DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth
Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less
RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878
2013-11-01
Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53
NASA Technical Reports Server (NTRS)
Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.
1997-01-01
The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe
2016-03-10
In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu
2012-06-29
Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
DOE Office of Scientific and Technical Information (OSTI.GOV)
An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min
Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less
Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M
1998-07-01
Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR. Thus, the fate of cells with p53 accumulation may depend on the interaction and the stoichiometry of the p53 and MDM2 proteins. Cells were indeed found with strong p53 accumulation and nuclear morphology typical for apoptosis and there were a few MIB1/Ki-67-positive cells with co-expression of MDM2, indicating a possible role for MDM2 in reversing the negative regulatory effects of p53 for cell cycle progression. The nuclear co-localization of p53 IR with MDM2 IR and the co-immunoprecipitation assay indicate the presence of p53-MDM2 complex formation in vivo in human atherosclerotic tissue. The destiny of individual p53 and MDM2-co-expressing cells either to undergo p53-dependent apoptosis or to re-enter the cycle of cell proliferation may depend on the relative ratios of the two proteins. p53 and MDM2 may therefore play an important role in regulating cellularity and inflammatory activity in human atherosclerotic plaques.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Toru; Ohashi, Sachiyo; Kobayashi, Shunsuke
In cancer cells, anticancer reagents often trigger nuclear accumulation of YB-1, which participates in the progression of cancer malignancy. YB-1 has a non-canonical nuclear localization signal (YB-NLS). Here we found that four nucleocytoplasmic-shuttling RNA-binding proteins and p53 interact specifically with the YB-NLS and co-accumulate with YB-1 in the nucleus of actinomycin D-treated cells. To elucidate the roles of these YB-NLS-binding proteins, we performed a dominant-negative experiment in which a large excess of YB-NLS interacts with the YB-NLS-binding proteins, and showed inhibitory effects on actinomycin D-induced nuclear transport of endogenous YB-1 and subsequent MDR1 gene expression. Furthermore, the YB-NLS-expressing cells weremore » also found to show increased drug sensitivity. Our results suggest that these YB-NLS-associating proteins are key factors for nuclear translocation/accumulation of YB-1 in cancer cells. - Highlights: • Four nucleocytoplasmic-shuttling proteins and p53 associate with YB-NLS. • They showed nuclear co-accumulation with YB-1 in actinomycin D-treated cells. • Overexpression of YB-NLS was carried out to take YB-NLS-binding proteins from YB-1. • YB-NLS inhibited actinomycin D-induced nuclear localization of endogenous YB-1. • YB-NLS suppressed actinomycin D-induced expression of MDR1.« less
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407
Cross Talk between PML and p53 during Poliovirus Infection: Implications for Antiviral Defense
Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K.
2006-01-01
PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation. PMID:16912307
Cross talk between PML and p53 during poliovirus infection: implications for antiviral defense.
Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K
2006-09-01
PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation.
Nguyen, Kim; Parry, Jesse J.; Rogers, Buck E.; Anderson, Carolyn J.
2011-01-01
Objectives Radiolabeled somatostatin analogs have become important agents for molecular imaging and targeted radiotherapy of somatostatin receptor-positive tumors. Here we determine the effect of the tumor suppressor protein, p53, on trafficking 64Cu to tumor cell nuclei from DOTA vs.CB-TE2A-conjugated agonist Y3-TATE and the antagonist 64Cu-CB-TE2A-sst2-ANT in cell lines that are positive or negative for p53. Methods Receptor binding, internalization, cAMP and nuclear localization studies were performed with the SSTr2 agonists, 64Cu-CB-TE2A-Y3-TATE and 64Cu-DOTA-Y3-TATE vs. antagonist, 64Cu-CB-TE2A-sst2-ANT, in SSTr2-transfected p53 +/+ and −/− HCT116 colorectal carcinoma cells. Results The antagonist, 64Cu-CB-TE2A-sst2-ANT, bound 8-9-fold more SSTr2 binding sites than did the 64Cu-labeled agonists. 64Cu-CB-TE2A-Y3-TATE was more efficiently internalized than 64Cu-DOTA-Y3-TATE, while 64Cu-CB-TE2A-sst2-ANT showed lower, yet significant levels of internalization. CB-TE2A-Y3-TATE acted as a full agonist, inhibiting cAMP production, whereas CB-TE2A-sst2-ANT showed no inhibition of cAMP production.The 64Cu from agonists 64Cu-DOTA-Y3-TATE and 64Cu-CB-TE2A-Y3-TATE showed greater nuclear localization at 24 h in p53 +/+ vs. −/− cells; however, there was no difference in the levels of 64Cu from the antagonist based on p53 status. Surprisingly, the DOTA and CB-TE2A-conjugated agonists showed similar nuclear localization in the p53 +/+ and −/− cells, suggesting no difference in 64Cu release from these chelators in the HCT116 cell lines. Conclusion Based on thesein vitro data, the agonist 64Cu-CB-TE2A-Y3-TATE demonstrated the most promise as an agent for targeted radiotherapy in p53 positive, SSTr2-positive tumors. PMID:22056254
Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage.
Karimian, Ansar; Ahmadi, Yasin; Yousefi, Bahman
2016-06-01
An appropriate control over cell cycle progression depends on many factors. Cyclin-dependent kinase (CDK) inhibitor p21 (also known as p21(WAF1/Cip1)) is one of these factors that promote cell cycle arrest in response to a variety of stimuli. The inhibitory effect of P21 on cell cycle progression correlates with its nuclear localization. P21 can be induced by both p53-dependent and p53-independent mechanisms. Some other important functions attributed to p21 include transcriptional regulation, modulation or inhibition of apoptosis. These functions are largely dependent on direct p21/protein interactions and also on p21 subcellular localizations. In addition, p21 can play a role in DNA repair by interacting with proliferating cell nuclear antigen (PCNA). In this review, we will focus on the multiple functions of p21 in cell cycle regulation, apoptosis and gene transcription after DNA damage and briefly discuss the pathways and factors that have critical roles in p21 expression and activity. Copyright © 2016 Elsevier B.V. All rights reserved.
Assessment of mdm2 Alterations on p53 Expression in Breast Cancer
2000-10-01
Figure 2. Schematic Comparison of mdm2 with PCR Products of Various Sizes. nuclear localization signal I p53 binding site X acidic domain zinc...susceptibility gene isolated by controlled homozygous functional knockout of allelic loci in mammalian cells. Cell. 85: 319-329, 1996. 36. Li, L., Li, X ...twelve years. Chinese Journal of Parasitology and Parasitic Diseases 10: 112-114, 1992. 7. Gao DQ, Cansesaa L, Mouradian MM, Jose P. Dopamine D2-long
Foster, K. Wade; Liu, Zhaoli; Nail, Clinton D.; Li, Xingnan; Fitzgerald, Thomas J.; Bailey, Sarah K.; Frost, Andra R.; Louro, Iuri D.; Townes, Tim M.; Paterson, Andrew J.; Kudlow, Jeffrey E.; Lobo-Ruppert, Susan M.; Ruppert, J. Michael
2006-01-01
KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions. PMID:15674344
Foster, K Wade; Liu, Zhaoli; Nail, Clinton D; Li, Xingnan; Fitzgerald, Thomas J; Bailey, Sarah K; Frost, Andra R; Louro, Iuri D; Townes, Tim M; Paterson, Andrew J; Kudlow, Jeffrey E; Lobo-Ruppert, Susan M; Ruppert, J Michael
2005-02-24
KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes, KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions.
Ehm, Patrick; Nalaskowski, Marcus M; Wundenberg, Torsten; Jücker, Manfred
2015-01-01
The inositol 5-phosphatase SHIP1 is a negative regulator of signaling processes in haematopoietic cells. By converting PI(3,4,5)P3 to PtdIns(3,4)P2 at the plasma membrane, SHIP1 modifies PI3-kinase mediated signaling. We have recently demonstrated that SHIP1 is a nucleo-cytoplasmic shuttling protein and SHIP1 nuclear puncta partially colocalize with FLASH, a component of nuclear bodies. In this study, we demonstrate that endogenous SHIP1 localizes to intranucleolar regions of both normal and leukemic haematopoietic cells. In addition, we report that ectopically expressed SHIP1 accumulates in nucleolar cavities and colocalizes with the tumor suppressor protein p53 and components of PML nuclear bodies (e.g. SP100, SUMO-1 and CK2). Moreover, SHIP1 also colocalizes in nucleolar cavities with components of the ubiquitin-proteasome pathway. By using confocal microscopy data, we generated 3D-models revealing the enormous extent of the SHIP1 aggresomes in the nucleolus. Furthermore, treatment of cells with the proteasome inhibitor MG132 causes an enlargement of nucleolar SHIP1 containing structures. Unexpectedly, this accumulation can be partially prevented by treatment with the inhibitor of nuclear protein export Leptomycin B. In recent years, several proteins aggregating in nucleolar cavities were shown to be key factors of neurodegenerative diseases and cancerogenesis. Our findings support current relevance of nuclear localized SHIP1.
Ehm, Patrick; Nalaskowski, Marcus M; Wundenberg, Torsten; Jücker, Manfred
2015-01-01
The inositol 5-phosphatase SHIP1 is a negative regulator of signaling processes in haematopoietic cells. By converting PI(3,4,5)P3 to PtdIns(3,4)P2 at the plasma membrane, SHIP1 modifies PI3-kinase mediated signaling. We have recently demonstrated that SHIP1 is a nucleo-cytoplasmic shuttling protein and SHIP1 nuclear puncta partially colocalize with FLASH, a component of nuclear bodies. In this study, we demonstrate that endogenous SHIP1 localizes to intranucleolar regions of both normal and leukemic haematopoietic cells. In addition, we report that ectopically expressed SHIP1 accumulates in nucleolar cavities and colocalizes with the tumor suppressor protein p53 and components of PML nuclear bodies (e.g. SP100, SUMO-1 and CK2). Moreover, SHIP1 also colocalizes in nucleolar cavities with components of the ubiquitin-proteasome pathway. By using confocal microscopy data, we generated 3D-models revealing the enormous extent of the SHIP1 aggresomes in the nucleolus. Furthermore, treatment of cells with the proteasome inhibitor MG132 causes an enlargement of nucleolar SHIP1 containing structures. Unexpectedly, this accumulation can be partially prevented by treatment with the inhibitor of nuclear protein export Leptomycin B. In recent years, several proteins aggregating in nucleolar cavities were shown to be key factors of neurodegenerative diseases and cancerogenesis. Our findings support current relevance of nuclear localized SHIP1. PMID:25723258
Nuclear thioredoxin-1 is required to suppress cisplatin-mediated apoptosis of MCF-7 cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Xiao-Ping; Liu, Shou; Tang, Wen-Xin
2007-09-21
Different cell line with increased thioredoxin-1 (Trx-1) showed a decreased or increased sensitivity to cell killing by cisplatin. Recently, several studies found that the subcellular localization of Trx-1 is closely associated with its functions. In this study, we explored the association of the nuclear Trx-1 with the cisplatin-mediated apoptosis of breast cancer cells MCF-7. Firstly, we found that higher total Trx-1 accompanied by no change of nuclear Trx-1 can not influence apoptosis induced by cisplatin in MCF-7 cells transferred with Trx-1 cDNA. Secondly, higher nuclear Trx-1 accompanied by no change of total Trx-1 can protect cells from apoptosis induced bymore » cisplatin. Thirdly, high nuclear Trx-1 involves in the cisplatin-resistance in cisplatin-resistive cells. Meanwhile, we found that the mRNA level of p53 is closely correlated with the level of nuclear Trx-1. In summary, we concluded that the nuclear Trx-1 is required to resist apoptosis of MCF-7 cells induced by cisplatin, probably through up-regulating the anti-apoptotic gene, p53.« less
Baldelli, Sara; Ciriolo, Maria Rosa
2016-12-20
p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress.
Baldelli, Sara; Ciriolo, Maria Rosa
2016-01-01
p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress. PMID:28025407
Guo, Yunjun; Parry, Jesse J; Laforest, Richard; Rogers, Buck E; Anderson, Carolyn J
2013-09-01
Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with (64)Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti-epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. We previously showed that nuclear localization of (64)Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with (64)Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor-bearing mice, with and without cisplatin, which upregulates wild-type p53. Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and -/- (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of (64)Cu from (64)Cu-acetate and (64)Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor-bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Together, these data suggest that (64)Cu specifically delivered to epidermal growth factor receptor-positive tumors by cetuximab can suppress tumor growth despite the KRAS status and present opportunities for personalized clinical treatment strategies in colorectal cancer.
Shimizu, Noriaki; Itoh, Nobuo; Utiyama, Hiroyasu; Wahl, Geoffrey M.
1998-01-01
Acentric, autonomously replicating extrachromosomal structures called double-minute chromosomes (DMs) frequently mediate oncogene amplification in human tumors. We show that DMs can be removed from the nucleus by a novel micronucleation mechanism that is initiated by budding of the nuclear membrane during S phase. DMs containing c-myc oncogenes in a colon cancer cell line localized to and replicated at the nuclear periphery. Replication inhibitors increased micronucleation; cell synchronization and bromodeoxyuridine–pulse labeling demonstrated de novo formation of buds and micronuclei during S phase. The frequencies of S-phase nuclear budding and micronucleation were increased dramatically in normal human cells by inactivating p53, suggesting that an S-phase function of p53 minimizes the probability of producing the broken chromosome fragments that induce budding and micronucleation. These data have implications for understanding the behavior of acentric DNA in interphase nuclei and for developing chemotherapeutic strategies based on this new mechanism for DM elimination. PMID:9508765
Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer
Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel
2016-01-01
Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766
Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73
NASA Astrophysics Data System (ADS)
Zhang, Heng; Wu, Shengnan
2011-01-01
p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.
Sepuri, Naresh Babu V; Tammineni, Prasad; Mohammed, Fareed; Paripati, Arunkumar
2017-01-01
Noncanonical functions of several nuclear transcription factors in the mitochondria have been gaining exceptional traction over the years. These transcription factors include nuclear hormone receptors like estrogen, glucocorticoid, and thyroid hormone receptors: p53, IRF3, STAT3, STAT5, CREB, NF-kB, and MEF-2D. Mitochondria-localized nuclear transcription factors regulate mitochondrial processes like apoptosis, respiration and mitochondrial transcription albeit being nuclear in origin and having nuclear functions. Hence, the cell permits these multi-stationed transcription factors to orchestrate and fine-tune cellular metabolism at various levels of operation. Despite their ubiquitous distribution in different subcompartments of mitochondria, their targeting mechanism is poorly understood. Here, we review the current status of mitochondria-localized transcription factors and discuss the possible targeting mechanism besides the functional interplay between these factors.
