present study we determined whether ozone exposure enhances DEP effect on interleukin-8 (IL-8) gene expression in human airway epithelial cells. We report that ozone exposure (0.5 ppm x 1 hr) significantly increased DEP-induced IL-8 gene expression in A549 cells (117 +/- 19 pg/ml, n = 6, p < 0.05) as compared to cultures treated with DEP (100 microg/ml x 4 hr) alone (31 +/- 3 pg/ml, n = 6), or cultures exposed to purified air (24 +/- 6 pg/ml, n = 6). The increased DEP-induced IL-8 gene expression following ozone exposure was attributed to ozone-induced increase in the activity of the transcription factors NF-kappaB and NF-IL6. The results of the present study indicate that ozone exposure enhances the toxicity of DEP in human airway epithelial cells by augmenting IL-8 gene expression, a potent chemoattractant of neutrophils in the lung.

  20. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.

    1984-01-01

    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  1. Effect of intercellular contact on DNA conformation, radiation-induced DNA damage, and mutation in Chinese hamster V79 cells

    SciTech Connect

    Olive, P.L.; Durand, R.E.

    1985-01-01

    Chinese hamster V79 cells, when grown as small spheroids in suspension culture, are more resistant to killing by ionizing radiation than when grown as monolayers. The authors have attempted to determine whether this enhanced survival following irradiation is reflected in DNA damage and repair at the structural level (by measuring alkali-induced DNA unwinding rates from strand breaks) and at the functional level (by measuring resistance to forward mutation at the HGPRT locus). For a given dose of radiation, the unwinding of DNA in high salt/weak alkali was less complete for spheroid DNA than for monolayer DNA, and the rate of repair of radiation damage was faster in spheroid DNA. These differential responses were lost 8 hr after separation of spheroids into single cells, coinciding with loss of radioresistance measured by clonogenicity. In addition, spheroid cells showed fewer numbers of induced mutants per Gray, although, for a given level of survival, the mutation frequency for monolayers and spheroids was identical. These results suggest that conformational changes in DNA resulting from cell growth as spheroids might enhance repair of radiation-induced lesions.

  2. DNA Self-Assembling Nanostructures Induced by Trivalent Ions and Polycations

    NASA Astrophysics Data System (ADS)

    Kasyanenko, Nina; Afanasieva, Daria

    The purpose of this work is to compare DNA condensation induced by small multivalent ions and polycations. DNA complexes with trivalent ions Fe3+, La3+, [Co(NH3)6]3+, spermidine and cationic polymers in a solution were investigated. The influence of cations on the volume, persistent length, and secondary structure of DNA was studied. A comparison of DNA packaging induced by trivalent ions and polycations was made. DNA complexes with trivalent metal ions and polycations were characterized by means of low gradient viscometry, dynamic light scattering, circular dichroism, UV spectrometry, flow birefringence, and atomic force microscopy.

  3. Divalent counterion-induced condensation of triple-strand DNA.

    PubMed

    Qiu, Xiangyun; Parsegian, V Adrian; Rau, Donald C

    2010-12-14

    Understanding and manipulation of the forces assembling DNA/RNA helices have broad implications for biology, medicine, and physics. One subject of significance is the attractive force between dsDNA mediated by polycations of valence ≥ 3. Despite extensive studies, the physical origin of the "like-charge attraction" remains unsettled among competing theories. Here we show that triple-strand DNA (tsDNA), a more highly charged helix than dsDNA, is precipitated by alkaline-earth divalent cations that are unable to condense dsDNA. We further show that our observation is general by examining several cations (Mg(2+), Ba(2+), and Ca(2+)) and two distinct tsDNA constructs. Cation-condensed tsDNA forms ordered hexagonal arrays that redissolve upon adding monovalent salts. Forces between tsDNA helices, measured by osmotic stress, follow the form of hydration forces observed with condensed dsDNA. Probing a well-defined system of point-like cations and tsDNAs with more evenly spaced helical charges, the counterintuitive observation that the more highly charged tsDNA (vs. dsDNA) is condensed by cations of lower valence provides new insights into theories of polyelectrolytes and the biological and pathological roles of tsDNA. Cations and tsDNAs also hold promise as a model system for future studies of DNA-DNA interactions and electrostatic interactions in general.

  4. HGF-induced DNA synthesis in hepatocytes is suppressed by p38.

    PubMed

    Aasrum, Monica; Brusevold, Ingvild J; Christoffersen, Thoralf; Thoresen, G Hege

    2016-12-01

    Previous studies in rat hepatocytes have shown that the MEK/ERK, PI3K/Akt and p38 pathways are all involved in the activation of DNA synthesis by EGF and that sustained activation of MEK/ERK is required. Here, we show that although HGF stimulated DNA synthesis and activated signaling in the same manner as EGF, the contribution of the signaling pathways to the induction of DNA synthesis differed. While HGF-induced DNA synthesis was dependent on MEK/ERK, with no significant contribution from PI3K/Akt, p38 suppressed HGF-induced DNA synthesis. The p38 inhibitor SB203580 increased HGF-induced DNA synthesis and enhanced the phosphorylation of ERK. In contrast, SB203580 decreased EGF-induced ERK phosphorylation. This suggests that p38 has distinct effects on DNA synthesis induced by EGF and HGF. Due to differential regulation of signaling through the MEK/ERK pathway, p38 acts as an enhancer of EGF-induced DNA synthesis and as a suppressor of HGF-induced DNA synthesis.

  5. Ozone-induced kiwifruit ripening delay is mediated by ethylene biosynthesis inhibition and cell wall dismantling regulation.

    PubMed

    Minas, Ioannis S; Vicente, Ariel R; Dhanapal, Arun Prabhu; Manganaris, George A; Goulas, Vlasios; Vasilakakis, Miltiadis; Crisosto, Carlos H; Molassiotis, Athanassios

    2014-12-01

    Ozone treatments are used to preserve quality during cold storage of commercially important fruits due to its ethylene oxidizing capacity and its antimicrobial attributes. To address whether or not ozone also modulates ripening by directly affecting fruit physiology, kiwifruit (Actinidia deliciosa cv. 'Hayward') were stored in very low ethylene atmosphere at 0°C (95% RH) in air (control) or in the presence of ozone (0.3μLL(-1)) for 2 or 4 months and subsequently ripened at 20°C (90% RH) for up to 8d. Ozone-treated kiwifruit showed a significant delay of ripening during maintenance at 20°C, accompanied by a marked decrease in ethylene biosynthesis due to inhibited AdACS1 and AdACO1 expression and reduced ACC synthase (ACS) and ACC oxidase (ACO) enzyme activity. Furthermore, ozone-treated fruit exhibited a marked reduction in flesh softening and cell wall disassembly. This effect was associated with reduced cell wall swelling and pectin and neutral sugar solubilization and was correlated with the inhibition of cell wall degrading enzymes activity, such as polygalacturonase (PG) and endo-1,4-β-glucanase/1,4-β-glucosidase (EGase/glu). Conclusively, the present study indicated that ozone may exert major residual effects in fruit ripening physiology and suggested that ethylene biosynthesis and cell walls turnover are specifically targeted by ozone.

  6. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    PubMed

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity.

  7. Regulation of ozone-induced lung inflammation and injury by the β-galactoside-binding lectin galectin-3.

    PubMed

    Sunil, Vasanthi R; Francis, Mary; Vayas, Kinal N; Cervelli, Jessica A; Choi, Hyejeong; Laskin, Jeffrey D; Laskin, Debra L

    2015-04-15

    Macrophages play a dual role in ozone toxicity, contributing to both pro- and anti-inflammatory processes. Galectin-3 (Gal-3) is a lectin known to regulate macrophage activity. Herein, we analyzed the role of Gal-3 in the response of lung macrophages to ozone. Bronchoalveolar lavage (BAL) and lung tissue were collected 24-72h after exposure (3h) of WT and Gal-3(-/-) mice to air or 0.8ppm ozone. In WT mice, ozone inhalation resulted in increased numbers of proinflammatory (Gal-3(+), iNOS(+)) and anti-inflammatory (MR-1(+)) macrophages in the lungs. While accumulation of iNOS(+) macrophages was attenuated in Gal-3(-/-) mice, increased numbers of enlarged MR-1(+) macrophages were noted. This correlated with increased numbers of macrophages in BAL. Flow cytometric analysis showed that these cells were CD11b(+) and consisted mainly (>97%) of mature (F4/80(+)CD11c(+)) proinflammatory (Ly6GLy6C(hi)) and anti-inflammatory (Ly6GLy6C(lo)) macrophages. Increases in both macrophage subpopulations were observed following ozone inhalation. Loss of Gal-3 resulted in a decrease in Ly6C(hi) macrophages, with no effect on Ly6C(lo) macrophages. CD11b(+)Ly6G(+)Ly6C(+) granulocytic (G) and monocytic (M) myeloid derived suppressor cells (MDSC) were also identified in the lung after ozone. In Gal-3(-/-) mice, the response of G-MDSC to ozone was attenuated, while the response of M-MDSC was heightened. Changes in inflammatory cell populations in the lung of ozone treated Gal-3(-/-) mice were correlated with reduced tissue injury as measured by cytochrome b5 expression. These data demonstrate that Gal-3 plays a role in promoting proinflammatory macrophage accumulation and toxicity in the lung following ozone exposure.

  8. Estrogens protect against hydrogen peroxide and arachidonic acid induced DNA damage.

    PubMed

    Tang, M; Subbiah, M T

    1996-01-19

    The ability of estrogens to protect against DNA damage induced by either hydrogen peroxide or arachidonic acid alone or in combination with Cu2+ was investigated. DNA strand breaks were determined by conversion of double stranded supercoiled OX-174 RFI DNA to double stranded open circular DNA and linear single stranded DNA. Estradiol-17 beta significantly decreased the formation of single and double strand breaks in DNA induced by H2O2 alone or with Cu2+. Equilin (an equine estrogen) was more effective than estradiol-17 beta at the doses tested. Arachidonic acid in the presence of Cu2+ caused the formation of high levels of linear DNA which was protected by estrogen with equilen being more effective. These studies suggest that estrogens through this protective effect on DNA damage might contribute to cardioprotection.

  9. Involvement of DNA-PK and ATM in radiation- and heat-induced DNA damage recognition and apoptotic cell death.

    PubMed

    Tomita, Masanori

    2010-01-01

    Exposure to ionizing radiation and hyperthermia results in important biological consequences, e.g. cell death, chromosomal aberrations, mutations, and DNA strand breaks. There is good evidence that the nucleus, specifically cellular DNA, is the principal target for radiation-induced cell lethality. DNA double-strand breaks (DSBs) are considered to be the most serious type of DNA damage induced by ionizing radiation. On the other hand, verifiable mechanisms which can lead to heat-induced cell death are damage to the plasma membrane and/or inactivation of heat-labile proteins caused by protein denaturation and subsequent aggregation. Recently, several reports have suggested that DSBs can be induced after hyperthermia because heat-induced phosphorylated histone H2AX (γ-H2AX) foci formation can be observed in several mammalian cell lines. In mammalian cells, DSBs are repaired primarily through two distinct and complementary mechanisms: non-homologous end joining (NHEJ), and homologous recombination (HR) or homology-directed repair (HDR). DNA-dependent protein kinase (DNA-PK) and ataxia-telangiectasia mutated (ATM) are key players in the initiation of DSB repair and phosphorylate and/or activate many substrates, including themselves. These phosphorylated substrates have important roles in the functioning of cell cycle checkpoints and in cell death, as well as in DSB repair. Apoptotic cell death is a crucial cell suicide mechanism during development and in the defense of homeostasis. If DSBs are unrepaired or misrepaired, apoptosis is a very important system which can protect an organism against carcinogenesis. This paper reviews recently obtained results and current topics concerning the role of DNA-PK and ATM in heat- or radiation-induced apoptotic cell death.

  10. Divalent counterion-induced condensation of triple-strand DNA

    PubMed Central

    Qiu, Xiangyun; Parsegian, V. Adrian; Rau, Donald C.

    2010-01-01

    Understanding and manipulation of the forces assembling DNA/RNA helices have broad implications for biology, medicine, and physics. One subject of significance is the attractive force between dsDNA mediated by polycations of valence ≥3. Despite extensive studies, the physical origin of the “like-charge attraction” remains unsettled among competing theories. Here we show that triple-strand DNA (tsDNA), a more highly charged helix than dsDNA, is precipitated by alkaline-earth divalent cations that are unable to condense dsDNA. We further show that our observation is general by examining several cations (Mg2+, Ba2+, and Ca2+) and two distinct tsDNA constructs. Cation-condensed tsDNA forms ordered hexagonal arrays that redissolve upon adding monovalent salts. Forces between tsDNA helices, measured by osmotic stress, follow the form of hydration forces observed with condensed dsDNA. Probing a well-defined system of point-like cations and tsDNAs with more evenly spaced helical charges, the counterintuitive observation that the more highly charged tsDNA (vs. dsDNA) is condensed by cations of lower valence provides new insights into theories of polyelectrolytes and the biological and pathological roles of tsDNA. Cations and tsDNAs also hold promise as a model system for future studies of DNA–DNA interactions and electrostatic interactions in general. PMID:21098260

  11. Ideas and perspectives: Southwestern tropical Atlantic coral growth response to atmospheric circulation changes induced by ozone depletion in Antarctica

    NASA Astrophysics Data System (ADS)

    Evangelista, Heitor; Wainer, Ilana; Sifeddine, Abdelfettah; Corrège, Thierry; Cordeiro, Renato C.; Lamounier, Saulo; Godiva, Daniely; Shen, Chuan-Chou; Le Cornec, Florence; Turcq, Bruno; Lazareth, Claire E.; Hu, Ching-Yi

    2016-04-01

    Recent Southern Hemisphere (SH) atmospheric circulation, predominantly driven by stratospheric ozone depletion over Antarctica, has caused changes in climate across the extratropics. Here, we present evidence that the Brazilian coast (southwestern Atlantic) may have been impacted from both wind and sea-surface temperature changes derived from this process. Skeleton analysis of massive coral species living in shallow waters off Brazil are very sensitive to air-sea interactions, and seem to record this impact. Growth rates of Brazilian corals show a trend reversal that fits the ozone depletion evolution, confirming that ozone impacts are far reaching and potentially affect coastal ecosystems in tropical environments.

  12. Ozone is mutagenic in Salmonella

    SciTech Connect

    Dillon, D.; Combes, R.; McConville, M.; Zeiger, E. )

    1992-01-01

    Ozone is a highly reactive gas that has been tested for genotoxicity in a number of systems. Induced genetic damage resulting from ozone treatment may not be readily observed because of the high toxicity of the chemical and difficulties in generating and administering controlled concentrations. The mutagenicity of ozone was investigated in Salmonella typhimurium using a plate test protocol designed for reactive vapours and gases. Ozone, at two to three consecutive doses, induced weak, albeit statistically significant, mutagenic responses in tester strain TA102 with and without Aroclor-induced rat liver S9 (lowest effective mean concentration of 0.019 ppm; 35 min total exposure). However, dose-related responses were not always obtained. No mutagenicity was detected in strains TA98, TA100, or TA1535, with or without S9. In strain TA104, ozone induced a weak response only at a single dose with S9; this response was not reproducible. Mutagenicity was dependent on the ozone flow rate and total exposure time, with variations in the optimum dose-time regimen leading to toxicity or complete inactivity. The data show that ozone is a very weak bacterial mutagen and only when tested under narrowly prescribed, subtoxic dosing conditions.

  13. Laser-Induced Heating for DNA Replication in a Microfluidics

    NASA Astrophysics Data System (ADS)

    Hung, Min-Sheng; Chen, Chin-Pin

    In this study, we integrated microfluidics and a laser to develop a microfluidic system that performs target DNA replication. To achieve replication of targeted position of DNA, DNA fibers are stretched and both ends immobilized onto an electrode through dielectrophoresis. During the process, 2 designed primers, as well as DNA polymerase and its substrates, are fed into the microfluidics, and a focused infrared laser is used to irradiate the center of the DNA strand. An on-off switching mechanism is used to create thermal cycling. A polymerase chain reaction is then used to confirm the successfully replicated DNA.

  14. Studying interfacial reactions of cholesterol sulfate in an unsaturated phosphatidylglycerol layer with ozone using field induced droplet ionization mass spectrometry.

    PubMed

    Ko, Jae Yoon; Choi, Sun Mi; Rhee, Young Min; Beauchamp, J L; Kim, Hugh I

    2012-01-01

    Field-induced droplet ionization (FIDI) is a recently developed ionization technique that can transfer ions from the surface of microliter droplets to the gas phase intact. The air-liquid interfacial reactions of cholesterol sulfate (CholSO(4)) in a 1-palmitoyl-2-oleoyl-sn-phosphatidylglycerol (POPG) surfactant layer with ozone (O(3)) are investigated using field-induced droplet ionization mass spectrometry (FIDI-MS). Time-resolved studies of interfacial ozonolysis of CholSO(4) reveal that water plays an important role in forming oxygenated products. An epoxide derivative is observed as a major product of CholSO(4) oxidation in the FIDI-MS spectrum after exposure of the droplet to O(3) for 5 s. The abundance of the epoxide product then decreases with continued O(3) exposure as the finite number of water molecules at the air-liquid interface becomes exhausted. Competitive oxidation of CholSO(4) and POPG is observed when they are present together in a lipid surfactant layer at the air-liquid interface. Competitive reactions of CholSO(4) and POPG with O(3) suggest that CholSO(4) is present with POPG as a well-mixed interfacial layer. Compared with CholSO(4) and POPG alone, the overall ozonolysis rates of both CholSO(4) and POPG are reduced in a mixed layer, suggesting the double bonds of both molecules are shielded by additional hydrocarbons from one another. Molecular dynamics simulations of a monolayer comprising POPG and CholSO(4) correlate well with experimental observations and provide a detailed picture of the interactions between CholSO(4), lipids, and water molecules in the interfacial region.

  15. Syntaxin 5 Overexpression and β-Amyloid 1–42 Accumulation in Endoplasmic Reticulum of Hippocampal Cells in Rat Brain Induced by Ozone Exposure

    PubMed Central

    Hernández-Zimbrón, Luis Fernando

    2016-01-01

    Oxidative stress is a risk factor for Alzheimer's disease and it is currently accepted that oxidative damage precedes the overproduction of A42 peptide. We have reported that ozone causes oxidative stress inducing neurodegeneration in the brain of rats. It is associated with A42 overproduction and intracellular accumulation in hippocampus. Organelles like mitochondria, intracellular membranes, and endoplasmic reticulum have been identified as sites of A42 production and accumulation affecting cellular metabolism. However whether ozone exposure induces overproduction and/or accumulation of A42 in endoplasmic reticulum has not been studied. We evaluated this effect in the endoplasmic reticulum of hippocampal cells of rats exposed chronically to low doses of ozone (0.25 ppm) at 7, 15, 30, 60, and 90 days. The effect of the presence of A42 in endoplasmic reticulum was analyzed evaluating the expression of the chaperone Syntaxin 5. Our results show an accumulation of A42 peptide in this organelle. It was observed by immunofluorescence and by WB in endoplasmic fractions from hippocampal cells of rats at 60 and 90 days of treatment. Significant overexpression of the chaperone Syntaxin 5 at 60 and 90 days of treatment was observed (⁎P < 0.05). These results indicate that the exposure to environmental pollutants could be involved as a risk factor for neurodegenerative processes. PMID:27366738

  16. SRC-mediated EGF Receptor Activation Regulates Ozone-induced Interleukin 8 Expression in Human Bronchial Epithelial Cells

    EPA Science Inventory

    BACKGROUND: Human exposure to ozone (03) results in pulmonary function decrements and airway inflammation. The mechanisms underlying these adverse effects remain unclear. Epidermal growth factor receptor (EGFR) plays an important role in the pathogenesis of lung inflammation. ...

  17. Modification of the biochemical pathways of plants induced by ozone: what are the varied routes to change?

    PubMed

    Heath, Robert L

    2008-10-01

    When plants are observed under a low dose of ozone, some physiological and metabolic shifts occur. Barring extreme injury such as tissue damage or stomata closure, most of these disruptive changes are likely to have been initiated at the level of gene expression. The belief is oxidative products formed in ozone exposed leaves, e.g. hydrogen peroxide, are responsible for much of the biochemical adjustments. The first line of defense is a range of antioxidants, such as ascorbate and glutathione, but if this defense is overwhelmed, subsequent actions occur, similar to systemic acquired resistance or general wounding. Yet there are seemingly unrelated metabolic responses which are also triggered, such as early senescence. We discuss here the current understanding of gene control and signal transduction/control in order to increase our comprehension of how ozone alters the basic metabolism of plants and how plants counteract or cope with ozone.

  18. Fibronectin inhibits cytokine production induced by CpG DNA in macrophages without direct binding to DNA.

    PubMed

    Yoshida, Hiroyuki; Nishikawa, Makiya; Yasuda, Sachiyo; Toyota, Hiroyasu; Kiyota, Tsuyoshi; Takahashi, Yuki; Takakura, Yoshinobu

    2012-10-01

    Fibronectin (FN) is known to have four DNA-binding domains although their physiological significance is unknown. Primary murine peritoneal macrophages have been shown to exhibit markedly lower responsiveness to CpG motif-replete plasmid DNA (pDNA), Toll-like receptor-9 (TLR9) ligand, compared with murine macrophage-like cell lines. The present study was conducted to examine whether FN having DNA-binding domains is involved in this phenomenon. The expression of FN was significantly higher in primary macrophages than in a macrophage-like cell line, RAW264.7, suggesting that abundant FN might suppress the responsiveness in the primary macrophages. However, electrophoretic analysis revealed that FN did not bind to pDNA in the presence of a physiological concentration of divalent cations. Surprisingly, marked tumor necrosis factor - (TNF-)α production from murine macrophages upon CpG DNA stimulation was significantly reduced by exogenously added FN in a concentration-dependent manner but not by BSA, laminin or collagen. FN did not affect apparent pDNA uptake by the cells. Moreover, FN reduced TNF-α production induced by polyI:C (TLR3 ligand), and imiquimod (TLR7 ligand), but not by LPS (TLR4 ligand), or a non-CpG pDNA/cationic liposome complex. The confocal microscopic study showed that pDNA was co-localized with FN in the same intracellular compartment in RAW264.7, suggesting that FN inhibits cytokine signal transduction in the endosomal/lysosomal compartment. Taken together, the results of the present study has revealed, for the first time, a novel effect of FN whereby the glycoprotein modulates cytokine signal transduction via CpG-DNA/TLR9 interaction in macrophages without direct binding to DNA through its putative DNA-binding domains.

