Sample records for ozone induces dna

  1. Inhalation of ozone induces DNA strand breaks and inflammation in mice.


    Bornholdt, Jette; Dybdahl, Marianne; Vogel, Ulla; Hansen, Max; Loft, Steffen; Wallin, Håkan


    Ozone (O3) is a well-known oxidant pollutant present in photochemical smog. Although ozone is suspected to be a respiratory carcinogen it is not regulated as a carcinogen in most countries. The genotoxic and inflammatory effects of ozone were investigated in female mice exposed to ozone for 90 min. The tail moment in bronchoalveolar lavage (BAL) cells from BALB/c mice was determined by the comet assay as a measure of DNA strand breaks. Within the first 200 min after exposure, the BAL cells from the mice exposed to 1 or 2 ppm ozone had 1.6- and 2.6-fold greater tail moments than unexposed mice. After 200 min there was no effect. It could be ruled out that the effect during the first 200 min was due to major infiltration of lymphocytes or neutrophils. Unexpectedly, ozone had no effect on the content of 8-oxo-deoxyguanosine (8-oxo-dG) in nuclear DNA or on oxidised amino acids in the lung tissue. The mRNA level of the repair enzyme ERCC1 was not increased in the lung tissue. Inflammation was measured by the cytokine mRNA level in lung homogenates. An up to 150-fold induction of interleukin-6 (IL-6) mRNA was detected in the animals exposed to 2 ppm ozone compared to the air-exposed control mice. Also at 1 ppm ozone, the IL-6 mRNA was induced. The large induction of IL-6 mRNA in the lung took place after DNA strand breaks were induced in BAL. This does not support the notion that inflammatory reactions are the cause of DNA damage. To determine whether these exposures were mutagenic, Muta Mice were exposed to 2 ppm ozone, 90 min per day for 5 days. No treatment-related mutations could be detected in the cII transgene. These results indicate that a short episode of ozone exposure at five times the threshold limit value (TLV) in US induces lung inflammatory mediators and DNA damage in the cells in the lumen of the lung. This was not reflected by an induction of mutations in the lung of Muta Mice. PMID:12297145

  2. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )


    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.


    EPA Science Inventory

    This research program was initiated with the overall objective of determining whether exposure to ozone could damage the DNA of peripheral blood cells. An animal model system was designed in which glycogen was used to stimulate the production of peritoneal exudate cells (PECs) in...

  4. Production of single- and double-strand breaks in plasmid DNA by ozone

    SciTech Connect

    Hamelin, C.


    Agarose gel electrophoresis and electron microscopy were used to determine the type of lesions produced in DNA by ozone. This strong oxidizing agent was found to relax, linearize, then degrade native plasmid (pAT153) DNA molecules in solution. Ozone, like ionizing radiation, thus produced DNA breakage. To ascertain this point, wild-type and radiosensitive strains of Escherichia coli were transfected with control or ozonated plasmid DNA, and the host cells were selected for antibiotic resistance. A significant reduction in the transforming ability of pAT153 was observed following ozonation. Mutants deficient in the repair of DNA single-strand breaks yielded less ampicillin- or tetracycline-resistant clones than repair-proficient strains. In E. coli, the same gene products are probably involved in the repair of both radiation- and ozone-induced DNA breaks.

  5. Apoptosis induced by ozone and oxysterols in human alveolar epithelial cells

    PubMed Central

    Kosmider, Beata; Loader, Joan E.; Murphy, Robert C.; Mason, Robert J.


    The mechanism of ozone-induced lung cell injury is poorly understood. One hypothesis is that ozone induces lipid peroxidation and that these peroxidased lipids produce oxidative stress and DNA damage. Oxysterols are lipid peroxide formed by the direct effect of ozone on pulmonary surfactant and cell membranes. We studied the effects of ozone and the oxysterol 5β,6β-epoxycholesterol (β-epoxide) and its metabolite cholestan-6-oxo-3,5-diol (6-oxo-3,5-diol) on human alveolar epithelial type I-like cells (ATI-like cells) and type II cells (ATII cells). Ozone and oxysterols induced apoptosis and cytotoxicity in ATI-like cells. They also generated reactive oxygen species and DNA damage. Ozone and β-epoxide were strong inducers of nuclear factor erythroid 2-related factor 2 (Nrf2), heat shock protein 70 (Hsp70) and Fos-related antigen 1 (Fra1) protein expressions. Furthermore, we found higher sensitivity of ATI-like cells than ATII cells exposed to ozone or treated with β-epoxide or 6-oxo-3,5-diol. In general the response to the cholesterol epoxides was similar to the effect of ozone. The importance of understanding the response of human ATI-like cells and ATII cells to oxysterols may be useful for further studies, because these compounds may represent useful biomarkers in other diseases. PMID:20219673

  6. Reconciliation of halogen-induced ozone loss with the total-column ozone record

    NASA Astrophysics Data System (ADS)

    Shepherd, T. G.; Plummer, D. A.; Scinocca, J. F.; Hegglin, M. I.; Fioletov, V. E.; Reader, M. C.; Remsberg, E.; von Clarmann, T.; Wang, H. J.


    The observed depletion of the ozone layer from the 1980s onwards is attributed to halogen source gases emitted by human activities. However, the precision of this attribution is complicated by year-to-year variations in meteorology, that is, dynamical variability, and by changes in tropospheric ozone concentrations. As such, key aspects of the total-column ozone record, which combines changes in both tropospheric and stratospheric ozone, remain unexplained, such as the apparent absence of a decline in total-column ozone levels before 1980, and of any long-term decline in total-column ozone levels in the tropics. Here we use a chemistry-climate model to estimate changes in halogen-induced ozone loss between 1960 and 2010; the model is constrained by observed meteorology to remove the effects of dynamical variability, and driven by emissions of tropospheric ozone precursors to separate out changes in tropospheric ozone. We show that halogen-induced ozone loss closely followed stratospheric halogen loading over the studied period. Pronounced enhancements in ozone loss were apparent in both hemispheres following the volcanic eruptions of El Chichon and, in particular, Mount Pinatubo, which significantly enhanced stratospheric aerosol loads. We further show that approximately 40% of the long-term non-volcanic ozone loss occurred before 1980, and that long-term ozone loss also occurred in the tropical stratosphere. Finally, we show that halogen-induced ozone loss has declined by over 10% since stratospheric halogen loading peaked in the late 1990s, indicating that the recovery of the ozone layer is well underway.

  7. Reconciliation of Halogen-Induced Ozone Loss with the Total-Column Ozone Record

    NASA Technical Reports Server (NTRS)

    Shepherd, T. G.; Plummer, D. A.; Scinocca, J. F.; Hegglin, M. I.; Fioletov, V. E.; Reader, M. C.; Remsberg, E.; von Clarmann, T.; Wang, H. J.


    The observed depletion of the ozone layer from the 1980s onwards is attributed to halogen source gases emitted by human activities. However, the precision of this attribution is complicated by year-to-year variations in meteorology, that is, dynamical variability, and by changes in tropospheric ozone concentrations. As such, key aspects of the total-column ozone record, which combines changes in both tropospheric and stratospheric ozone, remain unexplained, such as the apparent absence of a decline in total-column ozone levels before 1980, and of any long-term decline in total-column ozone levels in the tropics. Here we use a chemistry-climate model to estimate changes in halogen-induced ozone loss between 1960 and 2010; the model is constrained by observed meteorology to remove the eects of dynamical variability, and driven by emissions of tropospheric ozone precursors to separate out changes in tropospheric ozone. We show that halogen-induced ozone loss closely followed stratospheric halogen loading over the studied period. Pronounced enhancements in ozone loss were apparent in both hemispheres following the volcanic eruptions of El Chichon and, in particular, Mount Pinatubo, which significantly enhanced stratospheric aerosol loads. We further show that approximately 40% of the long-term non-volcanic ozone loss occurred before 1980, and that long-term ozone loss also occurred in the tropical stratosphere. Finally, we show that halogeninduced ozone loss has declined by over 10% since stratospheric halogen loading peaked in the late 1990s, indicating that the recovery of the ozone layer is well underway.

  8. ROCK insufficiency attenuates ozone-induced airway hyperresponsiveness in mice.


    Kasahara, David I; Mathews, Joel A; Park, Chan Y; Cho, Youngji; Hunt, Gabrielle; Wurmbrand, Allison P; Liao, James K; Shore, Stephanie A


    Ozone causes airway hyperresponsiveness (AHR) and pulmonary inflammation. Rho kinase (ROCK) is a key regulator of smooth muscle cell contraction and inflammatory cell migration. To determine the contribution of the two ROCK isoforms ROCK1 and ROCK2 to ozone-induced AHR, we exposed wild-type, ROCK1(+/-), and ROCK2(+/-) mice to air or ozone (2 ppm for 3 h) and evaluated mice 24 h later. ROCK1 or ROCK2 haploinsufficiency did not affect airway responsiveness in air-exposed mice but significantly reduced ozone-induced AHR, with a greater reduction in ROCK2(+/-) mice despite increased bronchoalveolar lavage (BAL) inflammatory cells in ROCK2(+/-) mice. Compared with wild-type mice, ozone-induced increases in BAL hyaluronan, a matrix protein implicated in ozone-induced AHR, were lower in ROCK1(+/-) but not ROCK2(+/-) mice. Ozone-induced increases in other inflammatory moieties reported to contribute to ozone-induced AHR (IL-17A, osteopontin, TNFα) were not different in wild-type vs. ROCK1(+/-) or ROCK2(+/-) mice. We also observed a dose-dependent reduction in ozone-induced AHR after treatment with the ROCK1/ROCK2 inhibitor fasudil, even though fasudil was administered after induction of inflammation. Ozone increased pulmonary expression of ROCK2 but not ROCK1 or RhoA. A ROCK2 inhibitor, SR3677, reduced contractile forces in primary human airway smooth muscle cells, confirming a role for ROCK2 in airway smooth muscle contraction. Our results demonstrate that ozone-induced AHR requires ROCK. Whereas ROCK1-dependent changes in hyaluronan may contribute to ROCK1's role in O3-induced AHR, the role of ROCK2 is downstream of inflammation, likely at the level of airway smooth muscle contraction. PMID:26276827

  9. Products of ozonized arachidonic acid potentiate the formation of DNA single strand breaks in cultured human lung cells

    SciTech Connect

    Kozumbo, W.J.; Hanley, N.M.; Agarwal, S.


    In this study we examined the potential for environmental levels of ozone (O{sub 3}) to degrade arachidonic acid (AA), a polyunsaturated fatty acid abundantly present in the lung, into products that can produce DNA single strand breaks (ssb) in cultured human lung cells. Human lung fibroblasts were incubated with 60 {mu}M AA that had been previously exposed to an degraded by 0.4 ppm O{sub 3} (1 hr). Incubation of the cells with O{sub 3}-exposed AA (but not with vehicle alone) for 1 hr at 4{degrees}C and 37{degrees}C produced 555 and 245 rad-equivalents of DNA ssb, respectively, as determined by the DNA alkaline elution technique. These breaks were completely eliminated when the ozonized AA solution was incubated with catalase prior to cell treatment, indicating that H{sub 2}O{sub 2} was solely responsible for damaging DNA. Superoxide dismutase, bovine serum albumin, or heat-inactivated catalase showed little, if any, inhibitory activity. The H{sub 2}O{sub 2} content for only about 40% of the observed breaks. Potentiation of the H{sub 2}O{sub 2}-induced DNA ssb persisted after removal of the carbonyl substances by chromatographic procedures, suggesting that the non-carbonyl component of ozonized AA was the responsible component for inducing augmentation of the observed increases in DNA ssb. Ozonized AA also induced DNA ssb in cultures of the human bronchial epithelial cell line BEAS-2B. Again, these breaks were shown to exceed levels that could be attributed to the presence of H{sub 2}O{sub 2} alone. These results indicate that products of ozonized AA can interact to potentiate DNA ssb in human lung cells. 42 refs., 6 figs., 3 tabs.

  10. Ozone pollution and ozone biomonitoring in European cities Part II. Ozone-induced plant injury and its relationship with descriptors of ozone pollution

    NASA Astrophysics Data System (ADS)

    Klumpp, Andreas; Ansel, Wolfgang; Klumpp, Gabriele; Vergne, Phillippe; Sifakis, Nicolas; Sanz, María José; Rasmussen, Stine; Ro-Poulsen, Helge; Ribas, Àngela; Peñuelas, Josep; Kambezidis, Harry; He, Shang; Garrec, Jean Pierre; Calatayud, Vicent

    Within the scope of a biomonitoring study conducted in twelve urban agglomerations in eight European countries, the ozone-sensitive bioindicator plant Nicotiana tabacum cv. Bel-W3 was employed in order to assess the occurrence of phytotoxic ozone effects at urban, suburban, rural and traffic-exposed sites. The tobacco plants were exposed to ambient air for biweekly periods at up to 100 biomonitoring sites from 2000 to 2002. Special emphasis was placed upon methodological standardisation of plant cultivation, field exposure and injury assessment. Ozone-induced leaf injury showed a clearly increasing gradient from northern and northwestern Europe to central and southern European locations. The strongest ozone impact occurred at the exposure sites in Lyon and Barcelona, while in Edinburgh, Sheffield, Copenhagen and Düsseldorf only weak to moderate ozone effects were registered. Between-site differences within local networks were relatively small, but seasonal and inter-annual differences were strong due to the variability of meteorological conditions and related ozone concentrations. The 2001 data revealed a significant relationship between foliar injury degree and various descriptors of ozone pollution such as mean value, AOT20 and AOT40. Examining individual sites of the local monitoring networks separately, however, yielded noticeable differences. Some sites showed no association between ozone pollution and ozone-induced effects, whereas others featured almost linear relationships. This is because the actual ozone flux into the leaf, which is modified by various environmental factors, rather than ambient ozone concentration determines the effects on plants. The advantage of sensitive bioindicators like tobacco Bel-W3 is that the impact of the effectively absorbed ozone dose can directly be measured.

  11. Analysis of oxidative signalling induced by ozone in Arabidopsis thaliana.


    Mahalingam, Ramamurthy; Jambunathan, Niranjani; Gunjan, Samir Kumar; Faustin, Enock; Weng, Hua; Ayoubi, Patricia


    We are using acute ozone as an elicitor of endogenous reactive oxygen species (ROS) to understand oxidative signalling in Arabidopsis. Temporal patterns of ROS following a 6 h exposure to 300 nL L(-1) of ozone in ozone-sensitive Wassilewskija (Ws-0) ecotype showed a biphasic ROS burst with a smaller peak at 4 h and a larger peak at 16 h. This was accompanied by a nitric oxide (NO) burst that peaked at 9 h. An analysis of antioxidant levels showed that both ascorbate (AsA) and glutathione (GSH) were at their lowest levels, when ROS levels were high in ozone-stressed plants. Whole genome expression profiling analysis at 1, 4, 8, 12 and 24 h after initiation of ozone treatment identified 371 differentially expressed genes. Early induction of proteolysis and hormone-responsive genes indicated that an oxidative cell death pathway was triggered rapidly. Down-regulation of genes involved in carbon utilization, energy pathways and signalling suggested an inefficient defense response. Comparisons with other large-scale expression profiling studies indicated some overlap between genes induced by ethylene and ozone, and a significant overlap between genes repressed by ozone and methyl jasmonate treatment. Further, analysis of cis elements in the promoters of ozone-responsive genes also supports the view that phytohormones play a significant role in ozone-induced cell death. PMID:17080957

  12. Ozone-induced ethylene release from leaf surfaces

    SciTech Connect

    Rodecap, K.D.; Tingey, D.T.


    Ozone-induced stress-ethylene emissions from the adaxial and abaxial leaf surfaces of four plant species (Glycine max (L) Merr. cv. Dare, Lycopersicon esculentum Mill cv. Roma VF, Eucalyptus globulus Labill. and Hedera helix L.) were studied to determine if the stress ethylene diffused through the stomata or cuticle. In plants not exposed to ozone, basal ethylene was detected above both the adaxial and abaxial leaf surfaces of all the plant species examined, indicating that some ethylene can diffuse across the leaf cuticle. Oxone-induced stress ethylene production in all species examined. These data indicate that ozone-induced stress ethylene primarily diffuses from the leaf via the stomata.

  13. Virucidal levels of ozone induce hemolysis and hemoglobin degradation

    SciTech Connect

    Wagner, S.J.; Wagner, K.F.; Friedman, L.I.; Benade, L.F. )


    The animal virus, vesicular stomatitis virus (VSV), and the bacterial virus, phi 6, were inactivated by greater than 4 log10 in response to incubation with 13 to 14 mL of 1.4 mmol per L (65 micrograms/mL) to 1.6 mmol per L (75 micrograms/mL) of overlaid ozone in virus-spiked, dilute, red cell suspensions. Virus inactivation was greatly inhibited when ozone was overlaid in the presence of high-hematocrit red cells or, to a lesser degree, high levels of plasma. At hematocrits at which 5 to 6 log10 of VSV were inactivated, ozone caused 30-percent hemolysis, as measured by the loss of total cellular hemoglobin. Unexpectedly, this level of hemolysis could not be observed in supernatants because of the ozone-induced destruction (bleaching) of extracellular hemoglobin. These results suggest that ozone may have little biological specificity for damaging viruses over red cells.

  14. Importance of airway inflammation for hyperresponsiveness induced by ozone. [Dogs

    SciTech Connect

    Holtzman, M.J.; Fabbri, L.M.; O'Byrne, P.M.; Gold, B.D.; Aizawa, H.; Walters, E.H.; Alpert, S.E.; Nadel, J.A.


    We studied whether ozone-induced airway hyperresponsiveness correlates with the development of airway inflammation in dogs. To assess airway responsiveness, we determined increases in pulmonary resistance produced by delivering acetylcholine aerosol to the airways. To assess airway inflammation, we biopsied the airway mucosa and counted the number of neutrophils present in the epithelium. Airway responsiveness and inflammation were assessed in anesthetized dogs before ozone exposure and then 1 h and 1 wk after ozone (2.1 ppm, 2 h). Airway responsiveness increased markedly at 1 h after ozone and returned to control levels 1 wk later in each of 6 dogs, but it did not change after ozone in another 4 dogs. Furthermore, dogs that became hyperresponsive also developed a marked and reversible increase in the number of neutrophils in the epithelium, whereas dogs that did not become hyperresponsive had no change in the number of neutrophils. For the group of dogs, the level of airway responsiveness before and after ozone exposure correlated closely with the number of epithelial neutrophils. The results suggest that ozone-induced airway hyperresponsiveness may depend on the development of an acute inflammatory response in the airways.

  15. Evaluation of DNA dosimetry to assess ozone-mediated variability of biologically harmful radiation in Antarctica.


    George, Alison L; Peat, Helen J; Buma, Anita G J


    In this study we investigated the use of a DNA dosimeter to accurately measure changes in ultraviolet B radiation (UVBR; 280-315 nm) under Antarctic ozone hole conditions. Naked DNA solution in quartz tubes was exposed to ambient solar radiation at Rothera Research Station, Antarctica, between October and December 1998 for 3 h during UVBR peak hours (1200-1500 h). Trends in UVBR-mediated DNA damage (formation of cyclobutane pyrimidine dimers [CPD]) were related to cloud cover, ozone-column depth and spectroradiometric measurements of ambient radiation. Ozone-column depths ranged from 130 to 375 DU during the study period, resulting in highly variable UVBR doses, from 1.6 to 137 kJ m(-2) over the 3 h exposure, as measured by spectroradiometry. There was a strong positive correlation (86%) between dosimeter CPD concentrations and DNA-weighted UVBR doses. Ozone depth was a strong predictor of DNA damage (63%), and there was no significant relationship between CPD formation and cloud cover. Subtle changes in spectral characteristics caused by ozone depletion were detected by the biodosimeter; the highest CPD concentrations were observed in October when ozone-mediated shifts favored shorter wavelengths of UVBR. We conclude that the DNA biodosimeter is an accurate indicator of biologically effective UVBR, even under highly variable ozone conditions. PMID:12403448

  16. Ozone depletion and UVB radiation: impact on plant DNA damage in southern South America.


    Rousseaux, M C; Ballaré, C L; Giordano, C V; Scopel, A L; Zima, A M; Szwarcberg-Bracchitta, M; Searles, P S; Caldwell, M M; Díaz, S B


    The primary motivation behind the considerable effort in studying stratospheric ozone depletion is the potential for biological consequences of increased solar UVB (280-315 nm) radiation. Yet, direct links between ozone depletion and biological impacts have been established only for organisms of Antarctic waters under the influence of the ozone "hole;" no direct evidence exists that ozone-related variations in UVB affect ecosystems of temperate latitudes. Indeed, calculations based on laboratory studies with plants suggest that the biological impact of ozone depletion (measured by the formation of cyclobutane pyrimidine dimers in DNA) is likely to be less marked than previously thought, because UVA quanta (315-400 nm) may also cause significant damage, and UVA is unaffected by ozone depletion. Herein, we show that the temperate ecosystems of southern South America have been subjected to increasingly high levels of ozone depletion during the last decade. We found that in the spring of 1997, despite frequent cloud cover, the passages of the ozone hole over Tierra del Fuego (55 degrees S) caused concomitant increases in solar UV and that the enhanced ground-level UV led to significant increases in DNA damage in the native plant Gunnera magellanica. The fluctuations in solar UV explained a large proportion of the variation in DNA damage (up to 68%), particularly when the solar UV was weighted for biological effectiveness according to action spectra that assume a sharp decline in quantum efficiency with increasing wavelength from the UVB into the UVA regions of the spectrum. PMID:10611381

  17. Ozone-Induced Hypertussive Responses in Rabbits and Guinea Pigs.


    Clay, Emlyn; Patacchini, Riccardo; Trevisani, Marcello; Preti, Delia; Branà, Maria Pia; Spina, Domenico; Page, Clive


    Cough remains a major unmet clinical need, and preclinical animal models are not predictive for new antitussive agents. We have investigated the mechanisms and pharmacological sensitivity of ozone-induced hypertussive responses in rabbits and guinea pigs. Ozone induced a significant increase in cough frequency and a decrease in time to first cough to inhaled citric acid in both conscious guinea pigs and rabbits. This response was inhibited by the established antitussive drugs codeine and levodropropizine. In contrast to the guinea pig, hypertussive responses in the rabbit were not inhibited by bronchodilator drugs (β2 agonists or muscarinic receptor antagonists), suggesting that the observed hypertussive state was not secondary to bronchoconstriction in this species. The ozone-induced hypertussive response in the rabbit was inhibited by chronic pretreatment with capsaicin, suggestive of a sensitization of airway sensory nerve fibers. However, we could find no evidence for a role of TRPA1 in this response, suggesting that ozone was not sensitizing airway sensory nerves via activation of this receptor. Whereas the ozone-induced hypertussive response was accompanied by a significant influx of neutrophils into the airway, the hypertussive response was not inhibited by the anti-inflammatory phosphodiesterase 4 inhibitor roflumilast at a dose that clearly exhibited anti-inflammatory activity. In summary, our results suggest that ozone-induced hypertussive responses to citric acid may provide a useful model for the investigation of novel drugs for the treatment of cough, but some important differences were noted between the two species with respect to sensitivity to bronchodilator drugs. PMID:26837703

  18. Ozone-Induced Hypertussive Responses in Rabbits and Guinea Pigs

    PubMed Central

    Clay, Emlyn; Patacchini, Riccardo; Trevisani, Marcello; Preti, Delia; Branà, Maria Pia; Spina, Domenico


    Cough remains a major unmet clinical need, and preclinical animal models are not predictive for new antitussive agents. We have investigated the mechanisms and pharmacological sensitivity of ozone-induced hypertussive responses in rabbits and guinea pigs. Ozone induced a significant increase in cough frequency and a decrease in time to first cough to inhaled citric acid in both conscious guinea pigs and rabbits. This response was inhibited by the established antitussive drugs codeine and levodropropizine. In contrast to the guinea pig, hypertussive responses in the rabbit were not inhibited by bronchodilator drugs (β2 agonists or muscarinic receptor antagonists), suggesting that the observed hypertussive state was not secondary to bronchoconstriction in this species. The ozone-induced hypertussive response in the rabbit was inhibited by chronic pretreatment with capsaicin, suggestive of a sensitization of airway sensory nerve fibers. However, we could find no evidence for a role of TRPA1 in this response, suggesting that ozone was not sensitizing airway sensory nerves via activation of this receptor. Whereas the ozone-induced hypertussive response was accompanied by a significant influx of neutrophils into the airway, the hypertussive response was not inhibited by the anti-inflammatory phosphodiesterase 4 inhibitor roflumilast at a dose that clearly exhibited anti-inflammatory activity. In summary, our results suggest that ozone-induced hypertussive responses to citric acid may provide a useful model for the investigation of novel drugs for the treatment of cough, but some important differences were noted between the two species with respect to sensitivity to bronchodilator drugs. PMID:26837703

  19. Metabolic enhancement and increase of alveolar macrophages induced by ozone

    SciTech Connect

    Mochitate, K.; Miura, T.


    Male Wistar rats were exposed to 0.2 ppm ozone (O3) for 14 days and at intervals alveolar macrophages were collected by bronchoalveolar lavage to examine the effects of O3. The specific activities of glucose-6-phosphate dehydrogenase and glutathione peroxidase of alveolar macrophages increased to 1.6-fold (on the 3rd day) and 1.5-fold (on the 5th day), respectively, those of the control values. Similarly, the specific activities of pyruvate kinase, lactate dehydrogenase, and hexokinase also increased to 1.6-fold, 1.4-fold, and 1.2-fold, respectively, those of the control values on the 3rd day. The activities of all enzymes tested were maintained at significantly higher levels until the 14th day. Furthermore, the incorporation of (14C)thymidine into alveolar macrophages increased twice the control values on the 1st and 3rd days and was almost completely inhibited by the addition of 1.23 x 10(-4) M aphidicolin, a competitive inhibitor of DNA polymerase alpha. The number of alveolar macrophages collected from exposed animals also increased to 1.5-fold that of the control value on the 3rd day and was maintained at significantly higher level until the 14th day. It was noted that alveolar macrophages of small size preferentially increased between the 5th and 14th days. These results show that exposures to 0.2 ppm O3 induced a metabolic enhancement of the peroxidative metabolism, glycolysis, and DNA synthesis in alveolar macrophages and increased the macrophages of small size.


    EPA Science Inventory

    Ozone-induced stress ethylene emissions from the adaxial and abaxial leaf surfaces of four plant species (Glycine max (L) Merr. cv. Dare, Lycopersicon esculentum Mill cv. Roma VF, Eucalyptus globulus Labill. and Hedera helix L.) were studied to determine if the stress ethylene di...

  1. Ozone


    ... Earth's surface. It shields us from the sun's ultraviolet rays. Part of the good ozone layer is ... enough good ozone, people may get too much ultraviolet radiation. This may increase the risk of skin ...

  2. Ozone


    ... reactive form of oxygen. In the upper atmosphere, ozone forms a protective layer that shields us from the sun’s ultraviolet rays. At ground level, ozone is a harmful air pollutant and a primary ...

  3. Ozone


    Ozone is a gas. It can be good or bad, depending on where it is. "Good" ozone occurs naturally about 10 to 30 miles above ... the sun's ultraviolet rays. Part of the good ozone layer is gone. Man-made chemicals have destroyed ...

  4. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )


    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.


    EPA Science Inventory

    We have recently shown that episodic but not acute exposure to ozone or DEP induces vascular effects that are associated with the loss of cardiac mitochondrial phospholipid fatty acids (DEP 2.0 mg/m3 > ozone, 0.4 ppm). In this study we determined ozone and DEP-induced cardiac gen...

  6. Ozone-Induced Pulmonary Injury and Inflammation are Modulated by Adrenal-Derived Stress Hormones

    EPA Science Inventory

    Ozone exposure promotes pulmonary injury and inflammation. Previously we have characterized systemic changes that occur immediately after acute ozone exposure and are mediated by neuro-hormonal stress response pathway. Both HPA axis and sympathetic tone alterations induce the rel...


    EPA Science Inventory

    Studies were conducted to investigate the effect of ozone in prolonging pentobarbital (PEN)-induced sleeping time (S.T.). Since ozone is a common air pollutant, an ozone-induced alteration of mechanisms of drug action could have public health implications. It was shown that a 5-h...

  8. Ozone depletion and UVB radiation: Impact on plant DNA damage in southern South America

    PubMed Central

    Rousseaux, M. Cecilia; Ballaré, Carlos L.; Giordano, Carla V.; Scopel, Ana L.; Zima, Ana M.; Szwarcberg-Bracchitta, Mariela; Searles, Peter S.; Caldwell, Martyn M.; Díaz, Susana B.


    The primary motivation behind the considerable effort in studying stratospheric ozone depletion is the potential for biological consequences of increased solar UVB (280–315 nm) radiation. Yet, direct links between ozone depletion and biological impacts have been established only for organisms of Antarctic waters under the influence of the ozone “hole;” no direct evidence exists that ozone-related variations in UVB affect ecosystems of temperate latitudes. Indeed, calculations based on laboratory studies with plants suggest that the biological impact of ozone depletion (measured by the formation of cyclobutane pyrimidine dimers in DNA) is likely to be less marked than previously thought, because UVA quanta (315–400 nm) may also cause significant damage, and UVA is unaffected by ozone depletion. Herein, we show that the temperate ecosystems of southern South America have been subjected to increasingly high levels of ozone depletion during the last decade. We found that in the spring of 1997, despite frequent cloud cover, the passages of the ozone hole over Tierra del Fuego (55° S) caused concomitant increases in solar UV and that the enhanced ground-level UV led to significant increases in DNA damage in the native plant Gunnera magellanica. The fluctuations in solar UV explained a large proportion of the variation in DNA damage (up to 68%), particularly when the solar UV was weighted for biological effectiveness according to action spectra that assume a sharp decline in quantum efficiency with increasing wavelength from the UVB into the UVA regions of the spectrum. PMID:10611381

  9. Ozone influence on native vegetation in the Jizerske hory Mts. of the Czech Republic: results based on ozone exposure and ozone-induced visible symptoms.


    Hůnová, Iva; Matoušková, Leona; Srněnský, Radek; Koželková, Klára


    Ozone levels in the Jizerske hory Mts. measured at 13 sites by diffusive samplers during the 2006 and 2007 vegetation seasons are presented. A significant ozone gradient (5.4 ppb in 2006 and 4.0 ppb in 2007) per 100 m difference in altitude between 370 and 1,100 m a.s.l. was recorded. High-resolution maps of phytotoxic potential were developed. The AOT40 threshold (5 ppm h) was exceeded over the entire area with the highest levels exceeding this threshold by 12 times in the upper portions of the mountains. Ozone visible injury was evaluated at four of the monitoring sites on seven native plant and tree species. Four species showed ozone-like symptoms, two of which (Rubus idaeus and Fagus sylvatica) were confirmed as ozone-induced. Our results indicate that ambient ozone is likely to have a much lower impact on the Jizerske hory Mts. vegetation than expected, considering the measured ambient ozone exposures and favourable environmental conditions for ozone uptake. PMID:21374050


    EPA Science Inventory

    The mechanism of ozone-mediated plant injury is not know but has been postulated to involve oxygen free radicals. Hydroxyl free radicals react with DNA causing formation of many products, one of which is 8-hydroxyguanine. By using high performance liquid chromatography with elect...

  11. Role of neutrophilic inflammation in ozone-induced epithelial alterations in the nasal airways of rats

    NASA Astrophysics Data System (ADS)

    Cho, Hye Youn

    Ozone is a principal oxidant air pollutant in photochemical smog. Epithelial cells lining the centriacinar region of lung and the proximal aspects of nasal passage are primary target sites for ozone-induced injury in laboratory animals. Acute exposure of rats to high ambient concentrations of ozone (e.g., 0.5 ppm) results in neutrophilic inflammation, epithelial hyperplasia and mucous cell metaplasia (MCM) in the nasal transitional epithelium (NTE) lining the proximal nasal airways. The principal purpose of the present study was to investigate the role of pre-metaplastic cellular responses, especially neutrophilic inflammation, in the pathogenesis of ozone-induced MCM in rat NTE. For this purpose, three specific hypotheses-based whole-animal inhalation studies were conducted. Male F344/N rats were exposed in whole-body inhalation chambers to 0 (filtered air) or 0.5 ppm ozone for 1-3 days (8 h/day). Histochemical, immunochemical, molecular and morphometric techniques were used to investigate the ozone-induced cellular and molecular events in the NTE. Two in vitro studies were also conducted to examine the effects of ozone-inducible cytokines (i.e., tumor necrosis factor-alpha; TNF- a, and interleukin-6; IL-6) on mucin gene (rMuc-5AC) expression. Ozone induced a rapid increase of rMuc-5AC mRNA in nasal tissues within hours after the start of exposure. It preceded the appearance of MCM, and persisted with MCM. Ozone-induced neutrophilic inflammation accompanied the mucin gene upregulation, but was resolved when MCM first appeared in the NTE. Antibody-mediated depletion of circulating neutrophils attenuated ozone-induced MCM, although it did not affect the ozone-induced epithelial hyperplasia and mucin mRNA upregulation. In another study, it was found that preexisting neutrophilic rhinitis induced by endotoxin augmented the ozone-induced MCM. However, pre-existing rhinitis did not alter the severity of ozone-induced epithelial hyperplasia and mucin gene upregulation

  12. A search for relativistic electron induced stratospheric ozone depletion

    NASA Technical Reports Server (NTRS)

    Aikin, Arthur C.


    Possible ozone changes at 1 mb associated with the time variation and precipitation of relativistic electrons are investigated by examining the NIMBUS 7 SBUV ozone data set and corresponding temperatures derived from NMC data. No ozone depletion was observed in high-latitude summer when temperature fluctuations are small. In winter more variation in ozone occurs, but large temperature changes make it difficult to identify specific ozone decreases as being the result of relativistic electron precipitation.

  13. Ozone-induced stomatal sluggishness changes carbon and water balance of temperate deciduous forests

    NASA Astrophysics Data System (ADS)

    Hoshika, Yasutomo; Katata, Genki; Deushi, Makoto; Watanabe, Makoto; Koike, Takayoshi; Paoletti, Elena


    Tropospheric ozone concentrations have increased by 60-100% in the Northern Hemisphere since the 19th century. The phytotoxic nature of ozone can impair forest productivity. In addition, ozone affects stomatal functions, by both favoring stomatal closure and impairing stomatal control. Ozone-induced stomatal sluggishness, i.e., a delay in stomatal responses to fluctuating stimuli, has the potential to change the carbon and water balance of forests. This effect has to be included in models for ozone risk assessment. Here we examine the effects of ozone-induced stomatal sluggishness on carbon assimilation and transpiration of temperate deciduous forests in the Northern Hemisphere in 2006-2009 by combining a detailed multi-layer land surface model and a global atmospheric chemistry model. An analysis of results by ozone FACE (Free-Air Controlled Exposure) experiments suggested that ozone-induced stomatal sluggishness can be incorporated into modelling based on a simple parameter (gmin, minimum stomatal conductance) which is used in the coupled photosynthesis-stomatal model. Our simulation showed that ozone can decrease water use efficiency, i.e., the ratio of net CO2 assimilation to transpiration, of temperate deciduous forests up to 20% when ozone-induced stomatal sluggishness is considered, and up to only 5% when the stomatal sluggishness is neglected.

  14. Ozone-induced stomatal sluggishness changes carbon and water balance of temperate deciduous forests

    PubMed Central

    Hoshika, Yasutomo; Katata, Genki; Deushi, Makoto; Watanabe, Makoto; Koike, Takayoshi; Paoletti, Elena


    Tropospheric ozone concentrations have increased by 60–100% in the Northern Hemisphere since the 19th century. The phytotoxic nature of ozone can impair forest productivity. In addition, ozone affects stomatal functions, by both favoring stomatal closure and impairing stomatal control. Ozone-induced stomatal sluggishness, i.e., a delay in stomatal responses to fluctuating stimuli, has the potential to change the carbon and water balance of forests. This effect has to be included in models for ozone risk assessment. Here we examine the effects of ozone-induced stomatal sluggishness on carbon assimilation and transpiration of temperate deciduous forests in the Northern Hemisphere in 2006-2009 by combining a detailed multi-layer land surface model and a global atmospheric chemistry model. An analysis of results by ozone FACE (Free-Air Controlled Exposure) experiments suggested that ozone-induced stomatal sluggishness can be incorporated into modelling based on a simple parameter (gmin, minimum stomatal conductance) which is used in the coupled photosynthesis-stomatal model. Our simulation showed that ozone can decrease water use efficiency, i.e., the ratio of net CO2 assimilation to transpiration, of temperate deciduous forests up to 20% when ozone-induced stomatal sluggishness is considered, and up to only 5% when the stomatal sluggishness is neglected. PMID:25943276

  15. Ozone-induced stomatal sluggishness changes carbon and water balance of temperate deciduous forests.


    Hoshika, Yasutomo; Katata, Genki; Deushi, Makoto; Watanabe, Makoto; Koike, Takayoshi; Paoletti, Elena


    Tropospheric ozone concentrations have increased by 60-100% in the Northern Hemisphere since the 19(th) century. The phytotoxic nature of ozone can impair forest productivity. In addition, ozone affects stomatal functions, by both favoring stomatal closure and impairing stomatal control. Ozone-induced stomatal sluggishness, i.e., a delay in stomatal responses to fluctuating stimuli, has the potential to change the carbon and water balance of forests. This effect has to be included in models for ozone risk assessment. Here we examine the effects of ozone-induced stomatal sluggishness on carbon assimilation and transpiration of temperate deciduous forests in the Northern Hemisphere in 2006-2009 by combining a detailed multi-layer land surface model and a global atmospheric chemistry model. An analysis of results by ozone FACE (Free-Air Controlled Exposure) experiments suggested that ozone-induced stomatal sluggishness can be incorporated into modelling based on a simple parameter (gmin, minimum stomatal conductance) which is used in the coupled photosynthesis-stomatal model. Our simulation showed that ozone can decrease water use efficiency, i.e., the ratio of net CO2 assimilation to transpiration, of temperate deciduous forests up to 20% when ozone-induced stomatal sluggishness is considered, and up to only 5% when the stomatal sluggishness is neglected. PMID:25943276

  16. Meteorology-induced variations in the spatial behavior of summer ozone pollution in Central California

    SciTech Connect

    Jin, Ling; Harley, Robert A.; Brown, Nancy J.


    Cluster analysis was applied to daily 8 h ozone maxima modeled for a summer season to characterize meteorology-induced variations in the spatial distribution of ozone. Principal component analysis is employed to form a reduced dimension set to describe and interpret ozone spatial patterns. The first three principal components (PCs) capture {approx}85% of total variance, with PC1 describing a general spatial trend, and PC2 and PC3 each describing a spatial contrast. Six clusters were identified for California's San Joaquin Valley (SJV) with two low, three moderate, and one high-ozone cluster. The moderate ozone clusters are distinguished by elevated ozone levels in different parts of the valley: northern, western, and eastern, respectively. The SJV ozone clusters have stronger coupling with the San Francisco Bay area (SFB) than with the Sacramento Valley (SV). Variations in ozone spatial distributions induced by anthropogenic emission changes are small relative to the overall variations in ozone amomalies observed for the whole summer. Ozone regimes identified here are mostly determined by the direct and indirect meteorological effects. Existing measurement sites are sufficiently representative to capture ozone spatial patterns in the SFB and SV, but the western side of the SJV is under-sampled.

  17. Bioinforrnatics of Gene Expression Profiling Data Provide Mechanistic Understanding of Acute Ozone-Induced Lung injury

    EPA Science Inventory

    Acute ozone-induced pulmonary injury and inflammation are well characterized. A few studies have used gene expression profiling to determine the types of changes induced by ozone; however the mechanisms or the pathways involved are less well understood. We presumed that robust bi...

  18. Acute Ozone-Induced Pulmonary and Systemic Metabolic Effects are Diminished in Adrenalectomized Rats

    EPA Science Inventory

    Acute ozone exposure increases circulating stress hormones and induces peripheral metabolic alterations in animals and humans. We hypothesized that the increase of adrenal-derived stress hormones is necessary for ozone-induced systemic metabolic effects and lung injury. Male Wis...

  19. Acute Ozone-Induced Pulmonary and Systemic Metabolic Effects are Diminished in Adrenalectomized Rats#

    EPA Science Inventory

    Acute ozone exposure increases circulating stress hormones and induces metabolic alterations in animals and humans. We hypothesized that the increase of adrenal-derived stress hormones is necessary for both ozone-induced metabolic effects and lung injury. Male Wistar-Kyoto rats ...

  20. Biomarkers of Oxidative Stress Study V: Ozone exposure of rats and its effect on lipids, proteins and DNA in plasma and urine

    PubMed Central

    Kadiiska, Maria B.; Basu, Samar; Brot, Nathan; Cooper, Christopher; Csallany, A. Saari; Davies, Michael J.; George, Magdalene M.; Murray, Dennis M.; Roberts, L. Jackson; Shigenaga, Mark K.; Sohal, Rajindar S.; Stocker, Roland; Van Thiel, David H.; Wiswedel, Ingrid; Hatch, Gary E.; Mason, Ronald P.


    Ozone exposure effect on free radical-catalyzed oxidation products of lipids, proteins and DNA in the plasma and urine of rats was studied as a continuation of the international Biomarker of Oxidative Stress Study (BOSS) sponsored by NIEHS/NIH. The goal was to identify a biomarker for ozone-induced oxidative stress and to assess whether inconsistent results often reported in the literature might be due to the limitations of the available methods for measuring the various types of oxidative products. The time and dose-dependent effects of ozone exposure on rat plasma lipid hydroperoxides, malondialdehyde, F2-isoprostanes, protein carbonyls, methionine oxidation, tyrosine- and phenylalanine oxidation products, as well as urinary malondialdehyde and F2-isoprostanes were investigated with various techniques. The criterion used to recognize a marker in the model of ozone exposure was that a significant effect could be identified and measured in a biological fluid seen at both doses at more than one time point. No statistically significant differences between the experimental and control groups at either ozone dose and time point studied could be identified in this study. Tissue samples were not included. Despite all the work accomplished in the BOSS study of ozone, no available product of oxidation in biological fluid has yet met the required criteria of being a biomarker. The current negative findings as a consequence of ozone exposure are of great importance, because they document that in complex systems, as the present in vivo experiment, the assays used may not provide meaningful data of ozone oxidation, especially in human studies. PMID:23608465

  1. Anti-inflammatory drug (BW755C) inhibits airway hyperresponsiveness induced by ozone in dogs

    SciTech Connect

    Fabbri, L.M.; Aizawa, H.; O'Byrne, P.M.; Bethel, R.A.; Walters, E.H.; Holtzman, M.J.; Nadel, J.A.


    To follow up a previous observation that airway hyperresponsiveness induced by ozone is linked to airway inflammation, the authors investigated the effect of BW755C, an anti-inflammatory drug, on ozone-induced hyperresponsiveness in dogs. Airway responsiveness was assessed with dose-response curves of acetylcholine aerosol versus pulmonary resistance in two sets of experiments. In one set (placebo treatment), five dogs were given only saline solution treatment and were studied before treatment or ozone exposure and then after treatment both before and after ozone (3.0 ppm, 2 hours); in another set (BW755C treatment), the same dogs were studied before BW755C treatment or ozone and then after treatment (10 mg/kg intravenously) both before and after ozone. When the dogs were given no BW755C treatment, ozone induced a marked increase in airway responsiveness to acetylcholine. When the dogs were given BW755C, responsiveness was no different during treatment than before treatment but, more importantly, responsiveness did not increase significantly after ozone. The authors conclude that BW755C markedly inhibits ozone-induced airway hyperresponsiveness in dogs, probably by inhibiting the formation of oxygenation products of arachidonic acid.

  2. Ozone

    SciTech Connect

    Not Available


    The author discusses the debate over whether concern about a hole in the ozone layer in Antarctic is real or science fiction. There is a growing consensus that efforts must be taken to protect the ozone layer. The issue now is not whether chlorofluorocarbons (CFCs) should be controlled and regulated but how much and how soon. The United States has urged that the production of dangerous CFCs, and any other chemicals that affect the ozone layer, be restricted immediately to current levels and that their use be reduced 95 percent over the next decade. The American position was too strong for many European nations and the Japanese. Negotiations at an international conference on the matter broke down. The breakdown is due in part to a more acute concern for environmental matters in the United States than exists in many countries. Meanwhile CFCs are linked to another environmental problem that equally threatens the world - the Greenhouse Effect. The earth is in a natural warming period, but man could be causing it to become even warmer. The Greenhouse Effect could have a catastrophic impact on mankind, although nothing has been proven yet.

  3. Acute Ozone-Induced Pulmonary and Systemic Metabolic Effects Are Diminished in Adrenalectomized Rats.


    Miller, Desinia B; Snow, Samantha J; Schladweiler, Mette C; Richards, Judy E; Ghio, Andrew J; Ledbetter, Allen D; Kodavanti, Urmila P


    Acute ozone exposure increases circulating stress hormones and induces metabolic alterations in animals. We hypothesized that the increase of adrenal-derived stress hormones is necessary for both ozone-induced metabolic effects and lung injury. Male Wistar-Kyoto rats underwent bilateral adrenal demedullation (DEMED), total bilateral adrenalectomy (ADREX), or sham surgery (SHAM). After a 4 day recovery, rats were exposed to air or ozone (1 ppm), 4 h/day for 1 or 2 days and responses assessed immediately postexposure. Circulating adrenaline levels dropped to nearly zero in DEMED and ADREX rats relative to SHAM. Corticosterone tended to be low in DEMED rats and dropped to nearly zero in ADREX rats. Adrenalectomy in air-exposed rats caused modest changes in metabolites and lung toxicity parameters. Ozone-induced hyperglycemia and glucose intolerance were markedly attenuated in DEMED rats with nearly complete reversal in ADREX rats. Ozone increased circulating epinephrine and corticosterone in SHAM but not in DEMED or ADREX rats. Free fatty acids (P = .15) and branched-chain amino acids increased after ozone exposure in SHAM but not in DEMED or ADREX rats. Lung minute volume was not affected by surgery or ozone but ozone-induced labored breathing was less pronounced in ADREX rats. Ozone-induced increases in lung protein leakage and neutrophilic inflammation were markedly reduced in DEMED and ADREX rats (ADREX > DEMED). Ozone-mediated decreases in circulating white blood cells in SHAM were not observed in DEMED and ADREX rats. We demonstrate that ozone-induced peripheral metabolic effects and lung injury/inflammation are mediated through adrenal-derived stress hormones likely via the activation of stress response pathway. PMID:26732886

  4. Indomethacin inhibits the airway hyperresponsiveness but not the neutrophil influx induced by ozone in dogs

    SciTech Connect

    O'Byrne, P.M.; Walters, E.H.; Aizawa, H.; Fabbri, L.M.; Holtzman, M.J.; Nadel, J.A.


    To determine whether oxygenation products of arachidonic acid may be involved in the airway hyperresponsiveness induced by ozone exposure, we studied whether ozone-induced hyperresponsiveness could be inhibited by the prostaglandin synthetase inhibitor, indomethacin, in dogs. Airway responsiveness was assessed with dose-response curves of acetylcholine aerosol versus pulmonary resistance in 2 sets of experiments: in one set, 5 dogs were given no indomethacin treatment and were studied both before and after ozone exposure (3.0 ppm, 2 h); in another set, the same dogs were studied before indomethacin treatment or ozone exposure and then during treatment (1 mg/kg every 12 h for 4 days) both before and after ozone exposure. On each occasion, we also determined the number of neutrophils in biopsies of the airway epithelium. When the dogs were not treated with indomethacin, ozone caused a marked increase in responsiveness to acetylcholine and a marked increase in the number of neutrophils in the airway epithelium. When the dogs were given indomethacin, responsiveness was no different during treatment than before treatment, but more importantly, responsiveness did not increase significantly after they were exposed to ozone. Interestingly, indomethacin treatment did not affect either the baseline number of epithelial neutrophils before ozone exposure or the increase in the number of neutrophils after exposure. The results suggest that oxygenation products of arachidonic acid that are sensitive to inhibition by indomethacin play a role in ozone-induced hyperresponsiveness without affecting the influx of neutrophils.

  5. Ozone-Induced Cell Death in Tobacco Cultivar Bel W3 Plants. The Role of Programmed Cell Death in Lesion Formation

    PubMed Central

    Pasqualini, Stefania; Piccioni, Claudia; Reale, Lara; Ederli, Luisa; Della Torre, Guido; Ferranti, Francesco


    Treatment of the ozone-sensitive tobacco (Nicotiana tabacum L. cv Bel W3) with an ozone pulse (150 nL L–1 for 5 h) induced visible injury, which manifested 48 to 72 h from onset of ozone fumigation. The “classical” ozone symptoms in tobacco cv Bel W3 plants occur as sharply defined, dot-like lesions on the adaxial side of the leaf and result from the death of groups of palisade cells. We investigated whether this reaction had the features of a hypersensitive response like that which results from the incompatible plant-pathogen interaction. We detected an oxidative burst, the result of H2O2 accumulation at 12 h from the starting of fumigation. Ozone treatment induced deposition of autofluorescent compounds and callose 24 h from the start of treatment. Total phenolic content was also strongly stimulated at the 10th and 72nd h from starting fumigation, concomitant with an enhancement in phenylalanine ammonia-lyase a and phenylalanine ammonia-lyase b expression, as evaluated by reverse transcriptase-polymerase chain reaction. There was also a marked, but transient, increase in the mRNA level of pathogenesis-related-1a, a typical hypersensitive response marker. Overall, these results are evidence that ozone triggers a hypersensitive response in tobacco cv Bel W3 plants. We adopted four criteria for detecting programmed cell death in ozonated tobacco cv Bel W3 leaves: (a) early release of cytochrome c from mitochondria; (b) activation of protease; (c) DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling of DNA 3′-OH groups; and (d) ultrastructural changes characteristic of programmed cell death, including chromatin condensation and blebbing of plasma membrane. We, therefore, provide evidence that ozone-induced oxidative stress triggers a cell death program in tobacco cv Bel W3. PMID:14612586

  6. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees


    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  7. The effect of antioxidants on ozone-induced airway hyperresponsiveness in dogs

    SciTech Connect

    Matsui, S.; Jones, G.L.; Woolley, M.J.; Lane, C.G.; Gontovnick, L.S.; O'Byrne, P.M. )


    The role of oxygen radicals in causing ozone-induced airway hyperresponsiveness in dogs was examined by pretreating dogs with allopurinol and/or deferoxamine mesylate (desferal), which are inhibitors of oxygen radical generation, before ozone inhalation. Acetylcholine airway responsiveness was measured before and after either air or ozone inhalation (3 ppm for 20 min) on 5 experimental days separated by at least 2 wk. On each day, the dogs were pretreated intravenously with allopurinol (50 mg/kg) followed by inhaled desferal (1,000 mg inhalation) or with allopurinol followed by the diluent for desferal or with the diluent for allopurinol and desferal or with both diluents. The effect of ozone on acetylcholine airway responsiveness was expressed as the differences in the log-transformed preozone-postozone acetylcholine provocative concentrations. When dogs received both diluents or either treatment alone, ozone inhalation caused airway hyperresponsiveness. The mean log differences for the preozone-postozone acetylcholine provocative concentration were 0.804 (SEM, 0.17) for both diluents, 0.524 (SEM, 0.16) for allopurinol alone, and 0.407 (SEM, 0.22) for desferal alone. However, the combination of allopurinol and desferal significantly inhibited the development of ozone-induced airway hyperresponsiveness, the log difference being 0.195 (SEM, 0.11) (p less than 0.05), without inhibiting ozone-induced neutrophil influx into the airways. The results suggest that the production of oxygen radicals is important in the pathogenesis of ozone-induced airway hyperresponsiveness.

  8. Low level ozone exposure induces airways inflammation and modifies cell surface phenotypes in healthy humans

    EPA Science Inventory

    Background: The effects of low level ozone exposure (0.08 ppm) on pulmonary function in healthy young adults are well known, however much less is known about the inflammatory and immuno-modulatory effects oflow level ozone in the airways. Techniques such as induced sputum and flo...


    EPA Science Inventory

    A Dynamic Nonlinear Model of Ozone-induced FEV1 Response under Changing Exposure Conditions. 1WF McDonnell, 2PW Stewart, 3MV Smith. 1Human Studies Division, NHEERL, U.S. EPA, RTP, NC. 2University of North Carolina, Chapel Hill, NC. 3ASI, Durham, NC.

    Ozone exposure result...

  10. Dose-response relationship of ozone-induced airway hyperresponsiveness in unanesthetized guinea pigs

    SciTech Connect

    Nishikawa, M.; Suzuki, S.; Ikeda, H.; Fukuda, T.; Suzuki, J.; Okubo, T. )


    The effect of ozone dose (the product of ozone concentration and exposure time) on airway responsiveness was examined in unanesthetized, spontaneously breathing guinea pigs. Airway responsiveness was assessed by measuring specific airway resistance (sRaw) as a function of increasing concentration of inhaled methacholine (Mch) aerosol (the concentration of Mch required in order to double the baseline sRaw: PC200Mch). The airway responsiveness was measured before and at 5 min, 5 h, and 24 h after exposure. A 30-min exposure to 1 ppm ozone (dose 30 ppm.min) did not change PC200Mch at any time after exposure. Both a 90-min exposure to 1 ppm ozone and a 30-min exposure to 3 ppm ozone, which are identical in terms of ozone dose (90 ppm.min), decreased PC200Mch to a similar degree. A 120-min exposure to 3 ppm ozone (360 ppm.min) produced a much greater decrease of PC200Mch at 5 min and 5 h after exposure, compared with low-dose exposure. There was a significant correlation between ozone dose and the change in airway responsiveness. In all groups, the baseline sRaw was increased by approximately 50% at 5 min after exposure, but there was no correlation between the changes in PC200Mch and the baseline sRaw. This study suggests that ozone-induced airway hyperresponsiveness in guinea pigs is closely related to ozone dose.

  11. Hyperthyroidism increases the risk of ozone-induced lung toxicity in rats.


    Huffman, L J; Judy, D J; Brumbaugh, K; Frazer, D G; Reynolds, J S; McKinney, W G; Goldsmith, W T


    The risk of lung injury from ozone exposure has been well documented. It is also known that various factors may significantly influence the susceptibility of animals to the toxic effects of ozone. In the present study, we investigated the possibility that hyperthyroidism might be associated with increases in ozone-induced pulmonary toxicity. To create a hyperthyroid condition, mature male Sprague--Dawley rats were given injections of thyroxine (dose range: 0.1 to 1 mg/kg body wt daily for 7 days). Control rats received vehicle injections. The animals were then exposed to air or ozone (dose range: 0.5 to 3 ppm for 3 h). At 18 h postexposure, bronchoalveolar lavage fluid and cells were harvested. In hyperthyroid animals, ozone exposure was associated with three- to sixfold increases in bronchoalveolar lavage fluid lactate dehydrogenase activities and albumin levels as well as the number of polymorphonuclear leukocytes harvested by bronchoalveolar lavage above levels observed in ozone-exposed control rats. Additional results from the present study suggest that these thyroid hormone-linked effects cannot be fully explained by differences in whole-body metabolic rate or changes in the inhaled dose of ozone. These findings indicate that the risk of ozone-induced lung toxicity is substantially increased in a hyperthyroid state and suggest that the susceptibility of the lung to damage from ozone exposure may be significantly influenced by individual thyroid hormone status. PMID:11350211

  12. Does cosmic-ray-induced heterogeneous chemistry influence stratospheric polar ozone loss?


    Müller, Rolf; Grooss, Jens-Uwe


    Cosmic-ray (CR) -induced heterogeneous reactions of halogenated species have been suggested to play the dominant role in causing the Antarctic ozone hole. However, measurements of total ozone in Antarctica do not show a compact and significant correlation with CR activity. Further, a substantial CR-induced heterogeneous loss of chlorofluorocarbons is incompatible with multiyear satellite observations of N2O and CFC-12. Thus, CR-induced heterogeneous reactions cannot be considered as an alternative mechanism causing the Antarctic ozone hole. PMID:20366127

  13. Lung transcriptional profiling: insights into the mechanisms of ozone-induced pulmonary injury in Wistar Kyoto rats

    EPA Science Inventory

    Acute ozone-induced pulmonary injury and inflammation are well characterized in rats; however, mechanistic understanding of the pathways involved is limited. We hypothesized that acute exposure of healthy rats to ozone will cause transcriptional alterations, and comprehensive ana...

  14. Ozone induces glucose intolerance and systemic metabolic effects in young and aged brown Norway rats

    SciTech Connect

    Bass, V.; Gordon, C.J.; Jarema, K.A.; MacPhail, R.C.; Cascio, W.E.; Phillips, P.M.; Ledbetter, A.D.; Schladweiler, M.C.; Andrews, D.; Miller, D.; Doerfler, D.L.; Kodavanti, U.P.


    Air pollutants have been associated with increased diabetes in humans. We hypothesized that ozone would impair glucose homeostasis by altering insulin signaling and/or endoplasmic reticular (ER) stress in young and aged rats. One, 4, 12, and 24 month old Brown Norway (BN) rats were exposed to air or ozone, 0.25 or 1.0 ppm, 6 h/day for 2 days (acute) or 2 d/week for 13 weeks (subchronic). Additionally, 4 month old rats were exposed to air or 1.0 ppm ozone, 6 h/day for 1 or 2 days (time-course). Glucose tolerance tests (GTT) were performed immediately after exposure. Serum and tissue biomarkers were analyzed 18 h after final ozone for acute and subchronic studies, and immediately after each day of exposure in the time-course study. Age-related glucose intolerance and increases in metabolic biomarkers were apparent at baseline. Acute ozone caused hyperglycemia and glucose intolerance in rats of all ages. Ozone-induced glucose intolerance was reduced in rats exposed for 13 weeks. Acute, but not subchronic ozone increased α{sub 2}-macroglobulin, adiponectin and osteopontin. Time-course analysis indicated glucose intolerance at days 1 and 2 (2 > 1), and a recovery 18 h post ozone. Leptin increased day 1 and epinephrine at all times after ozone. Ozone tended to decrease phosphorylated insulin receptor substrate-1 in liver and adipose tissues. ER stress appeared to be the consequence of ozone induced acute metabolic impairment since transcriptional markers of ER stress increased only after 2 days of ozone. In conclusion, acute ozone exposure induces marked systemic metabolic impairments in BN rats of all ages, likely through sympathetic stimulation. - Highlights: • Air pollutants have been associated with increased diabetes in humans. • Acute ozone exposure produces profound metabolic alterations in rats. • Age influences metabolic risk factors in aging BN rats. • Acute metabolic effects are reversible and repeated exposure reduces these effects. • Ozone

  15. Ozone-Induced Metabolic Impairment is Attenuated in Adrenalectomized Wistar Kyoto Rats

    EPA Science Inventory

    Rationale: Air pollutants have been linked to increased incidence of metabolic syndrome however the mechanisms are poorly understood. We have recently shown that ozone exposure induces significant hyperglycemia together with elevated serum leptin and epinephrine in the Wistar Ky...


    EPA Science Inventory

    Increased levels of oxidants and compromised compensatory response are associated with CVD susceptibility. We hypothesized that rat strains demonstrating genetic CVD will have lower levels of antioxidants and greater ozone-induced pulmonary injury relative to healthy strains. Mal...

  17. Protective role of interleukin-10 in Ozone-induced pulmonary inflammation**

    EPA Science Inventory

    Background: The mechanisms underlying ozone (03)-induced pulmonary inflammation remain unclear. Interleukin-10 (IL-10) is an anti-inflammatory cytokine that is known to inhibit inflammatory mediators. Objectives: We investigated the molecular mechanisms underlying interleuken-10...