Hekmat-Scafe, Daria S; Brownell, Sara E; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S; Stearns, Tim
2017-03-04
The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course-based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students' high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA-binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161-178, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.
Brownell, Sara E.; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F. Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S.; Stearns, Tim
2016-01-01
Abstract The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course‐based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students′ high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA‐binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161–178, 2017. PMID:27873457
2014-01-01
Background Squamous cell carcinoma of tongue (SCCT) is expected to harbor unique clinico-pathological and molecular genetic features since a significant proportion of patients are young and exhibit no association with tobacco or alcohol. Methods We determined P53, epidermal growth factor receptor, microsatellite instability, human papilloma virus infection and loss of heterozygosity status at several tumor suppressor loci in one hundred and twenty one oral SCCT (SSCOT) samples and analyzed their association with clinico-pathological features and patient survival. Results Our results revealed a significantly higher incidence of p53 nuclear stabilization in early (as against late) onset SCCOT. FHIT loss was significantly associated with p53 nuclear stabilization and the association was stronger in patients with no history of tobacco use. Samples harboring mutation in p53 DNA binding domain or exhibiting p53 nuclear stabilization, were significantly associated with poor survival. Conclusion Our study has therefore identified distinct features in SCCOT tumorigenesis with respect to age and tobacco exposure and revealed possible prognostic utility of p53. PMID:25152695
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less
Evaluation of nuclear unrest and p53 immunostaining in Wilms' tumor.
Salama, Asmaa; Kamel, Ahmad
2011-03-01
Nuclear unrest is a term applied to Wilms' tumors (WT) that show nuclear abnormalities close to anaplasia but without abnormal mitoses. p53 is claimed to be associated with anaplasia and poor prognosis. This study was undertaken to evaluate the clinical significance of nuclear unrest and p53 immunostaining in Wilms' tumor. This is a retrospective study of 63 patients who presented at NCI with Wilms' tumors, and underwent preoperative chemotherapy followed by nephrectomy. Histopathologic assessment and p53 immunohistochemistry were done. WT with nuclear unrest grade III closely resembled anaplastic tumors and both of them (group 1) constituted 19% of cases. Group 1 constituted 29% of cases showing blastema dominant morphology compared to 9.4% of cases without blastema dominant morphology with significant statistical difference (p=0.047). Almost 83% of cases that achieved 1st complete remission were stages I, II and III, while 17% were stages IV and V with significant statistical difference (p<0.001). Stage affected the 3-year relapse-free-survival (RFS) significantly (p=0.014) as it was more in stages I, II and III than in stages IV and V (75.4% versus 50%). Blastema dominant morphology and high risk state significantly lowered the 3-year overall survival (OS) into 54.8% in comparison to 80.9% for cases with non-blastema dominant morphology (p=0.042). Regarding p53 immunohistochemistry, group 1 tumors showed positive p53 more than group 2 with significant statistical difference (p=0.014). p53 Positive immunostaining was significantly associated with high risk nephroblastoma (p=0.004). Tumor stage and blastema dominant morphology are potent prognostic factors. p53 is linked to blastema dominant morphology. WT with nuclear unrest grade III closely resembles anaplastic WT. It may be appropriate to group tumors with nuclear unrest grade III with anaplastic histology regarding treatment stratification. Copyright © 2011. Published by Elsevier B.V.
Nuclear TP53: An unraveled function as transcriptional repressor of PINK1.
Checler, Frédéric; Goiran, Thomas; Alves da Costa, Cristine
2018-05-11
The tumor suppressor TP53/p53 is a key protein in both neurodegenerative diseases and cancer. Thus, TP53-linked cell death appears exacerbated in several age-related neuropathologies, while TP53 mutation-associated phenotypes indicate a loss of function accounting for approximately half of cancers. Thus, TP53 plays a pivotal role in these phenotypically distinct pathologies, a hypothesis reinforced by recent epidemiological studies suggesting an opposite risk to develop one type of pathology relative to the other. Dysfunctions in mitophagic processes also occur in both types of pathologies and again, TP53 has been proposed as one of the regulators of this cellular process. The consensus view postulates that TP53 exerts both anti- and pro-autophagy functions that are directly driven by a specific subcellular localization. Thus, TP53 positively modulates autophagy via the transcriptional control of several genes while it is acknowledged that its anti-autophagy phenotype is exclusively linked to a transcription-independent cytosolic control of an AMPK-MTOR cascade. Our study indicates that TP53 can also downregulate the specialized autophagy-related mitophagy response via the transcriptional repression of PINK1. This is the first demonstration of an anti-mitophagic control by nuclear TP53.
Manganese superoxide dismutase: beyond life and death
Holley, Aaron K.; Dhar, Sanjit Kumar; Xu, Yong
2010-01-01
Manganese superoxide dismutase (MnSOD) is a nuclear-encoded antioxidant enzyme that localizes to the mitochondria. Expression of MnSOD is essential for the survival of aerobic life. Transgenic mice expressing a luciferase reporter gene under the control of the human MnSOD promoter demonstrate that the level of MnSOD is reduced prior to the formation of cancer. Overexpression of MnSOD in transgenic mice reduces the incidences and multiplicity of papillomas in a DMBA/TPA skin carcinogenesis model. However, MnSOD deficiency does not lead to enhanced tumorigenicity of skin tissue similarly treated because MnSOD can modulate both the p53-mediated apoptosis and AP-1-mediated cell proliferation pathways. Apoptosis is associated with an increase in mitochondrial levels of p53 suggesting a link between MnSOD deficiency and mitochondrial-mediated apoptosis. Activation of p53 is preventable by application of a SOD mimetic (MnTE-2-PyP5+). Thus, p53 translocation to mitochondria and subsequent inactivation of MnSOD explain the observed mitochondrial dysfunction that leads to transcription-dependent mechanisms of p53-induced apoptosis. Administration of MnTE-2-PyP5+ following apoptosis but prior to proliferation leads to suppression of protein carbonyls and reduces the activity of AP-1 and the level of the proliferating cellular nuclear antigen, without reducing the activity of p53 or DNA fragmentation following TPA treatment. Remarkably, the incidence and multiplicity of skin tumors are drastically reduced in mice that receive MnTE-2-PyP5+ prior to cell proliferation. The results demonstrate the role of MnSOD beyond its essential role for survival and suggest a novel strategy for an antioxidant approach to cancer intervention. PMID:20454814
Curcumin homing to the nucleolus: mechanism for initiation of an apoptotic program.
Ghosh, Mistuni; Ryan, Robert O
2014-11-01
Curcumin is a plant-derived polyphenol that displays antitumor properties. Incubation of cultured SF-767 glioma cells with curcumin gave rise to intense intranuclear foci of curcumin fluorescence. In vitro studies revealed that nuclear homing by curcumin is not a result of DNA/chromatin binding. On the other hand, curcumin fluorescence colocalized with nucleophosmin, a nucleolus marker protein. To determine the temporal relationship between curcumin-induced apoptosis and nucleolar homing, confocal live cell imaging was performed. The data show that curcumin localization to the nucleolus occurs prior to cell surface exposure of phosphatidylserine. In studies of the mechanism of curcumin-induced apoptosis in SF-767 cells, its effect on the subcellular location of p14(ARF) was determined. Whereas p14(ARF) was confined to the nucleolus in untreated cells, 2 h following incubation with curcumin, it displayed a diffuse nuclear distribution. Given the role of nuclear p14(ARF) in binding the E3 ubiquitin ligase, mouse double minute 2 homolog (MDM2), the effect of curcumin treatment on cellular levels of the tumor suppressor protein, p53, was examined. Between 2 and 4 h following curcumin treatment, p53 levels increased with maximum levels reached by 8 h. Thus, curcumin homing to the nucleolus induces redistribution of p14(ARF) to the nucleoplasm where interaction with MDM2 leads to stabilization of p53, with subsequent initiation of apoptosis. Copyright © 2014 Elsevier Inc. All rights reserved.
Guo, Yunjun; Parry, Jesse J.; Laforest, Richard; Rogers, Buck E.; Anderson, Carolyn J.
2014-01-01
Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with 64Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti–epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. Methods We previously showed that nuclear localization of 64Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with 64Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor–bearing mice, with and without cisplatin, which upregulates wild-type p53. Results Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and −/− (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of 64Cu from 64Cuacetate and 64Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor–bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Conclusion Together, these data suggest that 64Cu specifically delivered to epidermal growth factor receptor–positive tumors by cetuximab can suppress tumor growth despite the KRAS status and present opportunities for personalized clinical treatment strategies in colorectal cancer. PMID:23873478
Betticher, D. C.; Heighway, J.; Hasleton, P. S.; Altermatt, H. J.; Ryder, W. D.; Cerny, T.; Thatcher, N.
1996-01-01
Amplification of the CCDN1 gene encoding cyclin D1 was examined by Southern blotting and multiplex polymerase chain reaction (PCR) and occurred in 8 of 53 patients (15%) with primary resected non-small-cell lung cancer (NSCLC). These tumours and 17 additional tumours with a normal gene copy number showed overexpression of cyclin D1 (25/53, 47%), as assessed by immunostaining using a monoclonal antibody. In 22/25 cases, cyclin D1 was localised in the cytoplasm, but some (7/25) had simultaneous nuclear staining. This result is in marked contrast to that reported in breast, hepatocellular and colorectal carcinoma studies where immunostaining was invariably nuclear. Examination of a restriction fragment length polymorphic (RFLP) site within the 3'untranslated region of the cDNA following reverse transcriptase (RT)-PCR (29/53 informative cases) showed a strong association between cytoplasmic staining and imbalance in allele-specific message levels. Cyclin D1 overexpression was associated with a poorly differentiated histology (P = 0.04), less lymphocytic infiltration of the tumour (P = 0.02) and a reduction in local relapse rate (P = 0.01). The relative risk of local relapse was 9.1 in tumours without cyclin D1 overexpression (P = 0.01, Cox regression analysis). We conclude that genetic alteration of cyclin D1 is a key abnormality in lung carcinogenesis and may have diagnostic and prognostic importance in the treatment of resectable NSCLC. Images Figure 1 Figure 2 Figure 3 PMID:8562333
2010-01-01
Introduction Women with ductal hyperplasia including usual ductal hyperplasia (UDH) and atypical ductal hyperplasia (ADH) have an increased risk of developing invasive ductal carcinoma (IDC) of breast. The importance of several molecular markers in breast cancer has been of considerable interest during recent years such as p53 and estrogen receptor alpha (ERα). However, p53 nuclear accumulation and ERα expression have not been assessed in ductal hyperplasia co-existing with ductal carcinoma in situ (DCIS) or IDC versus pure ductal hyperplasia without DCIS or IDC. Materials and methods We investigated p53 nuclear accumulation and ERα expression in breast ductal hyperplasia in a cohort of 215 Chinese women by immunohistochemistry (IHC), which included 129 cases of pure ductal hyperplasia, 86 cases of ductal hyperplasia co-existing with DCIS (41 cases) or IDC (45 cases). Results Nuclear p53 accumulation was identified in 22.8% of ADH (31/136), 41.5% of DCIS (17/41) and 42.2% of IDC (19/45), and no case of UDH (0/79). No difference in nuclear p53 accumulation was observed between pure ADH and ADH co-existing with DCIS (ADH/DCIS) or IDC (ADH/IDC) (P > 0.05). The positive rate of ERα expression was lower in ADH (118/136, 86.8%) than that in UDH (79/79, 100%) (P < 0.001), but higher than that in DCIS (28/41, 68.3%) or IDC (26/45, 57.8%) respectively (P < 0.001). The frequency of ERα expression was lower in ADH/DCIS (23/29, 79.31%) and ADH/IDC (23/30, 76.67%) than that in pure ADH (72/77, 93.51%) respectively (P < 0.05). There was a negative weak correlation between p53 nuclear accumulation and ERα expression as for ADH (coefficient correlation -0.51; P < 0.001). Conclusions Different pathological types of ductal hyperplasia of breast are accompanied by diversity in patterns of nuclear p53 accumulation and ERα expression. At least some pure ADH is molecularly distinct from ADH/CIS or ADH/IDC which indicated the two types of ADH are molecularly distinct entities although they have the same morphological appearance. PMID:20712900
de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad
2016-01-01
O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830
The small molecule 2-phenylethynesulfonamide induces covalent modification of p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent
p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Nuclear YB-1 expression as a negative prognostic marker in nonsmall cell lung cancer.
Gessner, C; Woischwill, C; Schumacher, A; Liebers, U; Kuhn, H; Stiehl, P; Jürchott, K; Royer, H D; Witt, C; Wolff, G
2004-01-01
The human Y-box binding protein, YB-1, is a multifunctional protein that regulates gene expression. Nuclear expression of YB-1 has been associated with chemoresistance and poor prognosis of tumour patients. Representative samples from autopsied material of primary tumours from 77 patients with NSCLC were investigated by immunohistochemistry for subcellular distribution of YB-1 and p53, in order to evaluate the prognostic role of nuclear expression of YB-1. Cytoplasmic YB-1 expression was found in all tumour samples, whereas nuclear expression was only observed in 48%. There was no correlation with histological classification, clinical parameters or tumour size, stage and metastasis status. However, patients with positive nuclear YB-1 expression in tumours showed reduced survival times when compared with patients without nuclear expression. Including information about the histology and mutational status for p53 increased the prognostic value of nuclear YB-1. Patients with nuclear YB-1 expression and p53 mutations had the worst prognosis (median survival 3 months), while best outcome was found in patients with no nuclear YB-1 and wildtype p53 (median survival 15 months). This suggests that the combined analysis of both markers allows a better identification of subgroups with varying prognosis. Nuclear expression of Y-box binding protien seems to be an independent prognostic marker.
Yoneda-Kato, Noriko; Kato, Jun-Ya
2008-01-01
Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation.