  19. Convective forcing of mercury and ozone in the Arctic boundary layer induced by leads in sea ice.

    PubMed

    Moore, Christopher W; Obrist, Daniel; Steffen, Alexandra; Staebler, Ralf M; Douglas, Thomas A; Richter, Andreas; Nghiem, Son V

    2014-02-06

    The ongoing regime shift of Arctic sea ice from perennial to seasonal ice is associated with more dynamic patterns of opening and closing sea-ice leads (large transient channels of open water in the ice), which may affect atmospheric and biogeochemical cycles in the Arctic. Mercury and ozone are rapidly removed from the atmospheric boundary layer during depletion events in the Arctic, caused by destruction of ozone along with oxidation of gaseous elemental mercury (Hg(0)) to oxidized mercury (Hg(II)) in the atmosphere and its subsequent deposition to snow and ice. Ozone depletion events can change the oxidative capacity of the air by affecting atmospheric hydroxyl radical chemistry, whereas atmospheric mercury depletion events can increase the deposition of mercury to the Arctic, some of which can enter ecosystems during snowmelt. Here we present near-surface measurements of atmospheric mercury and ozone from two Arctic field campaigns near Barrow, Alaska. We find that coastal depletion events are directly linked to sea-ice dynamics. A consolidated ice cover facilitates the depletion of Hg(0) and ozone, but these immediately recover to near-background concentrations in the upwind presence of open sea-ice leads. We attribute the rapid recoveries of Hg(0) and ozone to lead-initiated shallow convection in the stable Arctic boundary layer, which mixes Hg(0) and ozone from undepleted air masses aloft. This convective forcing provides additional Hg(0) to the surface layer at a time of active depletion chemistry, where it is subject to renewed oxidation. Future work will need to establish the degree to which large-scale changes in sea-ice dynamics across the Arctic alter ozone chemistry and mercury deposition in fragile Arctic ecosystems.

  20. Ozone Layer Protection

    MedlinePlus

    ... EPA United States Environmental Protection Agency Search Search Ozone Layer Protection Share Facebook Twitter Google+ Pinterest Contact Us Ozone Layer Protection Welcome to EPA's ozone layer protection web ...

  1. DISEASE-SPECIFIC SUSCEPTIBILITY TO ACUTE OZONE-INDUCED INJURY AND INFLAMMATION IN EIGHT RAT STRAINS

    EPA Science Inventory

    Susceptibility to environmental pollutant-induced injuries may be influenced by presence of disease and genetic make-up. To identify disease-specific susceptibility phenotype, we used eight rat strains with or without genetic cardiovascular disease. Male 12-15 wk old Sprague Dawl...

  2. Photosensitized UVA-Induced Cross-Linking between Human DNA Repair and Replication Proteins and DNA Revealed by Proteomic Analysis

    PubMed Central

    2016-01-01

    Long wavelength ultraviolet radiation (UVA, 320–400 nm) interacts with chromophores present in human cells to induce reactive oxygen species (ROS) that damage both DNA and proteins. ROS levels are amplified, and the damaging effects of UVA are exacerbated if the cells are irradiated in the presence of UVA photosensitizers such as 6-thioguanine (6-TG), a strong UVA chromophore that is extensively incorporated into the DNA of dividing cells, or the fluoroquinolone antibiotic ciprofloxacin. Both DNA-embedded 6-TG and ciprofloxacin combine synergistically with UVA to generate high levels of ROS. Importantly, the extensive protein damage induced by these photosensitizer+UVA combinations inhibits DNA repair. DNA is maintained in intimate contact with the proteins that effect its replication, transcription, and repair, and DNA–protein cross-links (DPCs) are a recognized reaction product of ROS. Cross-linking of DNA metabolizing proteins would compromise these processes by introducing physical blocks and by depleting active proteins. We describe a sensitive and statistically rigorous method to analyze DPCs in cultured human cells. Application of this proteomics-based analysis to cells treated with 6-TG+UVA and ciprofloxacin+UVA identified proteins involved in DNA repair, replication, and gene expression among those most vulnerable to cross-linking under oxidative conditions. PMID:27654267

  3. DNA fragment sizing and sorting by laser-induced fluorescence

    SciTech Connect

    Jett, J.H.; Hammond, M.L.; Keller, R.A.; Marrone, B.L.; Martin, J.C.

    1992-12-31

    A method is provided for obtaining DNA fingerprints using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a selected sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is directly proportional to the fragment length. Additional dyes can be bound to the DNA piece and DNA fragments to provide information additional to length information. Oligonucleotide specific dyes and/or hybridization probes can be bound to the DNA fragments to provide information on oligonucleotide distribution or probe hybridization to DNA fragments of different sizes.

  4. DNA damage induced by red food dyes orally administered to pregnant and male mice.

    PubMed

    Tsuda, S; Murakami, M; Matsusaka, N; Kano, K; Taniguchi, K; Sasaki, Y F

    2001-05-01

    We determined the genotoxicity of synthetic red tar dyes currently used as food color additives in many countries, including JAPAN: For the preliminary assessment, we treated groups of 4 pregnant mice (gestational day 11) once orally at the limit dose (2000 mg/kg) of amaranth (food red No. 2), allura red (food red No. 40), or acid red (food red No. 106), and we sampled brain, lung, liver, kidney, glandular stomach, colon, urinary bladder, and embryo 3, 6, and 24 h after treatment. We used the comet (alkaline single cell gel electrophoresis) assay to measure DNA damage. The assay was positive in the colon 3 h after the administration of amaranth and allura red and weakly positive in the lung 6 h after the administration of amaranth. Acid red did not induce DNA damage in any sample at any sampling time. None of the dyes damaged DNA in other organs or the embryo. We then tested male mice with amaranth, allura red, and a related color additive, new coccine (food red No. 18). The 3 dyes induced DNA damage in the colon starting at 10 mg/kg. Twenty ml/kg of soaking liquid from commercial red ginger pickles, which contained 6.5 mg/10 ml of new coccine, induced DNA damage in colon, glandular stomach, and bladder. The potencies were compared to those of other rodent carcinogens. The rodent hepatocarcinogen p-dimethylaminoazobenzene induced colon DNA damage at 1 mg/kg, whereas it damaged liver DNA only at 500 mg/kg. Although 1 mg/kg of N-nitrosodimethylamine induced DNA damage in liver and bladder, it did not induce colon DNA damage. N-nitrosodiethylamine at 14 mg/kg did not induce DNA damage in any organs examined. Because the 3 azo additives we examined induced colon DNA damage at a very low dose, more extensive assessment of azo additives is warranted.

  5. Ozone decomposition.

    PubMed

    Batakliev, Todor; Georgiev, Vladimir; Anachkov, Metody; Rakovsky, Slavcho; Zaikov, Gennadi E

    2014-06-01

    Catalytic ozone decomposition is of great significance because ozone is a toxic substance commonly found or generated in human environments (aircraft cabins, offices with photocopiers, laser printers, sterilizers). Considerable work has been done on ozone decomposition reported in the literature. This review provides a comprehensive summary of the literature, concentrating on analysis of the physico-chemical properties, synthesis and catalytic decomposition of ozone. This is supplemented by a review on kinetics and catalyst characterization which ties together the previously reported results. Noble metals and oxides of transition metals have been found to be the most active substances for ozone decomposition. The high price of precious metals stimulated the use of metal oxide catalysts and particularly the catalysts based on manganese oxide. It has been determined that the kinetics of ozone decomposition is of first order importance. A mechanism of the reaction of catalytic ozone decomposition is discussed, based on detailed spectroscopic investigations of the catalytic surface, showing the existence of peroxide and superoxide surface intermediates.

  6. Ozone decomposition

    PubMed Central

    Batakliev, Todor; Georgiev, Vladimir; Anachkov, Metody; Rakovsky, Slavcho

    2014-01-01

    Catalytic ozone decomposition is of great significance because ozone is a toxic substance commonly found or generated in human environments (aircraft cabins, offices with photocopiers, laser printers, sterilizers). Considerable work has been done on ozone decomposition reported in the literature. This review provides a comprehensive summary of the literature, concentrating on analysis of the physico-chemical properties, synthesis and catalytic decomposition of ozone. This is supplemented by a review on kinetics and catalyst characterization which ties together the previously reported results. Noble metals and oxides of transition metals have been found to be the most active substances for ozone decomposition. The high price of precious metals stimulated the use of metal oxide catalysts and particularly the catalysts based on manganese oxide. It has been determined that the kinetics of ozone decomposition is of first order importance. A mechanism of the reaction of catalytic ozone decomposition is discussed, based on detailed spectroscopic investigations of the catalytic surface, showing the existence of peroxide and superoxide surface intermediates. PMID:26109880

  7. Polar ozone

    NASA Technical Reports Server (NTRS)

    Solomon, S.; Grose, W. L.; Jones, R. L.; Mccormick, M. P.; Molina, Mario J.; Oneill, A.; Poole, L. R.; Shine, K. P.; Plumb, R. A.; Pope, V.

    1990-01-01

    The observation and interpretation of a large, unexpected ozone depletion over Antarctica has changed the international scientific view of stratospheric chemistry. The observations which show the veracity, seasonal nature, and vertical structure of the Antarctic ozone hole are presented. Evidence for Arctic and midlatitude ozone loss is also discussed. The chemical theory for Antarctic ozone depletion centers around the occurrence of polar stratospheric clouds (PSCs) in Antarctic winter and spring; the climatology and radiative properties of these clouds are presented. Lab studies of the physical properties of PSCs and the chemical processes that subsequently influence ozone depletion are discussed. Observations and interpretation of the chemical composition of the Antarctic stratosphere are described. It is shown that the observed, greatly enhanced abundances of chlorine monoxide in the lower stratosphere are sufficient to explain much if not all of the ozone decrease. The dynamic meteorology of both polar regions is given, interannual and interhemispheric variations in dynamical processes are outlined, and their likely roles in ozone loss are discussed.

  8. Endotoxin treatment protects rats against ozone-induced lung edema: with evidence for the role of manganese superoxide dismutase

    SciTech Connect

    Rahman, I.; Massaro, D. )

    1992-03-01

    Ozone is a strong oxidizing agent that can cause lung damage and edema. There is evidence that it does so by causing peroxidation of membrane lipids. However, the elevation in lung activity of copper, zinc superoxide dismutase (Cu, ZnSOD), and manganese superoxide dismutase (MnSOD) during exposure to ozone suggests that increased production of superoxide could contribute to lung edema caused by ozone. This latter observation, and preliminary evidence that treatment of rats with endotoxin elevates lung activity of MnSOD without elevation of the activity of Cu, ZnSOD, catalase (CAT), or glutathione peroxidase (GP), led to the present study. We treated rats with endotoxin, exposed them to different concentrations of ozone, measured lung wet weight to dry weight ratio, thiobarbituric acid-reactive material (TBAR), and assayed lung tissue for Cu, ZnSOD, MnSOD, CAT, and GP activity. Our major findings are, (1) a strongly edemogenic concentration of ozone-lowered MnSOD activity; (2) endotoxin treatment of air-breathing rats did not decrease lipid peroxidation as indicated by the lung concentration of TBAR; (3) induction of increased MnSOD activity in lung by treatment with endotoxin was associated with virtually complete protection against an otherwise edemogenic concentration of ozone, with less lipid peroxidation, and with less loss of weight; and (4) this protection occurred without elevated Cu, ZnSOD, CAT, or GP activity.

  9. Oxidant and environmental toxicant-induced effects compromise DNA ligation during base excision DNA repair

    PubMed Central

    Çağlayan, Melike; Wilson, Samuel H.

    2015-01-01

    DNA lesions arise from many endogenous and environmental agents, and they promote deleterious events leading to genomic instability and cell death. Base excision repair (BER) is the main DNA repair pathway responsible for repairing single strand breaks, base lesions and abasic sites in mammalian cells. During BER, DNA substrates and repair intermediates are channeled from one step to the next in a sequential fashion so that release of toxic repair intermediates is minimized. This includes handoff of the product of gap-filling DNA synthesis to the DNA ligation step. The conformational differences in DNA polymerase β (pol β) associated with incorrect or oxidized nucleotide (8-oxodGMP) insertion could impact channeling of the repair intermediate to the final step of BER, i.e., DNA ligation by DNA ligase I or the DNA Ligase III/XRCC1 complex. Thus, modified DNA ligase substrates produced by faulty pol β gap-filling could impair coordination between pol β and DNA ligase. Ligation failure is associated with 5'-AMP addition to the repair intermediate and accumulation of strand breaks that could be more toxic than the initial DNA lesions. Here, we provide an overview of the consequences of ligation failure in the last step of BER. We also discuss DNA-end processing mechanisms that could play roles in reversal of impaired BER. PMID:26596511

  10. Oxidant and environmental toxicant-induced effects compromise DNA ligation during base excision DNA repair

    PubMed Central

    çağlayan, Melike; Wilson, Samuel H.

    2015-01-01

    DNA lesions arise from many endogenous and environmental agents, and they promote deleterious events leading to genomic instability and cell death. Base excision repair (BER) is the main DNA repair pathway responsible for repairing single strand breaks, base lesions and abasic sites in mammalian cells. During BER, DNA substrates and repair intermediates are channeled from one step to the next in a sequential fashion so that release of toxic repair intermediates is minimized. This includes handoff of the product of gap-filling DNA synthesis to the DNA ligation step. The conformational differences in DNA polymerase β (pol β) associated with incorrect or oxidized nucleotide (8-oxodGMP) insertion could impact channeling of the repair intermediate to the final step of BER, i.e., DNA ligation by DNA ligase I or the DNA Ligase III/XRCC1 complex. Thus, modified DNA ligase substrates produced by faulty pol β gap-filling could impair coordination between pol β and DNA ligase. Ligation failure is associated with 5′-AMP addition to the repair intermediate and accumulation of strand breaks that could be more toxic than the initial DNA lesions. Here, we provide an overview of the consequences of ligation failure in the last step of BER. We also discuss DNA-end processing mechanisms that could play roles in reversal of impaired BER. PMID:26466358

  11. Oxidant and environmental toxicant-induced effects compromise DNA ligation during base excision DNA repair.

    PubMed

    Çağlayan, Melike; Wilson, Samuel H

    2015-11-01

    DNA lesions arise from many endogenous and environmental agents, and such lesions can promote deleterious events leading to genomic instability and cell death. Base excision repair (BER) is the main DNA repair pathway responsible for repairing single strand breaks, base lesions and abasic sites in mammalian cells. During BER, DNA substrates and repair intermediates are channeled from one step to the next in a sequential fashion so that release of toxic repair intermediates is minimized. This includes handoff of the product of gap-filling DNA synthesis to the DNA ligation step. The conformational differences in DNA polymerase β (pol β) associated with incorrect or oxidized nucleotide (8-oxodGMP) insertion could impact channeling of the repair intermediate to the final step of BER, i.e., DNA ligation by DNA ligase I or the DNA Ligase III/XRCC1 complex. Thus, modified DNA ligase substrates produced by faulty pol β gap-filling could impair coordination between pol β and DNA ligase. Ligation failure is associated with 5'-AMP addition to the repair intermediate and accumulation of strand breaks that could be more toxic than the initial DNA lesions. Here, we provide an overview of the consequences of ligation failure in the last step of BER. We also discuss DNA-end processing mechanisms that could play roles in reversal of impaired BER.

  12. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  13. The human oxidative DNA glycosylase NEIL1 excises psoralen-induced interstrand DNA cross-links in a three-stranded DNA structure.

    PubMed

    Couvé, Sophie; Macé-Aimé, Gaëtane; Rosselli, Filippo; Saparbaev, Murat K

    2009-05-01

    Previously, we have demonstrated that human oxidative DNA glycosylase NEIL1 excises photoactivated psoralen-induced monoadducts but not genuine interstrand cross-links (ICLs) in duplex DNA. It has been postulated that the repair of ICLs in mammalian cells is mainly linked to DNA replication and proceeds via dual incisions in one DNA strand that bracket the cross-linked site. This process, known as "unhooking," enables strand separation and translesion DNA synthesis through the gap, yielding a three-stranded DNA repair intermediate composed of a short unhooked oligomer covalently bound to the duplex. At present, the detailed molecular mechanism of ICL repair in mammalian cells remains unclear. Here, we constructed and characterized three-stranded DNA structures containing a single ICL as substrates for the base excision repair proteins. We show that NEIL1 excises with high efficiency the unhooked ICL fragment within a three-stranded DNA structure. Complete reconstitution of the repair of unhooked ICL shows that it can be processed in a short patch base excision repair pathway. The new substrate specificity of NEIL1 points to a preferential involvement in the replication-associated repair of ICLs. Based on these data, we propose a model for the mechanism of ICL repair in mammalian cells that implicates the DNA glycosylase activity of NEIL1 downstream of Xeroderma Pigmentosum group F/Excision Repair Cross-Complementing 1 endonuclease complex (XPF/ERCC1) and translesion DNA synthesis repair steps. Finally, our data demonstrate that Nei-like proteins from Escherichia coli to human cells can excise bulky unhooked psoralen-induced ICLs via hydrolysis of glycosidic bond between cross-linked base and deoxyribose sugar, thus providing an alternative heuristic solution for the removal of complex DNA lesions.

  14. Naturally occurring branched-chain polyamines induce a crosslinked meshwork structure in a giant DNA

    NASA Astrophysics Data System (ADS)

    Muramatsu, Akira; Shimizu, Yuta; Yoshikawa, Yuko; Fukuda, Wakao; Umezawa, Naoki; Horai, Yuhei; Higuchi, Tsunehiko; Fujiwara, Shinsuke; Imanaka, Tadayuki; Yoshikawa, Kenichi

    2016-12-01

    We studied the effect of branched-chain polyamines on the folding transition of genome-sized DNA molecules in aqueous solution by the use of single-molecule observation with fluorescence microcopy. Detailed morphological features of polyamine/DNA complexes were characterized by atomic force microscopy (AFM). The AFM observations indicated that branched-chain polyamines tend to induce a characteristic change in the higher-order structure of DNA by forming bridges or crosslinks between the segments of a DNA molecule. In contrast, natural linear-chain polyamines cause a parallel alignment between DNA segments. Circular dichroism measurements revealed that branched-chain polyamines induce the A-form in the secondary structure of DNA, while linear-chain polyamines have only a minimum effect. This large difference in the effects of branched- and linear-chain polyamines is discussed in relation to the difference in the manner of binding of these polyamines to negatively charged double-stranded DNA.

  15. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  16. RNA-directed DNA methylation induces transcriptional activation in plants

    PubMed Central

    Shibuya, Kenichi; Fukushima, Setsuko; Takatsuji, Hiroshi

    2009-01-01

    A class-C floral homeotic gene of Petunia, pMADS3, is specifically expressed in the stamen and carpels of developing flowers. We had previously reported the ect-pMADS3 phenomenon in which introduction of a part of the pMADS3 genomic sequence, including intron 2, induces ectopic expression of endogenous pMADS3. Unlike transcriptional or posttranscriptional gene silencing triggered by the introduction of homologous sequences, this observation is unique in that the gene expression is up-regulated. In this study, we demonstrated that the ect-pMADS3 phenomenon is due to transcriptional activation based on RNA-directed DNA methylation (RdDM) occurring in a particular CG in a putative cis-element in pMADS3 intron 2. The CG methylation was maintained over generations, along with pMADS3 ectopic expression, even in the absence of RNA triggers. These results demonstrate a previously undescribed transcriptional regulatory mechanism that could lead to the generation of a transcriptionally active epiallele, thereby contributing to plant evolution. Our results also reveal a putative negative cis-element for organ-specific transcriptional regulation of class-C floral homeotic genes, which could be difficult to identify by other approaches. PMID:19164525

  17. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  18. Decreased skeletal muscle mitochondrial DNA in patients with statin-induced myopathy.

    PubMed

    Stringer, Henry A J; Sohi, Gurmeet K; Maguire, John A; Côté, Hélène C F

    2013-02-15

    Statins are widely used to treat hyperlipidemia and lower cardiovascular disease risk. While statins are generally well tolerated, some patients experience statin-induced myopathy (SIM). Statin treatment has been associated with mitochondrial dysfunction and mitochondrial DNA (mtDNA) depletion. In this retrospective study, skeletal muscle biopsies from patients diagnosed with SIM were studied. These were compared with biopsies from patients clinically assessed as having statin-unrelated myopathy but whose biopsy showed no or negligible pathology. For each biopsy sample, mtDNA was quantified relative to nuclear DNA (mtDNA content) by qPCR, mtDNA deletions were investigated by long-template PCR followed by gel densitometry, and mtDNA oxidative damage was quantified using a qPCR-based assay. For a subset of matched samples, mtDNA heteroplasmy and mutations were investigated by cloning/sequencing. Skeletal muscle mtDNA content was significantly lower in SIM patients (N=23, mean±SD, 2036±1146) than in comparators (N=24, 3220±1594), p=0.006. There was no difference in mtDNA deletion score or oxidative mtDNA damage between the two groups, and no evidence of increased mtDNA heteroplasmy or somatic mutations was detected. The significant difference in skeletal muscle mtDNA suggests that SIM or statin treatments are associated with depletion of skeletal muscle mtDNA or that patients with an underlying predisposition to SIM have lower mtDNA levels. If statins induce mtDNA depletion, this would likely reflect decreased mitochondria biogenesis and/or increased mitochondria autophagy. Further work is necessary to distinguish between the lower mtDNA as a predisposition to SIM or an effect of SIM or statin treatment.

  19. Identification of a UV-induced trans-acting protein that stimulates polyomavirus DNA replication

    SciTech Connect

    Ronai, Z.A.; Weinstein, I.B. )

    1988-03-01

    Previous studies provided indirect evidence that the ability of a variety of DNA-damaging agents to induce asynchronous polyomavirus DNA replication in the H3 rat fibroblast cell line is mediated by a trans-acting factor. Using an erythrocyte insertion technique to introduce protein fractions from UV-irradiated cells into unirradiated H3 cells, we have now obtained evidence that this factor is a 60-kilodalton protein. These findings provide evidence that DNA damage in mammalian cells induces a factor that can alter the replication of a viral DNA.

  20. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

    2015-06-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  1. Consistent ozone-induced decreases in pasture forage quality across several grassland types and consequences for UK lamb production.

    PubMed

    Hayes, Felicity; Mills, Gina; Jones, Laurence; Abbott, John; Ashmore, Mike; Barnes, Jeremy; Neil Cape, J; Coyle, Mhairi; Peacock, Simon; Rintoul, Naomi; Toet, Sylvia; Wedlich, Kerstin; Wyness, Kirsten

    2016-02-01

    In this study we have demonstrated that rising background ozone has the potential to reduce grassland forage quality and explored the implications for livestock production. We analysed pasture samples from seven ozone exposure experiments comprising mesotrophic, calcareous, haymeadow and sanddune unimproved grasslands conducted in open-top chambers, solardomes and a field release system. Across all grassland types, there were significant increases in acid detergent fibre, crude fibre and lignin content with increasing ozone concentration, resulting in decreased pasture quality in terms of the metabolisable energy content of the vegetation. We derived a dose-response function for metabolisable energy of the grassland with ozone concentration, applicable to a range of grassland types, and used this to predict effects on pasture quality of UK vegetation at 1 km resolution using modelled ozone data for 2007 and for predicted higher average ozone concentrations in 2020. This showed a potential total reduction in lamb production in the UK of approximately 4% in 2020 compared to 2007. The largest impacts were in geographical areas of modest ozone increases between the two years, but where large numbers of lambs were present. For an individual farmer working to a very small cost margin this could represent a large reduction in profit, both in regions where the impacts per lamb and those where the impacts per km(2) of grazing land are largest. In the short term farmers could adapt their lamb management in response to changed forage quality by additional supplementary feed of high metabolisable energy content. Nationally this increase in annual additional feed in 2020 compared to 2007 would be 2,166 tonnes (an increase of 0.7%). Of added concern are the longer-term consequences of continual deterioration of pasture quality and the implications for changes in farming practices to compensate for potential reductions in livestock production capacity.