  18. Inflammasome, IL-1 and inflammation in ozone-induced lung injury

    PubMed Central

    Michaudel, Chloé; Couturier-Maillard, Aurélie; Chenuet, Pauline; Maillet, Isabelle; Mura, Catherine; Couillin, Isabelle; Gombault, Aurélie; Quesniaux, Valérie F; Huaux, François; Ryffel, Bernhard


    Exposure to ambient ozone causes airway hyperreactivity and lung inflammation, which represent an important health concern in humans. Recent clinical and experimental studies contributed to the understanding of the mechanisms of epithelial injury, inflammation and airway hyperreactivity, which is reviewed here. The present data suggest that ozone induced oxidative stress causes inflammasome activation with the release of IL-1, other cytokines and proteases driving lung inflammation leading to the destruction of alveolar epithelia with emphysema and respiratory failure. Insights in the pathogenic pathway may allow to identify novel biomarkers of ozone-induced lung disease and therapeutic targets. PMID:27168953

  19. Ozone Therapy in the Management of Persistent Radiation-Induced Rectal Bleeding in Prostate Cancer Patients

    PubMed Central

    Clavo, Bernardino; Santana-Rodriguez, Norberto; Llontop, Pedro; Gutierrez, Dominga; Ceballos, Daniel; Méndez, Charlin; Rovira, Gloria; Suarez, Gerardo; Rey-Baltar, Dolores; Garcia-Cabrera, Laura; Martínez-Sánchez, Gregorio; Fiuza, Dolores


    Introduction. Persistent radiation-induced proctitis and rectal bleeding are debilitating complications with limited therapeutic options. We present our experience with ozone therapy in the management of such refractory rectal bleeding. Methods. Patients (n = 12) previously irradiated for prostate cancer with persistent or severe rectal bleeding without response to conventional treatment were enrolled to receive ozone therapy via rectal insufflations and/or topical application of ozonized-oil. Ten (83%) patients had Grade 3 or Grade 4 toxicity. Median follow-up after ozone therapy was 104 months (range: 52–119). Results. Following ozone therapy, the median grade of toxicity improved from 3 to 1 (p < 0.001) and the number of endoscopy treatments from 37 to 4 (p = 0.032). Hemoglobin levels changed from 11.1 (7–14) g/dL to 13 (10–15) g/dL, before and after ozone therapy, respectively (p = 0.008). Ozone therapy was well tolerated and no adverse effects were noted, except soft and temporary flatulence for some hours after each session. Conclusions. Ozone therapy was effective in radiation-induced rectal bleeding in prostate cancer patients without serious adverse events. It proved useful in the management of rectal bleeding and merits further evaluation. PMID:26357522

  20. Ozone-induced changes in natural organic matter (NOM) structure

    USGS Publications Warehouse

    Westerhoff, P.; Debroux, J.; Aiken, G.; Amy, G.


    Hydrophobic organic acids (combined humic and fulvic acids), obtained from an Antarctic Lake with predominantly microbially derived organic carbon sources and two US fiver systems with terrestrial organic carbon sources, were ozonated. Several analyses, including 13C-NMR, UV absorbance, fluorescence, hydrophobic/transphilic classification, and potentiometric titrations, were performed before and after ozonation. Ozonation reduced aromatic carbon content, selectively reducing phenolic carbon content. Ozonation of the samples resulted in increased aliphatic, carboxyl, plus acetal and ketal anomeric carbon content and shifted towards less hydrophobic compounds.Hydrophobic organic acids (combined humic and fulvic acids), obtained from an Antarctic Lake with predominantly microbially derived organic carbon sources and two US river systems with terrestrial organic carbon sources, were ozonated. Several analyses, including 13C-NMR, UV absorbance, fluorescence, hydrophobic/transphilic classification, and potentiometric titrations, were performed before and after ozonation. Ozonation reduced aromatic carbon content, selectively reducing phenolic carbon content. Ozonation of the samples resulted in increased aliphatic, carboxyl, plus acetal and ketal anomeric carbon content and shifted towards less hydrophobic compounds.

  1. Ozone-Induced Nasal Type 2 Immunity in Mice Is Dependent on Innate Lymphoid Cells.


    Kumagai, Kazuyoshi; Lewandowski, Ryan; Jackson-Humbles, Daven N; Li, Ning; Van Dyken, Steven J; Wagner, James G; Harkema, Jack R


    Epidemiological studies suggest that elevated ambient concentrations of ozone are associated with activation of eosinophils in the nasal airways of atopic and nonatopic children. Mice repeatedly exposed to ozone develop eosinophilic rhinitis and type 2 immune responses. In this study, we determined the role of innate lymphoid cells (ILCs) in the pathogenesis of ozone-induced eosinophilic rhinitis by using lymphoid-sufficient C57BL/6 mice, Rag2(-/-) mice that are devoid of T cells and B cells, and Rag2(-/-)Il2rg(-/-) mice that are depleted of all lymphoid cells including ILCs. The animals were exposed to 0 or 0.8 ppm ozone for 9 consecutive weekdays (4 h/d). Mice were killed 24 hours after exposure, and nasal tissues were selected for histopathology and gene expression analysis. ILC-sufficient C57BL/6 and Rag2(-/-) mice exposed to ozone developed marked eosinophilic rhinitis and epithelial remodeling (e.g., epithelial hyperplasia and mucous cell metaplasia). Chitinase-like proteins and alarmins (IL-33, IL-25, and thymic stromal lymphopoietin) were also increased morphometrically in the nasal epithelium of ozone-exposed C57BL/6 and Rag2(-/-) mice. Ozone exposure elicited increased expression of Il4, Il5, Il13, St2, eotaxin, MCP-2, Gob5, Arg1, Fizz1, and Ym2 mRNA in C57BL/6 and Rag2(-/-) mice. In contrast, ozone-exposed ILC-deficient Rag2(-/-)Il2rg(-/-) mice had no nasal lesions or overexpression of Th2- or ILC2-related transcripts. These results indicate that ozone-induced eosinophilic rhinitis, nasal epithelial remodeling, and type 2 immune activation are dependent on ILCs. To the best of our knowledge, this is the first study to demonstrate that ILCs play an important role in the nasal pathology induced by repeated ozone exposure. PMID:26559808

  2. In vitro ozone exposure inhibits mitogen-induced lymphocyte proliferation and IL-2 production

    SciTech Connect

    Becker, S.; Jordan, R.L.; Orlando, G.S.; Koren, H.S.


    Human blood mononuclear cells were exposed to ozone in vitro and thereafter analyzed for competence in mitogen-induced proliferation as well as IL-1 and IL-2 production. Proliferative responses induced by phytohemagglutinin (PHA), concanavalin A (Con A), and pokeweed mitogen (PWM) were all depressed in lymphocytes exposed to an ozone concentration of 1 ppm for 4-6 h. The response to PWM was most sensitive to the ozone effect (38% suppression); responses to Con A and PHA were suppressed to a lesser extent, 23% and 18%, respectively, and were not significantly different from each other. PWM responses were affected at an ozone concentration as low as 0.1 ppm; however, no suppression of Con A-induced proliferation was seen below 0.18 ppm or of PHA-induced proliferation below 0.5 ppm. When lymphocytes and monocytes were exposed separately to ozone and then mixed back with control air-exposed monocytes or lymphocytes, both cell types appeared to be affected and the functional defects caused by the pollutant were additive. Monocyte IL-1 production induced by endotoxin was not affected by ozone exposure, while surface expression of HLA-DR on exposed monocytes was reduced by 40% 24 h after exposure. Moreover, lymphocytes exposed to ozone produced 46% less IL-2 while expressing similar surface density of IL-2 receptors. Taken together, these results show that exposure to ozone has distinct adverse effects on lymphocytes and monocytes, both of which are important in local immune defenses in the lung.

  3. Reversion by ozone treatment of acute nephrotoxicity induced by cisplatin in rats.

    PubMed Central

    González, Ricardo; Borrego, Aluet; Zamora, Zullyt; Romay, Cheyla; Hernández, Frank; Menéndez, Silvia; Montero, Teresita; Rojas, Enis


    BACKGROUND: Ozone therapy has become a useful treatment for pathological processes, in which the damage mediated by reactive oxygen species is involved. Several lines of evidence suggest that cisplatin-induced acute nephrotoxicity is partially mediated by reactive oxygen species AIMS: To analyze the effect of ozone administration after cisplatin-induced acute nephrotoxicity. METHODS: Male Sprague-Dawley rats were treated with five intra-rectal applications of ozone/oxygen mixture at 0.36, 1.1 and 1.8 mg/kg after cisplatin intraperitoneal injection (6 mg/kg). Serum and kidneys were taken off 5 days after cisplatin treatment. Creatinine was measured in the serum and the activities of antioxidant enzymes and thiobarbituric acid reactive substances and glutathione content were analyzed in renal homogenate. RESULTS: Ozone treatment diminished the increase in serum creatinine levels, the glutathione depletion and also reversed the inhibition of superoxide dismutase, catalase and glutathione peroxidase activities induced by cisplatin in the rat kidney. Also, the renal content of thiobarbituric reactive substances was decreased by ozone/oxygen mixture applied after cisplatin. CONCLUSION: Intrarectal applications of ozone reversed the renal pro-oxidant unbalance induced by cisplatin treatment by the way of stimulation to some constituents of antioxidant system in the kidney, and thereby it decreased the renal damage. PMID:15770045

  4. Elevated Ozone Modulates Herbivore-Induced Volatile Emissions of Brassica nigra and Alters a Tritrophic Interaction.


    Khaling, Eliezer; Li, Tao; Holopainen, Jarmo K; Blande, James D


    Plants damaged by herbivores emit volatile organic compounds (VOCs) that are used by parasitoids for host location. In nature, however, plants are exposed to multiple abiotic and biotic stresses of varying intensities, which may affect tritrophic interactions. Here, we studied the effects of ozone exposure and feeding by Pieris brassicae larvae on the VOCs emitted by Brassica nigra and the effects on oriented flight of the parasitoid Cotesia glomerata. We also investigated the oriented flight of C. glomerata in a wind-tunnel with elevated ozone levels. Herbivore-feeding induced the emission of several VOCs, while ozone alone had no significant effect. However, exposure to 120 ppb ozone, followed by 24 hr of herbivore-feeding, induced higher emissions of all VOCs as compared to herbivore-feeding alone. In accordance, herbivore-damaged plants elicited more oriented flights than undamaged plants, whereas plants exposed to 120 ppb ozone and 24 hr of herbivore-feeding elicited more oriented flights than plants subjected to herbivore-feeding alone. Ozone enrichment of the wind-tunnel air appeared to negatively affect orientation of parasitoids at 70 ppb, but not at 120 ppb. These results suggest that the combination of ozone and P. brassicae-feeding modulates VOC emissions, which significantly influence foraging efficiency of C. glomerata. PMID:27167383

  5. Uric acid protects erythrocytes from ozone-induced changes

    SciTech Connect

    Meadows, J.; Smith, R.C.


    Uric acid effectively reduced hemolysis and methemoglobin formation in bovine and swine erythrocytes bubbled with ozone in vitro. In bovine erythrocytes, formation of thiobarbituric acid-reactive material was inhibited by uric acid, but there was little immediate protection for the swine cells. Antioxidant protection was due to preferential degradation of the uric acid by ozone. These results provide evidence to support the hypothesis that in plasma, uric acid can provide antioxidant protection for erythrocytes.

  6. Southwestern Tropical Atlantic coral growth response to atmospheric circulation changes induced by ozone depletion in Antarctica

    NASA Astrophysics Data System (ADS)

    Evangelista, H.; Wainer, I.; Sifeddine, A.; Corrège, T.; Cordeiro, R. C.; Lamounier, S.; Godiva, D.; Shen, C.-C.; Le Cornec, F.; Turcq, B.; Lazareth, C. E.; Hu, C.-Y.


    Climate changes induced by stratospheric ozone depletion over Antarctica have been recognized as an important consequence of the recently observed Southern Hemisphere atmospheric circulation. Here we present evidences that the Brazilian coast (Southwestern Atlantic) may have been impacted from both winds and sea surface temperature changes derived from this process. Skeleton analysis of massive coral species living in shallow waters off Brazil are very sensitive to air-sea interactions, and seem to record this impact. Growth rates of Brazilian corals show a trend reversal that fits the ozone depletion evolution, confirming that ozone impacts are far reaching and potentially affect coastal ecosystems in tropical environments.

  7. Ozone-Oxidative Preconditioning Prevents Doxorubicin-induced Cardiotoxicity in Sprague-Dawley Rats

    PubMed Central

    Delgado-Roche, Livan; Hernández-Matos, Yanet; Medina, Emilio A.; Morejón, Dalia Á.; González, Maité R.; Martínez-Sánchez, Gregorio


    Objectives: Induced dilated cardiomyopathy is the main limitation of the anti-cancer drug doxorubicin, which causes oxidative stress and cardiomyocyte death. As ozone therapy can activate the antioxidant systems, this study aimed to investigate the therapeutic efficacy of ozone-oxidative preconditioning against doxorubicin-induced cardiotoxicity. Methods: The study was carried out from September 2013 to January 2014. Sprague-Dawley rats were randomly distributed in the following treatment groups: Group 1 were treated with 2 mg/kg intraperitoneal (i.p.) of doxorubicin twice a week for 50 days; Group 2 were treated with 0.3 mg of ozone/oxygen mixture at 50 μg/mL of ozone per 6 mL of oxygen by rectal insufflation and then treated with doxorubicin; Group 3 were treated as Group 2 but only with the oxygen, and Group 4 were treated with oxygen first, and then with sodium chloride i.p. as the control group. Results: The results showed that ozone therapy preserved left ventricle morphology which was accompanied by a reduction of serum pro-brain natriuretic peptide levels. The cardioprotective effects of ozone-oxidative preconditioning were associated with a significant increase (P <0.05) of antioxidant enzymes activities and a reduction of lipid and protein oxidation (P <0.05). Conclusion: Ozone-oxidative preconditioning prevents doxorubicin-induced dilated cardiomyopathy through an increase of antioxidant enzymes and a reduction of oxidised macromolecules. This establishes the background for future studies to determine if ozone therapy can be used as a complementary treatment for attenuating doxorubicin-induced cardiotoxicity in cancer patients. PMID:25097769

  8. The probability distribution of the predicted CFM-induced ozone depletion. [Chlorofluoromethane

    NASA Technical Reports Server (NTRS)

    Ehhalt, D. H.; Chang, J. S.; Bulter, D. M.


    It is argued from the central limit theorem that the uncertainty in model predicted changes of the ozone column density is best represented by a normal probability density distribution. This conclusion is validated by comparison with a probability distribution generated by a Monte Carlo technique. In the case of the CFM-induced ozone depletion, and based on the estimated uncertainties in the reaction rate coefficients alone the relative mean standard deviation of this normal distribution is estimated to be 0.29.

  9. Persistent damage induces mitochondrial DNA degradation

    PubMed Central

    Shokolenko, Inna N.; Wilson, Glenn L.; Alexeyev, Mikhail F.


    Considerable progress has been made recently toward understanding the processes of mitochondrial DNA (mtDNA) damage and repair. However, a paucity of information still exists regarding the physiological effects of persistent mtDNA damage. This is due, in part, to experimental difficulties associated with targeting mtDNA for damage, while sparing nuclear DNA. Here, we characterize two systems designed for targeted mtDNA damage based on the inducible (Tet-ON) mitochondrial expression of the bacterial enzyme, exonuclease III, and the human enzyme, uracil-N-glyosylase containing the Y147A mutation. In both systems, damage was accompanied by degradation of mtDNA, which was detectable by six hours after induction of mutant uracil-N-glycosylase and by twelve hours after induction of exoIII. Unexpectedly, increases in the steady-state levels of single-strand lesions, which led to degradation, were small in absolute terms indicating that both abasic sites and single-strand gaps may be poorly tolerated in mtDNA. mtDNA degradation was accompanied by the loss of expression of mtDNA-encoded COX2. After withdrawal of the inducer, recovery from mtDNA depletion occurred faster in the system expressing exonuclease III, but in both systems reduced mtDNA levels persisted longer than 144h after doxycycline withdrawal. mtDNA degradation was followed by reduction and loss of respiration, decreased membrane potential, reduced cell viability, reduced intrinsic reactive oxygen species production, slowed proliferation, and changes in mitochondrial morphology (fragmentation of the mitochondrial network, rounding and “foaming” of the mitochondria). The mutagenic effects of abasic sites in mtDNA were low, which indicates that damaged mtDNA molecules may be degraded if not rapidly repaired. This study establishes, for the first time, that mtDNA degradation can be a direct and immediate consequence of persistent mtDNA damage and that increased ROS production is not an invariant consequence

  10. Effect of ozonated oil and chlorhexidine gel on plaque induced gingivitis: A randomized control clinical trial

    PubMed Central

    Indurkar, Maya Sanjeev; Verma, Renu


    Background: Several chemotherapeutic agents have been developed to prevent gingivitis and its progression into periodontitis. In this present study, the efficacy of ozonated oil and chlorhexidine gel was assessed and compared on plaque induced gingivitis. Aim: To evaluate the effect of ozonated oil on plaque induced gingivitis and to compare its efficacy with chlorhexidine gel. Materials and Methods: A total of 20 subjects, aged from 18 to 65 years, with plaque-induced gingivitis were selected from the outpatient Department of Periodontology, Government Dental College and Hospital, Aurangabad, for this study. They were divided randomly into the test or ozonated oil group (Group I) and the control or chlorhexidine gel group (Group II) with 10 subjects in each group. Subjects were randomly assigned to massage their gingiva thrice a day for 3 weeks with ozonated oil (test), and chlorhexidine gel (control). Plaque index and gingival index scores were recorded for the 20 subjects at baseline and after 3 weeks. Results: Ozonated oil (Group I) and chlorhexidine gel (Group II) groups showed statistically significant differences with respect to plaque index and gingival index, from the baseline to 3 weeks (P < 0.001 in both). But the difference between Group I and Group II, at the end of the study period, was not statistically significant with respect to the plaque index and gingival index. Conclusions: The ozonated oil and chlorhexidine gel, both can be used as an effective agent in maintaining and improving gingival health. PMID:27041835

  11. Effect of ozone exposure on antigen-induced airway hyperresponsiveness in guinea pigs

    SciTech Connect

    Vargas, M.H.; Segura, P.; Campos, M.G.; Hong, E.; Montano, L.M.


    Airway hyperresponsiveness can be induced by several stimuli including antigen and ozone, both of which may be present in the air of polluted cities. Though the effect of ozone on the bronchoconstrictor response to antigen has been well described, the combined effect of these stimuli on airway hyperresponsiveness has not yet been studied. Sensitized guinea pigs with or without ozone exposure for 1 h at 3 ppm, 18 h prior to study, were challenged with a dose-response curve to histamine (0.01-1.8 {mu}g/kg, iv), and then by a second histamine dose-response curve 1 h later. Airway responses were measured as the increase in pulmonary insufflation pressure. In sensitized guinea pigs, the histamine ED50 significantly decreased after antigen challenge, demonstrating the development of airway hyperresponsiveness. Sensitized guinea pigs exposed to ozone showed airway hyperresponsiveness to histamine when compared with nonexposed animals, and such hyperresponsiveness was further enhanced after antigen challenge. We conclude that in this guinea pig model of acute allergic bronchoconstriction both antigen challenge and ozone induce airway hyperresponsiveness, while ozone exposure does not modify the development of antigen-induced hyperresponsiveness. 25 refs., 1 fig., 1 tab.

  12. Allostery through protein-induced DNA bubbles

    NASA Astrophysics Data System (ADS)

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.


    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resulting melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.

  13. Allostery through protein-induced DNA bubbles


    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.


    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resultingmore » melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.« less

  14. Allostery through protein-induced DNA bubbles

    SciTech Connect

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.


    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resulting melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.

  15. Classical and alternative macrophage activation in the lung following ozone-induced oxidative stress

    SciTech Connect

    Sunil, Vasanthi R.; Patel-Vayas, Kinal; Shen, Jianliang; Laskin, Jeffrey D.; Laskin, Debra L.


    Ozone is a pulmonary irritant known to cause oxidative stress, inflammation and tissue injury. Evidence suggests that macrophages play a role in the pathogenic response; however, their contribution depends on the mediators they encounter in the lung which dictate their function. In these studies we analyzed the effects of ozone-induced oxidative stress on the phenotype of alveolar macrophages (AM). Exposure of rats to ozone (2 ppm, 3 h) resulted in increased expression of 8-hydroxy-2′-deoxyguanosine (8-OHdG), as well as heme oxygenase-1 (HO-1) in AM. Whereas 8-OHdG was maximum at 24 h, expression of HO-1 was biphasic increasing after 3 h and 48–72 h. Cleaved caspase-9 and beclin-1, markers of apoptosis and autophagy, were also induced in AM 24 h post-ozone. This was associated with increased bronchoalveolar lavage protein and cells, as well as matrix metalloproteinase (MMP)-2 and MMP-9, demonstrating alveolar epithelial injury. Ozone intoxication resulted in biphasic activation of the transcription factor, NFκB. This correlated with expression of monocyte chemotactic protein‐1, inducible nitric oxide synthase and cyclooxygenase‐2, markers of proinflammatory macrophages. Increases in arginase-1, Ym1 and galectin-3 positive anti-inflammatory/wound repair macrophages were also observed in the lung after ozone inhalation, beginning at 24 h (arginase-1, Ym1), and persisting for 72 h (galectin-3). This was associated with increased expression of pro-surfactant protein-C, a marker of Type II cell proliferation and activation, important steps in wound repair. These data suggest that both proinflammatory/cytotoxic and anti-inflammatory/wound repair macrophages are activated early in the response to ozone-induced oxidative stress and tissue injury. -- Highlights: ► Lung macrophages are highly sensitive to ozone induced oxidative stress. ► Ozone induces autophagy and apoptosis in lung macrophages. ► Proinflammatory and wound repair macrophages are activated


    EPA Science Inventory

    Prior studies have shown that ozone (O3) increases pentobarbital (PEN)-induced sleeping time (S.T.) in female mice, rats, and hamsters. To investigate some potential mechanisms producing these effects, the authors measured zoxazolamine-induced paralysis time and thiopental- and h...

  17. The protective effect of intraperitoneal medical ozone preconditioning and treatment on hepatotoxicity induced by methotrexate

    PubMed Central

    Aslaner, Arif; Çakır, Tuğrul; Çelik, Betül; Doğan, Uğur; Akyüz, Cebrail; Baştürk, Ahmet; Polat, Cemal; Gündüz, Umut; Mayir, Burhan; Şehirli, Ahmet Özer


    The aim of this study is to determine the effects of medical ozone preconditioning and treatment on the methotrexate acute induced hepatotoxicity in rats that has not reports elsewhere. Eighteen rats were randomly assigned into three equal groups; control, Mtx and Mtx with ozone. Hepatotoxicity was performed with a single dose of 20 mg/kg Mtx to group 2 and group 3 at the fifteenth day. The medical ozone preconditioning was administered intraperitonealy in group 3 for fifteen days and more five days after inducing Mtx. The other rats of the group 1 and 2 received saline injection. At the twentyfirst day the blood and the liver tissue samples were obtained to measure the levels of liver enzymes ALT and AST, proinflamatory cytokines TNF-α, IL-1β, malondialdehyde, glutathione and myeloperoxidase. And the histolopatological examination was evaluated for injury score. In our study Mtx administration caused a significant increase on the liver enzymes ALT and AST, the tissue MDA and MPO activity and significant decrease in the tissue GSH. Moreover the both pro-inflammatory cytokines were significantly increased in the Mtx group. Medical ozone preconditioning and treatment reversed all these biochemical parameters and histopathological changes of the hepatotoxicity induced by Mtx. We conclude that medical ozone ameliorates Mtx induced hepatotoxicity in rats. PMID:26550257

  18. Influence of ozone on induced resistance in soybean to the Mexican bean beetle (Coleoptera: Coccinellidae)

    SciTech Connect

    Lin, Hengchen; Kogan, M. ); Endress, A.G. )


    The influence of ozone (O{sub 3}) on induced resistance in soybean, Glycine max (L.) Merr., cv. Williams 82, was investigated. Feeding by larval soybean looper, Pseudoplusia includens (Walker), was used to induce resistance, and the feeding preference of the Mexican bean beetle, Epilachna varivetis Mulsant, was used to indicate induced resistance. Greenhouse grown soybean plants at the V9 growth stage (eight open trifoliolates) were used in all experiments. One day following feeding injury by the soybean looper, the injured plants and the uninjured controls were exposed to three concentrations of ozone in transparent mylar chambers; level in ambient air (about 0.025 ppm), 0.06 ppm, or 0.1 ppm. Plants were exposed for 5 h a day for a period of 2-4 d. Ozone exposure at the levels used in this study produced no visible injuries to leaves. Low doses (up to 4-d-exposure to 0.06 ppm or 2-d exposure to 0.1 ppm) of ozone overrode the resistance in soybean that had been induced by the feeding of soybean looper larvae. Higher doses (3- or 4-d exposure to 0.1 ppm) of ozone actually resulted in a greater acceptability by the Mexican bean beetle of plants injured by the soybean looper than of uninjured plants. Doses of ozone used in these experiments did not significantly alter the feeding preference of the Mexican bean beetle for the uninjured plants. Because ozone pollution and herbivore injury are commonly experienced by plants in nature, the results of this study add another perspective to insect-plant interactions.

  19. Triplex-Induced DNA Damage Response

    PubMed Central

    Rogers, Faye A.; Tiwari, Meetu Kaushik


    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage. PMID:24348211

  20. Kinetics of aqueous ozone-induced oxidation of some endocrine disruptors.


    Deborde, Marie; Rabouan, Sylvie; Duguet, Jean-Pierre; Legube, Bernard


    This study investigated aqueous ozone-induced oxidation of six endocrine disruptors (EDs: 4-n-nonylphenol, bisphenol A, 17alpha-ethinylestradiol, 17beta-estradiol, estrone, and estriol). In the first part, ED ozonation kinetics were studied over a pH range of 2.5-10.5 at 20 +/- 2 degrees C and in the presence of tert-butyl alcohol. Under these conditions, for each studied compound, the apparent ozone rates presented minima at acidic pH (pH < 5) and maxima at basic pH (pH > 10). In the second part, to explain this pH dependence, elementary reactions, i.e., reactions of ozone with neutral and ionized ED species, were proposed, and the intrinsic constants of each of them were calculated. The reactivity of ozone with ionized EDs (i.e. 1.06 x 10(9)-6.83 x 10(9) M(-1) s(-1)) was found to be 10(4)-10(5) times higher than with neutral EDs (i.e. 1.68 x 10(4) M(-1) s(-1)-2.21 x 10(5) M(-1) s(-1)). At pH > 5, ozone reacted to the greatest extent with dissociated ED forms. Finally, to assess the potential of ozone for inducing ED oxidation in water treatment conditions, the expected removal rates for each of the studied EDs were determined on the basis of the kinetic study at pH = 7 and 20 +/- 2 degrees C. For all EDs considered, O3 exposures of only approximately 2 x 10(-3) mg min L(-1) were calculated to achieve > or = 95% removal efficiency. The ozonation process could thus highly oxidize the studied EDs under water treatment conditions. PMID:16173567

  1. Peripheral Blood Neutrophilia as a Biomarker of Ozone-Induced Pulmonary Inflammation

    PubMed Central

    Bosson, Jenny A.; Blomberg, Anders; Stenfors, Nikolai; Helleday, Ragnberth; Kelly, Frank J.; Behndig, Annelie F.; Mudway, Ian S.


    Background Ozone concentrations are predicted to increase over the next 50 years due to global warming and the increased release of precursor chemicals. It is therefore urgent that good, reliable biomarkers are available to quantify the toxicity of this pollutant gas at the population level. Such a biomarker would need to be easily performed, reproducible, economically viable, and reflective of ongoing pathological processes occurring within the lung. Methodology We examined whether blood neutrophilia occurred following a controlled ozone challenge and addressed whether this could serve as a biomarker for ozone-induced airway inflammation. Three separate groups of healthy subjects were exposed to ozone (0.2 ppm, 2h) and filtered air (FA) on two separate occasions. Peripheral blood samples were collected and bronchoscopy with biopsy sampling and lavages was performed at 1.5h post exposures in group 1 (n=13), at 6h in group 2 (n=15) and at 18h in group 3 (n=15). Total and differential cell counts were assessed in blood, bronchial tissue and airway lavages. Results In peripheral blood, we observed fewer neutrophils 1.5h after ozone compared with the parallel air exposure (-1.1±1.0x109 cells/L, p<0.01), at 6h neutrophil numbers were increased compared to FA (+1.2±1.3x109 cells/L, p<0.01), and at 18h this response had fully attenuated. Ozone induced a peak in neutrophil numbers at 6h post exposure in all compartments examined, with a positive correlation between the response in blood and bronchial biopsies. Conclusions These data demonstrate a systemic neutrophilia in healthy subjects following an acute ozone exposure, which mirrors the inflammatory response in the lung mucosa and lumen. This relationship suggests that blood neutrophilia could be used as a relatively simple functional biomarker for the effect of ozone on the lung. PMID:24391708


    EPA Science Inventory

    The influence of light on ozone-induced ethylene production from intact soybean (Glycine max L. Merr. cv. Dare) and tomato (Lycopersicon esculentum Mill. cv. Roma) plants was investigated. Ozone-induced stress ethylene production was 2.6-fold greater from dark-than light-incubate...

  3. Evaluation of lightning-induced tropospheric ozone enhancements observed by ozone lidar and simulated by WRF/Chem

    NASA Astrophysics Data System (ADS)

    Wang, Lihua; Follette-Cook, Melanie B.; Newchurch, M. J.; Pickering, Kenneth E.; Pour-Biazar, Arastoo; Kuang, Shi; Koshak, William; Peterson, Harold


    High spatial- and temporal-resolution ozone lidar profiles, in conjunction with ozonesonde and satellite observations, are well suited to characterize short-term ozone variations due to different physical and chemical processes, such as the impact of lightning-generated NOx (LNOx) on tropospheric ozone. This work presents the hourly variation of tropospheric-ozone profiles measured by an ozone lidar at the University of Alabama in Huntsville, on July 14, 18, and 27, 2011. These ozone lidar data are compared with two WRF/Chem simulations, one with lightning NO (LNO) emissions and the other without. On July 14, 2011, the ozone lidar observed an ozone laminar structure with elevated ozone concentrations of 65∼80 ppbv below 2 km, low ozone (50∼65) ppbv between 2 and 5 km, and high ozone up to 165 ppbv between 5 and 12 km AGL. WRF/Chem simulations, in conjunction with backward trajectory analysis, suggest that lightning events occurring within upwind regions resulted in an ozone enhancement of 28 ppbv at 7.5 km AGL over Huntsville. On July 27, LNO emissions were transported to Huntsville from upwind and account for 75% of NOx and an 8.3 ppbv of ozone enhancement at ∼10 km; the model overestimates ozone between 2.5 and 5 km AGL.

  4. Effects of buthionine sulfoximine on the development of ozone-induced pulmonary fibrosis.


    Sun, J D; Pickrell, J A; Harkema, J R; McLaughlin, S I; Hahn, F F; Henderson, R F


    The capacity of reduced glutathione (GSH) to protect lung tissue against ozone-induced pulmonary fibrosis was investigated. Male B6C3F1 mice were exposed to 0, 0.2, 0.5, and 1.0 ppm ozone for 23 hr/day for 14 days. During exposures and/or for a period of 90 days after exposures, subgroups of mice at each exposure level were given drinking water containing 30 mM L-buthionine-S,R-sulfoximine (BSO) to lower in vivo levels of GSH. These BSO treatments reduced blood glutamylcysteine synthetase (GCS) activity (regulatory enzyme for GSH biosynthesis) and lung nonprotein sulfhydryl (NPSH) levels in nonexposed animals by approximately half. In contrast, ozone exposures increased blood GCS activity and lung NPSH levels in a concentration-dependent manner, with smaller increases in the BSO-treated mice. Immediately after exposures, an ozone-related inflammatory response was seen in lungs, but no histopathological signs of developing fibrosis were evident. Ninety days later, mice exposed to 1 ppm ozone and not treated with BSO had modest evidence of pulmonary fibrosis. Mice exposed to 1 ppm ozone and treated with BSO during this post-exposure period (regardless of BSO treatment during exposures) showed histopathological evidence of exacerbated pulmonary fibrosis, compared to similarly exposed mice not treated with BSO postexposure. These results indicated that interference with the body's normal defense mechanisms against oxidant damage, including suppression of GSH biosynthesis, exacerbates the subsequent development of pulmonary fibrosis. PMID:2901982

  5. Ozone Ameliorates Doxorubicine-Induced Skin Necrosis - results from an animal model.


    Kesik, Vural; Yuksel, Ramazan; Yigit, Nuri; Saldir, Mehmet; Karabacak, Ercan; Erdem, Galip; Babacan, Oguzhan; Gulgun, Mustafa; Korkmazer, Nadir; Bayrak, Ziya


    Doxorubicin (DXR) extravasation result with serious morbidity like skin ulceration and necrosis. The purpose of this study is to determine the protective effects of ozone, olive oil, dimethyl sulfoxide (DMSO), and coenzyme Q10 in the treatment of DXR-induced skin ulcers on rats. After an intradermal injection of DXR on a basis of an animal extravasation model, the materials were topically applied. The ulcer sizes were measured, and a punch biopsy was taken from the extravasation site in which the skin ulcers formed at the end of the experiment. The samples were analyzed for tumor necrosis factor alpha (TNF-α), interleukin 1-beta (IL1β), malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) enzymes, and examined histopathologically. The ulcer sizes clearly decreased in the study groups, including DMSO, olive oil, ozone plus coenzyme Q10, and ozone plus olive oil groups in comparison with the control group with the exception of the coenzyme Q10 group. The malondialdehyde levels were lower in the DMSO, olive oil, ozone plus olive oil, and ozone plus coenzyme Q10 groups than they were in the control group, but they were not significantly different. The TNF-α level was lower in the DMSO, ozone plus olive oil, coenzyme Q10, and ozone plus coenzyme Q10 groups in comparison with the control group. There was no significant change in the SOD, GSH-Px, and IL1β levels in the study groups in comparison with the control and the sham groups. The ozone plus olive oil group could be considered to be an alternate therapy for skin ulcers due to DXR extravasation. PMID:26286933

  6. Light-Induced Dielectrophoretic Manipulation of DNA

    PubMed Central

    Hoeb, Marco; Rädler, Joachim O.; Klein, Stefan; Stutzmann, Martin; Brandt, Martin S.


    Light-induced dielectrophoretic movement of polystyrene beads and λ-DNA is studied using thin films of amorphous hydrogenated silicon as local photoaddressable electrodes with a diameter of 4 μm. Positive (high-field seeking) dielectrophoretic movement is observed for both types of objects. The absence of strong negative (low-field seeking) dielectrophoresis of DNA at high frequencies is in agreement with the similarity of the dielectric constants of DNA and water, the real part of the dielectric function. The corresponding imaginary part of the dielectric function governed by the conductivity of DNA can be determined from a comparison of the frequency dependence of the dielectrophoretic drift velocity with the Clausius-Mossotti relation. PMID:17483160

  7. Viroid-induced DNA methylation in plants.


    Dalakouras, Athanasios; Dadami, Elena; Wassenegger, Michael


    In eukaryotes, DNA methylation refers to the addition of a methyl group to the fifth atom in the six-atom ring of cytosine residues. At least in plants, DNA regions that become de novo methylated can be defined by homologous RNA molecules in a process termed RNA-directed DNA methylation (RdDM). RdDM was first discovered in viroid-infected plants. Viroids are pathogenic circular, non-coding, single-stranded RNA molecules. Members of the Pospiviroidae family replicate in the nucleus through double-stranded RNA intermediates, attracting the host RNA silencing machinery. The recruitment of this machinery results in the production of viroid-derived small RNAs (vd-sRNAs) that mediate RNA degradation and DNA methylation of cognate sequences. Here, we provide an overview of the cumulative data on the field of viroid-induced RdDM and discuss three possible scenarios concerning the mechanistic details of its establishment. PMID:25436756

  8. Indomethacin does not inhibit the ozone-induced increase in bronchial responsiveness in human subjects

    SciTech Connect

    Ying, R.L.; Gross, K.B.; Terzo, T.S.; Eschenbacher, W.L. )


    Exposure of human subjects to sufficiently high levels of ozone can result in reversible changes in lung function (restrictive in nature) and increases in nonspecific airway responsiveness. Several studies have implicated products of cyclooxygenase metabolism in the mediation of these changes. The purpose of this study was to determine if indomethacin (a cyclooxygenase inhibitor) would alter the changes in the ozone-induced increase in responsiveness to methacholine or the ozone-induced decrease in lung function. Thirteen male subjects underwent three randomly assigned 2-h exposure to 0.4 ppm ozone with alternating 15-min periods of rest and exercise on a cycle ergometer (30 L/min/m2, body surface area). For the 4 days before each of the exposures, the subjects received either indomethacin (150 mg/day) or placebo, or no modification. Of the 13 subjects, only seven had both detectable indomethacin serum levels on the indomethacin Study Day and a significant increase in bronchial responsiveness to methacholine on the No Medication Day. For this group of seven subjects, we found that indomethacin did not alter the ozone-induced increase in bronchial responsiveness to methacholine (decrease in PC100SRaw for the different study days: no medication, -78.4 +/- 5.3% (mean +/- SEM); placebo, -48.9 +/- 12.2%; indomethacin, -64.5 +/- 6.3%; p greater than 0.2), although indomethacin did attenuate the ozone-induced decrease in lung function. The decrease in the FEV1 for the different study days was as follows: no medication, -20.7 +/- 5.0% (mean +/- SEM); placebo, -19.2 +/- 6.3%; indomethacin, -4.8 +/- 3.7% (p less than 0.001).

  9. Effect of thromboxane antagonists on ozone-induced airway responses in dogs

    SciTech Connect

    Jones, G.L.; Lane, C.G.; O'Byrne, P.M. )


    Airway hyperresponsiveness after inhaled ozone in dogs may occur as a result of thromboxane release in the airway. In this study, two thromboxane receptor antagonists, L-655,240 and L-670,596, were used in doses that inhibit the response to an inhaled thromboxane mimetic, U-46619, to determine further the role of thromboxane in ozone-induced airway hyperresponsiveness. Dogs were studied on 2 days separated by 1 wk. On each day, the dogs inhaled ozone (3 ppm) for 30 min. On one randomly assigned day, 10 dogs received an infusion of L-655,240 (5 and 5 dogs received an infusion of L-670,596 (1; on the other day dogs received a control infusion. Airway responses to doubling doses of acetylcholine were measured before and after inhalation of ozone and were expressed as the concentration of acetylcholine giving a rise in resistance of 5 cmH2O.l-1.s from baseline (acetylcholine provocation concentration). The development of airway hyperresponsiveness after ozone was not inhibited by the thromboxane antagonists. The mean log difference in the acetylcholine provocative concentration before and after ozone on the L-655,240 treatment day was 0.62 +/- 0.12 (SE) and on the control day was 0.71 +/- 0.12 (P = 0.48); on the L-670,596 treatment day the mean log difference was 0.68 +/- 0.15 (SE) and on the control day it was 0.75 +/- 0.19 (P = 0.45). These results do not support an important role for thromboxane in causing ozone-induced airway hyperresponsiveness.


    EPA Science Inventory

    Diesel exhaust (DE) emissions contribute to near-road air pollution and have been shown to induce a variety of cardiovascular and pulmonary abnormalities in animals and humans. Since high ozone concentrations are often associated with increased traffic-related emissions, we postu...

  11. Variability in Ozone-Induced Pulmonary Injury and Inflammation in Healthy and Cardiovascular Compromised Rat Models

    EPA Science Inventory

    The molecular bases for variability in air pollutant-induced pulmonary injury due to underlying cardiovascular (CVD) and/or metabolic diseases are unknown. We hypothesized that healthy and genetic CVD-prone rat models will exhibit exacerbated response to acute ozone exposure depe...


    EPA Science Inventory

    METAL-INDUCED LATE PULMONARY INJURY IS REDUCED BY OZONE (O3) COEXPOSURE. UP Kodavanti, MCJ Schladweiler, WP Watkinson, JP Nolan, PA Evansky, ER Lappi, G Ross, JH Richards, and DL Costa. NHEERL, ORD, US Environmental Protection Agency, Research Triangle Park, NC USA.
    Ambient ...


    EPA Science Inventory

    Ozone-induced respiratory symptoms are known to be functions of concentration, minute ventilation, and duration of exposure. The purposes of this study were to identify an exposure-response model for symptoms, to determine whether response was related to age, and to assess the re...


    EPA Science Inventory

    Epidemiological, in vitro and animal studies suggest that dietary antioxidants can modulate the cellular and physiologic effects of ozone (O3) inhalation in humans. To determine whether antioxidants can influence human susceptibility to O3-induced changes in lung function and a...

  15. Heat Stress-Induced DNA Damage

    PubMed Central

    Kantidze, O.L.; Velichko, A.K.; Luzhin, A.V.; Razin, S.V.


    Although the heat-stress response has been extensively studied for decades, very little is known about its effects on nucleic acids and nucleic acid-associated processes. This is due to the fact that the research has focused on the study of heat shock proteins and factors (HSPs and HSFs), their involvement in the regulation of transcription, protein homeostasis, etc. Recently, there has been some progress in the study of heat stress effects on DNA integrity. In this review, we summarize and discuss well-known and potential mechanisms of formation of various heat stress-induced DNA damage. PMID:27437141

  16. Mechanisms of Action Involved in Ozone Therapy: Is healing induced via a mild oxidative stress?

    PubMed Central


    The potential mechanisms of action of ozone therapy are reviewed in this paper. The therapeutic efficacy of ozone therapy may be partly due the controlled and moderate oxidative stress produced by the reactions of ozone with several biological components. The line between effectiveness and toxicity of ozone may be dependent on the strength of the oxidative stress. As with exercise, it is well known that moderate exercise is good for health, whereas excessive exercise is not. Severe oxidative stress activates nuclear transcriptional factor kappa B (NFκB), resulting in an inflammatory response and tissue injury via the production of COX2, PGE2, and cytokines. However, moderate oxidative stress activates another nuclear transcriptional factor, nuclear factor-erythroid 2-related factor 2 (Nrf2). Nrf2 then induces the transcription of antioxidant response elements (ARE). Transcription of ARE results in the production of numerous antioxidant enzymes, such as SOD, GPx, glutathione-s-transferase(GSTr), catalase (CAT), heme-oxygenase-1 (HO-1), NADPH-quinone-oxidoreductase (NQO-1), phase II enzymes of drug metabolism and heat shock proteins (HSP). Both free antioxidants and anti-oxidative enzymes not only protect cells from oxidation and inflammation but they may be able to reverse the chronic oxidative stress. Based on these observations, ozone therapy may also activate Nrf2 via moderate oxidative stress, and suppress NFκB and inflammatory responses. Furthermore, activation of Nrf2 results in protection against neurodegenerative diseases, such as Alzheimer's and Parkinson's diseases. Mild immune responses are induced via other nuclear transcriptional factors, such as nuclear factor of activated T-cells (NFAT) and activated protein-1 (AP-1). Additionally, the effectiveness of ozone therapy in vascular diseases may also be explained by the activation of another nuclear transcriptional factor, hypoxia inducible factor-1α (HIF-1a), which is also induced via moderate

  17. Preexposure to ozone blocks the antigen-induced late asthmatic response of the canine peripheral airways

    SciTech Connect

    Turner, C.R.; Kleeberger, S.R.; Spannhake, E.W. )


    The influence of exposure of the airways to ozone on acute allergic responsiveness has been investigated in several species. Little is known, however, about the effect of this environmental pollutant on the late asthmatic response (LAR) in animals in which it is exhibited. The purpose of this study was to evaluate this effect in the canine peripheral airways and to assess the potential role of mast cells in modulating the effect. A series of experiments on seven mongrel dogs demonstrated that the numbers of mast cells at the base of the epithelial region of small subsegmental airways exposed to 1 ppm ozone for 5 min were significantly (p less than .01) increased 3 h following exposure compared to air exposed or nonexposed control airways. In a second series of experiments performed on eight additional mongrel dogs with inherent sensitivity to Ascaris suum antigen, antigen aerosol was administered to the sublobar segment 3 h following ozone preexposure when mast cell numbers were presumed to be increased. These experiments were performed to determine whether ozone preexposure could enhance the late-phase response to antigen by virtue of acutely increasing the number of mast cells available to bind the antigen. Four of the eight dogs tested displayed a late-phase response to antigen following air-sham preexposure. In these four dogs, simultaneous ozone preexposure of a contralateral lobe completely blocked the late-phase response to antigen. These results indicate that the consequences of a single exposure to ozone persist beyond its effects on acute antigen-induced bronchoconstriction and extend to the complex processes involved with the late response. This attenuating effect of ozone is seen under conditions where mast-cell numbers in the airways are increased above baseline levels.

  18. Ozone-induced climate change propped up by the Southern Hemisphere oceanic front

    NASA Astrophysics Data System (ADS)

    Ogawa, Fumiaki; Omrani, Nour-Eddine; Nishii, Kazuaki; Nakamura, Hisashi; Keenlyside, Noel


    The late twentieth century was marked by a significant summertime trend in the Southern Annular Mode (SAM), the dominant mode of tropospheric variability in the extratropical Southern Hemisphere (SH). This trend with poleward shifting tropospheric westerlies was attributed to downward propagation of stratospheric changes induced by ozone depletion. However, the role of the ocean in setting the SAM response to ozone depletion and its dynamical forcing remains unclear. Here we show, using idealized experiments with a state-of-the-art atmospheric model and analysis of Intergovernmental Panel on Climate Change climate simulations, that frontal sea surface temperature gradients in the midlatitude SH are critical for translating the ozone-induced stratospheric changes down to the surface. This happens through excitation of wave forcing, which controls the vertical connection of the tropospheric SAM with the stratosphere and shows the importance of internal tropospheric dynamics for stratosphere/troposphere coupling. Thus, improved simulation of oceanic fronts may reduce uncertainties in simulating SH ozone-induced climate changes.

  19. Hydrogen Sulfide Prevents and Partially Reverses Ozone-Induced Features of Lung Inflammation and Emphysema in Mice.


    Li, Feng; Zhang, Pengyu; Zhang, Min; Liang, Li; Sun, Xiaoyuan; Li, Min; Tang, Yueqin; Bao, Aihua; Gong, Jicheng; Zhang, Junfeng; Adcock, Ian; Chung, Kian Fan; Zhou, Xin


    Hydrogen sulfide (H2S), a novel signaling gasotransmitter in the respiratory system, may have antiinflammatory properties in the lung. We examined the preventive and therapeutic effects of H2S on ozone-induced features of lung inflammation and emphysema. C57/BL6 mice were exposed to ozone or filtered air over 6 weeks. Sodium hydrogen sulfide (NaHS), an H2S donor, was administered to the mice either before ozone exposure (preventive effect) or after completion of 6 weeks of ozone exposure (therapeutic effect). The ozone-exposed mice developed emphysema, measured by micro-computed tomography and histology, airflow limitation, measured by the forced maneuver system, and increased lung inflammation with augmented IL-1β, IL-18, and matrix metalloproteinase-9 (MMP-9) gene expression. Ozone-induced changes were associated with increased Nod-like receptor pyrin domain containing 3 (NLRP3)-caspase-1 activation and p38 mitogen-activated protein kinase phosphorylation and decreased Akt phosphorylation. NaHS both prevented and reversed lung inflammation and emphysematous changes in alveolar space. In contrast, NaHS prevented, but did not reverse, ozone-induced airflow limitation and bronchial structural remodeling. In conclusion, NaHS administration prevented and partially reversed ozone-induced features of lung inflammation and emphysema via regulation of the NLRP3-caspase-1, p38 mitogen-activated protein kinase, and Akt pathways. PMID:26731380

  20. Protection by ozone preconditioning is mediated by the antioxidant system in cisplatin-induced nephrotoxicity in rats.

    PubMed Central

    Borrego, Aluet; Zamora, Zullyt B; González, Ricardo; Romay, Cheyla; Menéndez, Silvia; Hernández, Frank; Montero, Teresita; Rojas, Enys


    BACKGROUND: Acute renal failure is a dose-limiting factor of cisplatin chemotherapy. Here, we show the protective effect of ozone oxidative preconditioning against cisplatin-induced renal dysfunction in rats. Ozone oxidative preconditioning is a prophylactic approach, which favors the antioxidant-pro-oxidant balance for preservation of the cell redox state by increasing antioxidant endogenous systems in various in vivo and in vitro experimental models. AIMS: To analyze the protective role of ozone oxidative preconditioning against cisplatin-induced nephrotoxicity. METHODS: Male Sprague-Dawley rats were pretreated with 15 intrarectal applications of ozone/oxygen mixture at 0.36, 0.72, 1.1, 1.8 and 2.5 mg/kg before cisplatin intraperitoneal injection (6 mg/kg). Serum and kidneys were extracted and analyzed 5 days after cisplatin treatment for determinations of the renal content of glutathione, thiobarbituric acid-reactive substances, renal concentration and enzymatic activities of catalase, superoxide dismutase and glutathione peroxidase. RESULTS: Ozone pretreatment prevented the increase in serum creatinine levels, the glutathione depletion and the inhibition of superoxide dismutase, catalase and glutathione peroxidase activities induced by cisplatin in the rat kidney. Also, the renal content of thiobarbituric acid-reactive substances was decreased by ozone therapy. These protective effects of ozone were dose dependent. CONCLUSIONS: Intrarectal ozone therapy prevented effectively the renal antioxidant unbalance induced by cisplatin treatment. PMID:15203559

  1. Inhibitory effect of hydrogen sulfide on ozone-induced airway inflammation, oxidative stress, and bronchial hyperresponsiveness.


    Zhang, Pengyu; Li, Feng; Wiegman, Coen H; Zhang, Min; Hong, Yan; Gong, Jicheng; Chang, Yan; Zhang, Junfeng Jim; Adcock, Ian; Chung, Kian Fan; Zhou, Xin


    Exposure to ozone has been associated with airway inflammation, oxidative stress, and bronchial hyperresponsiveness. The goal of this study was to examine whether these adverse effects of ozone could be prevented or reversed by hydrogen sulfide (H2S) as a reducing agent. The H2S donor sodium (NaHS) (2 mg/kg) or vehicle (PBS) was intraperitoneally injected into mice 1 hour before and after 3-hour ozone (2.5 ppm) or air exposure, and the mice were studied 24 hours later. Preventive and therapeutic treatment with NaHS reduced the ozone-induced increases in the total cells, including neutrophils and macrophages; this treatment also reduced levels of cytokines, including TNF-α, chemokine (C-X-C motif) ligand 1, IL-6, and IL-1β levels in bronchial alveolar lavage fluid; inhibited bronchial hyperresponsiveness; and attenuated ozone-induced increases in total malondialdehyde in bronchoalveolar lavage fluid and decreases in the ratio of reduced glutathione/oxidized glutathione in the lung. Ozone exposure led to decreases in the H2S production rate and in mRNA and protein levels of cystathionine-β-synthetase and cystathionine-γ-lyase in the lung. These effects were prevented and reversed by NaHS treatment. Furthermore, NaHS prevented and reversed the phosphorylation of p38 mitogen-activated protein kinase and heat shock protein 27. H2S may have preventive and therapeutic value in the treatment of airway diseases that have an oxidative stress basis. PMID:25010831


    EPA Science Inventory

    ABSTRACT BODY: Ozone causes oxidative stress and lung inflammation. We hypothesized that rat strains with or without genetic susceptibility to cardiovascular disease will have different antioxidant levels in alveolar lining, and that ozone induced inflammatory gene expression wil...

  3. Mechanisms of ozone-induced bronchial hyperreactivity to muscarinic agonists in the guinea pig

    SciTech Connect

    Roum, J.H.


    Bronchial hyperreactivity, a chief characteristic of asthma, is poorly understood mechanistically. Its development in ozone-exposed guinea pigs was studied in this dissertation research. Reactivity was assessed in awake, spontaneously breathing animals by measuring specific airway resistance (SRaw) as a function of increasing muscarinic bronchoconstrictor challenge. In the first study, improvements in the reactivity measurement were seen by using (1) propranolol pretreatment (10 mg/kg IP, 1/2 hr before measurement) and (2) intravenous (rather than aerosolized) muscarinic challenge. Both (1) decreased its population wide variation and (2) increased its intra-animal reproducibility. Secondly, characteristics of ozone-induced bronchial hyperreactivity, such as (1) its airway mucosal permeability dependence, (2) its time course of development, and (3) its ozone-dose dependence were studied. The relationship between airway mucosa neutrophilic infiltration and the development of this hyperreactivity was examined in the third and fourth study. In the third, a time course study showed that development of hyperreactivity occurred before the neutrophilic infiltration phase, and correlated best with a decrease in identifiable mucosal goblet cells and increase in identifiable mucosoal mast cells. In the fourth, the development of ozone-induced hyperreactivity in animals made granulocytopenic with cyclophosphamide and cortisone acetate treatment was studied. In the final study, the effects of indomethacin on the development of this hyperreactivity was assessed.

  4. Interaction of ozone exposure with airway hyperresponsiveness and inflammation induced by trimellitic anhydride in sensitized guinea pigs

    SciTech Connect

    Sun, Jian; Chung, K.Fan


    The effect of prior ozone (O{sub 3}) exposure on airway hyperresponsiveness and inflammation induced by trimellitic anhydride (TMA) has been investigated in TMA-sensitized guinea pigs. Airway responsiveness was measured as the concentration of acetylcholine needed to increase baseline lung resistance (RL) by 300% (PC300). Ozone (3 ppm, for 3 h) caused an increase in-log PC300 at 1 h after exposure, with return of -log PC300 to control levels at 8 h. Ozone also increased baseline RL at 8 h. TMA challenge increase -log PC300 in TMA-sensitized guinea pigs at 8 h after challenge from 3.85 {+-} 0.09 to 4.11 {+-} 0.09. Ozone exposure prior to TMA challenge prevented the induction of airway hyperresponsiveness with a mean -log PC300 of 3.51 {+-} 0.20, which was not different from that of control TMA-Sensitized group. Baseline RL was significantly higher in ozone-pretreated animals after TMA challenge when compared to those of either control or challenged with TMA alone. Ozone had no effect on TMA challenge-induced BAL eosinophilia and neutrophilia. We conclude that a single exposure to ozone inhibits the increase in airway responsiveness, but increases the bronchoconstrictor response induced by TMA in TMA-Sensitized guinea pigs; however, the inflammatory airway response to TMA is unchanged by preexposure to ozone. 29 refs., 2 figs., 1 tab.

  5. Remote assessment of forest health in southern Arizona, USA: evidence for ozone-induced foliar injury.


    Diem, Jeremy E


    This paper examines possible ozone-induced foliar injury to ponderosa pine areas in the Rincon Mountains of southern Arizona from 1972 to 1992. Spatiotemporal differences in a satellite-derived vegetation index (VI) are examined with respect to antecedent moisture conditions, temporal variations in ozone exposure levels, and measured foliar injury values from 1985. Seasonal ozone exposure levels (SUM60 and W126) increased from 1982 to 1998 and were significantly correlated (r = 0.49 and 0.53, alpha = 0.05) with annual population totals in the Tucson area. Extensive masking of satellite images from 1972, 1986, and 1992 resulted in two optimal change detection areas, with one site, TVWMica, exposed mostly to the Tucson air pollution plume, while the other site, EMica, was more protected from Tucson-derived pollution. An overall increase in VI from 1972 to 1992 at both sites appears to have been caused by an increase in moisture availability. Larger foliar injury values in 1985 were associated with a smaller increase in VI (i.e., a smaller increase in green leaf biomass) from 1972 to 1986. From 1972 to 1986 and from 1986 to 1992, VI values at TV/WMica increased at a slower rate compared to those at EMica. The reduced increase in "green-up" may have been caused partially by ozone-induced foliar injury and resulting decreases in green leaf biomass. However, these spatial differences in VI values may have also been caused by a number of other factors. Results nevertheless reveal the strong possibility of distinct, topographically based, spatial variations in ozone-induced foliar injury within the Rincons. PMID:11830767

  6. Effect of an anti-Mo1 MAb on ozone-induced airway inflammation and airway hyperresponsiveness in dogs

    SciTech Connect

    Li, Z.; Daniel, E.E.; Lane, C.G.; Arnaout, M.A.; O'Byrne, P.M. )


    Ozone inhalation causes neutrophil migration into the airway and airway hyperresponsiveness in dogs. The leukocyte adhesion molecule Mo1 (CD11b/CD18) is a heterodimeric glycoprotein the expression of which is necessary for neutrophil adhesion to endothelium. To evaluate the contribution of Mo1 to ozone-induced neutrophil influx and airway hyperresponsiveness, six dogs were treated intravenously with an Anti-Mo1 monoclonal antibody (3.75 mg/kg in normal saline) that binds to both human and canine Mo1, or the diluent alone, 1.5 h before inhaling ozone (3 ppm for 30 min), or dry air. Airway responses to doubling doses of inhaled acetylcholine (ACh) were measured before and after inhalation of ozone. Neutrophil influx was assessed by bronchoalveolar lavage (BAL) performed after the second ACh inhalation. Treatment with anti-Mo1 prevented the ozone-induced influx of neutrophils into BAL. After diluent and inhaled dry air, the neutrophil count in BAL was 1.49 +/- 1.26 (SE) x 10(4) (5.0% of total cells). After diluent and inhaled ozone, the neutrophil count increased to 7.27 +/- 3.22 (SE) x 10(4) (22.6% of total cells) (P < 0.05). After anti-Mo1 and inhaled ozone, the neutrophil count was 1.48 +/- 0.62 (SE) x 10(4) (8.5% of total cells). Treatment with anti-Mo1 also significantly reduced the number of eosinophils in BAL after ozone. Ozone-induced ACh airway hyperresponsiveness was not prevented by treatment with anti-Mo1. These results indicate that expression of Mo1 is necessary for ozone-induced neutrophil migration into the airway lumen.

  7. Ozone therapy ameliorates tubulointerstitial inflammation by regulating TLR4 in adenine-induced CKD rats.


    Chen, Zhiyuan; Liu, Xiuheng; Yu, Gang; Chen, Hui; Wang, Lei; Wang, Zhishun; Qiu, Tao; Weng, Xiaodong


    Tubulointerstitium inflammation is a common pathway aggravating chronic kidney disease (CKD) progression and the mechanism is partly associated with excessive activation of toll-like receptor 4 (TLR4) in tubulointerstitium. Ozone therapy is demonstrated to alleviate inflammation in some experiments. The aim of this study is to examine whether ozone therapy could ameliorate chronic tubulointerstitium inflammation by suppressing TLR4 in adenine-induced CKD rats. Sprague-Dawley rats were fed with 0.75% adenine-containing diet to induce CKD and tubulointerstitium inflammation injury. Ozone therapy (1.1 mg/kg) was simultaneously administrated by rectal insufflations (i.r.). After 4 weeks, serum and kidney samples were collected for detection. Renal function and systemic electrolyte were detected. Renal pathological changes were assessed by hematoxylin-eosin (H&E) staining and Masson trichrome (MT) staining. Immunohistochemistry, Western blot and Real-time PCR were applied to evaluate tubulointerstitium inflammation as well as the expression of TLR4 and phosphorylated nuclear factor kappa B P65 (p-NF-κB P65) in rats. The results showed ozone therapy improved serious renal insufficiency, systemic electrolyte disorder and tubulointerstitium morphology damages in adenine-induced CKD rats. In addition, ozone therapy suppressed excessive activation of TLR4 and p-NF-κB P65 in the tubulointerstitium of adenine-induced CKD rats, accompanied by the reduction of inflammation-related cytokines including monocyte chemoattractant protein-1 (MCP-1), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6). The protein expression of TLR4 was positively correlated with the protein expression levels of MCP-1 (r = 0.7863, p < 0.01) and TNF-α (r = 0.7547, p < 0.01) in CKD rats. These findings indicated ozone therapy could attenuate tubulointerstitium inflammation injury in adenine-induced CKD rats and the mechanism might associate with the

  8. Signal-Induced Noise Effects in a Photon Counting System for Stratospheric Ozone Measurement

    NASA Technical Reports Server (NTRS)

    Harper, David B.; DeYoung, Russell J.


    A significant source of error in making atmospheric differential absorption lidar ozone measurements is the saturation of the photomultiplier tube by the strong, near field light return. Some time after the near field light signal is gone, the photomultiplier tube gate is opened and a noise signal, called signal-induced noise, is observed. Research reported here gives experimental results from measurement of photomultiplier signal-induced noise. Results show that signal-induced noise has several decaying exponential signals, suggesting that electrons are slowly emitted from different surfaces internal to the photomultiplier tube.

  9. Sequential Collision- and Ozone-Induced Dissociation Enables Assignment of Relative Acyl Chain Position in Triacylglycerols.