Yoneda-Kato, Noriko; Kato, Jun-ya
2008-01-01
Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation. PMID:17967869
Tsapakidis, Konstantinos; Vlachostergios, Panagiotis J; Voutsadakis, Ioannis A; Befani, Christina D; Patrikidou, Anna; Hatzidaki, Eleana; Daliani, Danai D; Moutzouris, George; Liakos, Panagiotis; Papandreou, Christos N
2012-06-01
Neuropeptides are important signal initiators in advanced prostate cancer, partially acting through activation of nuclear factor kappa B. Central to nuclear factor kappa B regulation is the ubiquitin-proteasome system, pharmacological inhibition of which has been proposed as an anticancer strategy. We investigated the putative role of the proteasome inhibitor bortezomib in neuropeptides signaling effects on prostate cancer cells. Human prostate cancer cell lines, LNCaP and PC-3, were used to examine cell proliferation, levels of proapoptotic (caspase-3, Bad) and cell cycle regulatory proteins (p53, p27, p21), as well as total and phosphorylated Akt and p44/42 mitogen-activated protein kinase proteins. Furthermore, 20S proteasome activity, subcellular localization of nuclear factor kappa B and transcription of nuclear factor kappa B target genes, interleukin-8 and vascular endothelial growth factor, were assessed. Neuropeptides (endothelin-1, bombesin) increased cell proliferation, whereas bortezomib decreased proliferation and induced apoptosis, an effect maintained after cotreatment with neuropeptides. Bad, p53, p21 and p27 were downregulated by neuropeptides in PC-3, and these effects were reversed with the addition of bortezomib. Neuropeptides increased proteasomal activity and nuclear factor kappa B levels in PC-3, and these effects were prevented by bortezomib. Interleukin-8 and vascular endothelial growth factor transcripts were induced after neuropeptides treatment, but downregulated by bortezomib. These results coincided with the ability of bortezomib to reduce mitogen-activated protein kinase signaling in both cell lines. These findings are consistent with bortezomib-mediated abrogation of neuropeptides-induced proliferative and antiapoptotic signaling. Thus, the effect of the drug on the neuropeptides axis needs to be further investigated, as neuropeptide action in prostate cancer might entail involvement of the proteasome. © 2012 The Japanese Urological Association.
Oncoprotein p28 GANK binds to RelA and retains NF-kappaB in the cytoplasm through nuclear export.
Chen, Yao; Li, Hong Hai; Fu, Jing; Wang, Xue Feng; Ren, Yi Bin; Dong, Li Wei; Tang, Shan Hua; Liu, Shu Qing; Wu, Meng Chao; Wang, Hong Yang
2007-12-01
p28(GANK) (also known as PSMD10, p28 and gankyrin) is an ankyrin repeat anti-apoptotic oncoprotein that is commonly overexpressed in hepatocellular carcinomas and increases the degradation of p53 and Rb. NF-kappaB (nuclear factor-kappaB) is known to be sequestered in the cytoplasm by I kappaB (inhibitor of NF-kappaB) proteins, but much less is known about the cytoplasmic retention of NF-kappaB by other cellular proteins. Here we show that p28(GANK) inhibits NF-kappaB activity. As a nuclear-cytoplasmic shuttling protein, p28(GANK) directly binds to NF-kappaB/RelA and exports RelA from nucleus through a chromosomal region maintenance-1 (CRM-1) dependent pathway, which results in the cytoplasmic retention of NF-kappaB/RelA. We demonstrate that all the ankyrin repeats of p28(GANK) are required for the interaction with RelA and that the N terminus of p28(GANK), which contains the nuclear export sequence (NES), is responsible for suppressing NF-kappaB/RelA nuclear translocation. These results suggest that overexpression of p28(GANK) prevents the nuclear localization and inhibits the activity of NF-kappaB/RelA.
Sharma, Mayuri; Kamil, Jeremy P.; Coughlin, Margaret; Reim, Natalia I.
2014-01-01
Herpesvirus nucleocapsids traverse the nuclear envelope into the cytoplasm in a process called nuclear egress that includes disruption of the nuclear lamina. In several herpesviruses, a key player in nuclear egress is a complex of two proteins, whose homologs in human cytomegalovirus (HCMV) are UL50 and UL53. However, their roles in nuclear egress during HCMV infection have not been shown. Based largely on transfection studies, UL50 and UL53 have been proposed to facilitate disruption of the nuclear lamina by recruiting cellular protein kinase C (PKC), as occurs with certain other herpesviruses, and/or the viral protein kinase UL97 to phosphorylate lamins. To investigate these issues during HCMV infection, we generated viral mutants null for UL50 or UL53. Correlative light electron microscopic analysis of null mutant-infected cells showed the presence of intranuclear nucleocapsids and the absence of cytoplasmic nucleocapsids. Confocal immunofluorescence microscopy revealed that UL50 and UL53 are required for disruption of the nuclear lamina. A subpopulation of UL97 colocalized with the nuclear rim, and this was dependent on UL50 and, to a lesser extent, UL53. However, PKC was not recruited to the nuclear rim, and its localization was not affected by the absence of UL50 or UL53. Immunoprecipitation from cells infected with HCMV expressing tagged UL53 detected UL97 but not PKC. In summary, HCMV UL50 and UL53 are required for nuclear egress and disruption of nuclear lamina during HCMV infection, and they recruit UL97, not PKC, for these processes. Thus, despite the strong conservation of herpesvirus nuclear egress complexes, a key function can differ among them. PMID:24155370
Sharma, Mayuri; Kamil, Jeremy P; Coughlin, Margaret; Reim, Natalia I; Coen, Donald M
2014-01-01
Herpesvirus nucleocapsids traverse the nuclear envelope into the cytoplasm in a process called nuclear egress that includes disruption of the nuclear lamina. In several herpesviruses, a key player in nuclear egress is a complex of two proteins, whose homologs in human cytomegalovirus (HCMV) are UL50 and UL53. However, their roles in nuclear egress during HCMV infection have not been shown. Based largely on transfection studies, UL50 and UL53 have been proposed to facilitate disruption of the nuclear lamina by recruiting cellular protein kinase C (PKC), as occurs with certain other herpesviruses, and/or the viral protein kinase UL97 to phosphorylate lamins. To investigate these issues during HCMV infection, we generated viral mutants null for UL50 or UL53. Correlative light electron microscopic analysis of null mutant-infected cells showed the presence of intranuclear nucleocapsids and the absence of cytoplasmic nucleocapsids. Confocal immunofluorescence microscopy revealed that UL50 and UL53 are required for disruption of the nuclear lamina. A subpopulation of UL97 colocalized with the nuclear rim, and this was dependent on UL50 and, to a lesser extent, UL53. However, PKC was not recruited to the nuclear rim, and its localization was not affected by the absence of UL50 or UL53. Immunoprecipitation from cells infected with HCMV expressing tagged UL53 detected UL97 but not PKC. In summary, HCMV UL50 and UL53 are required for nuclear egress and disruption of nuclear lamina during HCMV infection, and they recruit UL97, not PKC, for these processes. Thus, despite the strong conservation of herpesvirus nuclear egress complexes, a key function can differ among them.
Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A
1998-01-01
A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.
Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan
Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less
Mapping of CIP/KIP inhibitors, G1 cyclins D1, D3, E and p53 proteins in the rat term placenta.
Korgun, Emin Turkay; Unek, Gozde; Herrera, Emilio; Jones, Carolyn J; Wadsack, Christian; Kipmen-Korgun, Dijle; Desoye, Gernot
2011-09-01
As cell cycle regulation is fundamental to the normal growth and development of the placenta, the aim of the present study was to determine the immunolocalizations of cell cycle related proteins, which have key roles in proliferation, differentiation and apoptosis during the development of the rat placenta. Here immunohistochemistry has been used to localize G1 cyclins (D1, D3, E), which are major determinants of proliferation, CIP/KIP inhibitors (p21, p27, p57), p53 as a master regulator and proliferating cell nuclear antigen in all cell types of the rat term placenta. The proportion of each cell type immunolabeled was counted. Cyclin D1 and cyclin D3 were present mostly in cells of the fetal aspect of the placenta, whereas the G1/S cyclin E was present only in the spongio- and labyrinthine trophoblast populations. Among the CIP/KIP inhibitors, p21 was present only in cells of the fetal aspect whereas p27 and p57 were found in all cell types studied. p53 was only found in a small proportion of cells with no co-localization of p53 and p21. The data suggest that the cells of the fetal side of the rat placenta still have some proliferation potential which is kept in check by expression of the CIP/KIP cell cycle inhibitors, whereas cells of the maternal aspect have lost this potential. Apoptosis is only marginal in the term rat placenta. In conclusion, proliferation and apoptosis in rat placental cells appears controlled mostly by the CIP/KIP inhibitors in late pregnancy.
Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent
2013-01-01
We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169
Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent
2013-09-01
We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.
Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation.
Jung, Yu Yeon; Son, Dong Ju; Lee, Hye Lim; Kim, Dae Hwan; Song, Min Jong; Ham, Young Wan; Kim, Youngsoo; Han, Sang Bae; Park, Mi Hee; Hong, Jin Tae
2017-08-01
Parkin is associated with various inflammatory diseases, including Parkinson's disease (PD) and rheumatoid arthritis (RA). However, the precise role of Parkin in RA is unclear. The present study addressed this issue by comparing the development of RA between non-transgenic (non-Tg) mice and PARK2 knockout (KO) mice. We found that cyclooxygenase-2 and inducible nitric oxide synthase expression and nuclear factor-κB activity were reduced but p53 activation was increased in PARK2 KO as compared to non-Tg mice. These effects were associated with reduced p53 degradation. Parkin was found to interact with p53; however, this was abolished in Parkin KO mice, which prevented p53 degradation. Treatment of PARK2 KO mice with p53 inhibitor increased Parkin expression as well as inflammation and RA development while decreasing nuclear p53 translocation, demonstrating that PARK2 deficiency inhibits inflammation in RA via suppression of p53 degradation. These results suggest that RA development may be reduced in PD patients. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Recognition of Local DNA Structures by p53 Protein
Brázda, Václav; Coufal, Jan
2017-01-01
p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646
Xu, Yinfeng; Wan, Wei; Shou, Xin; Huang, Rui; You, Zhiyuan; Shou, Yanhong; Wang, Lingling; Zhou, Tianhua; Liu, Wei
2016-07-02
Cells control their metabolism through modulating the anabolic and catabolic pathways. TP53INP2/DOR (tumor protein p53 inducible nuclear protein 2), participates in cell catabolism by serving as a promoter of autophagy. Here we uncover a novel function of TP53INP2 in protein synthesis, a major biosynthetic and energy-consuming anabolic process. TP53INP2 localizes to the nucleolus through its nucleolar localization signal (NoLS) located at the C-terminal domain. Chromatin immunoprecipitation (ChIP) assays detected an association of TP53INP2 with the ribosomal DNA (rDNA), when exclusion of TP53INP2 from the nucleolus repressed rDNA promoter activity and the production of ribosomal RNA (rRNA) and proteins. The removal of TP53INP2 also impaired the association of the POLR1/RNA polymerase I preinitiation complex (PIC) with rDNA. Further, TP53INP2 interacts directly with POLR1 PIC, and is required for the assembly of the complex. These data indicate that TP53INP2 promotes ribosome biogenesis through facilitating rRNA synthesis at the nucleolus, suggesting a dual role of TP53INP2 in cell metabolism, assisting anabolism on the nucleolus, and stimulating catabolism off the nucleolus.
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Yamamoto, Toshiyuki; Nishioka, Kiyoshi
2005-05-01
Systemic sclerosis (SSc) is a connective tissue disorder characterized by excessive deposition of extracellular matrix in the affected skin as well as various internal organs, vascular injury and immune abnormality; however, the etiology of SSc remains still unknown. We previously established an experimental mouse model for scleroderma by repeated local injections of bleomycin, a DNA damaging agent. In this study, we examined the induction of apoptosis and the expression of p53, p21 (Waf1/Cip1), and proliferating cell nuclear antigen (PCNA) in the lesional skin following bleomycin exposure in this model. Dermal sclerosis was induced by alternate day's injections of bleomycin for 4 weeks. TUNEL assay showed that apoptotic cells began to appear at 1 week after bleomycin exposure, and were prominently detected at 3-4 weeks. Immunohistochemical examination showed increased expression of p53 and p21 mainly in the infiltrating mononuclear cells at 2 weeks after bleomycin treatment. Bleomycin treatment markedly enhanced PCNA expression at 1-2 weeks, mainly in mesenchyme, as compared with control phosphate buffered saline treatment. Reverse transcriptase-polymerase chain reaction analysis showed that the expression of p53 and p21 mRNA was concurrently upregulated at 1-2 weeks after bleomycin treatment. Taken together, coordinate increased levels of p53 and p21 preceded the maximal induction of apoptosis and dermal sclerosis. Our findings suggest that apoptotic processes are involved in the pathophysiology of bleomycin-induced scleroderma, which may be mediated, in part, by the upregulation of p53 and p21.
Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef
2003-09-17
The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.
Lai, R; el Dabbagh, L; Mourad, W A
1996-06-01
Neoplastic transformation can be associated with mutations of the p53 gene. This leads to stabilization of its protein product and to its accumulation, which allows immunohistochemical detection. Mutant p53 expression has been seen in many neoplasms, including renal cell carcinoma (RCC). We recently described putative precursor lesions of RCC. The lesions were defined as intratubular epithelial dysplasia (IED) of kidney tubules adjacent to RCC. They were seen in one-third of the cases studied. The findings were based only on light microscopic analysis. We hypothesized that neoplastic transformation would be manifested by mutant p53 expression in the kidney tubules adjacent to RCC and not in nonneoplastic kidneys. Immunohistochemical staining for p53 in 24 cases of RCC with adjacent kidneys was performed. We used the DO-7 monoclonal antibody reactive for the N-terminal of the p53 protein on formalin-fixed paraffin-embedded tissue. Sections from 14 kidneys resected for nonneoplastic conditions were used as controls. Twenty-one (87%) of the 24 cases of RCC had nuclear p53 expression in the tumor cells. This included 14 cases (58%) with intense reactivity and 7 cases (29%) with weaker p53 immunoreactivity. Of the 24 cases of RCC, IED was identified in 13 cases (54%). Immunoreactivity for p53 was focally seen in tubules of all the lesions, as well as in the nonlesional areas. Six of the lesions exhibited intense nuclear staining. The kidneys adjacent to the RCC, with no evidence of IED, showed focally intense positive p53 nuclear staining in four cases. None of the control specimens showed p53 expression. Our findings provide supportive evidence that previously described IED in kidneys adjacent to RCC are most likely precursor lesions of the neoplasm. Aberrant expression of p53 in areas without evidence of IED may suggest that neoplastic transformation manifested by p53 mutation in kidney tubules may be seen before the development of the morphologic features of dysplasia and malignancy.
Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Yamaji, Taiki; Loda, Massimo; Fuchs, Charles S
2007-01-01
Downregulation of p27 (cyclin-dependent kinase inhibitor-1B, CDKN1B or KIP1) is caused by increased ubiquitin-mediated proteasomal degradation in colorectal cancer, and has been associated with poor prognosis. CpG island methylator phenotype (CIMP) is a phenotype of colorectal cancer with extensive promoter methylation, and associated with high degree of microsatellite instability (MSI-H) and BRAF mutations. We have recently shown that both CIMP and MSI-H are inversely associated with downregulation of p21 (CDKN1A or CIP1), another cyclin-dependent kinase inhibitor. However, no study to date has examined relationship between p27 and CIMP status in colorectal cancer. Using MethyLight assays, we measured DNA methylation in five CIMP-specific gene promoters {CACNA1G, CDKN2A (p16), CRABP1, MLH1 and NEUROG1} in 706 colorectal cancer samples obtained from two large prospective cohorts. Among the 706 tumors, 112 (16%) were CIMP-high tumors with >or=4/5 methylated promoters. We assessed p27 and p53 expressions by immunohistochemistry. Loss of nuclear p27 expression {observed in 231 tumors (33%)} was significantly associated with CIMP-high, MSI-H and BRAF mutations, and these associations were much more pronounced among p53-negative tumors than p53-positive tumors. When CIMP-high and non-CIMP-high tumors were stratified by MSI status (or KRAS and BRAF status), CIMP-high and MSI-H (but not BRAF mutations) were still significantly associated with nuclear p27 loss. Nuclear p27 loss did not appear to be directly related to CDKN2A (p16) methylation. We conclude that downregulation of nuclear p27 is associated with CIMP-high and MSI-H in colorectal cancer. These associations are stronger among p53 wild-type tumors, implying important interplay of p27 and p53 functions (or dysfunctions) in the development of various molecular subtypes of colorectal cancer.
Molecular biomarkers for progression of intraductal papillary mucinous neoplasm of the pancreas.
Kuboki, Yuko; Shimizu, Kyoko; Hatori, Takashi; Yamamoto, Masakazu; Shibata, Noriyuki; Shiratori, Keiko; Furukawa, Toru
2015-03-01
We aimed to identify molecular biomarkers for assessing the progression of intraductal papillary mucinous neoplasm of the pancreas (IPMN). We retrospectively investigated molecular aberrations and their associations with clinicopathological features in 172 IPMNs. GNAS and KRAS mutations were detected in 48% and 56% of IPMNs, respectively. No mutations of EGFR, PIK3CA GNAO1, GNAQ, or GNAI2 were observed. Significant associations were observed between IPMN morphological types and GNAS mutations, KRAS mutations, the expression of phosphorylated MAPK (pMAPK), AKT, and phosphorylated AKT (pAKT), nuclear accumulation of β-catenin, SMAD4 loss, and TP53 overexpression; histological grades and the expression of EGFR, pMAPK, AKT, and pAKT, the nuclear β-catenin, SMAD4 loss, and TP53 overexpression; invasive phenotypes and KRAS mutations, the nuclear β-catenin, and SMAD4 loss; and prognosis and SMAD4 loss and TP53 overexpression. Multivariate analysis to compare prognostic impacts of multiple molecular features revealed that TP53 overexpression was an independent prognostic factor (P = 0.030; hazard ratio, 5.533). These results indicate that mutations in GNAS and KRAS, the expression of EGFR and pMAPK, the nuclear β-catenin, SMAD4 loss, and TP53 overexpression may be relevant for assessing the clinical course of IPMN, including its progression into different morphological types, invasion, and prognosis.
Heat shock modulates the subcellular localization, stability, and activity of HIPK2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Upadhyay, Mamta; Bhadauriya, Pratibha; Ganesh, Subramaniam, E-mail: sganesh@iitk.ac.in
2016-04-15
The homeodomain-interacting protein kinase-2 (HIPK2) is a highly conserved serine/threonine kinase and is involved in transcriptional regulation. HIPK2 is a highly unstable protein, and is kept at a low level under normal physiological conditions. However, exposure of cells to physiological stress – such as hypoxia, oxidative stress, or UV damage – is known to stabilize HIPK2, leading to the HIPK2-dependent activation of p53 and the cell death pathway. Therefore HIPK2 is also known as a stress kinase and as a stress-activated pro-apoptotic factor. We demonstrate here that exposure of cells to heat shock results in the stabilization of HIPK2 andmore » the stabilization is mediated via K63-linked ubiquitination. Intriguingly, a sub-lethal heat shock (42 °C, 1 h) results in the cytoplasmic localization of HIPK2, while a lethal heat shock (45 °C, 1 h) results in its nuclear localization. Cells exposed to the lethal heat shock showed significantly higher levels of the p53 activity than those exposed to the sub-lethal thermal stress, suggesting that both the level and the nuclear localization are essential for the pro-apoptotic activity of HIPK2 and that the lethal heat shock could retain the HIPK2 in the nucleus to promote the cell death. Taken together our study underscores the importance of HIPK2 in stress mediated cell death, and that the HIPK2 is a generic stress kinase that gets activated by diverse set of physiological stressors.« less
Crosstalk between mitochondrial stress signals regulates yeast chronological lifespan.
Schroeder, Elizabeth A; Shadel, Gerald S
2014-01-01
Mitochondrial DNA (mtDNA) exists in multiple copies per cell and is essential for oxidative phosphorylation. Depleted or mutated mtDNA promotes numerous human diseases and may contribute to aging. Reduced TORC1 signaling in the budding yeast, Saccharomyces cerevisiae, extends chronological lifespan (CLS) in part by generating a mitochondrial ROS (mtROS) signal that epigenetically alters nuclear gene expression. To address the potential requirement for mtDNA maintenance in this response, we analyzed strains lacking the mitochondrial base-excision repair enzyme Ntg1p. Extension of CLS by mtROS signaling and reduced TORC1 activity, but not caloric restriction, was abrogated in ntg1Δ strains that exhibited mtDNA depletion without defects in respiration. The DNA damage response (DDR) kinase Rad53p, which transduces pro-longevity mtROS signals, is also activated in ntg1Δ strains. Restoring mtDNA copy number alleviated Rad53p activation and re-established CLS extension following mtROS signaling, indicating that Rad53p senses mtDNA depletion directly. Finally, DDR kinases regulate nucleus-mitochondria localization dynamics of Ntg1p. From these results, we conclude that the DDR pathway senses and may regulate Ntg1p-dependent mtDNA stability. Furthermore, Rad53p senses multiple mitochondrial stresses in a hierarchical manner to elicit specific physiological outcomes, exemplified by mtDNA depletion overriding the ability of Rad53p to transduce an adaptive mtROS longevity signal. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Yu, Qingfen; Ye, Wei; Wang, Wei; Chen, Hai-Feng
2013-01-01
The transactivation domain (TAD) of tumor suppressor p53 can bind with the nuclear coactivator binding domain (NCBD) of cyclic-AMP response element binding protein (CBP) and activate transcription. NMR experiments demonstrate that both apo-NCBD and TAD are intrinsic disordered and bound NCBD/TAD undergoes a transition to well folded. The recognition mechanism between intrinsic disordered proteins is still hotly debated. Molecular dynamics (MD) simulations in explicit solvent are used to study the recognition mechanism between intrinsic disordered TAD and NCBD. The average RMSD values between bound and corresponding apo states and Kolmogorov-Smirnov P test analysis indicate that TAD and NCBD may follow an induced fit mechanism. Quantitative analysis indicates there is also a global conformational selection. In summary, the recognition of TAD and NCBD might obey a local induced fit and global conformational selection. These conclusions are further supported by high-temperature unbinding kinetics and room temperature landscape analysis. These methods can be used to study the recognition mechanism of other intrinsic disordered proteins. PMID:23555731
ERIC Educational Resources Information Center
Seth, Rohit; Corniola, Rikki S.; Gower-Winter, Shannon D.; Morgan, Thomas J., Jr.; Bishop, Brian; Levenson, Cathy W.
2015-01-01
Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent…
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
Gümbel, Denis; Gelbrich, Nadine; Weiss, Martin; Napp, Matthias; Daeschlein, Georg; Sckell, Axel; Ender, Stephan A; Kramer, Axel; Burchardt, Martin; Ekkernkamp, Axel; Stope, Matthias B
2016-11-01
Cold atmospheric plasma has been shown to inhibit tumor cell growth and induce tumor cell death. The aim of the study was to investigate the effects of cold atmospheric plasma treatment on proliferation of human osteosarcoma cells and to characterize the underlying cellular mechanisms. Human osteosarcoma cells (U2-OS and MNNG/HOS) were treated with cold atmospheric plasma and seeded in culture plates. Cell proliferation, p53 and phospho-p53 protein expression and nuclear morphology were assessed. The treated human osteosarcoma cell lines exhibited attenuated proliferation rates by up to 66%. The cells revealed an induction of p53, as well as phospho-p53 expression, by 2.3-fold and 4.5-fold, respectively, compared to controls. 4',6-diamidino-2-phenylindole staining demonstrated apoptotic nuclear condensation following cold atmospheric plasma treatment. Cold atmospheric plasma treatment significantly attenuated cell proliferation in a preclinical in vitro osteosarcoma model. The resulting increase in p53 expression and phospho-activation in combination with characteristic nuclear changes indicate this was through induction of apoptosis. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morita, Akinori, E-mail: morita@tokushima-u.ac.jp; Ariyasu, Shinya; Wang, Bing
2014-08-08
Highlights: • A bidentate HQ derivative, AS-2, suppresses p53-dependent apoptosis by DNA damage. • AS-2 does not significantly affect nuclear p53 response. • UV-excited blue emission of AS-2 clearly showed its extranuclear localization. • AS-2 prevents mitochondrial dysfunction despite the increase of mitochondrial p53. • AS-2 protects mice from a radiation dose that causes lethal hematopoietic syndrome. - Abstract: In a previous study, we reported that some tetradentate zinc(II) chelators inhibit p53 through the denaturation of its zinc-requiring structure but a chelator, Bispicen, a potent inhibitor of in vitro apoptosis, failed to show any efficient radioprotective effect against irradiated micemore » because the toxicity of the chelator to mice. The unsuitability of using tetradentate chelators as radioprotectors prompted us to undertake a more extensive search for p53-inhibiting agents that are weaker zinc(II) chelators and therefore less toxic. Here, we show that an 8-hydroxyquinoline (8HQ) derivative, AS-2, suppresses p53-dependent apoptosis through a transcription-independent mechanism. A mechanistic study using cells with different p53 characteristics revealed that the suppressive effect of AS-2 on apoptosis is specifically mediated through p53. In addition, AS-2 was less effective in preventing p53-mediated transcription-dependent events than pifithrin-μ (PFTμ), an inhibitor of transcription-independent apoptosis by p53. Fluorescence visualization of the extranuclear distribution of AS-2 also supports that it is ineffective on the transcription-dependent pathway. Further investigations revealed that AS-2 suppressed mitochondrial apoptotic events, such as the mitochondrial release of intermembrane proteins and the loss of mitochondrial membrane potential, although AS-2 resulted in an increase in the mitochondrial translocation of p53 as opposed to the decrease of cytosolic p53, and did not affect the apoptotic interaction of p53 with Bcl-2. AS-2 also protected mice that had been exposed to a lethal dose of ionizing radiation. Our findings indicate that some types of bidentate 8HQ chelators could serve as radioprotectors with no substantial toxicity in vivo.« less
Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele
2009-04-15
The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.
Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M
1996-12-20
In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.
Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K
2017-10-01
Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (<5 cm) tumour) were recruited. The gene products of c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p < 0.0001) in the positivity rate of c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.
Around and beyond 53BP1 Nuclear Bodies.
Fernandez-Vidal, Anne; Vignard, Julien; Mirey, Gladys
2017-12-05
Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.
Sajeevan, Thara Purath; Saraswathi, Tillai Rajasekaran; Ranganathan, Kannan; Joshua, Elizabeth; Rao, Uma Devi K
2014-07-01
p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA) is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC) and periapical cyst (PA). A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%), whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1) OKC showed p53 expression in 6 cases (60%) whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2) The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.
CRISPR-mediated direct mutation of cancer genes in the mouse liver.
Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G; Zhang, Feng; Anderson, Daniel G; Sharp, Phillip A; Jacks, Tyler
2014-10-16
The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem cells. Here we describe a new method of cancer model generation using the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system in vivo in wild-type mice. We used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs) to the liver that directly target the tumour suppressor genes Pten (ref. 5) and p53 (also known as TP53 and Trp53) (ref. 6), alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology. Simultaneous targeting of Pten and p53 induced liver tumours that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumour tissue revealed insertion or deletion mutations of the tumour suppressor genes, including bi-allelic mutations of both Pten and p53 in tumours. Furthermore, co-injection of Cas9 plasmids harbouring sgRNAs targeting the β-catenin gene and a single-stranded DNA oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-catenin. This study demonstrates the feasibility of direct mutation of tumour suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics.
Schmoeckel, Elisa; Odai-Afotey, Ashley A.; Schleiβheimer, Michael; Rottmann, Miriam; Flesken-Nikitin, Andrea; Ellenson, Lora H.; Kirchner, Thomas; Mayr, Doris; Nikitin, Alexander Yu.
2017-01-01
Recently it has been reported that serous tubal intraepithelial carcinoma (STIC), the likely precursor of ovarian/extra-uterine high-grade serous carcinoma, are frequently located in the vicinity of tubal-peritoneal junctions, consistent with the cancer-prone features of many epithelial transitional regions. To test if p53 (aka TP53)-signatures and secretory cell outgrowths (SCOUTs) also localize to tubal-peritoneal junctions, we examined these lesions in the fallopian tubes of patients undergoing salpingo-oophorectomy for sporadic high-grade serous carcinomas or as a prophylactic procedure for carriers of familial BRCA1 or 2 mutations. STICs were located closest to the tubal-peritoneal junctions with an average distance of 1.31 mm, while SCOUTs were not detected in the fimbriated end of the fallopian tube. Since many epithelial transitional regions contain stem cells, we also determined the expression of stem cell markers in the normal fallopian tube, tubal intraepithelial lesions and high-grade serous carcinomas. Of those, LEF1 was consistently expressed in the tubal-peritoneal junctions and all lesions, independent of p53 status. All SCOUTs demonstrated strong nuclear expression of β-catenin consistent with the LEF1 participation in the canonical WNT pathway. However, β-catenin was preferentially located in the cytoplasm of cells comprising STICs and p53 signatures, suggesting WNT-independent function of LEF1 in those lesions. Both frequency of LEF1 expression and β-catenin nuclear expression correlated with the worst 5 year patient survival, supporting important role of both proteins in high-grade serous carcinoma. Taken together, our findings suggest the existence of stem cell niche within the tubal-peritoneal junctions. Furthermore, they support the notion that the pathogenesis of SCOUTs is distinct from that of STICs and p53 signatures. The location and discrete patterns of LEF1 and β-catenin expression may serve as highly sensitive and reliable ancillary markers for the detection and differential diagnosis of tubal intraepithelial lesions. PMID:28664938
Prognostic significance of p16INK4a/p53 in Tunisian patients with breast carcinoma.