  2. Ozone Pollution

    EPA Pesticide Factsheets

    Known as tropospheric or ground-level ozone, this gas is harmful to human heath and the environment. Since it forms from emissions of volatile organic compounds (VOCs) and nitrogen oxides (NOx), these pollutants are regulated under air quality standards.

  3. Time Resolved Studies of Interfacial Reactions of Ozone with Pulmonary Phospholipid Surfactants Using Field Induced Droplet Ionization Mass Spectrometry

    PubMed Central

    Kim, Hugh I.; Kim, Hyungjun; Shin, Young Shik; Beegle, Luther W.; Goddard, William A.; Heath, James R.; Kanik, Isik; Beauchamp, J. L.

    2013-01-01

    Field induced droplet ionization mass spectrometry (FIDI-MS) comprises a soft ionization method to sample ions from the surface of microliter droplets. A pulsed electric field stretches neutral droplets until they develop dual Taylor cones, emitting streams of positively and negatively charged submicrometer droplets in opposite directions, with the desired polarity being directed into a mass spectrometer for analysis. This methodology is employed to study the heterogeneous ozonolysis of 1-palmitoyl-2-oleoyl-sn-phosphatidylglycerol (POPG) at the air–liquid interface in negative ion mode using FIDI mass spectrometry. Our results demonstrate unique characteristics of the heterogeneous reactions at the air–liquid interface. We observe the hydroxyhydroperoxide and the secondary ozonide as major products of POPG ozonolysis in the FIDI-MS spectra. These products are metastable and difficult to observe in the bulk phase, using standard electrospray ionization (ESI) for mass spectrometric analysis. We also present studies of the heterogeneous ozonolysis of a mixture of saturated and unsaturated phospholipids at the air–liquid interface. A mixture of the saturated phospholipid 1,2-dipalmitoyl-sn-phosphatidylglycerol (DPPG) and unsaturated POPG is investigated in negative ion mode using FIDI-MS while a mixture of 1,2-dipalmitoyl-sn-phosphatidylcholine (DPPC) and 1-stearoyl-2-oleoyl-sn-phosphatidylcholine (SOPC) surfactant is studied in positive ion mode. In both cases FIDI-MS shows the saturated and unsaturated pulmonary surfactants form a mixed interfacial layer. Only the unsaturated phospholipid reacts with ozone, forming products that are more hydrophilic than the saturated phospholipid. With extensive ozonolysis only the saturated phospholipid remains at the droplet surface. Combining these experimental observations with the results of computational analysis provides an improved understanding of the interfacial structure and chemistry of a surfactant layer system

  4. How to Cope with DNA Damage Induced by Ionizing Radiation and Anti-Cancer Drugs?

    NASA Astrophysics Data System (ADS)

    Enomoto, A.; Miyagawa, K.

    Ionizing radiation and chemotherapeutic agents induce many types of DNA lesions, of which DNA double-strand breaks (DSBs) are assumed to be the most deleterious. DNA damage response mechanisms encompass pathways of DNA damage signaling, DNA repair, cell cycle checkpoint arrest, and apoptosis. Increasing evidence suggests that these pathways function co-operatively to maintain genomic stability in the face of exogenous and endogenous DNA damage. The relative impact of one mechanism over another probably depends on the kinds of lesions, the cell cycle phase, and the cell or tissue type. The inability to respond properly to or to repair DSBs may lead to hypersensitivity to DNA damaging agents and genomic instability including chromosomal aberrations. Chromosomal instability, a state of continuous accumulation of chromosomal change, is a common feature of many human cancers and of chromosome instability syndromes with increased cancer susceptibility. Here, we review the DNA da mage response and the links between deficiencies in response to DSBs and chromosomal instability.

  5. Ozone, Tropospheric

    NASA Technical Reports Server (NTRS)

    Fishman, Jack

    1995-01-01

    In the early part of the 20th century, ground-based and balloon-borne measurements discovered that most of atmosphere's ozone is located in the stratosphere with highest concentrations located between 15 and 30 km (9,3 and 18.6 miles). For a long time, it was believed that tropospheric ozone originated from the stratosphere and that most of it was destroyed by contact with the earth's surface. Ozone, O3, was known to be produced by the photo-dissociation of molecular oxygen, O2, a process that can only occur at wavelengths shorter than 242 nm. Because such short-wave-length radiation is present only in the stratosphere, no tropospheric ozone production is possible by this mechanism. In the 1940s, however, it became obvious that production of ozone was also taking place in the troposphere. The overall reaction mechanism was eventually identified by Arie Haagen-Smit of the California Institute of Technology, in highly polluted southern California. The copious emissions from the numerous cars driven there as a result of the mass migration to Los Angeles after World War 2 created the new unpleasant phenomenon of photochemical smog, the primary component of which is ozone. These high levels of ozone were injuring vegetable crops, causing women's nylons to run, and generating increasing respiratory and eye-irritation problems for the populace. Our knowledge of tropospheric ozone increased dramatically in the early 1950s as monitoring stations and search centers were established throughout southern California to see what could be done to combat this threat to human health and the environment.

  6. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.

    PubMed

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-06-24

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo.

  7. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage–induced cell senescence

    PubMed Central

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A.; Kumar, Sheetal; Kalab, Petr

    2016-01-01

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase–regulated nuclear–cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage–induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β–dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP–regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  8. Structures of DNA Polymerase Mispaired DNA Termini Transitioning to Pre-catalytic Complexes Support an Induced-Fit Fidelity Mechanism.

    PubMed

    Batra, Vinod K; Beard, William A; Pedersen, Lars C; Wilson, Samuel H

    2016-11-01

    High-fidelity DNA synthesis requires that polymerases display a strong preference for right nucleotide insertion. When the wrong nucleotide is inserted, the polymerase deters extension from the mismatched DNA terminus. Twenty-three crystallographic structures of DNA polymerase β with terminal template-primer mismatches were determined as binary DNA and ternary pre-catalytic substrate complexes. These structures indicate that the mismatched termini adopt various distorted conformations that attempt to satisfy stacking and hydrogen-bonding interactions. The binary complex structures indicate an induced strain in the mismatched template nucleotide. Addition of a non-hydrolyzable incoming nucleotide stabilizes the templating nucleotide with concomitant strain in the primer terminus. Several dead-end ternary complex structures suggest that DNA synthesis might occur as the enzyme transitions from an open to a closed complex. The structures are consistent with an induced-fit mechanism where a mismatched terminus is misaligned relative to the correct incoming nucleotide to deter or delay further DNA synthesis.

  9. Spatiotemporal dynamics of DNA repair proteins following laser microbeam induced DNA damage - when is a DSB not a DSB?

    PubMed

    Reynolds, Pamela; Botchway, Stanley W; Parker, Anthony W; O'Neill, Peter

    2013-08-30

    The formation of DNA lesions poses a constant threat to cellular stability. Repair of endogenously and exogenously produced lesions has therefore been extensively studied, although the spatiotemporal dynamics of the repair processes has yet to be fully understood. One of the most recent advances to study the kinetics of DNA repair has been the development of laser microbeams to induce and visualize recruitment and loss of repair proteins to base damage in live mammalian cells. However, a number of studies have produced contradictory results that are likely caused by the different laser systems used reflecting in part the wavelength dependence of the damage induced. Additionally, the repair kinetics of laser microbeam induced DNA lesions have generally lacked consideration of the structural and chemical complexity of the DNA damage sites, which are known to greatly influence their reparability. In this review, we highlight the key considerations when embarking on laser microbeam experiments and interpreting the real time data from laser microbeam irradiations. We compare the repair kinetics from live cell imaging with biochemical and direct quantitative cellular measurements for DNA repair.

  10. Primary sites of ozone-induced perturbations of photosynthesis in leaves: identification and characterization in Phaseolus vulgaris using high resolution chlorophyll fluorescence imaging.

    PubMed

    Leipner, J; Oxborough, K; Baker, N R

    2001-08-01

    High resolution imaging of chlorophyll a fluorescence was used to identify the sites at which ozone initially induces perturbations of photosynthesis in leaves of Phaseolus vulgaris. Leaves were exposed to 250 and 500 nmol mol(-1) ozone at a photosynthetically active photon flux density of 300 micromol m(-2) s(-1) for 3 h. Images of fluorescence parameters indicated that large decreases in both the maximum and operating quantum efficiencies of photosystem II had occurred in cells adjacent to stomata in the upper, but not lower, leaf surfaces. However, this treatment did not produce any significant changes in the maximum or operating quantum efficiencies of photosystem II in the leaves when estimated from fluorescence parameters measured with a conventional, integrating fluorometer. The localized decreases in photosystem II photochemical efficiencies were accompanied by an increase in the minimal fluorescence level, which is indicative of photoinactivation of photosystem II complexes and a decrease in stomatal conductance. Perturbations of photochemical efficiencies were not observed in cells associated with all of the stomata on the upper leaf surface or within cells distant from the upper leaf surface. It is concluded that ozone penetrates the leaf through stomata and initially damages only cells close to stomatal pores.

  11. Extracellular Self-DNA (esDNA), but Not Heterologous Plant or Insect DNA (etDNA), Induces Plasma Membrane Depolarization and Calcium Signaling in Lima Bean (Phaseolus lunatus) and Maize (Zea mays)

    PubMed Central

    Barbero, Francesca; Guglielmotto, Michela; Capuzzo, Andrea; Maffei, Massimo E.

    2016-01-01

    Extracellular self-DNA (esDNA) is produced during cell and tissue damage or degradation and has been shown to induce significant responses in several organisms, including plants. While the inhibitory effects of esDNA have been shown in conspecific individuals, little is known on the early events involved upon plant esDNA perception. We used electrophysiology and confocal laser scanning microscopy calcium localization to evaluate the plasma membrane potential (Vm) variations and the intracellular calcium fluxes, respectively, in Lima bean (Phaseolus lunatus) and maize (Zea mays) plants exposed to esDNA and extracellular heterologous DNA (etDNA) and to etDNA from Spodoptera littoralis larvae and oral secretions. In both species, esDNA induced a significant Vm depolarization and an increased flux of calcium, whereas etDNA was unable to exert any of these early signaling events. These findings confirm the specificity of esDNA to induce plant cell responses and to trigger early signaling events that eventually lead to plant response to damage. PMID:27690017

  12. Extracellular Self-DNA (esDNA), but Not Heterologous Plant or Insect DNA (etDNA), Induces Plasma Membrane Depolarization and Calcium Signaling in Lima Bean (Phaseolus lunatus) and Maize (Zea mays).

    PubMed

    Barbero, Francesca; Guglielmotto, Michela; Capuzzo, Andrea; Maffei, Massimo E

    2016-09-29

    Extracellular self-DNA (esDNA) is produced during cell and tissue damage or degradation and has been shown to induce significant responses in several organisms, including plants. While the inhibitory effects of esDNA have been shown in conspecific individuals, little is known on the early events involved upon plant esDNA perception. We used electrophysiology and confocal laser scanning microscopy calcium localization to evaluate the plasma membrane potential (Vm) variations and the intracellular calcium fluxes, respectively, in Lima bean (Phaseolus lunatus) and maize (Zea mays) plants exposed to esDNA and extracellular heterologous DNA (etDNA) and to etDNA from Spodoptera littoralis larvae and oral secretions. In both species, esDNA induced a significant Vm depolarization and an increased flux of calcium, whereas etDNA was unable to exert any of these early signaling events. These findings confirm the specificity of esDNA to induce plant cell responses and to trigger early signaling events that eventually lead to plant response to damage.

  13. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    SciTech Connect

    Qin Xujun; Hudson, Laurie G.; Liu Wenlan; Timmins, Graham S.; Liu Kejian

    2008-10-01

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite ({<=} 2 {mu}M) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 {mu}M arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic.

  14. Genetic and Functional Studies of Genes that Regulate DNA-Damage-Induced Cell Death

    DTIC Science & Technology

    2004-11-01

    AD Award Number: DAMD17-01-1-0145 TITLE: Genetic and Functional Studies of Genes that Regulate DNA-damage-induced Cell Death PRINCIPAL INVESTIGATOR...and Functional Studies of Genes that Regulate DAMD17-01-1-0145 DNA-damage-induced Cell Death 6. A UTHOR(S) Zhou Songyang, Ph.D. 7. PERFORMING ORGANIZA...mechanisms of genes that regulate DNA damage induced cell death are much less well studied. We have proposed to establish a genetic system to screen for

  15. Peroxidase release induced by ozone in Sedum album leaves: involvement of Ca/sup 2 +/. [Sedum album

    SciTech Connect

    Castillo, F.J.; Penel, C.; Greppin, H.

    1984-04-01

    The effect of ozone was studied on the peroxidase activity from various compartments of Sedum album leaves (epidermis, intercellular fluid, residual cell material, and total cell material). The greatest increase following a 2-hour ozone exposure (0.4 microliters O/sub 3/ per liter) was observed in extracellular peroxidases. Most of the main bands of peroxidase activity separated by isoelectric focusing exhibited an increase upon exposure to ozone. Incubation experiments with isolated peeled or unpeeled leaves showed that leaves from ozone-treated plants release much more peroxidases in the medium than untreated leaves. The withdrawal of Ca/sup 2 +/ ions reduced the level of extracellular peroxidase activity either in whole plants or in incubation experiments. This reduction and the activation obtained after addition of Ca/sup 2 +/ resulted from a direct requirment of Ca/sup 2 +/ by the enzyme and from an effect of Ca/sup 2 +/ on peroxidase secretion. The ionophore A23187 promoted an increase of extracellular peroxidase activity only in untreated plants. The release of peroxidases by untreated and ozone-treated leaves is considerably lowered by metabolic inhibitors (3-(3,4-dichlorophenyl)-1,1-dimethylurea and sodium azide) and by puromycin.

  16. Ozone induced leaf loss and decreased leaf production of European Holly (Ilex aquifolium L.) over multiple seasons.

    PubMed

    Ranford, Jonathan; Reiling, Kevin

    2007-01-01

    European Holly (Ilex aquifolium L.) was used to study the impact of one short (28 day) ozone fumigation episode on leaf production, leaf loss and stomatal conductance (g(s)), in order to explore potential longer term effects over 3 growing seasons. Young I. aquifolium plants received an episode of either charcoal-filtered air or charcoal-filtered air with 70 nl l(-1) O(3) added for 7 h d(-1) over a 28 day period from June 15th 1996, then placed into ambient environment, Stoke-on-Trent, U.K. Data were collected per leaf cohort over the next three growing seasons. Ozone exposure significantly increased leaf loss and stomatal conductance and reduced leaf production over all subsequent seasons. Impact of the initial ozone stress was still detected in leaves that had no direct experimental ozone exposure. This study has shown the potential of ozone to introduce long-term phenological perturbations into ecosystems by influencing productivity over a number of seasons.

  17. Methods to detect replication-dependent and replication-independent DNA structure-induced genetic instability

    PubMed Central

    Wang, Guliang; Gaddis, Sally; Vasquez, Karen M.

    2013-01-01

    DNA can adopt a variety of alternative secondary (i.e., non-B DNA) conformations that play important roles in cellular metabolism, including genetic instability, disease etiology, and evolution. While we still have much to learn, research in this field has expanded dramatically in the past decade. We have summarized in our previous Methods review (Wang et al., Methods, 2009) some commonly used techniques to determine non-B DNA structural conformations and non-B DNA-induced genetic instability in prokaryotes and eukaryotes. Since that time, we and others have further characterized mechanisms involved in DNA structure-induced mutagenesis and have proposed both replication-dependent and replication-independent models. Thus, in this review, we highlight some current methodologies to identify DNA replication-related and replication-independent mutations occurring at non-B DNA regions to allow for a better understanding of the mechanisms underlying DNA structure-induced genetic instability. We also describe a new web-based search engine to identify potential intramolecular triplex (H-DNA) and left-handed Z-DNA-forming motifs in entire genomes or at selected sequences of interest. PMID:23954565

  18. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  19. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.

    1987-03-24

    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  20. Association of arsenic-induced malignant transformation with DNA hypomethylation and aberrant gene expression

    PubMed Central

    Zhao, Christopher Q.; Young, Matthew R.; Diwan, Bhalchandra A.; Coogan, Timothy P.; Waalkes, Michael P.

    1997-01-01

    Inorganic arsenic, a human carcinogen, is enzymatically methylated for detoxication, consuming S-adenosyl-methionine (SAM) in the process. The fact that DNA methyltransferases (MeTases) require this same methyl donor suggests a role for methylation in arsenic carcinogenesis. Here we test the hypothesis that arsenic-induced initiation results from DNA hypomethylation caused by continuous methyl depletion. The hypothesis was tested by first inducing transformation in a rat liver epithelial cell line by chronic exposure to low levels of arsenic, as confirmed by the development of highly aggressive, malignant tumors after inoculation of cells into Nude mice. Global DNA hypomethylation occurred concurrently with malignant transformation and in the presence of depressed levels of S-adenosyl-methionine. Arsenic-induced DNA hypomethylation was a function of dose and exposure duration, and remained constant even after withdrawal of arsenic. Hyperexpressibility of the MT gene, a gene for which expression is clearly controlled by DNA methylation, was also detected in transformed cells. Acute arsenic or arsenic at nontransforming levels did not induce global hypomethylation of DNA. Whereas transcription of DNA MeTase was elevated, the MeTase enzymatic activity was reduced with arsenic transformation. Taken together, these results indicate arsenic can act as a carcinogen by inducing DNA hypomethylation, which in turn facilitates aberrant gene expression, and they constitute a tenable theory of mechanism in arsenic carcinogenesis. PMID:9380733

  1. The fluorophore 4',6-diamidino-2-phenylindole (DAPI) induces DNA folding in long double-stranded DNA.

    PubMed

    Beccia, Maria Rosa; Biver, Tarita; Pardini, Alberto; Spinelli, Jacopo; Secco, Fernando; Venturini, Marcella; Busto Vázquez, Natalia; Lopez Cornejo, Maria Pilar; Martin Herrera, Victoria Isabel; Prado Gotor, Rafael

    2012-08-01

    DAPI (4',6-diamidino-2-phenylindole) is a widely used fluorescent dye, whose complicated binding features to DNAs and RNAs have been the object of debates and are still not fully understood. In this study, different approaches were employed, including binding equilibrium measurements (spectrofluorometry), melting experiments (spectrophotometry), viscometric measurements, circular dichroism, and T-jump kinetic analyses; all data concur in shedding light on the complex mechanistic aspects of the binding mode of DAPI to natural DNA. Conditions are found that induce the mode of the DAPI/DNA interaction to change from groove binding to intercalation. Moreover, it is observed, for the first time, that DAPI is able to induce the formation of a rather compact polymer-dye adduct under particular conditions. The results suggest that this form is a folded or coiled DNA structure stabilized by DAPI dye bridges.

  2. Basic Mechanics of DNA Methylation and the Unique Landscape of the DNA Methylome in Metal-Induced Carcinogenesis

    PubMed Central

    Brocato, Jason; Costa, Max

    2013-01-01

    DNA methylation plays an intricate role in the regulation of gene expression and events that compromise the integrity of the methylome may potentially contribute to disease development. DNA methylation is a reversible and regulatory modification that elicits a cascade of events leading to chromatin condensation and gene silencing. In general, normal cells are characterized by gene-specific hypomethylation and global hypermethylation, while cancer cells portray a reverse profile to this norm. The unique methylome displayed in cancer cells is induced after exposure to carcinogenic metals such as nickel, arsenic, cadmium, and chromium (VI). These metals alter the DNA methylation profile by provoking both hyper- and hypomethylation events. The metal-stimulated deviations to the methylome are possible mechanisms for metal-induced carcinogenesis and may provide potential biomarkers for cancer detection. Development of therapies based on the cancer methylome requires further research including human studies that supply results with larger impact and higher human relevance. PMID:23844698

  3. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  4. Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

    PubMed Central

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-01-01

    Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570

  5. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    PubMed

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma.

  6. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping

    2010-12-01

    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  7. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  8. DNA polymorphism in Cab locus of tomato induced by tissue culture.

    PubMed

    Nambisan, P; Chopra, V L; Mohapatra, T

    1992-03-01

    Plants were regenerated from callus induced from leaf disc explants of a tomato F1 hybrid heterozygous for three marker loci anthocyaninless (a), without anthocyanin (aw), and hairless (hl). Regenerants were studied for somaclonal variation at the phenotypic level by scoring for variation in the marker loci, and at the DNA level by probing geomic DNA blots with a chlorophyll a/b binding protein (Cab-3C) cDNA sequence. While no variation was observed at the phenotypic level in over 950 somaclones studied, DNA polymorphism for the Cab locus could be detected in two out of 17 somaclones tested. Tissue culture induced variation at the phenotypic level for specific loci is very low (less than 0.001 for a, aw or hl) but DNA sequence changes are induced at much greater frequency (approximately 0.1 for a multicopy gene family such as Cab).

  9. ERCC2/XPD Lys751Gln alter DNA repair efficiency of platinum-induced DNA damage through P53 pathway.

    PubMed

    Zhang, Guopei; Guan, Yangyang; Zhao, Yuejiao; van der Straaten, Tahar; Xiao, Sha; Xue, Ping; Zhu, Guolian; Liu, Qiufang; Cai, Yuan; Jin, Cuihong; Yang, Jinghua; Wu, Shengwen; Lu, Xiaobo

    2017-02-01

    Platinum-based treatment causes Pt-DNA adducts which lead to cell death. The platinum-induced DNA damage is recognized and repaired by the nucleotide excision repair (NER) system of which ERCC2/XPD is a critical enzyme. Single nucleotide polymorphisms in ERCC2/XPD have been found to be associated with platinum resistance. The aim of the present study was to investigate whether ERCC2/XPD Lys751Gln (rs13181) polymorphism is causally related to DNA repair capacity of platinum-induced DNA damage. First, cDNA clones expressing different genotypes of the polymorphism was transfected to an ERCC2/XPD defective CHO cell line (UV5). Second, all cells were treated with cisplatin. Cellular survival rate were investigated by MTT growth inhibition assay, DNA damage levels were investigated by comet assay and RAD51 staining. The distribution of cell cycle and the change of apoptosis rates were detected by a flow cytometric method (FCM). Finally, P53mRNA and phospho-P53 protein levels were further investigated in order to explore a possible explanation. As expected, there was a significantly increased in viability of UV5(ERCC2 (AA)) as compared to UV5(ERCC2 (CC)) after cisplatin treatment. The DNA damage level of UV5(ERCC2 (AA)) was significant decreased compared to UV5(ERCC2 (CC)) at 24 h of treatment. Mutation of ERCC2rs13181 AA to CC causes a prolonged S phase in cell cycle. UV5(ERCC2 (AA)) alleviated the apoptosis compared to UV5(ERCC2 (CC)), meanwhile P53mRNA levels in UV(ERCC2 (AA)) was also lower when compared UV5(ERCC2 (CC)). It co-incides with a prolonged high expression of phospho-P53, which is relevant for cell cycle regulation, apoptosis, and the DNA damage response (DDR). We concluded that ERCC2/XPD rs13181 polymorphism is possibly related to the DNA repair capacity of platinum-induced DNA damage. This functional study provides some clues to clarify the relationship between cisplatin resistance and ERCC2/XPDrs13181 polymorphism.