    Marshall, David L; Pham, Huong T; Bhujel, Mahendra; Chin, Jacqueline S R; Yew, Joanne Y; Mori, Kenji; Mitchell, Todd W; Blanksby, Stephen J


    Unambiguous identification of isomeric lipids by mass spectrometry represents a significant analytical challenge in contemporary lipidomics. Herein, the combination of collision-induced dissociation (CID) with ozone-induced dissociation (OzID) on an ion-trap mass spectrometer is applied to the identification of triacylglycerol (TG) isomers that vary only by the substitution pattern of fatty acyl (FA) chains esterified to the glycerol backbone. Isolated product ions attributed to loss of a single FA arising from CID of [TG + Na](+) ions react rapidly with ozone within the ion trap. The resulting CID/OzID spectra exhibit abundant ions that unequivocally reveal the relative position of FAs along the backbone. Isomeric TGs containing two or three different FA substituents are readily differentiated by diagnostic ions present in their CID/OzID spectra. Compatibility of this method with chromatographic separations enables the characterization of unusual TGs containing multiple short-chain FAs present in Drosophila. PMID:26799085

  10. Effects of ozone and endotoxin coexposure on rat airway epithelium: potentiation of toxicant-induced alterations.


    Wagner, J G; Hotchkiss, J A; Harkema, J R


    Tropospheric ozone is the major oxidizing component in photochemical smog and is one of the most pervasive problems to human health of the criteria air pollutants for which the National Ambient Air Quality Standards have been designated by the Clean Air Act. Although many adverse health effects of ozone exposure have been documented in both humans and laboratory animals, controversy surrounds the establishment and implementation of ozone standards set forth by the U.S. Environmental Protection Agency. Because people are commonly exposed to more than one air pollutant at a time, studies that examine coexposures to airborne materials may be more relevant for assessing their risks to human health. Airborne biogenic substances such as pollens, spores, and bacterial products are ubiquitous in the environment, and when inhaled can cause adverse respiratory symptoms. One such biogenic agent, bacterial endotoxin, is a potent stimulus of airway inflammation and is a ubiquitous airborne contaminant commonly found in domestic, agricultural, and industrial settings. Little is known about the interaction of exposures to biogenic substances and criteria air pollutants such as ozone. In the last few years we have performed a series of studies in rodents that examined the biologic responses of the respiratory epithelium after airway exposures to both endotoxin and ozone. When exposed to ozone (0.5 ppm 8 hr/day for 3 days), Fischer rats develop lesions in the nasal transitional epithelium, whereas intranasal instillation of endotoxin (20 microg) elicits epithelial lesions in the respiratory epithelium of the nose and conducting airways. Our studies were designed to examine how exposure to one toxicant may affect the airway epithelial lesions induced by the other toxicant. We investigated the potential role of acute inflammation in the enhancement of airway epithelial lesions after exposure of these two toxicants in neutrophil-sufficient and neutrophil-deficient rodents. A summary

  11. Effects of ozone and endotoxin coexposure on rat airway epithelium: potentiation of toxicant-induced alterations.

    PubMed Central

    Wagner, J G; Hotchkiss, J A; Harkema, J R


    Tropospheric ozone is the major oxidizing component in photochemical smog and is one of the most pervasive problems to human health of the criteria air pollutants for which the National Ambient Air Quality Standards have been designated by the Clean Air Act. Although many adverse health effects of ozone exposure have been documented in both humans and laboratory animals, controversy surrounds the establishment and implementation of ozone standards set forth by the U.S. Environmental Protection Agency. Because people are commonly exposed to more than one air pollutant at a time, studies that examine coexposures to airborne materials may be more relevant for assessing their risks to human health. Airborne biogenic substances such as pollens, spores, and bacterial products are ubiquitous in the environment, and when inhaled can cause adverse respiratory symptoms. One such biogenic agent, bacterial endotoxin, is a potent stimulus of airway inflammation and is a ubiquitous airborne contaminant commonly found in domestic, agricultural, and industrial settings. Little is known about the interaction of exposures to biogenic substances and criteria air pollutants such as ozone. In the last few years we have performed a series of studies in rodents that examined the biologic responses of the respiratory epithelium after airway exposures to both endotoxin and ozone. When exposed to ozone (0.5 ppm 8 hr/day for 3 days), Fischer rats develop lesions in the nasal transitional epithelium, whereas intranasal instillation of endotoxin (20 microg) elicits epithelial lesions in the respiratory epithelium of the nose and conducting airways. Our studies were designed to examine how exposure to one toxicant may affect the airway epithelial lesions induced by the other toxicant. We investigated the potential role of acute inflammation in the enhancement of airway epithelial lesions after exposure of these two toxicants in neutrophil-sufficient and neutrophil-deficient rodents. A summary

  12. Sex differences in diet and inhaled ozone (O3) induced metabolic impairment

    EPA Science Inventory

    APS 2015 abstract Sex differences in diet and inhaled ozone (O3) induced metabolic impairment U.P. Kodavanti1, V.L. Bass2, M.C. Schladweiler1, C.J. Gordon3, K.A. Jarema1, P. Phillips1, A.D. Ledbetter1, D.B. Miller4, S. Snow5, J.E. Richards1. 1 EPHD, NHEERL, USEPA, Research Triang...

  13. Gender differences in ozone-induced pulmonary and metabolic health effects

    EPA Science Inventory

    SOT 2015 abstractGender differences in ozone-induced pulmonary and metabolic health effectsU.P. Kodavanti1, V.L. Bass2, M.C. Schladweiler1, C.J. Gordon3, K.A. Jarema3, P. Phillips3, A.D. Ledbetter1, D.B. Miller4, S. Snow5, J.E. Richards1. 1 EPHD, NHEERL, USEPA, Research Triangle ...

  14. Inhibition of myristoylated alanine-rich C kinase substrate (MARCKS) protein inhibits ozone-induced airway neutrophilia and inflammation

    PubMed Central

    Damera, Gautam; Jester, William F.; Jiang, Meiqi; Zhao, Hengjiang; Fogle, Homer W.; Mittelman, Michael; Haczku, Angela; Murphy, Edwin; Parikh, Indu; Panettieri, Reynold A.


    Evidence suggests inhibition of leukocyte trafficking mitigates, in part, ozone-induced inflammation. In the present study, the authors postulated that inhibition of myristoylated alanine-rich C kinase substrate (MARCKS), an 82-kDa protein with multiple biological roles, could inhibit ozone-induced leukocyte trafficking and cytokine secretions. BALB/c mice (n = 5/cohort) were exposed to ozone (100 ppb) or forced air (FA) for 4 hours. MARCKS-inhibiting peptides, MANS, BIO-11000, BIO-11006, or scrambled control peptide RNS, were intratracheally administered prior to ozone exposure. Ozone selectively enhanced bronchoalveolar lavage (BAL) levels of killer cells (KCs; 6 ± 0.9-fold), interleukin-6 (IL-6; 12.7 ± 1.9-fold), and tumor necrosis factor (TNF; 2.1 ± 0.5-fold) as compared to cohorts exposed to FA. Additionally, ozone increased BAL neutrophils by 21% ± 2% with no significant (P > .05) changes in other cell types. MANS, BIO-11000, and BIO-11006 significantly reduced ozone-induced KC secretion by 66% ± 14%, 47% ± 15%, and 71.1% ± 14%, and IL-6 secretion by 69% ± 12%, 40% ± 7%, and 86.1% ± 11%, respectively. Ozone-mediated increases in BAL neutrophils were reduced by MANS (86% ± 7%) and BIO-11006 (84% ± 2.5%), but not BIO-11000. These studies identify for the first time the novel potential of MARCKS protein inhibitors in abrogating ozone-induced increases in neutrophils, cytokines, and chemokines in BAL fluid. BIO-11006 is being developed as a treatment for chronic obstructive pulmonary disorder (COPD) and is currently being evaluated in a phase 2 clinical study. PMID:20205598

  15. Ozone Exposure of Macrophages Induces an Alveolar Epithelial Chemokine Response through IL-1α

    PubMed Central

    Manzer, Rizwan; Dinarello, Charles A.; McConville, Glen; Mason, Robert J.


    Ozone is known to produce an acute influx of neutrophils, and alveolar epithelial cells can secrete chemokines and modulate inflammatory processes. However, direct exposure of alveolar epithelial cells and macrophages to ozone (O3) produces little chemokine response. To determine if cell–cell interactions might be responsible, we investigated the effect of alveolar macrophage–conditioned media after ozone exposure (MO3CM) on alveolar epithelial cell chemokine production. Serum-free media were conditioned by exposing a rat alveolar macrophage cell line NR8383 to ozone for 1 hour. Ozone stimulated secretion of IL-1α, IL-1β, and IL-18 from NR8383 cells, but there was no secretion of chemokines or TNF-α. Freshly isolated type II cells were cultured, so as to express the biological markers of type I cells, and these cells are referred to as type I–like cells. Type I–like cells were exposed to diluted MO3CM for 24 hours, and this conditioned medium stimulated secretion of cytokine-induced neutrophil chemattractant-1 (CXCL1) and monocyte chemoattractant protein-1 (CCL2). Secretion of these chemokines was inhibited by the IL-1 receptor antagonist. Although both recombinant IL-1α and IL-1β stimulated alveolar epithelial cells to secrete chemokines, recombinant IL-1α was 100-fold more potent than IL-1β. Furthermore, neutralizing anti-rat IL-1α antibodies inhibited the secretion of chemokines by alveolar epithelial cells, whereas neutralizing anti-rat IL-1β antibodies had no effect. These observations indicate that secretion of IL-1α from macrophages stimulates alveolar epithelial cells to secrete chemokines that can elicit an inflammatory response. PMID:17901407

  16. Ozone autohemotherapy induces long-term cerebral metabolic changes in multiple sclerosis patients.


    Molinari, F; Simonetti, V; Franzini, M; Pandolfi, S; Vaiano, F; Valdenassi, L; Liboni, W


    CYT-c level changes in MS induced by ozone autohemotherapy. PMID:25280029

  17. DNA linking number change induced by sequence-specific DNA-binding proteins

    PubMed Central

    Chen, Bo; Xiao, Yazhong; Liu, Chang; Li, Chenzhong; Leng, Fenfei


    Sequence-specific DNA-binding proteins play a key role in many fundamental biological processes, such as transcription, DNA replication and recombination. Very often, these DNA-binding proteins introduce structural changes to the target DNA-binding sites including DNA bending, twisting or untwisting and wrapping, which in many cases induce a linking number change (ΔLk) to the DNA-binding site. Due to the lack of a feasible approach, ΔLk induced by sequence-specific DNA-binding proteins has not been fully explored. In this paper we successfully constructed a series of DNA plasmids that carry many tandem copies of a DNA-binding site for one sequence-specific DNA-binding protein, such as λ O, LacI, GalR, CRP and AraC. In this case, the protein-induced ΔLk was greatly amplified and can be measured experimentally. Indeed, not only were we able to simultaneously determine the protein-induced ΔLk and the DNA-binding constant for λ O and GalR, but also we demonstrated that the protein-induced ΔLk is an intrinsic property for these sequence-specific DNA-binding proteins. Our results also showed that protein-mediated DNA looping by AraC and LacI can induce a ΔLk to the plasmid DNA templates. Furthermore, we demonstrated that the protein-induced ΔLk does not correlate with the protein-induced DNA bending by the DNA-binding proteins. PMID:20185570

  18. Mapping the phase diagram of DNA force-induced melting in the presence of DNA intercalators

    NASA Astrophysics Data System (ADS)

    Vladescu, Ioana; McCauley, Micah; Nunez, Megan; Rouzina, Ioulia; Williams, Mark


    The interactions between single DNA molecules and different non-covalent binding agents - the classical intercalator ethidium and compounds from the family of ruthenium complexes - are investigated using an optical tweezers instrument and their effects on the structure and mechanical stability of DNA molecules are quantitatively analyzed using a model of force-induced melting. When a single DNA molecule is stretched beyond its normal contour length, a melting phase transition is observed. Drug binding increases the dsDNA contour length, decreases the DNA elongation upon melting, and increases the DNA melting force. At concentrations of intercalator above critical, no force induced melting of dsDNA is possible. The DNA stretching curves map out a phase diagram for DNA melting in the presence of intercalator, and define its critical point in the force-extension-drug concentration space. Our results allow for the complete thermodynamic characterization of the interaction of these intercalators with DNA.


    EPA Science Inventory

    To examine the hypothesis that the acute, reversible changes caused by O3 exposure are mediated by techykinin release, guinea pigs were depleted of tachykinins using repeated capsaicin (CAP) injections prior to O3 exposure, in an attempt to prevent O3-induced functional changes. ...

  20. DNA-PK is Involved in Repairing a Transient Surge of DNA BreaksInduced by Deceleration of DNA Replication.

    SciTech Connect

    Shimura, Tsutomu; Martin, Melvenia M.; Torres, Michael J.; Gu,Cory; Pluth, Janice M.; DiBernardi, Maria A.; McDonald, Jeffrey S.; Aladjem, Mirit I.


    ells that suffer substantial inhibition of DNA replication halt their cell cycle via a checkpoint response mediated by the PI3 kinases ATM and ATR. It is unclear how cells cope with milder replication insults, which are under the threshold for ATM and ATR activation. A third PI3 kinase, DNA-dependent protein kinase (DNA-PK), is also activated following replication inhibition, but the role DNA-PK might play in response to perturbed replication is unclear, since this kinase does not activate the signaling cascades involved in the S-phase checkpoint. Here we report that mild, transient drug-induced perturbation of DNA replication rapidly induced DNA breaks that promptly disappeared in cells that contained a functional DNA-PK whereas such breaks persisted in cells that were deficient in DNA-PK activity. After the initial transient burst of DNA breaks, cells with a functional DNA-PK did not halt replication and continued to synthesize DNA at a slow pace in the presence of replication inhibitors. In contrast, DNA-PK deficient cells subject to low levels of replication inhibition halted cell cycle progression via an ATR-mediated S-phase checkpoint. The ATM kinase was dispensable for the induction of the initial DNA breaks. These observations suggest that DNA-PK is involved in setting a high threshold for the ATR-Chkl-mediated S-phase checkpoint by promptly repairing DNA breaks that appear immediately following inhibition of DNA replication.

  1. Structural changes of linear DNA molecules induced by cisplatin

    SciTech Connect

    Liu, Zhiguo; Liu, Ruisi; Zhou, Zhen; Zu, Yuangang; Xu, Fengjie


    Interaction between long DNA molecules and activated cisplatin is believed to be crucial to anticancer activity. However, the exact structural changes of long DNA molecules induced by cisplatin are still not very clear. In this study, structural changes of long linear double-stranded DNA (dsDNA) and short single-stranded DNA (ssDNA) induced by activated cisplatin have been investigated by atomic force microscopy (AFM). The results indicated that long DNA molecules gradually formed network structures, beads-on-string structures and their large aggregates. Electrostatic and coordination interactions were considered as the main driving forces producing these novel structures. An interesting finding in this study is the beads-on-string structures. Moreover, it is worth noting that the beads-on-string structures were linked into the networks, which can be ascribed to the strong DNA–DNA interactions. This study expands our knowledge of the interactions between DNA molecules and cisplatin. - Highlights: • We investigate structural changes of dsDNA and ssDNA induced by cisplatin. • AFM results indicated long dsDNA formed network, beads-on-string and aggregates. • ssDNA can form very similar structures as those of long linear dsDNA. • A possible formation process of theses novel structure is proposed.

  2. Radiation-induced degradation of DNA bases

    NASA Astrophysics Data System (ADS)

    Douki, T.; Delatour, T.; Martini, R.; Cadet, J.


    Radio-induced degradation of DNA involves radical processes. A series of lesions among the major bases degradation products has been measured in isolated DNA exposed to gamma radiation in aerated aqueous solution. Degradation can be accounted for by the formation of hydroxyl radicals upon radiolysis of water (indirect effect). The four bases are degraded in high yield. Direct effect has been mimicked by photo-induced electron abstraction from the bases producing their radical cation. Quantification of the modified bases showed that guanine is the preferential target. This can be explained by its lower oxidation potential and charge transfer phenomena. La décomposition radio-induite de l'ADN fait intervenir des processus radicalaires. Une série de lésions choisies parmi les produits majeurs de dégradation des bases a été mesurée dans de l'ADN isolé exposé au rayonnement en solution aqueuse aérée. Les modifications sont alors dues aux radicaux hydroxyles produits par la radiolyse de l'eau (effet indirect) et les quatre bases sont efficacement dégradées. L'arrachement d'électrons aux bases par photosensibilisation pour produire leur radical cation, a été utilisé comme modèle de l'effet direct. La quantification des bases modifiées montre que la guanine est préférentiellement dégradée. Cette observation peut s'expliquer par le plus faible potentiel d'oxydation de cette base ainsi que par les phénomènes de transfert de charge vers les guanines.

  3. Ozone-induced airway epithelial cell death, the neurokinin-1 receptor pathway, and the postnatal developing lung

    PubMed Central

    Murphy, Shannon R.; Oslund, Karen L.; Hyde, Dallas M.; Miller, Lisa A.; Van Winkle, Laura S.


    Children are uniquely susceptible to ozone because airway and lung growth continue for an extensive period after birth. Early-life exposure of the rhesus monkey to repeated ozone cycles results in region-specific disrupted airway/lung growth, but the mediators and mechanisms are poorly understood. Substance P (SP), neurokinin-1 receptor (NK-1R); and nuclear receptor Nur77 (NR4A1) are signaling pathway components involved in ozone-induced cell death. We hypothesize that acute ozone (AO) exposure during postnatal airway development disrupts SP/NK-1R/Nur77 pathway expression and that these changes correlate with increased ozone-induced cell death. Our objectives were to 1) spatially define the normal development of the SP/NK-1R/Nur77 pathway in conducting airways; 2) compare how postnatal age modulates responses to AO exposure; and 3) determine how concomitant, episodic ozone exposure modifies age-specific acute responses. Male infant rhesus monkeys were assigned at age 1 mo to two age groups, 2 or 6 mo, and then to one of three exposure subgroups: filtered air (FA), FA+AO (AO: 8 h/day × 2 days), or episodic biweekly ozone exposure cycles (EAO: 8 h/day × 5 days/14-day cycle+AO). O3 = 0.5 ppm. We found that 1) ozone increases SP/NK-1R/Nur77 pathway expression in conducting airways, 2) an ozone exposure cycle (5 days/cycle) delivered early at age 2 mo resulted in an airway that was hypersensitive to AO exposure at the end of 2 mo, and 3) continued episodic exposure (11 cycles) resulted in an airway that was hyposensitive to AO exposure at 6 mo. These observations collectively associate with greater overall inflammation and epithelial cell death, particularly in early postnatal (2 mo), distal airways. PMID:25063800

  4. The effect of platelet activating factor antagonist on ozone-induced airway inflammation and bronchial hyperresponsiveness in guinea pigs

    SciTech Connect

    Tan, W.C.; Bethel, R.A. )


    We investigated the role of platelet-activating factor (PAF) in ozone-induced airway responses by examining the effects of L659,989, a potent PAF antagonist, on bronchial hyperresponsiveness and airway inflammation. Twenty-four male guinea pigs were studied in four equal groups. Total lung resistance (RL) in intubated and spontaneously breathing animals was measured in a constant-volume body plethysmograph. Dose-response curves to methacholine were determined in all animals at the start of the experiment. These were repeated on a separate day after the following types of treatments: air exposure in Group 1, intraperitoneally administered alcohol and air exposure in Group 2; intraperitoneally administered alcohol and ozone exposure in Group 3, and intraperitoneally administered L659,989 (a specific PAF antagonist), 5 mg/kg dissolved in alcohol, and ozone exposure in Group 4. Bronchoalveolar lavage (BAL) was performed after the second methacholine challenge, and the bronchial mucosa was also examined for inflammatory cells. Exposure to 3 ppm ozone for 2 h resulted in a three-doubling concentration increase in bronchial responsiveness, which was not significantly inhibited by prior treatment with L659,989. Ozone induced a 1.8-fold increase in BAL total cell count, increased eosinophilic influx into the airways, and increased eosinophilic infiltration in the bronchial mucosa, which were all not inhibited by L659,989 pretreatment. The results suggest that PAF may not have an essential role in ozone-induced airway hyperresponsiveness and nonallergic airway inflammation.

  5. Dietary antioxidants and ozone-induced bronchial hyperresponsiveness in adults with asthma.


    Trenga, C A; Koenig, J Q; Williams, P V


    Ozone exposure aggravates asthma, as has been demonstrated in both controlled exposures and epidemiologic studies. In the current double-blind crossover study, the authors evaluated the effects of dietary antioxidants (i.e., 400 IU vitamin E/500 mg vitamin C) on ozone-induced bronchial hyperresponsiveness in adult subjects with asthma. Seventeen subjects were exposed to 0.12 ppm of ozone or to air for 45 min during intermittent moderate exercise. Bronchial hyperresponsiveness was assessed with 10-min sulfur dioxide (i.e., 0.10 ppm and 0.25 ppm) inhalation challenges. Subjects who were given dietary antioxidants responded less severely to sulfur dioxide challenge than subjects given a placebo (i.e., forced expiratory volume in the 1st sec: -1.2% vs. 4.4%, respectively; peak flow: +2.2% vs. -3.0%, respectively; and mid-forced expiratory flow: +2.0% vs. -4.3%, respectively). Effects were more pronounced when subjects were grouped by response to sulfur dioxide at the screening visit. The results suggest that dietary supplementation with vitamins E and C benefits asthmatic adults who are exposed to air pollutants. PMID:11480500

  6. Delayed chromosomal instability induced by DNA damage.

    PubMed Central

    Marder, B A; Morgan, W F


    DNA damage induced by ionizing radiation can result in gene mutation, gene amplification, chromosome rearrangements, cellular transformation, and cell death. Although many of these changes may be induced directly by the radiation, there is accumulating evidence for delayed genomic instability following X-ray exposure. We have investigated this phenomenon by studying delayed chromosomal instability in a hamster-human hybrid cell line by means of fluorescence in situ hybridization. We examined populations of metaphase cells several generations after expanding single-cell colonies that had survived 5 or 10 Gy of X rays. Delayed chromosomal instability, manifested as multiple rearrangements of human chromosome 4 in a background of hamster chromosomes, was observed in 29% of colonies surviving 5 Gy and in 62% of colonies surviving 10 Gy. A correlation of delayed chromosomal instability with delayed reproductive cell death, manifested as reduced plating efficiency in surviving clones, suggests a role for chromosome rearrangements in cytotoxicity. There were small differences in chromosome destabilization and plating efficiencies between cells irradiated with 5 or 10 Gy of X rays after a previous exposure to 10 Gy and cells irradiated only once. Cell clones showing delayed chromosomal instability had normal frequencies of sister chromatid exchange formation, indicating that at this cytogenetic endpoint the chromosomal instability was not apparent. The types of chromosomal rearrangements observed suggest that chromosome fusion, followed by bridge breakage and refusion, contributes to the observed delayed chromosomal instability. Images PMID:8413263

  7. Analysis of alcohol-induced DNA damage in Escherichia coli by visualizing single genomic DNA molecules.


    Kang, Yujin; Lee, Jinyong; Kim, Jisoo; Oh, Yeeun; Kim, Dogeun; Lee, Jungyun; Lim, Sangyong; Jo, Kyubong


    Consumption of alcohol injures DNA, and such damage is considered to be a primary cause for the development of cancer and many other diseases essentially due to reactive oxygen species generated from alcohol. To sensitively detect alcohol-induced DNA lesions in a biological system, we introduced a novel analytical platform for visualization of single genomic DNA molecules using E. coli. By fluorescently labelling the DNA lesions, our approach demonstrated, with the highest sensitivity, that we could count the number of DNA lesions induced by alcohol metabolism in a single bacterial cell. Moreover, our results showed a linear relationship between ethanol concentration and the number of DNA lesions: 0.88 lesions per 1% ethanol. Using this approach, we quantitatively analysed the DNA damage induced by exposure to alcoholic beverages such as beer (5% ethanol), rice wine (13%), soju (20%), and whisky (40%). PMID:27186604

  8. OGG1 is essential in oxidative stress induced DNA demethylation.


    Zhou, Xiaolong; Zhuang, Ziheng; Wang, Wentao; He, Lingfeng; Wu, Huan; Cao, Yan; Pan, Feiyan; Zhao, Jing; Hu, Zhigang; Sekhar, Chandra; Guo, Zhigang


    DNA demethylation is an essential cellular activity to regulate gene expression; however, the mechanism that triggers DNA demethylation remains unknown. Furthermore, DNA demethylation was recently demonstrated to be induced by oxidative stress without a clear molecular mechanism. In this manuscript, we demonstrated that 8-oxoguanine DNA glycosylase-1 (OGG1) is the essential protein involved in oxidative stress-induced DNA demethylation. Oxidative stress induced the formation of 8-oxoguanine (8-oxoG). We found that OGG1, the 8-oxoG binding protein, promotes DNA demethylation by interacting and recruiting TET1 to the 8-oxoG lesion. Downregulation of OGG1 makes cells resistant to oxidative stress-induced DNA demethylation, while over-expression of OGG1 renders cells susceptible to DNA demethylation by oxidative stress. These data not only illustrate the importance of base excision repair (BER) in DNA demethylation but also reveal how the DNA demethylation signal is transferred to downstream DNA demethylation enzymes. PMID:27251462

  9. Superoxide generation catalyzed by the ozone-inducible plant peptides analogous to prion octarepeat motif.


    Yokawa, Ken; Kagenishi, Tomoko; Kawano, Tomonori


    Ozone-inducible (OI) peptides found in plants contain repeated sequences consisting of a hexa-repeat unit (YGH GGG) repeated 7-9 times in tandem, and each unit tightly binds copper. To date, the biochemical roles for OI peptides are not fully understood. Here, we demonstrated that the hexa-repeat unit from OI peptides behaves as metal-binding motif catalytically active in the O2•--generation. Lastly, possible mechanisms of the reaction and biological consequence of the reactions are discussed by analogy to the action of human prion octarepeat peptides. PMID:21350332

  10. The Effects of Volcano-Induced Ozone Depletion on Short-lived Climate Forcing in the Arctic

    NASA Astrophysics Data System (ADS)

    Ward, P. L.


    Photodissociation of oxygen maintains the stratopause ~50°C warmer than the tropopause. Photodissociation of ozone warms the lower stratosphere, preventing most of this high-energy DNA-damaging solar radiation from reaching the troposphere. Ozone depletion allows more UV energy to reach the lower troposphere causing photodissociation of anthropogenic ozone and nitrogen dioxide. UV energy also penetrates the ocean >10 m where it is absorbed more efficiently than infrared radiation that barely penetrates the surface. Manmade chlorofluorocarbons caused ozone depletion from 1965 to 1994 with slow recovery predicted over the next 50+ years. But the lowest levels of ozone followed the eruptions of Pinatubo (1991 VEI=6), Eyjafjallajökull (2010 VEI=4), and Grímsvötn (2011 VEI=4). Each of the relatively small, basaltic eruptions in Iceland caused more ozone depletion than the long-term effects of chlorofluorocarbons, although total ozone appears to return to pre-eruption levels within a decade. Ozone depletion by 20% increases energy flux thru the lowermost troposphere by 0.7 W m-2 for overhead sun causing temperatures in the lower stratosphere to drop >2°C since 1958 in steps after the 3 largest volcanic eruptions: Agung 1963, El Chichón 1982, and Pinatubo. Temperatures at the surface increased primarily in the regions and at the times of the greatest observed ozone depletion. The greatest warming observed was along the Western Antarctic Peninsula (65.4°S) where minimum temperatures rose 6.7°C from 1951 to 2003 while maximum temperatures remained relatively constant. Minimum total column ozone in September-October was 40-56% lower than in 1972 almost every year since 1987, strongly anti-correlated with observed minimum temperatures. Sea ice decreased 10%, 7 ice shelves separated, 87% of the glaciers retreated and the Antarctic Circumpolar Current warmed. Elsewhere under the ozone hole, warming of continental Antarctica was limited by the high albedo (0.86) of

  11. Ozone-Induced Rice Grain Yield Loss Is Triggered via a Change in Panicle Morphology That Is Controlled by ABERRANT PANICLE ORGANIZATION 1 Gene.


    Tsukahara, Keita; Sawada, Hiroko; Kohno, Yoshihisa; Matsuura, Takakazu; Mori, Izumi C; Terao, Tomio; Ioki, Motohide; Tamaoki, Masanori


    Rice grain yield is predicted to decrease in the future because of an increase in tropospheric ozone concentration. However, the underlying mechanisms are unclear. Here, we investigated the responses to ozone of two rice (Oryza Sativa L.) cultivars, Sasanishiki and Habataki. Sasanishiki showed ozone-induced leaf injury, but no grain yield loss. By contrast, Habataki showed grain yield loss with minimal leaf injury. A QTL associated with grain yield loss caused by ozone was identified in Sasanishiki/Habataki chromosome segment substitution lines and included the ABERRANT PANICLE ORGANIZATION 1 (APO1) gene. The Habataki allele of the APO1 locus in a near-isogenic line also resulted in grain yield loss upon ozone exposure, suggesting APO1 involvement in ozone-induced yield loss. Only a few differences in the APO1 amino acid sequences were detected between the cultivars, but the APO1 transcript level was oppositely regulated by ozone exposure: i.e., it increased in Sasanishiki and decreased in Habataki. Interestingly, the levels of some phytohormones (jasmonic acid, jasmonoyl-L-isoleucine, and abscisic acid) known to be involved in attenuation of ozone-induced leaf injury tended to decrease in Sasanishiki but to increase in Habataki upon ozone exposure. These data indicate that ozone-induced grain yield loss in Habataki is caused by a reduction in the APO1 transcript level through an increase in the levels of phytohormones that reduce leaf damage. PMID:25923431

  12. Effect of C-fiber-mediated, ozone-induced rapid shallow breathing on airway epithelial injury in rats.


    Schelegle, E S; Alfaro, M F; Putney, L; Stovall, M; Tyler, N; Hyde, D M


    We examined the relationship between C-fiber-mediated, ozone-induced rapid shallow breathing and airway epithelial cell injury at different airway sites within the lower respiratory tract of conscious Wistar rats (n = 24). We combined an acute 8-h ozone inhalation with vagal perineural capsaicin treatment, a selective C-fiber conduction block, and 5-bromo-2'-deoxyuridine (BrdU) labeling as an index of epithelial injury. Vehicle-treated rats that inhaled ozone developed a rapid shallow breathing pattern during ozone inhalation, whereas the capsaicin-treated rats that inhaled ozone showed no changes in respiratory frequency. In vehicle-treated, ozone-exposed rats that developed rapid shallow breathing, a progressive increase in BrdU-labeling density (no. of BrdU-labeled cells/mm(2) airway) was observed starting at the bifurcation of the left main stem bronchi (central airway) and going down either a short or long airway path. In vehicle-treated, ozone-exposed rats, terminal bronchioles supplied by short and long airway paths had a similar degree of BrdU-labeling density that was significantly (P < 0.05) greater than the BrdU-labeling density of the proximal airways that supply them. In contrast, the attenuation of rapid shallow breathing produced by capsaicin treatment resulted in a significantly reduced BrdU-labeling density in the terminal bronchioles supplied by short airway paths compared with the terminal bronchioles supplied by long airway paths. Our data indicate that ozone-induced rapid shallow breathing protects large conducting airways while producing a more even distribution of injury to terminal bronchioles. PMID:11568142

  13. Does ozone enhance the remineralizing potential of nanohydroxyapatite on artificially demineralized enamel? A laser induced fluorescence study

    NASA Astrophysics Data System (ADS)

    Srinivasan, Samuelraj; Prabhu, Vijendra; Chandra, Subhash; Koshy, Shalini; Acharya, Shashidhar; Mahato, Krishna K.


    The present era of minimal invasive dentistry emphasizes the early detection and remineralization of initial enamel caries. Ozone has been shown to reverse the initial demineralization before the integrity of the enamel surface is lost. Nano-hydroxyapatite is a proven remineralizing agent for early enamel caries. In the present study, the effect of ozone in enhancing the remineralizing potential of nano-hydroxyapatite on artificially demineralized enamel was investigated using laser induced fluorescence. Thirty five sound human premolars were collected from healthy subjects undergoing orthodontic treatment. Fluorescence was recorded by exciting the mesial surfaces using 325 nm He-Cd laser with 2 mW power. Tooth specimens were subjected to demineralization to create initial enamel caries. Following which the specimens were divided into three groups, i.e ozone (ozonated water for 2 min), without ozone and artificial saliva. Remineralization regimen was followed for 3 weeks. The fluorescence spectra of the specimens were recorded from all the three experimental groups at baseline, after demineralization and remineralization. The average spectrum for each experimental group was used for statistical analysis. Fluorescence intensities of Ozone treated specimens following remineralization were higher than that of artificial saliva, and this difference was found to be statistically significant (P<0.0001). In a nutshell, ozone enhanced the remineralizing potential of nanohydroxyapatite, and laser induced fluorescence was found to be effective in assessing the surface mineral changes in enamel. Ozone can be considered an effective agent in reversing the initial enamel caries there by preventing the tooth from entering into the repetitive restorative cycle.

  14. DNA induced chirality and helical twist in achiral liquid crystals

    NASA Astrophysics Data System (ADS)

    Garvey, Alfred; Basu, Rajratan; Kinnamon, Daniel

    A small quantity of DNA sample (Deoxyribonucleic acid -cellulose double-stranded from calf thymus DNA in lyophilized powder form) was doped in an achiral liquid crystal (LC), and the mixture was found to exhibit a weak degree of chirality. The induced chirality in the LC was probed by means of the electroclinic effect in the LC's smectic-A phase, which showed significant pretransitional behavior on approaching the smectic- A-smectic- C transition temperature from above. The same DNA was doped in an achiral nematic LC and the mixture was found to exhibit an average mechanical twist over macroscopic dimensions. The double-stranded DNA-induced chiral pitch length P was determined by measuring the radius of curvature of reverse twist disclination lines in 90o nematic twist cells. In the LC +DNA mixture, the LC's benzene rings interact with the nucleobases of the DNA through π - π stacking, which induces a molecular conformational deracemization in the LC.

  15. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia


    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  16. Modelled thermal and dynamical responses of the middle atmosphere to EPP-induced ozone changes

    NASA Astrophysics Data System (ADS)

    Karami, K.; Braesicke, P.; Kunze, M.; Langematz, U.; Sinnhuber, M.; Versick, S.


    Energetic particles including protons, electrons and heavier ions, enter the Earth's atmosphere over the polar regions of both hemispheres, where they can greatly disturb the chemical composition of the upper and middle atmosphere and contribute to ozone depletion in the stratosphere and mesosphere. The chemistry-climate general circulation model EMAC is used to investigate the impact of changed ozone concentration due to Energetic Particle Precipitation (EPP) on temperature and wind fields. The results of our simulations show that ozone perturbation is a starting point for a chain of processes resulting in temperature and circulation changes over a wide range of latitudes and altitudes. In both hemispheres, as winter progresses the temperature and wind anomalies move downward with time from the mesosphere/upper stratosphere to the lower stratosphere. In the Northern Hemisphere (NH), once anomalies of temperature and zonal wind reach the lower stratosphere, another signal develops in mesospheric heights and moves downward. Analyses of Eliassen and Palm (EP) flux divergence show that accelerating or decelerating of the stratospheric zonal flow is in harmony with positive and negative anomalies of the EP flux divergences, respectively. This results suggest that the oscillatory mode in the downwelling signal of temperature and zonal wind in our simulations are the consequence of interaction between the resolved waves in the model and the mean stratospheric flow. Therefore, any changes in the EP flux divergence lead to anomalies in the zonal mean zonal wind which in turn feed back on the propagation of Rossby waves from the troposphere to higher altitudes. The analyses of Rossby waves refractive index show that the EPP-induced ozone anomalies are capable of altering the propagation condition of the planetary-scale Rossby waves in both hemispheres. It is also found that while ozone depletion was confined to mesospheric and stratospheric heights, but it is capable to

  17. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.


    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  18. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton.


    Malloy, K D; Holman, M A; Mitchell, D; Detrich, H W


    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlate with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. PMID:9037040

  19. Ozone-induced oxygen radical release from bronchoalveolar lavage cells and airway hyper-responsiveness in dogs.

    PubMed Central

    Stevens, W H; Conlon, P D; O'Byrne, P M


    1. Ozone inhalation causes airway hyper-responsiveness and airway inflammation in dogs. The purpose of this study was to determine whether these effects are associated with increases in oxygen radical production from bronchoalveolar lavage (BAL) cells. 2. Twelve randomly selected dogs were studied twice, 4 weeks apart. On each study day, acetylcholine (ACh) airway responsiveness was measured before and 1 h after ozone (3 p.p.m., 30 min) or dry air inhalation, followed by BAL. The response to ACh was expressed as the concentration causing an increase in lung resistance of 5 cmH2O l-1 s-1 above baseline. Spontaneous and phorbol myristate acetate (PMA) (2.4 mumol l-1)-stimulated oxygen radical release from washed BAL cells (4 x 10(6) cells ml-1) was measured by luminol-enhanced chemiluminescence in a luminometer at 37 degrees C. 3. Ozone inhalation caused airway hyper-responsiveness. The concentration of ACh causing an increase in lung resistance of 5 cmH2O l-1 s-1 (the 'provocative' concentration) fell from 4.68 mg ml-1 (% S.E.M., 1.43) before, to 0.48 mg ml-1 (% S.E.M., 1.60) after ozone (P < 0.0001). Spontaneous chemiluminescence area under the curve (AUC) significantly increased after ozone from 4.08 mV (10 min) (% S.E.M., 1.28) after dry air to 8.25 mV (10 min; % S.E.M., 1.29) after ozone (P = 0.007). Ozone inhalation also increased PMA-stimulated chemiluminescence AUC from 18.97 mV (10 min; % S.E.M., 1.18) after dry air to 144.03 mV (10 min; % S.E.M., 1.45) after ozone (P = 0.0001). The increase in PMA-stimulated chemiluminescence was significantly correlated with ozone-induced ACh airway hyper-responsiveness (r = 0.83, P < 0.001). 4. These results indicate that inhaled ozone increases oxygen radical release from BAL cells and suggest that oxygen radicals are important in causing ozone-induced airway hyper-responsiveness. PMID:7562641

  20. Induced DNA repair pathway in mammalian cells

    SciTech Connect

    Overberg, R.


    The survival of cultured rat kangaroo cells (PtK-2) and human xeroderma pigmentosum cells incubated with 5 cycloheximide subsequent to ultraviolet irradiation is lower than that of cells incubated without cycloheximide. The drop in survival is considerably larger than that produced by incubation of unirradiated cells with cycloheximide. The phenomenon was also observed when PtK-2 cells were incubated with emetine, another protein synthesis inhibitor, or with 5,6-dichloro-1-..beta..-D-ribofuranosylbenzimidazole, a RNA synthesis inhibitor. PtK cells which received a preliminary UV treatment followed by an incubation period without cycloheximide and then a second irradiation and 24 hour incubation with cycloheximide, survived the effects of the second irradiation better than cells which were incubated in the presence of cycloheximide after the first and second UV irradiation. The application of cycloheximide for 24 hours after UV irradiation of PtK cells resulted in one-half as many 6-thioguanine resistant cells as compared to the number of 6-thioguanine resistant cells found when cycloheximide was not used. These experiments indicate that a UV-inducible cycloheximide-sensitive DNA repair pathway is present in PtK and xeroderma pigmentosum cells, which is error-prone in PtK cells.

  1. Effect of Obesity on Acute Ozone-Induced Changes in Airway Function, Reactivity, and Inflammation in Adult Females

    PubMed Central

    Bennett, William D.; Ivins, Sally; Alexis, Neil E.; Wu, Jihong; Bromberg, Philip A.; Brar, Sukhdev S.; Travlos, Gregory; London, Stephanie J.


    We previously observed greater ozone-induced lung function decrements in obese than non-obese women. Animal models suggest that obesity enhances ozone-induced airway reactivity and inflammation. In a controlled exposure study, we compared the acute effect of randomized 0.4ppm ozone and air exposures (2 h with intermittent light exercise) in obese (N = 20) (30induced-sputum (4h post-exposures and on 24h pre-exposure training day, no exercise): measures of C reactive protein (CRP) (blood only), leptin (blood only), adiponectin, interleukins IL-6, IL-1b, and IL-8, and tumor necrosis factor alpha, and sputum cell differential cell counts. The pre- to post-exposure decrease in forced vital capacity after ozone (adjusted for the change after air exposure) was significantly greater in the obese group (12.5+/-7.5 vs. 8.0+/-5.8%, p<0.05). Post ozone exposure, 6 obese and 6 non-obese subjects responded to methacholine at ≤ 10mg/ml (the maximum dose); the degree of hyperresponsiveness was similar for the two groups. Both BMI groups showed similar and significant ozone-induced increases in sputum neutrophils. Plasma IL-6 was increased by exercise (4 hr post air exposure vs. pre) only in the obese but returned to pre-air exposure levels at 20hr post-exposure. Plasma IL-6 was significantly increased at 4hr post ozone exposure in both groups and returned to pre-exposure levels by 20h post-exposure. These results confirm our previous findings of greater post-ozone spirometric decrements in obese young women. However, acute ozone-induced airway reactivity to methacholine and airway inflammation did not differ by obesity at the exposure and exercise levels used. PMID:27513854

  2. Effect of Obesity on Acute Ozone-Induced Changes in Airway Function, Reactivity, and Inflammation in Adult Females.


    Bennett, William D; Ivins, Sally; Alexis, Neil E; Wu, Jihong; Bromberg, Philip A; Brar, Sukhdev S; Travlos, Gregory; London, Stephanie J


    We previously observed greater ozone-induced lung function decrements in obese than non-obese women. Animal models suggest that obesity enhances ozone-induced airway reactivity and inflammation. In a controlled exposure study, we compared the acute effect of randomized 0.4ppm ozone and air exposures (2 h with intermittent light exercise) in obese (N = 20) (30induced-sputum (4h post-exposures and on 24h pre-exposure training day, no exercise): measures of C reactive protein (CRP) (blood only), leptin (blood only), adiponectin, interleukins IL-6, IL-1b, and IL-8, and tumor necrosis factor alpha, and sputum cell differential cell counts. The pre- to post-exposure decrease in forced vital capacity after ozone (adjusted for the change after air exposure) was significantly greater in the obese group (12.5+/-7.5 vs. 8.0+/-5.8%, p<0.05). Post ozone exposure, 6 obese and 6 non-obese subjects responded to methacholine at ≤ 10mg/ml (the maximum dose); the degree of hyperresponsiveness was similar for the two groups. Both BMI groups showed similar and significant ozone-induced increases in sputum neutrophils. Plasma IL-6 was increased by exercise (4 hr post air exposure vs. pre) only in the obese but returned to pre-air exposure levels at 20hr post-exposure. Plasma IL-6 was significantly increased at 4hr post ozone exposure in both groups and returned to pre-exposure levels by 20h post-exposure. These results confirm our previous findings of greater post-ozone spirometric decrements in obese young women. However, acute ozone-induced airway reactivity to methacholine and airway inflammation did not differ by obesity at the exposure and exercise levels used. PMID:27513854

  3. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest.


    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P; Chow, Vincent T K


    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  4. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest

    PubMed Central

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P.; Chow, Vincent T.K.


    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  5. Cell death induced by ozone and various non-thermal plasmas: therapeutic perspectives and limitations

    PubMed Central

    Lunov, Oleg; Zablotskii, Vitalii; Churpita, Olexander; Chánová, Eliška; Syková, Eva; Dejneka, Alexandr; Kubinová, Šárka


    Non-thermal plasma has been recognized as a promising tool across a vast variety of biomedical applications, with the potential to create novel therapeutic methods. However, the understanding of the molecular mechanisms behind non-thermal plasma cellular effects remains a significant challenge. In this study, we show how two types of different non-thermal plasmas induce cell death in mammalian cell cultures via the formation of multiple intracellular reactive oxygen/nitrogen species. Our results showed a discrepancy in the superoxide accumulation and lysosomal activity in response to air and helium plasma, suggesting that triggered signalling cascades might be grossly different between different plasmas. In addition, the effects of ozone, a considerable component of non-thermal plasma, have been simultaneously evaluated and have revealed much faster and higher cytotoxic effects. Our findings offer novel insight into plasma-induced cellular responses, and provide a basis for better controlled biomedical applications. PMID:25410636

  6. Cell death induced by ozone and various non-thermal plasmas: therapeutic perspectives and limitations

    NASA Astrophysics Data System (ADS)

    Lunov, Oleg; Zablotskii, Vitalii; Churpita, Olexander; Chánová, Eliška; Syková, Eva; Dejneka, Alexandr; Kubinová, Šárka


    Non-thermal plasma has been recognized as a promising tool across a vast variety of biomedical applications, with the potential to create novel therapeutic methods. However, the understanding of the molecular mechanisms behind non-thermal plasma cellular effects remains a significant challenge. In this study, we show how two types of different non-thermal plasmas induce cell death in mammalian cell cultures via the formation of multiple intracellular reactive oxygen/nitrogen species. Our results showed a discrepancy in the superoxide accumulation and lysosomal activity in response to air and helium plasma, suggesting that triggered signalling cascades might be grossly different between different plasmas. In addition, the effects of ozone, a considerable component of non-thermal plasma, have been simultaneously evaluated and have revealed much faster and higher cytotoxic effects. Our findings offer novel insight into plasma-induced cellular responses, and provide a basis for better controlled biomedical applications.

  7. Weakly Charged Cationic Nanoparticles Induce DNA Bending and Strand Separation

    SciTech Connect

    Railsback, Justin; Singh, Abhishek; Pearce, Ryan; McKnight, Timothy E; Collazo, Ramon; Sitar, Zlatko; Yingling, Yaroslava; Melechko, Anatoli Vasilievich


    The understanding of interactions between double stranded (ds) DNA and charged nanoparticles will have a broad bearing on many important applications from drug delivery [ 1 4 ] to DNAtemplated metallization. [ 5 , 6 ] Cationic nanoparticles (NPs) can bind to DNA, a negatively charged molecule, through a combination of electrostatic attraction, groove binding, and intercalation. Such binding events induce changes in the conformation of a DNA strand. In nature, DNA wraps around a cylindrical protein assembly (diameter and height of 6 nm) [ 7 ] with an 220 positive charge, [ 8 ] creating the complex known as chromatin. Wrapping and bending of DNA has also been achieved in the laboratory through the binding of highly charged species such as molecular assemblies, [ 9 , 10 ] cationic dendrimers, [ 11 , 12 ] and nanoparticles. [ 13 15 ] The charge of a nanoparticle plays a crucial role in its ability to induce DNA structural changes. If a nanoparticle has a highly positive surface charge density, the DNA is likely to wrap and bend upon binding to the nanoparticle [ 13 ] (as in the case of chromatin). On the other hand, if a nanoparticle is weakly charged it will not induce dsDNA compaction. [ 9 , 10 , 15 ] Consequently, there is a transition zone from extended to compact DNA conformations which depends on the chemical nature of the nanoparticle and occurs for polycations with charges between 5 and 10. [ 9 ] While the interactions between highly charged NPs and DNA have been extensively studied, the processes that occur within the transition zone are less explored.

  8. Ozone exposure increases eosinophilic airway response induced by previous allergen challenge.


    Vagaggini, Barbara; Taccola, Mauro; Cianchetti, Silvana; Carnevali, Stefano; Bartoli, Maria Laura; Bacci, Elena; Dente, Federico L; Di Franco, Antonella; Giannini, Daniele; Paggiaro, Pier Luigi


    We investigated whether exposure to ozone (O(3)) 24 hours after an allergen challenge test would increase airway eosinophilia induced by allergen in subjects with mild asthma with late airway response. Twelve subjects with mild atopic asthma participated in a randomized, single-blind study. Subjects underwent allergen challenge 24 hours before a 2 hour exposure to O(3) (0.27 ppm) or filtered air. Pulmonary function was monitored during the allergen challenge and after the exposure to O(3) or air. Six hours later, induced sputum was collected. After 4 weeks, the experiment was repeated with the same subjects. Allergen induced a comparable late airway response in both challenges. O(3) exposure induced a significant decrease in FVC, FEV(1), and vital capacity, and was associated with a significant increase in total symptom score compared with air exposure. The percentage of eosinophils, but not the percentage of neutrophils, in induced sputum was significantly higher after exposure to O(3) than after exposure to air (p = 0.04). These results indicate that O(3) exposure after a late airway response elicited by allergen challenge can potentiate the eosinophilic inflammatory response induced by the allergen challenge itself in subjects with mild atopic asthma. This observation may help explain the synergistic effect of air pollution and allergen exposure in the exacerbation of asthma. PMID:12379550

  9. Myeloperoxidase-induced genomic DNA-centered radicals.


    Gomez-Mejiba, Sandra E; Zhai, Zili; Gimenez, Maria S; Ashby, Michael T; Chilakapati, Jaya; Kitchin, Kirk; Mason, Ronald P; Ramirez, Dario C


    Myeloperoxidase (MPO) released by activated neutrophils can initiate and promote carcinogenesis. MPO produces hypochlorous acid (HOCl) that oxidizes the genomic DNA in inflammatory cells as well as in surrounding epithelial cells. DNA-centered radicals are early intermediates formed during DNA oxidation. Once formed, DNA-centered radicals decay by mechanisms that are not completely understood, producing a number of oxidation products that are studied as markers of DNA oxidation. In this study we employed the 5,5-dimethyl-1-pyrroline N-oxide-based immuno-spin trapping technique to investigate the MPO-triggered formation of DNA-centered radicals in inflammatory and epithelial cells and to test whether resveratrol blocks HOCl-induced DNA-centered radical formation in these cells. We found that HOCl added exogenously or generated intracellularly by MPO that has been taken up by the cell or by MPO newly synthesized produces DNA-centered radicals inside cells. We also found that resveratrol passed across cell membranes and scavenged HOCl before it reacted with the genomic DNA, thus blocking DNA-centered radical formation. Taken together our results indicate that the formation of DNA-centered radicals by intracellular MPO may be a useful point of therapeutic intervention in inflammation-induced carcinogenesis. PMID:20406811

  10. Myeloperoxidase-induced Genomic DNA-centered Radicals*

    PubMed Central

    Gomez-Mejiba, Sandra E.; Zhai, Zili; Gimenez, Maria S.; Ashby, Michael T.; Chilakapati, Jaya; Kitchin, Kirk; Mason, Ronald P.; Ramirez, Dario C.


    Myeloperoxidase (MPO) released by activated neutrophils can initiate and promote carcinogenesis. MPO produces hypochlorous acid (HOCl) that oxidizes the genomic DNA in inflammatory cells as well as in surrounding epithelial cells. DNA-centered radicals are early intermediates formed during DNA oxidation. Once formed, DNA-centered radicals decay by mechanisms that are not completely understood, producing a number of oxidation products that are studied as markers of DNA oxidation. In this study we employed the 5,5-dimethyl-1-pyrroline N-oxide-based immuno-spin trapping technique to investigate the MPO-triggered formation of DNA-centered radicals in inflammatory and epithelial cells and to test whether resveratrol blocks HOCl-induced DNA-centered radical formation in these cells. We found that HOCl added exogenously or generated intracellularly by MPO that has been taken up by the cell or by MPO newly synthesized produces DNA-centered radicals inside cells. We also found that resveratrol passed across cell membranes and scavenged HOCl before it reacted with the genomic DNA, thus blocking DNA-centered radical formation. Taken together our results indicate that the formation of DNA-centered radicals by intracellular MPO may be a useful point of therapeutic intervention in inflammation-induced carcinogenesis. PMID:20406811

  11. Influence of high carbohydrate versus high fat diet in ozone induced pulmonary injury and systemic metabolic impairment in a Brown Norway (BN) rat model of healthy aging

    EPA Science Inventory

    Rationale: Air pollution has been recently linked to the increased prevalence of metabolic syndrome. It has been postulated that dietary risk factors might exacerbate air pollution-induced metabolic impairment. We have recently reported that ozone exposure induces acute systemic ...

  12. Increased Sensitivity of DNA Damage Response-Deficient Cells to Stimulated Microgravity-Induced DNA Lesions

    PubMed Central

    Li, Nan; An, Lili; Hang, Haiying


    Microgravity is a major stress factor that astronauts have to face in space. In the past, the effects of microgravity on genomic DNA damage were studied, and it seems that the effect on genomic DNA depends on cell types and the length of exposure time to microgravity or simulated microgravity (SMG). In this study we used mouse embryonic stem (MES) and mouse embryonic fibroblast (MEF) cells to assess the effects of SMG on DNA lesions. To acquire the insight into potential mechanisms by which cells resist and/or adapt to SMG, we also included Rad9-deleted MES and Mdc1-deleted MEF cells in addition to wild type cells in this study. We observed significant SMG-induced DNA double strand breaks (DSBs) in Rad9-/- MES and Mdc1-/- MEF cells but not in their corresponding wild type cells. A similar pattern of DNA single strand break or modifications was also observed in Rad9-/- MES. As the exposure to SMG was prolonged, Rad9-/- MES cells adapted to the SMG disturbance by reducing the induced DNA lesions. The induced DNA lesions in Rad9-/- MES were due to SMG-induced reactive oxygen species (ROS). Interestingly, Mdc1-/- MEF cells were only partially adapted to the SMG disturbance. That is, the induced DNA lesions were reduced over time, but did not return to the control level while ROS returned to a control level. In addition, ROS was only partially responsible for the induced DNA lesions in Mdc1-/- MEF cells. Taken together, these data suggest that SMG is a weak genomic DNA stress and can aggravate genomic instability in cells with DNA damage response (DDR) defects. PMID:25915950

  13. UV laser-induced DNA photochemistry

    SciTech Connect

    Minton, K.W.


    Previous studies examining the effects of UV laser irradiation of nucleosides and nucleotides have determined that qualitative and quantitative differences exist between irradiation at low and high intensities. Multi-photon events involving the singlet and triplet excited states of DNA bases occur following irradiation at high intensity, leading to degradation of bases due to intra-molecular bond cleavage; such events are not seen following irradiation at low intensity. This work extends these studies. Salmon sperm and plasmid DNA were irradiated at low (3.15 [times] 10[sup 7] W/m[sup 2]), intermediate (2.5 [times] 10[sup 9] and 1.16 [times] 10[sup 10] W/m[sup 2]), and high (1.25 [times] 10[sup 11] W/m[sup 2]) intensities, using a KrF excimer laser emitting at 248 nm. DNA damage was then assayed, with the following findings; (1) pyrimidine cyclobutane dimer and bipyrimidine T(6-4)C photoadduct formation was reduced at high intensity relative to low intensity; (2) free thymine and thymine fragments were released from DNA at high intensity, but not at low intensity; (3) DNA strand break formation increased with increasing intensity; (4) double-stranded breaks occurred in DNA at high intensity. A mathematical model describing the effect of high intensity UV radiation on plasmid DNa conformation was developed and fit to experimental data on strand breaks. Using the model, dose constants for single- and double-stranded breaks were determined and found to increase with intensity. These results are consistent with the absorption of a second photon by long-lived triplet excited states of DNA following irradiation at high intensity, but not low intensity. Absorption of two photons leads to the depopulation of triplet excited states in DNA through ionization and fragmentation of bases, causing decreased levels of pyrimidine dimer formation and increased amounts of strand breakage in DNA components, and help extend our understanding of DNA-UV light interactions.

  14. Regulation of ozone-induced lung inflammation and injury by the β-galactoside-binding lectin galectin-3

    SciTech Connect

    Sunil, Vasanthi R.; Francis, Mary; Vayas, Kinal N.; Cervelli, Jessica A.; Choi, Hyejeong; Laskin, Jeffrey D.; Laskin, Debra L.


    Macrophages play a dual role in ozone toxicity, contributing to both pro- and anti-inflammatory processes. Galectin-3 (Gal-3) is a lectin known to regulate macrophage activity. Herein, we analyzed the role of Gal-3 in the response of lung macrophages to ozone. Bronchoalveolar lavage (BAL) and lung tissue were collected 24–72 h after exposure (3 h) of WT and Gal-3{sup -/-} mice to air or 0.8 ppm ozone. In WT mice, ozone inhalation resulted in increased numbers of proinflammatory (Gal-3{sup +}, iNOS{sup +}) and anti-inflammatory (MR-1{sup +}) macrophages in the lungs. While accumulation of iNOS{sup +} macrophages was attenuated in Gal-3{sup -/-} mice, increased numbers of enlarged MR-1{sup +} macrophages were noted. This correlated with increased numbers of macrophages in BAL. Flow cytometric analysis showed that these cells were CD11b{sup +} and consisted mainly (> 97%) of mature (F4/80{sup +}CD11c{sup +}) proinflammatory (Ly6GLy6C{sup hi}) and anti-inflammatory (Ly6GLy6C{sup lo}) macrophages. Increases in both macrophage subpopulations were observed following ozone inhalation. Loss of Gal-3 resulted in a decrease in Ly6C{sup hi} macrophages, with no effect on Ly6C{sup lo} macrophages. CD11b{sup +}Ly6G{sup +}Ly6C{sup +} granulocytic (G) and monocytic (M) myeloid derived suppressor cells (MDSC) were also identified in the lung after ozone. In Gal-3{sup -/-} mice, the response of G-MDSC to ozone was attenuated, while the response of M-MDSC was heightened. Changes in inflammatory cell populations in the lung of ozone treated Gal-3{sup -/-} mice were correlated with reduced tissue injury as measured by cytochrome b5 expression. These data demonstrate that Gal-3 plays a role in promoting proinflammatory macrophage accumulation and toxicity in the lung following ozone exposure. - Highlights: • Multiple monocytic-macrophage subpopulations accumulate in the lung after ozone inhalation. • Galectin-3 plays a proinflammatory role in ozone-induced lung injury. • In the

  15. Ethanol Induced Shortening of DNA in Nanochannels

    NASA Astrophysics Data System (ADS)

    Gemmen, Greg; Reisner, Walter; Tegenfeldt, Jonas; Linke, Heiner


    The confinement of DNA in nanochannels has greatly facilitated the study of DNA polymer physics and holds promise as a powerful tool for genomic sequencing. Ethanol precipitation of DNA is a common tool in molecular biology, typically in >70% [EtOH]. Even at lower ethanol concentrations, however, DNA transforms from B-form to A-form, a shorter yet slightly less twisted conformation. Accordingly, we isolated individual YOYO-1 labeled λ-DNA molecules in 100nmx100nm channels in 0, 20, 40 and 60% [EtOH]. We observed a dramatic shortening in the mean measured lengths with increasing [EtOH] and a broadening of the distribution of measured lengths at the intermediate concentrations. These observed lengths are less than those expected from fully A-form λ-DNA, suggesting that poor solvency effects are involved. Also, substantial spatial variations in intensity in a small number of molecules at the higher [EtOH] suggest the presence of higher order DNA conformations, in accord with the observation that the effective persistence length of DNA has been greatly reduced.

  16. Histopathological changes in retinas and F-ERG features of streptozotocin-induced diabetic rats treated with ozone

    PubMed Central

    Xie, Ting-Yu; Li, Qin; Chen, Xue-Yi


    AIM To study the histopathological changes in the retina and flash electroretinogram (F-ERG) features of ozone-treated streptozotocin (STZ)-induced diabetic rats. METHODS Seventy male Sprague Dawley rats were grouped as follows: blank group (GB, n=10), model control group (GM, n=18), ozone group (GO3, n=19), and oxygen group (GO2, n=18). The model was induced by single intraperitoneal injection of STZ. Ozone or oxygen enteroclysm was given twice per week for 4wk. F-ERG and histopathological examinations were performed one month after treatment. RESULTS Under dark adaption, as compared to GB, the other groups each had differential decreases in the a-wave amplitudes (P<0.05); the latencies were delayed in GM, GO2, and GO3 rats (P<0.05). Similar results were observed under light adaption, with the exception that the a-wave of the amplitudes (F=0.28, P>0.05). There were significant differences in the apoptosis index among the groups (P<0.05). Under ozone treatment, apoptosis was decreased in GO3 as compared to GM and GO2. CONCLUSION Ozone administration alleviates nerve damage and reduces pathology and apoptosis in the retinas of diabetic rats. PMID:27366680

  17. Ozone Therapy in Ethidium Bromide-Induced Demyelination in Rats: Possible Protective Effect.


    Salem, Neveen A; Assaf, Naglaa; Ismail, Manal F; Khadrawy, Yasser A; Samy, Mohga


    Multiple sclerosis, an autoimmune inflammatory disease of the central nervous system, is characterized by excessive demyelination. The study aimed to investigate the possible protective effect of ozone (O3) therapy in ethidium bromide (EB)-induced demyelination in rats either alone or in combination with corticosteroids in order to decrease the dose of steroid therapy. Rats were divided into Group (1) normal control rats received saline, Group (2) Sham-operated rats received saline, Group (3) Sham-operated rats received vehicle (oxygen), Group (4) EB-treated rats received EB, Group (5) EB-treated rats received O3, Group (6) EB-treated rats received methylprednisolone (MP), and Group (7) EB-treated rats received half the dose of MP concomitant with O3. EB-treated rats showed a significant increase in the number of footfalls in the grid walk test, decreased brain GSH, and paraoxonase-1 enzyme activity, whereas brain MDA, TNF-α, IL-1β, INF-γ, Cox-2 immunoreactivity, and p53 protein levels were increased. A significant decline in brain serotonin, dopamine, norepinephrine, and MBP immunoreactivity was also reported. Significant improvement of the above-mentioned parameters was demonstrated with the administration of either MP or O3, whereas best amelioration was achieved by combining half the dose of MP with ozone. PMID:26467344

  18. Oxidized lipids and lipid-mediators are involved in cardiovascular injury induced by diesel exhaust particles and ozone

    EPA Science Inventory

    The mechanisms by which air pollutants induce cardiac and vascular injuries are unknown. We hypothesized that these injuries involve alterations in'aortic membrane lipids and lipid-mediators. We exposed male Wistar Kyoto rats (12-15 wk old), nose-only to air, ozone (03; 0.5 ppm),...