Karray-Chouayekh, Sondes; Baccouche, Sami; Khabir, Abdelmajid; Sellami-Boudawara, Tahia; Daoud, Jamel; Frikha, Mounir; Jlidi, Rachid; Gargouri, Ali; Mokdad-Gargouri, Raja
2011-09-01
Infiltrating ductal carcinoma (IDC) of the breast is a result of genetic alterations that affect the regulation of the cell cycle check-point and apoptosis. The aim of the present study was analysis using immunohistochemical localization of mouse double minute-2 (mdm2), p16INK4a, p53, bax and bcl-2 markers in Tunisian patients with breast IDC and to determine if there was correlation with the major clinico-pathological parameters and with survival of patients. We showed that the expression of p53, p16INK4a, mdm2, bcl-2, and bax was observed in 46.3%, 20.7%, 38%, 50% and 11.9% of cases, respectively. Statistical analysis revealed that positive expression of mdm2 was associated with larger tumors (P=0.013), whereas bax positivity was more prevalent in younger patients and in tumors of smaller size (P=0.008 and P=0.012 respectively). Furthermore, the expression of p16INK4a correlated with advanced grade (P<0.0001), triple negative tumors (ER-/PR-/HER2-, P=0.001) and mdm2 expression (P=0.017). The absence of nuclear p53 accumulation was predictive of good prognosis as well as when it was associated with negative expression of p16INK4a. Our findings suggest that among the biomarkers tested, p16INK4a might have a useful clinical and prognostic significance in infiltrating ductal carcinoma of the breast. Copyright © 2010 Elsevier GmbH. All rights reserved.
Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X
2017-10-01
The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.
Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang
2017-11-03
Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.
Sánchez-Aguilera, Abel; Sánchez-Beato, Margarita; García, Juan F; Prieto, Ignacio; Pollan, Marina; Piris, Miguel A
2002-02-15
p14(ARF), the alternative product from the human INK4a/ARF locus, antagonizes Hdm2 and mediates p53 activation in response to oncogenic stimuli. An immunohistochemical study of p14(ARF) expression in 74 samples of aggressive B-cell lymphomas was performed, demonstrating an array of different abnormalities. A distinct nucleolar expression pattern was detected in nontumoral tissue and a subset of lymphomas (50/74). In contrast, a group of cases (8/74) showed absence of p14(ARF) expression, dependent either on promoter hypermethylation or gene loss. Additionally, 16 out of 74 cases displayed an abnormal nuclear p14(ARF) overexpression not confined to the nucleoli, as confirmed by confocal microscopy, and that was associated with high levels of p53 and Hdm2. A genetic study of these cases failed to show any alteration in the p14(ARF) gene, but revealed the presence of p53 mutations in over 50% of these cases. An increased growth fraction and a more aggressive clinical course, with a shortened survival time, also characterized the group of tumors with p14(ARF) nuclear overexpression. Moreover, this p14(ARF) expression pattern was more frequent in tumors displaying accumulated alterations in the p53, p16(INK4a), and p27(KIP1) tumor supressors. These observations, together with the consideration of the central role of p14(ARF) in cell cycle control, suggest that p14(ARF) abnormal nuclear overexpression is a sensor of malfunction of the major cell cycle regulatory pathways, and consequently a marker of a high tumor aggressivity.
Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi
2018-04-01
Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.
Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.
1995-01-01
We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Around and beyond 53BP1 Nuclear Bodies
Fernandez-Vidal, Anne; Vignard, Julien
2017-01-01
Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction. PMID:29206178
Miller, Matthew S; Furlong, Wendy E; Pennell, Leesa; Geadah, Marc; Hertel, Laura
2010-07-01
The products of numerous open reading frames (ORFs) present in the genome of human cytomegalovirus (CMV) have not been characterized. Here, we describe the identification of a new CMV protein localizing to the nuclear envelope and in cytoplasmic vesicles at late times postinfection. Based on this distinctive localization pattern, we called this new protein nuclear rim-associated cytomegaloviral protein, or RASCAL. Two RASCAL isoforms exist, a short version of 97 amino acids encoded by the majority of CMV strains and a longer version of 176 amino acids encoded by the Towne, Toledo, HAN20, and HAN38 strains. Both isoforms colocalize with lamin B in deep intranuclear invaginations of the inner nuclear membrane (INM) and in novel cytoplasmic vesicular structures possibly derived from the nuclear envelope. INM infoldings have been previously described as sites of nucleocapsid egress, which is mediated by the localized disruption of the nuclear lamina, promoted by the activities of viral and cellular kinases recruited by the lamina-associated proteins UL50 and UL53. RASCAL accumulation at the nuclear membrane required the presence of UL50 but not of UL53. RASCAL and UL50 also appeared to specifically interact, suggesting that RASCAL is a new component of the nuclear egress complex (NEC) and possibly involved in mediating nucleocapsid egress from the nucleus. Finally, the presence of RASCAL within cytoplasmic vesicles raises the intriguing possibility that this protein might participate in additional steps of virion maturation occurring after capsid release from the nucleus.
Rogers, Jason V; Rose, Mark D
2014-12-02
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide-sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p's functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. Copyright © 2015 Rogers and Rose.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costes, Sylvain V; Chiolo, Irene; Pluth, Janice M.
2009-09-15
DNA damage sensing proteins have been shown to localize to the sites of DSB within seconds to minutes following ionizing radiation (IR) exposure, resulting in the formation of microscopically visible nuclear domains referred to as radiation-induced foci (RIF). This review characterizes the spatio-temporal properties of RIF at physiological doses, minutes to hours following exposure to ionizing radiation, and it proposes a model describing RIF formation and resolution as a function of radiation quality and nuclear densities. Discussion is limited to RIF formed by three interrelated proteins ATM (Ataxia telangiectasia mutated), 53BP1 (p53 binding protein 1) and ?H2AX (phosphorylated variant histonemore » H2AX). Early post-IR, we propose that RIF mark chromatin reorganization, leading to a local nuclear scaffold rigid enough to keep broken DNA from diffusing away, but open enough to allow the repair machinery. We review data indicating clear kinetic and physical differences between RIF emerging from dense and uncondensed regions of the nucleus. At later time post-IR, we propose that persistent RIF observed days following exposure to ionizing radiation are nuclear ?scars? marking permanent disruption of the chromatin architecture. When DNA damage is resolved, such chromatin modifications should not necessarily lead to growth arrest and it has been shown that persistent RIF can replicate during mitosis. Thus, heritable persistent RIF spanning over tens of Mbp may affect the transcriptome of a large progeny of cells. This opens the door for a non DNA mutation-based mechanism of radiation-induced phenotypes.« less
Rodríguez-Marí, Adriana; Wilson, Catherine; Titus, Tom A; Cañestro, Cristian; BreMiller, Ruth A; Yan, Yi-Lin; Nanda, Indrajit; Johnston, Adam; Kanki, John P; Gray, Erin M; He, Xinjun; Spitsbergen, Jan; Schindler, Detlev; Postlethwait, John H
2011-03-01
Mild mutations in BRCA2 (FANCD1) cause Fanconi anemia (FA) when homozygous, while severe mutations cause common cancers including breast, ovarian, and prostate cancers when heterozygous. Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis. Experiments showed that mutant embryos and mutant cells in culture experienced genome instability, as do cells in FA patients. In wild-type zebrafish, meiotic cells expressed brca2; and, unexpectedly, transcripts in oocytes localized asymmetrically to the animal pole. In juvenile brca2 mutants, oocytes failed to progress through meiosis, leading to female-to-male sex reversal. Adult mutants became sterile males due to the meiotic arrest of spermatocytes, which then died by apoptosis, followed by neoplastic proliferation of gonad somatic cells that was similar to neoplasia observed in ageing dead end (dnd)-knockdown males, which lack germ cells. The construction of animals doubly mutant for brca2 and the apoptotic gene tp53 (p53) rescued brca2-dependent sex reversal. Double mutants developed oocytes and became sterile females that produced only aberrant embryos and showed elevated risk for invasive ovarian tumors. Oocytes in double-mutant females showed normal localization of brca2 and pou5f1 transcripts to the animal pole and vasa transcripts to the vegetal pole, but had a polarized rather than symmetrical nucleus with the distribution of nucleoli and chromosomes to opposite nuclear poles; this result revealed a novel role for Brca2 in establishing or maintaining oocyte nuclear architecture. Mutating tp53 did not rescue the infertility phenotype in brca2 mutant males, suggesting that brca2 plays an essential role in zebrafish spermatogenesis. Overall, this work verified zebrafish as a model for the role of Brca2 in human disease and uncovered a novel function of Brca2 in vertebrate oocyte nuclear architecture.
Rodríguez-Marí, Adriana; Wilson, Catherine; Titus, Tom A.; Cañestro, Cristian; BreMiller, Ruth A.; Yan, Yi-Lin; Nanda, Indrajit; Johnston, Adam; Kanki, John P.; Gray, Erin M.; He, Xinjun; Spitsbergen, Jan; Schindler, Detlev; Postlethwait, John H.
2011-01-01
Mild mutations in BRCA2 (FANCD1) cause Fanconi anemia (FA) when homozygous, while severe mutations cause common cancers including breast, ovarian, and prostate cancers when heterozygous. Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis. Experiments showed that mutant embryos and mutant cells in culture experienced genome instability, as do cells in FA patients. In wild-type zebrafish, meiotic cells expressed brca2; and, unexpectedly, transcripts in oocytes localized asymmetrically to the animal pole. In juvenile brca2 mutants, oocytes failed to progress through meiosis, leading to female-to-male sex reversal. Adult mutants became sterile males due to the meiotic arrest of spermatocytes, which then died by apoptosis, followed by neoplastic proliferation of gonad somatic cells that was similar to neoplasia observed in ageing dead end (dnd)-knockdown males, which lack germ cells. The construction of animals doubly mutant for brca2 and the apoptotic gene tp53 (p53) rescued brca2-dependent sex reversal. Double mutants developed oocytes and became sterile females that produced only aberrant embryos and showed elevated risk for invasive ovarian tumors. Oocytes in double-mutant females showed normal localization of brca2 and pou5f1 transcripts to the animal pole and vasa transcripts to the vegetal pole, but had a polarized rather than symmetrical nucleus with the distribution of nucleoli and chromosomes to opposite nuclear poles; this result revealed a novel role for Brca2 in establishing or maintaining oocyte nuclear architecture. Mutating tp53 did not rescue the infertility phenotype in brca2 mutant males, suggesting that brca2 plays an essential role in zebrafish spermatogenesis. Overall, this work verified zebrafish as a model for the role of Brca2 in human disease and uncovered a novel function of Brca2 in vertebrate oocyte nuclear architecture. PMID:21483806
Regulation of autophagy by cytoplasmic p53
Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2009-01-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141
Rogers, Jason V.; Rose, Mark D.
2014-01-01
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide–sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p’s functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. PMID:25467943
Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2
Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja
2012-01-01
Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530
Sonntag, Eric; Wagner, Sabrina; Strojan, Hanife; Wangen, Christina; Lenac Rovis, Tihana; Lisnic, Berislav; Jonjic, Stipan; Schlötzer-Schrehardt, Ursula; Marschall, Manfred
2018-01-01
The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC) that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV) capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction. PMID:29342872
Milbradt, Jens; Sonntag, Eric; Wagner, Sabrina; Strojan, Hanife; Wangen, Christina; Lenac Rovis, Tihana; Lisnic, Berislav; Jonjic, Stipan; Sticht, Heinrich; Britt, William J; Schlötzer-Schrehardt, Ursula; Marschall, Manfred
2018-01-13
The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC) that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV) capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohan, Vijay; Agarwal, Rajesh; Singh, Rana P., E-mail: ranaps@hotmail.com
Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survivalmore » of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer cell apoptosis involving mitochondrial membrane depolarization. • Increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. • DR5 and caspase-8 extrinsic pathway was also activated in p53-independent manner. • Thus evodiamine could be a potential anticancer agent against lung cancer.« less
Najjar, Imen; Schischmanoff, Pierre Olivier; Baran-Marszak, Fanny; Deglesne, Pierre-Antoine; Youlyouz-Marfak, Ibtissam; Pampin, Mathieu; Feuillard, Jean; Bornkamm, Georg W; Chelbi-Alix, Mounira K; Fagard, Remi
2008-12-01
Alternate splicing of STAT1 produces two isoforms: alpha, known as the active form, and beta, previously shown to act as a dominant-negative factor. Most studies have dealt with STAT1alpha, showing its involvement in cell growth control and cell death. To examine the specific function of either isoform in cell death, a naturally STAT1-deficient human B cell line was transfected to express STAT1alpha or STAT1beta. STAT1alpha, expressed alone, enhanced cell death, potentiated the fludarabine-induced apoptosis, and enhanced the nuclear location, the phosphorylation, and the transcriptional activity of p53. Unexpectedly, STAT1beta, expressed alone, induced cell death through a mechanism that was independent of the nuclear function of p53. Indeed, in STAT1beta-expressing B cells, p53 was strictly cytoplasmic where it formed clusters, and there was no induction of the transcriptional activity of p53. These data reveal a novel role of STAT1beta in programmed cell death, which is independent of p53.
MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.
Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M
2018-04-17
The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.
TIRR regulates 53BP1 by masking its histone methyl-lysine binding function.
Drané, Pascal; Brault, Marie-Eve; Cui, Gaofeng; Meghani, Khyati; Chaubey, Shweta; Detappe, Alexandre; Parnandi, Nishita; He, Yizhou; Zheng, Xiao-Feng; Botuyan, Maria Victoria; Kalousi, Alkmini; Yewdell, William T; Münch, Christian; Harper, J Wade; Chaudhuri, Jayanta; Soutoglou, Evi; Mer, Georges; Chowdhury, Dipanjan
2017-03-09
P53-binding protein 1 (53BP1) is a multi-functional double-strand break repair protein that is essential for class switch recombination in B lymphocytes and for sensitizing BRCA1-deficient tumours to poly-ADP-ribose polymerase-1 (PARP) inhibitors. Central to all 53BP1 activities is its recruitment to double-strand breaks via the interaction of the tandem Tudor domain with dimethylated lysine 20 of histone H4 (H4K20me2). Here we identify an uncharacterized protein, Tudor interacting repair regulator (TIRR), that directly binds the tandem Tudor domain and masks its H4K20me2 binding motif. Upon DNA damage, the protein kinase ataxia-telangiectasia mutated (ATM) phosphorylates 53BP1 and recruits RAP1-interacting factor 1 (RIF1) to dissociate the 53BP1-TIRR complex. However, overexpression of TIRR impedes 53BP1 function by blocking its localization to double-strand breaks. Depletion of TIRR destabilizes 53BP1 in the nuclear-soluble fraction and alters the double-strand break-induced protein complex centring 53BP1. These findings identify TIRR as a new factor that influences double-strand break repair using a unique mechanism of masking the histone methyl-lysine binding function of 53BP1.
PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence
Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues
2015-01-01
Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773
PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.
Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues
2015-11-17
Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.
Cytomegalovirus recruitment of cellular kinases to dissolve the nuclear lamina.
Muranyi, Walter; Haas, Jürgen; Wagner, Markus; Krohne, Georg; Koszinowski, Ulrich H
2002-08-02
The passage of large-sized herpesviral capsids through the nuclear lamina and the inner nuclear membrane to leave the nucleus requires a dissolution of the nuclear lamina. Here, we report on the functions of M50/p35, a beta-herpesviral protein of murine cytomegalovirus. M50/p35 inserts into the inner nuclear membrane and is aggregated by a second viral protein, M53/p38, to form the capsid docking site. M50/p35 recruits the cellular protein kinase C for phosphorylation and dissolution of the nuclear lamina, suggesting that herpesviruses target a critical element of nuclear architecture.
Regulation of p53 Stability and Apoptosis by a ROR Agonist
Wang, Yongjun; Solt, Laura A.; Kojetin, Douglas J.; Burris, Thomas P.
2012-01-01
Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer. PMID:22509368
Regulation of p53 stability and apoptosis by a ROR agonist.
Wang, Yongjun; Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P
2012-01-01
Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Liu, Pei-Yao; Chan, James Yi-Hsin; Lin, Hsiu-Chen; Wang, Sung-Ling; Liu, Shu-Ting; Ho, Ching-Liang; Chang, Li-Chien; Huang, Shih-Ming
2008-07-01
Zac1 is a novel seven-zinc finger protein which possesses the ability to bind specifically to GC-rich DNA elements. Zac1 not only promotes apoptosis and cell cycle arrest but also acts as a transcriptional cofactor for p53 and a number of nuclear receptors. Our previous study indicated that the enhancement of p53 activity by Zac1 is much more pronounced in HeLa cells compared with other cell lines tested. This phenomenon might be due to the coactivator effect of Zac1 on p53 and the ability of Zac1 to reverse E6 inhibition of p53. In the present study, we showed that Zac1 acted synergistically with either p53 or a histone deacetylase inhibitor, trichostatin A, to enhance p21(WAF1/Cip1) promoter activity. We showed that Zac1 physically interacted with some nuclear receptor corepressors such as histone deacetylase 1 (HDAC1) and mSin3a, and the induction of p21(WAF1/Cip1) gene and protein by Zac1 was suppressed by either overexpressing HDAC1 or its deacetylase-dead mutant. In addition, our data suggest that trichostatin A-induced p21(WAF1/Cip1) protein expression might be mediated through a p53-independent and HDAC deacetylase-independent pathway. Taken together, our data suggest that Zac1 might be involved in regulating the p21(WAF1/Cip1) gene and protein expression through its protein-protein interaction with p53 and HDAC1 in HeLa cells.
Guo, Gang; Yu, Miao; Xiao, Wei; Celis, Esteban; Cui, Yan
2017-01-01
Mutations in tumor suppressor p53 remain a vital mechanism of tumor escape from apoptosis and senescence. Emerging evidence suggests that p53 dysfunction also fuels inflammation and supports tumor immune evasion, thereby serving as an immunological driver of tumorigenesis. Therefore, targeting p53 in the tumor microenvironment (TME) also represents an immunologically desirable strategy for reversing immunosuppression and enhancing antitumor immunity. Using a pharmacological p53 activator nutlin-3a, we show that local p53 activation in TME comprising overt tumor infiltrating leukocytes (TILeus) induces systemic antitumor immunity and tumor regression, but not in TME with scarce TILeus, such as B16 melanoma. Maneuvers that recruit leukocytes to TME, such as TLR3 ligand in B16 tumors, greatly enhanced nutlin-induced antitumor immunity and tumor control. Mechanistically, nutlin-3a-induced antitumor immunity was contingent on two non-redundant but immunologically synergistic p53-dependent processes: reversal of immunosuppression in TME and induction of tumor immunogenic cell death (ICD), leading to activation and expansion of polyfunctional CD8 CTLs and tumor regression. Our study demonstrates that unlike conventional tumoricidal therapies, which rely on effective p53 targeting in each tumor cell and often associate with systemic toxicity, this immune-based strategy requires only limited local p53 activation to alter the immune landscape of TME and subsequently amplify immune response to systemic antitumor immunity. Hence, targeting the p53 pathway in TME can be exploited to reverse immunosuppression and augment therapeutic benefits beyond tumoricidal effects to harness tumor-specific, durable, and systemic antitumor immunity with minimal toxicity. PMID:28280037
HIPK2 restricts SIRT1 activity upon severe DNA damage by a phosphorylation-controlled mechanism
Conrad, E; Polonio-Vallon, T; Meister, M; Matt, S; Bitomsky, N; Herbel, C; Liebl, M; Greiner, V; Kriznik, B; Schumacher, S; Krieghoff-Henning, E; Hofmann, T G
2016-01-01
Upon severe DNA damage a cellular signalling network initiates a cell death response through activating tumour suppressor p53 in association with promyelocytic leukaemia (PML) nuclear bodies. The deacetylase Sirtuin 1 (SIRT1) suppresses cell death after DNA damage by antagonizing p53 acetylation. To facilitate efficient p53 acetylation, SIRT1 function needs to be restricted. How SIRT1 activity is regulated under these conditions remains largely unclear. Here we provide evidence that SIRT1 activity is limited upon severe DNA damage through phosphorylation by the DNA damage-responsive kinase HIPK2. We found that DNA damage provokes interaction of SIRT1 and HIPK2, which phosphorylates SIRT1 at Serine 682 upon lethal damage. Furthermore, upon DNA damage SIRT1 and HIPK2 colocalize at PML nuclear bodies, and PML depletion abrogates DNA damage-induced SIRT1 Ser682 phosphorylation. We show that Ser682 phosphorylation inhibits SIRT1 activity and impacts on p53 acetylation, apoptotic p53 target gene expression and cell death. Mechanistically, we found that DNA damage-induced SIRT1 Ser682 phosphorylation provokes disruption of the complex between SIRT1 and its activator AROS. Our findings indicate that phosphorylation-dependent restriction of SIRT1 activity by HIPK2 shapes the p53 response. PMID:26113041
Lorenz, Laurel D.; Rivera Cardona, Jessenia; Lambert, Paul F.
2013-01-01
The human papillomavirus DNA genome undergoes three distinct stages of replication: establishment, maintenance and amplification. We show that the HPV16 E6 protein is required for the maintenance of the HPV16 DNA genome as an extrachromosomal, nuclear plasmid in its natural host cell, the human keratinocyte. Based upon mutational analyses, inactivation of p53 by E6, but not necessarily E6-mediated degradation of p53, was found to correlate with the ability of E6 to support maintenance of the HPV16 genome as a nuclear plasmid. Inactivation of p53 with dominant negative p53 rescued the ability of HPV16 E6STOP and E6SAT mutant genomes to replicate as extrachromosomal genomes, though not to the same degree as observed for the HPV16 E6 wild-type (WT) genome. Inactivation of p53 also rescued the ability of HPV18 and HPV31 E6-deficient genomes to be maintained at copy numbers comparable to that of HPV18 and HPV31 E6WT genomes at early passages, though upon further passaging copy numbers for the HPV18 and 31 E6-deficient genomes lessened compared to that of the WT genomes. We conclude that inactivation of p53 is necessary for maintenance of HPV16 and for HPV18 and 31 to replicate at WT copy number, but that additional functions of E6 independent of inactivating p53 must also contribute to the maintenance of these genomes. Together these results suggest that re-activation of p53 may be a possible means for eradicating extrachromosomal HPV16, 18 or 31 genomes in the context of persistent infections. PMID:24204267
Ok, Chi Young; Tzankov, Alexandar; Manyam, Ganiraju C.; Sun, Ruifan; Visco, Carlo; Zhang, Mingzhi; Montes-Moreno, Santiago; Dybkaer, Karen; Chiu, April; Orazi, Attilio; Zu, Youli; Bhagat, Govind; Richards, Kristy L.; Hsi, Eric D.; Choi, William W.L.; van Krieken, J. Han; Huh, Jooryung; Ponzoni, Maurilio; Ferreri, Andrés J.M.; Møller, Michael B.; Wang, Jinfeng; Parsons, Ben M.; Winter, Jane N.; Piris, Miguel A.; Pham, Lan V.; Medeiros, L. Jeffrey; Young, Ken H.
2015-01-01
Dysregulated NF-κB signaling is critical for lymphomagenesis. The regulation, function, and clinical relevance of c-Rel/NF-κB activation in diffuse large B-cell lymphoma (DLBCL) have not been well studied. In this study we analyzed the prognostic significance and gene-expression signature of c-Rel nuclear expression as surrogate of c-Rel activation in 460 patients with de novo DLBCL. Nuclear c-Rel expression, observed in 137 (26.3%) DLBCL patients frequently associated with extranoal origin, did not show significantly prognostic impact in the overall- or germinal center B-like-DLBCL cohort, likely due to decreased pAKT and Myc levels, up-regulation of FOXP3, FOXO3, MEG3 and other tumor suppressors coincided with c-Rel nuclear expression, as well as the complicated relationships between NF-κB members and their overlapping function. However, c-Rel nuclear expression correlated with significantly poorer survival in p63+ and BCL-2− activated B-cell-like-DLBCL, and in DLBCL patients with TP53 mutations. Multivariate analysis indicated that after adjusting clinical parameters, c-Rel positivity was a significantly adverse prognostic factor in DLBCL patients with wild type TP53. Gene expression profiling suggested dysregulations of cell cycle, metabolism, adhesion, and migration associated with c-Rel activation. In contrast, REL amplification did not correlate with c-Rel nuclear expression and patient survival, likely due to co-amplification of genes that negatively regulate NF-κB activation. These insights into the expression, prognostic impact, regulation and function of c-Rel as well as its crosstalk with the p53 pathway underscore the importance of c-Rel and have significant therapeutic implications. PMID:26324762
Meng, Ning; Zhao, Jing; Su, Le; Zhao, Baoxiang; Zhang, Yun; Zhang, Shangli; Miao, Junying
2012-02-01
Lipopolysaccharide (LPS)-induced vascular endothelial cell (VEC) dysfunction is an important contributing factor in vascular diseases. Recently, we found that LPS impaired VEC by inducing autophagy. Our previous researches showed that a butyrolactone derivative, 3-benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one (3BDO) selectively protected VEC function. The objective of the present study is to investigate whether and how 3BDO inhibits LPS-induced VEC autophagic injury. Our results showed that LPS induced autophagy and led to increase of reactive oxygen species (ROS) and decrease of mitochondrial membrane potential (MMP) in Human umbilical vein vascular endothelial cells (HUVECs). Furthermore, LPS significantly increased p8 and p53 protein levels and the nuclear translocation of p53. All of these effects of LPS on HUVECs were strongly inhibited by 3BDO. Importantly, the ROS scavenger N-acetylcysteine (NAC) could inhibited LPS-induced autophagy and knockdown of p8 by RNA interference inhibited the autophagy, p53 protein level increase, the translocation of p53 into nuclei and the ROS level increase induced by LPS in HUVECs. The data suggested that 3BDO inhibited LPS-induced autophagy in HUVECs through inhibiting the ROS overproduction, the increase of p8 and p53 expression and the nuclear translocation of p53. Our findings provide a potential tool for understanding the mechanism underlying LPS-induced autophagy in HUVECs and open the door to a novel therapeutic drug for LPS-induced vascular diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.
Prm3p is a pheromone-induced peripheral nuclear envelope protein required for yeast nuclear fusion.
Shen, Shu; Tobery, Cynthia E; Rose, Mark D
2009-05-01
Nuclear membrane fusion is the last step in the mating pathway of the yeast Saccharomyces cerevisiae. We adapted a bioinformatics approach to identify putative pheromone-induced membrane proteins potentially required for nuclear membrane fusion. One protein, Prm3p, was found to be required for nuclear membrane fusion; disruption of PRM3 caused a strong bilateral defect, in which nuclear congression was completed but fusion did not occur. Prm3p was localized to the nuclear envelope in pheromone-responding cells, with significant colocalization with the spindle pole body in zygotes. A previous report, using a truncated protein, claimed that Prm3p is localized to the inner nuclear envelope. Based on biochemistry, immunoelectron microscopy and live cell microscopy, we find that functional Prm3p is a peripheral membrane protein exposed on the cytoplasmic face of the outer nuclear envelope. In support of this, mutations in a putative nuclear localization sequence had no effect on full-length protein function or localization. In contrast, point mutations and deletions in the highly conserved hydrophobic carboxy-terminal domain disrupted both protein function and localization. Genetic analysis, colocalization, and biochemical experiments indicate that Prm3p interacts directly with Kar5p, suggesting that nuclear membrane fusion is mediated by a protein complex.
Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena
2006-01-01
The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF-kappaB distinctively, while modulating the pathways of JNK and AP-1 similarly. These differences may influence cellular processes such as proliferation, differentiation, and apoptosis. 2005 Wiley-Liss, Inc.
Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M
2001-03-01
Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.
Markers of potential malignancy in chronic hyperplastic candidiasis.