  10. Methotrexate-induced misincorporation of uracil into DNA

    PubMed Central

    Goulian, M.; Bleile, B.; Tseng, B. Y.

    1980-01-01

    A line of human lymphoid cells was tested for the presence of dUMP in DNA with or without treatment with the dihydrofolate reductase inhibitor, methotrexate. Cells treated with methotrexate and labeled with [3H]dUrd contained dUMP in DNA in readily detectable amounts (≈0.8 pmol of dUMP per μmol of total DNA nucleotide), and this was increased ≈3-fold if the cells were also treated with Ura at the same time. No dUMP (<1 fmol/μmol of DNA) could be detected by these methods in DNA from cells not treated with methotrexate, regardless of whether Ura was present or absent. The presence of dUMP in DNA from cells treated with methotrexate is a result of the great increase in intracellular concentration of dUTP and the fall in dTTP that accompany inhibition of thymidylate synthetase (5,10-methylenetetrahydrofolate:dUMP C-methyltransferase; EC 2.1.1.45) by the drug. These changes are apparently sufficient to overcome the normal mechanisms that exclude dUMP from DNA, and the enhancement by Ura reflects suppression of one of the mechanisms, Ura removal from DNA by the enzyme Ura-DNA glycosylase. The results suggest an active lesion of DNA in cells in which thymidylate synthetase is inhibited. Under these conditions there appears to be a cyclic incorporation and removal of dUMP resulting from reinsertion of dUMP during gap repair at sites of Ura removal. This consequence of the normal excision-repair process, which occurs when intracellular levels of dUTP approach those of dTTP, may have effects related to the cytotoxicity of drug inhibitors of thymidylate synthetase, clinical deficiencies of folate and vitamin B-12, and thymineless death, in general. Images PMID:6929529

  11. Observations of ozone-induced foliar injury on black cherry (Prunus serotina, var. capuli) within the Desierto de Los Leones National Park, Mexico City.

    PubMed

    Skelly, J M; Savage, J E; de Bauer, M de L; Alvarado, D

    1997-01-01

    A survey for ozone-induced foliar injury of black cherry was conducted in mid-June 1995 within the Desierto de Los Leones National Park located southwest of Mexico City. Evaluations of the upper and lower tree crowns of 18 trees revealed evidence of significant upper surface stipple, leaf reddening and premature senescence on 72% of the trees. A general survey of an additional 169 trees disclosed that 41% exhibited similar symptoms. A gradient of increasing symptoms with increasing elevation was also evident. For the most part, asymptomatic trees were observed to be situated within well-shaded coves at the lower elevations with very few symptomatic trees present in these areas.

  12. Signal-Induced Noise Effects in a Photon Counting System for Stratospheric Ozone Measurement

    NASA Technical Reports Server (NTRS)

    Harper, David B.; DeYoung, Russell J.

    1998-01-01

    Signal-induced noise (SIN) is a common effect resulting when a photomultiplier tube (PMT) is saturated, for a brief moment, with a high intensity light pulse. After the laser pulse is sent into the atmosphere a very large light return, from either the near-field or a cloud, causes the PMT to momentarily saturate. The PMT is gated off at this time so no signal is seen at the anode. When the PMT gate is turned on, the far-field light return from the atmosphere is observed. This signal is distorted, however because of the addition of SIN to the received light signal causing a slower than expected decay of the atmospheric signal return. We have characterized SIN responses to varying parameters of the incident light on the PMT. These varied parameters included incident wavelength, PMT voltage, incident intensity, and tube type. We found that only the amplitude of the SIN was effected by varying PMT voltages and light intensities. The amplitude increased linearly as input light intensity increased. Different incident wavelengths at the same intensity did not effect the amplitude or the temporal behavior of the SIN response. Finally, different PMT tubes with similar physical structures exhibited similar SIN responses although with different amplitudes. The different amplitudes can be attributed to the different gains and operating voltages of each tube. These results suggest that SIN is caused by photocathode electron dynamics such as charge accumulation on internal PMT surfaces. These surfaces then emit the electrons slowly resulting in a long decay noise signal. With the SIN responses characterized we can now try to develop a method to reduce or eliminate SIN in DIAL systems.

  13. Acrylonitrile-Induced Oxidative Stress and Oxidative DNA Damage in Male Sprague-Dawley Rats

    PubMed Central

    Kamendulis, Lisa M.; Klaunig, James E.

    2009-01-01

    Studies have demonstrated that the induction of oxidative stress may be involved in brain tumor induction in rats by acrylonitrile. The present study examined whether acrylonitrile induces oxidative stress and DNA damage in rats and whether blood can serve as a valid surrogate for the biomonitoring of oxidative stress induced by acrylonitrile in the exposed population. Male Sprague-Dawley rats were treated with 0, 3, 30, 100, and 200 ppm acrylonitrile in drinking water for 28 days. One group of rats were also coadministered N-acetyl cysteine (NAC) (0.3% in diet) with acrylonitrile (200 ppm in drinking water) to examine whether antioxidant supplementation was protective against acrylonitrile-induced oxidative stress. Direct DNA strand breakage in white blood cells (WBC) and brain was measured using the alkaline comet assay. Oxidative DNA damage in WBC and brain was evaluated using formamidopyrimidine DNA glycosylase (fpg)-modified comet assay and with high-performance liquid chromatography-electrochemical detection. No significant increase in direct DNA strand breaks was observed in brain and WBC from acrylonitrile-treated rats. However, oxidative DNA damage (fpg comet and 8′hydroxyl-2-deoxyguanosine) in brain and WBC was increased in a dose-dependent manner. In addition, plasma levels of reactive oxygen species (ROS) increased in rats administered acrylonitrile. Dietary supplementation with NAC prevented acrylonitrile-induced oxidative DNA damage in brain and WBC. A slight, but significant, decrease in the GSH:GSSG ratio was seen in brain at acrylonitrile doses > 30 ppm. These results provide additional support that the mode of action for acrylonitrile-induced astrocytomas involves the induction of oxidative stress and damage. Significant associations were seen between oxidative DNA damage in WBC and brain, ROS formation in plasma, and the reported tumor incidences. Since oxidative DNA damage in brain correlated with oxidative damage in WBC, these results suggest

  14. Specificity of mutations induced by incorporation of oxidized dNTPs into DNA by human DNA polymerase eta.

    PubMed

    Hidaka, Katsuhiko; Yamada, Masami; Kamiya, Hiroyuki; Masutani, Chikahide; Harashima, Hideyoshi; Hanaoka, Fumio; Nohmi, Takehiko

    2008-03-01

    Aberrant oxidation is a property of many tumor cells. Oxidation of DNA precursors, i.e., deoxynucleotide triphosphates (dNTPs), as well as DNA is a major cause of genome instability. Here, we report that human DNA polymerase eta (h Poleta) incorporates oxidized dNTPs, i.e., 2-hydroxy-2'-deoxyadenosine 5'-triphosphate (2-OH-dATP) and 8-hydroxy-2'-deoxyguanosine 5'-triphosphate (8-OH-dGTP), into DNA in an erroneous and efficient manner, thereby inducing various types of mutations during in vitro gap-filling DNA synthesis. When 2-OH-dATP was present at a concentration equal to those of the four normal dNTPs in the reaction mixture, DNA synthesis by h Poleta enhanced the frequency of G-to-T transversions eight-fold higher than that of the transversions in control where only the normal dNTPs were present. When 8-OH-dGTP was present at an equimolar concentration to the normal dNTPs, it enhanced the frequency of A-to-C transversions 17-fold higher than the control. It also increased the frequency of C-to-A transversions about two-fold. These results suggest that h Poleta incorporates 2-OH-dATP opposite template G and incorporates 8-OH-dGTP opposite template A and slightly opposite template C during DNA synthesis. Besides base substitutions, h Poleta enhanced the frequency of single-base frameshifts and deletions with the size of more than 100 base pairs when 8-OH-dGTP was present in the reaction mixture. Since h Poleta is present in replication foci even without exogenous DNA damage, we suggest that h Poleta may be involved in induction of various types of mutations through the erroneous and efficient incorporation of oxidized dNTPs into DNA in human cells.

  15. Three-Dimensional Mapping of Ozone-Induced Injury in the Nasal Airways of Monkeys Using Magnetic Resonance Imaging and Morphometric Techniques

    SciTech Connect

    Carey, Stephen A.; Minard, Kevin R.; Trease, Lynn L.; Wagner, James G.; Garcia, Guilherme M.; Ballinger, Carol A.; Kimbell, Julia; Plopper, Charles G.; Corley, Rick A.; Postlewait, Ed; Harkema, Jack R.

    2007-03-01

    ABSTRACT Age-related changes in gross and microscopic structure of the nasal cavity can alter local tissue susceptibility as well as the dose of inhaled toxicant delivered to susceptible sites. This article describes a novel method for the use of magnetic resonance imaging, 3-dimensional airway modeling, and morphometric techniques to characterize the distribution and magnitude of ozone-induced nasal injury in infant monkeys. Using this method, we are able to generate age-specific, 3-dimensional, epithelial maps of the nasal airways of infant Rhesus macaques. The principal nasal lesions observed in this primate model of ozone-induced nasal toxicology were neutrophilic rhinitis, along with necrosis and exfoliation of the epithelium lining the anterior maxilloturbinate. These lesions, induced by acute or cyclic (episodic) exposures, were examined by light microscopy, quantified by morphometric techniques, and mapped on 3-dimensional models of the nasal airways. Here, we describe the histopathologic, imaging, and computational biology methods developed to efficiently characterize, localize, quantify, and map these nasal lesions. By combining these techniques, the location and severity of the nasal epithelial injury were correlated with epithelial type, nasal airway geometry, and local biochemical and molecular changes on an individual animal basis. These correlations are critical for accurate predictive modeling of exposure-dose-response relationships in the nasal airways, and subsequent extrapolation of nasal findings in animals to humans for developing risk assessment.

  16. Double strand-breaks and DNA-to-protein cross-links induced by fast neutrons in bacteriophage DNA.

    PubMed

    Hawkins, R B

    1979-01-01

    Coliphage T7 was suspended in tryptone broth and exposed to a mixture of fast neutrons and gamma radiation. Plaque survival, double strand-breaks and DNA-to-protein cross-linkage were examined and the results compared with those found in phage exposed to gamma radiation alone. Neutral sucrose density sedimentation patterns indicate that neutron-induced double strand-breaks sometimes occur in clusters of more than 100 in the same phage and that the effeciency with which double strand-breaks form is about 50 times that of gamma-induced double strand-breaks. Neutron-induced protein-to-DNA cross-links probably also occur in clusters with enhanced efficiency relative to low LET radiation.

  17. The Energetic Contribution of Induced Electrostatic Asymmetry to DNA Bending by a Site-Specific Protein

    PubMed Central

    Hancock, Stephen P.; Hiller, David A.; Perona, John J.; Jen-Jacobson, Linda

    2012-01-01

    DNA bending can be promoted by reducing the net negative electrostatic potential around phosphates on one face of the DNA, such that electrostatic repulsion among phosphates on the opposite face drives bending toward the less negative surface. To provide the first assessment of the energetic contribution to DNA bending when electrostatic asymmetry is induced by a site-specific DNA binding protein, we manipulated the electrostatics in the EcoRV endonuclease-DNA complex by mutation of cationic sidechains that contact DNA phosphates and/or by replacing a selected phosphate in each strand with uncharged methylphosphonate. Reducing the net negative charge at two symmetrically located phosphates on the concave DNA face contributes −2.3 to −0.9 kcal/mol (depending on position) to complex formation. In contrast, reducing negative charge on the opposing convex face produces a penalty of +1.3 kcal/mol. Förster resonance energy transfer experiments show that the extent of axial DNA bending (about 50°) is little affected in the modified complexes, implying that modification affects the energetic cost but not the extent of DNA bending. Kinetic studies show that favorable effects of induced electrostatic asymmetry on equilibrium binding derive primarily from a reduced rate of complex dissociation, suggesting stabilization of the specific complex between protein and markedly bent DNA. A smaller increase in the association rate may suggest that the DNA in the initial encounter complex is mildly bent. The data imply that protein-induced electrostatic asymmetry makes a significant contribution to DNA bending, but is not itself sufficient to drive full bending in the specific EcoRV-DNA complex. PMID:21167173

  18. Stacking of Short DNA Induces the Gyroid Cubic-to-Inverted Hexagonal Phase Transition in Lipid–DNA Complexes

    PubMed Central

    Leal, Cecília; Ewert, Kai K.; Bouxsein, Nathan F.; Shirazi, Rahau S.; Li, Youli; Safinya, Cyrus R.

    2012-01-01

    Lyotropic phases of amphiphiles are a prototypical example of self-assemblies. Their structure is generally determined by amphiphile shape and their phase transitions are primarily governed by composition. In this paper, we demonstrate a new paradigm for membrane shape control where the electrostatic coupling of charged membranes to short DNA (sDNA), with tunable temperature-dependent end-to-end stacking interactions, enables switching between the inverted gyroid cubic structure (QIIG) and the inverted hexagonal phase (HIIC). We investigated the structural shape transitions induced in the QIIG phase upon complexation with a series of sDNAs (5, 11, 24, and 48 bp) with three types of end structure (“sticky” adenine (A)–thymine (T) (dAdT) overhangs, no overhang (blunt), and “nonsticky” dTdT overhangs) using synchrotron small-angle X-ray scattering. Very short 5 bp sDNA with dAdT overhangs and blunt ends induce coexistence of the QIIG and the HIIC phase, with the fraction of QIIG increasing with temperature. Phase coexistence for blunt 5 bp sDNA is observed from 27 °C to about 65 °C, where the HIIC phase disappears and the temperature dependence of the lattice spacing of the QIIG phase indicates that the sDNA duplexes melt into single strands. The only other sDNA for which melting is observed is 5 bp sDNA with dTdT overhangs, which forms the QIIG phase throughout the studied range of temperature (27 °C to 85.2 °C). The longer 11 bp sDNA forms coexisting QIIG and HIIC phases (with the fraction of QIIG again increasing with temperature) only for “nonsticky” dTdT overhangs, while dAdT overhangs and blunt ends exclusively template the HIIC phase. For 24 and 48 bp sDNAs the HIIC phase replaces the QIIG phase at all investigated temperatures, independent of sDNA end structure. Our work demonstrates how the combined effects of sDNA length and end structure (which determine the temperature-dependent stacking length) tune the phase behavior of the complexes

  19. DNA strand scission induced by a non-thermal atmospheric pressure plasma jet.

    PubMed

    Ptasińska, Sylwia; Bahnev, Blagovest; Stypczyńska, Agnieszka; Bowden, Mark; Mason, Nigel J; Braithwaite, Nicholas St J

    2010-07-28

    The DNA molecule is observed to be very susceptible to short-term exposures to an atmospheric pressure plasma jet. The DNA damage induced by plasma-generated species, i.e. excited atoms, charged particles, electrons and UV light is determined.

  20. Oleandrin induces DNA damage responses in cancer cells by suppressing the expression of Rad51

    PubMed Central

    Bao, Zhengqiang; Tian, Baoping; Wang, Xiaohui; Feng, Hanrong; Liang, Ye; Chen, Zhihua; Li, Wen; Shen, Huahao; Ying, Songmin

    2016-01-01

    Oleandrin is a monomeric compound extracted from leaves and seeds of Nerium oleander. It had been reported that oleandrin could effectively inhibit the growth of human cancer cells. However, the specific mechanisms of the oleandrin-induced anti-tumor effects remain largely unclear. Genomic instability is one of the main features of cancer cells, it can be the combined effect of DNA damage and tumour-specific DNA repair defects. DNA damage plays important roles during tumorigenesis. In fact, most of the current chemotherapy agents were designed to kill cancer cells by inducing DNA damage. In this study, we found that oleandrin was effective to induce apoptosis in cancer cells, and cause rapid DNA damage response, represented by nuclear RPA (Replication Protein A, a single strand DNA binding protein) and γH2AX(a marker for DNA double strand breaks) foci formation. Interestingly, expression of RAD51, a key protein involved in homologous recombination (HR), was suppressed while XRCC1 was up-regulated in oleandrin treated cancer cells. These results suggested that XRCC1 may play a predominant role in repairing oleandrin-induced DNA damage. Collectively, oleandrin may be a potential anti-tumor agent by suppressing the expression of Rad51. PMID:27449097

  1. Cleavage enhancement of specific chemical bonds in DNA-Cisplatin complexes induced by X-rays

    NASA Astrophysics Data System (ADS)

    Zheng, Yi; Yao, Xiaobin; Luo, Xinglan; Fu, Xianzhi

    2014-04-01

    The chemical bond transformation of cisplatin-DNA complexes can be probed efficiently by XPS which provides a concomitant X-ray irradiation source as well. The presence to Pt could considerably increase formation of the SE induced by X-ray and that the further interaction of these LEE with DNA leads to the enhancement of bond cleavages.

  2. Chromatin Structure Following UV-Induced DNA Damage—Repair or Death?

    PubMed Central

    Farrell, Andrew W.; Halliday, Gary M.; Lyons, James Guy

    2011-01-01

    In eukaryotes, DNA is compacted into a complex structure known as chromatin. The unravelling of DNA is a crucial step in DNA repair, replication, transcription and recombination as this allows access to DNA for these processes. Failure to package DNA into the nucleosome, the individual unit of chromatin, can lead to genomic instability, driving a cell into apoptosis, senescence, or cellular proliferation. Ultraviolet (UV) radiation damage causes destabilisation of chromatin integrity. UV irradiation induces DNA damage such as photolesions and subjects the chromatin to substantial rearrangements, causing the arrest of transcription forks and cell cycle arrest. Highly conserved processes known as nucleotide and base excision repair (NER and BER) then begin to repair these lesions. However, if DNA repair fails, the cell may be forced into apoptosis. The modification of various histones as well as nucleosome remodelling via ATP-dependent chromatin remodelling complexes are required not only to repair these UV-induced DNA lesions, but also for apoptosis signalling. Histone modifications and nucleosome remodelling in response to UV also lead to the recruitment of various repair and pro-apoptotic proteins. Thus, the way in which a cell responds to UV irradiation via these modifications is important in determining its fate. Failure of these DNA damage response steps can lead to cellular proliferation and oncogenic development, causing skin cancer, hence these chromatin changes are critical for a proper response to UV-induced injury. PMID:22174650

  3. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  4. CDK1 Enhances Mitochondrial Bioenergetics for Radiation-Induced DNA Repair

    PubMed Central

    Qin, Lili; Fan, Ming; Candas, Demet; Jiang, Guochun; Papadopoulos, Stelios; Tian, Lin; Woloschak, Gayle; Grdina, David J.; Li, Jian Jian

    2015-01-01

    SUMMARY Nuclear DNA repair capacity is a critical determinant of cell fate under genotoxic stress conditions. DNA repair is a well-defined energy consuming process; however, it is unclear how DNA repair is fueled and whether mitochondrial energy production contributes to nuclear DNA repair. Here, we report a dynamic enhancement of oxygen consumption and mitochondrial ATP generation in irradiated normal cells, paralleled with increased mitochondrial relocation of cell cycle kinase CDK1 and nuclear DNA repair. The basal and radiation-induced mitochondrial ATP generation is significantly reduced in cells harboring CDK1 phosphorylation deficient mutant complex I subunits. Similarly, mitochondrial ATP generation and nuclear DNA repair are also severely compromised in cells harboring mitochondrial-targeted kinase deficient CDK1. These results demonstrate a mechanism governing the communication between mitochondria and nucleus, by which CDK1 boosts mitochondrial bioenergetics to meet the increased cellular fuel demand for DNA repair and cell survival under genotoxic stress. PMID:26670043

  5. Parvovirus B19 Nonstructural Protein-Induced Damage of Cellular DNA and Resultant Apoptosis

    PubMed Central

    Poole, Brian D.; Kivovich, Violetta; Gilbert, Leona; Naides, Stanley J.

    2011-01-01

    Parvovirus B19 is a widespread virus with diverse clinical presentations. The viral nonstructural protein, NS1, binds to and cleaves the viral genome, and induces apoptosis when transfected into nonpermissive cells, such as hepatocytes. We hypothesized that the cytotoxicity of NS1 in such cells results from chromosomal DNA damage caused by the DNA-nicking and DNA-attaching activities of NS1. Upon testing this hypothesis, we found that NS1 covalently binds to cellular DNA and is modified by PARP, an enzyme involved in repairing single-stranded DNA nicks. We furthermore discovered that the DNA nick repair pathway initiated by poly(ADPribose)polymerase and the DNA repair pathways initiated by ATM/ATR are necessary for efficient apoptosis resulting from NS1 expression. PMID:21278893

  6. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  7. Diallyl sulfide inhibits diethylstilbesterol-induced DNA adducts in the breast of female ACI rats.

    PubMed

    Green, M; Wilson, C; Newell, O; Sadrud-Din, S; Thomas, R

    2005-09-01

    Diethylstilbestrol (DES) is metabolized to reactive intermediates that produce DNA adducts and ultimately cancer. Diallyl sulfide (DAS) has been shown to inhibit the metabolism of several procarcinogens. The ability of DES to produce DNA adducts in microsomal, mitochondrial, and nuclear in vitro metabolic systems and in the breast of female ACI rats, as well as ability of DAS to inhibit DNA adducts were investigated. Microsomes, mitochondria, and nuclei isolated from breast tissue of female ACI rats were used to catalyze oxidation reactions. Female ACI rats were treated i.p. as follows: (1) corn oil, (2) 200mg/kg DES, (3) 200mg/kg DES/200mg/kg of DAS, (4) 200mg/kg DES/400mg/kg DAS. DES produced DNA adducts in each metabolic system. The relative adduct levels were 2.1 x 10(-4), 6.2 x 10(-6), and 2.9 x 10(-7) in microsomal, mitochondrial, and nuclear reactions, respectively. DAS inhibited DNA adducts in each metabolic system. The percent inhibition ranged from 86% in microsomes to 93% in nuclei. DES produced DNA adducts in mtDNA and nDNA. DAS completely inhibited the DES-induced mtDNA adducts and caused a dose dependent decrease in nDNA adduct formation. These findings suggest that DAS could inhibit DES-induced breast cancer by inhibiting its metabolism.

  8. Acute pulmonary toxicity of urban particulate matter and ozone.

    PubMed Central

    Vincent, R.; Bjarnason, S. G.; Adamson, I. Y.; Hedgecock, C.; Kumarathasan, P.; Guénette, J.; Potvin, M.; Goegan, P.; Bouthillier, L.