  19. DNA damage in cells exhibiting radiation-induced genomic instability


    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  20. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  1. Herpes simplex virus induces the replication of foreign DNA

    SciTech Connect

    Danovich, R.M.; Frenkel, N.


    Plasmids containing the simian virus 40 (SV40) DNA replication origin and the large T gene are replicated in Vero monkey cells but not in rabbit skin cells. Efficient replication of the plasmids was observed in rabbit cells infected with herpes simplex virus type 1 (HSV-1) and HSV-2. The HSV-induced replication required the large T antigen and the SV40 replication origin. However, it produced concatemeric molecules resembling replicative intermediates of HSV DNA and was sensitive to phosphonoacetate at concentrations known to inhibit the HSV DNA polymerase. Therefore, it involved the HSV DNA polymerase itself or a viral gene product(s) which was expressed following the replication of HSV DNA. Analyses of test plasmids lacking SV40 or HSV DNA sequences showed that, under some conditions. HSV also induced low-level replication of test plasmids containing no known eucaryotic replication origins. Together, these results show that HSV induces a DNA replicative activity which amplifies foreign DNA. The relevance of these findings to the putative transforming potential of HSV is discussed.

  2. Herpes simplex virus induces the replication of foreign DNA.

    PubMed Central

    Danovich, R M; Frenkel, N


    Plasmids containing the simian virus 40 (SV40) DNA replication origin and the large T gene are replicated efficiently in Vero monkey cells but not in rabbit skin cells. Efficient replication of the plasmids was observed in rabbit skin cells infected with herpes simplex virus type 1 (HSV-1) and HSV-2. The HSV-induced replication required the large T antigen and the SV40 replication origin. However, it produced concatemeric molecules resembling replicative intermediates of HSV DNA and was sensitive to phosphonoacetate at concentrations known to inhibit the HSV DNA polymerase. Therefore, it involved the HSV DNA polymerase itself or a viral gene product(s) which was expressed following the replication of HSV DNA. Analyses of test plasmids lacking SV40 or HSV DNA sequences showed that, under some conditions, HSV also induced low-level replication of test plasmids containing no known eucaryotic replication origins. Together, these results show that HSV induces a DNA replicative activity which amplifies foreign DNA. The relevance of these findings to the putative transforming potential of HSV is discussed. Images PMID:2850486

  3. Comparative studies of UV-induced DNA cleavage by structural isomers of an iodinated DNA ligand

    SciTech Connect

    Martin, R.F.; Green, A.; Denison, L.; Pardee, M.; Kelly, D.P.; Roberts, M.; Rose, M.; Reum, M.


    The purpose was to evaluate the importance of the position of the halogen atom in iodinated DNA-binding bibenzimidazoles, with respect to sensitization of UV-A-induced DNA breakage. Three analogues of iodoHoechst 33258, denoted ortho-, meta- and paraiodoHoechst, according to the site of iodine substitution, were synthesized. Plasmid DNA (pBR322) was used to assay UV-A-induced DNA single-strand breaks (ssbs). The location of the sites of strand breakage was determined by DNA sequencing gel analysis, using a [sup 32]P-endlabelled oligoDNA with a single binding site for the ligands. A clear trend in decreasing activity of sensitization of UV-induced DNA ssbs was established: Ortho- > meta-, para- > iodoHoechst 33258. The sequencing gel studies showed that orthoiodoHoechst was distinct from the other three compounds, with respect to the sites of DNA strand breakage and the chemistry of the cleavage reaction. The position of iodine substitution in iodinated bibenzimidazoles determines the location of the carbon-centered radical on the ligand in the minor groove of DNA. DNA strand cleavage is mediated by abstraction of a nearby deoxyribosyl H-atom. Hence, the position of the radical species determines: which deoxyribosyl group is attacked (i.e., site of cleavage relative to the ligand binding site); which H-atom is abstracted, more specifically which of the five deoxyribosyl carbons is involved (i.e., the chemistry of the cleavage reaction), and the stereochemistry of the transition state for the H-atom abstraction (and hence the efficiency or extent of strand breakage). The ortho-compound represents the best example to date of iodinated DNA ligands designed as potential radiation sensitizers, as an extension of the well-established sensitization by halogenated DNA precursors. 30 refs., 3 figs.

  4. Ozone-induced alterations in arachidonic acid metabolism in cultured lung cell types

    SciTech Connect

    Madden, M.C.


    One of the most sensitive cells to ozone (O/sub 3/) damage is the pulmonary endothelial cell which may mediate the response of the lung to injury by productions of the autacoid prostacyclin (PGl/sub 2/), a metabolite of arachidonic acid. Exposure of endothelial cell cultures to ozone produced a concentration dependent decreases in the synthesis of PGl/sub 2/. Release of /sup 3/H-arachidonic acid from endothelial cells was increased after two hours of 0.3 and 1.0 ppm O/sub 3/ exposure while incubation of cells with 20 and arachidonate (4 min) after exposure resulted in a decreased PGl/sub 2/ synthesis. Cells exposed to 1.0 ppm O/sub 3/ did not have a decreased PGl/sub 2/ production when incubated with 5 PGH/sub 2/ immediately after exposure. These results are consistent with an O/sub 3/-induced inhibition of cyclooxygenase activity. O/sub 3/ exposure (1.0 ppm) produced a rapid decrease in endothelial PGl/sub 2/ synthesis. The data suggest that cyclooxygenase was not inactivated by increased autooxidation due to metabolism of increased free arachidonate. PGl/sub 2/ synthesis returned to control amounts within 12 hours after ozone exposure similar to the recovery time of irreversibly inhibited cyclooxygenase suggesting that recovery was due to de novo synthesis of enzyme. Lipid peroxides and/or hydrogen peroxide (H/sub 2/O/sub 2/) may have caused the inhibition of cyclooxygenase. Incubation of cells with catalase (5 U/ml) protected against the O/sub 3/-induced depression in PGl/sub 2/ synthesis. Exogenously added H/sub 2/O/sub 2/ (greater than or equal to 75 caused a stimulation of basal PGl/sub 2/ production but depressed arachidonate-stimulated synthesis. O/sub 3/ exposure (2 hr, 1.0 ppm) produced altered metabolism of arachidonate in other important lung cell types, e.g., a decreased PGl/sub 2/ synthesis in smooth muscle cultures. Exposure of lung macrophages to O/sub 3/ caused an increase in almost all arachidonate metabolites produced.

  5. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage.


    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa


    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  6. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa


    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  7. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  8. A Green Solvent Induced DNA Package

    NASA Astrophysics Data System (ADS)

    Satpathi, Sagar; Sengupta, Abhigyan; Hridya, V. M.; Gavvala, Krishna; Koninti, Raj Kumar; Roy, Bibhisan; Hazra, Partha


    Mechanistic details of DNA compaction is essential blue print for gene regulation in living organisms. Many in vitro studies have been implemented using several compaction agents. However, these compacting agents may have some kinds of cytotoxic effects to the cells. To minimize this aspect, several research works had been performed, but people have never focused green solvent, i.e. room temperature ionic liquid as DNA compaction agent. To the best of our knowledge, this is the first ever report where we have shown that guanidinium tris(pentafluoroethyl)trifluorophosphate (Gua-IL) acts as a DNA compacting agent. The compaction ability of Gua-IL has been verified by different spectroscopic techniques, like steady state emission, circular dichroism, dynamic light scattering and UV melting. Notably, we have extensively probed this compaction by Gua-IL through field emission scanning electron microscopy (FE-SEM) and fluorescence microscopy images. We also have discussed the plausible compaction mechanism process of DNA by Gua-IL. Our results suggest that Gua-IL forms a micellar kind of self aggregation above a certain concentration (>=1 mM), which instigates this compaction process. This study divulges the specific details of DNA compaction mechanism by a new class of compaction agent, which is highly biodegradable and eco friendly in nature.

  9. Minimal influence of G-protein null mutations on ozone-induced changes in gene expression, foliar injury, gas-exchange and peroxidase activity in Arabidopsis thaliana L

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ozone uptake by plants leads to an increase in reactive oxygen species (ROS) in the intercellular space of leaves and induces signalling processes reported to involve the membrane-bound heterotrimeric G-protein complex. Therefore, potential G-protein-mediated response mechanisms to ozone were compar...

  10. DNA Photonics — Probing Light-Induced Dynamics in DNA on the Femtosecond Timescale

    NASA Astrophysics Data System (ADS)

    Wang, Qiang; Fiebig, Torsten

    In Chap. 10, Wang and Fiebig discuss about a new field, DNA photonics that is important to understand the role of DNA as a functional building block in molecular nanoscale devices, and is also expected to shed light on the complex interactions between structural and electronic properties of DNA. The latter is important for biomedical applications such as DNA-targeted drug design. In this chapter, the authors present experimental data from several different classes of functionalized DNA systems and illustrate the relationship between the structural dynamics and charge injection/migration using state-of-the art femtosecond broadband spectroscopy. They also highlight the importance of the initial electronic excitation for modelling electron transfer rates and point out that ultrafast electronic energy migration, dissipation, and (de)localization must be included into the theoretical description of light-induced dynamics in DNA.

  11. Alleviation of Antioxidant Defense System by Ozonized Olive Oil in DNBS-Induced Colitis in Rats

    PubMed Central

    Bayoumi, Fatehia A.; Ahmed, Naglaa G.


    The aim of the study was to evaluate the potential protective effect of ozonized olive oil (OZO) in 2,4-dinitrobenzene sulphuric acid (DNBS) induced colitis in rats and to elucidate the role of some antioxidant defense system (superoxide dismutase “SOD,” glutathione peroxidase “GSH-Px,” and catalase “CAT”) in these effects. The physicochemical parameters including viscosity, peroxide, and acid values of olive oil and OZO were evaluated. The animals were divided into several groups and the colitis was induced in the rats by intracolonic instillation of DNBS at dose of 15 mg/rat. Olive oil (OO) at dose of 6 mg/kg and OZO at doses of 3 and 6 mg/kg was administered orally for 7 days, starting the day before induction of colitis. Our results showed that macroscopic and microscopic damage scores were significantly reduced in a dose response manner in rats pretreated with OZO only. In contrast, CAT, GSH-Px, and SOD activities were significantly increased in the distal colon of inflamed animals pretreated with OZO with respect to control group dose dependently. Results demonstrate that OZO pretreatment exerts protective effects in DNBS induced colitis in rats and provide evidence that the protective effects of OZO are mediated by stimulation of some antioxidant enzymes. PMID:25276059

  12. Alleviation of antioxidant defense system by ozonized olive oil in DNBS-induced colitis in rats.


    Abu-Gharbieh, Eman; Bayoumi, Fatehia A; Ahmed, Naglaa G


    The aim of the study was to evaluate the potential protective effect of ozonized olive oil (OZO) in 2,4-dinitrobenzene sulphuric acid (DNBS) induced colitis in rats and to elucidate the role of some antioxidant defense system (superoxide dismutase "SOD," glutathione peroxidase "GSH-Px," and catalase "CAT") in these effects. The physicochemical parameters including viscosity, peroxide, and acid values of olive oil and OZO were evaluated. The animals were divided into several groups and the colitis was induced in the rats by intracolonic instillation of DNBS at dose of 15 mg/rat. Olive oil (OO) at dose of 6 mg/kg and OZO at doses of 3 and 6 mg/kg was administered orally for 7 days, starting the day before induction of colitis. Our results showed that macroscopic and microscopic damage scores were significantly reduced in a dose response manner in rats pretreated with OZO only. In contrast, CAT, GSH-Px, and SOD activities were significantly increased in the distal colon of inflamed animals pretreated with OZO with respect to control group dose dependently. Results demonstrate that OZO pretreatment exerts protective effects in DNBS induced colitis in rats and provide evidence that the protective effects of OZO are mediated by stimulation of some antioxidant enzymes. PMID:25276059

  13. Large climate-induced changes in ultraviolet index and stratosphere-to-troposphere ozone flux

    NASA Astrophysics Data System (ADS)

    Hegglin, Michaela I.; Shepherd, Theodore G.


    Now that stratospheric ozone depletion has been controlled by the Montreal Protocol, interest has turned to the effects of climate change on the ozone layer. Climate models predict an accelerated stratospheric circulation, leading to changes in the spatial distribution of stratospheric ozone and an increased stratosphere-to-troposphere ozone flux. Here we use an atmospheric chemistry climate model to isolate the effects of climate change from those of ozone depletion and recovery on stratosphere-to-troposphere ozone flux and the clear-sky ultraviolet radiation index-a measure of potential human exposure to ultraviolet radiation. We show that under the Intergovernmental Panel on Climate Change moderate emissions scenario, global stratosphere-to-troposphere ozone flux increases by 23% between 1965 and 2095 as a result of climate change. During this time, the clear-sky ultraviolet radiation index decreases by 9% in northern high latitudes-a much larger effect than that of stratospheric ozone recovery-and increases by 4% in the tropics, and by up to 20% in southern high latitudes in late spring and early summer. The latter increase in the ultraviolet index is equivalent to nearly half of that generated by the Antarctic `ozone hole' that was created by anthropogenic halogens. Our results suggest that climate change will alter the tropospheric ozone budget and the ultraviolet index, which would have consequences for tropospheric radiative forcing, air quality and human and ecosystem health.

  14. Ozone treatment of conditioned wastewater selects antibiotic resistance genes, opportunistic bacteria, and induce strong population shifts.


    Alexander, Johannes; Knopp, Gregor; Dötsch, Andreas; Wieland, Arne; Schwartz, Thomas


    An ozone treatment system was investigated to analyze its impact on clinically relevant antibiotic resistant bacteria (ARB) and antibiotic resistant genes (ARGs). A concentration of 0.9±0.1g ozone per 1g DOC was used to treat conventional clarified wastewater. PCR, qPCR analyses, Illumina 16S Amplicon Sequencing, and PCR-DGGE revealed diverse patterns of resistances and susceptibilities of opportunistic bacteria and accumulations of some ARGs after ozone treatment. Molecular marker genes for enterococci indicated a high susceptibility to ozone. Although they were reduced by almost 99%, they were still present in the bacterial population after ozone treatment. In contrast to this, Pseudomonas aeruginosa displayed only minor changes in abundance after ozone treatment. This indicated different mechanisms of microorganisms to cope with the bactericidal effects of ozone. The investigated ARGs demonstrated an even more diverse pattern. After ozone treatment, the erythromycin resistance gene (ermB) was reduced by 2 orders of magnitude, but simultaneously, the abundance of two other clinically relevant ARGs increased within the surviving wastewater population (vanA, blaVIM). PCR-DGGE analysis and 16S-Amplicon-Sequencing confirmed a selection-like process in combination with a substantial diversity loss within the vital wastewater population after ozone treatment. Especially the PCR-DGGE results demonstrated the survival of GC-rich bacteria after ozone treatment. PMID:27058129

  15. Oxidative DNA adducts and DNA-protein cross-links are the major DNA lesions induced by arsenite.


    Bau, Da-Tian; Wang, Tsu-Shing; Chung, Chiao-Hui; Wang, Alexander S S; Wang, Alexander S S; Jan, Kun-Yan


    Arsenic is recognized to be a nonmutagenic carcinogen because it induces DNA damage only at very high concentrations. However, many more DNA strand breaks could be detected by digesting the DNA of arsenite-treated cells with endonuclease III, formamidopyrimidine-DNA glycosylase, and proteinase K. By doing so, arsenite could be shown to induce DNA damage in human cells within a pathologically meaningful concentration range. Oxidized guanine products were detected in all arsenite-treated human cells examined. DNA-protein cross-links were also detected in arsenite-treated NB4 and HL60 cells. In human umbilical vein endothelial cells, the induction of oxidized guanine products by arsenite was sensitive to inhibitors of nitric oxide (NO) synthase but not to oxidant modulators, whereas the opposite result was obtained in vascular smooth muscle cells. On the other hand, the arsenite-induced oxidized guanine products and DNA-protein cross-links in NB4 and HL60 cells were sensitive to modulators of calcium, NO synthase, oxidant, and myeloperoxidase. Therefore, although oxidized guanine products were detected in all the human cells treated with arsenite, the pathways could be different in different cell types. Because the sensitivity and the mechanism of arsenic intoxication are cell specific, it is important that target tissues and target cells are used for investigations. It is also important that pathologically or pharmacologically meaningful concentrations of arsenic are used. This is because in most cases we are dealing with the chronic effect rather than acute toxicity. PMID:12426126

  16. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.


    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  17. DNA damage induced by the direct effect of radiation

    NASA Astrophysics Data System (ADS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.


    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  18. Light induced heterogeneous ozone processing on the pesticides adsorbed on silica particles

    NASA Astrophysics Data System (ADS)

    Socorro, J.; Désert, M.; Quivet, E.; Gligorovski, S.; Wortham, H.


    In France, in 2010, the sales of pesticides reached 1.8 billion euros for 61 900 tons of active ingredients, positioning France as a first European consumer of pesticides, as reported by the European Crop Protection Association. About 19 million hectares of crops are sprayed annually with pesticides, i.e., 35% of the total surface area of France. This corresponds to an average pesticide dose of 3.2 kg ha-1. The consumption of herbicide and fungicide is favoured in comparison to the use of insecticides in France and the other European countries, as well. The partitioning of pesticides between the gas and particulate phases influences the atmospheric fate of these compounds such as their photo-chemical degradation. There is much uncertainty concerning the behavior of the pesticides in the atmosphere. Especially, there is a gap of knowledge concerning the degradation of the pesticides induced by heterogeneous reactions in absence and especially in presence of solar light. Considering that most of the pesticides currently used are semi-volatile, it is of crucial importance to investigate the heterogeneous reactivity of particulate pesticides with light and with atmospheric oxidants such as ozone and OH radical. The aim of the present work is to evaluate the light induced heterogeneous ozonation of suspended pesticide particles. 8 pesticides (cyprodinil, deltamethrin, difenoconazole, fipronil, oxadiazon, pendimethalin, permethrin and tetraconazole) were chosen for their physico-chemical properties and their concentration levels in the PACA (Région Provence-Alpes-Côte d'Azur) region, France. Silica particles with well-known properties were chosen as model particles of atmospheric relevance. Kinetic rate constants were determined to allow estimate the atmospheric lifetimes relating to ozone. The rate constants were determined as follows: k = (6.6 × 0.2) 10-19, (7.2 × 0.3) 10-19, (5.1 × 0.5) 10-19, (3.9 × 0.3) 10-19 [cm3 molecules-1 s-1] for Cyprodinil

  19. Harnessing DNA-induced immune responses for improving cancer vaccines

    PubMed Central

    Herrada, Andrés A.; Rojas-Colonelli, Nicole; González-Figueroa, Paula; Roco, Jonathan; Oyarce, César; Ligtenberg, Maarten A.; Lladser, Alvaro


    DNA vaccines have emerged as an attractive strategy to promote protective cellular and humoral immunity against the encoded antigen. DNA vaccines are easy to generate, inexpensive to produce and purify at large-scale, highly stable and safe. In addition, plasmids used for DNA vaccines act as powerful “danger signals” by stimulating several DNA-sensing innate immune receptors that promote the induction of protective adaptive immunity. The induction of tumor-specific immune responses represents a major challenge for DNA vaccines because most of tumor-associated antigens are normal non-mutated self-antigens. As a consequence, induction of potentially self-reactive T cell responses against such poorly immunogenic antigens is controlled by mechanisms of central and peripheral tolerance as well as tumor-induced immunosuppression. Although several DNA vaccines against cancer have reached clinical testing, disappointing results have been observed. Therefore, the development of new adjuvants that strongly stimulate the induction of antitumor T cell immunity and counteract immune-suppressive regulation is an attractive approach to enhance the potency of DNA vaccines and overcome tumor-associated tolerance. Understanding the DNA-sensing signaling pathways of innate immunity that mediate the induction of T cell responses elicited by DNA vaccines represents a unique opportunity to develop novel adjuvants that enhance vaccine potency. The advance of DNA adjuvants needs to be complemented with the development of potent delivery systems, in order to step toward successful clinical application. Here, we briefly discuss recent evidence showing how to harness DNA-induced immune response to improve the potency of cancer vaccines and counteract tumor-associated tolerance. PMID:23111166

  20. Resistin deficiency in mice has no effect on pulmonary responses induced by acute ozone exposure.


    Razvi, Shehla S; Richards, Jeremy B; Malik, Farhan; Cromar, Kevin R; Price, Roger E; Bell, Cynthia S; Weng, Tingting; Atkins, Constance L; Spencer, Chantal Y; Cockerill, Katherine J; Alexander, Amy L; Blackburn, Michael R; Alcorn, Joseph L; Haque, Ikram U; Johnston, Richard A


    Acute exposure to ozone (O3), an air pollutant, causes pulmonary inflammation, airway epithelial desquamation, and airway hyperresponsiveness (AHR). Pro-inflammatory cytokines-including IL-6 and ligands of chemokine (C-X-C motif) receptor 2 [keratinocyte chemoattractant (KC) and macrophage inflammatory protein (MIP)-2], TNF receptor 1 and 2 (TNF), and type I IL-1 receptor (IL-1α and IL-1β)-promote these sequelae. Human resistin, a pleiotropic hormone and cytokine, induces expression of IL-1α, IL-1β, IL-6, IL-8 (the human ortholog of murine KC and MIP-2), and TNF. Functional differences exist between human and murine resistin; yet given the aforementioned observations, we hypothesized that murine resistin promotes O3-induced lung pathology by inducing expression of the same inflammatory cytokines as human resistin. Consequently, we examined indexes of O3-induced lung pathology in wild-type and resistin-deficient mice following acute exposure to either filtered room air or O3. In wild-type mice, O3 increased bronchoalveolar lavage fluid (BALF) resistin. Furthermore, O3 increased lung tissue or BALF IL-1α, IL-6, KC, TNF, macrophages, neutrophils, and epithelial cells in wild-type and resistin-deficient mice. With the exception of KC, which was significantly greater in resistin-deficient compared with wild-type mice, no genotype-related differences in the other indexes existed following O3 exposure. O3 caused AHR to acetyl-β-methylcholine chloride (methacholine) in wild-type and resistin-deficient mice. However, genotype-related differences in airway responsiveness to methacholine were nonexistent subsequent to O3 exposure. Taken together, these data demonstrate that murine resistin is increased in the lungs of wild-type mice following acute O3 exposure but does not promote O3-induced lung pathology. PMID:26386120

  1. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  2. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    PubMed Central

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna


    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex. PMID:27339811

  3. Photochromic switching of the DNA helicity induced by azobenzene derivatives.


    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna


    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex. PMID:27339811

  4. Genomic DNA transposition induced by human PGBD5

    PubMed Central

    Henssen, Anton G; Henaff, Elizabeth; Jiang, Eileen; Eisenberg, Amy R; Carson, Julianne R; Villasante, Camila M; Ray, Mondira; Still, Eric; Burns, Melissa; Gandara, Jorge; Feschotte, Cedric; Mason, Christopher E; Kentsis, Alex


    Transposons are mobile genetic elements that are found in nearly all organisms, including humans. Mobilization of DNA transposons by transposase enzymes can cause genomic rearrangements, but our knowledge of human genes derived from transposases is limited. In this study, we find that the protein encoded by human PGBD5, the most evolutionarily conserved transposable element-derived gene in vertebrates, can induce stereotypical cut-and-paste DNA transposition in human cells. Genomic integration activity of PGBD5 requires distinct aspartic acid residues in its transposase domain, and specific DNA sequences containing inverted terminal repeats with similarity to piggyBac transposons. DNA transposition catalyzed by PGBD5 in human cells occurs genome-wide, with precise transposon excision and preference for insertion at TTAA sites. The apparent conservation of DNA transposition activity by PGBD5 suggests that genomic remodeling contributes to its biological function. DOI: PMID:26406119

  5. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    NASA Astrophysics Data System (ADS)

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna


    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex.

  6. Torin2 Suppresses Ionizing Radiation-Induced DNA Damage Repair.


    Udayakumar, Durga; Pandita, Raj K; Horikoshi, Nobuo; Liu, Yan; Liu, Qingsong; Wong, Kwok-Kin; Hunt, Clayton R; Gray, Nathanael S; Minna, John D; Pandita, Tej K; Westover, Kenneth D


    Several classes of inhibitors of the mammalian target of rapamycin (mTOR) have been developed based on its central role in sensing growth factor and nutrient levels to regulate cellular metabolism. However, its ATP-binding site closely resembles other phosphatidylinositol 3-kinase-related kinase (PIKK) family members, resulting in reactivity with these targets that may also be therapeutically useful. The ATP-competitive mTOR inhibitor, Torin2, shows biochemical activity against the DNA repair-associated proteins ATM, ATR and DNA-PK, which raises the possibility that Torin2 and related compounds might radiosensitize cancerous tumors. In this study Torin2 was also found to enhance ionizing radiation-induced cell killing in conditions where ATM was dispensable, confirming the requirement for multiple PIKK targets. Moreover, Torin2 did not influence the initial appearance of γ-H2AX foci after irradiation but significantly delayed the disappearance of radiation-induced γ-H2AX foci, indicating a DNA repair defect. Torin2 increased the number of radiation-induced S-phase specific chromosome aberrations and reduced the frequency of radiation-induced CtIP and Rad51 foci formation, suggesting that Torin2 works by blocking homologous recombination (HR)-mediated DNA repair resulting in an S-phase specific DNA repair defect. Accordingly, Torin2 reduced HR-mediated repair of I-Sce1-induced DNA damage and contributed to replication fork stalling. We conclude that radiosensitization of tumor cells by Torin2 is associated with disrupting ATR- and ATM-dependent DNA damage responses. Our findings support the concept of developing combination cancer therapies that incorporate ionizing radiation therapy and Torin2 or compounds with similar properties. PMID:27135971

  7. Ultraviolet-B- and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana.

    PubMed Central

    Rao, M V; Paliyath, G; Ormrod, D P


    Earlier studies with Arabidopsis thaliana exposed to ultraviolet B (UV-B) and ozone (O3) have indicated the differential responses of superoxide dismutase and glutathione reductase. In this study, we have investigated whether A. thaliana genotype Landsberg erecta and its flavonoid-deficient mutant transparent testa (tt5) is capable of metabolizing UV-B- and O3-induced activated oxygen species by invoking similar antioxidant enzymes. UV-B exposure preferentially enhanced guaiacol-peroxidases, ascorbate peroxidase, and peroxidases specific to coniferyl alcohol and modified the substrate affinity of ascorbate peroxidase. O3 exposure enhanced superoxide dismutase, peroxidases, glutathione reductase, and ascorbate peroxidase to a similar degree and modified the substrate affinity of both glutathione reductase and ascorbate peroxidase. Both UV-B and O3 exposure enhanced similar Cu,Zn-superoxide dismutase isoforms. New isoforms of peroxidases and ascorbate peroxidase were synthesized in tt5 plants irradiated with UV-B. UV-B radiation, in contrast to O3, enhanced the activated oxygen species by increasing membrane-localized NADPH-oxidase activity and decreasing catalase activities. These results collectively suggest that (a) UV-B exposure preferentially induces peroxidase-related enzymes, whereas O3 exposure invokes the enzymes of superoxide dismutase/ascorbate-glutathione cycle, and (b) in contrast to O3, UV-B exposure generated activated oxygen species by increasing NADPH-oxidase activity. PMID:8587977

  8. Ultraviolet-B- and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana

    SciTech Connect

    Rao, M.V.; Paliyath, G.; Ormrod, D.P.


    Earlier studies with Arabidopsis thaliana exposed to ultraviolet B (UV-B) and ozone (O{sub 3}) have indicated the differential responses of superoxide dismutase and glutathione reductase. In this study, we have investigated whether A. thaliana genotype Landsberg erecta and its flavonoid-deficient mutant transparent testa (tt5) is capable of metabolizing UV-B- and O{sub 3}-induced activated oxygen species by invoking similar antioxidant enzymes. UV-B exposure preferentially enhanced guaiacol-peroxidases, ascorbate peroxidase, and peroxidases specific to coniferyl alcohol and modified the substrate affinity of ascorbate peroxidase. O{sub 3} exposure enhanced superoxide dismutase, peroxidases, glutathione reductase, and ascorbate peroxidase to a similar degree and modified the substrate affinity of both glutathione reductase and ascorbate peroxidase. Both UV-B and O{sub 3} exposure enhanced similar Cu,Zn-superoxide dismutase isoforms. New isoforms of peroxidases and ascorbate peroxidase were synthesized in tt5 plants irradiated with UV-B. UV-B radiation, in contrast to O{sub 3}, enhanced the activation oxygen species by increasing membrane-localized NADPH-oxidase activity and decreasing catalase activities. These results collectively suggest that (a) UV-B exposure preferentially induces peroxidase-related enzymes, whereas O{sub 3} exposure invokes the enzymes of superoxide dismutase/ascorbate-glutathione cycle, and (b) in contrast to O{sub 3}, UV-B exposure generated activated oxygen species by increasing NADPH-oxidase activity. 10 figs., 4 tabs.

  9. Increased transforming growth factor beta 1 expression mediates ozone-induced airway fibrosis in mice

    PubMed Central

    Katre, Ashwini; Ballinger, Carol; Akhter, Hasina; Fanucchi, Michelle; Kim, Dae-Kee; Postlethwait, Edward; Liu, Rui-Ming


    Ozone (O3), a commonly encountered environmental pollutant, has been shown to induce pulmonary fibrosis in different animal models; the underlying mechanism, however, remains elusive. To investigate the molecular mechanism underlying O3-induced pulmonary fibrosis, 6- to 8-week-old C57BL/6 male mice were exposed to a cyclic O3 exposure protocol consisting of 2 days of filtered air and 5 days of O3 exposure (0.5 ppm, 8 h/day) for 5 and 10 cycles with or without intraperitoneal injection of IN-1233, a specific inhibitor of the type 1 receptor of transforming growth factor beta (TGF-β), the most potent profibrogenic cytokine. The results showed that O3 exposure for 5 or 10 cycles increased the TGF-β protein level in the epithelial lining fluid (ELF), associated with an increase in the expression of plasminogen activator inhibitor 1 (PAI-1), a TGF-β-responsive gene that plays a critical role in the development of fibrosis under various pathological conditions. Cyclic O3 exposure also increased the deposition of collagens and alpha smooth muscle actin (α-SMA) in airway walls. However, these fibrotic changes were not overt until after 10 cycles of O3 exposure. Importantly, blockage of the TGF-β signaling pathway with IN-1233 suppressed O3-induced Smad2/3 phosphorylation, PAI-1 expression, as well as collagens and α-SMA deposition in the lung. Our data demonstrate for the first time that O3 exposure increases TGF-β expression and activates TGF-β signaling pathways, which mediates O3-induced lung fibrotic responses in vivo. PMID:21689010

  10. Inhaled ozone (O{sub 3})-induces changes in serum metabolomic and liver transcriptomic profiles in rats

    SciTech Connect

    Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.; Ward, William O.; Vallanat, Beena D.; Andrews, Debora L.; Schladweiler, Mette C.; Snow, Samantha J.; Bass, Virginia L.; Richards, Judy E.; Ghio, Andrew J.; Cascio, Wayne E.; Ledbetter, Allen D.; Kodavanti, Urmila P.


    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O{sub 3}) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O{sub 3} exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O{sub 3} at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0 ppm O{sub 3}, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O{sub 3} increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O{sub 3} increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O{sub 3}. In conclusion, short-term O{sub 3} exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. - Highlights: • Ozone, an ubiquitous air pollutant induces acute systemic metabolic derangement. • Serum metabolomic approach provides novel insights in ozone-induced changes. • Ozone exposure induces leptinemia

  11. Modulation of irinotecan-induced genomic DNA damage by theanine.


    Attia, Sabry


    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity. PMID:22414655

  12. Cisplatin induces loop structures and condensation of single DNA molecules

    PubMed Central

    Hou, Xi-Miao; Zhang, Xing-Hua; Wei, Kong-Ji; Ji, Chao; Dou, Shuo-Xing; Wang, Wei-Chi; Li, Ming; Wang, Peng-Ye


    Structural properties of single λ DNA treated with anti-cancer drug cisplatin were studied with magnetic tweezers and AFM. Under the effect of low-concentration cisplatin, the DNA became more flexible, with the persistence length decreased significantly from ∼52 to 15 nm. At a high drug concentration, a DNA condensation phenomenon was observed. Based on experimental results from both single-molecule and AFM studies, we propose a model to explain this kind of DNA condensation by cisplatin: first, di-adducts induce local distortions of DNA. Next, micro-loops of ∼20 nm appear through distant crosslinks. Then, large aggregates are formed through further crosslinks. Finally, DNA is condensed into a compact globule. Experiments with Pt(dach)Cl2 indicate that oxaliplatin may modify the DNA structures in the same way as cisplatin. The observed loop structure formation of DNA may be an important feature of the effect of platinum anti-cancer drugs that are analogous to cisplatin in structure. PMID:19129234


    EPA Science Inventory

    Although airway epithelial cells appear damaged following exposure of humans and animals to ozone, the contribution of these cells to inflammation observed after ozone exposure is unclear. ince human airway cells are infrequently available for in vitro studies, we have investigat...


    EPA Science Inventory

    Short duration exposure to ozone (<8 hr) is known to result in lung function decrements and respiratory symptoms in humans. The magnitudes of these responses are functions of ozone concentration (C), activity level measured by minute ventilation (Ve), duration of exposure (T), a...

  15. No minimum threshold for ozone-induced changes in soybean canopy fluxes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tropospheric ozone concentrations [O3] are increasing at rates that exceed any other pollutant. This highly reactive gas drives reductions in plant productivity and canopy water use while also increasing canopy temperature and sensible heat flux. It is not clear whether a minimum threshold of ozone ...

  16. Mitochondrial DNA Released by Trauma Induces Neutrophil Extracellular Traps

    PubMed Central

    Itagaki, Kiyoshi; Kaczmarek, Elzbieta; Lee, Yen Ting; Tang, I. Tien; Isal, Burak; Adibnia, Yashar; Sandler, Nicola; Grimm, Melissa J.; Segal, Brahm H.; Otterbein, Leo E.; Hauser, Carl J.


    Neutrophil extracellular traps (NETs) are critical for anti-bacterial activity of the innate immune system. We have previously shown that mitochondrial damage-associated molecular patterns (mtDAMPs), including mitochondrial DNA (mtDNA), are released into the circulation after injury. We therefore questioned whether mtDNA is involved in trauma-induced NET formation. Treatment of human polymorphoneutrophils (PMN) with mtDNA induced robust NET formation, though in contrast to phorbol myristate acetate (PMA) stimulation, no NADPH-oxidase involvement was required. Moreover, formation of mtDNA-induced NETs was completely blocked by TLR9 antagonist, ODN-TTAGGG. Knowing that infective outcomes of trauma in elderly people are more severe than in young people, we measured plasma mtDNA and NET formation in elderly and young trauma patients and control subjects. MtDNA levels were significantly higher in the plasma of elderly trauma patients than young patients, despite lower injury severity scores in the elderly group. NETs were not visible in circulating PMN isolated from either young or old control subjects. NETs were however, detected in PMN isolated from young trauma patients and to a lesser extent from elderly patients. Stimulation by PMA induced widespread NET formation in PMN from both young volunteers and young trauma patients. NET response to PMA was much less pronounced in both elderly volunteers’ PMN and in trauma patients’ PMN. We conclude that mtDNA is a potent inducer of NETs that activates PMN via TLR9 without NADPH-oxidase involvement. We suggest that decreased NET formation in the elderly regardless of higher mtDNA levels in their plasma may result from decreased levels of TLR9 and/or other molecules, such as neutrophil elastase and myeloperoxidase that are involved in NET generation. Further study of the links between circulating mtDNA and NET formation may elucidate the mechanisms of trauma-related organ failure as well as the greater susceptibility to

  17. DNA interference: DNA-induced gene silencing in the appendicularian Oikopleura dioica

    PubMed Central

    Omotezako, Tatsuya; Onuma, Takeshi A.; Nishida, Hiroki


    RNA interference is widely employed as a gene-silencing system in eukaryotes for host defence against invading nucleic acids. In response to invading double-stranded RNA (dsRNA), mRNA is degraded in sequence-specific manner. So far, however, DNA interference (DNAi) has been reported only in plants, ciliates and archaea, and has not been explored in Metazoa. Here, we demonstrate that linear double-stranded DNA promotes both sequence-specific transcription blocking and mRNA degradation in developing embryos of the appendicularian Oikopleura dioica. Introduced polymerase chain reaction (PCR) products or linearized plasmids encoding Brachyury induced tail malformation and mRNA degradation. This malformation was also promoted by DNA fragments of the putative 5′-flanking region and intron without the coding region. PCR products encoding Zic-like1 and acetylcholine esterase also induced loss of sensory organ and muscle acetylcholinesterase activity, respectively. Co-injection of mRNA encoding EGFP and mCherry, and PCR products encoding these fluorescent proteins, induced sequence-specific decrease in the green or red fluorescence, respectively. These results suggest that O. dioica possesses a defence system against exogenous DNA and RNA, and that DNA fragment-induced gene silencing would be mediated through transcription blocking as well as mRNA degradation. This is the first report of DNAi in Metazoa. PMID:25904672

  18. DNA interference: DNA-induced gene silencing in the appendicularian Oikopleura dioica.


    Omotezako, Tatsuya; Onuma, Takeshi A; Nishida, Hiroki


    RNA interference is widely employed as a gene-silencing system in eukaryotes for host defence against invading nucleic acids. In response to invading double-stranded RNA (dsRNA), mRNA is degraded in sequence-specific manner. So far, however, DNA interference (DNAi) has been reported only in plants, ciliates and archaea, and has not been explored in Metazoa. Here, we demonstrate that linear double-stranded DNA promotes both sequence-specific transcription blocking and mRNA degradation in developing embryos of the appendicularian Oikopleura dioica. Introduced polymerase chain reaction (PCR) products or linearized plasmids encoding Brachyury induced tail malformation and mRNA degradation. This malformation was also promoted by DNA fragments of the putative 5'-flanking region and intron without the coding region. PCR products encoding Zic-like1 and acetylcholine esterase also induced loss of sensory organ and muscle acetylcholinesterase activity, respectively. Co-injection of mRNA encoding EGFP and mCherry, and PCR products encoding these fluorescent proteins, induced sequence-specific decrease in the green or red fluorescence, respectively. These results suggest that O. dioica possesses a defence system against exogenous DNA and RNA, and that DNA fragment-induced gene silencing would be mediated through transcription blocking as well as mRNA degradation. This is the first report of DNAi in Metazoa. PMID:25904672

  19. Impact of diet on ozone-induced pulmonary and systemic effects in female Brown Norway (BN) rats

    EPA Science Inventory

    Impact of diet on ozone-induced pulmonary and systemic effects in female Brown Norway (BN) ratsV.L. Bass1, M.C. Schladweiler2, S. Snow5, C.J. Gordon4, K.A. Jarema4, P. Phillips4, A.D. Ledbetter2, D.B. Miller3, J.E. Richards2, U.P. Kodavanti2. 1. SPH, UNC, Chapel Hill2. EPHD, NHE...

  20. Persistent rhinitis and epithelial remodeling induced by cyclic ozone exposure in the nasal airways of infant monkeys

    PubMed Central

    Ballinger, Carol A.; Plopper, Charles G.; McDonald, Ruth J.; Bartolucci, Alfred A.; Postlethwait, Edward M.; Harkema, Jack R.


    Children chronically exposed to high levels of ozone (O3), the principal oxidant pollutant in photochemical smog, are more vulnerable to respiratory illness and infections. The specific factors underlying this differential susceptibility are unknown but may be related to air pollutant-induced nasal alterations during postnatal development that impair the normal physiological functions (e.g., filtration and mucociliary clearance) serving to protect the more distal airways from inhaled xenobiotics. In adult animal models, chronic ozone exposure is associated with adaptations leading to a decrease in airway injury. The purpose of our study was to determine whether cyclic ozone exposure induces persistent morphological and biochemical effects on the developing nasal airways of infant monkeys early in life. Infant (180-day-old) rhesus macaques were exposed to 5 consecutive days of O3 [0.5 parts per million (ppm), 8 h/day; “1-cycle”] or filtered air (FA) or 11 biweekly cycles of O3 (FA days 1–9; 0.5 ppm, 8 h/day on days 10–14; “11-cycle”). The left nasal passage was processed for light microscopy and morphometric analysis. Mucosal samples from the right nasal passage were processed for GSH, GSSG, ascorbate (AH2), and uric acid (UA) concentration. Eleven-cycle O3 induced persistent rhinitis, squamous metaplasia, and epithelial hyperplasia in the anterior nasal airways of infant monkeys, resulting in a 39% increase in the numeric density of epithelial cells. Eleven-cycle O3 also induced a 65% increase in GSH concentrations at this site. The persistence of epithelial hyperplasia was positively correlated with changes in GSH. These results indicate that early life ozone exposure causes persistent nasal epithelial alterations in infant monkeys and provide a potential mechanism for the increased susceptibility to respiratory illness exhibited by children in polluted environments. PMID:21131400

  1. Persistent rhinitis and epithelial remodeling induced by cyclic ozone exposure in the nasal airways of infant monkeys.


    Carey, Stephan A; Ballinger, Carol A; Plopper, Charles G; McDonald, Ruth J; Bartolucci, Alfred A; Postlethwait, Edward M; Harkema, Jack R


    Children chronically exposed to high levels of ozone (O(3)), the principal oxidant pollutant in photochemical smog, are more vulnerable to respiratory illness and infections. The specific factors underlying this differential susceptibility are unknown but may be related to air pollutant-induced nasal alterations during postnatal development that impair the normal physiological functions (e.g., filtration and mucociliary clearance) serving to protect the more distal airways from inhaled xenobiotics. In adult animal models, chronic ozone exposure is associated with adaptations leading to a decrease in airway injury. The purpose of our study was to determine whether cyclic ozone exposure induces persistent morphological and biochemical effects on the developing nasal airways of infant monkeys early in life. Infant (180-day-old) rhesus macaques were exposed to 5 consecutive days of O(3) [0.5 parts per million (ppm), 8 h/day; "1-cycle"] or filtered air (FA) or 11 biweekly cycles of O(3) (FA days 1-9; 0.5 ppm, 8 h/day on days 10-14; "11-cycle"). The left nasal passage was processed for light microscopy and morphometric analysis. Mucosal samples from the right nasal passage were processed for GSH, GSSG, ascorbate (AH(2)), and uric acid (UA) concentration. Eleven-cycle O(3) induced persistent rhinitis, squamous metaplasia, and epithelial hyperplasia in the anterior nasal airways of infant monkeys, resulting in a 39% increase in the numeric density of epithelial cells. Eleven-cycle O(3) also induced a 65% increase in GSH concentrations at this site. The persistence of epithelial hyperplasia was positively correlated with changes in GSH. These results indicate that early life ozone exposure causes persistent nasal epithelial alterations in infant monkeys and provide a potential mechanism for the increased susceptibility to respiratory illness exhibited by children in polluted environments. PMID:21131400

  2. Elevation of susceptibility to ozone-induced acute tracheobronchial injury in transgenic mice deficient in Clara cell secretory protein

    SciTech Connect

    Plopper, C.G. . E-mail:; Mango, G.W.; Hatch, G.E.; Wong, V.J.; Toskala, E.; Reynolds, S.D.; Tarkington, B.K.; Stripp, B.R.


    Increases in Clara cell abundance or cellular expression of Clara cell secretory protein (CCSP) may cause increased tolerance of the lung to acute oxidant injury by repeated exposure to ozone (O{sub 3}). This study defines how disruption of the gene for CCSP synthesis affects the susceptibility of tracheobronchial epithelium to acute oxidant injury. Mice homozygous for a null allele of the CCSP gene (CCSP-/-) and wild type (CCSP+/+) littermates were exposed to ozone (0.2 ppm, 8 h; 1 ppm, 8 h) or filtered air. Injury was evaluated by light and scanning electron microscopy, and the abundance of necrotic, ciliated, and nonciliated cells was estimated by morphometry. Proximal and midlevel intrapulmonary airways and terminal bronchioles were evaluated. There was no difference in airway epithelial composition between CCSP+/+ and CCSP-/- mice exposed to filtered air, and exposure to 0.2 ppm ozone caused little injury to the epithelium of both CCSP+/+ and CCSP-/- mice. After exposure to 1.0 ppm ozone, CCSP-/- mice suffered from a greater degree of epithelial injury throughout the airways compared to CCSP+/+ mice. CCSP-/- mice had both ciliated and nonciliated cell injury. Furthermore, lack of CCSP was associated with a shift in airway injury to include proximal airway generations. Therefore, we conclude that CCSP modulates the susceptibility of the epithelium to oxidant-induced injury. Whether this is due to the presence of CCSP on the acellular lining layer surface and/or its intracellular distribution in the secretory cell population needs to be defined.

  3. Acute ozone-induced change in airway permeability: role of infiltrating leukocytes

    SciTech Connect

    Kleeberger, S.R.; Hudak, B.B. )


    The role of infiltrating polymorphonuclear leukocytes (PMNs) in acute lung injury and inflammation is still controversial. In inbred mice, acute ozone (O3) exposure induces airway inflammation that is characterized by a maximal influx of lavageable PMNs 6 h after exposure and a maximal increase in lung permeability 24 h after O3. We tested the hypothesis that O3-induced change in airway epithelial permeability of O3-susceptible C57BL/6J mice is due to infiltrating PMNs. Male mice (6-8 wk) were treated with a nonsteroidal anti-inflammatory drug (indomethacin), a chemotactic inhibitor (colchicine), or an immunosuppressant (cyclophosphamide) to deplete or inhibit PMNs from infiltrating the airways. After drug or vehicle treatment, mice were exposed for 3 h to 2 ppm O3 or filtered air, and pulmonary inflammation was assessed by inflammatory cell counts and total protein content (a marker of airway permeability) in bronchoalveolar lavage (BAL) fluid. Filtered air exposure did not affect the parameters of pulmonary inflammation at any time after exposure. Compared with vehicle controls, each of the drug treatments resulted in significant reduction of PMN influx 6 and 24 h after O3. However, total BAL protein content was not attenuated significantly by the three treatments at either 6 or 24 h postexposure. Results of these experiments suggest that the influx of PMNs and the change in total BAL protein are not mutually dependent events in this model and suggest that infiltrating PMNs do not play a major role in acute O3-induced changes in permeability of the murine lung.

  4. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope


    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  5. Dissecting protein-induced DNA looping dynamics in real time

    PubMed Central

    Laurens, Niels; Bellamy, Stuart R. W.; Harms, August F.; Kovacheva, Yana S.; Halford, Stephen E.; Wuite, Gijs J. L.


    Many proteins that interact with DNA perform or enhance their specific functions by binding simultaneously to multiple target sites, thereby inducing a loop in the DNA. The dynamics and energies involved in this loop formation influence the reaction mechanism. Tethered particle motion has proven a powerful technique to study in real time protein-induced DNA looping dynamics while minimally perturbing the DNA–protein interactions. In addition, it permits many single-molecule experiments to be performed in parallel. Using as a model system the tetrameric Type II restriction enzyme SfiI, that binds two copies of its recognition site, we show here that we can determine the DNA–protein association and dissociation steps as well as the actual process of protein-induced loop capture and release on a single DNA molecule. The result of these experiments is a quantitative reaction scheme for DNA looping by SfiI that is rigorously compared to detailed biochemical studies of SfiI looping dynamics. We also present novel methods for data analysis and compare and discuss these with existing methods. The general applicability of the introduced techniques will further enhance tethered particle motion as a tool to follow DNA–protein dynamics in real time. PMID:19586932

  6. Dynamic evaluation of a regional air quality model: Assessing the emissions-induced weekly ozone cycle

    NASA Astrophysics Data System (ADS)

    Pierce, Thomas; Hogrefe, Christian; Trivikrama Rao, S.; Porter, P. Steven; Ku, Jia-Yeong


    Air quality models are used to predict changes in pollutant concentrations resulting from envisioned emission control policies. Recognizing the need to assess the credibility of air quality models in a policy-relevant context, we perform a dynamic evaluation of the Community Multiscale Air Quality (CMAQ) modeling system for the "weekend ozone effect" to determine if observed changes in ozone due to weekday-to-weekend (WDWE) reductions in precursor emissions can be accurately simulated. The weekend ozone effect offers a unique opportunity for dynamic evaluation, as it is a widely documented phenomenon that has persisted since the 1970s. In many urban areas of the Unites States, higher ozone has been observed on weekends than weekdays, despite dramatically reduced emissions of ozone precursors (nitrogen oxides [NO x] and volatile organic compounds [VOCs]) on weekends. More recent measurements, however, suggest shifts in the spatial extent or reductions in WDWE ozone differences. Using 18 years (1988-2005) of observed and modeled ozone and temperature data across the northeastern United States, we re-examine the long-term trends in the weekend effect and confounding factors that may be complicating the interpretation of this trend and explore whether CMAQ can replicate the temporal features of the observed weekend effect. The amplitudes of the weekly ozone cycle have decreased during the 18-year period in our study domain, but the year-to-year variability in weekend minus weekday (WEWD) ozone amplitudes is quite large. Inter-annual variability in meteorology appears to influence WEWD differences in ozone, as well as WEWD differences in VOC and NO x emissions. Because of the large inter-annual variability, modeling strategies using a single episode lasting a few days or a few episodes in a given year may not capture the WEWD signal that exists over longer time periods. The CMAQ model showed skill in predicting the absolute values of ozone concentrations during the

  7. Aerosol-induced chemical perturbations of stratospheric ozone: Three-dimensional simulations and analysis of mechanisms

    NASA Astrophysics Data System (ADS)

    Zhao, Xuepeng; Turco, Richard P.; Kao, C.-Y. Jim; Elliott, Scott


    An atmospheric general circulation model is coupled with a stratospheric photochemical model to simulate the chemical/dynamical perturbations associated with background and volcanically perturbed aerosols in the lower stratosphere. The present work focuses on short-term anomalies at middle and high latitudes in the northern hemisphere, where large ozone depletions have been observed in late winter and early spring, particularly following the eruption of Mount Pinatubo. Five fully coupled simulations are analyzed, corresponding to a control case with only gas phase chemistry, and cases including heterogeneous chemistry on background aerosols, on El Chichón-type, and on Pinatubo-type aerosols. It is found that heterogeneous reactions occurring on sulfate aerosols (background or postvolcanic) can strongly perturb the chemical partitioning in the lower stratosphere, leading to significant ozone depletion through enhanced chlorine, bromine, and odd-hydrogen catalytic cycles. In the Arctic lower stratosphere, the maximum zonal and March monthly mean local ozone reductions (with respect to the control case) can exceed 15% for the background aerosol case, 40% for the El Chichón case, and 50% for the Pinatubo case. The corresponding zonal mean total column ozone decreases are roughly 5% and 15% for the background and volcanic aerosol cases, respectively. In the most extreme case tested (post-Pinatubo), a large ozone depletion below 30 mbar is offset to some extent by an ozone increase above that level. The results of a sensitivity study (in which the aerosols are distributed closer to the tropics, as might occur early after an eruption at low latitude) lead to relatively small total ozone depletions at northern high latitudes, and small ozone increases in the tropical lower stratosphere. The reduced impact on total ozone at high latitudes is associated both with local ozone increases above 30 mbar and with poleward transport of enhanced ozone from the tropical lower

  8. Prophylactic Ozone Administration Reduces Intestinal Mucosa Injury Induced by Intestinal Ischemia-Reperfusion in the Rat

    PubMed Central

    Onal, Ozkan; Yetisir, Fahri; Sarer, A. Ebru Salman; Zeybek, N. Dilara; Onal, C. Oztug; Yurekli, Banu; Celik, H. Tugrul; Sirma, Ayse; Kılıc, Mehmet


    Objectives. Intestinal ischemia-reperfusion injury is associated with mucosal damage and has a high rate of mortality. Various beneficial effects of ozone have been shown. The aim of the present study was to show the effects of ozone in ischemia reperfusion model in intestine. Material and Method. Twenty eight Wistar rats were randomized into four groups with seven rats in each group. Control group was administered serum physiologic (SF) intraperitoneally (ip) for five days. Ozone group was administered 1 mg/kg ozone ip for five days. Ischemia Reperfusion (IR) group underwent superior mesenteric artery occlusion for one hour and then reperfusion for two hours. Ozone + IR group was administered 1 mg/kg ozone ip for five days and at sixth day IR model was applied. Rats were anesthetized with ketamine∖xyzlazine and their intracardiac blood was drawn completely and they were sacrificed. Intestinal tissue samples were examined under light microscope. Levels of superoxide dismutase (SOD), catalase (CAT), glutathioneperoxidase (GSH-Px), malondyaldehide (MDA), and protein carbonyl (PCO) were analyzed in tissue samples. Total oxidant status (TOS), and total antioxidant capacity (TAC) were analyzed in blood samples. Data were evaluated statistically by Kruskal Wallis test. Results. In the ozone administered group, degree of intestinal injury was not different from the control group. IR caused an increase in intestinal injury score. The intestinal epithelium maintained its integrity and decrease in intestinal injury score was detected in Ozone + IR group. SOD, GSH-Px, and CAT values were high in ozone group and low in IR. TOS parameter was highest in the IR group and the TAC parameter was highest in the ozone group and lowest in the IR group. Conclusion. In the present study, IR model caused an increase in intestinal injury.In the present study, ozone administration had an effect improving IR associated tissue injury. In the present study, ozone therapy prevented

  9. Indomethacin pretreatment reduces ozone-induced pulmonary function decrements in human subjects

    SciTech Connect

    Schelegle, E.S.; Adams, W.C.; Siefkin, A.D.


    We studied whether O/sub 3/-induced pulmonary function decrements could be inhibited by the prostaglandin synthetase inhibitor, indomethacin, in healthy human subjects. Fourteen college-age males completed six 1-h exposure protocols consisting of no drug, placebo, and indomethacin (Indocin SR 75 mg every 12 h for 5 days) pretreatments, with filtered air and O/sub 3/ (0.35 ppm) exposures within each pretreatment. Pretreatments were delivered weekly in random order in a double-blind fashion. Ozone and filtered air exposures, separated by 72 h, were delivered in random order in a single-blind fashion. Exposures consisted of 1-h exercise on a bicycle ergometer with work loads set to elicit a mean minute ventilation of 60 L/min. Statistical analysis revealed significant (p less than 0.05) across pretreatment effects for FVC and FEV1, with no drug versus indomethacin and placebo versus indomethacin comparisons being significant. These findings suggest that cyclooxygenase products of arachidonic acid, which are sensitive to indomethacin inhibition, play a prominent role in the development of pulmonary function decrements consequent to acute O/sub 3/ exposure.

  10. Role of tachykinins in ozone-induced acute lung injury in guinea pigs

    SciTech Connect

    Tepper, J.S.; Costa, D.L.; Fitzgerald, S.; Doerfler, D.L.; Bromberg, P.A. )


    To examine the hypothesis that the acute reversible changes caused by ozone (O3) exposure are mediated by tachykinin release, guinea pigs were depleted of tachykinins by use of repeated capsaicin (CAP) injections before O3 exposure in an attempt to prevent O3-induced functional changes. Unexpectedly, CAP pretreatment caused divergent results in the functional responses to O3. Ventilatory measurements obtained from CAP-pretreated O3-exposed (CAP-O3) animals were exacerbated rather than diminished compared with the effects of O3 alone. Similarly, lavage fluid protein accumulation was enhanced in the CAP-O3 group compared with the O3-exposed group. In better agreement with our initial hypothesis, the CAP-O3 group was less responsive than the O3-exposed animals to histamine aerosol challenge. Additionally, Evans blue dye accumulation, a hallmark of tachykinin release, was increased in O3-exposed animals and was partially blocked in the CAP-O3 group. These data suggest that tachykinin-containing sensory fibers are unlikely to mediate the acute effects of O3 exposure on tidal breathing and lavage fluid protein accumulation but may play a role in causing post-O3 airway hyperreactivity and protein extravasation into the trachea.

  11. DNA damage profiles induced by sunlight at different latitudes.


    Schuch, André Passaglia; Yagura, Teiti; Makita, Kazuo; Yamamoto, Hiromasa; Schuch, Nelson Jorge; Agnez-Lima, Lucymara Fassarella; MacMahon, Ricardo Monreal; Menck, Carlos Frederico Martins


    Despite growing knowledge on the biological effects of ultraviolet (UV) radiation on human health and ecosystems, it is still difficult to predict the negative impacts of the increasing incidence of solar UV radiation in a scenario of global warming and climate changes. Hence, the development and application of DNA-based biological sensors to monitor the solar UV radiation under different environmental conditions is of increasing importance. With a mind to rendering a molecular view-point of the genotoxic impact of sunlight, field experiments were undertaken with a DNA-dosimeter system in parallel with physical photometry of solar UVB/UVA radiation, at various latitudes in South America. On applying biochemical and immunological approaches based on specific DNA-repair enzymes and antibodies, for evaluating sunlight-induced DNA damage profiles, it became clear that the genotoxic potential of sunlight does indeed vary according to latitude. Notwithstanding, while induction of oxidized DNA bases is directly dependent on an increase in latitude, the generation of 6-4PPs is inversely so, whereby the latter can be regarded as a biomolecular marker of UVB incidence. This molecular DNA lesion-pattern largely reflects the relative incidence of UVA and UVB energy at any specific latitude. Hereby is demonstrated the applicability of this DNA-based biosensor for additional, continuous field experiments, as a means of registering variations in the genotoxic impact of solar UV radiation. PMID:22674547

  12. Ozone-induced changes in pulmonary function and bronchial responsiveness in asthmatics

    SciTech Connect

    Kreit, J.W.; Gross, K.B.; Moore, T.B.; Lorenzen, T.J.; D'Arcy, J.; Eschenbacher, W.L.


    To compare the responses of asthmatic and normal subjects to high effective doses of ozone, nine asthmatic and nine normal subjects underwent two randomly assigned 2-h exposures to filtered, purified air and 0.4 ppm ozone with alternating 15-min periods of rest and exercise on a cycle ergometer (minute ventilation = 30 l.min-1.m-2). Before and after each exposure, pulmonary function and bronchial responsiveness to methacholine were measured and symptoms were recorded. Ozone exposure was associated with a statistically significant decrease in forced vital capacity (FVC), forced expired volume in 1 s (FEV1), percent FEV1 (FEV1%), and forced expired flow at 25-75% FVC (FEF25-75) in both normal and asthmatic subjects. However, comparing the response of asthmatic and normal subjects to ozone revealed a significantly greater percent decrease in FEV1, FEV1%, and FEF25-75 in the asthmatic subjects. The effect of ozone on FVC and symptom scores did not differ between the two groups. In both normal and asthmatic subjects, exposure to ozone was accompanied by a significant increase in bronchial responsiveness. We conclude that exposure to a high effective ozone dose produces 1) increased bronchial responsiveness in both normal and asthmatic subjects, 2) greater airways obstruction in asthmatic than in normal subjects, and 3) similar symptoms and changes in lung volumes in the two groups.