Darling, Mark R; McCord, Christina; Jackson-Boeters, Linda; Copete, Maria
2012-08-01
To examine the presence of markers associated with malignancy, including p53, p21 cyclin-dependent kinase inhibitor 1A, murine double minutes-2, and others, in chronic hyperplastic candidiasis. Immunohistochemical methods were used to examine the expression of p53, murine double minutes-2, p21 cyclin-dependent kinase inhibitor 1A, metallothionein, and proliferating cell nuclear antigen in 42 chronic hyperplastic candidiasis lesions and 11 non-infected control tissues. Terminal deoxynucleotidyl transferase-mediated digoxigenin-dUTP nick-end labeling was used to examine apoptosis, which was correlated with p53 expression. These markers were measured in lesions of chronic hyperplastic candidiasis that did not show any epithelial dysplasia or histological signs of malignancy. p53 scores were higher in chronic hyperplastic candidiasis than in controls (P = 0.0046). Murine double-minutes 2 levels were not elevated. p21 cyclin-dependent kinase inhibitor 1A was increased in parabasal (P < 0.0001) and basal epithelial cells. Chronic hyperplastic candidiasis lesions showed a similar basal/parabasal metallothionein staining pattern to that seen in normal squamous epithelium. Proliferating cell nuclear antigen was increased (P = 0.0007), as was apoptosis (P = 0.0033). Increased p53 in oral chronic hyperplastic candidiasis suggests an increased potential for malignant change in the epithelium, above that of normal tissues. Further functional investigation is required, as well as clinical follow-up studies. © 2012 Blackwell Publishing Asia Pty Ltd.
Counterinsurgency Warfare Approach to Iran
2010-04-01
p. x. 3 Ibid. 4 Yossi Melman and Meir Javedanfar, The Nuclear Sphinx of Tehran, Caroll & Graf Publishers, 2007, p. 53. 5 Global Security...22 Ibid. 23 Yossi Melman and Meir Javedanfar, The Nuclear Sphinx of Tehran, Caroll & Graf Publishers, 2007, p. 55. 24 Shirin Ebadi, Iran...US Army War College, Strategic Studies Institute, October 2005) Yossi Melman and Meir Javedanfar, The Nuclear Sphinx of Tehran, Caroll & Graf Publishers, 2007
Nuclear localization of Schizosaccharomyces pombe Mcm2/Cdc19p requires MCM complex assembly.
Pasion, S G; Forsburg, S L
1999-12-01
The minichromosome maintenance (MCM) proteins MCM2-MCM7 are conserved eukaryotic replication factors that assemble in a heterohexameric complex. In fission yeast, these proteins are nuclear throughout the cell cycle. In studying the mechanism that regulates assembly of the MCM complex, we analyzed the cis and trans elements required for nuclear localization of a single subunit, Mcm2p. Mutation of any single mcm gene leads to redistribution of wild-type MCM subunits to the cytoplasm, and this redistribution depends on an active nuclear export system. We identified the nuclear localization signal sequences of Mcm2p and showed that these are required for nuclear targeting of other MCM subunits. In turn, Mcm2p must associate with other MCM proteins for its proper localization; nuclear localization of MCM proteins thus requires assembly of MCM proteins in a complex. We suggest that coupling complex assembly to nuclear targeting and retention ensures that only intact heterohexameric MCM complexes remain nuclear.
Nuclear Localization of Schizosaccharomyces pombe Mcm2/Cdc19p Requires MCM Complex Assembly
Pasion, Sally G.; Forsburg, Susan L.
1999-01-01
The minichromosome maintenance (MCM) proteins MCM2–MCM7 are conserved eukaryotic replication factors that assemble in a heterohexameric complex. In fission yeast, these proteins are nuclear throughout the cell cycle. In studying the mechanism that regulates assembly of the MCM complex, we analyzed the cis and trans elements required for nuclear localization of a single subunit, Mcm2p. Mutation of any single mcm gene leads to redistribution of wild-type MCM subunits to the cytoplasm, and this redistribution depends on an active nuclear export system. We identified the nuclear localization signal sequences of Mcm2p and showed that these are required for nuclear targeting of other MCM subunits. In turn, Mcm2p must associate with other MCM proteins for its proper localization; nuclear localization of MCM proteins thus requires assembly of MCM proteins in a complex. We suggest that coupling complex assembly to nuclear targeting and retention ensures that only intact heterohexameric MCM complexes remain nuclear. PMID:10588642
Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice
Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.
2014-01-01
Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632
Manna, Sunil K.; Bose, Julie S.; Gangan, Vijay; Raviprakash, Nune; Navaneetha, Thota; Raghavendra, Pongali B.; Babajan, Banaganapalli; Kumar, Chitta S.; Jain, Swatantra K.
2010-01-01
The Dracaena resin is widely used in traditional medicine as an anticancer agent, and benzofuran lignan is the active component. In this report, we provide evidence that the synthetic derivative of benzofuran lignan (Benfur) showed antitumor activities. It induced apoptosis in p53-positive cells. Though it inhibited endotoxin-induced nuclear factor κB (NF-κB) activation in both p53-positive and -negative cells, the activation of caspase 3 was observed in p53-positive cells. It showed partial cell death effect in both p53-positive and -negative cells through inhibition of NF-κB. Cell cycle analysis using flow cytometry showed that treatment with this novel benozofuran lignan derivative to Jurkat T-cells, but not U-937 cells, resulted in a G2/M arrest in a dose- and time-dependent manner. It increased amounts of p21, p27, and cyclin B, but not phospho-Rb through p53 nuclear translocation in Jurkat T-cells, but not in U-937 cells. It inhibited amounts of MDM2 (murine double minute 2) by repressing the transcription factor Sp1, which was also proved in silico. It induced cell death in tumor cells, but not in primary T-cells. Overall, our data suggest that Benfur-mediated cell death is partially dependent upon NF-κB, but predominantly dependent on p53. Thus, this novel benzofuran lignan derivative can be effective chemopreventive or chemotherapeutic agent against malignant T-cells. PMID:20472557
Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry
Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.
2015-01-01
p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J
2005-12-08
TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.
Clément, Florencia; Martin, Ayelen; Venara, Marcela; de Luján Calcagno, Maria; Mathó, Cecilia; Maglio, Silvana; Lombardi, Mercedes García; Bergadá, Ignacio; Pennisi, Patricia A
2018-06-01
Nuclear localization of insulin-like growth factor receptor type 1 (IGF-1R) has been described as adverse prognostic factor in some cancers. We studied the expression and localization of IGF-1R in paediatric patients with gliomas, as well as its association with World Health Organization (WHO) grading and survival. We conducted a single cohort, prospective study of paediatric patients with gliomas. Samples were taken at the time of the initial surgery; IGF-1R expression and localization were characterized by immunohistochemistry (IHC), subcellular fractionation and western blotting. Tumours (47/53) showed positive staining for IGF-1R by IHC. IGF-1R nuclear labelling was observed in 10/47 cases. IGF-1R staining was mostly non-nuclear in low-grade tumours, while IGF-1R nuclear labelling was predominant in high-grade gliomas (p = 0.0001). Survival was significantly longer in patients with gliomas having non-nuclear IGF-1R localization than in patients with nuclear IGF-1R tumours (p = 0.016). In gliomas, IGF-1R nuclear localization was significantly associated with both high-grade tumours and increased risk of death. Based on a prospective design, we provide evidence of a potential usefulness of intracellular localization of IGF-1R as prognostic factor in paediatric patients with gliomas.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Yoshida, Midori; Katsuda, Shin-ichi; Maekawa, Akihiko
2012-01-01
Involvements of estrogen receptor (ER)α, proliferating cell nuclear antigen (PCNA) and p53 in the uterine carcinogenesis process in Donryu rats, a high yield strain of the uterine cancer were investigated immunohistochemically. ERα was expressed in atypical endometrial hyperplasia, accepted as a precancerous lesion of the uterine tumors, as well as well- and in moderately-differentiated endometrial adenocarcinomas, and the intensities of expression were similar to those in the luminal epithelial cells of the atrophic uterus at 15 months of age. The expression, however, was negative in the tumor cells of poorly differentiated type. Good growth of implanted grafts of the poorly-differentiated adenocarcinomas in both sexes with or without gonadectomy supported the estrogen independency of tumor progression to malignancy. PCNA labeling indices were increased with tumor development from atypical hyperplasia to adenocarcinoma. The tumor cells in poorly-differentiated adenocarcinomas were positive for p53 positive but negative for p21 expression, suggesting accumulation of mutated p53. These results indicate that the consistent ERα expression is involved in initiation and promotion steps of uterine carcinogenesis, but not progression. In addition, PCNA is related to tumor development and the expression of mutated p53 might be a late event during endometrial carcinogenesis. PMID:23345926
Accumulation of p53 in infectious mononucleosis tissues.
Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L
2000-11-01
Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company
Negative feedback regulation of wild-type p53 biosynthesis.
Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W
1995-01-01
When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087
Payandeh, Mehrdad; Sadeghi, Masoud; Sadeghi, Edris; Madani, Seyed-Hamid
2016-01-01
In breast cancer (BC), it has been suggested that nuclear overexpression of p53 protein might be an indicator of poor prognosis. The aim of the current study was to evaluate the expression of p53 BC in Kurdish women from the West of Iran and its correlation with other clinicopathology figures. In the present retrospective study, 231 patients were investigated for estrogen receptor (ER) and progesterone receptor (PR) positivity, defined as ≥10% positive tumor cells with nuclear staining. A binary logistic regression model was selected using Akaike Information Criteria (AIC) in stepwise selection for determination of important factors. ER, PR, the human epidermal growth factor receptor 2 (HER2) and p53 were positive in 58.4%, 55.4%, 59.7% and 45% of cases, respectively. Ki67 index was divided into two groups: 54.5% had Ki67<20% and 45.5% had Ki67 ≥20%. Of 214 patients, 137(64%) had lymph node metastasis and of 186 patients, 122(65.6%) had vascular invasion. Binary logistic regression analysis showed that there was inverse significant correlation between lymph node metastasis (P=0.008, OR 0.120 and 95%CI 0.025-0.574), ER status (P=0.006, OR 0.080, 95%CI 0.014-0.477) and a direct correlation between HER2 (P=005, OR 3.047, 95%CI 1.407-6.599) with the expression of p53. As in a number of studies, expression of p53 had a inverse correlation with lymph node metastasis and ER status and also a direct correlation with HER2 status. Also, p53-positivity is more likely in triple negative BC compared to other subtypes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Preta, Giulio; Klark, Rainier de; Glas, Rickard, E-mail: rickard.glas@ki.se
2009-11-27
Responses to DNA damage are influenced by cellular metabolism through the continuous production of reactive oxygen species (ROS), of which most are by-products of mitochondrial respiration. ROS have a strong influence on signaling pathways during responses to DNA damage, by relatively unclear mechanisms. Previous reports have shown conflicting data on a possible role for tripeptidyl-peptidase II (TPPII), a large cytosolic peptidase, within the DNA damage response. Here we show that TPPII translocated into the nucleus in a p160-ROCK-dependent fashion in response to {gamma}-irradiation, and that nuclear expression of TPPII was present in most {gamma}-irradiated transformed cell lines. We used amore » panel of nine cell lines of diverse tissue origin, including four lymphoma cell lines (T, B and Hodgkins lymphoma), a melanoma, a sarcoma, a colon and two breast carcinomas, where seven out of nine cell lines showed nuclear TPPII expression after {gamma}-irradiation. Further, this required cellular production of ROS; treatment with either N-acetyl-Cysteine (anti-oxidant) or Rotenone (inhibitor of mitochondrial respiration) inhibited nuclear accumulation of TPPII. The local density of cells was important for nuclear accumulation of TPPII at early time-points following {gamma}-irradiation (at 1-4 h), indicating a bystander effect. Further, we showed that the peptide-based inhibitor Z-Gly-Leu-Ala-OH, but not its analogue Z-Gly-(D)-Leu-Ala-OH, excluded TPPII from the nucleus. This correlated with reduced nuclear expression of p53 as well as caspase-3 and -9 activation in {gamma}-irradiated lymphoma cells. Our data suggest a role for TPPII in ROS-dependent DNA damage responses, through alteration of its localization from the cytosol into the nucleus.« less
Preta, Giulio; de Klark, Rainier; Glas, Rickard
2009-11-27
Responses to DNA damage are influenced by cellular metabolism through the continuous production of reactive oxygen species (ROS), of which most are by-products of mitochondrial respiration. ROS have a strong influence on signaling pathways during responses to DNA damage, by relatively unclear mechanisms. Previous reports have shown conflicting data on a possible role for tripeptidyl-peptidase II (TPPII), a large cytosolic peptidase, within the DNA damage response. Here we show that TPPII translocated into the nucleus in a p160-ROCK-dependent fashion in response to gamma-irradiation, and that nuclear expression of TPPII was present in most gamma-irradiated transformed cell lines. We used a panel of nine cell lines of diverse tissue origin, including four lymphoma cell lines (T, B and Hodgkins lymphoma), a melanoma, a sarcoma, a colon and two breast carcinomas, where seven out of nine cell lines showed nuclear TPPII expression after gamma-irradiation. Further, this required cellular production of ROS; treatment with either N-acetyl-Cysteine (anti-oxidant) or Rotenone (inhibitor of mitochondrial respiration) inhibited nuclear accumulation of TPPII. The local density of cells was important for nuclear accumulation of TPPII at early time-points following gamma-irradiation (at 1-4h), indicating a bystander effect. Further, we showed that the peptide-based inhibitor Z-Gly-Leu-Ala-OH, but not its analogue Z-Gly-(D)-Leu-Ala-OH, excluded TPPII from the nucleus. This correlated with reduced nuclear expression of p53 as well as caspase-3 and -9 activation in gamma-irradiated lymphoma cells. Our data suggest a role for TPPII in ROS-dependent DNA damage responses, through alteration of its localization from the cytosol into the nucleus.
Goyeneche, Alicia A; Seidel, Erin E; Telleria, Carlos M
2012-06-01
Antiprogestins have been largely utilized in reproductive medicine, yet their repositioning for oncologic use is rapidly emerging. In this study we investigated the molecular mediators of the anti-ovarian cancer activity of the structurally related antiprogestins RU-38486, ORG-31710 and CDB-2914. We studied the responses of wt p53 OV2008 and p53 null SK-OV-3 cells to varying doses of RU-38486, ORG-31710 and CDB-2914. The steroids inhibited the growth of both cell lines with a potency of RU-38486 > ORG-31710 > CDB-2914, and were cytostatic at lower doses but lethal at higher concentrations. Antiprogestin-induced lethality associated with morphological features of apoptosis, hypodiploid DNA content, DNA fragmentation, and cleavage of executer caspase substrate PARP. Cell death ensued despite RU-38486 caused transient up-regulation of anti-apoptotic Bcl-2, ORG-31710 induced transient up-regulation of inhibitor of apoptosis XIAP, and CDB-2914 up-regulated both XIAP and Bcl-2. The antiprogestins induced accumulation of Cdk inhibitors p21(cip1) and p27(kip1) and increased association of p21(cip1) and p27(kip1) with Cdk-2. They also promoted nuclear localization of p21(cip1) and p27(kip1), reduced the nuclear abundances of Cdk-2 and cyclin E, and blocked the activity of Cdk-2 in both nucleus and cytoplasm. The cytotoxic potency of the antiprogestins correlated with the magnitude of the inhibition of Cdk-2 activity, ranging from G1 cell cycle arrest towards cell death. Our results suggest that, as a consequence of their cytostatic and lethal effects, antiprogestin steroids of well-known contraceptive properties emerge as attractive new agents to be repositioned for ovarian cancer therapeutics.