    1997-01-01

    We have investigated the acute lung toxicity of urban particulate matter in interaction with ozone. Rats were exposed for 4 hours to clean air, ozone (0.8 ppm), the urban dust EHC-93 (5 mg/m3 or 50 mg/m3), or ozone in combination with urban dust. The animals were returned to clean air for 32 hours and then injected (intraperitoneally) with [3H]thymidine to label proliferating cells and killed after 90 minutes. The lungs were fixed by inflation, embedded in glycol methacrylate, and processed for light microscopy autoradiography. Cell labeling was low in bronchioles (0.14 +/- 0.04%) and parenchyma (0.13 +/- 0.02%) of air control animals. Inhalation of EHC-93 alone did not induce cell labeling. Ozone alone increased (P < 0.05) cell labeling (bronchioles, 0.42 +/- 0.16%; parenchyma, 0.57 +/- 0.21%), in line with an acute reparative cell proliferation. The effects of ozone were clearly potentiated by co-exposure with either the low (3.31 +/- 0.31%; 0.99 +/- 0.18%) or the high (4.45 +/- 0.51%; 1.47 +/- 0.18%) concentrations of urban dust (ozone X EHC-93, P < 0.05). Cellular changes were most notable in the epithelia of terminal bronchioles and alveolar ducts and did not distribute to the distal parenchyma. Enhanced DNA synthesis indicates that particulate matter from ambient air can exacerbate epithelial lesions in the lungs. This may extend beyond air pollutant interactions, such as to effects of inhaled particles in the lungs of compromised individuals. Images Figure 1 PMID:9403707

  9. Ozone sensitivity in hybrid poplar correlates with insensitivity to both salicylic acid and jasmonic acid. The role of programmed cell death in lesion formation.

    PubMed

    Koch, J R; Creelman, R A; Eshita, S M; Seskar, M; Mullet, J E; Davis, K R

    2000-06-01

    Our earlier studies demonstrated that the ozone-sensitive hybrid poplar clone NE-388 displays an attenuated level of ozone-, wound-, and phytopathogen-induced defense gene expression. To determine if this reduced gene activation involves signal transduction pathways dependent on salicylic acid (SA) and/or jasmonic acid (JA), we compared the responses of NE-388 and an ozone-tolerant clone, NE-245, to these signal molecules. JA levels increased in both clones in response to ozone, but only minimal increases in SA levels were measured for either clone. Treatment with SA and methyl jasmonate induced defense gene expression only in NE-245, indicating that NE-388 is insensitive to these signal molecules. DNA fragmentation, an indicator of programmed cell death (PCD), was detected in NE-245 treated with either ozone or an avirulent phytopathogen, but was not detected in NE-388. We conclude that these clones undergo two distinct mechanisms of ozone-induced lesion formation. In NE-388, lesions appear to be due to toxic cell death resulting from a limited ability to perceive and subsequently activate SA- and/or JA-mediated antioxidant defense responses. In NE-245, SA-dependent PCD precedes lesion formation via a process related to the PCD pathway activated by phytopathogenic bacteria. These results support the hypothesis that ozone triggers a hypersensitive response.

  10. Ozone adsorption on carbon nanoparticles

    NASA Astrophysics Data System (ADS)

    Chassard, Guillaume; Gosselin, Sylvie; Visez, Nicolas; Petitprez, Denis

    2014-05-01

    Carbonaceous particles produced by incomplete combustion or thermal decomposition of hydrocarbons are ubiquitous in the atmosphere. On these particles are adsorbed hundreds of chemical species. Those of great concern to health are polycyclic aromatic hydrocarbons (PAHs). During atmospheric transport, particulate PAHs react with gaseous oxidants. The induced chemical transformations may change toxicity and hygroscopicity of these potentially inhalable particles. The interaction between ozone and carbon particles has been extensively investigated in literature. However ozone adsorption and surface reaction mechanisms are still ambiguous. Some studies described a fast catalytic decomposition of ozone initiated by an atomic oxygen chemisorption followed by a molecular oxygen release [1-3]. Others suggested a reversible ozone adsorption according to Langmuir-type behaviour [4,5]. The aim of this present study is a better understanding of ozone interaction with carbon surfaces. An aerosol of carbon nanoparticles was generated by flowing synthetic air in a glass tube containing pure carbon (primary particles < 50 nm), under magnetic stirring. The aerosol was then mixed with ozone in an aerosol flow tube. Ozone uptake experiments were performed with different particles concentrations with a fixed ozone concentration. The influence of several factors on kinetics was examined: initial ozone concentration, particle size (50 nm ≤ Dp ≤ 200 nm) and competitive adsorption (with probe molecule and water). The effect of initial ozone concentration was first studied. Accordingly to literature, it has been observed that the number of gas-phase ozone molecules lost per unit particle surface area tends towards a plateau for high ozone concentration suggesting a reversible ozone adsorption according to a Langmuir mechanism. We calculated the initial reaction probability between O3 and carbon particles.An initial uptake coefficient of 1.10-4 was obtained. Similar experiments were

  11. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.

    PubMed

    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R

    2013-12-01

    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage.

  12. Ozone-Induced Pulmonary Injury and Vascular Contractility are Differentially Impacted by Coconut, Fish, and Olive Oil-Rich Diets

    EPA Science Inventory

    Pulmonary and systemic effects of ozone (O3) are mediated by hypothalamus pituitary adrenal (HPA)-axis activation. Fish oil (FO) and olive oil (OO) dietary supplementation have several cardioprotective benefits, but it is not established if these supplements can protect against t...

  13. Ozone-induced changes in oxidative stress parameters in brains of adult, middle-age, and senescent Brown Norway rats

    EPA Science Inventory

    Understanding life-stage susceptibility is a critical part of community based human health risk assessment following chemical exposure. Recently there is growing concern over a common air pollutant, ozone (03), and adverse health effects including dysfunction of the pulmonary, ca...

  14. Impacts of Foreign, Domestic, and State-Level Emissions on Ozone-Induced Vegetation Loss in the United States.

    PubMed

    Lapina, Kateryna; Henze, Daven K; Milford, Jana B; Travis, Katherine

    2016-01-19

    Exposure to elevated levels of ozone leads to yield reduction in agricultural crops and biomass loss in trees. Here, we quantify the impact of ozone pollution on two major U.S. crops, wheat and soybean, and two ozone-sensitive tree species, ponderosa pine and quaking aspen, using simulations with the GEOS-Chem model for 2010. Using previously established exposure-response functions, we estimate nationwide relative yield reductions of 4.9% for wheat and 6.7% for soybean, and relative biomass loss of 2.5% and 2.9% for ponderosa pine and aspen seedlings, respectively. Adjoint model sensitivities are used to estimate the impact of emissions sources from different locations, species, and sectors. We find that the nationwide relative loss in each vegetation type is influenced most by domestic anthropogenic NOx (>75%). Long-range transport from foreign sources is small relative to domestic influences. More than half of the anthropogenic NOx responsible for vegetation damage originates from outside the states where the damage occurs. Texas and Missouri are the highest contributors to the nationwide loss of wheat and soybean, respectively. California "exports" ozone damage for all types of vegetation studied, due to its location, high share of anthropogenic NOx, and a relatively low share of vegetation.

  15. The Role of Underlying Type 2 Diabetes Mellitus and Obesity in Ozone-Induced Pulmonary Injury and Metabolic Impairment

    EPA Science Inventory

    RATIONALE: A growing body of evidence indicates an association between air pollution exposure and metabolic disorders such as obesity and type 2 diabetes mellitus (T2DM). We have recently demonstrated that an acute exposure to ozone in metabolically normal rat strains produces h...

  16. Irrigation of the abdominal cavity in the treatment of experimentally induced microbial peritonitis: Efficacy of ozonated saline

    SciTech Connect

    Ozmen, V.; Thomas, W.O.; Healy, J.T.; Fish, J.M.; Chambers, R.; Tacchi, E.; Nichols, R.L.; Flint, L.M.; Ferrara, J.J. )

    1993-05-01

    Ozone is an oxidizing agent possessing potent in vitro microbicidal capacity. This study was designed to address the extent to which irrigation of the contaminated abdominal cavity using a saline solution primed with ozone is effective in reducing morbidity and mortality. Gelatin capsules containing different quantities of a premixed slurry of filtered human fecal material were implanted in the peritoneal cavities of a preliminary series of rats. Three inocula concentrations were selected for later experiments, based upon their ability to produce morbid consequences: (1) high (100% 1-day mortality), (2) medium (70% 3-day mortality, 100% abscess rate in survivors), and (3) low (100% 10-day survival, 100% abscess rate). Fecal and abscess bacteriology were similar in all rats. The peritoneal cavities of 240 rats then underwent fecal-capsule implantation (three groups of 80 rats/inoculum concentration). At celiotomy 4 hours later, equal numbers of rats from each group were randomly assigned to one of four protocols: (1) no irrigation, (2) normal saline irrigation, (3) saline-cephalothin irrigation, and (4) ozonated saline irrigation. Each treatment lasted 5 minutes, using 100 ml of irrigation fluid. Mortality was significantly reduced when, in lieu of no irrigation, any of the irrigation solutions were used. Additionally, ozonated saline statistically proved the most effective irrigating solution for reducing abscess formation in survivors.

  17. Crowding-induced Cooperativity in DNA Surface Hybridization

    NASA Astrophysics Data System (ADS)

    Lei, Qun-Li; Ren, Chun-Lai; Su, Xiao-Hang; Ma, Yu-Qiang

    2015-04-01

    High density DNA brush is not only used to model cellular crowding, but also has a wide application in DNA-functionalized materials. Experiments have shown complicated cooperative hybridization/melting phenomena in these systems, raising the question that how molecular crowding influences DNA hybridization. In this work, a theoretical modeling including all possible inter and intramolecular interactions, as well as molecular details for different species, is proposed. We find that molecular crowding can lead to two distinct cooperative behaviours: negatively cooperative hybridization marked by a broader transition width, and positively cooperative hybridization with a sharper transition, well reconciling the experimental findings. Moreover, a phase transition as a result of positive cooperativity is also found. Our study provides new insights in crowding and compartmentation in cell, and has the potential value in controlling surface morphologies of DNA functionalized nano-particles.

  18. Crowding-induced Cooperativity in DNA Surface Hybridization

    PubMed Central

    Lei, Qun-li; Ren, Chun-lai; Su, Xiao-hang; Ma, Yu-qiang

    2015-01-01

    High density DNA brush is not only used to model cellular crowding, but also has a wide application in DNA-functionalized materials. Experiments have shown complicated cooperative hybridization/melting phenomena in these systems, raising the question that how molecular crowding influences DNA hybridization. In this work, a theoretical modeling including all possible inter and intramolecular interactions, as well as molecular details for different species, is proposed. We find that molecular crowding can lead to two distinct cooperative behaviours: negatively cooperative hybridization marked by a broader transition width, and positively cooperative hybridization with a sharper transition, well reconciling the experimental findings. Moreover, a phase transition as a result of positive cooperativity is also found. Our study provides new insights in crowding and compartmentation in cell, and has the potential value in controlling surface morphologies of DNA functionalized nano-particles. PMID:25875056

  19. Methylation-induced blocks to in vitro DNA replication.

    PubMed

    Larson, K; Sahm, J; Shenkar, R; Strauss, B

    1985-01-01

    Single-stranded primed M13mp2 templates and double-stranded templates were treated with either dimethyl sulfate (DMS) or N-methyl-N'-nitro-N-nitrosoguanidine and used for DNA synthesis in vitro. Methylation inhibits the ability of the molecules to serve as templates. When either E. coli DNA polymerase I or AMV reverse transcriptase were used as polymerases, DNA synthesis terminated one nucleotide 3' to the site of adenine residues in the template. Heating of the templates resulted in the appearance of additional termination bands one nucleotide before the site of G's in the template. We assume that methylated A's but not methylated G's are blocks to in vitro DNA synthesis and that heating converts a portion of the sites of methylated G to AP sites which are blocks to synthesis.

  20. RNA m(6)A methylation regulates the ultraviolet-induced DNA damage response.

    PubMed

    Xiang, Yang; Laurent, Benoit; Hsu, Chih-Hung; Nachtergaele, Sigrid; Lu, Zhike; Sheng, Wanqiang; Xu, Chuanyun; Chen, Hao; Ouyang, Jian; Wang, Siqing; Ling, Dominic; Hsu, Pang-Hung; Zou, Lee; Jambhekar, Ashwini; He, Chuan; Shi, Yang

    2017-03-23

    Cell proliferation and survival require the faithful maintenance and propagation of genetic information, which are threatened by the ubiquitous sources of DNA damage present intracellularly and in the external environment. A system of DNA repair, called the DNA damage response, detects and repairs damaged DNA and prevents cell division until the repair is complete. Here we report that methylation at the 6 position of adenosine (m(6)A) in RNA is rapidly (within 2 min) and transiently induced at DNA damage sites in response to ultraviolet irradiation. This modification occurs on numerous poly(A)(+) transcripts and is regulated by the methyltransferase METTL3 (methyltransferase-like 3) and the demethylase FTO (fat mass and obesity-associated protein). In the absence of METTL3 catalytic activity, cells showed delayed repair of ultraviolet-induced cyclobutane pyrimidine adducts and elevated sensitivity to ultraviolet, demonstrating the importance of m(6)A in the ultraviolet-responsive DNA damage response. Multiple DNA polymerases are involved in the ultraviolet response, some of which resynthesize DNA after the lesion has been excised by the nucleotide excision repair pathway, while others participate in trans-lesion synthesis to allow replication past damaged lesions in S phase. DNA polymerase κ (Pol κ), which has been implicated in both nucleotide excision repair and trans-lesion synthesis, required the catalytic activity of METTL3 for immediate localization to ultraviolet-induced DNA damage sites. Importantly, Pol κ overexpression qualitatively suppressed the cyclobutane pyrimidine removal defect associated with METTL3 loss. Thus, we have uncovered a novel function for RNA m(6)A modification in the ultraviolet-induced DNA damage response, and our findings collectively support a model in which m(6)A RNA serves as a beacon for the selective, rapid recruitment of Pol κ to damage sites to facilitate repair and cell survival.

  1. Correlation-induced DNA adsorption on like-charged membranes

    NASA Astrophysics Data System (ADS)

    Buyukdagli, Sahin; Blossey, Ralf

    2016-10-01

    The adsorption of DNA or other polyelectrolyte molecules on charged membranes is a recurrent motif in soft matter and bionanotechnological systems. Two typical situations encountered are the deposition of single DNA chains onto substrates for further analysis, e.g., by force microscopy, or the pulling of polyelectrolytes into membrane nanopores, as in sequencing applications. In this paper, we present a theoretical analysis of such scenarios based on the self-consistent field theory approach, which allows us to address the important effect of charge correlations. We calculate the grand potential of a stiff polyelectrolyte immersed in an electrolyte in contact with a negatively charged dielectric membrane. For the sake of conciseness, we neglect conformational polymer fluctuations and model the molecule as a rigid charged line. At strongly charged membranes, the adsorbed counterions enhance the screening ability of the interfacial region. In the presence of highly charged polymers such as double-stranded DNA molecules close to the membrane, this enhanced interfacial screening dominates the mean-field level DNA-membrane repulsion and results in the adsorption of the DNA molecule to the surface. This picture provides a simple explanation for the recently observed DNA binding onto similarly charged substrates [G. L.-Caballero et al., Soft Matter 10, 2805 (2014), 10.1039/c3sm52428k] and points out charge correlations as a non-negligible ingredient of polymer-surface interactions.

  2. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.

    PubMed

    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott

    2016-05-05

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons.

  3. Estradiol prevents ozone-induced increases in brain lipid peroxidation and impaired social recognition memory in female rats.

    PubMed

    Guevara-Guzmán, R; Arriaga, V; Kendrick, K M; Bernal, C; Vega, X; Mercado-Gómez, O F; Rivas-Arancibia, S

    2009-03-31

    There is increasing concern about the neurodegenerative and behavioral consequences of ozone pollution in industrialized urban centers throughout the world and that women may be more susceptible to brain neurodegenerative disorders. In the present study we have investigated the effects of chronic (30 or 60 days) exposure to ozone on olfactory perception and memory and on levels of lipid peroxidation, alpha and beta estrogen receptors and dopamine beta-hydroxylase in the olfactory bulb in ovariectomized female rats. The ability of 17beta-estradiol to prevent these effects was then assessed. Results showed that ozone exposure for 30 or 60 days impaired formation/retention of a selective olfactory recognition memory 120 min after exposure to a juvenile stimulus animal with the effect at 60 days being significantly greater than at 30 days. They also showed impaired speed in locating a buried chocolate reward after 60 days of ozone exposure indicating some loss of olfactory perception. These functional impairments could all be prevented by coincident estradiol treatment. In the olfactory bulb, levels of lipid peroxidation were increased at both 30- and 60-day time-points and numbers of cells with immunohistochemical staining for alpha and beta estrogen receptors, and dopamine beta-hydroxylase were reduced as were alpha and beta estrogen receptor protein levels. These effects were prevented by estradiol treatment. Oxidative stress damage caused by chronic exposure to ozone does therefore impair olfactory perception and social recognition memory and may do so by reducing noradrenergic and estrogen receptor activity in the olfactory bulb. That these effects can be prevented by estradiol treatment suggests increased susceptibility to neurodegenerative disorders in aging women may be contributed to by reduced estrogen levels post-menopause.

  4. Changes induced by ozone and ultraviolet light in type I collagen. Bovine Achilles tendon collagen versus rat tail tendon collagen.

    PubMed

    Fujimori, E

    1985-10-15

    High-molecular-mass aggregates were made soluble from insoluble collagens of bovine Achilles tendon and rat tail tendon by limited thermal hydrolysis. These polymeric collagen aggregates were cross-linked by 390-nm-fluorescent 3-hydroxy-pyridinium residues (excited at 325 nm) in the former tendon and by unknown non-fluorescent residues in the latter. With the solubilized insoluble-collagens from both tendons, as well as with acid-soluble collagen from rat tail tendon, other 350-385-nm fluorescence intensities (excited at 300 nm) were found to be higher in monomeric chains than in dimeric and polymeric chains. Low levels of ozone inhibited fibril formation of acid-soluble collagen particularly from young rat tail tendon, reacting with tyrosine residues and the 350-385-nm fluorophores. Aldehyde groups, involved in cross-linking, were not effectively modified by ozone. beta-Components (alpha-chain dimers) were not efficiently dissociated even by higher doses of ozone compared to gamma-components (alpha-chain trimers). Polymeric chain aggregates from bovine Achilles tendon collagen, whose 3-hydroxy-pyridinium cross-links are cleaved by ozone, were more readily dissociated by ozone than those from rat tail tendon collagen. Ultraviolet (300-nm) light, which destroyed the 350-385-nm fluorophores, inhibited fibril formation less effectively than ultraviolet (275-nm) light, which is absorbed by tyrosine residues, and did not dissociate collagen polymers from rat tail tendon. On the other hand, ultraviolet (320-nm) light, absorbed by 3-hydroxy-pyridinium cross-links which were rapidly photolyzed, partially dissociated polymeric collagen aggregates from bovine Achilles tendon after subsequent heating.

  5. UV-Induced Adenine Radicals Induced in DNA A-Tracts: Spectral and Dynamical Characterization.

    PubMed

    Banyasz, Akos; Ketola, Tiia-Maaria; Muñoz-Losa, Aurora; Rishi, Sunny; Adhikary, Amitava; Sevilla, Michael D; Martinez-Fernandez, Lara; Improta, Roberto; Markovitsi, Dimitra

    2016-10-06

    Adenyl radicals generated in DNA single and double strands, (dA)20 and (dA)20·(dT)20, by one- and two-photon ionization by 266 nm laser pulses decay at 600 nm with half-times of 1.0 ± 0.1 and 4 ± 1 ms, respectively. Though ionization initially forms the cation radical, the radicals detected for (dA)20 are quantitatively identified as N6-deprotonated adenyl radicals by their absorption spectrum, which is computed quantum mechanically employing TD-DFT. Theoretical calculations show that deprotonation of the cation radical induces only weak spectral changes, in line with the spectra of the adenyl radical cation and the deprotonated radical trapped in low temperature glasses.

  6. Non-Problematic Risks from Low-Dose Radiation-Induced DNA Damage Clusters

    PubMed Central

    Hayes, Daniel P.

    2008-01-01

    Radiation-induced DNA damage clusters have been proposed and are usually considered to pose the threat of serious biological damage. This has been attributed to DNA repair debilitation or cessation arising from the complexity of cluster damage. It will be shown here, contrary to both previous suggestions and perceived wisdom, that radiation induced damage clusters contribute to non-problematic risks in the low-dose, low-LET regime. The very complexity of cluster damage which inhibits and/or compromises DNA repair will ultimately be responsible for the elimination and/or diminution of precancer-ous and cancerous cells. PMID:18648573

  7. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    SciTech Connect

    Heilbronn, R.; zur Hausen, H. )

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  8. Characterization of UVC-induced DNA damage in bloodstains: forensic implications.

    PubMed

    Hall, Ashley; Ballantyne, Jack

    2004-09-01

    The ability to detect DNA polymorphisms using molecular genetic techniques has revolutionized the forensic analysis of biological evidence. DNA typing now plays a critical role within the criminal justice system, but one of the limiting factors with the technology is that DNA isolated from biological stains recovered from the crime scene is sometimes so damaged as to be intractable to analysis. Potential remedies for damaged DNA are likely to be dependent upon the precise nature of the DNA damage present in any particular sample but, unfortunately, current knowledge of the biochemical nature, and the extent, of such DNA damage in dried biological stains is rudimentary. As a model for DNA damage assessment in biological stains recovered from crime scenes, we have subjected human bloodstains and naked DNA in the hydrated and dehydrated states to varying doses of UVC radiation. It was possible to damage the DNA sufficiently in a bloodstain to cause a standard autosomal short tandem repeat (STR) profile to be lost. However, a detailed analysis of the process, based upon assays developed to detect bipyrimidine photoproducts (BPPPs), single- and double-strand breaks, and DNA-DNA crosslinks, produced some unexpected findings. Contrary to the situation with living tissues or cells in culture, the predominant UVC-induced damage to DNA in bloodstains appears not to be pyrimidine dimers. Although some evidence for the presence of BPPPs and DNA crosslinks was obtained, the major form of UVC damage causing genetic profile loss appeared to be single-strand breaks. It was not possible, however, to preclude the possibility that a combination of damage types was responsible for the profile loss observed. We demonstrate here that a significant measure of protection against UVC-mediated genetic profile loss in dried biological stain material is afforded by the dehydrated state of the DNA and, to a lesser extent, the DNA cellular milieu.

  9. Use of RAPD to detect sodium arsenite-induced DNA damage in human lymphoblastoid cells.

    PubMed

    Lee, Yuan-Cho; Yang, Vivian C; Wang, Tsu-Shing

    2007-09-24

    Inorganic arsenic is a known human carcinogen, yet its mechanism of action remains unclear. Our previous study showed that arsenite significantly induces oxidative DNA adducts and DNA-protein cross-links in several mammalian cell lines. In the present study, we used the random amplified polymorphic DNA (RAPD) assay to evaluate the possible target in the genomic DNA of human lymphoblastoid cells that were exposed to sodium arsenite. Treatment with both 10 and 80 microM arsenite for 4h induced significant changes in RAPD profiles compared with the control pattern. Two 10-mer RAPD primers (D11 and F1) produced the most distinguishable banding profiles between arsenite-treated and control genomic DNA. The sequencing of four arsenite-sensitive RAPD bands showed that the RB1CC1 and PACE4 genes might be the DNA targets of sodium arsenite treatment. We propose that arsenite may induce sequence- or gene-specific damage and then change the RAPD profile in human lymphoblastoid cells. The results of our study also show that RAPD combined with other techniques is a good tool for detecting alterations in genomic DNA and for the direct screening of new molecular markers related to arsenite-induced carcinogenesis.