  13. DNA melting and genotoxicity induced by silver nanoparticles and graphene.


    Ivask, Angela; Voelcker, Nicolas H; Seabrook, Shane A; Hor, Maryam; Kirby, Jason K; Fenech, Michael; Davis, Thomas P; Ke, Pu Chun


    We have revealed a connection between DNA-nanoparticle (NP) binding and in vitro DNA damage induced by citrate- and branched polyethylenimine-coated silver nanoparticles (c-AgNPs and b-AgNPs) as well as graphene oxide (GO) nanosheets. All three types of nanostructures triggered an early onset of DNA melting, where the extent of the melting point shift depends upon both the type and concentration of the NPs. Specifically, at a DNA/NP weight ratio of 1.1/1, the melting temperature of lambda DNA dropped from 94 °C down to 76 °C, 60 °C, and room temperature for GO, c-AgNPs and b-AgNPs, respectively. Consistently, dynamic light scattering revealed that the largest changes in DNA hydrodynamic size were also associated with the binding of b-AgNPs. Upon introduction to cells, b-AgNPs also exhibited the highest cytotoxicity, at the half-maximal inhibitory (IC50) concentrations of 3.2, 2.9, and 5.2 mg/L for B and T-lymphocyte cell lines and primary lymphocytes, compared to the values of 13.4, 12.2, and 12.5 mg/L for c-AgNPs and 331, 251, and 120 mg/L for GO nanosheets, respectively. At cytotoxic concentrations, all NPs elicited elevated genotoxicities via the increased number of micronuclei in the lymphocyte cells. However, b-AgNPs also induced micronuclei at subtoxic concentrations starting from 0.1 mg/L, likely due to their stronger cellular adhesion and internalization, as well as their subsequent interference with normal DNA synthesis or chromosome segregation during the cell cycle. This study facilitates our understanding of the effects of NP chemical composition, surface charge, and morphology on DNA stability and genotoxicity, with implications ranging from nanotoxicology to nanobiotechnology and nanomedicine. PMID:25781053

  14. Protective effects of medical ozone combined with traditional Chinese medicine against chemically-induced hepatic injury in dogs

    PubMed Central

    Li, Li-Jie; Yang, Yun-Gao; Zhang, Zhi-Ling; Nie, Sui-Feng; Li, Ze; Li, Feng; Hua, He-Yu; Hu, Yan-Jun; Zhang, Hong-Shuan; Guo, Ya-Bing


    AIM: To investigate the protective effect of medical ozone (O3) combined with Traditional Chinese Medicine (TCM) Yigan Fuzheng Paidu Capsules (YC) against carbon tetrachloride (CCl4)-induced hepatic injury in dogs. METHODS: Thirty healthy dogs were divided randomly into five groups (n = 6 in each group), namely control, oleanolic acid tablet (OAT), O3, YC and O3 + YC, given either no particular pre-treatment, oral OAT, medical ozone rectal insulfflation every other day, oral YC, or oral YC plus medical ozone rectal insulfflation every other day, respectively, for 30 consecutive days. After pre-treatment, acute hepatic injury was induced in all dogs with a single-dose intraperitoneal injection of CCl4. General condition and survival time were recorded. The biochemical and hematological indexes of alanine aminotransferase (ALT), aspartate aminotransferase/alanine aminotransferase (AST/ALT), serum total bilirubin (TBIL), prothrombin time (PT), blood ammonia (AMMO), and blood urea nitrogen (BUN) were measured after CCl4 injection. Hepatic pathological changes were also observed. RESULTS: Compared to the other four groups, the changes of group O3 + YC dogs’ general conditions (motoricity, mental state, eating, urination and defecation) could be better controlled. In group O3 + YC the survival rates were higher (P < 0.05 vs group control). AST/ALT values were kept within a normal level in group O3 + YC. Hepatic histopathology showed that hepatic injury in group O3 + YC was less serious than those in the other four groups. CONCLUSION: Medical ozone combined with TCM YC could exert a protective effect on acute liver injury induced by CCl4. PMID:18023088

  15. Ozone induces synthesis of systemic prostacyclin by cyclooxygenase-2 dependent mechanism in vivo.


    Schulz, Siegfried; Ninke, Simone; Watzer, Bernhard; Nüsing, Rolf Michael


    Under certain pathological conditions, e.g., infectious or neoplastic diseases, application of ozone exerts therapeutic effects. However, pharmacological mechanisms are not understood. Since an interaction with the arachidonic acid metabolism is suggested we investigated the effect of intraperitoneal insufflation of ozone on prostanoid system in vivo. Upon ozone application (4 mg/kg) to rats we observed an approximate 3-fold increase in excretion rate of 6-keto-prostaglandin (PG) F1α and of 2,3-dinor-6-keto-PG F1α, the measurable stable products of prostacyclin. In plasma and vessel tissue 6-keto-PG F1α concentration was also significantly increased. In contrast, excretion rates for PGE2 and thromboxane (TX) B2 did not change. F2-isoprostanes, regarded as endogenous indicators of oxidative stress, were also unaffected by ozone application. Oxygen insufflation used as control was without any effect on prostanoid levels. Ozone caused increase in 6-keto-PG F1α by arterial but not by venous vessel tissues with peak activity 6-9h following insufflation. The increase in PGI2 synthesis was dependent on cyclooxygenase (COX)-2 activity, demonstrated by its sensitivity towards COX-2 inhibition, and by enhanced COX-2 mRNA and protein expression in vessels. Ozone exerted no rise in excretion rate of prostacyclin metabolites in COX-2(-/-) but in COX-1(-/-) mice. Enzymatic activity and mRNA expression of vascular PGI2 synthase (PGIS) was unaffected by ozone treatment. In summary our study shows for the first time that ozone insufflation causes enhanced expression of COX-2 in the vessel system leading to exclusive elevation of systemic PGI2 levels. We assume that PGI2 stimulation may contribute to the beneficial effects of ozone treatment. PMID:22155309

  16. Ozone-Induced Dissociation of Conjugated Lipids Reveals Significant Reaction Rate Enhancements and Characteristic Odd-Electron Product Ions

    NASA Astrophysics Data System (ADS)

    Pham, Huong T.; Maccarone, Alan T.; Campbell, J. Larry; Mitchell, Todd W.; Blanksby, Stephen J.


    Ozone-induced dissociation (OzID) is an alternative ion activation method that relies on the gas phase ion-molecule reaction between a mass-selected target ion and ozone in an ion trap mass spectrometer. Herein, we evaluated the performance of OzID for both the structural elucidation and selective detection of conjugated carbon-carbon double bond motifs within lipids. The relative reactivity trends for [M + X]+ ions (where X = Li, Na, K) formed via electrospray ionization (ESI) of conjugated versus nonconjugated fatty acid methyl esters (FAMEs) were examined using two different OzID-enabled linear ion-trap mass spectrometers. Compared with nonconjugated analogues, FAMEs derived from conjugated linoleic acids were found to react up to 200 times faster and to yield characteristic radical cations. The significantly enhanced reactivity of conjugated isomers means that OzID product ions can be observed without invoking a reaction delay in the experimental sequence (i.e., trapping of ions in the presence of ozone is not required). This possibility has been exploited to undertake neutral-loss scans on a triple quadrupole mass spectrometer targeting characteristic OzID transitions. Such analyses reveal the presence of conjugated double bonds in lipids extracted from selected foodstuffs. Finally, by benchmarking of the absolute ozone concentration inside the ion trap, second order rate constants for the gas phase reactions between unsaturated organic ions and ozone were obtained. These results demonstrate a significant influence of the adducting metal on reaction rate constants in the fashion Li > Na > K.

  17. Mast cells modulate acute ozone-induced inflammation of the murine lung

    SciTech Connect

    Kleeberger, S.R.; Seiden, J.E.; Levitt, R.C.; Zhang, L.Y. )


    We hypothesized that mast cells modulate lung inflammation that develops after acute ozone (O3) exposure. Two tests were done: (1) genetically mast-cell-deficient (WBB6F1-W/Wv, WCB6F1-SI/SId) and bone-marrow-transplanted W/Wv mice were exposed to O3 or filtered air, and the inflammatory responses were compared with those of mast-cell-sufficient congenic mice (WBB6F1-(+)/+, WCB6F1-(+)/+); (2) genetically O3-susceptible C57BL/6J mice were treated pharmacologically with putative mast-cell modulators or vehicle, and the O3-induced inflammatory responses were compared. Mice were exposed to 1.75 ppm O3 or air for 3 h, and lung inflammation was assessed by bronchoalveolar lavage (BAL) 6 and 24 h after exposure. Relative to O3-exposed W/Wv and SI/SId mice, the mean numbers of lavageable polymorphonuclear leukocytes (PMNs) and total BAL protein concentration (a marker of permeability) were significantly greater in the respective O3-exposed normal congenic +/+ mice (p < 0.05). Mast cells were reconstituted in W/Wv mice by transplantation of bone marrow cells from congenic +/+ mice, and O3-induced lung inflammation was assessed in the mast-cell-replete W/Wv mice. After O3 exposure, the changes in lavageable PMNs and total protein of mast-cell-replete W/Wv mice were not different from age-matched normal +/+ control mice, and they were significantly greater than those of sham-transplanted W/Wv mice (p < 0.05). Genetically susceptible C57BL/6J mice were pretreated with a mast-cell stabilizer (nedocromil sodium), secretagogue (compound 48/80), or vehicle, and the mice were exposed to O3.

  18. Susceptibility to ozone-induced inflammation. I. Genetic control of the response to subacute exposure

    SciTech Connect

    Kleeberger, S.R.; Levitt, R.C.; Zhang, L.Y. )


    We demonstrated previously that C57BL/6J (B6) inbred mice are susceptible and C3H/HeJ (C3) mice are resistant to airway inflammation that is induced by acute (3 h) exposure to 2 parts per million (ppm) ozone (O3). In the present study we tested the hypothesis that B6 and C3 mice are also differentially susceptible to the airway inflammatory responses to subacute (72 h) exposure to environmentally relevant concentrations of O3 (0.12 and 0.30 ppm). Male mice (20-25 g, 5-7 wk) were exposed continuously to 0.12 ppm O3, 0.30 ppm O3, or filtered air (control). Pulmonary inflammation was assessed after 24, 48, and 72 h by differential cell count and total protein in bronchoalveolar lavage (BAL) returns. Exposure to 0.12 ppm O3 caused significant influx of alveolar macrophages, polymorphonuclear leukocytes (PMNs), lymphocytes, and total BAL protein in both strains, but no differences in the magnitude of the responses were found between B6 and C3 mice. In contrast to the effect of 0.12 ppm O3, exposure to 0.30 ppm O3 elicited significantly greater numbers of inflammatory cells and BAL protein concentration in B6 mice relative to C3 mice. The phenotypes of the B6 and C3 mice were termed susceptible and resistant, respectively. To further evaluate the potential genetic contribution to the inflammatory response to 0.30 ppm O3, the F1, F2, and backcross progeny from B6 and C3 progenitors were examined. The ratios of susceptible and resistant phenotypes of these progeny support the hypothesis that a single autosomal recessive gene confers susceptibility to subacute O3-induced inflammation.

  19. Hypoxia-induced pulmonary arterial hypertension augments lung injury and airway reactivity caused by ozone exposure.


    Zychowski, Katherine E; Lucas, Selita N; Sanchez, Bethany; Herbert, Guy; Campen, Matthew J


    Ozone (O3)-related cardiorespiratory effects are a growing public health concern. Ground level O3 can exacerbate pre-existing respiratory conditions; however, research regarding therapeutic interventions to reduce O3-induced lung injury is limited. In patients with chronic obstructive pulmonary disease, hypoxia-associated pulmonary hypertension (HPH) is a frequent comorbidity that is difficult to treat clinically, yet associated with increased mortality and frequency of exacerbations. In this study, we hypothesized that established HPH would confer vulnerability to acute O3 pulmonary toxicity. Additionally, we tested whether improvement of pulmonary endothelial barrier integrity via rho-kinase inhibition could mitigate pulmonary inflammation and injury. To determine if O3 exacerbated HPH, male C57BL/6 mice were subject to either 3 weeks continuous normoxia (20.9% O2) or hypoxia (10.0% O2), followed by a 4-h exposure to either 1ppm O3 or filtered air (FA). As an additional experimental intervention fasudil (20mg/kg) was administered intraperitoneally prior to and after O3 exposures. As expected, hypoxia significantly increased right ventricular pressure and hypertrophy. O3 exposure in normoxic mice caused lung inflammation but not injury, as indicated by increased cellularity and edema in the lung. However, in hypoxic mice, O3 exposure led to increased inflammation and edema, along with a profound increase in airway hyperresponsiveness to methacholine. Fasudil administration resulted in reduced O3-induced lung injury via the enhancement of pulmonary endothelial barrier integrity. These results indicate that increased pulmonary vascular pressure may enhance lung injury, inflammation and edema when exposed to pollutants, and that enhancement of pulmonary endothelial barrier integrity may alleviate such vulnerability. PMID:27286659

  20. Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats☆

    PubMed Central

    Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.; Ward, William O.; Vallanat, Beena D.; Andrews, Debora L.; Schladweiler, Mette C.; Snow, Samantha J.; Bass, Virginia L.; Richards, Judy E.; Ghio, Andrew J.; Cascio, Wayne E.; Ledbetter, Allen D.; Kodavanti, Urmila P.


    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0 ppm O3, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. PMID:25838073

  1. Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats.


    Miller, Desinia B; Karoly, Edward D; Jones, Jan C; Ward, William O; Vallanat, Beena D; Andrews, Debora L; Schladweiler, Mette C; Snow, Samantha J; Bass, Virginia L; Richards, Judy E; Ghio, Andrew J; Cascio, Wayne E; Ledbetter, Allen D; Kodavanti, Urmila P


    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0ppm, 6h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0ppm O3, 6h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress-response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. PMID:25838073

  2. Rebound of Antarctic ozone

    NASA Astrophysics Data System (ADS)

    Salby, Murry; Titova, Evgenia; Deschamps, Lilia


    Restrictions on CFCs have led to a gradual decline of Equivalent Effective Stratospheric Chlorine (EESC). A rebound of Antarctic ozone, however, has remained elusive, masked by large interannual changes that dominate its current evolution. A positive response of ozone is not expected to emerge for at least 1-2 decades, possibly not for half a century. We show that interannual changes of the Antarctic ozone hole are accounted for almost perfectly by changes in dynamical forcing of the stratosphere. The close relationship enables dynamically-induced changes of ozone to be removed, unmasking the climate signal associated with CFCs. The component independent of dynamically-induced changes exhibits a clear upward trend over the last decade - the first signature of a rebound in Antarctic ozone. It enables ozone to be tracked relative to CFCs and other changes of climate.


    EPA Science Inventory

    Hydrodynamics of ozone contactors have a crucial impact on efficient inactivation of pathogens such as Cryptosporidium as well as control of disinfection byproducts such as bromate. Improper mixing behaviors including short-circuiting, internal recirculation and presence...

  4. Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity

    PubMed Central

    Pan, Yanchun; Daito, Takuji; Sasaki, Yo; Chung, Yong Hee; Xing, Xiaoyun; Pondugula, Santhi; Swamidass, S. Joshua; Wang, Ting; Kim, Albert H.; Yano, Hiroko


    Although epigenetic abnormalities have been described in Huntington’s disease (HD), the causal epigenetic mechanisms driving neurodegeneration in HD cortex and striatum remain undefined. Using an epigenetic pathway-targeted drug screen, we report that inhibitors of DNA methyltransferases (DNMTs), decitabine and FdCyd, block mutant huntingtin (Htt)-induced toxicity in primary cortical and striatal neurons. In addition, knockdown of DNMT3A or DNMT1 protected neurons against mutant Htt-induced toxicity, together demonstrating a requirement for DNMTs in mutant Htt-triggered neuronal death and suggesting a neurodegenerative mechanism based on DNA methylation-mediated transcriptional repression. Inhibition of DNMTs in HD model primary cortical or striatal neurons restored the expression of several key genes, including Bdnf, an important neurotrophic factor implicated in HD. Accordingly, the Bdnf promoter exhibited aberrant cytosine methylation in mutant Htt-expressing cortical neurons. In vivo, pharmacological inhibition of DNMTs in HD mouse brains restored the mRNA levels of key striatal genes known to be downregulated in HD. Thus, disturbances in DNA methylation play a critical role in mutant Htt-induced neuronal dysfunction and death, raising the possibility that epigenetic strategies targeting abnormal DNA methylation may have therapeutic utility in HD. PMID:27516062

  5. Ozone-Induced Type 2 Immunity in Nasal Airways. Development and Lymphoid Cell Dependence in Mice.


    Ong, Chee Bing; Kumagai, Kazuyoshi; Brooks, Phillip T; Brandenberger, Christina; Lewandowski, Ryan P; Jackson-Humbles, Daven N; Nault, Rance; Zacharewski, Timothy R; Wagner, James G; Harkema, Jack R


    Inhalation exposures to ozone commonly encountered in photochemical smog cause airway injury and inflammation. Elevated ambient ozone concentrations have been epidemiologically associated with nasal airway activation of neutrophils and eosinophils. In the present study, we elucidated the temporal onset and lymphoid cell dependency of eosinophilic rhinitis and associated epithelial changes in mice repeatedly exposed to ozone. Lymphoid cell-sufficient C57BL/6 mice were exposed to 0 or 0.5 parts per million (ppm) ozone for 1, 2, 4, or 9 consecutive weekdays (4 h/d). Lymphoid cell-deficient, Rag2(-/-)Il2rg(-/-) mice were similarly exposed for 9 weekdays. Nasal tissues were taken at 2 or 24 hours after exposure for morphometric and gene expression analyses. C57BL/6 mice exposed to ozone for 1 day had acute neutrophilic rhinitis, with airway epithelial necrosis and overexpression of mucosal Ccl2 (MCP-1), Ccl11 (eotaxin), Cxcl1 (KC), Cxcl2 (MIP-2), Hmox1, Il1b, Il5, Il6, Il13, and Tnf mRNA. In contrast, 9-day ozone exposure elicited type 2 immune responses in C57BL/6 mice, with mucosal mRNA overexpression of Arg1, Ccl8 (MCP-2), Ccl11, Chil4 (Ym2), Clca1 (Gob5), Il5, Il10, and Il13; increased density of mucosal eosinophils; and nasal epithelial remodeling (e.g., hyperplasia/hypertrophy, mucous cell metaplasia, hyalinosis, and increased YM1/YM2 proteins). Rag2(-/-)Il2rg(-/-) mice exposed to ozone for 9 days, however, had no nasal pathology or overexpression of transcripts related to type 2 immunity. These results provide a plausible paradigm for the activation of eosinophilic inflammation and type 2 immunity found in the nasal airways of nonatopic individuals subjected to episodic exposures to high ambient ozone. PMID:26203683

  6. Long-Term Ozone Exposure Attenuates 1-Nitronaphthalene–Induced Cytotoxicity in Nasal Mucosa

    PubMed Central

    Lee, Myong Gyong; Wheelock, Åsa M.; Boland, Bridget; Plopper, Charles G.


    1-Nitronaphthalene (1-NN) and ozone are cytotoxic air pollutants commonly found as components of photochemical smog. The mechanism of toxicity for 1-NN involves bioactivation by cytochrome P450s and subsequent adduction to proteins. Previous studies have shown that 1-NN toxicity in the lung is considerably higher in rats after long-term exposure to ozone compared with the corresponding filtered air–exposed control rats. The aim of the present study was to establish whether long-term exposure to ozone alters the susceptibility of nasal mucosa to the bioactivated toxicant, 1-NN. Adult male Sprague-Dawley rats were exposed to filtered air or 0.8 ppm ozone for 8 hours per day for 90 days, followed by a single treatment with 0, 12.5, or 50.0 mg/kg 1-NN by intraperitoneal injection. The results of the histopathologic analyses show that the nasal mucosa of rats is a target of systemic 1-NN, and that long-term ozone exposure markedly lessens the severity of injury, as well as the protein adduct formation by reactive 1-NN metabolites. The antagonistic effects were primarily seen in the nasal transitional epithelium, which corresponds to the main site of histologic changes attributed to ozone exposure (goblet cell metaplasia and hyperplasia). Long-term ozone exposure did not appear to alter susceptibility to 1-NN injury in other nasal regions. This study shows that long-term ozone exposure has a protective effect on the susceptibility of nasal transitional epithelium to subsequent 1-NN, a result that clearly contrasts with the synergistic toxicological effect observed in pulmonary airway epithelium in response to the same exposure regimen. PMID:17901409

  7. Inducible Escherichia coli fermentation for increased plasmid DNA production.


    Carnes, Aaron E; Hodgson, Clague P; Williams, James A


    Bacterial plasmids are the vectors of choice for DNA vaccines and short-term gene therapeutics. Growing plasmid DNA by microbial (Escherichia coli) fermentation is usually combined with alkaline lysis/chromatography methods of purification. To date, typical plasmid fermentation media and processes result in yields of 100-250 mg of plasmid DNA/l of culture medium, using standard high-copy pUC origin-containing plasmids. In order to address this initial and yield-limiting upstream step, we identified novel fermentation control parameters for fed-batch fermentation. The resulting fermentation strategies significantly increased specific plasmid yield with respect to cell mass while enhancing plasmid integrity and maintaining supercoiled DNA content. Fed-batch fermentation yield exceeding 1000 mg of plasmid DNA/l was obtained after reduction of plasmid-mediated metabolic burden during growth, and yields up to 1500 mg of plasmid DNA/l have been achieved with optimized plasmid backbones. Interestingly, by inducing high plasmid levels after sufficient biomass accumulation at low temperature and restricted growth, cells were able to tolerate significantly higher plasmid quantities than cells grown by conventional processes. This 5-10-fold increase in plasmid yield dramatically decreases plasmid manufacturing costs and improves the effectiveness of downstream purification by reducing the fraction of impurities. PMID:16819941

  8. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; van Dilla, M.A.; Lake, S.; Wyrobek, A.J.


    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular x-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to x-ray-induced DNA content variability. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artifically enriched in one population.

  9. Ozone-induced changes in host-plant suitability: interactions of Keiferia lycopersicella and Lycopersicon esculentum

    SciTech Connect

    Trumble, J.T.; Hare, J.D.; Musselman, R.C.; McCool, P.M.


    Tomato pinworms, Keiferia lycopersicella (Walsingham), survived better and developed faster on tomato plants, Lycopersicon esculentum Mill., damaged by ozone than on plants not subjected to ozone fumigation. Other measures of fitness, including survival during pupation, sex ratio of adults, female longevity, and fecundity, were not affected. Analyses of ozonated foliage at zero, two and seven days following fumigation demonstrated a transient but significant increase (18-24%) in soluble protein concentration. Although the concentration of the total free amino acids in ozonated foliage did not increase significantly, significant changes were observed in at least 10 specific amino acids, some of which are critical for either insect development or the production of plant defensive chemicals. A reduction in total nitrogen in ozonated foliage at seven days postfumigation indicated that nitrogen was being translocated to other portions of the plant. The implications of increases in assimilable forms of nitrogen in ozonated foliage, which lead to improved host-plant suitability for insect herbivores, are discussed both in relation to some current ecological theories and in regard to pest-management strategies. 59 references, 1 figure, 4 tables.

  10. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.


    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  11. Influenza infection induces host DNA damage and dynamic DNA damage responses during tissue regeneration

    PubMed Central

    Li, Na; Parrish, Marcus; Chan, Tze Khee; Yin, Lu; Rai, Prashant; Yoshiyuki, Yamada; Abolhassani, Nona; Tan, Kong Bing; Kiraly, Orsolya; Chow, Vincent TK; Engelward, Bevin P.


    Influenza viruses account for significant morbidity worldwide. Inflammatory responses, including excessive generation of reactive oxygen and nitrogen species (RONS), mediate lung injury in severe Influenza infections. However, the molecular basis of inflammation-induced lung damage is not fully understood. Here, we studied influenza H1N1 infected cells in vitro, as well as H1N1 infected mice, and we monitored molecular and cellular responses over the course of two weeks in vivo. We show that influenza induces DNA damage both when cells are directly exposed to virus in vitro (measured using the comet assay) and also when cells are exposed to virus in vivo (estimated via γH2AX foci). We show that DNA damage, as well as responses to DNA damage, persist in vivo until long after virus has been cleared, at times when there are inflammation associated RONS (measured by xanthine oxidase activity and oxidative products). The frequency of lung epithelial and immune cells with increased γH2AX foci is elevated in vivo, especially for dividing cells (Ki-67 positive) exposed to oxidative stress during tissue regeneration. Additionally, we observed a significant increase in apoptotic cells as well as increased levels of DSB repair proteins Ku70, Ku86 and Rad51 during the regenerative phase. In conclusion, results show that influenza induces DNA both in vitro and in vivo, and that DNA damage responses are activated, raising the possibility that DNA repair capacity may be a determining factor for tissue recovery and disease outcome. PMID:25809161

  12. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.


    Englander, Ella W


    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  13. DNA Damage Response in Peripheral Nervous System: Coping with Cancer Therapy-Induced DNA Lesions

    PubMed Central

    Englander, Ella W


    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  14. Low-energy plasma immersion ion implantation to induce DNA transfer into bacterial E. coli

    NASA Astrophysics Data System (ADS)

    Sangwijit, K.; Yu, L. D.; Sarapirom, S.; Pitakrattananukool, S.; Anuntalabhochai, S.


    Plasma immersion ion implantation (PIII) at low energy was for the first time applied as a novel biotechnology to induce DNA transfer into bacterial cells. Argon or nitrogen PIII at low bias voltages of 2.5, 5 and 10 kV and fluences ranging from 1 × 1012 to 1 × 1017 ions/cm2 treated cells of Escherichia coli (E. coli). Subsequently, DNA transfer was operated by mixing the PIII-treated cells with DNA. Successes in PIII-induced DNA transfer were demonstrated by marker gene expressions. The induction of DNA transfer was ion-energy, fluence and DNA-size dependent. The DNA transferred in the cells was confirmed functioning. Mechanisms of the PIII-induced DNA transfer were investigated and discussed in terms of the E. coli cell envelope anatomy. Compared with conventional ion-beam-induced DNA transfer, PIII-induced DNA transfer was simpler with lower cost but higher efficiency.

  15. Effect of cumulative ozone exposure on ozone-induced nasal epithelial hyperplasia and secretory metaplasia in rats

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R.; Henderson, R.F. )


    Repeated exposure of rats to O3 induces proliferative and secretory metaplastic changes within nasal airway epithelia that may protect against subsequent exposures. Our study assessed the effect of different cumulative exposure times on O3-induced nasal epithelial hyperplasia and secretory metaplasia. Rats were exposed 6 h/day to air or to 0.8 ppm O3 and were sacrificed 18 h after the end of their last exposure. The rats were exposed to either air or 0.8 ppm O3 for 3 or 7 days, or to 0.8 ppm O3 for 3 days followed by a 4-day exposure to air. The effects of the exposures were determined by quantitating the hyperplastic (epithelial nuclei/mm basal lamina) and secretory metaplastic changes (volume densities of acidic and neutral mucosubstances) within the nasal nonciliated cuboidal epithelium (NNCE). There were no significant changes in NNCE cell numeric density, or in the volume density of intraepithelial mucus, compared to air-exposed control rats, in rats exposed to O3 for 3 days and sacrificed 18 h later. Compared to control rats, there was significant epithelial hyperplasia and secretory metaplasia within the NNCE of rats exposed to O3 either for 7 days or for 3 days followed by 4 days of exposure to air. There were no significant differences in NNCE cell hyperplasia or secretory metaplasia between these two experimental groups. Three 6 h/day exposures to 0.8 ppm O3 triggered hyperplastic and metaplastic changes within rat NNCE that were indistinguishable from those produced by seven 6 h/day exposures to the same concentration of O3. The data suggest that O3 is capable of rapidly inducing hyperplastic and metaplastic responses within rat NNCE, and that once initiated, development of the phenotypic changes within the epithelium does not require further O3 exposure.

  16. Ozone-induced inflammation in the lower airways of human subjects

    SciTech Connect

    Koren, H.S.; Devlin, R.B.; Graham, D.E.; Mann, R.; McGee, M.P.; Horstman, D.H.; Kozumbo, W.J.; Becker, S.; House, D.E.; McDonnell, W.F.


    Although ozone (O3) has been shown to induce inflammation in the lungs of animals, very little is known about its inflammatory effects on humans. In this study, 11 healthy nonsmoking men, 18 to 35 yr of age (mean, 25.4 +/- 3.5), were exposed once to 0.4 ppm O3 and once to filtered air for 2 h with intermittent exercise. Eighteen hours later, bronchoalveolar lavage (BAL) was performed and the cells and fluid were analyzed for various indicators of inflammation. There was an 8.2-fold increase in the percentage of polymorphonuclear leukocytes (PMN) in the total cell population, and a small but significant decrease in the percentage of macrophages after exposure to O3. Immunoreactive neutrophil elastase often associated with inflammation and lung damage increased by 3.8-fold in the fluid while its activity increased 20.6-fold in the lavaged cells. A 2-fold increase in the levels of protein, albumin, and IgG suggested increased vascular permeability of the lung. Several biochemical markers that could act as chemotactic or regulatory factors in an inflammatory response were examined in the BAL fluid (BALF). The level of complement fragment C3 alpha was increased by 1.7-fold. The chemotactic leukotriene B4 was unchanged while prostaglandin E2 increased 2-fold. In contrast, three enzyme systems of phagocytes with potentially damaging effects on tissues and microbes, namely, NADPH-oxidase and the lysosomal enzymes acid phosphatase and beta-glucuronidase, were increased neither in the lavaged fluid nor cells. In addition, the amounts of fibrogenic-related molecules were assessed in BALF.

  17. Susceptibility to ozone-induced inflammation. II. Separate loci control responses to acute and subacute exposures

    SciTech Connect

    Kleeberger, S.R.; Levitt, R.C.; Zhang, L.Y. )


    We demonstrated previously that inbred strains of mice are differentially susceptible to acute (3 h) and subacute (48 h) exposures to 2 parts per million (ppm) ozone (O3) and 0.30 ppm O3, respectively. Genetic studies with O3-resistant C3H/HeJ and O3-susceptible C57BL/6J strains have indicated that susceptibility to each of these O3 exposures is under Mendelian (single gene) control. In the present study, we hypothesized that the same gene controls susceptibility to the airway inflammatory responses to 2 ppm and 0.30 ppm O3 exposures. To test this hypothesis, airway inflammation was induced in 10 BXH and 16 BXD recombinant inbred (RI) strains of mice by acute as well as subacute O3 exposures. Airway inflammation was assessed by counting the number of polymorphonuclear leukocytes (PMNs) in bronchoalveolar lavage (BAL) returns obtained immediately after 48-h subacute exposure to 0.30 ppm O3, or 6 h after 3 h acute exposure to 2 ppm O3. Each RI strain was classified as susceptible or resistant to each exposure, based on a comparison of mean numbers of PMNs with those of the respective progenitor strains. For each RI set, a phenotypic strain distribution pattern (SDP) was thus derived for each exposure regimen, and the SDPs were then compared for concordance. Among the BXH RI strains, 4 of 10 responded discordantly to the two exposures: 3 were susceptible to acute exposure and resistant to subacute exposure, whereas 1 was conversely susceptible. Among the BXD RI strains, 4 of 16 were discordant: 1 was susceptible to acute exposure, and resistant to subacute exposure, whereas 3 were conversely susceptible.

  18. Baseline Chromatin Modification Levels May Predict Interindividual Variability in Ozone-Induced Gene Expression.


    McCullough, Shaun D; Bowers, Emma C; On, Doan M; Morgan, David S; Dailey, Lisa A; Hines, Ronald N; Devlin, Robert B; Diaz-Sanchez, David


    Traditional toxicological paradigms have relied on factors such as age, genotype, and disease status to explain variability in responsiveness to toxicant exposure; however, these are neither sufficient to faithfully identify differentially responsive individuals nor are they modifiable factors that can be leveraged to mitigate the exposure effects. Unlike these factors, the epigenome is dynamic and shaped by an individual's environment. We sought to determine whether baseline levels of specific chromatin modifications correlated with the interindividual variability in their ozone (O3)-mediated induction in an air-liquid interface model using primary human bronchial epithelial cells from a panel of 11 donors. We characterized the relationship between the baseline abundance of 6 epigenetic markers with established roles as key regulators of gene expression-histone H3 lysine 4 trimethylation (H3K4me3), H3K27 acetylation (H3K27ac), pan-acetyl H4 (H4ac), histone H3K27 di/trimethylation (H3K27me2/3), unmodified H3, and 5-hydroxymethylcytosine (5-hmC)-and the variability in the O3-induced expression of IL-8, IL-6, COX2, and HMOX1. Baseline levels of H3K4me3, H3K27me2/3, and 5-hmC, but not H3K27ac, H4ac, and total H3, correlated with the interindividual variability in O3-mediated induction of HMOX1 and COX2. In contrast, none of the chromatin modifications that we examined correlated with the induction of IL-8 and IL-6. From these findings, we propose an "epigenetic seed and soil" model in which chromatin modification states between individuals differ in the relative abundance of specific modifications (the "soil") that govern how receptive the gene is to toxicant-mediated cellular signals (the "seed") and thus regulate the magnitude of exposure-related gene induction. PMID:26719369

  19. Proton-induced direct and indirect damage of plasmid DNA.


    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, Václav; Moretto-Capelle, Patrick; Bugler, Beatrix; Legube, Gaelle; Cafarelli, Pierre; Casta, Romain; Champeaux, Jean Philippe; Sence, Martine; Vlk, Martin; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, Sebastien; Juha, Libor; Davídková, Marie


    Clustered DNA damage induced by 10, 20 and 30 MeV protons in pBR322 plasmid DNA was investigated. Besides determination of strand breaks, additional lesions were detected using base excision repair enzymes. The plasmid was irradiated in dry form, where indirect radiation effects were almost fully suppressed, and in water solution containing only minimal residual radical scavenger. Simultaneous irradiation of the plasmid DNA in the dry form and in the solution demonstrated the contribution of the indirect effect as prevalent. The damage composition slightly differed when comparing the results for liquid and dry samples. The obtained data were also subjected to analysis concerning different methodological approaches, particularly the influence of irradiation geometry, models used for calculation of strand break yields and interpretation of the strand breaks detected with the enzymes. It was shown that these parameters strongly affect the results. PMID:26007308

  20. Current-induced enhancement of DNA bubble creation

    NASA Astrophysics Data System (ADS)

    Gu, Lei; Fu, Hua-Hua


    Current-induced heating of short double-stranded DNA chains is studied within a two-probe transport setup by using the Langevin approach. The electrons are modeled by a tight-binding Hamiltonian. The DNA atomic motion is described by the Peyrard–Bishop–Dauxois atomic potential, coupled with electrons through the Holstein interaction. The solvent environment is accounted for as a classical heat bath. Voltage biases of 0.1∼ 0.5 {{V}} can effectively break the base pairs and lead to the melting transition, which can be detected from the resulting significant reduction of the conductance. When the bias increases, the opening of base pairs near the leads with higher chemical potential is suppressed and bubble (localized separation of the double strand) formation becomes asymmetric. Our results suggest that the voltage bias can excite the base pairs, hence increases the chemical activity of DNA.

  1. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].



    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25507621

  2. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].


    Smetanina, N M; Pustovalova, M V; Osipov, A N


    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25427371

  3. The impact of surfactant protein-A on ozone-induced changes in the mouse bronchoalveolar lavage proteome

    PubMed Central


    Background Ozone is a major component of air pollution. Exposure to this powerful oxidizing agent can cause or exacerbate many lung conditions, especially those involving innate immunity. Surfactant protein-A (SP-A) plays many roles in innate immunity by participating directly in host defense as it exerts opsonin function, or indirectly via its ability to regulate alveolar macrophages and other innate immune cells. The mechanism(s) responsible for ozone-induced pathophysiology, while likely related to oxidative stress, are not well understood. Methods We employed 2-dimensional difference gel electrophoresis (2D-DIGE), a discovery proteomics approach, coupled with MALDI-ToF/ToF to compare the bronchoalveolar lavage (BAL) proteomes in wild type (WT) and SP-A knockout (KO) mice and to assess the impact of ozone or filtered air on the expression of BAL proteins. Using the PANTHER database and the published literature most identified proteins were placed into three functional groups. Results We identified 66 proteins and focused our analysis on these proteins. Many of them fell into three categories: defense and immunity; redox regulation; and protein metabolism, modification and chaperones. In response to the oxidative stress of acute ozone exposure (2 ppm; 3 hours) there were many significant changes in levels of expression of proteins in these groups. Most of the proteins in the redox group were decreased, the proteins involved in protein metabolism increased, and roughly equal numbers of increases and decreases were seen in the defense and immunity group. Responses between WT and KO mice were similar in many respects. However, the percent change was consistently greater in the KO mice and there were more changes that achieved statistical significance in the KO mice, with levels of expression in filtered air-exposed KO mice being closer to ozone-exposed WT mice than to filtered air-exposed WT mice. Conclusion We postulate that SP-A plays a role in reactive oxidant

  4. Molecular regulation of UV-induced DNA repair.


    Shah, Palak; He, Yu-Ying


    Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the United States, as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors. PMID:25534312

  5. Molecular Regulation of UV-Induced DNA Repair

    PubMed Central

    Shah, Palak; He, Yu-Ying


    Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the U.S., as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors. PMID:25534312

  6. Acid-induced change in ozone-reactive site in indole ring of tryptophan

    SciTech Connect

    Matsumura, Sueo Yoshimura, Ayuko; Okazaki, Kazuyuki; Fijitani, Noboru; Hattori, Hideki


    It is well established that ozone as well as oxygen activated by tryptophan 2,3-dioxygenase or indoleamine 2,3-dioxygenase cleave the 2,3-C=C bond of the indole ring of tryptophan to produce N-formylkynurenine. In the present study, however, we found that exposure of tryptophan to aqueous ozone at and below pH 4.5 generated a different compound. The compound was identified as kynurenine by high performance liquid chromatography and mass spectrometry. Exposure of N-formylkynurenine to acidic ozone did not generate a significant amount of kynurenine, indicating that the kynurenine was not produced via N-formylkynurenine. Acidic ozone thus appears to cleave the 1, 2-N-C bond in place of the 2,3-C=C bond of the indole ring, followed by liberation of the 2-C atom. The 1,2-N-C bond and 2,3-C=C bond are likely to undergo changes in their nature of bonding on acidification, enabling ozone to react with the former bond but not with the latter bond.

  7. Transcription induces gyration of the DNA template in Escherichia coli.

    PubMed Central

    Figueroa, N; Bossi, L


    We show that transcription modulation of a plasmid sequence in exponentially growing Escherichia coli cells leads to a rapid change in the linking number of plasmid DNA. Activation of transcription is accompanied by an increase in the plasmid's level of negative supercoiling. The added superhelical turns, whose number is proportional to the strength of the promoter and to the length of the transcript, are promptly removed when transcription is turned off. The transcription-induced increase of template supercoiling can still be detected in the presence of an inhibitor of ATP-dependent DNA gyrase [DNA topoisomerase (ATP-hydrolyzing), EC]. Altogether, our results indicate that, in addition to being under a general control, DNA superhelicity can be modulated locally in response to the topological perturbations associated with DNA tracking processes. We discuss a model in which supercoiling changes are produced by differential swiveling activities on the opposite sides of a transcriptional flow during transcriptional modulation. Images PMID:2849103

  8. DNA glycosylase enzymes induced during chemical adaptation of M. luteus.

    PubMed Central

    Riazuddin, S; Athar, A; Ahmed, Z; Lali, S M; Sohail, A


    Five peaks of DNA glycosylase activity showing a preference for MNNG alkylated DNA have been identified from extracts of adapted M. luteus. They are numerically designated as GI to GV in order of their decreasing molecular weights. The first two of these peaks have been highly purified. GI, is a constitutive heat labile protein, 35% stimulated by the presence of 50 mM NaCl, acts exclusively on 3 MeA residues in alkylated DNA, 60-70% inhibited by the presence of 2 mM free 3MeA and has been designated as 3MeA DNA glycosylase enzyme. GII, which is an inducible protein, is heat stable, 28% inhibited by the presence of 50 mM NaCl, removes 3MeA, 3MeG, 7MeA & 7MeG with different efficiency, and has been designated as 3,7 methylpurine DNA glycosylase enzyme. The rate of release of 3 methylpurines is 30 times that of 7MeG. There is no activity of either enzyme on O2-MeC, O2-MeT, O4-MeT or O6-MeG. The apparent molecular weights of GI and GII proteins are 28 Kd and 22 Kd respectively. PMID:3628000

  9. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; Van Dilla, M.A.; Lake, S.; Wyrobek, A.J.


    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular X-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to X-ray-induced DNA content variability. In the range between 0 and 600 rad the dose dependence of the square of CV of the DNA content variability, delta CV2D, is described by delta CV2D . Bx + Cx2, with 0 less than or equal to B less than or equal to 0.23 X 10(-2) and C . (0.44 +/- 0.06) X 10(-4). The dose x is measured in rad and delta CVD is expressed in percent. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artificially enriched in one population.

  10. Heavy ion induced DNA transfer in biological cells

    NASA Astrophysics Data System (ADS)

    Vilaithong, T.; Yu, L. D.; Apavatjrut, P.; Phanchaisri, B.; Sangyuenyongpipat, S.; Anuntalabhochai, S.; Brown, I. G.


    Low-energy ion beam bombardment of biological materials for genetic modification purposes has experienced rapid growth in the last decade, particularly for the direct DNA transfer into living organisms including both plants and bacteria. Attempts have been made to understand the mechanisms involved in ion-bombardment-induced direct gene transfer into biological cells. Here we summarize the present status of the application of low-energy ions for genetic modification of living sample materials.

  11. Ozone-induced lung function decrements do not correlate with early airway inflammatory or antioxidant responses.


    Blomberg, A; Mudway, I S; Nordenhäll, C; Hedenström, H; Kelly, F J; Frew, A J; Holgate, S T; Sandström, T


    This study sought to clarify the early events occurring within the airways of healthy human subjects performing moderate intermittent exercise following ozone challenge. Thirteen healthy nonsmoking subjects were exposed in a single blinded, crossover control fashion to 0.2 parts per million (ppm) O3 and filtered air for 2 h, using a standard intermittent exercise and rest protocol. Lung function was assessed pre- and immediately post-exposure. Bronchoscopy was performed with endobronchial mucosal biopsies, bronchial wash (BW) and bronchoalveolar lavage (BAL) 1.5 h after the end of the exposure period. Respiratory tract lining fluid (RTLF) redox status was assessed by measuring a range of antioxidants and oxidative damage markers in BW and BAL fluid samples. There was a significant upregulation after O3 exposure in the expression of vascular endothelial P-selectin (p<0.005) and intercellular adhesion molecule-1 (p<0.005). This was associated with a 2-fold increase in submucosal mast cells (p<0.005) in biopsy samples, without evidence of neutrophilic inflammation, and a decrease in BAL fluid macrophage numbers (1.6-fold, p<0.005), with an activation of the remaining macrophage subset (2.5-fold increase in % human leukocyte antigen (HLA)-DR+ cells, p<0.005). In addition, exposure led to a 4.5-fold and 3.1-fold increase of reduced glutathione (GSH) concentrations, in BW and BAL fluid respectively (p<0.05), with alterations in urate and alpha-tocopherol plasma/RTLF partitioning ratios (p<0.05). Spirometry showed reductions in forced vital capacity (p<0.05) and forced expiratory volume in one second (p<0.01), with evidence of small airway narrowing using forced expiratory flow values (p<0.005). Evidence was found of O3-induced early adhesion molecule upregulation, increased submucosal mast cell numbers and alterations to the respiratory tract lining fluid redox status. No clear relationship was demonstrable between changes in these early markers and the lung function

  12. Ozone-induced bronchial hyperreactivity in guinea pigs is abolished by BW 755C or FPL 55712 but not by indomethacin

    SciTech Connect

    Lee, H.K.; Murlas, C.


    The authors investigated the effects of BW 755C, an inhibitor of both the cyclooxygenase and lipoxygenase pathways of arachidonic acid metabolism; FPL 55712, a selective antagonist of slow-reacting substance of anaphylaxis; and indomethacin, a cyclooxygenase inhibitor, on bronchial reactivity after ozone exposure. Guinea pigs in groups of 5 were treated with BW 755C, FPL 55712, or indomethacin and studied before and 30 min after a 15-min exposure to 3.0 ppm ozone. These animals were compared with a similarly exposed group that was untreated. Reactivity was determined by measuring specific airway resistance (SRaw) upon intravenous acetylcholine infusion in unanesthetized, spontaneously breathing animals. Prior to ozone exposure, they found that drug treatment did not affect either SRaw or muscarinic reactivity. After exposure to 3.0 ppm, all untreated guinea pigs showed substantial muscarinic hyperreactivity. Indomethacin treatment did not inhibit this effect. Furthermore, in the indomethacin-treated animals, marked elevations in SRaw after ozone occurred. In contrast, no change in SRaw or muscarinic reactivity occurred after ozone in any animal treated with either BW 755C or FPL 55712. The authors conclude that ozone-induced bronchial hyperreactivity in the guinea pig rapidly develops after a brief, high-level exposure. This effect may be mediated in part by lipoxygenase products derived from lung arachidonic acid metabolism post-ozone period.

  13. Fungicide prochloraz induces oxidative stress and DNA damage in vitro.


    Lundqvist, J; Hellman, B; Oskarsson, A


    Prochloraz is widely used in horticulture and agriculture, e.g. as a post-harvest anti-mold treatment. Prochloraz is a known endocrine disruptor causing developmental toxicity with multiple mechanisms of action. However, data are scarce concerning other toxic effects. Since oxidative stress response, with formation of reactive oxygen species (ROS), is a common mechanism for different toxic endpoints, e.g. genotoxicity, carcinogenicity and teratogenicity, the aim of this study was to investigate if prochloraz can induce oxidative stress and/or DNA damage in human cells. A cell culture based in vitro model was used to study oxidative stress response by prochloraz, as measured by the activity of the nuclear factor erythroid 2-related factor 2 (Nrf2), a key molecule in oxidative defense mechanisms. It was observed that prochloraz induced oxidative stress in cultured human adrenocortical H295R and hepatoma HepG2 cells at non-toxic concentrations. Further, we used Comet assay to investigate the DNA damaging potential of prochloraz, and found that non-toxic concentrations of prochloraz induced DNA damage in HepG2 cells. These are novel findings, contradicting previous studies in the field of prochloraz and genotoxicity. This study reports a new mechanism by which prochloraz may exert toxicity. Our findings suggest that prochloraz might have genotoxic properties. PMID:26945613

  14. Surface-enhanced Raman scattering spectroscopy of topotecan-DNA complexes: Binding to DNA induces topotecan dimerization

    NASA Astrophysics Data System (ADS)

    Mochalov, K. E.; Strel'Tsov, S. A.; Ermishov, M. A.; Grokhovskii, S. L.; Zhuze, A. L.; Ustinova, O. A.; Sukhanova, A. V.; Nabiev, I. R.; Oleinikov, V. A.


    The interaction of topotecan (TPT), antitumor inhibitor of human DNA topoisomerase I, with calf thymus DNA was studied by surface-enhanced Raman scattering (SERS) spectroscopy. The SERS spectra of TPT are found to depend on its concentration in solution, which is associated with the dimerization of TPT. The spectral signatures of dimerization are identified. It is shown that binding to DNA induces the formation of TPT dimers. The formation of DNA-TPT-TPT-DNA complexes is considered as one of the possible mechanisms of human DNA topoisomerase I inhibition.

  15. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.


    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji


    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  16. Volcanic-aerosol-induced changes in stratospheric ozone following the eruption of Mount Pinatubo

    NASA Technical Reports Server (NTRS)

    Grant, W. B.; Browell, E. V.; Fishman, J.; Brackett, V. G.; Fenn, M. A.; Butler, C. F.; Nganga, D.; Minga, A.; Cros, B.; Mayor, S. D.


    Measurements of lower stratospheric ozone in the Tropics using electrochemical concentrations cell (ECC) sondes and the airborne UV Differential Absorption Lidar (DIAL) system after the eruption of Mt. Pinatubo are compared with the Stratospheric Aerosol and Gas Experiment 2 (SAGE 2) and ECC sonde measurements from below the eruption to determine what changes have occurred as a result. Aerosol data from the Advanced Very High Resolution Radiometer (AVHRR) and the visible and IR wavelengths of the lidar system are used to examine the relationship between aerosols and ozone changes. Ozone decreases of 30 percent at altitudes between 19 and 26 km, partial column (16-28 km) decreases of about 27 D.U., and slight increases (5.4 D.U.) between 28 and 31 km are found in comparison with SAGE 2 climatological values.

  17. Diesel exhaust modulates ozone-induced lung function decrements in healthy human volunteers

    PubMed Central


    The potential effects of combinations of dilute whole diesel exhaust (DE) and ozone (O3), each a common component of ambient airborne pollutant mixtures, on lung function were examined. Healthy young human volunteers were exposed for 2 hr to pollutants while exercising (~50 L/min) intermittently on two consecutive days. Day 1 exposures were either to filtered air, DE (300 μg/m3), O3 (0.300 ppm), or the combination of both pollutants. On Day 2 all exposures were to O3 (0.300 ppm), and Day 3 served as a followup observation day. Lung function was assessed by spirometry just prior to, immediately after, and up to 4 hr post-exposure on each exposure day. Functional pulmonary responses to the pollutants were also characterized based on stratification by glutathione S-transferase mu 1 (GSTM1) genotype. On Day 1, exposure to air or DE did not change FEV1 or FVC in the subject population (n = 15). The co-exposure to O3 and DE decreased FEV1 (17.6%) to a greater extent than O3 alone (9.9%). To test for synergistic exposure effects, i.e., in a greater than additive fashion, FEV1 changes post individual O3 and DE exposures were summed together and compared to the combined DE and O3 exposure; the p value was 0.057. On Day 2, subjects who received DE exposure on Day 1 had a larger FEV1 decrement (14.7%) immediately after the O3 exposure than the individuals’ matched response following a Day 1 air exposure (10.9%). GSTM1 genotype did not affect the magnitude of lung function changes in a significant fashion. These data suggest that altered respiratory responses to the combination of O3 and DE exposure can be observed showing a greater than additive manner. In addition, O3-induced lung function decrements are greater with a prior exposure to DE compared to a prior exposure to filtered air. Based on the joint occurrence of these pollutants in the ambient environment, the potential exists for interactions in more than an additive fashion affecting lung physiological

  18. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.


    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung


    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204


    EPA Science Inventory

    We have developed a process that uses surface corona for the production of ozone by passing air or oxygen through a high voltage electrical discharge and the emitted ultraviolet light is being used to activate a photocatalyst. A thin film of nanostructured TiO2 with primary part...

  20. Diesel Exhaust Modulates Ozone-induced Lung Function Decrements in Healthy Human Volunteers

    EPA Science Inventory

    The potential effects of combinations of dilute whole diesel exhaust (DE) and ozone (03), each a common component of ambient airborne pollutant mixtures, on lung function were examined. Healthy young human volunteers were exposed for 2 hr to pollutants while exercising (~50 L/min...

  1. Coconut, Fish, and Olive Oil-Rich Diets Modify Ozone-Induced Metabolic Effects

    EPA Science Inventory

    Pulmonary health effects of ozone (O3) exposure are well known; however, the cardiovascular and metabolic consequences are still under investigation. Fish oil (FO) and olive oil (OO) dietary supplementation have several cardioprotective benefits, but it is not established if thes...


    EPA Science Inventory

    Ozone is a respiratory irritant that has been shown in animals to increase the premeability of the respiratory epithelium. In the study the authors have recently reported that respiratory epithelial permeability was similarly affected in eight healthy non-smoking young men expose...

  3. From climate change to molecular response: redox proteomics of ozone-induced responses in soybean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ozone (O3) causes significant agricultural losses with soybean being highly sensitive to this oxidant. Here we assess the effect of elevated seasonal O3 exposure on the total and redox proteomes of soybean. To understand the molecular responses to O3 exposure, soybean grown at the Soybean Free Air C...

  4. Aviation 2006 NOx-induced effects on atmospheric ozone and HOx in Community Earth System Model (CESM)

    NASA Astrophysics Data System (ADS)

    Khodayari, A.; Tilmes, S.; Olsen, S. C.; Phoenix, D. B.; Wuebbles, D. J.; Lamarque, J.-F.; Chen, C.-C.


    The interaction between atmospheric chemistry and ozone (O3) in the upper troposphere-lower stratosphere (UTLS) presents a major uncertainty in understanding the effects of aviation on climate. In this study, two configurations of the atmospheric model from the Community Earth System Model (CESM), Community Atmosphere Model with Chemistry, Version 4 (CAM4) and Version 5 (CAM5), are used to evaluate the effects of aircraft nitrogen oxide (NOx = NO + NO2) emissions on ozone and the background chemistry in the UTLS. CAM4 and CAM5 simulations were both performed with extensive tropospheric and stratospheric chemistry including 133 species and 330 photochemical reactions. CAM5 includes direct and indirect aerosol effects on clouds using a modal aerosol module (MAM), whereby CAM4 uses a bulk aerosol module, which can only simulate the direct effect. To examine the accuracy of the aviation NOx-induced ozone distribution in the two models, results from the CAM5 and CAM4 simulations are compared to ozonesonde data. Aviation NOx emissions for 2006 were obtained from the AEDT (Aviation Environmental Design Tool) global commercial aircraft emissions inventory. Differences between simulated O3 concentrations and ozonesonde measurements averaged at representative levels in the troposphere and different regions are 13% in CAM5 and 18% in CAM4. Results show a localized increase in aviation-induced O3 concentrations at aviation cruise altitudes that stretches from 40° N to the North Pole. The results indicate a greater and more disperse production of aviation NOx-induced ozone in CAM5, with the annual tropospheric mean O3 perturbation of 1.2 ppb (2.4%) for CAM5 and 1.0 ppb (1.9%) for CAM4. The annual mean O3 perturbation peaks at about 8.2 ppb (6.4%) and 8.8 ppb (5.2%) in CAM5 and CAM4, respectively. Aviation emissions also result in increased hydroxyl radical (OH) concentrations and methane (CH4) loss rates, reducing the tropospheric methane lifetime in CAM5 and CAM4 by 1.69 and

  5. Transcription-induced DNA toxicity at trinucleotide repeats

    PubMed Central

    Wilson, John H


    Trinucleotide repeats (TNRs) are a blessing and a curse. In coding regions, where they are enriched, short repeats offer the potential for continuous, rapid length variation with linked incremental changes in the activity of the encoded protein, a valuable source of variation for evolution. But at the upper end of these benign and beneficial lengths, trinucleotide repeats become very unstable, with a dangerous bias toward continual expansion, which can lead to neurological diseases in humans. The mechanisms of expansion are varied and the links to disease are complex. Where they have been delineated, however, they have often revealed unexpected, fundamental aspects of the underlying cell biology. Nowhere is this more apparent than in recent studies, which indicate that expanded CAG repeats can form toxic sites in the genome, which can, upon interaction with normal components of DNA metabolism, trigger cell death. Here we discuss the phenomenon of TNR-induced DNA toxicity, with special emphasis on the role of transcription. Transcription-induced DNA toxicity may have profound biological consequences, with particular relevance to repeat-associated neurodegenerative diseases. PMID:21293182

  6. Thermal stability of DNA adducts induced by cyanomorpholinoadriamycin in vitro.

    PubMed Central

    Cullinane, C; Phillips, D R


    The Adriamycin derivative, cyanomorpholinoadriamycin (CMA) was reacted with DNA in vitro to form apparent interstrand crosslinks. The extent of interstrand crosslink formation was monitored by a gel electrophoresis assay and maximal crosslinking of DNA was observed within 1 hr with 5 microM of drug. The interstrand crosslinks were heat labile, with a midpoint melting temperature of 70 degrees C (10 min exposure to heat) in 45% formamide. When CMA-induced adducts were detected as blockages of lambda-exonuclease, 12 blockage sites were observed with 8 being prior to 5'-GG sequences, one prior to 5'-CC, one prior to 5'-GC and 2 at unresolved combinations of these sequences. These exonuclease-detected blockages reveal the same sites of CMA-induced crosslinking as detected by in vitro transcription footprinting and primer-extension blockages on single strand DNA, where the blockages at 5'-GG and 5'-CC were identified as sites of intrastrand crosslinking and the 5'-GC blockage as a probable site of interstrand crosslinking. The thermal stability of both types of crosslink (10 min exposure to heat) ranged from 63-70 degrees C at individual sites. High levels of adduct were detected with poly (dG-dC) but not with poly (dI-dC). These results suggest adduct formation involving an aminal linkage between the 3 position of the morpholino moiety and N2 of guanine. Images PMID:8493102

  7. Quantitation of DNA Adducts Induced by 1,3-Butadiene

    NASA Astrophysics Data System (ADS)

    Sangaraju, Dewakar; Villalta, Peter W.; Wickramaratne, Susith; Swenberg, James; Tretyakova, Natalia


    Human exposure to 1,3-butadiene (BD) present in automobile exhaust, cigarette smoke, and forest fires is of great concern because of its potent carcinogenicity. The adverse health effects of BD are mediated by its epoxide metabolites such as 3,4-epoxy-1-butene (EB), which covalently modify genomic DNA to form promutagenic nucleobase adducts. Because of their direct role in cancer, BD-DNA adducts can be used as mechanism-based biomarkers of BD exposure. In the present work, a mass spectrometry-based methodology was developed for accurate, sensitive, and precise quantification of EB-induced N-7-(1-hydroxy-3-buten-2-yl) guanine (EB-GII) DNA adducts in vivo. In our approach, EB-GII adducts are selectively released from DNA backbone by neutral thermal hydrolysis, followed by ultrafiltration, offline HPLC purification, and isotope dilution nanoLC/ESI+-HRMS3 analysis on an Orbitrap Velos mass spectrometer. Following method validation, EB-GII lesions were quantified in human fibrosarcoma (HT1080) cells treated with micromolar concentrations of EB and in liver tissues of rats exposed to sub-ppm concentrations of BD (0.5-1.5 ppm). EB-GII concentrations increased linearly from 1.15 ± 0.23 to 10.11 ± 0.45 adducts per 106 nucleotides in HT1080 cells treated with 0.5-10 μM DEB. EB-GII concentrations in DNA of laboratory rats exposed to 0.5, 1.0, and 1.5 ppm BD were 0.17 ± 0.05, 0.33 ± 0.08, and 0.50 ± 0.04 adducts per 106 nucleotides, respectively. We also used the new method to determine the in vivo half-life of EB-GII adducts in rat liver DNA (2.20 ± 0.12 d) and to detect EB-GII in human blood DNA. To our knowledge, this is the first application of nanoLC/ESI+-HRMS3 Orbitrap methodology to quantitative analysis of DNA adducts in vivo.

  8. Dynamical DNA accessibility induced by chromatin remodeling and protein binding

    NASA Astrophysics Data System (ADS)

    Montel, F.; Faivre-Moskalenko, C.; Castelnovo, M.


    Chromatin remodeling factors are enzymes being able to alter locally chromatin structure at the nucleosomal level and they actively participate in the regulation of gene expression. Using simple rules for individual nucleosome motion induced by a remodeling factor, we designed simulations of the remodeling of oligomeric chromatin, in order to address quantitatively collective effects in DNA accessibility upon nucleosome mobilization. Our results suggest that accessibility profiles are inhomogeneous thanks to borders effects like protein binding. Remarkably, we show that the accessibility lifetime of DNA sequence is roughly doubled in the vicinity of borders as compared to its value in bulk regions far from the borders. These results are quantitatively interpreted as resulting from the confined diffusion of a large nucleosome depleted region.

  9. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj


    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  12. Understanding the Molecular Mechanism(s) of Formaldehyde-induced DNA-protein Crosslink Repair

    EPA Science Inventory

    Although formaldehyde has been shown to induce many kinds of DNA damage both in in vitro and in vivo assay systems, initial DNA-protein crosslink (DPC) formation might play a major role in FA-induced mutagenesis and carcinogenesis. Several DNA repair pathways, such as base excisi...

  13. Increased expression of Bcl-2 during mucous cell metaplasia induced by endotoxin and ozone

    SciTech Connect

    Tesfaigzi, J.; Ray, L.M.; Hotchkiss, J.A.


    Apoptosis or programmed cell death is accompanied by characteristic morphological changes that distinguish apoptosis from other forms of cell death. These changes include DNA fragmentation, chromatin condensation, cell shrinkage, cell surface pseudopodia, and finally the cellular collapse into membrane-enclosed apoptotic bodies which are rapidly engulfed by macrophages or neighboring cells. Although the morphological features of apoptotic cells are well studied, the biochemical events that control apoptosis are not understood. Programmed cell death is triggered by a variety of pathways that are initiated by different stimuli including noxious agents, DNA damage, the activation of TNF receptors, or the withdrawl of growth factors. The central process of programmed cell death involves a cascade of biochemical events that begins with the initiation of a family of cysteine proteases, including the interleukin-1-{Beta}-converting enzyme, CPP-32, and Apopain. The ratio of Bax, a death-inducer gene, to Bcl-2, an apoptosis suppressor gene, determines whether or not the main apoptotic pathyway is blocked. Apoptosis is suppressed if the ratio of Bcl-2/Bax is > 1, and cells undergo apoptosis if the ratio is < 1. The overexpression of Bcl-2 has been shown to block the apoptotic program triggered by a variety of agents. Therefore, Bcl-2 must be involved in blocking the central pathway of the cell death program. In conclusion, this study showed that high levels of Bcl-2 were detected in some mucous cells at specific time points during mucous cell metaplasia, and this expression was reduced at later time points or was absent after remodeling of this epithelium.

  14. Studies on the biological effects of ozone: 2. Induction of tumor necrosis factor (TNF-alpha) on human leucocytes

    SciTech Connect

    Paulesu, L.; Luzzi, E.; Bocci, V. )


    The effect of ozone as a probable inducer of tumor necrosis factor (TNF-alpha) has been investigated on human blood and on Ficoll-purified blood mononuclear cells (PBMC). Samples were exposed at different ozone concentrations ranging from 2.2 to 108 micrograms/ml and incubated at 37 degrees C in an 95% air-5% CO2 atmosphere. At predetermined times, all cell supernatants were tested for TNF activity and some PBMC cultures were examined for DNA synthesis. The authors have shown that ozone concentration is critical in terms of TNF production and of cell mitogenesis and that, owing to the presence of erythrocytes, higher ozone concentrations are required to be effective in blood than in PBMC. Because ozonization of blood is a procedure followed in several European countries for the treatment of viral diseases and tumors, the release of factors with antiviral and immunomodulatory activities by leukocytes may explain the mechanism of action of ozone and of autohemotherapy.

  15. Ozone-induced bronchial hyperresponsiveness in the rat is not accompanied by neutrophil influx or increased vascular permeability in the trachea

    SciTech Connect

    Evans, T.W.; Brokaw, J.J.; Chung, K.F.; Nadel, J.A.; McDonald, D.M.


    We determined whether ozone-induced bronchial hyperresponsiveness in the rat is accompanied by neutrophil influx or increased vascular permeability in the trachea. Three groups of female Long-Evans rats were studied. One group was exposed to 4 ppm ozone for 2 h and studied immediately thereafter, another group was similarly exposed but was not studied until 24 h after the ozone exposure, and a third group consisted of control rats that breathed room air. Increases in total pulmonary resistance caused by acetylcholine aerosol were measured to assess bronchial responsiveness in these 3 groups. In parallel studies, neutrophil influx into the tracheal mucosa was quantified by counting cells within whole mounts of tracheas that were treated histochemically to stain the myeloperoxidase in neutrophils, and tracheal vascular permeability was quantified by measuring the amount of Evans blue dye extravasated into the trachea. In the rats studied immediately after the ozone exposure, the concentration of acetylcholine required to increase total pulmonary resistance to three-fold the baseline value was only 6% of that required in the controls. In the rats studied 24 h after the ozone exposure, this provocative acetylcholine concentration was not significantly different from that of the controls. Neither the number of neutrophils in the tracheal mucosa nor the amount of Evans blue dye extravasated into the trachea was significantly different from the corresponding control values at either time. We conclude that rats exposed to ozone develop bronchial hyperresponsiveness without detectable neutrophil influx or increased vascular permeability in the trachea.

  16. Ozone oxidative postconditioning ameliorates joint damage and decreases pro-inflammatory cytokine levels and oxidative stress in PG/PS-induced arthritis in rats.


    Vaillant, Jaqueline Dranguet; Fraga, Angela; Díaz, María Teresa; Mallok, A; Viebahn-Hänsler, Renate; Fahmy, Ziad; Barberá, Ariana; Delgado, Liván; Menéndez, Silvia; Fernández, Olga Sonia León


    Rheumatoid Arthritis (RA) is the most prevalent chronic condition present in ~1% of the adult population. Many pro-inflammatory mediators are increased in RA, including Reactive Oxygen Species such as nitric oxide NO, pro-inflammatory cytokines as tumor necrosis factor alpha (TNF-α), interleukin-1beta (IL-1β) and other molecules. Ozone oxidative postconditioning has regulatory effects on some pathological targets associated with RA. Thus, the aim of this study was to investigate the efficacy of ozone therapy in PG/PS-induced arthritis in rats in point of joints inflammation and morphology. Moreover, cytokines, nitric oxide and oxidative stress levels in spleen homogenates were evaluated. Ozone treatment ameliorated joint damage, reduced TNF-α concentrations as well as TNF-α and IL-1β mRNA levels. Besides, cellular redox balance, nitric oxide and fructolysine levels were reestablished after ozone oxidative postconditioning. It was concluded that pleiotropic ozone's effects clarify its therapeutic efficacy in RA. Decreasing inflammation and joint injury, reduction of pro-inflammatory cytokines, TNF-α and IL-1β transcripts and re-establishment of cellular redox balance after ozone treatment were demonstrated. PMID:23911887

  17. Repair and recombination induced by triple helix DNA.


    Chin, Joanna Y; Schleifman, Erica B; Glazer, Peter M


    Triple-helix DNA structures can form endogenously at mirror repeat polypurine/polypyrimidine sequences or by introduction of triplex-forming oligonucleotides (TFOs). Recent evidence suggests that triple helices are sources of genetic instability, and are subject to increased rates of mutagenesis and recruitment of repair factors. Indeed, observations using TFOs suggest that triple helices provoke a variety of biological processes which can be harnessed to modulate gene expression and induce heritable changes in targeted genes. This review surveys the biological applications of TFOs, with particular attention to their recombinogenic and mutagenic potential, and summarizes available evidence for the mechanism of triplex and triplex-associated repair. PMID:17485375

  18. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.


    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena


    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  19. Dielectric Barrier Discharge Plasma-Induced Photocatalysis and Ozonation for the Treatment of Wastewater

    NASA Astrophysics Data System (ADS)

    Mok, Young Sun; Jo, Jin-Oh; Lee, Heon-Ju


    The physicochemical processes of dielectric barrier discharge (DBD) such as in-situ formation of chemically active species and emission of ultraviolet (UV)/visible light were utilized for the treatment of a simulated wastewater formed with Acid Red 4 as the model organic contaminant. The chemically active species (mostly ozone) produced in the DBD reactor were well distributed in the wastewater using a porous gas diffuser, thereby increasing the gas-liquid contact area. For the purpose of making the best use of the light emission, a titanium oxide-based photocatalyst was incorporated in the wastewater treating system. The experimental parameters chosen were the voltage applied to the DBD reactor, the initial pH of the wastewater, and the concentration of hydrogen peroxide added to the wastewater. The results have clearly shown that the present system capable of degrading organic contaminants in two ways (photocatalysis and ozonation) may be a promising wastewater treatment technology.

  20. Considerations for evaluating ultraviolet radiation-induced genetic damage relative to Antarctic ozone depletion.


    Karentz, D


    Springtime ozone depletion over the Antarctic results in increased UVB in local marine environments. It has been established that decreases in primary productivity occur with decreases in ozone concentrations, but the impact of increased UVB on the functioning and stability of the ecosystem has not yet been determined. Very little has been done to evaluate the potential for genetic damage caused by the increase in UVB, and this type of damage is most significant relative to the fitness and maintenance of populations. An essential problem in evaluating genotoxic effects is the lack of appropriate techniques to sample and quantify genetic damage in field populations under ambient UVB levels. In addition, it is currently not feasible to estimate exposure levels for organisms in their natural habitats. PMID:7713036

  1. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  2. α-Tocopherol/Gallic Acid Cooperation in the Protection of Galactolipids Against Ozone-Induced Oxidation.


    Rudolphi-Skórska, Elżbieta; Filek, Maria; Zembala, Maria


    The protective ability of α-tocopherol (TOH) and gallic acid (GA) acting simultaneously at the moment of oxidizer application was evaluated by determination of galactolipid layers' oxidation degree. Addition of GA resulted in a significant decrease of ozone-derived radicals shifting the threshold of lipid sensitivity by an amount approximately corresponding to the GA intake in bulk reaction with ozone. TOH presence in lipid layers results in a change of the role of GA which additionally may be involved in the reduction of tocopheroxyl radical formed during oxidation. This leads to a decrease in effectiveness of GA in diminishing the amount of ozone radicals. Such an effect was not observed for mixed layers containing galactolipid and pre-oxidized tocopherol where the ozone threshold level was associated with a stoichiometry of GA + O3 reaction. It was concluded that probably subsequent transformations of tocopheroxyl radical to less reactive forms prevent its reaction with GA the entire quantity of which is used for radicals scavenging. This result shows the role of time parameter in systems where substrates are engaged in various reactions taking place simultaneously. The inactivation of 1,1-diphenyl-2-picrylhydrazyl radical by studied antioxidants in homogeneous system confirmed observations made on the basis of lipid layer properties indicating their antagonistic action (at least at studied conditions). Formation of layers in post-oxidation situation did not depend whether tocopherol was oxidized during oxidation of lipid/tocopherol mixture or was introduced as pre-oxidized. This may be interpreted as indication that products of tocopherol oxidation may stabilize lipid layers. PMID:26498297

  3. DNA methylation dynamics in human induced pluripotent stem cells.


    Nishino, Koichiro; Umezawa, Akihiro


    Indeed human induced pluripotent stem cells (hiPSCs) are considered to be powerful tools in regenerative medicine. To enable the use of hiPSCs in the field of regenerative medicine, it is necessary to understand the mechanisms of reprogramming during the transformation of somatic cells into hiPSCs. Genome-wide epigenetic modification constitutes a critical event in the generation of iPSCs. In other words, to analyze epigenetic changes in iPSCs means to elucidate reprogramming processes. We have established a large number of hiPSCs derived from various human tissues and have obtained their DNA methylation profiles. Comparison analyses indicated that the epigenetic patterns of various hiPSCs, irrespective of their source tissue, were very similar to one another and were similar to those of human embryonic stem cells (hESCs). However, the profiles of hiPSCs and hESCs exhibited epigenetic differences, which were caused by random aberrant hypermethylation at early passages. Interestingly, continuous passaging of the hiPSCs diminished the differences between DNA methylation profiles of hiPSCs and hESCs. The number of aberrant DNA methylation regions may thus represent a useful epigenetic index for evaluating hiPSCs in the context of therapeutic applications. PMID:27083573

  4. A kinetic analysis of strand breaks on large DNA induced by cigarette smoke extract

    NASA Astrophysics Data System (ADS)

    Kurita, Hirofumi; Takata, Tatsuya; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira


    We report a kinetic analysis of strand breakages on large DNA molecules induced by cigarette smoke extract (CSE), an extract of soluble cigarette smoke components. Previously, this DNA damage was analyzed by agarose gel electrophoresis, whereas we used fluorescence to kinetically analyze damage to individual DNA molecules. CSE caused a marked change in length of DNA molecules. The rate of CSE-induced double-strand breakage on large random-coiled DNA molecules was determined using a simple theoretical model, allowing the facile estimation of the rate of double-strand breaks on large DNA molecules.

  5. Maintenance of the DNA-Damage Checkpoint Requires DNA-Damage-Induced Mediator Protein Oligomerization

    PubMed Central

    Usui, Takehiko; Foster, Steven S.; Petrini, John H.J.


    SUMMARY Oligomeric assembly of Brca1 C-terminal (BRCT) domain-containing mediator proteins occurs at sites of DNA damage. However, the functional significance and regulation of such assemblies are not well understood. In this study, we defined the molecular mechanism of DNA-damage-induced oligomerization of the S. cerevisiae BRCT protein Rad9. Our data suggest that Rad9’s tandem BRCT domain mediates Rad9 oligomerization via its interaction with its own Mec1/Tel1-phosphorylated SQ/TQ cluster domain (SCD). Rad53 activation is unaffected by mutations that impair Rad9 oligomerization, but checkpoint maintenance is lost, indicating that oligomerization is required to sustain checkpoint signaling. Once activated, Rad53 phosphorylates the Rad9 BRCT domain, which attenuates the BRCT-SCD interaction. Failure to phosphorylate the Rad9 BRCT results in cytologically visible Rad9 foci. This suggests a feedback loop wherein Rad53 activity and Rad9 oligomerization are regulated to tune the DNA-damage response. PMID:19187758

  6. DNA-PKcs deficiency leads to persistence of oxidatively-induced clustered DNA lesions in human tumor cells

    PubMed Central

    Peddi, Prakash; Loftin, Charles W.; Dickey, Jennifer S.; Hair, Jessica M.; Burns, Kara J.; Aziz, Khaled; Francisco, Dave C.; Panayiotidis, Mihalis I.; Sedelnikova, Olga A.; Bonner, William M.; Winters, Thomas A.; Georgakilas, Alexandros G.


    DNA-dependent protein kinase (DNA-PK) is a key non-homologous end joining (NHEJ) nuclear serine/threonine protein kinase involved in various DNA metabolic and damage signaling pathways contributing to the maintenance of genomic stability and prevention of cancer. In order to examine the role of DNA-PK in processing of non-DSB clustered DNA damage, we have used three different models of DNA-PK deficiency i.e. chemical inactivation of its kinase activity by novel inhibitors IC86621 and NU7026, knock-down and complete absence of the protein in human breast cancer (MCF-7) and glioblastoma cell lines (MO59-J/K). Compromised DNA-PK repair pathway has lead to accumulation of clustered DNA lesions induced by γ-rays. Tumor cells lacking protein expression or with inhibited kinase activity showed a marked decrease in their ability to process oxidatively-induced non-DSB clustered DNA lesions measured using a modified version of pulsed field gel electrophoresis or single cell gel electrophoresis (Comet assay). In all cases, DNA-PK inactivation lead to a higher level of lesion persistence even after 24–72 hrs of repair. We suggest a model in which DNA-PK deficiency affects the processing of these clusters by first compromising base excision repair and second by the presence of catalytically inactive DNA-PK inhibiting the efficient processing of these lesions due to the failure of DNA-PK to disassociate from the DNA ends. The information rendered will be important not only for understating cancer etiology in the presence of a NHEJ deficiency but also lead to a better understanding of cancer treatments based on the induction of oxidative stress and inhibition of cluster repair. PMID:20193758

  7. Influence of ozone air pollution on plant-herbivore interactions. Part 1: Biochemical changes in ornamental milkweed (Asclepias curassavica L.; asclepiadaceae) induced by ozone.


    Bolsinger, M; Lier, M E; Lansky, D M; Hughes, P R


    A series of fumigation experiments was conducted with bloodflower (Asclepias curassavica L.) in continuous-flow stirred reactors (CSTRs) to elucidate the effects of ozone on foliar concentrations of several primary and secondary plant metabolites relevant to herbivores. Plants 8 weeks of age were subjected to different ozone levels ranging from 0 to 134 nl liter(-1) for exposure periods up to 16 days. Leaves were analyzed for concentration of soluble carbohydrates, starch, free amino acids, soluble protein, total phenolics, and total cardenolides. Significant interactions between the linear effects of ozone concentration and exposure time were found for soluble carbohydrates, amino acids, cardenolides and phenolics. No significant treatment effects could be observed on foliar starch and protein concentration. The metabolic responses of plants to fumigation appeared to be altered by overall plant nutrition. It is possible that the metabolic changes observed in the host plant represent important changes in nutritional quality to insects. PMID:15092115

  8. Ozone Induces a Proinflammatory Response in Primary Human Bronchial Epithelial Cells Through Mitogen-Activated Protein Kinase Activation Without Nuclear Factor-kB Activation

    EPA Science Inventory

    Ground-level ozone (O3) is a ubiquitous environmental air pollutant that is a potent inducer of airway inflammation and has been linked with both respiratory and cardiovascular morbidity and mortality. Some studies using transformed or immortalized cells have attributed O3-medi...

  9. Acute Ozone (O3) Exposure Accelerates Diet-Induced Pulmonary Injury and Metabolic Alterations in a Rat Model of Type II Diabetes

    EPA Science Inventory

    Abstract for Society of Toxicology, March 22-25, 2015, San Diego, CAAcute Ozone (O3) Exposure Accelerates Diet-Induced Pulmonary Injury and Metabolic Alterations in a Rat Model of Type II DiabetesS.J. Snow1,3, D. Miller2, V. Bass2, M. Schladweiler3, A. Ledbetter3, J. Richards3, C...

  10. Langevin Dynamics Simulation of DNA Condensation Induced by Nanoparticles in Confinement

    NASA Astrophysics Data System (ADS)

    Liao, Guo-Jun; Chen, Yeng-Long


    We study nanoparticle-induced DNA condensation in a confined suspension of dilute DNA molecules and ideal nanoparticles (NPs) with Langevin dynamics simulation. DNA condensation has been observed in a solution of dilute DNA molecules (persistence length P ~ 50 nm) and high concentration of electrostatically neutral NPs (diameter d ~ 5 to 35 nm) in recent experimental measurements. It is believed that NPs entropically induce an attraction between DNA segments. For NPs much smaller than P, a DNA molecule can be considered as a chain of connected rods, and the NP-induced depletion attraction between DNA segments can be regarded as rod-rod attraction. Thus, the strength of the depletion attraction is proportional to the number of persistence length in a DNA chain, N = L / P , the depletion volume NP2 d , and the NP density ρ, where L is the DNA contour length. In slit confinement, DNA conformation changes are much different from in an unconfined environment. The height of the slit relative to the NPs size (H / d) strongly influences the DNA conformation. For H / d ~ 1 , DNA size decreases monotonically as ρ increases, while non-monotonic dependence happens for H / d ~ 5 , due to the competition between DNA-DNA, DNA-NP, and NP-wall interactions.

  11. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation

    PubMed Central

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang


    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92–1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  12. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation.


    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang


    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92-1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  13. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes

    PubMed Central

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W.; Agarwal, Rajesh


    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  14. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.


    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh


    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  15. Ozone degrades common herbivore-induced plant volatiles: does this affect herbivore prey location by predators and parasitoids?


    Pinto, Delia M; Blande, James D; Nykänen, Riikka; Dong, Wen-Xia; Nerg, Anne-Marja; Holopainen, Jarmo K


    Inducible terpenes and lipoxygenase pathway products, e.g., green-leaf volatiles (GLVs), are emitted by plants in response to herbivory. They are used by carnivorous arthropods to locate prey. These compounds are highly reactive with atmospheric pollutants. We hypothesized that elevated ozone (O(3)) may affect chemical communication between plants and natural enemies of herbivores by degrading signal compounds. In this study, we have used two tritrophic systems (Brassica oleracea-Plutella xylostella-Cotesia plutellae and Phaseolus lunatus-Tetranychus urticae-Phytoseiulus persimilis) to show that exposure of plants to moderately enhanced atmospheric O(3) levels (60 and 120 nl l(-1)) results in complete degradation of most herbivore-induced terpenes and GLVs, which is congruent with our hypothesis. However, orientation behavior of natural enemies was not disrupted by O(3) exposure in either tritrophic system. Other herbivore-induced volatiles, such as benzyl cyanide, a nitrile in cabbage, and methyl salicylate in lima bean, were not significantly reduced in reactions with O(3). We suggest that more atmospherically stable herbivore-induced volatile compounds can provide important long-distance plant-carnivore signals and may be used by natural enemies of herbivores to orientate in O(3)-polluted environments. PMID:17333375

  16. DNA fragment sizing and sorting by laser-induced fluorescence


    Hammond, Mark L.; Jett, James H.; Keller, Richard A.; Marrone, Babetta L.; Martin, John C.


    A method is provided for sizing DNA fragments using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA piece or the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is linearly related to the fragment length. The distribution of DNA fragment sizes forms a characterization of the DNA piece for use in forensic and research applications.

  17. Polymer- and salt-induced toroids of hexagonal DNA.

    PubMed Central

    Ubbink, J; Odijk, T


    A model is proposed for polymer- and salt-induced toroidal condensates of DNA, based on a recent theory of the undulation enhancement of the electrostatic interaction in the bulk hexagonal phase of semiflexible polyions. In a continuum approximation, the thermodynamic potential of a monomolecular toroid may be split up in bulk, surface, and curvature contributions. With the help of an approximate analytical minimization procedure, the optimal torus dimensions are calculated as a function of the concentrations of inert polymer and added salt. The stability of the torus is analyzed in terms of its surface tension and a bulk melting criterion. The theory should be applicable to psi-toroids that are not too thick. PMID:7711268

  18. Cardiovascular Depression in Rats Exposed to Inhaled Particulate Matter and Ozone: Effects of Diet-Induced Metabolic Syndrome

    PubMed Central

    Allen, Katryn; Yang, Hui-yu; Nan, Bin; Morishita, Masako; Mukherjee, Bhramar; Dvonch, J. Timothy; Spino, Catherine; Fink, Gregory D.; Rajagopalan, Sanjay; Sun, Qinghua; Brook, Robert D.; Harkema, Jack R.


    Background: High ambient levels of ozone (O3) and fine particulate matter (PM2.5) are associated with cardiovascular morbidity and mortality, especially in people with preexisting cardiopulmonary diseases. Enhanced susceptibility to the toxicity of air pollutants may include individuals with metabolic syndrome (MetS). Objective: We tested the hypothesis that cardiovascular responses to O3 and PM2.5 will be enhanced in rats with diet-induced MetS. Methods: Male Sprague-Dawley rats were fed a high-fructose diet (HFrD) to induce MetS and then exposed to O3, concentrated ambient PM2.5, or the combination of O3 plus PM2.5 for 9 days. Data related to heart rate (HR), HR variability (HRV), and blood pressure (BP) were collected. Results: Consistent with MetS, HFrD rats were hypertensive and insulin resistant, and had elevated fasting levels of blood glucose and triglycerides. Decreases in HR and BP, which were found in all exposure groups, were greater and more persistent in HFrD rats compared with those fed a normal diet (ND). Coexposure to O3 plus PM2.5 induced acute drops in HR and BP in all rats, but only ND rats adapted after 2 days. HFrD rats had little exposure-related changes in HRV, whereas ND rats had increased HRV during O3 exposure, modest decreases with PM2.5, and dramatic decreases during O3 plus PM2.5 coexposures. Conclusions: Cardiovascular depression in O3- and PM2.5-exposed rats was enhanced and prolonged in rats with HFrD-induced MetS. These results in rodents suggest that people with MetS may be prone to similar exaggerated BP and HR responses to inhaled air pollutants. Citation: Wagner JG, Allen K, Yang HY, Nan B, Morishita M, Mukherjee B, Dvonch JT, Spino C, Fink GD, Rajagopalan S, Sun Q, Brook RD, Harkema JR. 2014. Cardiovascular depression in rats exposed to inhaled particulate matter and ozone: effects of diet-induced metabolic syndrome. Environ Health Perspect 122:27–33; PMID:24169565

  19. DNA damage sensor MRE11 recognizes cytosolic double-stranded DNA and induces type I interferon by regulating STING trafficking

    PubMed Central

    Kondo, Takeshi; Kobayashi, Junya; Saitoh, Tatsuya; Maruyama, Kenta; Ishii, Ken J.; Barber, Glen N.; Komatsu, Kenshi; Akira, Shizuo; Kawai, Taro


    Double-stranded DNA (dsDNA) derived from pathogen- or host-damaged cells triggers innate immune responses when exposed to cytoplasm. However, the machinery underlying the primary recognition of intracellular dsDNA is obscure. Here we show that the DNA damage sensor, meiotic recombination 11 homolog A (MRE11), serves as a cytosolic sensor for dsDNA. Cells with a mutation of MRE11 gene derived from a patient with ataxia-telangiectasia–like disorder, and cells in which Mre11 was knocked down, had defects in dsDNA-induced type I IFN production. MRE11 physically interacted with dsDNA in the cytoplasm and was required for activation of stimulator of IFN genes (STING) and IRF3. RAD50, a binding protein to MRE11, was also required for dsDNA responses, whereas NBS1, another binding protein to MRE11, was dispensable. Collectively, our results suggest that the MRE11–RAD50 complex plays important roles in recognition of dsDNA and initiation of STING-dependent signaling, in addition to its role in DNA-damage responses. PMID:23388631

  20. Construction of DNA logic gates utilizing a H+/Ag+ induced i-motif structure.


    Shi, Yunhua; Sun, Hongxia; Xiang, Junfeng; Chen, Hongbo; Yang, Qianfan; Guan, Aijiao; Li, Qian; Yu, Lijia; Tang, Yalin


    A simple technology to construct diverse DNA logic gates (OR and INHIBIT) has been designed utilizing a H(+) and/or Ag(+) induced i-motif structure. The logic gates are easily controlled and also show a real time response towards inputs. The research provides a new insight for designing DNA logic gates using an i-motif DNA structure. PMID:25349963

  1. Mitochondrial DNA plasticity is an essential inducer of tumorigenesis

    PubMed Central

    Lee, W T Y; Cain, J E; Cuddihy, A; Johnson, J; Dickinson, A; Yeung, K-Y; Kumar, B; Johns, T G; Watkins, D N; Spencer, A; St John, J C


    Although mitochondrial DNA has been implicated in diseases such as cancer, its role remains to be defined. Using three models of tumorigenesis, namely glioblastoma multiforme, multiple myeloma and osteosarcoma, we show that mitochondrial DNA plays defining roles at early and late tumour progression. Specifically, tumour cells partially or completely depleted of mitochondrial DNA either restored their mitochondrial DNA content or actively recruited mitochondrial DNA, which affected the rate of tumorigenesis. Nevertheless, non-depleted tumour cells modulated mitochondrial DNA copy number at early and late progression in a mitochondrial DNA genotype-specific manner. In glioblastoma multiforme and osteosarcoma, this was coupled with loss and gain of mitochondrial DNA variants. Changes in mitochondrial DNA genotype affected tumour morphology and gene expression patterns at early and late progression. Importantly, this identified a subset of genes that are essential to early progression. Consequently, mitochondrial DNA and commonly expressed early tumour-specific genes provide novel targets against tumorigenesis. PMID:27551510

  2. Mitochondrial DNA plasticity is an essential inducer of tumorigenesis.


    Lee, W T Y; Cain, J E; Cuddihy, A; Johnson, J; Dickinson, A; Yeung, K-Y; Kumar, B; Johns, T G; Watkins, D N; Spencer, A; St John, J C


    Although mitochondrial DNA has been implicated in diseases such as cancer, its role remains to be defined. Using three models of tumorigenesis, namely glioblastoma multiforme, multiple myeloma and osteosarcoma, we show that mitochondrial DNA plays defining roles at early and late tumour progression. Specifically, tumour cells partially or completely depleted of mitochondrial DNA either restored their mitochondrial DNA content or actively recruited mitochondrial DNA, which affected the rate of tumorigenesis. Nevertheless, non-depleted tumour cells modulated mitochondrial DNA copy number at early and late progression in a mitochondrial DNA genotype-specific manner. In glioblastoma multiforme and osteosarcoma, this was coupled with loss and gain of mitochondrial DNA variants. Changes in mitochondrial DNA genotype affected tumour morphology and gene expression patterns at early and late progression. Importantly, this identified a subset of genes that are essential to early progression. Consequently, mitochondrial DNA and commonly expressed early tumour-specific genes provide novel targets against tumorigenesis. PMID:27551510

  3. DNA Self-Assembling Nanostructures Induced by Trivalent Ions and Polycations

    NASA Astrophysics Data System (ADS)

    Kasyanenko, Nina; Afanasieva, Daria

    The purpose of this work is to compare DNA condensation induced by small multivalent ions and polycations. DNA complexes with trivalent ions Fe3+, La3+, [Co(NH3)6]3+, spermidine and cationic polymers in a solution were investigated. The influence of cations on the volume, persistent length, and secondary structure of DNA was studied. A comparison of DNA packaging induced by trivalent ions and polycations was made. DNA complexes with trivalent metal ions and polycations were characterized by means of low gradient viscometry, dynamic light scattering, circular dichroism, UV spectrometry, flow birefringence, and atomic force microscopy.

  4. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi


    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  5. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.


    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong


    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  6. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.


    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  7. Interannual variability of the Antarctic ozone hole in a GCM. Part 2: A comparison of unforced and QBO-induced variability

    SciTech Connect

    Shindell, D.T.; Rind, D.; Balachandran, N. )


    Simulations were performed with the Goddard Institute for Space Studies GCM including a prescribed quasi-biennial oscillation (QBO), applied at a constant maximum value, and a physically realistic parameterization of the heterogeneous chemistry responsible for severe polar ozone loss. While the QBO is primarily a stratospheric phenomenon, in this model the QBO modulates the amount and propagation of planetary wave energy in the troposphere as well as in the stratosphere. Dynamical activity is greater in the easterly than in the unforced case, while westerly years are dynamically more quiescent. By altering zonal winds and potential vorticity, the QBO forcing changes the refraction of planetary waves beginning in midwinter, causing the lower-stratospheric zonal average temperatures at Southern Hemisphere high latitudes to be [approximately]3--5 K warmer in the easterly phase than in the westerly during the late winter and early spring. Ozone loss varies nonlinearly with temperature, due to the sharp threshold for formation of heterogeneous chemistry surfaces, so that the mean daily total mass of ozone depleted in this region during September was 8.7 [times] 10[sup 10] kg in the QBO easterly maximum, as compared with 12.0 [times] 10[sup 10] kg in the westerly maximum and 10.3 [times] 10[sup 10] kg in the unforced case. Through this mechanism, the midwinter divergence of the Eliassen-Palm flux is well correlated with the subsequent springtime total ozone loss (R[sup 2] = 0.6). The chemical ozone loss differences are much larger than QBO-induced transport differences in the authors' model. Inclusion of the QBO forcing also increased the maximum variability in total ozone loss from the [approximately]20% value found in the unforced runs to [approximately]50%. These large variations in ozone depletion are very similar in size to the largest observed variations in the severity of the ozone hole. The results suggest that both random variability and periodic QBO forcing are

  8. Ozone-induced acute tracheobronchial epithelial injury: relationship to granulocyte emigration in the lung

    SciTech Connect

    Hyde, D.M.; Hubbard, W.C.; Wong, V.; Wu, R.; Pinkerton, K.; Plopper, C.G. )


    To investigate the relationship between granulocyte emigration and epithelial injury in specific airway generations of the tracheobronchial tree following short-term ozone exposure, we exposed rhesus monkeys for 8 h to 0.00 (controls) or 0.96 ppm ozone with post-exposure periods of 1, 12, 24, 72, and 168 h in filtered air before necropsy. There were five control and three exposed monkeys for each of the post-exposure times for a total of 20 monkeys. Neutrophils isolated from peripheral blood and labeled with 111In-tropolonate were infused in the cephalic vein in unanesthetized monkeys (except the 1-h group) 4 to 5 h before necropsy. The trachea and microdissected bronchi (fourth and ninth generations) and respiratory bronchioles (fifteenth generation) from the right upper lobe of each monkey were examined by electron microscopy. Labeled neutrophil influx into lung tissue and bronchoalveolar lavage fluid (BALF) was maximal at 12 h and returned to baseline by 24 h after exposure. This was in contrast to total neutrophils in BALF, which were significantly elevated through 24 h after exposure but returned to baseline by 72 h. Lavage protein was significantly elevated at 24 h after exposure but was at control levels at all other times. Morphometric observations showed epithelial necrosis at 1 and 12 h in the trachea and bronchioles but continued to be observed in significant numbers at 24 h after exposure in bronchi. A significant increase in the labeling index of epithelial cells was observed at 12 h only in bronchi. Epithelial necrosis and repair was associated with the presence of granulocytes in the epithelium and interstitium of all airway levels. However, eosinophils were maximally increased in the epithelium and interstitium of bronchi at 24 h after exposure when epithelial necrosis was maximal in these airways and when lavage protein was significantly elevated.

  9. Human cytomegalovirus induces JC virus DNA replication in human fibroblasts.

    PubMed Central

    Heilbronn, R; Albrecht, I; Stephan, S; Bürkle, A; zur Hausen, H


    JC virus, a human papovavirus, is the causative agent of the demyelinating brain disease progressive multifocal leucoencephalopathy (PML). PML is a rare but fatal disease which develops as a complication of severe immunosuppression. Latent JC virus is harbored by many asymptomatic carriers and is transiently reactivated from the latent state upon immunosuppression. JC virus has a very restricted host range, with human glial cells being the only tissue in which it can replicate at reasonable efficiency. Evidence that latent human cytomegalovirus is harbored in the kidney similar to latent JC virus led to the speculation that during episodes of impaired immunocompetence, cytomegalovirus might serve as helper virus for JC virus replication in otherwise nonpermissive cells. We show here that cytomegalovirus infection indeed leads to considerable JC virus DNA replication in cultured human fibroblasts that are nonpermissive for the replication of JC virus alone. Cytomegalovirus-mediated JC virus replication is dependent on the JC virus origin of replication and T antigen. Ganciclovir-induced inhibition of cytomegalovirus replication is associated with a concomitant inhibition of JC virus replication. These results suggest that reactivation of cytomegalovirus during episodes of immunosuppression might lead to activation of latent JC virus, which would enhance the probability of subsequent PML development. Ganciclovir-induced repression of both cytomegalovirus and JC virus replication may form the rational basis for the development of an approach toward treatment or prevention of PML. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248262

  10. Assessment of Protective Effect of Some Modern Agrochemicals against Ozone-Induced Stress in Sensitive Clover and Tobacco Cultivars

    PubMed Central

    Blum, Oleg; Didyk, Nataliya; Pavluchenko, Nataliya; Godzik, Barbara


    Some modern agrochemicals with antioxidant potential were tested for their protective effect against ozone injury using clover and tobacco ozone-sensitive cultivars as model plants subjected to ambient ozone at two sites (Kyiv city in Ukraine and Szarów village in Poland). All used agrochemicals showed partial protective effects against ozone injury on clover and tobacco. Conducted studies confirmed the effectiveness of modern fungicides belonging to strobilurin group as protectants of sensitive crops against ozone damage. The effectiveness of new growth regulators “Emistym C” and “Agrostymulin” was showed for the first time. Out of the studied agrochemicals, fungicide “Strobi” and natural growth regulator “Emistym C” demonstrated the best protective effects. These agrochemicals present promise for further studies of their possible utilization for enhancement of ozone tolerance of sensitive crops. PMID:21776257

  11. Total ozone, ozone vertical distributions, and stratospheric temperatures at South Pole, Antarctica, in 1986 and 1987

    NASA Technical Reports Server (NTRS)

    Komhyr, W. D.; Grass, R. D.; Reitelbach, P. J.; Franchois, P. R.; Kuester, S. E.


    Seventy-six electrochemical cell (ECC) ozonesondes were flown at South Pole, Antarctica, during 1987 in a continuing program to document year-round changes in Antarctica ozone that are dynamically and photochemically induced. Dobson spectrophotometer total ozone observations were also made. For the twilight months of March and September when Dobson instrument observations cannot be made at South Pole, total ozone amounts were deduced from the ECC ozonesonde soundings. ECC sonde total ozone data obtained during the polar night (April to August), supplemented the sparse total ozone data obtained from Dobson instrument moon observations. Similar ozone profile and total ozone observations were made at South Pole in 1986.

  12. Oxidative DNA damage induced by a metabolite of 2-naphthylamine, a smoking-related bladder carcinogen.


    Ohnishi, Shiho; Murata, Mariko; Kawanishi, Shosuke


    2-Naphthylamine (2-NA), a bladder carcinogen, is contained in cigarette smoke. DNA adduct formation is thought to be a major cause of DNA damage by carcinogenic aromatic amines. We have investigated whether a metabolite of 2-NA, 2-nitroso-1-naphthol (NO-naphthol) causes oxidative DNA damage, using (32)P-labeled DNA fragments. We compared the mechanism of DNA damage induced by NO-naphthol with that by N-hydroxy-4-aminobiphenyl (4-ABP(NHOH)), a metabolite of 4-aminobiphenyl, another smoking-related bladder carcinogen. NO-naphthol caused Cu(II)-mediated DNA damage at T > C > G residues, with non-enzymatic reduction by NADH. Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited the DNA damage, suggesting the involvement of H(2)O(2) and Cu(I). Some free. OH scavengers also attenuated NO-naphthol-induced DNA damage, while free. OH scavengers had no effect on the DNA damage induced by 4-ABP(NHOH). This difference suggests that the reactive species formed by NO-naphthol has more free. OH-character than that by 4-ABP(NHOH). A high-pressure liquid chromatograph equipped with an electrochemical detector showed that NO-naphthol induced 8-oxo-7,8-dihydro-2'-deoxyguanosine formation in the presence of NADH and Cu(II). The oxidative DNA damage by these amino-aromatic compounds may participate in smoking-related bladder cancer, in addition to DNA adduct formation. PMID:12149138

  13. DNA Bending is Induced in an Enhancer by the DNA-Binding Domain of the Bovine Papillomavirus E2 Protein

    NASA Astrophysics Data System (ADS)

    Moskaluk, Christopher; Bastia, Deepak


    The E2 gene of bovine papillomavirus type 1 has been shown to encode a DNA-binding protein and to trans-activate the viral enhancer. We have localized the DNA-binding domain of the E2 protein to the carboxyl-terminal 126 amino acids of the E2 open reading frame. The DNA-binding domain has been expressed in Escherichia coli and partially purified. Gel retardation and DNase I ``footprinting'' on the bovine papillomavirus type 1 enhancer identify the sequence motif ACCN6GGT (in which N = any nucleotide) as the E2 binding site. Using electrophoretic methods we have shown that the DNA-binding domain changes conformation of the enhancer by inducing significant DNA bending.

  14. The activation-induced cytidine deaminase (AID) efficiently targets DNA in nucleosomes but only during transcription

    PubMed Central

    Shen, Hong Ming; Poirier, Michael G.; Allen, Michael J.; North, Justin; Lal, Ratnesh; Widom, Jonathan


    The activation-induced cytidine deaminase (AID) initiates somatic hypermutation, class-switch recombination, and gene conversion of immunoglobulin genes. In vitro, AID has been shown to target single-stranded DNA, relaxed double-stranded DNA, when transcribed, or supercoiled DNA. To simulate the in vivo situation more closely, we have introduced two copies of a nucleosome positioning sequence, MP2, into a supercoiled AID target plasmid to determine where around the positioned nucleosomes (in the vicinity of an ampicillin resistance gene) cytidine deaminations occur in the absence or presence of transcription. We found that without transcription nucleosomes prevented cytidine deamination by AID. However, with transcription AID readily accessed DNA in nucleosomes on both DNA strands. The experiments also showed that AID targeting any DNA molecule was the limiting step, and they support the conclusion that once targeted to DNA, AID acts processively in naked DNA and DNA organized within transcribed nucleosomes. PMID:19380635

  15. Quantifying DNA and proteins using laser-induced thermophoresis

    NASA Astrophysics Data System (ADS)

    Yu, Li-Hsien; Wang, Chih-Hsuan; Chen, Yih-Fan


    The study utilized thermophoresis, the directed motion of molecules in a temperature gradient to quantify DNA and proteins for point-of-care applications. Because the direction and speed of thermophoretic motion is dependent on the size, charge, and conformation of the molecules, the binding between molecules can induce changes in their thermophoretic motion. To quantify biomolecules using thermophoresis, we mixed fluorescently-labeled capture probes with samples and then used an infrared laser to create a temperature gradient in the solution. By adding a small fraction of polymers to the buffer solution, we accumulated the fluorescent probes in a temperature gradient using the thermophoretic effects. The thermophoretic motion of the fluorescent probes significantly changed as the target molecules bind to the specially designed capture probes. Consequently, the level of the thermophoretic accumulation, which was determined by the spatial distribution of fluorescent probes, could be used to quantify molecules. This method functioned well even when the buffer contained 10% serum, which suggested that the detection was resistant to the interferences from the molecules in serum. The thermophoresis-based detection method developed in this study only requires a laser and an epi-fluorescence microscope during the detection. Unlike many other commonly seen biosensing methods, quantifying molecules using thermophoresis does not need any fluid channels or pumps for washing away unbound molecules during the detection process. In addition, the detection does not rely on any micro- or nanofabricated chips. In short, this thermophoresis-based biosensing method can be a simple, robust, and sensitive method for quantifying proteins and DNA.

  16. Impacts of thermal circulations induced by urbanization on ozone formation in the Pearl River Delta region, China

    NASA Astrophysics Data System (ADS)

    Li, Mengmeng; Song, Yu; Mao, Zhichun; Liu, Mingxu; Huang, Xin


    Thermal circulations induced by urbanization could exert important effects on regional ozone (O3) formation through regulating the chemical transformations and transport of O3 and its precursors. In this study, the Weather Research and Forecasting/Chemistry (WRF/Chem) model combined with remote sensing are used to investigate the impacts of urbanization-induced circulations on O3 formation in the Pearl River Delta (PRD) region, China. The urban heat island (UHI) effect in PRD significantly enhances turbulent mixing and modifies local circulations, i.e., initiates the UHI circulation and strengthens the sea breeze, which in turn cause a detectable decrease of daytime O3 concentration (-1.3 ppb) and an increase of O3 (+5.2 ppb) around the nocturnal rush-hours. The suppressed O3 titration destruction due to NOx dilution into the deeper urban boundary layer (200-400 m) is the main reason for elevated nocturnal O3 levels. In the daytime, however, the upward transport of O3 precursors weakens near-surface O3 photochemical production and conversely enhances upper-level O3 generation. Furthermore, the surface UHI convergence flow and intensified sea breeze act to effectively trap O3 at the suburban and coastal regions.

  17. Seasonal fluctuation of DNA photodamage in marine plankton assemblages at Palmer Station, Antarctica.


    Meador, Jarah; Jeffrey, Wade H; Kase, Jason P; Pakulski, J Dean; Chiarello, Stephanie; Mitchell, David L


    Ultraviolet radiation-induced DNA damage frequencies were measured in DNA dosimeters and natural plankton communities during the austral spring at Palmer Station, Antarctica, during the 1999-2000 field season. We found that the fluence of solar ultraviolet-B radiation (UV-B) at the earth's surface correlated with stratospheric ozone concentrations, with significant ozone depletion observed because of "ozone hole" conditions. To verify the interdependence of ozone depletion and DNA damage in natural microbial communities, seawater was collected daily or weekly from Arthur Harbor at Palmer Station, Antarctica, throughout "ozone season," exposed to ambient sunlight between 0600 and 1800 h and fractionated using membrane filtration to separate phytoplankton and bacterioplankton populations. DNA from these fractions was isolated and DNA damage measured using radioimmunoassay. Under low-ozone conditions cyclobutane dimer concentrations in bacterioplankton and phytoplankton communities were maximal. DNA damage measured in dosimeters correlated closely with ozone concentrations and UV-B fluence. Our studies offer further support to the theory that stratospheric deozonation is detrimental to marine planktonic organisms in the Southern Ocean. PMID:11950092

  18. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia


    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  19. DNA fragment sizing and sorting by laser-induced fluorescence

    SciTech Connect

    Jett, J.H.; Hammond, M.L.; Keller, R.A.; Marrone, B.L.; Martin, J.C.


    A method is provided for obtaining DNA fingerprints using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a selected sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is directly proportional to the fragment length. Additional dyes can be bound to the DNA piece and DNA fragments to provide information additional to length information. Oligonucleotide specific dyes and/or hybridization probes can be bound to the DNA fragments to provide information on oligonucleotide distribution or probe hybridization to DNA fragments of different sizes.

  20. Heterogeneous light-induced ozone processing on the organic coatings in the atmosphere

    NASA Astrophysics Data System (ADS)

    Net, Sopheak; Nieto-Gligorovski, Laura; Gligorovski, Sašo; Temime-Rousell, Brice; Barbati, Stephane; Lazarou, Yannis G.; Wortham, Henri

    Many of the more recent studies concerning heterogeneous reactions of atmospheric interest, carry, in some cases, much more details but still follow the basic philosophy of the first pioneering studies. Therefore, in this study the accent is put on the additional complexities that arise when the aerosols of interest have more complex compositions. Hence, it is attempted to identify the products following the simultaneous ozone processing and light irradiation on particles coated with 4-phenoxyphenol in the presence of 4-carboxybenzophenone as a photosensitizer. In order to reveal a more complete picture on the fate of these aromatic compounds under controlled experimental conditions, different analytical tools such as gas chromatography coupled to mass spectrometry (GC-MS) and proton transfer reaction-mass spectrometry (PTR-MS) have been applied. Several surface bound products were identified via GC-MS and some of them (phenol, hydroquinone, catechol, 4-hydroxybenzoic acid, benzoic acid, fumaric acid, terephthalic acid, maleic acid, 1,2,4-trihydroxybenzene and 4,4'-oxydiphenol) confirmed with standards. The main volatile secondary products as identified by PTR-MS in this study were formic acid, phenol and p-benzoquinone. A reaction mechanism was proposed and density functional theory calculations were performed in order to elucidate the initial steps of the ozonolysis reaction on 4-phenoxyphenol in the presence of 4-carboxybenzophenone.

  1. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis.


    Li, Diqiu; Huang, Qingchun; Lu, Miaoqing; Zhang, Lei; Yang, Zhichuan; Zong, Mimi; Tao, Liming


    The organophosphate insecticide chlorpyrifos (CPF) is known to induce neurological effects, malformation and micronucleus formation, persistent developmental disorders, and maternal toxicity in rats and mice. The binding of chlorpyrifos with DNA to produce DNA adducts leads to an increasing social concern about the genotoxic risk of CPF in human, but CPF-induced cytotoxicity through DNA damage and cell apoptosis is not well understood. Here, we quantified the cytotoxicity and potential genotoxicity of CPF using the alkaline comet assay, γH2AX foci formation, and the DNA laddering assay in order to detect DNA damage and apoptosis in human HeLa and HEK293 cells in vitro. Drosophila S2 cells were used as a positive control. The alkaline comet assay showed that sublethal concentrations of CPF induced significant concentration-dependent increases in single-strand DNA breaks in the treated cells compared with the control. The percentage of γH2AX-positive HeLa cells revealed that CPF also causes DNA double-strand breaks in a time-dependent manner. Moreover, DNA fragmentation analysis demonstrated that exposure to CPF induced a significant concentration- and time-dependent increase in cell apoptosis. We conclude that CPF is a strongly genotoxic agent that induces DNA damage and cell apoptosis. PMID:26002045

  2. Vorinostat Induces Reactive Oxygen Species and DNA Damage in Acute Myeloid Leukemia Cells

    PubMed Central

    Pettersson, Filippa; Retrouvey, Hélène; Skoulikas, Sophia; Miller, Wilson H.


    Histone deacetylase inhibitors (HDACi) are promising anti-cancer agents, however, their mechanisms of action remain unclear. In acute myeloid leukemia (AML) cells, HDACi have been reported to arrest growth and induce apoptosis. In this study, we elucidate details of the DNA damage induced by the HDACi vorinostat in AML cells. At clinically relevant concentrations, vorinostat induces double-strand breaks and oxidative DNA damage in AML cell lines. Additionally, AML patient blasts treated with vorinostat display increased DNA damage, followed by an increase in caspase-3/7 activity and a reduction in cell viability. Vorinostat-induced DNA damage is followed by a G2-M arrest and eventually apoptosis. We found that pre-treatment with the antioxidant N-acetyl cysteine (NAC) reduces vorinostat-induced DNA double strand breaks, G2-M arrest and apoptosis. These data implicate DNA damage as an important mechanism in vorinostat-induced growth arrest and apoptosis in both AML cell lines and patient-derived blasts. This supports the continued study and development of vorinostat in AMLs that may be sensitive to DNA-damaging agents and as a combination therapy with ionizing radiation and/or other DNA damaging agents. PMID:21695163

  3. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M


    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  4. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  5. Stress-induced DNA damage biomarkers: applications and limitations.


    Nikitaki, Zacharenia; Hellweg, Christine E; Georgakilas, Alexandros G; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  6. Mitochondrial DNA damage induced autophagy, cell death, and disease

    PubMed Central

    Van Houten, Bennett; Hunter, Senyene E.; Meyer, Joel N.


    Mammalian mitochondria contain multiple small genomes. While these organelles have efficient base excision removal of oxidative DNA lesions and alkylation damage, many DNA repair systems that work on nuclear DNA damage are not active in mitochondria. What is the fate of DNA damage in the mitochondria that cannot be repaired or that overwhelms the repair system? Some forms of mitochondrial DNA damage can apparently trigger mitochondrial DNA destruction, either via direct degradation or through specific forms of autophagy, such as mitophagy. However, accumulation of certain types of mitochondrial damage, in the absence of DNA ligase III (Lig3) or exonuclease G (EXOG), enzymes required for repair, can directly trigger cell death. This review examines the cellular effects of persistent damage to mitochondrial genomes and discusses the very different cell fates that occur in response to different kinds of damage. PMID:26709760

  7. Delayed climate change in the Southern Hemisphere induced by stratospheric ozone recovery, as projected by the CMIP5 models (Invited)

    NASA Astrophysics Data System (ADS)

    Polvani, L. M.; Barnes, E. A.


    Stratospheric ozone is expected to recover in the second half of this century, due to the regulation of ozone depleting substances by the Montreal Protocol. Targeted modeling studies have suggested that the climate response to ozone recovery will greatly oppose the climate response to increasing greenhouse-gases (GHG); owever, the extent of this cancellation remains unclear, as few such studies are available. Here, we analyze the much larger set of models participating in the Coupled Model Intercomparison Project, phase 5 (CMIP5), all of which include stratospheric ozone depletion and recovery. We show that the closing of the ozone hole will cause a delay in summer-time (DJF) Southern Hemisphere climate change, between now and mid-century. Specifically, we find that the position of the jet stream, the width of the subtropical dry-zones, the seasonality of surface temperatures, and sea ice concentrations all exhibit significantly reduced summer-time trends over the first half of the 21st Century as a consequence of ozone recovery. Beyond mid-century, forcing from GHG emissions begins to dominate the climate response. We also compare the relative influences of future GHG emissions and historic ozone depletion, and find that the simulated DJF tropospheric circulation changes in the Southern Hemisphere between 1965-2005 -- driven primarily by ozone depletion -- are larger than the projected changes in any future scenario over the entire 21st Century.

  8. Perchlorate content of plant foliage reflects a wide range of species-dependent accumulation but not ozone-induced biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Perchlorate interferes with uptake of iodide in humans. Emission inventories do not explain observed distributions. Ozone is implicated in the natural origin of perchlorate, and has increased since pre-industrial times. Ozone produces perchlorate in vitro from chloride, and plant tissues contain chl...

  9. The glutathione-S-transferase Mu 1 null genotype modulates ozone-induced airway inflammation in humans*

    EPA Science Inventory

    Background: The Glutathione-S-Transferase Mu 1 null genotype has been reported to be a risk factor for acute respiratory disease associated with increases in ambient air ozone. Ozone is known to cause an immediate decrease in lung function and increased airway inflammation. Howev...

  10. DNA Compaction Induced by a Cationic Polymer or Surfactant Impact Gene Expression and DNA Degradation

    PubMed Central

    Ainalem, Marie-Louise; Bartles, Andrew; Muck, Joscha; Dias, Rita S.; Carnerup, Anna M.; Zink, Daniele; Nylander, Tommy


    There is an increasing interest in achieving gene regulation in biotechnological and biomedical applications by using synthetic DNA-binding agents. Most studies have so far focused on synthetic sequence-specific DNA-binding agents. Such approaches are relatively complicated and cost intensive and their level of sophistication is not always required, in particular for biotechnological application. Our study is inspired by in vivo data that suggest that DNA compaction might contribute to gene regulation. This study exploits the potential of using synthetic DNA compacting agents that are not sequence-specific to achieve gene regulation for in vitro systems. The semi-synthetic in vitro system we use include common cationic DNA-compacting agents, poly(amido amine) (PAMAM) dendrimers and the surfactant hexadecyltrimethylammonium bromide (CTAB), which we apply to linearized plasmid DNA encoding for the luciferase reporter gene. We show that complexing the DNA with either of the cationic agents leads to gene expression inhibition in a manner that depends on the extent of compaction. This is demonstrated by using a coupled in vitro transcription-translation system. We show that compaction can also protect DNA against degradation in a dose-dependent manner. Furthermore, our study shows that these effects are reversible and DNA can be released from the complexes. Release of DNA leads to restoration of gene expression and makes the DNA susceptible to degradation by Dnase. A highly charged polyelectrolyte, heparin, is needed to release DNA from dendrimers, while DNA complexed with CTAB dissociates with the non-ionic surfactant C12E5. Our results demonstrate the relation between DNA compaction by non-specific DNA-binding agents and gene expression and gene regulation can be achieved in vitro systems in a reliable dose-dependent and reversible manner. PMID:24671109

  11. Subacute inhalation exposure to ozone induces systemic inflammation but not insulin resistance in a diabetic mouse model.


    Ying, Zhekang; Allen, Katryn; Zhong, Jixin; Chen, Minjie; Williams, Keisha M; Wagner, James G; Lewandowski, Ryan; Sun, Qinghua; Rajagopalan, Sanjay; Harkema, Jack R


    Epidemiological studies suggest that diabetics may be more susceptible to the adverse health effects from exposure to high ambient concentrations of ozone, the primary oxidant gas in photochemical smog. While increased morbidity and mortality from ozone inhalation has been linked to disruption of normal cardiovascular and airway functions, potential effects on glucose and insulin homeostasis are not understood. We tested the hypothesis that ozone exposure would worsen metabolic homeostasis in KKAy mice, a genetic diabetic animal model. Male KKAy mice were exposed to 0.5 ppm ozone for 13 consecutive weekdays, and then assessed for airway, adipose and systemic inflammation, glucose homeostasis, and insulin signaling. Ozone exposure increased plasma TNFα, as well as expression of VCAM-1, iNOS and IL-6 in both pulmonary and adipose tissues. Pro-inflammatory CD11b(+)Gr-1(lo)7/4(hi) macrophages were increased by 200% in adipose tissue, but unchanged in blood. Interestingly, glucose levels were not significantly different in the insulin tolerance test between air- and ozone-exposed mice, whereas fasting insulin levels and HOMA-IR in ozone-exposed animals were significantly reduced. These changes were accompanied by increased insulin signaling in skeletal muscle and liver, but not adipose tissues. Ozone also caused decrease in body weight and plasma leptin. Our results show that in addition to marked local and systemic inflammation, ozone increases insulin sensitivity that may be related to weight loss/leptin sensitization-dependent mechanisms in KKAy mice, warranting further study on the role of hyperglycemia in mediating cardiometabolic effects of ozone inhalation. PMID:26986950

  12. Subacute Inhalation Exposure to Ozone Induces Systemic Inflammation but not Insulin Resistance in a Diabetic Mouse Model

    PubMed Central

    Ying, Zhekang; Allen, Katryn; Zhong, Jixin; Chen, Minjie; Williams, Keisha M.; Wagner, James G.; Lewandowski, Ryan; Sun, Qinghua; Rajagopalan, Sanjay; Harkema, Jack R.


    Epidemiological studies suggest that diabetics may be more susceptible to the adverse health effects from exposure to high ambient concentrations of ozone, the primary oxidant gas in photochemical smog. While increased morbidity and mortality from ozone inhalation has been linked to disruption of normal cardiovascular and airway functions, potential effects on glucose and insulin homeostasis are not understood. We tested the hypothesis that ozone exposure would worsen metabolic homeostasis in KKAy mice, a genetic diabetic animal model. Male KKAy mice were exposed to 0.5 ppm ozone for thirteen consecutive weekdays, and then assessed for airway, adipose and systemic inflammation, glucose homeostasis, and insulin signaling. Ozone exposure caused increased plasma TNFα, as well as expression of VCAM-1, iNOS and IL-6 in both pulmonary and adipose tissues. Pro-inflammatory CD11b+Gr-1lo7/4hi macrophages were increased 200% in adipose tissue but unchanged in blood. Interestingly, glucose levels were not significantly different in the insulin tolerance test between air and ozone-expose mice, whereas fasting insulin levels and HOMA-IR in ozone-exposed animals were significantly reduced. These changes were accompanied by increased insulin signaling in skeletal muscle and liver, but not adipose tissues. Ozone also caused decreases in body weight and plasma leptin. Our results show that in addition to marked local and systemic inflammation, ozone increases insulin sensitivity that may be related to weight loss/leptin sensitization-dependent mechanisms in KKAy mice, warranting further study on the role of hyperglycemia in mediating cardiometabolic effects of ozone inhalation. PMID:26986950

  13. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  14. Corticosteroid administration modifies ozone-induced increases in sheep airway blood flow

    SciTech Connect

    Gunther, R.A.; Yousef, M.A.; Schelegle, E.S.; Cross, C.E. )


    Recently, we have shown that exposure of intubated conscious sheep to 3 to 4 ppm ozone (O3) for 3 h increases bronchial blood flow (Qbr). The purpose of the present study was to assess the potential role of corticosteroids in modulating this increase. Six nasally intubated sheep were exposed to filtered room air, 3.5 ppm O3 on two separate occasions, and 3.5 ppm O3 plus methyl-prednisone, for 3 h. Qbr was measured using a chronically implanted 20 MHz pulsed Doppler flow probe. Qbr, mean aortic pressure, cardiac output, pulmonary artery pressure, arterial blood gases, and core temperature were monitored. After 3 h of 3.5 ppm O3, Qbr increased from 3.2 +/- 0.5 (mean +/- SEM) to 8.5 +/- 1.6 KHz, whereas bronchial vascular resistance (BVR) decreased from the baseline value of 43.6 +/- 8.0 to 15.0 +/- 3 mm Hg/KHz. With corticosteroids, baseline Qbr was 3.2 +/- 0.6 and BVR was 44.2 +/- 9.7; after 3 h of 3.5 ppm O3, Qbr was 3.3 +/- 0.5 KHz and BVR was 39.0 +/- 8.0 mm Hg/KHz. The two 3.5-ppm O3 exposures without corticosteroids were impressively reproducible. Except for Qbr and BVR, no other measured cardiovascular parameters were affected by O3. The results indicate that corticosteroids are capable of interfering with mediator, neurohumoral, or inflammatory cell mechanisms responsible for vasodilation of the airway microcirculation after O3 exposure, but do not specifically address the specific processes whereby this attenuation occurs.

  15. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.


    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr


    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  16. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage–induced cell senescence

    PubMed Central

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A.; Kumar, Sheetal; Kalab, Petr


    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase–regulated nuclear–cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage–induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β–dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP–regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  17. The role of nitric oxide on DNA damage induced by benzene metabolites

    PubMed Central



    Benzene, a tobacco constituent, is a leukemogen in humans and a carcinogen in rodents. Several benzene metabolites generate superoxide anion (O2•−) and induce nitric oxide synthase in the bone marrow of mice. We hypothesized that the reaction of nitric oxide (•NO) with O2•− leads to the formation of peroxynitrite as an intermediate during benzene metabolism. This hypothesis was supported by demonstrating that the exposure of mice to benzene produced nitrated metabolites and enhanced the levels of protein-bound 3-nitrotyrosine in the bone marrow of mice in vivo. In the current study, we investigated the influence of nitric oxide, generated from sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate, on DNA strand breaks induced by each single or binary benzene metabolite at different doses and compared the levels of the DNA damage induced by each benzene metabolite in the presence of nitric oxide with the levels of DNA strand breaks induced by peroxynitrite at similar doses in vitro. We found that among benzene metabolites only 1,2,4-trihydroxybenzene (BT) can induce significant DNA damage in the absence of nitric oxide. While 1,4-dihydroxybenzene (HQ), 1,4-benzo-quinone (BQ) and 1,2-dihydroxybenzene (CAT) require •NO to induce DNA strand breaks, hydroquinone was the most potent DNA-damaging benzene metabolite in the presence of •NO. The order of DNA breaks by benzene metabolites in the presence of •NO is: Peroxynitrite = HQ > BT > BQ > CAT. The •NO and O2•− scavengers inhibited DNA damage induced by [HQ+•NO]. Benzene, trans,trans-muconaldehyde, and phenol, do not induce DNA strand breaks either in the absence or presence of •NO. However, adding phenol to [HQ+•NO] leads to greater DNA damage than [HQ+•NO] alone. Collectively, these results suggest that nitric oxide is an important factor in DNA damage induced by certain benzene metabolites, probably via the formation of the peroxynitrite intermediate. Phenol, the major benzene metabolite

  18. Vitamin C Compound Mixtures Prevent Ozone-Induced Oxidative Damage in Human Keratinocytes as Initial Assessment of Pollution Protection

    PubMed Central

    Valacchi, Giuseppe; Sticozzi, Claudia; Belmonte, Giuseppe; Cervellati, Franco; Demaude, Julien; Chen, Nannan; Krol, Yevgeniy; Oresajo, Christian


    Introduction One of the main functions of cutaneous tissues is to protect our body from the outdoor insults. Ozone (O3) is among the most toxic stressors to which we are continuously exposed and because of its critical location, the skin is one of the most susceptible tissues to the oxidative damaging effect of O3. O3 is not able to penetrate the skin, and although it is not a radical per se, the damage is mainly a consequence of its ability to induce oxidative stress via the formation of lipid peroxidation products. Aim of Study In this study we investigated the protective effect of defined “antioxidant” mixtures against O3 induced oxidative stress damage in human keratinocytes and understand their underlying mechanism of action. Results Results showed that the mixtures tested were able to protect human keratinocytes from O3-induced cytotoxicity, inhibition of cellular proliferation, decrease the formation of HNE protein adducts, ROS, and carbonyls levels. Furthermore, we have observed the decreased activation of the redox sensitive transcription factor NF-kB, which is involved in transcribing pro-inflammatory cytokines and therefore constitutes one of the main players associated with O3 induced skin inflammation. Cells exposed to O3 demonstrated a dose dependent increase in p65 subunit nuclear expression as a marker of NF-kB activation, while pre-treatment with the mixtures abolished NF-kB nuclear translocation. In addition, a significant activation of Nrf2 in keratinocytes treated with the mixtures was also observed. Conclusion Overall this study was able to demonstrate a protective effect of the tested compounds versus O3-induced cell damage in human keratinocytes. Pre-treatment with the tested compounds significantly reduced the oxidative damage induced by O3 exposure and this protective effect was correlated to the abolishment of NF-kB nuclear translocation, as well as activation of Nrf2 nuclear translocation activating the downstream defence enzymes

  19. DNA repair and the evolution of transformation in Bacillus subtilis. II. Role of inducible repair

    SciTech Connect

    Wojciechowski, M.F.; Hoelzer, M.A.; Michod, R.E.