  10. Modification of tumour cell metabolism modulates sensitivity to Chk1 inhibitor-induced DNA damage

    PubMed Central

    Massey, Andrew J.

    2017-01-01

    Chk1 kinase inhibitors are currently under clinical investigation as potentiators of cytotoxic chemotherapy and demonstrate potent activity in combination with anti-metabolite drugs that increase replication stress through the inhibition of nucleotide or deoxyribonucleotide biosynthesis. Inhibiting other metabolic pathways critical for the supply of building blocks necessary to support DNA replication may lead to increased DNA damage and synergy with an inhibitor of Chk1. A screen of small molecule metabolism modulators identified combinatorial activity between a Chk1 inhibitor and chloroquine or the LDHA/LDHB inhibitor GSK 2837808A. Compounds, such as 2-deoxyglucose or 6-aminonicotinamide, that reduced the fraction of cells undergoing active replication rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage. Withdrawal of glucose or glutamine induced G1 and G2/M arrest without increasing DNA damage and reduced Chk1 expression and activation through autophosphorylation. This suggests the expression and activation of Chk1 kinase is associated with cells undergoing active DNA replication. Glutamine starvation rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage and reversal of the glutamine starvation restored the sensitivity of tumour cells to Chk1 inhibitor-induced DNA damage. Chk1 inhibitors may be a potentially useful therapeutic treatment for patients whose tumours contain a high fraction of replicating cells. PMID:28106079

  11. THE PROTEASOME REGULATES BACTERIAL CpG DNA-INDUCED SIGNALING PATHWAYS IN MURINE MACROPHAGES

    PubMed Central

    Gao, Jian Jun; Shen, Jing; Kolbert, Christopher; Raghavakaimal, Sreekumar; Papasian, Christopher J.; Qureshi, Asaf A.; Vogel, Stefanie N.; Morrison, David C.; Qureshi, Nilofer

    2010-01-01

    Our previous work has provided strong evidence that the proteasome is central to the vast majority of genes induced in mouse macrophages in response to lipopolysaccharide (LPS) stimulation. In the studies presented here, we evaluated the role of the macrophage proteasome in response to a second microbial product CpG DNA (unmethylated bacterial DNA). For these studies, we applied Affymetrix microarray analysis of RNA derived from murine macrophages stimulated with CpG DNA in the presence or absence of proteasome inhibitor, lactacystin. The results of these studies revealed that similar to LPS, a vast majority of those macrophage genes regulated by CpG DNA are also under the control of the proteasome at 4 h. In contrast to LPS stimulation, however, many of these genes were induced much later than 4 h, at 18 h, in response to CpG DNA. Lactacystin treatment of macrophages completely blocked the CpG DNA-induced gene expression of TNF-α and other genes involved in production of inflammatory mediators. These data strongly support the conclusion that, similar to LPS, the macrophage proteasome is a key regulator of CpG DNA-induced signaling pathways. PMID:20160661

  12. Macrophage activation induced by Brucella DNA suppresses bacterial intracellular replication via enhancing NO production.

    PubMed

    Liu, Ning; Wang, Lin; Sun, Changjiang; Yang, Li; Tang, Bin; Sun, Wanchun; Peng, Qisheng

    2015-12-01

    Brucella DNA can be sensed by TLR9 on endosomal membrane and by cytosolic AIM2-inflammasome to induce proinflammatory cytokine production that contributes to partially activate innate immunity. Additionally, Brucella DNA has been identified to be able to act as a major bacterial component to induce type I IFN. However, the role of Brucella DNA in Brucella intracellular growth remains unknown. Here, we showed that stimulation with Brucella DNA promote macrophage activation in TLR9-dependent manner. Activated macrophages can suppresses wild type Brucella intracellular replication at early stage of infection via enhancing NO production. We also reported that activated macrophage promotes bactericidal function of macrophages infected with VirB-deficient Brucella at the early or late stage of infection. This study uncovers a novel function of Brucella DNA, which can help us further elucidate the mechanism of Brucella intracellular survival.

  13. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  14. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. II. Experimental detection

    SciTech Connect

    Rydberg, B.

    1996-02-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single {delta} rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA. In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [{sup 3}H]thymidine and exposed at 0{degrees}C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/pm. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated {open_quotes}regionally multiply damaged sites.{close_quotes} Postirradiation incubation at 37{degrees}C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown. 34 refs., 6 figs., 1 tab.

  15. Recombinant covalently closed circular hepatitis B virus DNA induces prolonged viral persistence in immunocompetent mice.

    PubMed

    Qi, Zhihua; Li, Gaiyun; Hu, Hao; Yang, Chunhui; Zhang, Xiaoming; Leng, Qibin; Xie, Youhua; Yu, Demin; Zhang, Xinxin; Gao, Yueqiu; Lan, Ke; Deng, Qiang

    2014-07-01

    It remains crucial to develop a laboratory model for studying hepatitis B virus (HBV) chronic infection. We hereby produced a recombinant covalently closed circular DNA (rcccDNA) in view of the key role of cccDNA in HBV persistence. A loxP-chimeric intron was engineered into a monomeric HBV genome in a precursor plasmid (prcccDNA), which was excised using Cre/loxP-mediated DNA recombination into a 3.3-kb rcccDNA in the nuclei of hepatocytes. The chimeric intron was spliced from RNA transcripts without interrupting the HBV life cycle. In cultured hepatoma cells, cotransfection of prcccDNA and pCMV-Cre (encoding Cre recombinase) resulted in accumulation of nuclear rcccDNA that was heat stable and epigenetically organized as a minichromosome. A mouse model of HBV infection was developed by hydrodynamic injection of prcccDNA. In the presence of Cre recombinase, rcccDNA was induced in the mouse liver with effective viral replication and expression, triggering a compromised T-cell response against HBV. Significant T-cell hyporesponsiveness occurred in mice receiving 4 μg prcccDNA, resulting in prolonged HBV antigenemia for up to 9 weeks. Persistent liver injury was observed as elevated alanine transaminase activity in serum and sustained inflammatory infiltration in the liver. Although a T-cell dysfunction was induced similarly, mice injected with a plasmid containing a linear HBV replicon showed rapid viral clearance within 2 weeks. Collectively, our study provides an innovative approach for producing a cccDNA surrogate that established HBV persistence in immunocompetent mice. It also represents a useful model system in vitro and in vivo for evaluating antiviral treatments against HBV cccDNA. Importance: (i) Unlike plasmids that contain a linear HBV replicon, rcccDNA established HBV persistence with sustained liver injury in immunocompetent mice. This method could be a prototype for developing a mouse model of chronic HBV infection. (ii) An exogenous intron was

  16. ATM mediates oxidative stress-induced dephosphorylation of DNA ligase IIIalpha.

    PubMed

    Dong, Zhiwan; Tomkinson, Alan E

    2006-01-01

    Among the three mammalian genes encoding DNA ligases, only the LIG3 gene does not have a homolog in lower eukaryotes. In somatic mammalian cells, the nuclear form of DNA ligase IIIalpha forms a stable complex with the DNA repair protein XRCC1 that is also found only in higher eukaryotes. Recent studies have shown that XRCC1 participates in S phase-specific DNA repair pathways independently of DNA ligase IIIalpha and is constitutively phosphorylated by casein kinase II. In this study we demonstrate that DNA ligase IIIalpha, unlike XRCC1, is phosphorylated in a cell cycle-dependent manner. Specifically, DNA ligase IIIalpha is phosphorylated on Ser123 by the cell division cycle kinase Cdk2 beginning early in S phase and continuing into M phase. Interestingly, treatment of S phase cells with agents that cause oxygen free radicals induces the dephosphorylation of DNA ligase IIIalpha. This oxidative stress-induced dephosphorylation of DNA ligase IIIalpha is dependent upon the ATM (ataxia-telangiectasia mutated) kinase and appears to involve inhibition of Cdk2 and probably activation of a phosphatase.

  17. ATM mediates oxidative stress-induced dephosphorylation of DNA ligase IIIα

    PubMed Central

    Dong, Zhiwan; Tomkinson, Alan E.

    2006-01-01

    Among the three mammalian genes encoding DNA ligases, only the LIG3 gene does not have a homolog in lower eukaryotes. In somatic mammalian cells, the nuclear form of DNA ligase IIIα forms a stable complex with the DNA repair protein XRCC1 that is also found only in higher eukaryotes. Recent studies have shown that XRCC1 participates in S phase-specific DNA repair pathways independently of DNA ligase IIIα and is constitutively phosphorylated by casein kinase II. In this study we demonstrate that DNA ligase IIIα, unlike XRCC1, is phosphorylated in a cell cycle-dependent manner. Specifically, DNA ligase IIIα is phosphorylated on Ser123 by the cell division cycle kinase Cdk2 beginning early in S phase and continuing into M phase. Interestingly, treatment of S phase cells with agents that cause oxygen free radicals induces the dephosphorylation of DNA ligase IIIα. This oxidative stress-induced dephosphorylation of DNA ligase IIIα is dependent upon the ATM (ataxia-telangiectasia mutated) kinase and appears to involve inhibition of Cdk2 and probably activation of a phosphatase. PMID:17040896

  18. NEK8 regulates DNA damage-induced RAD51 foci formation and replication fork protection

    PubMed Central

    Abeyta, Antonio; Castella, Maria; Jacquemont, Celine; Taniguchi, Toshiyasu

    2017-01-01

    ABSTRACT Proteins essential for homologous recombination play a pivotal role in the repair of DNA double strand breaks, DNA inter-strand crosslinks and replication fork stability. Defects in homologous recombination also play a critical role in the development of cancer and the sensitivity of these cancers to chemotherapy. RAD51, an essential factor for homologous recombination and replication fork protection, accumulates and forms immunocytochemically detectable nuclear foci at sites of DNA damage. To identify kinases that may regulate RAD51 localization to sites of DNA damage, we performed a human kinome siRNA library screen, using DNA damage-induced RAD51 foci formation as readout. We found that NEK8, a NIMA family kinase member, is required for efficient DNA damage-induced RAD51 foci formation. Interestingly, knockout of Nek8 in murine embryonic fibroblasts led to cellular sensitivity to the replication inhibitor, hydroxyurea, and inhibition of the ATR kinase. Furthermore, NEK8 was required for proper replication fork protection following replication stall with hydroxyurea. Loading of RAD51 to chromatin was decreased in NEK8-depleted cells and Nek8-knockout cells. Single-molecule DNA fiber analyses revealed that nascent DNA tracts were degraded in the absence of NEK8 following treatment with hydroxyurea. Consistent with this, Nek8-knockout cells showed increased chromosome breaks following treatment with hydroxyurea. Thus, NEK8 plays a critical role in replication fork stability through its regulation of the DNA repair and replication fork protection protein RAD51. PMID:27892797

  19. Lac repressor: Crystallization of intact tetramer and its complexes with inducer and operator DNA

    SciTech Connect

    Pace, H.C.; Lu, P. ); Lewis, M. Smith Kline and French Labs., King of Prussia, PA )

    1990-03-01

    The intact lac repressor tetramer, which regulates expression of the lac operon in Escherichia coli, has been crystallized in the native form, with an inducer, and in a ternary complex with operator DNA and an anti-inducer. The crystals without DNA diffract to better than 3.5 {angstrom}. They belong to the monoclinic space group C2 and have cell dimensions a = 164.7 {angstrom}, b = 75.6 {angstrom}, and c = 161.2 {angstrom}, with {alpha} = {gamma} = 90{degree} and {beta} = 125.5{degree}. Cocrystals have been obtained with a number of different lac operator-related DNA fragments. The complex with a blunt-ended 16-base-pair strand yielded tetragonal bipyramids that diffract to 6.5 {angstrom}. These protein-DNA cocrystals crack upon exposure to the gratuitous inducer isopropyl {beta}-D-thiogalactoside, suggesting a conformational change in the repressor-operator complex.

  20. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  1. Minimal role of base excision repair in TET-induced global DNA demethylation in HEK293T cells

    PubMed Central

    Jin, Chunlei; Qin, Taichun; Barton, Michelle Craig; Jelinek, Jaroslav; Issa, Jean-Pierre J

    2015-01-01

    Oxidation of 5-methylcytosine by TET family proteins can induce DNA replication-dependent (passive) DNA demethylation and base excision repair (BER)-based (active) DNA demethylation. The balance of active vs. passive TET-induced demethylation remains incompletely determined. In the context of large scale DNA demethylation, active demethylation may require massive induction of the DNA repair machinery and thus compromise genome stability. To study this issue, we constructed a tetracycline-controlled TET-induced global DNA demethylation system in HEK293T cells. Upon TET overexpression, we observed induction of DNA damage and activation of a DNA damage response; however, BER genes are not upregulated to promote DNA repair. Depletion of TDG (thymine DNA glycosylase) or APEX1 (apurinic/apyrimidinic endonuclease 1), two key BER enzymes, enhances rather than impairs global DNA demethylation, which can be explained by stimulated proliferation. By contrast, growth arrest dramatically blocks TET-induced global DNA demethylation. Thus, in the context of TET-induction in HEK293T cells, the DNA replication-dependent passive mechanism functions as the predominant pathway for global DNA demethylation. In the same context, BER-based active demethylation is markedly restricted by limited BER upregulation, thus potentially preventing a disastrous DNA damage response to extensive active DNA demethylation. PMID:26440216

  2. Kinetics of the UV-induced DNA damage response in relation to cell cycle phase. Correlation with DNA replication

    PubMed Central

    Zhao, Hong; Traganos, Frank; Darzynkiewicz, Zbigniew

    2010-01-01

    It has been reported that exposure to UV light triggers DNA damage response (DDR) seen as induction of γH2AX not only in S- but also in G1- phase cells. In the present study, in addition to γH2AX, we assessed other markers of DDR, namely phosphorylation of ATM on Ser1981, of ATM/ATR substrate on Ser/Thr at SQ/TQ cluster domains and of the tumor suppressor p53 on Ser15, in human pulmonary carcinoma A549 cells irradiated with 50 J/m2 of UV-B. Phosphorylation of these proteins detected with phospho-specific Abs and measured by laser scanning cytometry in relation the cell cycle phase was found to be selective to S-phase cells. The kinetics of phosphorylation of ATM was strikingly similar to that of ATM/ATR substrate, peaking at 30 min after UV irradiation and followed by rapid dephosphorylation. The peak of H2AX phosphorylation was seen at 2 h and the peak of p53 phosphorylation at 4 h after exposure to UV light. Local high spatial density of these phospho-proteins reported by intensity of maximal pixel of immunofluorescence in the DDR nuclear foci was distinctly more pronounced in the early compared to late portion of S-phase. Exposure of cells to UV following 1 h pulse-labeling of their DNA with 5-ethynyl-2′deoxyuridine (EdU) made it possible to correlate the extent of DNA replication during the pulse with the extent of the UV-induced H2AX phosphorylation within the same cells. This correlation was very strong (R2= 0.98) and the cells that did not incorporate EdU showed no evidence of H2AX phosphorylation. The data are consistent with the mechanism in which stalling of DNA replication forks upon collision with the primary UV-induced DNA lesions and likely formation of double-strand DNA breaks triggers DDR. The prior reports (including our own) on induction of γH2AX in G1 cells by UV may have erroneously identified cells initiating DNA replication following UV exposure as G1 cells due to the fact that their DNA content did not significantly differ from that of G

  3. DNA damage and estrogenic activity induced by the environmental pollutant 2-nitrotoluene and its metabolite

    PubMed Central

    Watanabe, Chigusa; Egami, Takashi; Midorikawa, Kaoru; Hiraku, Yusuke; Oikawa, Shinji; Kawanishi, Shosuke

    2010-01-01

    Objectives The environmental pollutant 2-nitrotoluene (2-NO2-T) is carcinogenic and reproductively toxic in animals. In this study, we elucidated the mechanisms of its carcinogenicity and reproductive toxicity. Methods We examined DNA damage induced by 2-NO2-T and its metabolite, 2-nitrosotoluene (2-NO-T), using 32P-5′-end-labeled DNA. We measured 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA and cellular DNA in cultured human leukemia (HL-60) cells treated with 2-NO2-T and 2-NO-T. 8-Oxoguanine DNA glycosylase (OGG1) gene expression in HL-60 cells was measured by real-time polymerase chain reaction (PCR). We examined estrogenic activity using an E-screen assay and a surface plasmon resonance (SPR) sensor. Results In experiments with isolated DNA fragments, 2-NO-T induced oxidative DNA damage in the presence of Cu (II) and β-nicotinamide adenine dinucleotide disodium salt (reduced form) (NADH), while 2-NO2-T did not. 2-NO-T significantly increased levels of 8-oxodG in HL-60 cells. Real-time polymerase chain reaction (PCR) analysis revealed upregulation of OGG1 gene expression induced by 2-NO-T. An E-screen assay using the human breast cancer cell line MCF-7 revealed that 2-NO2-T induced estrogen-dependent cell proliferation. In contrast, 2-NO-T decreased the cell number and suppressed 17β-estradiol-induced cell proliferation. The data obtained with the SPR sensor using estrogen receptor α and the estrogen response element supported the results of the E-screen assay. Conclusions Oxidative DNA damage caused by 2-NO-T and estrogen-disrupting effects caused by 2-NO2-T and 2-NO-T may play a role in the reproductive toxicity and carcinogenicity of these entities. PMID:21432561

  4. Mechanisms of peroxisome proliferator-induced DNA hypomethylation in rat liver.

    PubMed

    Pogribny, Igor P; Tryndyak, Volodymyr P; Boureiko, Anna; Melnyk, Stepan; Bagnyukova, Tetyana V; Montgomery, Beverly; Rusyn, Ivan

    2008-09-26

    Genomic hypomethylation is a consistent finding in both human and animal tumors and mounting experimental evidence suggests a key role for epigenetic events in tumorigenesis. Furthermore, it has been suggested that early changes in DNA methylation and histone modifications may serve as sensitive predictive markers in animal testing for carcinogenic potency of environmental agents. Alterations in metabolism of methyl donors, disturbances in activity and/or expression of DNA methyltransferases, and presence of DNA single-strand breaks could contribute to the loss of cytosine methylation during carcinogenesis; however, the precise mechanisms of genomic hypomethylation induced by chemical carcinogens remain largely unknown. This study examined the mechanism of DNA hypomethylation during hepatocarcinogenesis induced by peroxisome proliferators WY-14,643 (4-chloro-6-(2,3-xylidino)-pyrimidynylthioacetic acid) and DEHP (di-(2-ethylhexyl)phthalate), agents acting through non-genotoxic mode of action. In the liver of male Fisher 344 rats exposed to WY-14,643 (0.1% (w/w), 5 months), the level of genomic hypomethylation increased by approximately 2-fold, as compared to age-matched controls, while in the DEHP group (1.2% (w/w), 5 months) DNA methylation did not change. Global DNA hypomethylation in livers from WY-14,643 group was accompanied by the accumulation of DNA single-strand breaks, increased cell proliferation, and diminished expression of DNA methyltransferase 1, while the metabolism of methyl donors was not affected. In contrast, none of these parameters changed significantly in rats fed DEHP. Since WY-14,643 is much more potent carcinogen than DEHP, we conclude that the extent of loss of DNA methylation may be related to the carcinogenic potential of the chemical agent, and that accumulation of DNA single-strand breaks coupled to the increase in cell proliferation and altered DNA methyltransferase expression may explain genomic hypomethylation during peroxisome

  5. DNA-Tile Structures Induce Ionic Currents through Lipid Membranes.

    PubMed

    Göpfrich, Kerstin; Zettl, Thomas; Meijering, Anna E C; Hernández-Ainsa, Silvia; Kocabey, Samet; Liedl, Tim; Keyser, Ulrich F

    2015-05-13

    Self-assembled DNA nanostructures have been used to create man-made transmembrane channels in lipid bilayers. Here, we present a DNA-tile structure with a nominal subnanometer channel and cholesterol-tags for membrane anchoring. With an outer diameter of 5 nm and a molecular weight of 45 kDa, the dimensions of our synthetic nanostructure are comparable to biological ion channels. Because of its simple design, the structure self-assembles within a minute, making its creation scalable for applications in biology. Ionic current recordings demonstrate that the tile structures enable ion conduction through lipid bilayers and show gating and voltage-switching behavior. By demonstrating the design of DNA-based membrane channels with openings much smaller than that of the archetypical six-helix bundle, our work showcases their versatility inspired by the rich diversity of natural membrane components.

  6. The ATM Kinase Induces MicroRNA Biogenesis in the DNA Damage Response

    PubMed Central

    Zhang, Xinna; Wan, Guohui; Berger, Franklin G.; He, Xiaoming; Lu, Xiongbin

    2011-01-01

    SUMMARY The DNA damage response involves a complex network of processes that detect and repair DNA damage. Here we show that miRNA biogenesis is globally induced upon DNA damage in an ATM-dependent manner. About one fourth of miRNAs are significantly up-regulated after DNA damage, while loss of ATM abolishes their induction. KSRP (KH-type splicing regulatory protein) is a key player that translates DNA damage signaling to miRNA biogenesis. The ATM kinase directly binds to and phosphorylates KSRP, leading to enhanced interaction between KSRP and pri-miRNAs and increased KSRP activity in miRNA processing. Mutations of the ATM phosphorylation sites of KSRP impaired its activity in regulating miRNAs. These findings reveal a mechanism by which DNA damage signaling is linked to miRNA biogenesis. PMID:21329876

  7. G4-Tetra DNA Duplex Induce Lung Cancer Cell Apoptosis in A549 Cells

    NASA Astrophysics Data System (ADS)

    Xu, Xiaobo; Zhao, YiZhuo; Lu, Hu; Fu, Cuiping; Li, Xiao; Jiang, Liyan; Li, Shanqun

    2016-10-01

    The specific DNA is typically impermeable to the plasma membrane due to its natural characters, but DNA tetra structures (DTNs) can be readily uptake by cells in the absence of transfection agents, providing a new strategy to deliver DNA drugs. In this research, the delivery efficiency of tetrahedral DNA nanostructures was measured on adenocarcinomic human alveolar basal epithelial (A549) cells via delivering AS1411 (G4). The DNA tetra-AS1411 complex was rapidly and abundantly uptake by A549 cells, and the induced apoptosis was enhanced. Furthermore, biodistribution in mouse proved the rapid clearance from non-targeted organs in vivo. This study improved the understanding of potential function in DNA-based drug delivery and proved that DTNs-AS1411 could be potentially useful for the treatment of lung cancer.

  8. Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis

    PubMed Central

    Zhao, Hua; Shen, Kai

    2015-01-01

    DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696

  9. Tropopause Ozone

    NASA Astrophysics Data System (ADS)

    Prather, M.; Zhu, X.; Hsu, J.; Neu, J.; Tang, Q.

    2009-04-01

    The tropopause, however defined, is meant to describe the boundary between the well mixed troposphere and the stably stratified stratosphere. Ozone abundances in the vicinity of the tropopause exhibit large variations with latitude and season, being controlled by a combination of large-scale transport like the Brewer-Dobson circulation, small-scale turbulent mixing unresolved by global models, and photochemistry. A clear, instantaneous, 3-D definition of the tropopause is needed for diagnostics that separate stratosphere from troposphere, e.g., strat-trop exchange fluxes. In the UCI CTM, we define the stratosphere-troposphere boundary with what is effectively an age-of-air tracer: a tracer emitted uniformly from the surface with a uniform e-fold of 90 days (designated e90). Where the abundance of e90 falls below about 70% of the mass-median value (i.e., 33 days-old), we define as the stratosphere. With this diagnostic of the mixing barrier between stratosphere and troposphere the CTM with EC IFS forecast meteorology is able to match much of the observed seasonal cycle of the tropopause pressure and ozone abundance. With the CTM we examine the importance of chemistry vs. transport in controlling tropopause ozone. For example, we note that photolysis of molecular oxygen in the upper troposphere contributes significantly to tropopause ozone in the tropics and sub-tropics.

  10. Application of DNA amplification to pneumocystosis: presence of serum Pneumocystis carinii DNA during human and experimentally induced Pneumocystis carinii pneumonia

    PubMed Central

    1992-01-01

    Pneumocystis carinii pneumonia is a leading cause of morbidity and mortality in patients with the acquired immunodeficiency syndrome (AIDS). Much remains unknown about the basic biology of P. carinii and studies of this infection have been hampered by the lack of cultivation methods. We developed a sensitive and specific assay for P. carinii by utilizing DNA amplification of the P. carinii dihydrofolate reductase (DHFR) gene. By this method, P. carinii DNA was detected in the lungs of rats with experimentally induced P. carinii pneumonia 2 wk before the onset of histopathological changes. DNA amplification analysis of serum demonstrated that by 10 wk of corticosteroid treatment, 12 of 12 (100%) infected rats had circulating DHFR DNA. P. carinii DHFR DNA also was detected in the serum of patients with AIDS and active P. carinii pneumonia (12 of 14 sera collected prospectively). Patients with advanced AIDS but without a history of P. carinii pneumonia were negative by this assay (0 of 6 sera examined). Serum polymerase chain reaction may facilitate investigations into the natural history and epidemiology of P. carinii infection, provide insight into the pathogenesis of parasite dissemination, and offer a useful, noninvasive diagnostic test for the detection of human pneumocystosis. PMID:1402679

  11. Inhibition of uracil DNA glycosylase sensitizes cancer cells to 5-fluorodeoxyuridine through replication fork collapse-induced DNA damage

    PubMed Central

    Yan, Yan; Han, Xiangzi; Qing, Yulan; Condie, Allison G.; Gorityala, Shashank; Yang, Shuming; Xu, Yan; Zhang, Youwei; Gerson, Stanton L.

    2016-01-01

    5-fluorodeoxyuridine (5-FdU, floxuridine) is active against multiple cancers through the inhibition of thymidylate synthase, which consequently introduces uracil and 5-FU incorporation into the genome. Uracil DNA glycosylase (UDG) is one of the main enzymes responsible for the removal of uracil and 5-FU. However, how exactly UDG mediates cellular sensitivity to 5-FdU, and if so whether it is through its ability to remove uracil and 5-FU have not been well characterized. In this study, we report that UDG depletion led to incorporation of uracil and 5-FU in DNA following 5-FdU treatment and significantly enhanced 5-FdU's cytotoxicity in cancer cell lines. Co-treatment, but not post-treatment with thymidine prevented cell death of UDG depleted cells by 5-FdU, indicating that the enhanced cytotoxicity is due to the retention of uracil and 5-FU in genomic DNA in the absence of UDG. Furthermore, UDG depleted cells were arrested at late G1 and early S phase by 5-FdU, followed by accumulation of sub-G1 population indicating cell death. Mechanistically, 5-FdU dramatically reduced DNA replication speed in UDG depleted cells. UDG depletion also greatly enhanced DNA damage as shown by γH2AX foci formation. Notably, the increased γH2AX foci formation was not suppressed by caspase inhibitor treatment, suggesting that DNA damage precedes cell death induced by 5-FdU. Together, these data provide novel mechanistic insights into the roles of UDG in DNA replication, damage repair, and cell death in response to 5-FdU and suggest that UDG is a target for improving the anticancer effect of this agent. PMID:27517750

  12. Diethyl pyrocarbonate reaction with the lactose repressor protein affects both inducer and DNA binding

    SciTech Connect

    Sams, C.F.; Matthews, K.S.

    1988-04-05

    Modification of the lactose repressor protein of Escherichia coli with diethyl pyrocarbonate (DPC) results in decreased inducer binding as well as operator and nonspecific DNA binding. Spectrophotometric measurements indicated a maximum of three histidines per subunit was modified, and quantitation of lysine residues with trinitrobenzenesulfonate revealed the modification of one lysine residue. The loss of DNA binding, both operator and nonspecific, was correlated with histidine modification; removal of the carbethoxy groups from the histidines by hydroxylamine was accompanied by significant recovery of DNA binding function. The presence of inducing sugars during the DPC reaction had no effect on histidine modification or the loss of DNA binding activity. In contrast, inducer binding was not recovered upon reversal of the histidine modification. However, the presence of inducer during reaction protected lysine from reaction and also prevented the decrease in inducer binding; these results indicate that reaction of the lysine residue(s) may correlate to the loss of sugar binding activity. Since no difference in incorporation of radiolabeled carbethoxy was observed following reaction with diethyl pyrocarbonate in the presence or absence of inducer, the reagent appears to function as a catalyst in the modification of the lysine. The formation of an amide bond between the affected lysine and a nearby carboxylic acid moiety provides a possible mechanism for the activity loss. Reaction of the isolated NH2-terminal domain resulted in loss of DNA binding with modification of the single histidine at position 29. Results from the modification of core domain paralleled observations with intact repressor.

  13. UVA-induced DNA double-strand breaks result from the repair of clustered oxidative DNA damages

    PubMed Central

    Greinert, R.; Volkmer, B.; Henning, S.; Breitbart, E. W.; Greulich, K. O.; Cardoso, M. C.; Rapp, Alexander

    2012-01-01

    UVA (320–400 nm) represents the main spectral component of solar UV radiation, induces pre-mutagenic DNA lesions and is classified as Class I carcinogen. Recently, discussion arose whether UVA induces DNA double-strand breaks (dsbs). Only few reports link the induction of dsbs to UVA exposure and the underlying mechanisms are poorly understood. Using the Comet-assay and γH2AX as markers for dsb formation, we demonstrate the dose-dependent dsb induction by UVA in G1-synchronized human keratinocytes (HaCaT) and primary human skin fibroblasts. The number of γH2AX foci increases when a UVA dose is applied in fractions (split dose), with a 2-h recovery period between fractions. The presence of the anti-oxidant Naringin reduces dsb formation significantly. Using an FPG-modified Comet-assay as well as warm and cold repair incubation, we show that dsbs arise partially during repair of bi-stranded, oxidative, clustered DNA lesions. We also demonstrate that on stretched chromatin fibres, 8-oxo-G and abasic sites occur in clusters. This suggests a replication-independent formation of UVA-induced dsbs through clustered single-strand breaks via locally generated reactive oxygen species. Since UVA is the main component of solar UV exposure and is used for artificial UV exposure, our results shine new light on the aetiology of skin cancer. PMID:22941639

  14. Holistic sludge management through ozonation: A critical review.

    PubMed

    Semblante, Galilee U; Hai, Faisal I; Dionysiou, Dionysios D; Fukushi, Kensuke; Price, William E; Nghiem, Long D

    2017-01-01

    This paper critically reviews the multidimensional benefits of ozonation in wastewater treatment plants. These benefits include sludge reduction, removal of emerging trace organic contaminants (TrOC) from wastewater and sludge, and resource recovery from sludge. Literature shows that ozonation leads to sludge solubilisation, reducing overall biomass yield. Sludge solubilisation is primarily influenced by ozone dosage, which, in turn, depends on the fraction of ozonated sludge, ozone concentration, and sludge concentration. Additionally, sludge ozonation facilitates the removal of TrOCs from wastewater. On the other hand, by inducing cell lysis, ozonation increases the chemical oxygen demand (COD) and nutrient concentration of the sludge supernatant, which deteriorates effluent quality. This issue can be resolved by implementing resource recovery. Thus far, successful retrieval of phosphorous from ozonated sludge supernatant has been performed. The recovery of phosphorous and other resources from sludge could help offset the operation cost of ozonation, and give greater incentive for wastewater treatment plants to adapt this approach.

  15. The DNA damage response induced by infection with human cytomegalovirus and other viruses.

    PubMed

    Xiaofei, E; Kowalik, Timothy F

    2014-05-23

    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed.

  16. The protective effect of clay minerals against damage to adsorbed DNA induced by cadmium and mercury.

    PubMed

    Hou, Yakun; Wu, Pingxiao; Zhu, Nengwu

    2014-01-01

    The adsorption of Salmon Sperm DNA on three kinds of raw clay (rectorite, montmorillonite and sericite) was investigated as a function of pH, ionic strength and the concentrations of DNA and phosphate ions in solution. The DNA adsorption was reduced in the following order: rectorite>montmorillonite>sericite. Based on these findings, there is a strong evidence that the mechanisms for DNA adsorption on clay involve electrostatic forces, cation bridging and ligand exchange. Cyclic voltammetry (CV) and UV-vis absorption and fluorescence spectroscopy were used to compare the properties of unbound DNA and the absorbed DNA on rectorite, both in the absence and presence of Cd(2+) and Hg(2+) inaqueous solutions. The interaction of heavy metals with the unbound DNA was evidenced by the disappearance of reduction peaks in CV, a small bathochromic shift in UV-vis spectroscopy and an incomplete quenching in the emission spectra. Such changes were not observed in the DNA-rectorite hybrids, which is evidence that adsorption on the clay can reduce the extent of the DNA damage caused by heavy metals. Therefore, in these experience the rectorite played an important role in protecting DNA against Cd(2+) and Hg(2+) induced damage.

  17. Conformational selection and induced fit for RNA polymerase and RNA/DNA hybrid backtracked recognition

    PubMed Central

    Wu, Jian; Ye, Wei; Yang, Jingxu; Chen, Hai-Feng

    2015-01-01

    RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD) simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15, and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS) P-test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein. PMID:26594643

  18. Single-cell analysis challenges the connection between autophagy and senescence induced by DNA damage.

    PubMed

    Filippi-Chiela, Eduardo Cremonese; Bueno e Silva, Mardja Manssur; Thomé, Marcos Paulo; Lenz, Guido

    2015-01-01

    Autophagy and senescence have been described as central features of cell biology, but the interplay between these mechanisms remains obscure. Using a therapeutically relevant model of DNA damage-induced senescence in human glioma cells, we demonstrated that acute treatment with temozolomide induces DNA damage, a transitory activation of PRKAA/AMPK-ULK1 and MAPK14/p38 and the sustained inhibition of AKT-MTOR. This produced a transient induction of autophagy, which was followed by senescence. However, at the single cell level, this coordinated transition was not observed, and autophagy and senescence were triggered in a very heterogeneous manner. Indeed, at a population level, autophagy was highly negatively correlated with senescence markers, while in single cells this correlation did not exist. The inhibition of autophagy triggered apoptosis and decreased senescence, while its activation increased temozolomide-induced senescence, showing that DNA damage-induced autophagy acts by suppressing apoptosis.

  19. Regulation of DNA damage-induced apoptosis by the c-Abl tyrosine kinase

    PubMed Central

    Yuan, Zhi-Min; Huang, Yinyin; Ishiko, Takatoshi; Kharbanda, Surender; Weichselbaum, Ralph; Kufe, Donald

    1997-01-01

    Activation of the c-Abl protein tyrosine kinase by certain DNA-damaging agents contributes to down-regulation of Cdk2 and G1 arrest by a p53-dependent mechanism. The present work investigates the potential role of c-Abl in apoptosis induced by DNA damage. Transient transfection studies with wild-type, but not kinase-inactive, c-Abl demonstrate induction of apoptosis. Cells that stably express inactive c-Abl exhibit resistance to ionizing radiation-induced loss of clonogenic survival and apoptosis. Cells null for c-abl are also impaired in the apoptotic response to ionizing radiation. We further show that cells deficient in p53 undergo apoptosis in response to expression of c-Abl and exhibit decreases in radiation-induced apoptosis when expressing inactive c-Abl. These findings suggest that c-Abl kinase regulates DNA damage-induced apoptosis. PMID:9037071

  20. Cytometric analysis of DNA changes induced by sulfur mustard

    SciTech Connect

    Smith, W.J.; Sanders, K.M.; Ruddle, S.E.; Gross, C.L.

    1993-05-13

    Sulfur mustard is an alkylating agent which causes severe, potentially debilitating blisters following cutaneous exposure. Its mechanism of pathogenesis is unknown and no antidote exists to prevent its pathology. The biochemical basis of sulfur mustard's vesicating activity has been hypothesized to be a cascade of events beginning with alkylation of DNA. Using human cells in culture, we have assessed the effects of sulfur mustard on cell cycle activity using flow cytometry with propidium iodide. Two distinct patterns emerged, a Gl/S interface block at concentrations equivalent to vesicating doses (>50-micronM) and a G2 block at 10-fold lower concentrations. In addition, noticeable increases in amount of dye uptake were observed at 4 and 24 hours after sulfur mustard exposure. These increases are believed to be related to DNA repair activities and can be prevented by treatment of the cells with niacinamide, which inhibits DNA repair. Other drugs which provide alternate alkylating sites or inhibit cell cycle progression were shown to lower the cytotoxicity of sulfur mustard and to protect against its direct DNA damaging effects.

  1. The MIF Antagonist ISO-1 Attenuates Corticosteroid-Insensitive Inflammation and Airways Hyperresponsiveness in an Ozone-Induced Model of COPD

    PubMed Central

    Russell, Kirsty E.; Chung, Kian Fan; Clarke, Colin J.; Durham, Andrew L.; Mallia, Patrick; Johnston, Sebastian L.; Barnes, Peter J.; Hall, Simon R.; Simpson, Karen D.; Starkey, Malcolm R.; Hansbro, Philip M.; Adcock, Ian M.; Wiegman, Coen H.

    2016-01-01

    Introduction Macrophage migration inhibitory factor (MIF) is an inflammatory cytokine associated with acute and chronic inflammatory disorders and corticosteroid insensitivity. Its expression in the airways of patients with chronic obstructive pulmonary disease (COPD), a relatively steroid insensitive inflammatory disease is unclear, however. Methods Sputum, bronchoalveolar lavage (BAL) macrophages and serum were obtained from non-smokers, smokers and COPD patients. To mimic oxidative stress-induced COPD, mice were exposed to ozone for six-weeks and treated with ISO-1, a MIF inhibitor, and/or dexamethasone before each exposure. BAL fluid and lung tissue were collected after the final exposure. Airway hyperresponsiveness (AHR) and lung function were measured using whole body plethysmography. HIF-1α binding to the Mif promoter was determined by Chromatin Immunoprecipitation assays. Results MIF levels in sputum and BAL macrophages from COPD patients were higher than those from non-smokers, with healthy smokers having intermediate levels. MIF expression correlated with that of HIF-1α in all patients groups and in ozone-exposed mice. BAL cell counts, cytokine mRNA and protein expression in lungs and BAL, including MIF, were elevated in ozone-exposed mice and had increased AHR. Dexamethasone had no effect on these parameters in the mouse but ISO-1 attenuated cell recruitment, cytokine release and AHR. Conclusion MIF and HIF-1α levels are elevated in COPD BAL macrophages and inhibition of MIF function blocks corticosteroid-insensitive lung inflammation and AHR. Inhibition of MIF may provide a novel anti-inflammatory approach in COPD. PMID:26752192

  2. The Antarctic Ozone Hole

    ERIC Educational Resources Information Center

    Jones, Anna E.

    2008-01-01

    Since the mid 1970s, the ozone layer over Antarctica has experienced massive destruction during every spring. In this article, we will consider the atmosphere, and what ozone and the ozone layer actually are. We explore the chemistry responsible for the ozone destruction, and learn about why conditions favour ozone destruction over Antarctica. For…

  3. DNA Methylation in the Medial Prefrontal Cortex Regulates Alcohol-Induced Behavior and Plasticity

    PubMed Central

    Tapocik, Jenica D.; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R.; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F.; Goldman, David; Heilig, Markus

    2015-01-01

    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism. PMID:25878287

  4. DNA methylation in the medial prefrontal cortex regulates alcohol-induced behavior and plasticity.

    PubMed

    Barbier, Estelle; Tapocik, Jenica D; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F; Goldman, David; Heilig, Markus

    2015-04-15

    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism.

  5. Ozone-induced changes in the content of bioactive compounds and enzyme activity during storage of pepper fruits.

    PubMed

    Sachadyn-Król, Monika; Materska, Małgorzata; Chilczuk, Barbara; Karaś, Monika; Jakubczyk, Anna; Perucka, Irena; Jackowska, Izabella

    2016-11-15

    This paper presents for the first time the results of investigations concerning the effect of treatment of whole pepper fruits with gaseous ozone and the refrigeration storage period conditions on pepper quality. The effects are reflected in changes in the flavonoid contents, the antioxidant activity of the phenolic compound fraction and the enzymes involved in phenylpropanoid metabolism. The investigations were carried out on a hot pepper fruit cultivar, Cyklon. It was found that the levels of a majority of flavonoids, in particular those of quercetin 3-O-rhamnoside and quercetin 3-O-rhamnoside-7-O-glucoside increased in the pericarp of fruits treated with ozone for 3h and stored for 20days (by 25% relative to the control). Simultaneously, reduced phenylalanine ammonia-lyase and tyrosine ammonia-lyase activity were noted, which implies slight degradation of enzymes caused by the ozone treatment and enhancement of the polyphenol oxidase and guaiacol oxidase activity involved in response to increased oxidative stress.

  6. Rofecoxib prevents ctdsDNA against damage induced by copper sulfate and ultraviolet B radiation in vitro study.

    PubMed

    Al-Nimer, Marwan S M; Al-Deen, Suad M; Abdul Lateef, Zainab W

    2010-12-01

    Rofecoxib is a selective cyclooxygenase COX-2 enzyme inhibitor with chemoprotective effect against cancer in experimental models. This study aimed to investigate the effect of rofecoxib against ctds DNA damage induced by copper ions or ultraviolet (UV)B radiation. Aliquot ctdsDNA samples were incubated with copper sulfate solution (50 nmol) and rofecoxib (0.8 mol) was added either before or after the admixing the ctdsDNA with copper sulfate. In another experimental series, aliquot of ctdsDNA were exposed to UVB radiation for 30 min in absence or presence of rofecoxib. Rofecoxib significantly attenuated the separation of double strands of DNA (detected by increase the absorbance of DNA at 260 nm) induced by Cu ions. Rofecoxib significantly offered protection against UVB-induced DNA damage. It is concluded that rofecoxib offered protection against copper ions or UVB induced-DNA damage via different mechanisms not related to the inhibition COX-2.

  7. Microcystin-LR induced DNA damage in human peripheral blood lymphocytes.

    PubMed

    Zegura, B; Gajski, G; Straser, A; Garaj-Vrhovac, V; Filipič, M

    2011-12-24

    Human exposure to microcystins, which are produced by freshwater cyanobacterial species, is of growing concern due to increasing appearance of cyanobacterial blooms as a consequence of global warming and increasing water eutrophication. Although microcystins are considered to be liver-specific, there is evidence that they may also affect other tissues. These substances have been shown to induce DNA damage in vitro and in vivo, but the mechanisms of their genotoxic activity remain unclear. In human peripheral blood lymphocytes (HPBLs) exposure to non-cytotoxic concentrations (0, 0.1, 1 and 10μg/ml) of microcystin-LR (MCLR) induced a dose- and time-dependent increase in DNA damage, as measured with the comet assay. Digestion of DNA from MCLR-treated HPBLs with purified formamidopyrimidine-DNA glycosylase (Fpg) displayed a greater number of DNA strand-breaks than non-digested DNA, confirming the evidence that MCLR induces oxidative DNA damage. With the cytokinesis-block micronucleus assay no statistically significant induction of micronuclei, nucleoplasmic bridges and nuclear buds was observed after a 24-h exposure to MCLR. At the molecular level, no changes in the expression of selected genes involved in the cellular response to DNA damage and oxidative stress were observed after a 4-h exposure to MCLR (1μg/ml). After 24h, DNA damage-responsive genes (p53, mdm2, gadd45a, cdkn1a), a gene involved in apoptosis (bax) and oxidative stress-responsive genes (cat, gpx1, sod1, gsr, gclc) were up-regulated. These results provide strong support that MCLR is an indirectly genotoxic agent, acting via induction of oxidative stress, and that lymphocytes are also the target of microcystin-induced toxicity.

  8. DNA-damage-inducible (din) loci are transcriptionally activated in competent Bacillus subtilis

    SciTech Connect

    Love, P.E.; Lyle, M.J.; Yasbin, R.E.

    1985-09-01

    DNA damage-inducible (din) operon fusions were generated in Bacillus subtilis by transpositional mutagenesis. These YB886(din::Tn917-lacZ) fusion isolates produced increased ..beta..-galactosidase when exposed to mitomycin C, UV radiation, or ethyl methanesulfonate, indicating that the lacZ structural gene had inserted into host transcriptional units that are induced by a variety of DNA-damaging agents. One of the fusion strains was DNA-repair deficient and phenotypically resembled a UV-sensitive mutant of B. subtilis. Induction of ..beta..-galactosidase also occurred in the competent subpopulation of each of the din fusion strains, independent of exposure to DNA-damaging agents. Both the DNA-damage-inducible and competence-inducible components of ..beta..-galactosidase expression were abolished by the recE4 mutation, which inhibits SOS-like (SOB) induction but does not interfere with the development of the component state. The results indicate that gene expression is stimulated at specific loci within the B. subtilis chromosome both by DNA-damaging agents and by the development of competence and that this response is under the control of the SOB regulatory system. Furthermore, they demonstrate that at the molecular level SOB induction and the development of competence are interrelated cellular events.

  9. Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells

    NASA Astrophysics Data System (ADS)

    Yu, L. D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.

    2014-05-01

    As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10-20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence.

  10. Both physiological and pharmacological levels of melatonin reduce DNA adduct formation induced by the carcinogen safrole.