    In Bacillus subtilis, DNA repair and recombination are intimately associated with competence, the physiological state in which the bacterium can bind, take up and recombine exogenous DNA. Previously, we have shown that the homologous DNA transformation rate (ratio of transformants to total cells) increases with increasing UV dosage if cells are transformed after exposure to UV radiation (UV-DNA), whereas the transformation rate decreases if cells are transformed before exposure to UV (DNA-UV). In this report, by using different DNA repair-deficient mutants, we show that the greater increase in transformation rate in UV-DNA experiments than in DNA-UV experiments does not depend upon excision repair or inducible SOS-like repair, although certain quantitative aspects of the response do depend upon these repair systems. We also show that there is no increase in the transformation rate in a UV-DNA experiment when repair and recombination proficient cells are transformed with nonhomologous plasmid DNA, although the results in a DNA-UV experiment are essentially unchanged by using plasmid DNA. We have used din operon fusions as a sensitive means of assaying for the expression of genes under the control of the SOS-like regulon in both competent and noncompetent cell subpopulations as a consequence of competence development and our subsequent experimental treatments. Results indicate that the SOS-like system is induced in both competent and noncompetent subpopulations in our treatments and so should not be a major factor in the differential response in transformation rate observed in UV-DNA and DNA-UV treatments. These results provide further support to the hypothesis that the evolutionary function of competence is to bring DNA into the cell for use as template in the repair of DNA damage.

  20. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    SciTech Connect

    Qin Xujun; Hudson, Laurie G.; Liu Wenlan; Timmins, Graham S.; Liu Kejian


    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite ({<=} 2 {mu}M) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 {mu}M arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic.

  1. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung


    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  2. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.


    Song, Eun Ah; Kim, Hyeyoung


    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  3. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.


    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  4. Azobenzene Photoisomerization-Induced Destabilization of B-DNA

    PubMed Central

    Biswas, Mithun; Burghardt, Irene


    Molecular photoswitches provide a promising way for selective regulation of nanoscaled biological systems. It has been shown that conformational changes of azobenzene, one of the widely used photoswitches, can be used to reversibly control DNA duplex formation. Here, we investigate the conformational response of DNA upon azobenzene binding and isomerization, using a threoninol linker that has been experimentally investigated recently. To this end, nonequilibrium molecular dynamics simulations are carried out using a switching potential describing the photoinduced isomerization. Attachment of azobenzene leads to a distortion of the DNA helical conformation that is similar for the trans and cis forms. However, the trans form is stabilized by favorable stacking interactions whereas the cis form is found to remain flipped out of the basepair-stacked position. Multiple azobenzene attachment augments the distortion in DNA helical conformation. The distorted DNA retains nativelike pairing of bases at ambient temperatures, but shows weaker basepairing compared to native DNA at an elevated temperature. PMID:25140428

  5. The determination of the DNA sequence specificity of bleomycin-induced abasic sites.


    Chen, Jon K; Murray, Vincent


    The DNA sequence specificity of the cancer chemotherapeutic agent, bleomycin, was determined with high precision in purified plasmid DNA using an improved technique. This improved technique involved the labelling of the 5'- and 3'-ends of DNA with different fluorescent tags, followed by simultaneous cleavage by bleomycin and capillary electrophoresis with laser-induced fluorescence. This permitted the determination of bleomycin cleavage specificity with high accuracy since end-label bias was greatly reduced. Bleomycin produces single- and double-strand breaks, abasic sites and other base damage in DNA. This high-precision method was utilised to elucidate, for the first time, the DNA sequence specificity of bleomycin-induced DNA damage at abasic sites. This was accomplished using endonuclease IV that cleaves DNA at abasic sites after bleomycin damage. It was found that bleomycin-induced abasic sites formed at 5'-GC and 5'-GT sites while bleomycin-induced phosphodiester strand breaks formed mainly at 5'-GT dinucleotides. Since bleomycin-induced abasic sites are produced in the absence of molecular oxygen, this difference in DNA sequence specificity could be important in hypoxic tumour cells. PMID:26940956

  6. Basic Mechanics of DNA Methylation and the Unique Landscape of the DNA Methylome in Metal-Induced Carcinogenesis

    PubMed Central

    Brocato, Jason; Costa, Max


    DNA methylation plays an intricate role in the regulation of gene expression and events that compromise the integrity of the methylome may potentially contribute to disease development. DNA methylation is a reversible and regulatory modification that elicits a cascade of events leading to chromatin condensation and gene silencing. In general, normal cells are characterized by gene-specific hypomethylation and global hypermethylation, while cancer cells portray a reverse profile to this norm. The unique methylome displayed in cancer cells is induced after exposure to carcinogenic metals such as nickel, arsenic, cadmium, and chromium (VI). These metals alter the DNA methylation profile by provoking both hyper- and hypomethylation events. The metal-stimulated deviations to the methylome are possible mechanisms for metal-induced carcinogenesis and may provide potential biomarkers for cancer detection. Development of therapies based on the cancer methylome requires further research including human studies that supply results with larger impact and higher human relevance. PMID:23844698

  7. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  8. Atmospheric photochemical transformations enhance 1,3-butadiene-induced inflammatory responses in human epithelial cells: The role of ozone and other photochemical degradation products.


    Doyle, Melanie; Sexton, Kenneth G; Jeffries, Harvey; Jaspers, Ilona


    Chemistry of hazardous air pollutants has been studied for many years, yet little is known about how these chemicals, once reacted within urban atmospheres, affect healthy and susceptible individuals. Once released into the atmosphere, 1,3-butadiene (BD) reacts with hydroxyl radicals and ozone (created by photochemical processes), to produce many identified and unidentified products. Once this transformation has occurred, the toxic potential of atmospheric pollutants such as BD in the ambient environment is currently unclear. During this study, environmental irradiation chambers (also called smog chambers), utilizing natural sunlight, were used to create photochemical transformations of BD. The smog chamber/in vitro exposure system was designed to investigate the toxicity of chemicals before and after photochemical reactions and to investigate interactions with the urban atmosphere using representative in vitro samples. In this study, we determined the relative toxicity and inflammatory gene expression induced by coupling smog chamber atmospheres with an in vitro system to expose human respiratory epithelial cells to BD, BDs photochemical degradation products, or the equivalent ozone generated within the photochemical mixture. Exposure to the photochemically generated products of BD (primarily acrolein, acetaldehyde, formaldehyde, furan and ozone) induced significant increases in cytotoxicity, IL-8, and IL-6 gene expression compared to a synthetic mixture of primary products that was created by injecting the correct concentrations of the detected products from the irradiation experiments. Interestingly, exposure to the equivalent levels of ozone generated during the photochemical transformation of BD did not induce the same level of inflammatory cytokine release for either exposure protocol, suggesting that the effects from ozone alone do not account for the entire response in the irradiation experiments. These results indicate that BDs full photochemical product

  9. Ozone enhances diesel exhaust particles (DEP)-induced interleukin-8 (IL-8) gene expression in human airway epithelial cells through activation of nuclear factors- kappaB (NF-kappaB) and IL-6 (NF-IL6).


    Kafoury, Ramzi M; Kelley, James


    Ozone, a highly reactive oxidant gas is a major component of photochemical smog. As an inhaled toxicant, ozone induces its adverse effects mainly on the lung. Inhalation of particulate matter has been reported to cause airway inflammation in humans and animals. Furthermore, epidemiological evidence has indicated that exposure to particulate matter (PM[2.5-10]), including diesel exhaust particles (DEP) has been correlated with increased acute and chronic respiratory morbidity and exacerbation of asthma. Previously, exposure to ozone or particulate matter and their effect on the lung have been addressed as separate environmental problems. Ozone and particulate matter may be chemically coupled in the ambient air. In the present study we determined whether ozone exposure enhances DEP effect on interleukin-8 (IL-8) gene expression in human airway epithelial cells. We report that ozone exposure (0.5 ppm x 1 hr) significantly increased DEP-induced IL-8 gene expression in A549 cells (117 +/- 19 pg/ml, n = 6, p < 0.05) as compared to cultures treated with DEP (100 microg/ml x 4 hr) alone (31 +/- 3 pg/ml, n = 6), or cultures exposed to purified air (24 +/- 6 pg/ml, n = 6). The increased DEP-induced IL-8 gene expression following ozone exposure was attributed to ozone-induced increase in the activity of the transcription factors NF-kappaB and NF-IL6. The results of the present study indicate that ozone exposure enhances the toxicity of DEP in human airway epithelial cells by augmenting IL-8 gene expression, a potent chemoattractant of neutrophils in the lung. PMID:16819095

  10. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.


    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A


    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity. PMID:23793613

  11. Multi-model prediction of climate-induced changes in ozone and reactive nitrogen fluxes into the troposphere

    NASA Astrophysics Data System (ADS)

    Hegglin, M. I.; Shepherd, T. G.; Ccmval Modelling Team


    Chemistry-Climate Models (CCMs) consistently predict a strengthening of the stratospheric Brewer-Dobson circulation due to climate change. The associated changes in the distribution of stratospheric ozone and reactive nitrogen will affect not only the flux of those tracers into the troposphere, but also the amount of ultra-violet radiation reaching the troposphere. While the contribution of stratospheric ozone to the total tropospheric ozone budget is only about 10%, it strongly affects ozone concentrations in the upper troposphere, where ozone has a relatively long lifetime (about one month) and its largest impact on radiative forcing. At the same time, changes in reactive nitrogen and UV radiation may influence the efficacy of chemical processes in the troposphere, and have adverse effects on human beings and the ecosystem. We present new results from a multi-model comparison of predicted changes in stratospheric ozone and reactive nitrogen fluxes using state-of-the-art CCMs, and the role of ozone depletion and recovery in modulating them. In order to gain confidence in the model predictions, we also evaluate the models’ capabilities to represent dynamical and chemical processes in the lower stratosphere through process-oriented diagnostics using both aircraft and satellite data.

  12. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping


    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  13. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.


    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L


    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma. PMID:24798949

  14. DNA damage-induced type I interferon promotes senescence and inhibits stem cell function

    PubMed Central

    Carbone, Christopher J.; Zhao, Bin; Katlinski, Kanstantsin V.; Zheng, Hui; Guha, Manti; Li, Ning; Chen, Qijun; Yang, Ting; Lengner, Christopher J.; Greenberg, Roger A.; Johnson, F. Brad; Fuchs, Serge Y.


    Expression of type I interferons (IFN) can be induced by DNA damaging agents but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β dependent manner, stimulates cell-autonomous IFNβ expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFNβ and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA damage responses, activate the p53 pathway, promote senescence and inhibit stem cells function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the life span of Terc knockout mice. These data identify DNA damage response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging. PMID:25921537

  15. Regulation of ozone-induced lung inflammation and injury by the β-galactoside-binding lectin galectin-3.


    Sunil, Vasanthi R; Francis, Mary; Vayas, Kinal N; Cervelli, Jessica A; Choi, Hyejeong; Laskin, Jeffrey D; Laskin, Debra L


    Macrophages play a dual role in ozone toxicity, contributing to both pro- and anti-inflammatory processes. Galectin-3 (Gal-3) is a lectin known to regulate macrophage activity. Herein, we analyzed the role of Gal-3 in the response of lung macrophages to ozone. Bronchoalveolar lavage (BAL) and lung tissue were collected 24-72h after exposure (3h) of WT and Gal-3(-/-) mice to air or 0.8ppm ozone. In WT mice, ozone inhalation resulted in increased numbers of proinflammatory (Gal-3(+), iNOS(+)) and anti-inflammatory (MR-1(+)) macrophages in the lungs. While accumulation of iNOS(+) macrophages was attenuated in Gal-3(-/-) mice, increased numbers of enlarged MR-1(+) macrophages were noted. This correlated with increased numbers of macrophages in BAL. Flow cytometric analysis showed that these cells were CD11b(+) and consisted mainly (>97%) of mature (F4/80(+)CD11c(+)) proinflammatory (Ly6GLy6C(hi)) and anti-inflammatory (Ly6GLy6C(lo)) macrophages. Increases in both macrophage subpopulations were observed following ozone inhalation. Loss of Gal-3 resulted in a decrease in Ly6C(hi) macrophages, with no effect on Ly6C(lo) macrophages. CD11b(+)Ly6G(+)Ly6C(+) granulocytic (G) and monocytic (M) myeloid derived suppressor cells (MDSC) were also identified in the lung after ozone. In Gal-3(-/-) mice, the response of G-MDSC to ozone was attenuated, while the response of M-MDSC was heightened. Changes in inflammatory cell populations in the lung of ozone treated Gal-3(-/-) mice were correlated with reduced tissue injury as measured by cytochrome b5 expression. These data demonstrate that Gal-3 plays a role in promoting proinflammatory macrophage accumulation and toxicity in the lung following ozone exposure. PMID:25724551

  16. Measurement of 60Co-gamma ray-induced DNA damage by capillary electrophoresis.


    Nackerdien, Z; Atha, D


    Capillary electrophoresis was employed in this study to monitor 60Co-gamma ray-induced damage to a 1 kb DNA ladder which consists of restriction fragments ranging from 75 to 12,000 bp. DNA samples (0.5 mg/ml) were exposed to 0-60 Gy of gamma-radiation in the presence and absence of 110 mumol/l ethidium bromide (EB). The analysis showed peak broadening without significant changes in the size distribution of irradiated fragments. Radiation-induced conformational changes may account for this peak broadening. EB addition caused small increases in the retention times of DNA fragments without affecting the overall DNA damage. This indicates that the presence of intercalated EB during radiation will not stabilize the DNA against 60Co-gamma ray-induced damage. PMID:8876442

  17. Ideas and perspectives: Southwestern tropical Atlantic coral growth response to atmospheric circulation changes induced by ozone depletion in Antarctica

    NASA Astrophysics Data System (ADS)

    Evangelista, Heitor; Wainer, Ilana; Sifeddine, Abdelfettah; Corrège, Thierry; Cordeiro, Renato C.; Lamounier, Saulo; Godiva, Daniely; Shen, Chuan-Chou; Le Cornec, Florence; Turcq, Bruno; Lazareth, Claire E.; Hu, Ching-Yi


    Recent Southern Hemisphere (SH) atmospheric circulation, predominantly driven by stratospheric ozone depletion over Antarctica, has caused changes in climate across the extratropics. Here, we present evidence that the Brazilian coast (southwestern Atlantic) may have been impacted from both wind and sea-surface temperature changes derived from this process. Skeleton analysis of massive coral species living in shallow waters off Brazil are very sensitive to air-sea interactions, and seem to record this impact. Growth rates of Brazilian corals show a trend reversal that fits the ozone depletion evolution, confirming that ozone impacts are far reaching and potentially affect coastal ecosystems in tropical environments.

  18. Distorted DNA structures induced by HMGB2 possess a high affinity for HMGB2.


    Nakamura, Yasuyuki; Shimizu, Mitsuhiro; Yoshida, Michiteru


    HMGB2 (HMG2) protein binds with DNA duplex in a sequence-nonspecific manner, then bends and unwinds the DNA. In DNA cyclization analyses for the bending activity of HMGB2, two unidentified bands, denoted alpha and beta, were observed in addition to monomer circular DNA (1C) on the gel. Re-electrophoresis and proteinase K digestion revealed that alpha and beta are complexes of circularized probe DNA (seeming 1C) with HMGB2 (K(d) approximately 10(-10) M). The DNA components of alpha and beta (alpha- and beta-DNA) showed higher affinities to HMGB2 than did the linear probe DNA (K(d) approximately 10(-7) M). The DNAs have distorted structures containing partial single-stranded regions. Nicked circular molecules presumably due to severe DNA distortion by HMGB2 were observed in alpha- and beta-DNA, in addition to closed circular double-stranded molecules. The alpha and beta bands were not formed in the presence of sole DNA binding regions which are necessary for DNA bending, indicating that the acidic C-tail in the HMGB2 molecule is necessary for inducing the peculiar distorted structures of higher affinity to HMGB2. HMGB2 binds with linker DNA and/or the entry and exit of nucleosomes fixed at both ends likewise mini-circles similar to alpha-DNA and beta-DNA. Thus, the distorted structures present in alpha-DNA and beta-DNA should be important in considering the functional mechanisms in which HMGB2 participates. PMID:11754747

  19. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.


    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  20. Replication-induced supercoiling: a neglected DNA transaction regulator?


    Yu, Haojie; Dröge, Peter


    Dynamic (-) DNA supercoiling generated in the wake of translocating protein complexes is known to occur during transcription. Recent studies indicate that (-) superhelical tension also builds up specifically in the leading duplex during replication. Here, we argue that this unrecognized supercoiling is causally involved in the regulation of key DNA transactions and deserves further consideration. PMID:24637041

  1. Weakly charged cationic nanoparticles induce DNA bending and strand separation.


    Railsback, Justin G; Singh, Abhishek; Pearce, Ryan C; McKnight, Timothy E; Collazo, Ramón; Sitar, Zlatko; Yingling, Yaroslava G; Melechko, Anatoli V


    Weakly charged cationic nanoparticles cause structural changes including local denaturing and compaction to DNA under mild conditions. The charged ligands bind to the phosphate backbone of DNA and the uncharged ligands penetrate the helix and disrupt base pairing. Mobility shifts in electrophoresis, molecular dynamics, and UV-vis spectrophotometry give clues to the details of the interactions. PMID:22711427

  2. Exposure to Ultrafine Particles from Ambient Air and Oxidative Stress–Induced DNA Damage

    PubMed Central

    Bräuner, Elvira Vaclavik; Forchhammer, Lykke; Møller, Peter; Simonsen, Jacob; Glasius, Marianne; Wåhlin, Peter; Raaschou-Nielsen, Ole; Loft, Steffen


    Background Particulate matter, especially ultrafine particles (UFPs), may cause health effects through generation of oxidative stress, with resulting damage to DNA and other macromolecules. Objective We investigated oxidative damage to DNA and related repair capacity in peripheral blood mononuclear cells (PBMCs) during controlled exposure to urban air particles with assignment of number concentration (NC) to four size modes with average diameters of 12, 23, 57, and 212 nm. Design Twenty-nine healthy adults participated in a randomized, two-factor cross-over study with or without biking exercise for 180 min and with exposure to particles (NC 6169-15362/cm3) or filtered air (NC 91-542/cm3) for 24 hr. Methods The levels of DNA strand breaks (SBs), oxidized purines as formamidopyrimidine DNA glycolase (FPG) sites, and activity of 7,8-dihydro-8-oxoguanine-DNA glycosylase (OGG1) in PBMCs were measured by the Comet assay. mRNA levels of OGG1, nucleoside diphosphate linked moiety X-type motif 1 (NUDT1), and heme oxygenase-1 (HO1) were determined by real-time reverse transcriptase–polymerase chain reaction. Results Exposure to UFPs for 6 and 24 hr significantly increased the levels of SBs and FPG sites, with a further insignificant increase after physical exercise. The OGG1 activity and expression of OGG1, NUDT1, and HO1 were unaltered. There was a significant dose–response relationship between NC and DNA damage, with the 57-nm mode as the major contributor to effects. Concomitant exposure to ozone, nitrogen oxides, and carbon monoxide had no influence. Conclusion Our results indicate that UFPs, especially the 57-nm soot fraction from vehicle emissions, causes systemic oxidative stress with damage to DNA and no apparent compensatory up-regulation of DNA repair within 24 hr. PMID:17687444

  3. Indomethacin and cromolyn sodium alter ozone-induced changes in lung function and plasma eicosanoid concentrations in guinea pigs

    SciTech Connect

    Miller, P.D.; Ainsworth, D.; Lam, H.F.; Amdur, M.O.


    Male Hartley guinea pigs were given either indomethacin (IN), cromolyn sodium (CS), or no drug (ND) and then exposed either to filtered air or to 1 ppm ozone (O3) for 1 hr. At 2 or 24 hr postexposure, ventilation, respiratory mechanics, lung volumes, carbon monoxide-diffusing capacity (DLCO), and alveolar volume (VA) were measured, and in separate groups of animals, plasma eicosanoids (EC) were measured. Both drugs blocked the increase in flow resistance noted at 2 hr after O3 and prevented O3-induced increases in the wet lung weight to body weight ratio seen at 2 and 24 hr in the ND group. In the ND animals O3 also decreased total lung capacity (TLC), vital capacity (VC), functional residual capacity (FRC), and residual volume (RV). IN as well as CS blocked reductions in FRC and RV at both 2 and 24 hr after O3. TLC was reduced by both drug treatments in air- and O3-exposed animals. CS treatment also decreased VC in all groups. IN blocked reductions in VA after O3 but did not prevent decreases in DLCO. CS blocked reductions in both VA and DLCO after O3, but the drug decreased DLCO in air-exposed animals. The prostaglandins PGF2 alpha and 6-keto PGF1 alpha were largely unaffected by O3 exposure or drug treatment. Prostaglandin E1 (PGE1) was not affected by O3, but both drugs significantly increased PGE1 in all exposure groups. Effects on plasma thromboxane B2 (TxB2) were variable although in most groups TxB2 was lower than in the O3-exposed ND groups. Although our findings suggest that both drugs block some effects of O3 exposure on the lungs and on plasma EC concentrations, the degree to which EC contribute to O3-induced pulmonary effects is not clearly apparent.

  4. The Energetic Contribution of Induced Electrostatic Asymmetry to DNA Bending by a Site-Specific Protein

    PubMed Central

    Hancock, Stephen P.; Hiller, David A.; Perona, John J.; Jen-Jacobson, Linda


    DNA bending can be promoted by reducing the net negative electrostatic potential around phosphates on one face of the DNA, such that electrostatic repulsion among phosphates on the opposite face drives bending toward the less negative surface. To provide the first assessment of the energetic contribution to DNA bending when electrostatic asymmetry is induced by a site-specific DNA binding protein, we manipulated the electrostatics in the EcoRV endonuclease-DNA complex by mutation of cationic sidechains that contact DNA phosphates and/or by replacing a selected phosphate in each strand with uncharged methylphosphonate. Reducing the net negative charge at two symmetrically located phosphates on the concave DNA face contributes −2.3 to −0.9 kcal/mol (depending on position) to complex formation. In contrast, reducing negative charge on the opposing convex face produces a penalty of +1.3 kcal/mol. Förster resonance energy transfer experiments show that the extent of axial DNA bending (about 50°) is little affected in the modified complexes, implying that modification affects the energetic cost but not the extent of DNA bending. Kinetic studies show that favorable effects of induced electrostatic asymmetry on equilibrium binding derive primarily from a reduced rate of complex dissociation, suggesting stabilization of the specific complex between protein and markedly bent DNA. A smaller increase in the association rate may suggest that the DNA in the initial encounter complex is mildly bent. The data imply that protein-induced electrostatic asymmetry makes a significant contribution to DNA bending, but is not itself sufficient to drive full bending in the specific EcoRV-DNA complex. PMID:21167173


    EPA Science Inventory

    Susceptibility to environmental pollutant-induced injuries may be influenced by presence of disease and genetic make-up. To identify disease-specific susceptibility phenotype, we used eight rat strains with or without genetic cardiovascular disease. Male 12-15 wk old Sprague Dawl...

  6. Understanding the molecular mechanism of formaldehyde-induced DNA-protein crosslink repair

    EPA Science Inventory

    Formaldehyde induces DNA-protein crosslinks (DPCs) in several experimental in vitro and in vivo test systems, as well as in exposed human workers. DPCs are repaired by several DNA repair pathways in different species, but the molecular understanding of DPC repair in human tissues...


    EPA Science Inventory

    Rapid and cost-effective indicator assays are being developed which may be used as a rapid screen to assess the potential for exposure to hazardous compounds that can be related to a biological target (e.g., DNA). Chemically-induced DNA damage will be measured using surrogate DN...

  8. Chromatin Structure Following UV-Induced DNA Damage—Repair or Death?

    PubMed Central

    Farrell, Andrew W.; Halliday, Gary M.; Lyons, James Guy


    In eukaryotes, DNA is compacted into a complex structure known as chromatin. The unravelling of DNA is a crucial step in DNA repair, replication, transcription and recombination as this allows access to DNA for these processes. Failure to package DNA into the nucleosome, the individual unit of chromatin, can lead to genomic instability, driving a cell into apoptosis, senescence, or cellular proliferation. Ultraviolet (UV) radiation damage causes destabilisation of chromatin integrity. UV irradiation induces DNA damage such as photolesions and subjects the chromatin to substantial rearrangements, causing the arrest of transcription forks and cell cycle arrest. Highly conserved processes known as nucleotide and base excision repair (NER and BER) then begin to repair these lesions. However, if DNA repair fails, the cell may be forced into apoptosis. The modification of various histones as well as nucleosome remodelling via ATP-dependent chromatin remodelling complexes are required not only to repair these UV-induced DNA lesions, but also for apoptosis signalling. Histone modifications and nucleosome remodelling in response to UV also lead to the recruitment of various repair and pro-apoptotic proteins. Thus, the way in which a cell responds to UV irradiation via these modifications is important in determining its fate. Failure of these DNA damage response steps can lead to cellular proliferation and oncogenic development, causing skin cancer, hence these chromatin changes are critical for a proper response to UV-induced injury. PMID:22174650

  9. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed


    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  10. Capillary electrophoresis as a technique to analyze sequence-induced anomalously migrating DNA fragments.

    PubMed Central

    Wenz, H M


    Sequence-induced anomalous migration of double-stranded (ds) DNA in native gel electrophoresis is a well known phenomenon. The retardation of migration is more obvious in polyacrylamide compared with agarose gels, and is greatly affected by the concentration of the gel and the temperature. This anomalous migration results in a difference between calculated and actual sizes of the affected DNA fragments. A low viscosity polymer solution (DNA Fragment Analysis Reagent) under investigation for use in dsDNA analysis by capillary electrophoresis is shown to be useful for the visualization of anomalies in migration of dsDNA fragments. Comparable with traditional slab gel systems, the retardation effect, indicative of bent or curved DNA, is strongly dependent on polymer concentration and separation temperature. These dependencies have implications on the accurate sizing of dsDNA fragments with unknown sequences and secondary structures. PMID:7937124

  11. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells.

    PubMed Central

    Wu, J; Issa, J P; Herman, J; Bassett, D E; Nelkin, B D; Baylin, S B


    Abnormal regional increases in DNA methylation, which have potential for causing gene inactivation and chromosomal instability, are consistently found in immortalized and tumorigenic cells. Increased DNA methyltransferase activity, which is also a characteristic of such cells, is a candidate to mediate these abnormal DNA methylation patterns. We now show that, in NIH 3T3 mouse fibroblasts, constitutive overexpression of an exogenous mouse DNA methyltransferase gene results in a marked increase in overall DNA methylation which is accompanied by tumorigenic transformation. These transformation changes can also be elicited by dexamethasone-inducible expression of an exogenous DNA methyltransferase gene. Our findings provide strong evidence that the increase in DNA methyltransferase activity associated with tumor progression could be a key step in carcinogenesis and provide a model system that can be used to further study this possibility. Images Fig. 1 Fig. 2 PMID:8415627

  12. Hairpin DNA probes based on target-induced in situ generation of luminescent silver nanoclusters.


    Xiao, Yan; Wu, Zhengjun; Wong, Kwok-Yin; Liu, Zhihong


    Novel hairpin DNA probes are designed and constructed based on target-induced in situ generation of luminescent silver nanoclusters. This design allows specific and versatile detection of diverse targets with easy operation and low cost. PMID:24686790

  13. Syntaxin 5 Overexpression and β-Amyloid 1–42 Accumulation in Endoplasmic Reticulum of Hippocampal Cells in Rat Brain Induced by Ozone Exposure

    PubMed Central

    Hernández-Zimbrón, Luis Fernando


    Oxidative stress is a risk factor for Alzheimer's disease and it is currently accepted that oxidative damage precedes the overproduction of A42 peptide. We have reported that ozone causes oxidative stress inducing neurodegeneration in the brain of rats. It is associated with A42 overproduction and intracellular accumulation in hippocampus. Organelles like mitochondria, intracellular membranes, and endoplasmic reticulum have been identified as sites of A42 production and accumulation affecting cellular metabolism. However whether ozone exposure induces overproduction and/or accumulation of A42 in endoplasmic reticulum has not been studied. We evaluated this effect in the endoplasmic reticulum of hippocampal cells of rats exposed chronically to low doses of ozone (0.25 ppm) at 7, 15, 30, 60, and 90 days. The effect of the presence of A42 in endoplasmic reticulum was analyzed evaluating the expression of the chaperone Syntaxin 5. Our results show an accumulation of A42 peptide in this organelle. It was observed by immunofluorescence and by WB in endoplasmic fractions from hippocampal cells of rats at 60 and 90 days of treatment. Significant overexpression of the chaperone Syntaxin 5 at 60 and 90 days of treatment was observed (⁎P < 0.05). These results indicate that the exposure to environmental pollutants could be involved as a risk factor for neurodegenerative processes. PMID:27366738

  14. Syntaxin 5 Overexpression and β-Amyloid 1-42 Accumulation in Endoplasmic Reticulum of Hippocampal Cells in Rat Brain Induced by Ozone Exposure.


    Hernández-Zimbrón, Luis Fernando; Rivas-Arancibia, Selva


    Oxidative stress is a risk factor for Alzheimer's disease and it is currently accepted that oxidative damage precedes the overproduction of A42 peptide. We have reported that ozone causes oxidative stress inducing neurodegeneration in the brain of rats. It is associated with A42 overproduction and intracellular accumulation in hippocampus. Organelles like mitochondria, intracellular membranes, and endoplasmic reticulum have been identified as sites of A42 production and accumulation affecting cellular metabolism. However whether ozone exposure induces overproduction and/or accumulation of A42 in endoplasmic reticulum has not been studied. We evaluated this effect in the endoplasmic reticulum of hippocampal cells of rats exposed chronically to low doses of ozone (0.25 ppm) at 7, 15, 30, 60, and 90 days. The effect of the presence of A42 in endoplasmic reticulum was analyzed evaluating the expression of the chaperone Syntaxin 5. Our results show an accumulation of A42 peptide in this organelle. It was observed by immunofluorescence and by WB in endoplasmic fractions from hippocampal cells of rats at 60 and 90 days of treatment. Significant overexpression of the chaperone Syntaxin 5 at 60 and 90 days of treatment was observed ((⁎) P < 0.05). These results indicate that the exposure to environmental pollutants could be involved as a risk factor for neurodegenerative processes. PMID:27366738

  15. Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients

    PubMed Central


    Background DNA-damage assays, quantifying the initial number of DNA double-strand breaks induced by radiation, have been proposed as a predictive test for radiation-induced toxicity. Determination of radiation-induced apoptosis in peripheral blood lymphocytes by flow cytometry analysis has also been proposed as an approach for predicting normal tissue responses following radiotherapy. The aim of the present study was to explore the association between initial DNA damage, estimated by the number of double-strand breaks induced by a given radiation dose, and the radio-induced apoptosis rates observed. Methods Peripheral blood lymphocytes were taken from 26 consecutive patients with locally advanced breast carcinoma. Radiosensitivity of lymphocytes was quantified as the initial number of DNA double-strand breaks induced per Gy and per DNA unit (200 Mbp). Radio-induced apoptosis at 1, 2 and 8 Gy was measured by flow cytometry using annexin V/propidium iodide. Results Radiation-induced apoptosis increased in order to radiation dose and data fitted to a semi logarithmic mathematical model. A positive correlation was found among radio-induced apoptosis values at different radiation doses: 1, 2 and 8 Gy (p < 0.0001 in all cases). Mean DSB/Gy/DNA unit obtained was 1.70 ± 0.83 (range 0.63-4.08; median, 1.46). A statistically significant inverse correlation was found between initial damage to DNA and radio-induced apoptosis at 1 Gy (p = 0.034). A trend toward 2 Gy (p = 0.057) and 8 Gy (p = 0.067) was observed after 24 hours of incubation. Conclusions An inverse association was observed for the first time between these variables, both considered as predictive factors to radiation toxicity. PMID:20868468

  16. DNA Processing Proteins Involved in the UV-Induced Stress Response of Sulfolobales

    PubMed Central

    van Wolferen, Marleen; Ma, Xiaoqing


    ABSTRACT The ups operon of Sulfolobus species is highly induced upon UV stress. Previous studies showed that the pili encoded by this operon are involved in cellular aggregation, which is essential for subsequent DNA exchange between cells, resulting in homologous recombination. The presence of this pilus system increases the fitness of Sulfolobus cells under UV light-induced stress conditions, as the transfer of DNA takes place in order to repair UV-induced DNA lesions via homologous recombination. Four conserved genes (saci_1497 to saci_1500) which encode proteins with putative DNA processing functions are present downstream of the ups operon. In this study, we show that after UV treatment the cellular aggregation of strains with saci_1497, saci_1498, and saci_1500 deletions is similar to that of wild-type strains; their survival rates, however, were reduced and similar to or lower than those of the pilus deletion strains, which could not aggregate anymore. DNA recombination assays indicated that saci_1498, encoding a ParB-like protein, plays an important role in DNA transfer. Moreover, biochemical analysis showed that the endonuclease III encoded by saci_1497 nicks UV-damaged DNA. In addition, RecQ-like helicase Saci_1500 is able to unwind homologous recombination intermediates, such as Holliday junctions. Interestingly, a saci_1500 deletion mutant was more sensitive to UV light but not to the replication-stalling agents hydroxyurea and methyl methanesulfonate, suggesting that Saci_1500 functions specifically in the UV damage pathway. Together these results suggest a role of Saci_1497 to Saci_1500 in the repair or transfer of DNA that takes place after UV-induced damage to the genomic DNA of Sulfolobus acidocaldarius. IMPORTANCE Sulfolobales species increase their fitness after UV stress by a UV-inducible pilus system that enables high rates of DNA exchange between cells. Downstream of the pilus operon, three genes that seem to play a role in the repair or

  17. Oxidative DNA damage induced by di-(2-ethylhexyl) phthalate in HEK-293 cell line.


    Wang, Xuan; Jiang, Lijie; Ge, Lan; Chen, Min; Yang, Guang; Ji, Fang; Zhong, Laifu; Guan, Yingjie; Liu, Xiaofang


    Di-(2-ethylhexyl) phthalate (DEHP) is commonly employed as a plasticizer. We have found that exposure of human embryonic kidney cell line 293 (HEK-293) to DEHP resulted in a crucial dose-dependent increase of DNA strand breaks in a comet assay. To elucidate the role of glutathione (GSH) in the DNA damage, the cells were pretreated with buthionine-(S,R)-sulfoximine (BSO) and pretreated with N-acetylcysteine (NAC), a GSH precursor. Here we show that depletion of GSH in HEK-293 cells with BSO dramatically increased the susceptibility of HEK-293 cells to DEHP-induced DNA damage. Furthermore, when the intracellular GSH content was elevated by NAC, the DNA damage induced by DEHP was almost completely abolished. In addition, DEHP had effect on lysosomal or mitochondrial damage at high dose level. These results indicate that DEHP exerts genotoxic effects in HEK-293 cells, probably through DNA damage induced by oxidative stress; GSH is responsible for cellular defense against DEHP-induced DNA damage; lysosome and mitochondria may be the vital targets in DEHP-induced DNA damage. PMID:25899473

  18. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  19. SRC-mediated EGF Receptor Activation Regulates Ozone-induced Interleukin 8 Expression in Human Bronchial Epithelial Cells

    EPA Science Inventory

    BACKGROUND: Human exposure to ozone (03) results in pulmonary function decrements and airway inflammation. The mechanisms underlying these adverse effects remain unclear. Epidermal growth factor receptor (EGFR) plays an important role in the pathogenesis of lung inflammation. ...

  20. Ozone is mutagenic in Salmonella

    SciTech Connect

    Dillon, D.; Combes, R.; McConville, M.; Zeiger, E. )


    Ozone is a highly reactive gas that has been tested for genotoxicity in a number of systems. Induced genetic damage resulting from ozone treatment may not be readily observed because of the high toxicity of the chemical and difficulties in generating and administering controlled concentrations. The mutagenicity of ozone was investigated in Salmonella typhimurium using a plate test protocol designed for reactive vapours and gases. Ozone, at two to three consecutive doses, induced weak, albeit statistically significant, mutagenic responses in tester strain TA102 with and without Aroclor-induced rat liver S9 (lowest effective mean concentration of 0.019 ppm; 35 min total exposure). However, dose-related responses were not always obtained. No mutagenicity was detected in strains TA98, TA100, or TA1535, with or without S9. In strain TA104, ozone induced a weak response only at a single dose with S9; this response was not reproducible. Mutagenicity was dependent on the ozone flow rate and total exposure time, with variations in the optimum dose-time regimen leading to toxicity or complete inactivity. The data show that ozone is a very weak bacterial mutagen and only when tested under narrowly prescribed, subtoxic dosing conditions.

  1. Convective forcing of mercury and ozone in the Arctic boundary layer induced by leads in sea ice.


    Moore, Christopher W; Obrist, Daniel; Steffen, Alexandra; Staebler, Ralf M; Douglas, Thomas A; Richter, Andreas; Nghiem, Son V


    The ongoing regime shift of Arctic sea ice from perennial to seasonal ice is associated with more dynamic patterns of opening and closing sea-ice leads (large transient channels of open water in the ice), which may affect atmospheric and biogeochemical cycles in the Arctic. Mercury and ozone are rapidly removed from the atmospheric boundary layer during depletion events in the Arctic, caused by destruction of ozone along with oxidation of gaseous elemental mercury (Hg(0)) to oxidized mercury (Hg(II)) in the atmosphere and its subsequent deposition to snow and ice. Ozone depletion events can change the oxidative capacity of the air by affecting atmospheric hydroxyl radical chemistry, whereas atmospheric mercury depletion events can increase the deposition of mercury to the Arctic, some of which can enter ecosystems during snowmelt. Here we present near-surface measurements of atmospheric mercury and ozone from two Arctic field campaigns near Barrow, Alaska. We find that coastal depletion events are directly linked to sea-ice dynamics. A consolidated ice cover facilitates the depletion of Hg(0) and ozone, but these immediately recover to near-background concentrations in the upwind presence of open sea-ice leads. We attribute the rapid recoveries of Hg(0) and ozone to lead-initiated shallow convection in the stable Arctic boundary layer, which mixes Hg(0) and ozone from undepleted air masses aloft. This convective forcing provides additional Hg(0) to the surface layer at a time of active depletion chemistry, where it is subject to renewed oxidation. Future work will need to establish the degree to which large-scale changes in sea-ice dynamics across the Arctic alter ozone chemistry and mercury deposition in fragile Arctic ecosystems. PMID:24429521

  2. Convective forcing of mercury and ozone in the Arctic boundary layer induced by leads in sea ice

    NASA Astrophysics Data System (ADS)

    Moore, Christopher W.; Obrist, Daniel; Steffen, Alexandra; Staebler, Ralf M.; Douglas, Thomas A.; Richter, Andreas; Nghiem, Son V.


    The ongoing regime shift of Arctic sea ice from perennial to seasonal ice is associated with more dynamic patterns of opening and closing sea-ice leads (large transient channels of open water in the ice), which may affect atmospheric and biogeochemical cycles in the Arctic. Mercury and ozone are rapidly removed from the atmospheric boundary layer during depletion events in the Arctic, caused by destruction of ozone along with oxidation of gaseous elemental mercury (Hg(0)) to oxidized mercury (Hg(II)) in the atmosphere and its subsequent deposition to snow and ice. Ozone depletion events can change the oxidative capacity of the air by affecting atmospheric hydroxyl radical chemistry, whereas atmospheric mercury depletion events can increase the deposition of mercury to the Arctic, some of which can enter ecosystems during snowmelt. Here we present near-surface measurements of atmospheric mercury and ozone from two Arctic field campaigns near Barrow, Alaska. We find that coastal depletion events are directly linked to sea-ice dynamics. A consolidated ice cover facilitates the depletion of Hg(0) and ozone, but these immediately recover to near-background concentrations in the upwind presence of open sea-ice leads. We attribute the rapid recoveries of Hg(0) and ozone to lead-initiated shallow convection in the stable Arctic boundary layer, which mixes Hg(0) and ozone from undepleted air masses aloft. This convective forcing provides additional Hg(0) to the surface layer at a time of active depletion chemistry, where it is subject to renewed oxidation. Future work will need to establish the degree to which large-scale changes in sea-ice dynamics across the Arctic alter ozone chemistry and mercury deposition in fragile Arctic ecosystems.

  3. Protection of DNA From Ionizing Radiation-Induced Lesions by Asiaticoside.


    Joy, Jisha; Alarifi, Saud; Alsuhaibani, Entissar; Nair, Cherupally K Krishnan


    This study aims to investigate whether asiaticoside, a triterpene glycoside, can afford protection to DNA from alterations induced by gamma radiation under in vitro, ex vivo, and in vivo conditions. In vitro studies were done on plasmid pBR322 DNA, ex vivo studies were done on cellular DNA of human peripheral blood leukocytes, and in vivo investigations were conducted on cellular DNA of spleen and bone marrow cells of mice exposed to whole-body gamma radiation. The supercoiled form of the plasmid pBR322 DNA upon exposure to the radiation was converted into relaxed open circular form due to induction of strand breaks. Presence of asiaticoside along with the DNA during irradiation prevented the relaxation of the supercoiled form to the open circular form. When human peripheral blood leukocytes were exposed to gamma radiation, the cellular DNA suffered strand breaks as evidenced by the increased comet parameters in an alkaline comet assay. Asiaticoside, when present along with blood during irradiation ex vivo, prevented the strand breaks and the comet parameters were closer to that of the controls. Whole-body exposure of mice to gamma radiation resulted in a significant increase in comet parameters of DNA of bone marrow and spleen cells of mice as a result of radiation-induced strand breaks in DNA. Administration of asiaticoside prior to whole-body radiation exposure of the mice prevented this increase in radiation-induced increase in comet parameters, which could be the result of protection to DNA under in vivo conditions of radiation exposure. Thus, it can be concluded from the results that asiaticoside can offer protection to DNA from radiation-induced alterations under in vitro, ex vivo, and in vivo conditions. PMID:26756427

  4. Whole-Tree Water Use Efficiency Is Decreased by Ambient Ozone and Not Affected by O3-Induced Stomatal Sluggishness

    PubMed Central

    Hoshika, Yasutomo; Omasa, Kenji; Paoletti, Elena


    Steady-state and dynamic gas exchange responses to ozone visible injury were investigated in an ozone-sensitive poplar clone under field conditions. The results were translated into whole tree water loss and carbon assimilation by comparing trees exposed to ambient ozone and trees treated with the ozone-protectant ethylenediurea (EDU). Steady-state stomatal conductance and photosynthesis linearly decreased with increasing ozone visible injury. Dynamic responses simulated by severing of a leaf revealed that stomatal sluggishness increased until a threshold of 5% injury and was then fairly constant. Sluggishness resulted from longer time to respond to the closing signal and slower rate of closing. Changes in photosynthesis were driven by the dynamics of stomata. Whole-tree carbon assimilation and water loss were lower in trees exposed to ambient O3 than in trees protected by EDU, both under steady-state and dynamic conditions. Although stomatal sluggishness is expected to increase water loss, lower stomatal conductance and premature leaf shedding of injured leaves aggravated O3 effects on whole tree carbon gain, while compensating for water loss. On average, WUE of trees exposed to ambient ozone was 2–4% lower than that of EDU-protected control trees in September and 6–8% lower in October. PMID:22723982

  5. Increased Mitochondrial DNA Induces Acquired Docetaxel Resistance in Head and Neck Cancer Cells

    PubMed Central

    Mizumachi, T; Suzuki, S; Naito, A; Carcel-Trullols, J; Evans, TT; Spring, PM; Oridate, N; Furuta, Y; Fukuda, S; Higuchi, M


    Docetaxel is one of the most effective chemotherapeutic agents against cancer; nevertheless, some patients develop resistance. Unfortunately, their causes and mechanisms remain unknown. We created docetaxel-resistant DRHEp2 from human laryngeal cancer HEp2 and investigated the roles of mitochondrial DNA (mtDNA) and ROS on docetaxel resistance. DRHEp2 had greatly increased mtDNA content. Reduction of mtDNA content in DRHEp2 by ethidium bromide treatment reduced the resistance. These results indicate the possible roles of mtDNA-coded enzymes in mitochondrial respiratory chain (MRC) in resistant mechanisms. Oligomycin A, an Fo-ATPase inhibitor, eliminated docetaxel resistance in DRHEp2. In contrast, inhibitors of other MRC did not. RNA interference targeted to Fo-ATPase d-subunit restored docetaxel-induced cytotoxicity to DRHEp2. These results indicate the roles of Fo-ATPase for resistant mechanisms. Docetaxel induced ROS generation in HEp2 but not in DRHEp2 and antioxidant pyrrolidine dithiocarbamate eliminated docetaxel-induced cytotoxicity, suggesting roles of ROS in docetaxel-induced cell death. Furthermore, inhibition of Fo-ATPase by Oligomycin A induced docetaxel–mediated ROS generation in DRHEp2. Taken together, DRHEp2 acquired docetaxel resistance through increasing Fo-ATPase, which led to diminish docetaxel-induced ROS generation and subsequently inhibited cell death. In conclusion, mtDNA plays an important role in developing docetaxel resistance through the reduction of ROS generation by regulating Fo-ATPase. PMID:17637738

  6. The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion.


    Ganesan, Shanthi; Keating, Aileen F


    Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fisher 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96h in medium containing DMSO ±60μM PM or KU 55933 (48h; 10nM). PM-induced activation of DNA damage repair genes was observed as early as 12h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. PMID:26708502

  7. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.


    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R


    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage. PMID:24006104

  8. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.


    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott


    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons. PMID:27060144

  9. Ultrasound-induced DNA damage and signal transductions indicated by gammaH2AX

    NASA Astrophysics Data System (ADS)

    Furusawa, Yukihiro; Fujiwara, Yoshisada; Zhao, Qing-Li; Hassan, Mariame Ali; Ogawa, Ryohei; Tabuchi, Yoshiaki; Takasaki, Ichiro; Takahashi, Akihisa; Ohnishi, Takeo; Kondo, Takashi


    Ultrasound (US) has been shown to induce cancer cell death via different forms including apoptosis. Here, we report the potential of low-intensity pulsed US (LIPUS) to induce genomic DNA damage and subsequent DNA damage response. Using the ionizing radiation-induced DNA double-strand breaks (DSBs) as the positive control, we were able to observe the induction of DSBs (as neutral comet tails) and the subsequent formation of gammaH2AX-positive foci (by immunofluorescence detection) in human leukemia cells following exposure to LIPUS. The LIPUS-induced DNA damage arose most likely from the mechanical, but not sonochemical, effect of cavitation, based on our observation that the suppression of inertial cavitation abrogated the gammH2AX foci formation, whereas scavenging of free radical formation (e.g., hydroxyl radical) had no protective effect on it. Treatment with the specific kinase inhibitor of ATM or DNA-PKcs, which can phosphorylate H2AX Ser139, revealed that US-induced gammaH2AX was inhibited more effectively by the DNA-PK inhibitor than ATM kinase inhibitor. Notably, these inhibitor effects were opposite to those with radiation-induced gammH2AX. In conclusion, we report, for the first time that US can induce DNA damage and the DNA damage response as indicated by gammaH2AX was triggered by the cavitational mechanical effects. Thus, it is expected that the data shown here may provide a better understanding of the cellular responses to US.

  10. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome.

    PubMed Central

    Heilbronn, R; zur Hausen, H


    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of six HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensible for SV40 DNA amplification. Our results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo. Images PMID:2547992

  11. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    SciTech Connect

    Heilbronn, R.; zur Hausen, H. )


    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  12. Polar ozone

    NASA Technical Reports Server (NTRS)

    Solomon, S.; Grose, W. L.; Jones, R. L.; Mccormick, M. P.; Molina, Mario J.; Oneill, A.; Poole, L. R.; Shine, K. P.; Plumb, R. A.; Pope, V.


    The observation and interpretation of a large, unexpected ozone depletion over Antarctica has changed the international scientific view of stratospheric chemistry. The observations which show the veracity, seasonal nature, and vertical structure of the Antarctic ozone hole are presented. Evidence for Arctic and midlatitude ozone loss is also discussed. The chemical theory for Antarctic ozone depletion centers around the occurrence of polar stratospheric clouds (PSCs) in Antarctic winter and spring; the climatology and radiative properties of these clouds are presented. Lab studies of the physical properties of PSCs and the chemical processes that subsequently influence ozone depletion are discussed. Observations and interpretation of the chemical composition of the Antarctic stratosphere are described. It is shown that the observed, greatly enhanced abundances of chlorine monoxide in the lower stratosphere are sufficient to explain much if not all of the ozone decrease. The dynamic meteorology of both polar regions is given, interannual and interhemispheric variations in dynamical processes are outlined, and their likely roles in ozone loss are discussed.

  13. Ozone decomposition

    PubMed Central

    Batakliev, Todor; Georgiev, Vladimir; Anachkov, Metody; Rakovsky, Slavcho


    Catalytic ozone decomposition is of great significance because ozone is a toxic substance commonly found or generated in human environments (aircraft cabins, offices with photocopiers, laser printers, sterilizers). Considerable work has been done on ozone decomposition reported in the literature. This review provides a comprehensive summary of the literature, concentrating on analysis of the physico-chemical properties, synthesis and catalytic decomposition of ozone. This is supplemented by a review on kinetics and catalyst characterization which ties together the previously reported results. Noble metals and oxides of transition metals have been found to be the most active substances for ozone decomposition. The high price of precious metals stimulated the use of metal oxide catalysts and particularly the catalysts based on manganese oxide. It has been determined that the kinetics of ozone decomposition is of first order importance. A mechanism of the reaction of catalytic ozone decomposition is discussed, based on detailed spectroscopic investigations of the catalytic surface, showing the existence of peroxide and superoxide surface intermediates. PMID:26109880

  14. Ozone decomposition.


    Batakliev, Todor; Georgiev, Vladimir; Anachkov, Metody; Rakovsky, Slavcho; Zaikov, Gennadi E


    Catalytic ozone decomposition is of great significance because ozone is a toxic substance commonly found or generated in human environments (aircraft cabins, offices with photocopiers, laser printers, sterilizers). Considerable work has been done on ozone decomposition reported in the literature. This review provides a comprehensive summary of the literature, concentrating on analysis of the physico-chemical properties, synthesis and catalytic decomposition of ozone. This is supplemented by a review on kinetics and catalyst characterization which ties together the previously reported results. Noble metals and oxides of transition metals have been found to be the most active substances for ozone decomposition. The high price of precious metals stimulated the use of metal oxide catalysts and particularly the catalysts based on manganese oxide. It has been determined that the kinetics of ozone decomposition is of first order importance. A mechanism of the reaction of catalytic ozone decomposition is discussed, based on detailed spectroscopic investigations of the catalytic surface, showing the existence of peroxide and superoxide surface intermediates. PMID:26109880

  15. HMGB1-DNA Complex-induced Autophagy Limits AIM2 Inflammasome Activation through RAGE

    PubMed Central

    Liu, Liying; Yang, Minghua; Kang, Rui; Yu, Yan; Dai, Yunpen; Gao, Fei; Wang, Hongmei; Sun, Xiaojun; Li, Xiuli; Li, Jianhua; Wang, Haichao; Cao, Lizhi; Tang, Daolin


    High mobility group box 1 (HMGB1) is a prototype damage-associated molecular pattern (DAMP) that can induce inflammatory and immune responses alone as well as in combination with other molecules such as DNA. However, the intricate molecular mechanisms underlying HMGB1-DNA complex-mediated innate immune response remains largely elusive. In this study, we demonstrated that HMGB1-DNA complex initially induced absent in melanoma 2 (AIM2)-dependent inflammasome activation, and promoted rapid release of inflammasome-dependent early proinflammatory cytokines such as interleukin 1β (IL-1β). Subsequently, HMGB1-DNA complex stimulated an ATG5-dependent cellular degradation process, autophagy, which was paralleled by a cessation of AIM2 inflammasome activation and IL-1β release. These HMGB1-DNA complex-induced inflammasome activation and autophagy were both dependent on the receptor for advanced glycation endproducts (RAGE) that recognizes a wide array of ligands (including HMGB1 and DNA). Thus, autophagy may function as a negative counter-regulatory mechanism for HMGB1-DNA complex-induced inflammasome activation, and provide a checkpoint to limit the development of inflammation. PMID:24971542

  16. Time resolved studies of interfacial reactions of ozone with pulmonary phospholipid surfactants using field induced droplet ionization mass spectrometry.


    Kim, Hugh I; Kim, Hyungjun; Shin, Young Shik; Beegle, Luther W; Goddard, William A; Heath, James R; Kanik, Isik; Beauchamp, J L


    Field induced droplet ionization mass spectrometry (FIDI-MS) comprises a soft ionization method to sample ions from the surface of microliter droplets. A pulsed electric field stretches neutral droplets until they develop dual Taylor cones, emitting streams of positively and negatively charged submicrometer droplets in opposite directions, with the desired polarity being directed into a mass spectrometer for analysis. This methodology is employed to study the heterogeneous ozonolysis of 1-palmitoyl-2-oleoyl-sn-phosphatidylglycerol (POPG) at the air-liquid interface in negative ion mode using FIDI mass spectrometry. Our results demonstrate unique characteristics of the heterogeneous reactions at the air-liquid interface. We observe the hydroxyhydroperoxide and the secondary ozonide as major products of POPG ozonolysis in the FIDI-MS spectra. These products are metastable and difficult to observe in the bulk phase, using standard electrospray ionization (ESI) for mass spectrometric analysis. We also present studies of the heterogeneous ozonolysis of a mixture of saturated and unsaturated phospholipids at the air-liquid interface. A mixture of the saturated phospholipid 1,2-dipalmitoyl-sn-phosphatidylglycerol (DPPG) and unsaturated POPG is investigated in negative ion mode using FIDI-MS while a mixture of 1,2-dipalmitoyl-sn-phosphatidylcholine (DPPC) and 1-stearoyl-2-oleoyl-sn-phosphatidylcholine (SOPC) surfactant is studied in positive ion mode. In both cases FIDI-MS shows the saturated and unsaturated pulmonary surfactants form a mixed interfacial layer. Only the unsaturated phospholipid reacts with ozone, forming products that are more hydrophilic than the saturated phospholipid. With extensive ozonolysis only the saturated phospholipid remains at the droplet surface. Combining these experimental observations with the results of computational analysis provides an improved understanding of the interfacial structure and chemistry of a surfactant layer system when

  17. Determination of the Action Spectrum of UVR-Induced Mitochondrial DNA Damage in Human Skin Cells.


    Latimer, Jennifer A; Lloyd, James J; Diffey, Brian L; Matts, Paul J; Birch-Machin, Mark A


    Biological responses of human skin to UVR including cancer and aging are largely wavelength-dependent, as shown by the action spectra of UVR-induced erythema and nuclear DNA (nDNA) damage. A molecular dosimeter of UVR exposure is therefore required. Although mitochondrial DNA (mtDNA) damage has been shown to be a reliable and sensitive biomarker of UVR exposure in human skin, its wavelength dependency is unknown. The current study solves this problem by determining the action spectrum of UVR-induced mtDNA damage in human skin. Human neonatal dermal fibroblasts and primary human adult keratinocyte cells were irradiated with increasing doses of UVR. Dose-response curves of mtDNA damage were produced for each of the UVR sources and cell types, and an action spectrum for each cell type was determined by mathematical induction. Similarities between these mtDNA damage action spectra and previously determined nDNA damage were observed, with the most detrimental effects occurring over the shorter UVR wavelengths. Notably, a statistically significant (P<0.0001) greater sensitivity to mtDNA damage was observed in dermal fibroblasts compared with keratinocytes at wavelengths >300 nm, possibly indicating a wider picture of depth dependence in sensitivity. This finding has implications for disease/photodamage mechanisms and interventions. PMID:26030182

  18. A facile method for the assessment of DNA damage induced by UV-activated nanomaterials

    NASA Astrophysics Data System (ADS)

    Yamazaki, Yuka; Zinchenko, Anatoly A.; Murata, Shizuaki


    Fluorescent microscopy observation of gene-size DNA (T4 phage DNA or λ phage DNA) was used to assess DNA damage induced by UV irradiation in the presence of nanomaterials, such as QDs (quantum dots: CdSe/ZnS semiconductor nanoparticles), the water-soluble fullerene derivative C60(OH)n (n = 6-12) and titanium oxide nanoparticles of 25 nm in diameter. The magnitude of DNA damage could be simply evaluated based on the degree of shortening of the stretched DNA image. This method showed that DNA damage was amplified by the action of QDs under irradiation by C-band (λmax = 254 nm) or B-band (λmax = 303 nm) UV. Smaller QDs that emitted higher-energy fluorescence (λemmax = 565 nm) induced more severe damage than medium- and larger-size QDs that emitted longer-wavelength fluorescence (λemmax = 605 and 705 nm, respectively). The fullerene derivative and TiO2 nanoparticles caused DNA damage even under irradiation by A-band UV (λmax = 365 nm) and showed more severe DNA damage than QDs under similar conditions.

  19. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  20. Consistent ozone-induced decreases in pasture forage quality across several grassland types and consequences for UK lamb production.


    Hayes, Felicity; Mills, Gina; Jones, Laurence; Abbott, John; Ashmore, Mike; Barnes, Jeremy; Neil Cape, J; Coyle, Mhairi; Peacock, Simon; Rintoul, Naomi; Toet, Sylvia; Wedlich, Kerstin; Wyness, Kirsten


    In this study we have demonstrated that rising background ozone has the potential to reduce grassland forage quality and explored the implications for livestock production. We analysed pasture samples from seven ozone exposure experiments comprising mesotrophic, calcareous, haymeadow and sanddune unimproved grasslands conducted in open-top chambers, solardomes and a field release system. Across all grassland types, there were significant increases in acid detergent fibre, crude fibre and lignin content with increasing ozone concentration, resulting in decreased pasture quality in terms of the metabolisable energy content of the vegetation. We derived a dose-response function for metabolisable energy of the grassland with ozone concentration, applicable to a range of grassland types, and used this to predict effects on pasture quality of UK vegetation at 1 km resolution using modelled ozone data for 2007 and for predicted higher average ozone concentrations in 2020. This showed a potential total reduction in lamb production in the UK of approximately 4% in 2020 compared to 2007. The largest impacts were in geographical areas of modest ozone increases between the two years, but where large numbers of lambs were present. For an individual farmer working to a very small cost margin this could represent a large reduction in profit, both in regions where the impacts per lamb and those where the impacts per km(2) of grazing land are largest. In the short term farmers could adapt their lamb management in response to changed forage quality by additional supplementary feed of high metabolisable energy content. Nationally this increase in annual additional feed in 2020 compared to 2007 would be 2,166 tonnes (an increase of 0.7%). Of added concern are the longer-term consequences of continual deterioration of pasture quality and the implications for changes in farming practices to compensate for potential reductions in livestock production capacity. PMID:26595401

  1. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng


    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  2. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.


    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng


    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  3. Detection of DNA damage induced by heavy ion irradiation in the individual cells with comet assay

    NASA Astrophysics Data System (ADS)

    Wada, S.; Natsuhori, M.; Ito, N.; Funayama, T.; Kobayashi, Y.


    Investigating the biological effects of high-LET heavy ion irradiation at low fluence is important to evaluate the risk of charged particles. Especially it is important to detect radiation damage induced by the precise number of heavy ions in the individual cells. Thus we studied the relationship between the number of ions traversing the cell and DNA damage produced by the ion irradiation. We applied comet assay to measure the DNA damage in the individual cells. Cells attached on the ion track detector CR-39 were irradiated with ion beams at TIARA, JAERI-Takasaki. After irradiation, the cells were stained with ethidium bromide and the opposite side of the CR-39 was etched. We observed that the heavy ions with higher LET values induced the heavier DNA damage. The result indicated that the amount of DNA damage induced by one particle increased with the LET values of the heavy ions.

  4. Lac repressor: Crystallization of intact tetramer and its complexes with inducer and operator DNA

    SciTech Connect

    Pace, H.C.; Lu, P. ); Lewis, M. Smith Kline and French Labs., King of Prussia, PA )


    The intact lac repressor tetramer, which regulates expression of the lac operon in Escherichia coli, has been crystallized in the native form, with an inducer, and in a ternary complex with operator DNA and an anti-inducer. The crystals without DNA diffract to better than 3.5 {angstrom}. They belong to the monoclinic space group C2 and have cell dimensions a = 164.7 {angstrom}, b = 75.6 {angstrom}, and c = 161.2 {angstrom}, with {alpha} = {gamma} = 90{degree} and {beta} = 125.5{degree}. Cocrystals have been obtained with a number of different lac operator-related DNA fragments. The complex with a blunt-ended 16-base-pair strand yielded tetragonal bipyramids that diffract to 6.5 {angstrom}. These protein-DNA cocrystals crack upon exposure to the gratuitous inducer isopropyl {beta}-D-thiogalactoside, suggesting a conformational change in the repressor-operator complex.

  5. Autophosphorylation and Pin1 binding coordinate DNA damage-induced HIPK2 activation and cell death.


    Bitomsky, Nadja; Conrad, Elisa; Moritz, Christian; Polonio-Vallon, Tilman; Sombroek, Dirk; Schultheiss, Kathrin; Glas, Carolina; Greiner, Vera; Herbel, Christoph; Mantovani, Fiamma; del Sal, Giannino; Peri, Francesca; Hofmann, Thomas G


    Excessive genome damage activates the apoptosis response. Protein kinase HIPK2 is a key regulator of DNA damage-induced apoptosis. Here, we deciphered the molecular mechanism of HIPK2 activation and show its relevance for DNA damage-induced apoptosis in cellulo and in vivo. HIPK2 autointeracts and site-specifically autophosphorylates upon DNA damage at Thr880/Ser882. Autophosphorylation regulates HIPK2 activity and mutation of the phosphorylation-acceptor sites deregulates p53 Ser46 phosphorylation and apoptosis in cellulo. Moreover, HIPK2 autophosphorylation is conserved between human and zebrafish and is important for DNA damage-induced apoptosis in vivo. Mechanistically, autophosphorylation creates a binding signal for the phospho-specific isomerase Pin1. Pin1 links HIPK2 activation to its stabilization by inhibiting HIPK2 polyubiquitination and modulating Siah-1-HIPK2 interaction. Concordantly, Pin1 is required for DNA damage-induced HIPK2 stabilization and p53 Ser46 phosphorylation and is essential for induction of apotosis both in cellulo and in zebrafish. Our results identify an evolutionary conserved mechanism regulating DNA damage-induced apoptosis. PMID:24145406

  6. Prompt repair of hydrogen peroxide-induced DNA lesions prevents catastrophic chromosomal fragmentation.


    Mahaseth, Tulip; Kuzminov, Andrei


    Iron-dependent oxidative DNA damage in vivo by hydrogen peroxide (H2O2, HP) induces copious single-strand(ss)-breaks and base modifications. HP also causes infrequent double-strand DNA breaks, whose relationship to the cell killing is unclear. Since hydrogen peroxide only fragments chromosomes in growing cells, these double-strand breaks were thought to represent replication forks collapsed at direct or excision ss-breaks and to be fully reparable. We have recently reported that hydrogen peroxide kills Escherichia coli by inducing catastrophic chromosome fragmentation, while cyanide (CN) potentiates both the killing and fragmentation. Remarkably, the extreme density of CN+HP-induced chromosomal double-strand breaks makes involvement of replication forks unlikely. Here we show that this massive fragmentation is further amplified by inactivation of ss-break repair or base-excision repair, suggesting that unrepaired primary DNA lesions are directly converted into double-strand breaks. Indeed, blocking DNA replication lowers CN+HP-induced fragmentation only ∼2-fold, without affecting the survival. Once cyanide is removed, recombinational repair in E. coli can mend several double-strand breaks, but cannot mend ∼100 breaks spread over the entire chromosome. Therefore, double-strand breaks induced by oxidative damage happen at the sites of unrepaired primary one-strand DNA lesions, are independent of replication and are highly lethal, supporting the model of clustered ss-breaks at the sites of stable DNA-iron complexes. PMID:27078578

  7. Ozone-Induced Alterations in the Accumulation of Newly Synthesized Proteins in Leaves of Maize.

    PubMed Central

    Pino, M. E.; Mudd, J. B.; Bailey-Serres, J.


    We examined the response of leaves of 3-week-old maize (Zea mays L.) to short-term (5 h) fumigation with O3-enriched air (0, 0.12, 0.24, or 0.36 [mu]L/L). Older leaves and leaf tissue developed more severe visible damage at higher external O3 concentrations. To investigate the immediate effect of O3 exposure on the accumulation of newly synthesized leaf proteins, leaves were labeled with [35S]methionine after 2 h and fumigated for an additional 3 h. O3-induced alterations of leaf proteins were observed in a concentration-dependent manner. There was a significant decrease in [35S]methionine incorporation into protein at the highest O3 concentration. Developmental differences in accumulation of de novo-synthesized leaf proteins were observed when the leaf tip, middle, and basal sections were labeled under 0 [mu]L/L O3, and additional changes were apparent upon exposure to increasing O3 concentrations. Changes in leaf protein synthesis were observed in the absence of visible leaf injury. Subcellular fractionation revealed O3-induced alterations in soluble and membrane-associated proteins. A number of thylakoid membrane-associated proteins showed specific increases in response to O3 fumigation. In contrast, the synthesis of a 32-kD polypeptide associated with thylakoid membranes was reduced in response to O3 fumigation in parallel with reduced incorporation of [35S]methionine into protein. Immunoprecipitation identified this polypeptide as the D1 protein of photosystem II. A reduction in the accumulation of newly synthesized D1 could have consequences for the efficiency of photosynthesis and other cellular processes. PMID:12228510

  8. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint

    PubMed Central

    Collins, Josie K.; Lane, Simon I. R.; Merriman, Julie A.; Jones, Keith T.


    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule–kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  9. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint.


    Collins, Josie K; Lane, Simon I R; Merriman, Julie A; Jones, Keith T


    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule-kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  10. DNase I induced DNA degradation is inhibited by neomycin.


    Woegerbauer, M; Burgmann, H; Davies, J; Graninger, W


    Preparations of antimicrobials from biotechnological sources containing nucleic acids may serve as vector for the dissemination of resistance genes. An essential prerequisite for the acquisition of a new resistance phenotype in a transformational scenario is the availability of physically intact DNA molecules capable of transforming competent microorganisms. DNA is thought to be an easy target for catabolic processes when present in the natural habitat of bacteria (e.g. gastrointestinal tract, soil) due to the overall presence of nucleolytic enzymes. Aminoglycoside antibiotics are known to display a strong affinity to nucleic acids rendering these compounds to be primary candidates for exerting DNA protective functions in the gastrointestinal tract when applied orally during antibiotic chemotherapy. Using a DNase I protection assay it could be demonstrated that neomycin B at a concentration of 2 mM completely inhibited degradation of plasmid DNA in vitro. No inhibition of degradation was observed with streptomycin and kanamycin and the non-aminoglycoside antibiotics oxytetracycline and ampicillin under identical assay conditions. Thus, neomycin preparations may be able to promote structural integrity of contaminating DNA-fragments in DNase-rich environments. PMID:10819299

  11. SSTs, nitrogen fertiliser and stratospheric ozone

    NASA Technical Reports Server (NTRS)

    Turco, R. P.; Whitten, R. C.; Poppoff, I. G.; Capone, L. A.


    A recently revised model of the stratosphere is used to show that a substantial enhancement in the ozone layer could accompany worldwide SST fleet operations and that water vapor may be an important factor in SST assessments. Revised rate coefficients for various ozone-destroying reactions are employed in calculations which indicate a slight increase in the total content of stratospheric ozone for modest-sized fleets of SSTs flying below about 25 km. It is found that water-vapor chemical reactions can negate in large part the NOx-induced ozone gains computed below 25 km and that increased use of nitrogen fertilizer might also enhance the ozone layer.

  12. Prevention of Helicobacter pylori-induced gastric cancers in gerbils by a DNA demethylating agent.


    Niwa, Tohru; Toyoda, Takeshi; Tsukamoto, Tetsuya; Mori, Akiko; Tatematsu, Masae; Ushijima, Toshikazu


    Suppression of aberrant DNA methylation is a novel approach to cancer prevention, but, so far, the efficacy of the strategy has not been evaluated in cancers associated with chronic inflammation. Gastric cancers induced by Helicobacter pylori infection are known to involve aberrant DNA methylation and associated with severe chronic inflammation in their early stages. Here, we aimed to clarify whether suppression of aberrant DNA methylation can prevent H. pylori-induced gastric cancers using a Mongolian gerbil model. Administration of a DNA demethylating agent, 5-aza-2'-deoxycytidine (5-aza-dC), to gerbils (0.125 mg/kg for 50-55 weeks) decreased the incidence of gastric cancers induced by H. pylori infection and N-methyl-N-nitrosourea (MNU) treatment from 55.2% to 23.3% (P < 0.05). In gastric epithelial cells, DNA methylation levels of six CpG islands (HE6, HG2, SB1, SB5, SF12, and SH6) decreased to 46% to 68% (P < 0.05) of gerbils without 5-aza-dC treatment. Also, the global DNA methylation level decreased from 83.0% ± 4.5% to 80.3% ± 4.4% (mean ± SD) by 5-aza-dC treatment (P < 0.05). By 5-aza-dC treatment, Il1b and Nos2 were downregulated (42% and 58% of gerbils without, respectively) but Tnf was upregulated (187%), suggesting that 5-aza-dC treatment induced dysregulation of inflammatory responses. No obvious adverse effect of 5-aza-dC treatment was observed, besides testicular atrophy. These results showed that 5-aza-dC treatment can prevent H. pylori-induced gastric cancers and suggested that removal of induced DNA methylation and/or suppression of DNA methylation induction can become a target for prevention of chronic inflammation-associated cancers. PMID:23559452

  13. Effects of (+)-catechin and (-)-epicatechin on heterocyclic amines-induced oxidative DNA damage.


    Haza, Ana Isabel; Morales, Paloma


    The aim of the present study was to evaluate the protective effect of (+)-catechin and (-)-epicatechin against 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (8-MeIQx), 2-amino-3,4,8-trimethylimidazo[4,5-f]-quinoxaline (4,8-diMeIQx) and 2-amino-1-methyl-6-phenyl-imidazo[4,5-b]pyridine (PhIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or comet assay. Increasing concentrations of 8-MeIQx, 4,8-diMeIQx and PhIP induced a significant increase in DNA strand breaks and oxidized purines and pyrimidines in a dose-dependent manner. Among those, PhIP (300 µm) exerted the highest genotoxicity. (+)-Catechin exerted protection against oxidized purines induced by 8-MeIQx, 4,8-diMeIQx and PhIP. Oxidized pyrimidines and DNA strand breaks induced by PhIP were also prevented by (+)-catechin. Otherwise, (-)-epicatechin protected against the oxidized pyrimidines induced by PhIP and the oxidized purines induced by 8-MeIQx and 4,8-diMeIQx. One feasible mechanism by which (+)-catechin and (-)-epicatechin exert their protective effect towards heterocyclic amines-induced oxidative DNA damage may be by modulation of phase I and II enzyme activities. The ethoxyresorufin O-deethylation (CYP1A1) activity was moderately inhibited by (+)-catechin, while little effect was observed by (-)-epicatechin. However, (+)-catechin showed the greatest increase in UDP-glucuronyltransferase activity. In conclusion, our results clearly indicate that (+)-catechin was more efficient than (-)-epicatechin in preventing DNA damage (strand breaks and oxidized purines/pyrimidines) induced by PhIP than that induced by 8-MeIQx and 4,8-diMeIQx. PMID:20583320

  14. Kinetics and localization of wound-induced DNA biosynthesis in potato tuber

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses that are involved in processes required to heal and protect surviving plant tissues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marke...

  15. Conformational selection and induced fit for RNA polymerase and RNA/DNA hybrid backtracked recognition

    PubMed Central

    Wu, Jian; Ye, Wei; Yang, Jingxu; Chen, Hai-Feng


    RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD) simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15, and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS) P-test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein. PMID:26594643

  16. UVA-induced DNA double-strand breaks result from the repair of clustered oxidative DNA damages

    PubMed Central

    Greinert, R.; Volkmer, B.; Henning, S.; Breitbart, E. W.; Greulich, K. O.; Cardoso, M. C.; Rapp, Alexander


    UVA (320–400 nm) represents the main spectral component of solar UV radiation, induces pre-mutagenic DNA lesions and is classified as Class I carcinogen. Recently, discussion arose whether UVA induces DNA double-strand breaks (dsbs). Only few reports link the induction of dsbs to UVA exposure and the underlying mechanisms are poorly understood. Using the Comet-assay and γH2AX as markers for dsb formation, we demonstrate the dose-dependent dsb induction by UVA in G1-synchronized human keratinocytes (HaCaT) and primary human skin fibroblasts. The number of γH2AX foci increases when a UVA dose is applied in fractions (split dose), with a 2-h recovery period between fractions. The presence of the anti-oxidant Naringin reduces dsb formation significantly. Using an FPG-modified Comet-assay as well as warm and cold repair incubation, we show that dsbs arise partially during repair of bi-stranded, oxidative, clustered DNA lesions. We also demonstrate that on stretched chromatin fibres, 8-oxo-G and abasic sites occur in clusters. This suggests a replication-independent formation of UVA-induced dsbs through clustered single-strand breaks via locally generated reactive oxygen species. Since UVA is the main component of solar UV exposure and is used for artificial UV exposure, our results shine new light on the aetiology of skin cancer. PMID:22941639

  17. Ozone variability

    NASA Astrophysics Data System (ADS)

    Duetsch, H. U.


    The annual and long-term variations in the atmospheric ozone layer were examined on the basis of 55 yr of data taken at Aroya, Switzerland and 25 yr of data gathered by the global ozone network. Attention was given to annual and biennial variations, which showed that the midlatitude peak concentration was affected by a quasi-biennial variation of the tropical stratospheric circulation. Smaller scale circulation patterns were dominant in the lower stratosphere, although an observed negative trend of the total ozone was equally distributed between the troposphere and 24 km altitude. The global ozone increase detected in the 1960s was possible due to general circulation alterations, but may also have been influenced by injection of NO(x) into the atmosphere during atomic bomb testing.

  18. Ozone, Tropospheric

    NASA Technical Reports Server (NTRS)

    Fishman, Jack


    In the early part of the 20th century, ground-based and balloon-borne measurements discovered that most of atmosphere's ozone is located in the stratosphere with highest concentrations located between 15 and 30 km (9,3 and 18.6 miles). For a long time, it was believed that tropospheric ozone originated from the stratosphere and that most of it was destroyed by contact with the earth's surface. Ozone, O3, was known to be produced by the photo-dissociation of molecular oxygen, O2, a process that can only occur at wavelengths shorter than 242 nm. Because such short-wave-length radiation is present only in the stratosphere, no tropospheric ozone production is possible by this mechanism. In the 1940s, however, it became obvious that production of ozone was also taking place in the troposphere. The overall reaction mechanism was eventually identified by Arie Haagen-Smit of the California Institute of Technology, in highly polluted southern California. The copious emissions from the numerous cars driven there as a result of the mass migration to Los Angeles after World War 2 created the new unpleasant phenomenon of photochemical smog, the primary component of which is ozone. These high levels of ozone were injuring vegetable crops, causing women's nylons to run, and generating increasing respiratory and eye-irritation problems for the populace. Our knowledge of tropospheric ozone increased dramatically in the early 1950s as monitoring stations and search centers were established throughout southern California to see what could be done to combat this threat to human health and the environment.

  19. Signal-Induced Noise Effects in a Photon Counting System for Stratospheric Ozone Measurement

    NASA Technical Reports Server (NTRS)

    Harper, David B.; DeYoung, Russell J.


    Signal-induced noise (SIN) is a common effect resulting when a photomultiplier tube (PMT) is saturated, for a brief moment, with a high intensity light pulse. After the laser pulse is sent into the atmosphere a very large light return, from either the near-field or a cloud, causes the PMT to momentarily saturate. The PMT is gated off at this time so no signal is seen at the anode. When the PMT gate is turned on, the far-field light return from the atmosphere is observed. This signal is distorted, however because of the addition of SIN to the received light signal causing a slower than expected decay of the atmospheric signal return. We have characterized SIN responses to varying parameters of the incident light on the PMT. These varied parameters included incident wavelength, PMT voltage, incident intensity, and tube type. We found that only the amplitude of the SIN was effected by varying PMT voltages and light intensities. The amplitude increased linearly as input light intensity increased. Different incident wavelengths at the same intensity did not effect the amplitude or the temporal behavior of the SIN response. Finally, different PMT tubes with similar physical structures exhibited similar SIN responses although with different amplitudes. The different amplitudes can be attributed to the different gains and operating voltages of each tube. These results suggest that SIN is caused by photocathode electron dynamics such as charge accumulation on internal PMT surfaces. These surfaces then emit the electrons slowly resulting in a long decay noise signal. With the SIN responses characterized we can now try to develop a method to reduce or eliminate SIN in DIAL systems.

  20. DNA Methylation in the Medial Prefrontal Cortex Regulates Alcohol-Induced Behavior and Plasticity

    PubMed Central

    Tapocik, Jenica D.; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R.; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F.; Goldman, David; Heilig, Markus


    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism. PMID:25878287

  1. DNA damage induced by m-phenylenediamine and its derivative in the presence of copper ion.


    Chen, F; Murata, M; Hiraku, Y; Yamashita, N; Oikawa, S; Kawanishi, S


    To clarify the mechanism of carcinogenesis by hair dyes, we compared the extent of DNA damage induced by mutagenic m-phenylenediamine and 4-methoxy-m-phenylenediamine, using 32P-5'-end-labeled DNA fragments obtained from the human c-Ha-ras-1 protooncogene and the p53 tumor suppressor gene. Carcinogenic 4-methoxy-m-phenylenediamine caused DNA damage at thymine and cytosine residues in the presence of Cu(II). Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited 4-methoxy-m-phenylenediamine-induced DNA damage, suggesting the involvement of H2O2 and Cu(I). Superoxide dismutase (SOD) enhanced the DNA damage. Formation of 8-hydroxy-2'-deoxyguanosine (8-OH-dG) was induced by 4-methoxy-m-phenylenediamine in the presence of Cu(II). UV-visible spectroscopic studies have shown that Cu(II) mediated autoxidation of 4-methoxy-m-phenylenediamine and SOD accelerated the autoxidation. On the other hand, non-carcinogenic m-phenylenediamine did not cause clear DNA damage and significant autoxidation even in the presence of Cu(II). These results suggest that carcinogenicity of m-phenylenediamines is associated with ability to cause oxidative DNA damage rather than bacterial mutagenicity. PMID:9802551

  2. DNA methylation in the medial prefrontal cortex regulates alcohol-induced behavior and plasticity.


    Barbier, Estelle; Tapocik, Jenica D; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F; Goldman, David; Heilig, Markus


    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism. PMID:25878287

  3. Role of DNA repair inhibition in lead- and cadmium-induced genotoxicity: a review.

    PubMed Central

    Hartwig, A


    Compounds of lead and cadmium have been shown to be carcinogenic to humans and experimental animals. However, the underlying mechanisms are still not understood. In mammalian cells in culture, lead(II) is weakly mutagenic after long incubation times and generates DNA strand breaks only after treatment with high, toxic doses. Cadmium(II) induces DNA strand breaks and chromosomal aberrations, but its mutagenic potential is rather weak. However, both metals exert pronounced indirect genotoxic effects. Lead(II) is comutagenic towards UV and N-methyl-N-nitro-N-nitrosoguanidine (MNNG) and enhances the number of UV-induced sister chromatid exchanges in V79 Chinese hamster cells. With regard to DNA repair, lead(II) causes an accumulation of DNA strand breaks after UV-irradiation in HeLa cells, indicating an interference with the polymerization or ligation step in excision repair. Cadmium(II) enhances the mutagenicity of UV light in V79 Chinese hamster cells and an increased sensitivity toward UV light is observed in various rodent and human cell lines. Furthermore, an inhibition of unscheduled DNA synthesis after UV-irradiation and a partial inhibition of the removal of UV-induced DNA lesions has been shown. For both metals, the indirect genotoxic effects are observed at low, nontoxic concentrations, suggesting that an interference with DNA repair processes may be predominant at biologically relevant concentrations. This might also explain the conflicting results of epidemiological studies obtained for both metals. Possible mechanisms of repair inhibition are discussed. PMID:7843136

  4. Crowding-Induced Hybridization of Single DNA Hairpins.


    Baltierra-Jasso, Laura E; Morten, Michael J; Laflör, Linda; Quinn, Steven D; Magennis, Steven W


    It is clear that a crowded environment influences the structure, dynamics, and interactions of biological molecules, but the complexity of this phenomenon demands the development of new experimental and theoretical approaches. Here we use two complementary single-molecule FRET techniques to show that the kinetics of DNA base pairing and unpairing, which are fundamental to both the biological role of DNA and its technological applications, are strongly modulated by a crowded environment. We directly observed single DNA hairpins, which are excellent model systems for studying hybridization, either freely diffusing in solution or immobilized on a surface under crowding conditions. The hairpins followed two-state folding dynamics with a closing rate increasing by 4-fold and the opening rate decreasing 2-fold, for only modest concentrations of crowder [10% (w/w) polyethylene glycol (PEG)]. These experiments serve both to unambiguously highlight the impact of a crowded environment on a fundamental biological process, DNA base pairing, and to illustrate the benefits of single-molecule approaches to probing the structure and dynamics of complex biomolecular systems. PMID:26654490

  5. Cytometric analysis of DNA changes induced by sulfur mustard

    SciTech Connect

    Smith, W.J.; Sanders, K.M.; Ruddle, S.E.; Gross, C.L.


    Sulfur mustard is an alkylating agent which causes severe, potentially debilitating blisters following cutaneous exposure. Its mechanism of pathogenesis is unknown and no antidote exists to prevent its pathology. The biochemical basis of sulfur mustard's vesicating activity has been hypothesized to be a cascade of events beginning with alkylation of DNA. Using human cells in culture, we have assessed the effects of sulfur mustard on cell cycle activity using flow cytometry with propidium iodide. Two distinct patterns emerged, a Gl/S interface block at concentrations equivalent to vesicating doses (>50-micronM) and a G2 block at 10-fold lower concentrations. In addition, noticeable increases in amount of dye uptake were observed at 4 and 24 hours after sulfur mustard exposure. These increases are believed to be related to DNA repair activities and can be prevented by treatment of the cells with niacinamide, which inhibits DNA repair. Other drugs which provide alternate alkylating sites or inhibit cell cycle progression were shown to lower the cytotoxicity of sulfur mustard and to protect against its direct DNA damaging effects.

  6. Extracellular DNA Acidifies Biofilms and Induces Aminoglycoside Resistance in Pseudomonas aeruginosa

    PubMed Central

    Wilton, Mike; Charron-Mazenod, Laetitia; Moore, Richard


    Biofilms consist of surface-adhered bacterial communities encased in an extracellular matrix composed of DNA, exopolysaccharides, and proteins. Extracellular DNA (eDNA) has a structural role in the formation of biofilms, can bind and shield biofilms from aminoglycosides, and induces antimicrobial peptide resistance mechanisms. Here, we provide evidence that eDNA is responsible for the acidification of Pseudomonas aeruginosa planktonic cultures and biofilms. Further, we show that acidic pH and acidification via eDNA constitute a signal that is perceived by P. aeruginosa to induce the expression of genes regulated by the PhoPQ and PmrAB two-component regulatory systems. Planktonic P. aeruginosa cultured in exogenous 0.2% DNA or under acidic conditions demonstrates a 2- to 8-fold increase in aminoglycoside resistance. This resistance phenotype requires the aminoarabinose modification of lipid A and the production of spermidine on the bacterial outer membrane, which likely reduce the entry of aminoglycosides. Interestingly, the additions of the basic amino acid l-arginine and sodium bicarbonate neutralize the pH and restore P. aeruginosa susceptibility to aminoglycosides, even in the presence of eDNA. These data illustrate that the accumulation of eDNA in biofilms and infection sites can acidify the local environment and that acidic pH promotes the P. aeruginosa antibiotic resistance phenotype. PMID:26552982

  7. Ochratoxin A induces oxidative DNA damage in liver and kidney after oral dosing to rats.


    Kamp, Hennicke G; Eisenbrand, Gerhard; Janzowski, Christine; Kiossev, Jetchko; Latendresse, John R; Schlatter, Josef; Turesky, Robert J


    The nephrotoxic/carcinogenic mycotoxin ochratoxin A (OTA) occurs as a contaminant in food and feed and may be linked to human endemic Balkan nephropathy. The mechanism of OTA-derived carcinogenicity is still under debate, since reactive metabolites of OTA and DNA adducts have not been unambiguously identified. Oxidative DNA damage, however, has been observed in vitro after incubation of mammalian cells with OTA. In this study, we investigated whether OTA induces oxidative DNA damage in vivo as well. Male F344 rats were dosed with 0, 0.03, 0.1, 0.3 mg/kg bw per day OTA for 4 wk (gavage, 7 days/wk, five animals per dose group). Subsequently, oxidative DNA damage was determined in liver and kidney by the comet assay (single cell gel electrophoresis) with/without use of the repair enzyme formamido-pyrimidine-DNA-glycosylase (FPG). The administration of OTA had no effect on basic DNA damage (determined without FPG); however, OTA-mediated oxidative damage was detected with FPG treatment in kidney and liver DNA of all dose groups. Since the doses were in a range that had caused kidney tumors in a 2-year carcinogenicity study with rats, the oxidative DNA damage induced by OTA may help to explain its mechanism of carcinogenicity. For the selective induction of tumors in the kidney, increased oxidative stress in connection with severe cytotoxicity and increased cell proliferation might represent driving factors. PMID:16302199

  8. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor


    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  9. Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells

    NASA Astrophysics Data System (ADS)

    Yu, L. D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.


    As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10-20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence.

  10. Intranasal vaccination with proinsulin DNA induces regulatory CD4+ T cells that prevent experimental autoimmune diabetes.


    Every, Alison L; Kramer, David R; Mannering, Stuart I; Lew, Andrew M; Harrison, Leonard C


    Insulin, an autoantigen in type 1 diabetes, when administered mucosally to diabetes-prone NOD mice induces regulatory T cells (T(reg)) that protect against diabetes. Compared with protein, Ag encoded as DNA has potential advantages as a therapeutic agent. We found that intranasal vaccination of NOD mice with plasmid DNA encoding mouse proinsulin II-induced CD4+ T(reg) that suppressed diabetes development, both after adoptive cotransfer with "diabetogenic" spleen cells and after transfer into NOD mice given cyclophosphamide to accelerate diabetes onset. In contrast to prototypic CD4+ CD25+ T(reg), CD4+ T(reg) induced by proinsulin DNA were both CD25+ and CD25- and not defined by markers such as glucocorticoid-induced TNFR-related protein (GITR), CD103, or Foxp3. Intriguingly, despite induction of T(reg) and reduced islet inflammation, diabetes incidence in proinsulin DNA-treated mice was unchanged. However, diabetes was prevented when DNA vaccination was performed under the cover of CD40 ligand blockade, known to prevent priming of CTL by mucosal Ag. Thus, intranasal vaccination with proinsulin DNA has therapeutic potential to prevent diabetes, as demonstrated by induction of protective T(reg), but further modifications are required to improve its efficacy, which could be compromised by concomitant induction of pathogenic immunity. PMID:16585551

  11. Complete Spectrum of CRISPR/Cas9-induced Mutations on HBV cccDNA.


    Seeger, Christoph; Sohn, Ji A


    Hepatitis B virus (HBV) causes chronic infections that cannot yet be cured. The virus persists in infected hepatocytes, because covalently closed circular DNA (cccDNA), the template for the transcription of viral RNAs, is stable in nondividing cells. Antiviral therapies with nucleoside analogues inhibit HBV DNA synthesis in capsids in the cytoplasm of infected hepatocytes, but do not destroy nuclear cccDNA. Because over 200 million people are still infected, a cure for chronic hepatitis B (CHB) has become one of the major challenges in antiviral therapy. As a first step toward the development of curative therapies, we previously demonstrated that the CRISPR/Cas9 system can be used to functionally inactivate cccDNA derived from infectious HBV. Moreover, some evidence suggests that certain cytokines might induce an APOBEC-mediated cascade leading to the destruction of cccDNA. In this report we investigated whether a combination of the two mechanisms could act synergistically to inactivate cccDNA. Using next generation sequencing (NGS), we determined the complete spectrum of mutations in cccDNA following Cas9 cleavage and repair by nonhomologous end joining (NHEJ). We found that over 90% of HBV DNA was cleaved by Cas9. In addition our results showed that editing of HBV DNA after Cas9 cleavage is at least 15,000 times more efficient that APOBEC-mediated cytosine deamination following treatment of infected cells with interferon alpha (IFNα). We also found that a previously used method to detect cytosine deaminated DNA, termed 3D-PCR, overestimates the amount and frequency of edited HBV DNA. Taken together, our results demonstrated that the CRISPR/Cas9 system is so far the best method to functionally inactivate HBV cccDNA and provide a cure for CHB. PMID:27203444

  12. Three-Dimensional Mapping of Ozone-Induced Injury in the Nasal Airways of Monkeys Using Magnetic Resonance Imaging and Morphometric Techniques

    SciTech Connect

    Carey, Stephen A.; Minard, Kevin R.; Trease, Lynn L.; Wagner, James G.; Garcia, Guilherme M.; Ballinger, Carol A.; Kimbell, Julia; Plopper, Charles G.; Corley, Rick A.; Postlewait, Ed; Harkema, Jack R.


    ABSTRACT Age-related changes in gross and microscopic structure of the nasal cavity can alter local tissue susceptibility as well as the dose of inhaled toxicant delivered to susceptible sites. This article describes a novel method for the use of magnetic resonance imaging, 3-dimensional airway modeling, and morphometric techniques to characterize the distribution and magnitude of ozone-induced nasal injury in infant monkeys. Using this method, we are able to generate age-specific, 3-dimensional, epithelial maps of the nasal airways of infant Rhesus macaques. The principal nasal lesions observed in this primate model of ozone-induced nasal toxicology were neutrophilic rhinitis, along with necrosis and exfoliation of the epithelium lining the anterior maxilloturbinate. These lesions, induced by acute or cyclic (episodic) exposures, were examined by light microscopy, quantified by morphometric techniques, and mapped on 3-dimensional models of the nasal airways. Here, we describe the histopathologic, imaging, and computational biology methods developed to efficiently characterize, localize, quantify, and map these nasal lesions. By combining these techniques, the location and severity of the nasal epithelial injury were correlated with epithelial type, nasal airway geometry, and local biochemical and molecular changes on an individual animal basis. These correlations are critical for accurate predictive modeling of exposure-dose-response relationships in the nasal airways, and subsequent extrapolation of nasal findings in animals to humans for developing risk assessment.

  13. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc.


    Cooper, Karen L; King, Brenee S; Sandoval, Monica M; Liu, Ke Jian; Hudson, Laurie G


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  14. Agents that reverse UV-induced immune suppression and photocarcinogenesis affect DNA repair

    PubMed Central

    Sreevidya, Coimbatore S.; Fukunaga, Atsushi; Khaskhely, Noor M.; Masaki, Taro; Ono, Ryusuke; Nishigori, Chikako; Ullrich, Stephen E.


    UV exposure induces skin cancer, in part by inducing immune suppression. Repairing DNA damage, neutralizing the activity of cis-urocanic acid (cis-UCA), and reversing oxidative stress abrogates UV-induced immune suppression and skin cancer induction, suggesting the DNA, UCA and lipid photo-oxidation serves as UV photoreceptors. What is not clear is whether signaling through each of these different photoreceptors activates independent pathways to induce biological effects or whether there is a common checkpoint where these pathways converge. Here we show that agents known to reverse photocarcinogenesis and photoimmune suppression, such as platelet activating factor (PAF) and serotonin (5-HT) receptor antagonists regulate DNA repair. Pyrimidine dimer repair was accelerated in UV-irradiated mice injected with PAF and 5-HT receptor antagonists. Nucleotide excision repair, as measured by unscheduled DNA synthesis, was accelerated by PAF and 5-HT receptor antagonists. Injecting PAF and 5-HT receptor antagonists into UV-irradiated Xeroderma pigmentosum complementation group A (XPA) deficient mice, which lack the enzymes responsible for nucleotide excision repair, did not accelerate photoproduct repair. Similarly, UV-induced formation of 8-oxo-deoxyguanosine (8-oxo-dG) was reduced by PAF and 5-HT receptor antagonists. We conclude that PAF and 5-HT receptor antagonists accelerate DNA repair caused by UV radiation, which prevents immune suppression and interferes with photocarcinogenesis. PMID:19829299

  15. Toll-like Receptor 9 Can be Activated by Endogenous Mitochondrial DNA to Induce Podocyte Apoptosis

    PubMed Central

    Bao, Wenduona; Xia, Hong; Liang, Yaojun; Ye, Yuting; Lu, Yuqiu; Xu, Xiaodong; Duan, Aiping; He, Jing; Chen, Zhaohong; Wu, Yan; Wang, Xia; Zheng, Chunxia; Liu, Zhihong; Shi, Shaolin


    Toll-like receptor 9 (TLR9) senses bacterial DNA characteristic of unmethylated CpG motifs to induce innate immune response. TLR9 is de novo expressed in podocytes of some patients with glomerular diseases, but its role in podocyte injury remains undetermined. Since TLR9 activates p38 MAPK and NFkB that are known to mediate podocyte apoptosis, we hypothesized that TLR9 induces podocyte apoptosis in glomerular diseases. We treated immortalized podocytes with puromycin aminonucleosides (PAN) and observed podocyte apoptosis, accompanied by TLR9 upregulation. Prevention of TLR9 upregulation by siRNA significantly attenuated NFκB p65 or p38 activity and apoptosis, demonstrating that TLR9 mediates podocyte apoptosis. We next showed that endogenous mitochondrial DNA (mtDNA), whose CpG motifs are also unmethylated, is the ligand for TLR9, because PAN induced mtDNA accumulation in endolysosomes where TLR9 is localized, overexpression of endolysosomal DNase 2 attenuated PAN-induced p38 or p65 activity and podocyte apoptosis, and DNase 2 silencing was sufficient to activate p38 or p65 and induce apoptosis. In PAN-treated rats, TLR9 was upregulated in the podocytes, accompanied by increase of apoptosis markers. Thus, de novo expressed TLR9 may utilize endogenous mtDNA as the ligand to facilitate podocyte apoptosis, a novel mechanism underlying podocyte injury in glomerular diseases. PMID:26934958

  16. Induced topological changes in DNA complexes: influence of DNA sequences and small molecule structures

    PubMed Central

    Hunt, Rebecca A.; Munde, Manoj; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Arafa, Reem K.; Say, Martial; Batista-Parra, Adalgisa; Tevis, Denise; Boykin, David W.; Wilson, W. David


    Heterocyclic diamidines are compounds with antiparasitic properties that target the minor groove of kinetoplast DNA. The mechanism of action of these compounds is unknown, but topological changes to DNA structures are likely to be involved. In this study, we have developed a polyacrylamide gel electrophoresis-based screening method to determine topological effects of heterocyclic diamidines on four minor groove target sequences: AAAAA, TTTAA, AAATT and ATATA. The AAAAA and AAATT sequences have the largest intrinsic bend, whereas the TTTAA and ATATA sequences are relatively straight. The changes caused by binding of the compounds are sequence dependent, but generally the topological effects on AAAAA and AAATT are similar as are the effects on TTTAA and ATATA. A total of 13 compounds with a variety of structural differences were evaluated for topological changes to DNA. All compounds decrease the mobility of the ATATA sequence that is consistent with decreased minor groove width and bending of the relatively straight DNA into the minor groove. Similar, but generally smaller, effects are seen with TTTAA. The intrinsically bent AAAAA and AAATT sequences, which have more narrow minor grooves, have smaller mobility changes on binding that are consistent with increased or decreased bending depending on compound structure. PMID:21266485

  17. Cyclic GMP-AMP Synthase is Activated by Double-stranded DNA-Induced Oligomerization

    PubMed Central

    Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T.; Shelton, Catherine L.; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B.; Li, Pingwei


    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide 2′,5′ cGAMP that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and IFN-β reporter assays of cGAS mutants demonstrated that interactions at both DNA binding sites are essential for cGAS activation. Mutagenesis and DNA binding studies showed that the two sites bind dsDNA cooperatively and site B plays a critical role in DNA binding. The structure of mouse cGAS bound to dsDNA and 2′,5′ cGAMP provided insight into the catalytic mechanism of cGAS. These results demonstrated that cGAS is activated by dsDNA-induced oligomerization. PMID:24332030

  18. Crystal Structure of the Lactose Operon Repressor and Its Complexes with DNA and Inducer

    NASA Astrophysics Data System (ADS)

    Lewis, Mitchell; Chang, Geoffrey; Horton, Nancy C.; Kercher, Michele A.; Pace, Helen C.; Schumacher, Maria A.; Brennan, Richard G.; Lu, Ponzy


    The lac operon of Escherichia coli is the paradigm for gene regulation. Its key component is the lac repressor, a product of the lacI gene. The three-dimensional structures of the intact lac repressor, the lac repressor bound to the gratuitous inducer isopropyl-β-D-1-thiogalactoside (IPTG) and the lac repressor complexed with a 21-base pair symmetric operator DNA have been determined. These three structures show the conformation of the molecule in both the induced and repressed states and provide a framework for understanding a wealth of biochemical and genetic information. The DNA sequence of the lac operon has three lac repressor recognition sites in a stretch of 500 base pairs. The crystallographic structure of the complex with DNA suggests that the tetrameric repressor functions synergistically with catabolite gene activator protein (CAP) and participates in the quaternary formation of repression loops in which one tetrameric repressor interacts simultaneously with two sites on the genomic DNA.

  19. The DNA damage-induced cell death response: a roadmap to kill cancer cells.


    Matt, Sonja; Hofmann, Thomas G


    Upon massive DNA damage cells fail to undergo productive DNA repair and trigger the cell death response. Resistance to cell death is linked to cellular transformation and carcinogenesis as well as radio- and chemoresistance, making the underlying signaling pathways a promising target for therapeutic intervention. Diverse DNA damage-induced cell death pathways are operative in mammalian cells and finally culminate in the induction of programmed cell death via activation of apoptosis or necroptosis. These signaling routes affect nuclear, mitochondria- and plasma membrane-associated key molecules to activate the apoptotic or necroptotic response. In this review, we highlight the main signaling pathways, molecular players and mechanisms guiding the DNA damage-induced cell death response. PMID:26791483

  20. Geometry of a complex formed by double strand break repair proteins at a single DNA end: recruitment of DNA-PKcs induces inward translocation of Ku protein.


    Yoo, S; Dynan, W S


    Ku protein and the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) are essential components of the double-strand break repair machinery in higher eukaryotic cells. Ku protein binds to broken DNA ends and recruits DNA-PKcs to form an enzymatically active complex. To characterize the arrangement of proteins in this complex, we developed a set of photocross-linking probes, each with a single free end. We have previously used this approach to characterize the contacts in an initial Ku-DNA complex, and we have now applied the same technology to define the events that occur when Ku recruits DNA-PKcs. The new probes allow the binding of one molecule of Ku protein and one molecule of DNA-PKcs in a defined position and orientation. Photocross-linking reveals that DNA-PKcs makes direct contact with the DNA termini, occupying an approximately 10 bp region proximal to the free end. Characterization of the Ku protein cross-linking pattern in the presence and absence of DNA-PKcs suggests that Ku binds to form an initial complex at the DNA ends, and that recruitment of DNA-PKcs induces an inward translocation of this Ku molecule by about one helical turn. The presence of ATP had no effect on protein-DNA contacts, suggesting that neither DNA-PK-mediated phosphorylation nor a putative Ku helicase activity plays a role in modulating protein conformation under the conditions tested. PMID:10572166

  1. Calculation of complex DNA damage induced by ions

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.


    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  2. Calculation of complex DNA damage induced by ions

    SciTech Connect

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.


    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  3. Low Incubation Temperature Induces DNA Hypomethylation in Lizard Brains.


    Paredes, Ursula; Radersma, Reinder; Cannell, Naomi; While, Geoffrey M; Uller, Tobias


    Developmental stress can have organizational effects on suites of physiological, morphological, and behavioral characteristics. In lizards, incubation temperature is perhaps the most significant environmental variable affecting embryonic development. Wall lizards (Podarcis muralis) recently introduced by humans from Italy to England experience stressfully cool incubation conditions, which we here show reduce growth and increase the incidence of scale malformations. Using a methylation-sensitive AFLP protocol optimized for vertebrates, we demonstrate that this low incubation temperature also causes hypomethylation of DNA in brain tissue. A consistent pattern across methylation-susceptible AFLP loci suggests that hypomethylation is a general response and not limited to certain CpG sites. The functional consequences of hypomethylation are unknown, but it could contribute to genome stability and regulation of gene expression. Further studies of the effects of incubation temperature on DNA methylation in ectotherm vertebrates may reveal mechanisms that explain why the embryonic thermal environment often has physiological and behavioral consequences for offspring. PMID:27328739

  4. UV-Induced Proton Transfer between DNA Strands.


    Zhang, Yuyuan; de La Harpe, Kimberly; Beckstead, Ashley A; Improta, Roberto; Kohler, Bern


    UV radiation creates excited states in DNA that lead to mutagenic photoproducts. Photoexcitation of single-stranded DNA can transfer an electron between stacked bases, but the fate of excited states in the double helix has been intensely debated. Here, photoinduced interstrand proton transfer (PT) triggered by intrastrand electron transfer (ET) is detected for the first time by time-resolved vibrational spectroscopy and quantum mechanical calculations. Long-lived excited states are shown to be oppositely charged base pair radical ions. In two of the duplexes, the base pair radical anions are present as tautomers formed by interstrand PT. Charge recombination occurs on the picosecond time scale preventing the accumulation of damaging radicals or mutagenic tautomers. PMID:26005794

  5. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.


    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  6. Investigation of olive mill wastewater (OMW) ozonation efficiency with the use of a battery of selected ecotoxicity and human toxicity assays.


    Siorou, Sofia; Vgenis, Theodoros T; Dareioti, Margarita A; Vidali, Maria-Sophia; Efthimiou, Ioanna; Kornaros, Michael; Vlastos, Dimitris; Dailianis, Stefanos


    The effects of olive mill wastewater (OMW) on a battery of biological assays, before and during the ozonation process, were investigated in order to assess ozone's efficiency in removing phenolic compounds from OMW and decreasing the concomitant OMW toxicity. Specifically, ozonated-OMW held for 0, 60, 120, 300, 420, 540min in a glass bubble reactor, showed a drastic reduction of OMW total phenols (almost 50%) after 300min of ozonation with a concomitant decrease of OMW toxicity. In particular, the acute toxicity test primarily performed in the fairy shrimp Thamnocephalus platyurus (Thamnotoxkit F™ screening toxicity test) showed a significant attenuation of OMW-induced toxic effects, after ozonation for a period of 120 and in a lesser extent 300min, while further treatment resulted in a significant enhancement of ozonated-OMW toxic effects. Furthermore, ozonated-OMW-treated mussel hemocytes showed a significant attenuation of the ability of OMW to cause cytotoxic (obtained by the use of NRRT assay) effects already after an ozonation period of 120 and to a lesser extent 300min. In accordance with the latter, OMW-mediated oxidative (enhanced levels of superoxide anions and lipid peroxidation by-products) and genotoxic (induction of DNA damage) effects were diminished after OMW ozonation for the aforementioned periods of time. The latter was also revealed by the use of cytokinesis block micronucleus (CBMN) assay in human lymphocytes exposed to different concentrations of both raw- and ozonated-OMW for 60, 120 and 300min. Those findings revealed for a first time the existence of a critical time point during the OMW ozonation process that could be fundamentally used for evaluating OMW ozonation as a pretreatment method of OMW. PMID:25957716

  7. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.


    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  8. Polyethylene glycol and divalent salt-induced DNA reentrant condensation revealed by single molecule measurements.


    Cheng, Chao; Jia, Jun-Li; Ran, Shi-Yong


    In this study, we investigated the DNA condensation induced by polyethylene glycol (PEG) with different molecular weights (PEG 600 and PEG 6000) in the presence of NaCl or MgCl2 by using magnetic tweezers (MT) and atomic force microscopy (AFM). The MT measurements show that with increasing NaCl concentration, the critical condensation force in the PEG 600-DNA or PEG 6000-DNA system increased approximately linearly. PEG 6000 solution has a larger critical force than PEG 600 solution at a given NaCl concentration. In comparison, a parabolic trend of the critical condensation force was observed with increasing MgCl2 concentration, indicating that DNA undergoes a reentrant condensation. The AFM results show that the morphologies of the compacted DNA-PEG complexes depended on the salt concentration and were consistent with the MT results. PMID:25871460

  9. DNA demethylation caused by 5-Aza-2′-deoxycytidine induces mitotic alterations and aneuploidy

    PubMed Central

    Lentini, Laura; Cilluffo, Danilo; Di Leonardo, Aldo


    Aneuploidy, the unbalanced number of chromosomes in a cell, is considered a prevalent form of genetic instability and is largely acknowledged as a condition implicated in tumorigenesis. Epigenetic alterations like DNA hypomethylation have been correlated with cancer initiation/progression. Furthermore, a growing body of evidence suggests the involvement of epigenome-wide disruption as a cause of global DNA hypomethylation in aneuploidy generation. Here, we report that the DNA hypomethylating drug 5-aza-2′-deoxycytidine (DAC), affects the correct ploidy of nearly diploid HCT-116 human cells by altering the methylation pattern of the chromosomes. Specifically, we show that a DAC-induced reduction of 5-Methyl Cytosine at the pericentromeric region of chromosomes correlates with aneuploidy and mitotic defects. Our results suggest that DNA hypomethylation leads to aneuploidy by altering the DNA methylation landscape at the centromere that is necessary to ensure proper chromosomes segregation by recruiting the proteins necessary to build up a functional kinetochore. PMID:26771138

  10. Human papillomavirus type 16 DNA-induced malignant transformation of NIH 3T3 cells

    SciTech Connect

    Yasumoto, S.; Burkhardt, A.L.; Doniger, J.; DiPaolo, J.A.


    A biological function for human papillomavirus 16 (HPV 16) DNA was demonstrated by transformation of NIH 3T3 cells. HPV 16 DNA has been found frequently in genital cancer and has been classified as a papillomavirus on the basis of DNA homology. A recombinant HPV 16 DNA (pSHPV16d), which contains a head-to-tail dimer of the full-length HPV 16 genome, induced morphologic transformation; the transformed cells were tumorigenic in nude mice. Expression of transforming activity was unique because of the long latency period (more than 4 weeks) required for induction of morphologic transformation and because the transfected DNA existed primarily in a multimeric form with some rearrangement. Furthermore, virus-specific RNAs were expressed in the transformants. The transformation of NIH 3T3 cells provides a model for analyzing the functions of HPV 16, which is associated with cervical carcinomas.

  11. Condensations of single DNA molecules induced by heptaplatin and its chiral isomer

    SciTech Connect

    Zhang, Hong-Yan; Liu, Yu-Ru; Li, Wei; Li, Hui; Dou, Shuo-Xing; Xie, Ping; Wang, Wei-Chi; Wang, Peng-Ye


    Heptaplatin is a third-generation platinum antitumor drug. It has a chiral isomer. We studied the interactions between the two isomers and DNA by using magnetic tweezers and atomic force microscopy (AFM) to investigate the effect of chiralities of the isomers on the interactions. We found that the extension curves and average condensation rates of DNA molecules incubated with heptaplatin were nearly the same as those incubated with its chiral isomer. In addition, the structures of DNA molecules incubated with heptaplatin were also similar to those incubated with its chiral isomer. These results indicate the difference in chirality of the two isomers does not induce different interactions of the isomers with DNA. Our study may facilitate the understanding of interactions of platinum complexes with DNA and the design of new antitumor platinum complexes.

  12. The Potential Role of 8-Oxoguanine DNA Glycosylase-Driven DNA Base Excision Repair in Exercise-Induced Asthma

    PubMed Central

    Belanger, KarryAnne K.; Ameredes, Bill T.; Boldogh, Istvan


    Asthma is characterized by reversible airway narrowing, shortness of breath, wheezing, coughing, and other symptoms driven by chronic inflammatory processes, commonly triggered by allergens. In 90% of asthmatics, most of these symptoms can also be triggered by intense physical activities and severely exacerbated by environmental factors. This condition is known as exercise-induced asthma (EIA). Current theories explaining EIA pathogenesis involve osmotic and/or thermal alterations in the airways caused by changes in respiratory airflow during exercise. These changes, along with existing airway inflammatory conditions, are associated with increased cellular levels of reactive oxygen species (ROS) affecting important biomolecules including DNA, although the underlying molecular mechanisms have not been completely elucidated. One of the most abundant oxidative DNA lesions is 8-oxoguanine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase 1 (OGG1) during the base excision repair (BER) pathway. Whole-genome expression analyses suggest a cellular response to OGG1-BER, involving genes that may have a role in the pathophysiology of EIA leading to mast cell degranulation, airway hyperresponsiveness, and bronchoconstriction. Accordingly, this review discusses a potential new hypothesis in which OGG1-BER-induced gene expression is associated with EIA symptoms. PMID:27524866

  13. Irrigation of the abdominal cavity in the treatment of experimentally induced microbial peritonitis: Efficacy of ozonated saline

    SciTech Connect

    Ozmen, V.; Thomas, W.O.; Healy, J.T.; Fish, J.M.; Chambers, R.; Tacchi, E.; Nichols, R.L.; Flint, L.M.; Ferrara, J.J. )


    Ozone is an oxidizing agent possessing potent in vitro microbicidal capacity. This study was designed to address the extent to which irrigation of the contaminated abdominal cavity using a saline solution primed with ozone is effective in reducing morbidity and mortality. Gelatin capsules containing different quantities of a premixed slurry of filtered human fecal material were implanted in the peritoneal cavities of a preliminary series of rats. Three inocula concentrations were selected for later experiments, based upon their ability to produce morbid consequences: (1) high (100% 1-day mortality), (2) medium (70% 3-day mortality, 100% abscess rate in survivors), and (3) low (100% 10-day survival, 100% abscess rate). Fecal and abscess bacteriology were similar in all rats. The peritoneal cavities of 240 rats then underwent fecal-capsule implantation (three groups of 80 rats/inoculum concentration). At celiotomy 4 hours later, equal numbers of rats from each group were randomly assigned to one of four protocols: (1) no irrigation, (2) normal saline irrigation, (3) saline-cephalothin irrigation, and (4) ozonated saline irrigation. Each treatment lasted 5 minutes, using 100 ml of irrigation fluid. Mortality was significantly reduced when, in lieu of no irrigation, any of the irrigation solutions were used. Additionally, ozonated saline statistically proved the most effective irrigating solution for reducing abscess formation in survivors.

  14. Impacts of Foreign, Domestic, and State-Level Emissions on Ozone-Induced Vegetation Loss in the United States.


    Lapina, Kateryna; Henze, Daven K; Milford, Jana B; Travis, Katherine


    Exposure to elevated levels of ozone leads to yield reduction in agricultural crops and biomass loss in trees. Here, we quantify the impact of ozone pollution on two major U.S. crops, wheat and soybean, and two ozone-sensitive tree species, ponderosa pine and quaking aspen, using simulations with the GEOS-Chem model for 2010. Using previously established exposure-response functions, we estimate nationwide relative yield reductions of 4.9% for wheat and 6.7% for soybean, and relative biomass loss of 2.5% and 2.9% for ponderosa pine and aspen seedlings, respectively. Adjoint model sensitivities are used to estimate the impact of emissions sources from different locations, species, and sectors. We find that the nationwide relative loss in each vegetation type is influenced most by domestic anthropogenic NOx (>75%). Long-range transport from foreign sources is small relative to domestic influences. More than half of the anthropogenic NOx responsible for vegetation damage originates from outside the states where the damage occurs. Texas and Missouri are the highest contributors to the nationwide loss of wheat and soybean, respectively. California "exports" ozone damage for all types of vegetation studied, due to its location, high share of anthropogenic NOx, and a relatively low share of vegetation. PMID:26694633

  15. Ozone-induced changes in oxidative stress parameters in brains of adult, middle-age, and senescent Brown Norway rats

    EPA Science Inventory

    Understanding life-stage susceptibility is a critical part of community based human health risk assessment following chemical exposure. Recently there is growing concern over a common air pollutant, ozone (03), and adverse health effects including dysfunction of the pulmonary, ca...

  16. The Role of Underlying Type 2 Diabetes Mellitus and Obesity in Ozone-Induced Pulmonary Injury and Metabolic Impairment

    EPA Science Inventory

    RATIONALE: A growing body of evidence indicates an association between air pollution exposure and metabolic disorders such as obesity and type 2 diabetes mellitus (T2DM). We have recently demonstrated that an acute exposure to ozone in metabolically normal rat strains produces h...

  17. Ozone-Induced Pulmonary Injury and Vascular Contractility are Differentially Impacted by Coconut, Fish, and Olive Oil-Rich Diets

    EPA Science Inventory

    Pulmonary and systemic effects of ozone (O3) are mediated by hypothalamus pituitary adrenal (HPA)-axis activation. Fish oil (FO) and olive oil (OO) dietary supplementation have several cardioprotective benefits, but it is not established if these supplements can protect against t...

  18. The radiomimetic enediyne C-1027 induces unusual DNA damage responses to double-strand breaks.


    Kennedy, Daniel R; Beerman, Terry A


    Cells lacking the protein kinase ataxia telangiectasia mutated (ATM) have defective responses to DNA double-strand breaks (DSBs), including an inability to activate damage response proteins such as p53. However, we previously showed that cells lacking ATM robustly activate p53 in response to DNA strand breaks induced by the radiomimetic enediyne C-1027. To gain insight into the nature of C-1027-induced ATM-independent damage responses to DNA DSBs, we further examined the molecular mechanisms underlying the cellular response to this unique radiomimetic agent. Like ionizing radiation (IR) and other radiomimetics, breaks induced by C-1027 efficiently activate ATM by phosphorylation at Ser1981, yet unlike other radiomimetics and IR, DNA breaks induced by C-1027 result in normal phosphorylation of p53 and the cell cycle checkpoint kinases (Chk1 and Chk2) in the absence of ATM. In the presence of ATM, but under ATM and Rad3-related kinase (ATR) deficient conditions, C-1027 treatment resulted in a decrease in the level of Chk1 phosphorylation but not in the level of p53 and Chk2 phosphorylation. Only when cells were deficient in both ATM and ATR was there a reduction in the level of phosphorylation of each of these DNA damage response proteins. This reduction was also accompanied by an increased level of cell death in comparison to that of wild-type cells or cells lacking either ATM or ATR. Our findings demonstrate a unique cellular response to C-1027-induced DNA DSBs in that DNA damage response proteins are unaffected by the absence of ATM, as long as ATR is present. PMID:16533058

  19. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben


    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  20. Immune response induced by candidate Sarcoptes scabiei var. cuniculi DNA vaccine encoding paramyosin in mice.


    Gu, Xiaobin; Xie, Yue; Wang, Shuxian; Peng, Xuerong; Lai, Songjia; Yang, Guangyou


    Sarcoptes scabiei is the causal agent of the highly contagious disease sarcoptic mange (scabies) that affects animals and humans worldwide. An increasing number of cases of treatment failure is being reported because of drug resistance. The development of a specific vaccine would be a sustainable option for control of this disease. In this study, we cloned and expressed a S. scabiei gene encoding paramyosin (PAR) and investigated the immune response elicited by DNA encoding PAR in mice. The ability of the DNA vaccine to express antigen in COS-7 cells was confirmed by RT-PCR and IFA. The immune response induced by DNA vaccine was investigated by ELISA, splenocyte proliferation assay, and cytokine production assay. Compared to the pVAX1 control group, the PAR DNA vaccination group showed the higher levels of IgG, IgG1, IgG2a, IgE, IgM, stronger lymphocyte proliferation in mouse spleen, and larger production of IL-2, IL-4, IL-5, and IFN-γ in the supernatant of cultures from splenocytes. These results indicated that the PAR DNA vaccine induced a mixed Th1/Th2 response in mice. In conclusion, our results revealed that the S. scabiei PAR DNA vaccine induced both a humoral and cellular immune response, which would provide basic data for the further study to develop an effective vaccine against sarcoptic mange. PMID:24729069

  1. The adeno-associated virus rep gene suppresses herpes simplex virus-induced DNA amplification.

    PubMed Central

    Heilbronn, R; Bürkle, A; Stephan, S; zur Hausen, H


    Herpes simplex virus (HSV) induces within the host cell genome DNA amplification which can be suppressed by coinfection with adeno-associated virus (AAV). To characterize the AAV functions mediating this effect, cloned AAV type 2 wild-type or mutant genomes were transfected into simian virus 40 (SV40)-transformed hamster cells together with the six HSV replication genes (encoding UL5, UL8, major DNA-binding protein, DNA polymerase, UL42, and UL52) which together are necessary and sufficient for the induction of SV40 DNA amplification (R. Heilbronn and H. zur Hausen, J. Virol. 63:3683-3692, 1989). The AAV rep gene was identified as being responsible for the complete inhibition of HSV-induced SV40 DNA amplification. Likewise, rep inhibited origin-dependent HSV replication. rep neither killed the transfected host cells nor interfered with gene expression from the cotransfected amplification genes. This points to a specific interference with HSV-induced DNA amplification. Images PMID:2159559

  2. Viral Single-Strand DNA Induces p53-Dependent Apoptosis in Human Embryonic Stem Cells

    PubMed Central

    Hirsch, Matthew L.; Fagan, B. Matthew; Dumitru, Raluca; Bower, Jacquelyn J.; Yadav, Swati; Porteus, Matthew H.; Pevny, Larysa H.; Samulski, R. Jude


    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication. PMID:22114676

  3. Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks.


    Kuhar, Ryan; Gwiazda, Kamila S; Humbert, Olivier; Mandt, Tyler; Pangallo, Joey; Brault, Michelle; Khan, Iram; Maizels, Nancy; Rawlings, David J; Scharenberg, Andrew M; Certo, Michael T


    The creation of a DNA break at a specific locus by a designer endonuclease can be harnessed to edit a genome. However, DNA breaks may engage one of several competing repair pathways that lead to distinct types of genomic alterations. Therefore, understanding the contribution of different repair pathways following the introduction of a targeted DNA break is essential to further advance the safety and efficiency of nuclease-induced genome modification. To gain insight into the role of different DNA repair pathways in resolving nuclease-induced DNA breaks into genome editing outcomes, we previously developed a fluorescent-based reporter system, designated the Traffic Light Reporter, which provides a readout of gene targeting and gene disruption downstream of a targeted DNA double-strand break. Here we describe two related but novel reporters that extend this technology: one that allows monitoring of the transcriptional activity at the reporter locus, and thus can be applied to interrogate break resolution at active and repressed loci; and a second that reads out single-strand annealing in addition to gene targeting and gene disruption. Application of these reporters to assess repair pathway usage in several common gene editing contexts confirms the importance that chromatin status and initiation of end resection have on the resolution of nuclease-induced breaks. PMID:24121685

  4. Importa