    PubMed

    Tan, D; Reiter, R J; Chen, L D; Poeggeler, B; Manchester, L C; Barlow-Walden, L R

    1994-02-01

    Hepatic DNA adduct formation induced by the chemical carcinogen, safrole, was suppressed by both endogenous pineal melatonin release and by the exogenous administration of melatonin to rats. DNA damage after administration of of melatonin to rats. DNA damage after administration of 100 mg/kg safrole (i.p.) was measured by the P1 enhanced 32P-postlabeling analysis method. The RAL (relative adduct labeling) x 10(7) of carcinogen modified DNA in the liver of untreated controls and in safrole treated animals killed during the day, at night, after pinealectomy and pinealectomy plus melatonin injection (0.15 mg/kg x 4 or a total of 0.6 mg/kg) was 0, 12.6 +/- 0.75, 10.9 +/- 0.72, 13.6 +/- 1.12 and 5.7 +/- 0.53 respectively. For the same groups of animals, circulating melatonin levels at the termination of the study were 31 +/- 3, 29 +/- 2, 276 +/- 31, 24 +/- 1 and 13,950 +/- 1016 pg/ml serum respectively. The higher the melatonin concentration in the serum the lower was DNA adduct formation in the rat liver. Thus, high nocturnal levels of melatonin were protective against safrole-induced DNA damage. These findings indicate that the functional pineal gland plays an important role in oncostatic actions of carcinogens such as safrole. At physiological levels, melatonin seemed to prevent especially the formation of what was referred to as the N1 DNA adduct. Melatonin's ability to suppress DNA adduct formation may relate to its inhibitory effect on a mixed function oxidase, cytochrome p-450, and on the recently identified hydroxyl radical scavenging capacity of the indole. The oncostatic action of melatonin is also suggested by its nuclear accumulation and DNA stabilization characteristics. At pharmacological levels melatonin is extremely potent in preventing DNA modification induced by the chemical carcinogen, safrole.

  11. A human cellular sequence implicated in trk oncogene activation is DNA damage inducible

    SciTech Connect

    Ben-Ishai, R.; Scharf, R.; Sharon, R.; Kapten, I. )

    1990-08-01

    Xeroderma pigmentosum cells, which are deficient in the repair of UV light-induced DNA damage, have been used to clone DNA-damage-inducible transcripts in human cells. The cDNA clone designated pC-5 hybridizes on RNA gel blots to a 1-kilobase transcript, which is moderately abundant in nontreated cells and whose synthesis is enhanced in human cells following UV irradiation or treatment with several other DNA-damaging agents. UV-enhanced transcription of C-5 RNA is transient and occurs at lower fluences and to a greater extent in DNA-repair-deficient than in DNA-repair-proficient cells. Southern blot analysis indicates that the C-5 gene belongs to a multigene family. A cDNA clone containing the complete coding sequence of C-5 was isolated. Sequence analysis revealed that it is homologous to a human cellular sequence encoding the amino-terminal activating sequence of the trk-2h chimeric oncogene. The presence of DNA-damage-responsive sequences at the 5' end of a chimeric oncogene could result in enhanced expression of the oncogene in response to carcinogens.

  12. Analysis of the Contribution of Charge Transport in Iodine-125 induced DNA Damage

    PubMed Central

    Ndlebe, Thabisile; Panyutin, Igor; Neumann, Ronald

    2009-01-01

    Auger electron emitters, like iodine-125, are the radionuclides of choice for gene-targeted radiotherapy. The highly localized damage they induced in DNA is produced by three mechanisms: direct damage by the emitted Auger electrons, indirect damage by diffusible free radicals produced by Auger electrons travelling in water, and charge neutralization of the residual, highly positively charged, tellurium daughter atom by stripping electrons from covalent bonds of neighboring residues. The purpose of our work was to determine whether these mechanisms proceed through an intermediate energy transfer step along DNA. It was proposed that this intermediate step proceeds through the charge transport mechanism in DNA. Conventional charge transport has been described as either a hopping mechanism initiated by charge injection into DNA and propagated by charge migration along the DNA, or a tunneling mechanism in which charge moves directly from a donor to an acceptor within DNA. Well-known barriers for the hopping mechanism were used to probe the role of charge transport in 125I induced DNA damage. We studied their effect on the distribution of DNA breaks produced by the decay of iodine-125 in samples frozen at −80°C. We found that these barriers had no measurable effect on the iodine-125 breaks distribution. PMID:20041764

  13. Extracellular DNA Acidifies Biofilms and Induces Aminoglycoside Resistance in Pseudomonas aeruginosa.

    PubMed

    Wilton, Mike; Charron-Mazenod, Laetitia; Moore, Richard; Lewenza, Shawn

    2015-11-09

    Biofilms consist of surface-adhered bacterial communities encased in an extracellular matrix composed of DNA, exopolysaccharides, and proteins. Extracellular DNA (eDNA) has a structural role in the formation of biofilms, can bind and shield biofilms from aminoglycosides, and induces antimicrobial peptide resistance mechanisms. Here, we provide evidence that eDNA is responsible for the acidification of Pseudomonas aeruginosa planktonic cultures and biofilms. Further, we show that acidic pH and acidification via eDNA constitute a signal that is perceived by P. aeruginosa to induce the expression of genes regulated by the PhoPQ and PmrAB two-component regulatory systems. Planktonic P. aeruginosa cultured in exogenous 0.2% DNA or under acidic conditions demonstrates a 2- to 8-fold increase in aminoglycoside resistance. This resistance phenotype requires the aminoarabinose modification of lipid A and the production of spermidine on the bacterial outer membrane, which likely reduce the entry of aminoglycosides. Interestingly, the additions of the basic amino acid L-arginine and sodium bicarbonate neutralize the pH and restore P. aeruginosa susceptibility to aminoglycosides, even in the presence of eDNA. These data illustrate that the accumulation of eDNA in biofilms and infection sites can acidify the local environment and that acidic pH promotes the P. aeruginosa antibiotic resistance phenotype.

  14. Listeria monocytogenes induces host DNA damage and delays the host cell cycle to promote infection

    PubMed Central

    Leitão, Elsa; Costa, Ana Catarina; Brito, Cláudia; Costa, Lionel; Pombinho, Rita; Cabanes, Didier; Sousa, Sandra

    2014-01-01

    Listeria monocytogenes (Lm) is a human intracellular pathogen widely used to uncover the mechanisms evolved by pathogens to establish infection. However, its capacity to perturb the host cell cycle was never reported. We show that Lm infection affects the host cell cycle progression, increasing its overall duration but allowing consecutive rounds of division. A complete Lm infectious cycle induces a S-phase delay accompanied by a slower rate of DNA synthesis and increased levels of host DNA strand breaks. Additionally, DNA damage/replication checkpoint responses are triggered in an Lm dose-dependent manner through the phosphorylation of DNA-PK, H2A.X, and CDC25A and independently from ATM/ATR. While host DNA damage induced exogenously favors Lm dissemination, the override of checkpoint pathways limits infection. We propose that host DNA replication disturbed by Lm infection culminates in DNA strand breaks, triggering DNA damage/replication responses, and ensuring a cell cycle delay that favors Lm propagation. PMID:24552813

  15. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor

    2011-06-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  16. Correlation between cosmic rays and ozone depletion.

    PubMed

    Lu, Q-B

    2009-03-20

    This Letter reports reliable satellite data in the period of 1980-2007 covering two full 11-yr cosmic ray (CR) cycles, clearly showing the correlation between CRs and ozone depletion, especially the polar ozone loss (hole) over Antarctica. The results provide strong evidence of the physical mechanism that the CR-driven electron-induced reaction of halogenated molecules plays the dominant role in causing the ozone hole. Moreover, this mechanism predicts one of the severest ozone losses in 2008-2009 and probably another large hole around 2019-2020, according to the 11-yr CR cycle.

  17. Evidence for vertical ozone redistribution since 1967

    NASA Astrophysics Data System (ADS)

    Furrer, R.; Döhler, W.; Kirsch, H.-J.; Plessing, P.; Görsdorf, U.

    1993-03-01

    Long-term measurements of the ozone concentration in the vicinity of the city of Berlin have been performed with ground based Dobson spectrophotometers and balloon borne systems. The respective experiments cover the past 24 years. All data have been reevaluated and corrected towards uniform calibration standards, leading to the longest European data set of total column density, altitude-dependent ozone partial pressures and the corresponding temperatures. Smoothing algorithms unravel significant long-term trends. The analysis shows an increase of ozone concentration within the middle stratosphere (below 31 km height) as well as in the troposphere over the past 24 years. On the contrary, ongoing ozone depletion in the lower stratosphere has been found. The large scale vertical redistribution of atmospheric ozone in the troposphere and the lower stratosphere seems to be in agreement with model calculations and trend predictions that have their roots in changes of the chemical composition and the ozone photochemistry due to anthropogenically induced trace gas concentrations.

  18. Evidence for vertical ozone redistribution since 1967

    NASA Astrophysics Data System (ADS)

    Furrer, R.; Döhler, W.; Kirsch, H.-J.; Plessing, P.; Görsdorf, U.

    1993-01-01

    Long-term measurements of ozone concentration in the vicinity of the city of Berlin have been performed with ground-based Dobson spectrophotometers and balloon borne systems. The respective experiments cover the past 24 yr. All data have been re-evaluated and corrected towards uniform calibration standards, leading to the longest lasting European data set of total column density, altitude-dependent ozone partial pressures and the corresponding temperatures. Smoothing algorithms reveal significant longterm trends. The analysis shows an increase of ozone concentration within the middle stratosphere (below 31 km height) as well as in the troposphere over the past 24 yr. On the contrary, ongoing ozone depletion in the lower stratosphere became evident. The large scale vertical redistribution of atmospheric ozone in the troposphere and the lower stratosphere seems to be in agreement with model calculations and trend predictions that have their roots in changes of the chemical composition and the ozone photochemistry due to anthropogenically induced tracer gas concentrations.

  19. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    PubMed Central

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-01-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  20. Equatorial Kelvin wave signatures in ozone profile measurements from Global Ozone Monitoring Experiment (GOME)

    NASA Astrophysics Data System (ADS)

    Timmermans, R. M. A.; van Oss, R. F.; Kelder, H. M.

    2005-11-01

    This study investigates the ability to derive height-resolved information on equatorial Kelvin wave activity from three different Global Ozone Monitoring Experiment (GOME) ozone profile data sets. The ozone profiles derived using the Ozone Profile Retrieval Algorithm (OPERA) based on optimal estimation and the Neural Network Ozone Retrieval System (NNORSY) both show Kelvin wave signals in agreement with previously identified signals in the GOME total ozone columns. However, because of the inadequate vertical resolution, these two data sets are not able to resolve the vertical structure of the Kelvin wave activity. The third data set, consisting of assimilated OPERA ozone profiles, does provide height-resolved information on Kelvin wave activity that is consistent with results from the analysis of GOME total ozone columns and ECMWF Re-Analysis (ERA-40) temperature data. Largest Kelvin-wave-induced perturbations of up to 0.69 DU/km coincide with the maximum vertical gradient in ozone around 35 hPa and show an in-phase relationship with temperature perturbations in ERA-40 as expected from theoretical considerations. These results indicate that the ozone perturbations in the lower stratosphere and in the total column of ozone are transport related. Between 10 and 1 hPa, large Kelvin-wave-induced fluctuations in ozone mixing ratio are present that, however, because of their small contribution to the total column, do not constitute a large contribution to the total ozone column perturbations. The ozone perturbations between 10 and 1 hPa show an out-of-phase relationship with temperature perturbations in ERA-40, indicating that the perturbations can either be caused by transport effects or photochemical influences.

  1. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.

    1989-01-01

    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  2. Botanical Extracts as Medical Countermeasures for Radiation Induced DNA Damage

    DTIC Science & Technology

    2012-03-01

    seed extract supplements and Labrador tea whole leaf extracts as potential radioprotectants. Three different commercial grape seed extracts were... supplements and Labrador tea whole leaf extracts as potential radioprotectants. A novel assay was used to compare DNA damage in cellular and...concentrations of commercial grape seed extract supplements and Labrador tea. In addition, this work has identified and validated a set of procedures to use

  3. Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

    DTIC Science & Technology

    1987-11-23

    III (Gates and inn, 1977), Micrococcus luteus UV endo- nuclease (Grossman et al, 1978) and bacteriophage T UV endonuclease (Warner et al, 1980) have DNA...34, Garland Publishing, Inc. New York & London USA. Ather, A., Z. Ahmed and S. Riazxxddin, 1984. Adaptive response of Micrococcus luteus to alkylating...Laval, J., 3. Pierre and F. Laval. 1981. Release of 7-nmthylguanine residues frain alkylated ENA by extracts of Micrococcus luteus and Escherichia

  4. Repair Machinery for Radiation-Induced DNA Damage

    DTIC Science & Technology

    2000-07-01

    significant defect in the repair of certain DNA damages, but of which damages needs to be determined. We have selected Chinese Hamster Ovary ( CHO ) as...chromosome (BAC) genomic fragment, which we isolated from a CHO BAC library, revealed that APE1 exists as a single copy gene in AA8 (see Appendix, Figure... cells , we first determined the APE1 gene copy number in the CHO AA8 cell line. Fluorescence in situ hybridization with an APE1 bacterial artificial

  5. Crystal Structure of the Lactose Operon Repressor and Its Complexes with DNA and Inducer

    NASA Astrophysics Data System (ADS)

    Lewis, Mitchell; Chang, Geoffrey; Horton, Nancy C.; Kercher, Michele A.; Pace, Helen C.; Schumacher, Maria A.; Brennan, Richard G.; Lu, Ponzy

    1996-03-01

    The lac operon of Escherichia coli is the paradigm for gene regulation. Its key component is the lac repressor, a product of the lacI gene. The three-dimensional structures of the intact lac repressor, the lac repressor bound to the gratuitous inducer isopropyl-β-D-1-thiogalactoside (IPTG) and the lac repressor complexed with a 21-base pair symmetric operator DNA have been determined. These three structures show the conformation of the molecule in both the induced and repressed states and provide a framework for understanding a wealth of biochemical and genetic information. The DNA sequence of the lac operon has three lac repressor recognition sites in a stretch of 500 base pairs. The crystallographic structure of the complex with DNA suggests that the tetrameric repressor functions synergistically with catabolite gene activator protein (CAP) and participates in the quaternary formation of repression loops in which one tetrameric repressor interacts simultaneously with two sites on the genomic DNA.

  6. Exposure to 1800 MHz radiofrequency radiation induces oxidative damage to mitochondrial DNA in primary cultured neurons.

    PubMed

    Xu, Shangcheng; Zhou, Zhou; Zhang, Lei; Yu, Zhengping; Zhang, Wei; Wang, Yuan; Wang, Xubu; Li, Maoquan; Chen, Yang; Chen, Chunhai; He, Mindi; Zhang, Guangbin; Zhong, Min

    2010-01-22

    Increasing evidence indicates that oxidative stress may be involved in the adverse effects of radiofrequency (RF) radiation on the brain. Because mitochondrial DNA (mtDNA) defects are closely associated with various nervous system diseases and mtDNA is particularly susceptible to oxidative stress, the purpose of this study was to determine whether radiofrequency radiation can cause oxidative damage to mtDNA. In this study, we exposed primary cultured cortical neurons to pulsed RF electromagnetic fields at a frequency of 1800 MHz modulated by 217 Hz at an average special absorption rate (SAR) of 2 W/kg. At 24 h after exposure, we found that RF radiation induced a significant increase in the levels of 8-hydroxyguanine (8-OHdG), a common biomarker of DNA oxidative damage, in the mitochondria of neurons. Concomitant with this finding, the copy number of mtDNA and the levels of mitochondrial RNA (mtRNA) transcripts showed an obvious reduction after RF exposure. Each of these mtDNA disturbances could be reversed by pretreatment with melatonin, which is known to be an efficient antioxidant in the brain. Together, these results suggested that 1800 MHz RF radiation could cause oxidative damage to mtDNA in primary cultured neurons. Oxidative damage to mtDNA may account for the neurotoxicity of RF radiation in the brain.

  7. Earth's Endangered Ozone

    ERIC Educational Resources Information Center

    Panofsky, Hans A.

    1978-01-01

    Included are (1) a discussion of ozone chemistry; (2) the effects of nitrogen fertilizers, fluorocarbons, and high level aircraft on the ozone layer; and (3) the possible results of a decreasing ozone layer. (MR)

  8. Ozone-Induced Responses in Croton floribundus Spreng. (Euphorbiaceae): Metabolic Cross-Talk between Volatile Organic Compounds and Calcium Oxalate Crystal Formation

    PubMed Central

    Cardoso-Gustavson, Poliana; Bolsoni, Vanessa Palermo; de Oliveira, Debora Pinheiro; Guaratini, Maria Tereza Gromboni; Aidar, Marcos Pereira Marinho; Marabesi, Mauro Alexandre; Alves, Edenise Segala; de Souza, Silvia Ribeiro

    2014-01-01

    Here, we proposed that volatile organic compounds (VOC), specifically methyl salicylate (MeSA), mediate the formation of calcium oxalate crystals (COC) in the defence against ozone (O3) oxidative damage. We performed experiments using Croton floribundus, a pioneer tree species that is tolerant to O3 and widely distributed in the Brazilian forest. This species constitutively produces COC. We exposed plants to a controlled fumigation experiment and assessed biochemical, physiological, and morphological parameters. O3 induced a significant increase in the concentrations of constitutive oxygenated compounds, MeSA and terpenoids as well as in COC number. Our analysis supported the hypothesis that ozone-induced VOC (mainly MeSA) regulate ROS formation in a way that promotes the opening of calcium channels and the subsequent formation of COC in a fast and stable manner to stop the consequences of the reactive oxygen species in the tissue, indeed immobilising the excess calcium (caused by acute exposition to O3) that can be dangerous to the plant. To test this hypothesis, we performed an independent experiment spraying MeSA over C. floribundus plants and observed an increase in the number of COC, indicating that this compound has a potential to directly induce their formation. Thus, the tolerance of C. floribundus to O3 oxidative stress could be a consequence of a higher capacity for the production of VOC and COC rather than the modulation of antioxidant balance. We also present some insights into constitutive morphological features that may be related to the tolerance that this species exhibits to O3. PMID:25165889

  9. Ozone-induced responses in Croton floribundus Spreng. (Euphorbiaceae): metabolic cross-talk between volatile organic compounds and calcium oxalate crystal formation.

    PubMed

    Cardoso-Gustavson, Poliana; Bolsoni, Vanessa Palermo; de Oliveira, Debora Pinheiro; Guaratini, Maria Tereza Gromboni; Aidar, Marcos Pereira Marinho; Marabesi, Mauro Alexandre; Alves, Edenise Segala; de Souza, Silvia Ribeiro

    2014-01-01

    Here, we proposed that volatile organic compounds (VOC), specifically methyl salicylate (MeSA), mediate the formation of calcium oxalate crystals (COC) in the defence against ozone (O3) oxidative damage. We performed experiments using Croton floribundus, a pioneer tree species that is tolerant to O3 and widely distributed in the Brazilian forest. This species constitutively produces COC. We exposed plants to a controlled fumigation experiment and assessed biochemical, physiological, and morphological parameters. O3 induced a significant increase in the concentrations of constitutive oxygenated compounds, MeSA and terpenoids as well as in COC number. Our analysis supported the hypothesis that ozone-induced VOC (mainly MeSA) regulate ROS formation in a way that promotes the opening of calcium channels and the subsequent formation of COC in a fast and stable manner to stop the consequences of the reactive oxygen species in the tissue, indeed immobilising the excess calcium (caused by acute exposition to O3) that can be dangerous to the plant. To test this hypothesis, we performed an independent experiment spraying MeSA over C. floribundus plants and observed an increase in the number of COC, indicating that this compound has a potential to directly induce their formation. Thus, the tolerance of C. floribundus to O3 oxidative stress could be a consequence of a higher capacity for the production of VOC and COC rather than the modulation of antioxidant balance. We also present some insights into constitutive morphological features that may be related to the tolerance that this species exhibits to O3.

  10. The Potential Role of 8-Oxoguanine DNA Glycosylase-Driven DNA Base Excision Repair in Exercise-Induced Asthma

    PubMed Central

    Belanger, KarryAnne K.; Ameredes, Bill T.; Boldogh, Istvan

    2016-01-01

    Asthma is characterized by reversible airway narrowing, shortness of breath, wheezing, coughing, and other symptoms driven by chronic inflammatory processes, commonly triggered by allergens. In 90% of asthmatics, most of these symptoms can also be triggered by intense physical activities and severely exacerbated by environmental factors. This condition is known as exercise-induced asthma (EIA). Current theories explaining EIA pathogenesis involve osmotic and/or thermal alterations in the airways caused by changes in respiratory airflow during exercise. These changes, along with existing airway inflammatory conditions, are associated with increased cellular levels of reactive oxygen species (ROS) affecting important biomolecules including DNA, although the underlying molecular mechanisms have not been completely elucidated. One of the most abundant oxidative DNA lesions is 8-oxoguanine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase 1 (OGG1) during the base excision repair (BER) pathway. Whole-genome expression analyses suggest a cellular response to OGG1-BER, involving genes that may have a role in the pathophysiology of EIA leading to mast cell degranulation, airway hyperresponsiveness, and bronchoconstriction. Accordingly, this review discusses a potential new hypothesis in which OGG1-BER-induced gene expression is associated with EIA symptoms. PMID:27524866

  11. Staphylococcus aureus Sepsis Induces Early Renal Mitochondrial DNA Repair and Mitochondrial Biogenesis in Mice

    PubMed Central

    Bartz, Raquel R.; Fu, Ping; Suliman, Hagir B.; Crowley, Stephen D.; MacGarvey, Nancy Chou; Welty-Wolf, Karen; Piantadosi, Claude A.

    2014-01-01

    Acute kidney injury (AKI) contributes to the high morbidity and mortality of multi-system organ failure in sepsis. However, recovery of renal function after sepsis-induced AKI suggests active repair of energy-producing pathways. Here, we tested the hypothesis in mice that Staphyloccocus aureus sepsis damages mitochondrial DNA (mtDNA) in the kidney and activates mtDNA repair and mitochondrial biogenesis. Sepsis was induced in wild-type C57Bl/6J and Cox-8 Gfp-tagged mitochondrial-reporter mice via intraperitoneal fibrin clots embedded with S. aureus. Kidneys from surviving mice were harvested at time zero (control), 24, or 48 hours after infection and evaluated for renal inflammation, oxidative stress markers, mtDNA content, and mitochondrial biogenesis markers, and OGG1 and UDG mitochondrial DNA repair enzymes. We examined the kidneys of the mitochondrial reporter mice for changes in staining density and distribution. S. aureus sepsis induced sharp amplification of renal Tnf, Il-10, and Ngal mRNAs with decreased renal mtDNA content and increased tubular and glomerular cell death and accumulation of protein carbonyls and 8-OHdG. Subsequently, mtDNA repair and mitochondrial biogenesis was evidenced by elevated OGG1 levels and significant increases in NRF-1, NRF-2, and mtTFA expression. Overall, renal mitochondrial mass, tracked by citrate synthase mRNA and protein, increased in parallel with changes in mitochondrial GFP-fluorescence especially in proximal tubules in the renal cortex and medulla. Sub-lethal S. aureus sepsis thus induces widespread renal mitochondrial damage that triggers the induction of the renal mtDNA repair protein, OGG1, and mitochondrial biogenesis as a conspicuous resolution mechanism after systemic bacterial infection. PMID:24988481

  12. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.