Chang, Tung-Cheng; Changou, Chun A.; Lai, Hsuan-Yu; Fu, Earl; HuangFu, Wei-Chun; Davis, Paul J.; Lin, Hung-Yun; Liu, Leroy F.
2015-01-01
Dihydrotestosterone (DHT) has been shown to promote breast cancer growth via different mechanisms. In addition to binding to ERα, the DHT membrane receptor exists on integrin αvβ3. Resveratrol induces p53-dependent apoptosis via plasma membrane integrin αvβ3. Resveratrol and DHT signals are both transduced by activated ERK1/2; however, DHT promotes cell proliferation in cancer cells, whereas resveratrol is pro-apoptotic. In this study, we examined the mechanism by which DHT inhibits resveratrol-induced apoptosis in human ERα positive (MCF-7) and negative (MDA-MB-231) breast cancer cells. DHT inhibited resveratrol-stimulated phosphorylation of Ser-15 of p53 in a concentration-dependent manner. These effects of DHT on resveratrol action were blocked by an ERα antagonist, ICI 182,780, in MCF-7 breast cancer cells. DHT inhibited resveratrol-induced nuclear complex of p53-COX-2 formation which is required p53-dependent apoptosis. ChIP studies of COX-2/p53 binding to DNA and expression of p53-responsive genes indicated that DHT inhibited resveratrol-induced p53-directed transcriptional activity. In addition, DHT did inhibit resveratrol-induced COX-2/p53-dependent gene expression. These results suggest that DHT inhibits p53-dependent apoptosis in breast cancer cells by interfering with nuclear COX-2 accumulation which is essential for stimulation of apoptotic pathways. Thus, the surface receptor sites for resveratrol and DHT are discrete and activate ERK1/2-dependent downstream effects on apoptosis that are distinctive. These studies provide new insights into the antagonizing effects of resveratrol versus DHT, an important step toward better understanding and eventually treating breast cancer. It also indicates the complex pathways by which apoptosis is induced by resveratrol in DHT-depleted and -repleted environments. PMID:26456774
Amin, A R M Ruhul; Khuri, Fadlo R; Chen, Zhuo Georgia; Shin, Dong M
2009-06-01
We have previously reported that the green tea polyphenol epigallocatechin-3-gallate (EGCG) and the epidermal growth factor receptor-tyrosine kinase inhibitor erlotinib had synergistic growth-inhibitory effects in cell culture and a nude mouse xenograft model of squamous cell carcinoma of the head and neck. However, the mechanism of their antitumor synergism is not fully understood. In the current study, we investigate the mechanism of their synergistic growth-inhibitory effects. The treatment of squamous cell carcinoma of the head and neck cell lines with erlotinib time-dependently increased the expression of cell cycle regulatory proteins p21 and p27 and apoptosis regulatory protein Bim. EGCG alone had very little or no effect on the expression of these proteins among the cell lines. However, simultaneous treatment with EGCG and erlotinib strongly inhibited erlotinib-induced expression of p21 and p27 without affecting the expression of Bim. Moreover, erlotinib increased the expression of p53 protein, the ablation of which by short hairpin RNA strongly inhibited EGCG- and erlotinib-mediated growth inhibition and the expression of p21, p27, and Bim. In addition, combined treatment with erlotinib and EGCG inhibited the protein level of p65 subunit of nuclear factor-kappaB and its transcriptional target Bcl-2, but failed to do so in cells with ablated p53. Taken together, our results, for the first time, suggest that erlotinib treatment activates p53, which plays a critical role in synergistic growth inhibition by erlotinib and EGCG via inhibiting nuclear factor-kappaB signaling pathway. Characterizing the underlying mechanisms of EGCG and erlotinib synergism will provide an important rationale for chemoprevention or treatment trials using this combination.
Casein kinase 2 and the cell response to growth factors.
Filhol-Cochet, O; Loue-Mackenbach, P; Cochet, C; Chambaz, E M
1994-01-01
Different approaches have been followed with the aim of delineating a possible role of casein kinase 2 (CK2) in the mitogenic signalling in response to cell growth factors. (a) Immunocytochemical detection of CK2 showed that while the kinase is evenly distributed throughout cycle arrested cells, it becomes preferentially associated with the nuclear compartment in activity growing cells; (b) CK2 biosynthesis is activated as an early response of quiescent cells to growth factors. The newly synthesized CK2 steadily accumulates as the cells progress through the G1 phase. This growth factor-induced CK2 biosynthesis involves in parallel the two alpha and beta subunits of the kinase, with no detectable preferential subcellular localization of the newly synthesized enzyme; and (c) In addition to substrate phosphorylation, CK2 may form molecular complexes with cell components of functional significance. Such is the case with the protein p53, a major negative regulator of the cell cycle. CK2 forms a high affinity association (Kd 70 nM) with p53, through its beta subunit. The complex dissociates in the presence of adenosine triphosphate (ATP). These observations suggest that CK2 and p53 may play a coordinated regulatory role in the cell response to growth factors.
Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo
2017-12-01
Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy.
Simon, Christian M; Dai, Ya; Van Alstyne, Meaghan; Koutsioumpa, Charalampia; Pagiazitis, John G; Chalif, Joshua I; Wang, Xiaojian; Rabinowitz, Joseph E; Henderson, Christopher E; Pellizzoni, Livio; Mentis, George Z
2017-12-26
The hallmark of spinal muscular atrophy (SMA), an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Xia; School of Ocean, Shandong University, Weihai 264209; Wu, William K.K.
2011-03-01
Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G{sub 2}/M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine,more » suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21{sup Waf1/Cip1}. In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B{sub 1}, a cyclin required for progression through the G{sub 2}/M phase. Taken together, DHA induces G{sub 2}/M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.« less
Szollosi, Zoltan; Nemeth, Tamas; Egervari, Kristof; Nemes, Zoltan
2005-01-01
The term malignant fibrous histiocytoma (MFH) is widely used for pleomorphic soft tissue sarcomas without a specific line of differentiation. MFH is included in the category of fibrohistiocytic soft tissue tumors. MFH has a broad range of histological appearances, and it has several subtypes. All of these subtypes are composed of spindled fibroblast-like cells, undifferentiated cells, and histiocytic or histiocyte-like cells. A large number of fibroblast-like and pleomorphic cells express factor XIIIa in MFH. The cytological pleomorphism of factor XIIIa cells suggests that these cells may belong to the neoplastic population. It is equally possible that the factor XIIIa-positive cells are only activated stromal cells. The relation of factor XIIIa-positive cells to the neoplastic cell population in MFH is addressed in the present study. A morphometric approach compares the measure of nuclear pleomorphism of the factor XIIIa-positive cells with that of the factor XIIIa-negative tumor cells in high-grade MFH. The immunohistochemical approach compares the factor XIIIa-positive and -negative cell populations with regard to mutations of p53 tumor suppressor gene in p53-positive MFH cases. We selected 58 cases of soft tissue pleomorphic or storiform-pleomorphic MFH on the basis of histopathological examinations. A combination of incident light immunofluorescence for factor XIIIa and transmitted light examination for nuclear staining was used for morphometrical analysis. We found cytoplasmic factor XIIIa positivity in at least 2% of cells in 39 cases; the number of factor XIIIa-positive cells was under 0.5% in two cases, and the number of factor-positive cells ranged between 0.5% and 2% in 13 cases. Eighteen cases were analyzed with nuclear morphometry. We found that mean nuclear area and mean nuclear Ferret diameter in factor XIIIa-positive cells differed significantly from those of the tumor cells in all cases. The mean nuclear roundness factor differed significantly only in four cases. The latter finding showed that the microscopic polymorphism of factor XIIIa cells is measurable and is not merely a suspicion. The immunohistochemical positivity for p53 positivity can be accepted as the manifestation of a missense mutation of TP53 gene and as a marker of neoplastic cells. The simultaneous immunohistochemical detection of factor XIIIa and p53 in the same section revealed that factor XIIIa-positive cells were invariably p53 negative in MFH. This finding implies that the factor XIIIa cell population is non-neoplastic and belongs to the stromal component of MFH.
Rubbi, Carlos P.; Milner, Jo
2003-01-01
p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953
Felix, A; El-Naggar, A K; Press, M F; Ordonez, N G; Fonseca, I; Tucker, S L; Luna, M A; Batsakis, J G
1996-06-01
Salivary duct carcinoma (SDC), a rare neoplasm of the major salivary glands, is a high-grade carcinoma with a predilection for elderly men. The authors investigated the prognostic role of p53, c-erbB2, proliferating cell nuclear antigen (PCNA), and DNA flow cytometry in a pathobiological evaluation of a cohort of 30 patients with these neoplasms. The patient group comprised 24 men and 6 women, with ages ranging from 22 to 87 years (mean = 61 years). Twenty-eight tumors were located in the parotid gland and two in the submandibular gland. Tumor size ranged from 1.0 to 8.0 cm (mean = 3.48 cm). Regional metastases were found in 73.3% (22 patients), systemic metastases in 43.3% (13 patients), and recurrences in 8 (26.6%) patients. DNA aneuploidy was found in 18 tumors (58.0%) and DNA diploidy in 12 (42%), with proliferative fractions ranging from 8.60% to 15.5 (mean = 10.6%). p53 protein nuclear immunostaining was positive in 56.6% and c-erbB2 overexpression was observed in 63% of the tumors. PCNA positivity ranged from 16.5% to 91.0%, with a mean of 49.5%. p53 immunopositivity, DNA aneuploidy, high growth, and proliferative fractions by PCNA and flow cytometry did not correlate with patient outcome. These results indicate that tumor size (P = .05), distant metastasis (P = .006), and C-erbB2 amplification (P = .04) are independent prognostic parameters in patients with salivary duct carcinoma.
Grow-ING, Age-ING and Die-ING: ING proteins link cancer, senescence and apoptosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Russell, Michael; Berardi, Philip; Gong Wei
The INhibitor of Growth (ING) family of plant homeodomain (PHD) proteins induce apoptosis and regulate gene expression through stress-inducible binding of phospholipids with subsequent nuclear and nucleolar localization. Relocalization occurs concomitantly with interaction with a subset of nuclear proteins, including PCNA, p53 and several regulators of acetylation such as the p300/CBP and PCAF histone acetyltransferases (HATs), as well as the histone deacetylases HDAC1 and hSir2. These interactions alter the localized state of chromatin compaction, subsequently affecting the expression of subsets of genes, including those associated with the stress response (Hsp70), apoptosis (Bax, MDM2) and cell cycle regulation (p21{sup WAF1}, cyclinmore » B) in a cell- and tissue-specific manner. The expression levels and subcellular localization of ING proteins are altered in a significant number of human cancer types, while the expression of ING isoforms changes during cellular aging, suggesting that ING proteins may play a role in linking cellular transformation and replicative senescence. The variety of functions attributed to ING proteins suggest that this tumor suppressor serves to link the disparate processes of cell cycle regulation, cell suicide and cellular aging through epigenetic regulation of gene expression. This review examines recent findings in the ING field with a focus on the functions of protein-protein interactions involving ING family members and the mechanisms by which these interactions facilitate the various roles that ING proteins play in tumorigenesis, apoptosis and senescence.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahu, Sushil Kumar; Mohanty, Suchitra; Kumar, Amit
The p73 protein has structural and functional homology with the tumor suppressor p53, which plays an important role in cell cycle regulation, apoptosis, and DNA repair. The p73 locus encodes both a tumor suppressor (TAp73) and a putative oncogene (ΔNp73). p73 May play a significant role in p53-deficient lymphomas infected with Epstein–Barr virus (EBV). EBV produces an asymptomatic infection in the majority of the global population, but it is associated with several human B-cell malignancies. The EBV-encoded Epstein–Barr virus nuclear antigen 3C (EBNA3C) is thought to disrupt the cell cycle checkpoint by interacting directly with p53 family proteins. Doxorubicin, amore » commonly used chemotherapeutic agent, induces apoptosis through p53 and p73 signaling such that the lowΔNp73 level promotes the p73-mediated intrinsic pathway of apoptosis. In this report, we investigated the mechanism by which EBV infection counters p73α-induced apoptosis through EBNA3C. - Highlights: • EBV-encoded EBNA3C suppresses doxorubicin-induced apoptosis in B-cell lymphomas. • EBNA3C binds to p73 to suppress its apoptotic effect. • EBNA3C maintains latency by regulating downstream mitochondrial pathways.« less
Moussa, Rayan S.; Kovacevic, Zaklina; Richardson, Des R.
2015-01-01
Chelators such as 2-hydroxy-1-napthylaldehyde isonicotinoyl hydrazone (311) and di-2-pyridylketone-4,4-dimethyl-3-thiosemicarbazone (Dp44mT) target tumor cell iron pools and inhibit proliferation. These agents also modulate multiple targets, one of which is the cyclin-dependent kinase inhibitor, p21. Hence, this investigation examined the mechanism of action of these compounds in targeting p21. All the chelators up-regulated p21 mRNA in the five tumor cell-types assessed. In contrast, examining their effect on total p21 protein levels, these agents induced either: (1) down-regulation in MCF-7 cells; (2) up-regulation in SK-MEL-28 and CFPAC-1 cells; or (3) had no effect in LNCaP and SK-N-MC cells. The nuclear localization of p21 was also differentially affected by the ligands depending upon the cell-type, with it being decreased in MCF-7 cells, but increased in SK-MEL-28 and CFPAC-1 cells. Further studies assessing the mechanisms responsible for these effects demonstrated that p21 expression was not correlated with p53 status, suggesting a p53-independent mechanism. Considering this, we examined proteins that modulate p21 independently of p53, namely NDRG1, MDM2 and ΔNp63. These studies demonstrated that a dominant negative MDM2 isoform (p75MDM2) closely resembled p21 expression in response to chelation in three cell lines. These data suggest MDM2 may be involved in the regulation of p21 by chelators. PMID:26335183
Morris, Joanna S; Nixon, Colin; Bruck, Alicia; Nasir, Lubna; Morgan, Iain M; Philbey, Adrian W
2008-02-01
The immunohistochemical expression of topoisomerase IIbeta binding protein 1 (TopBP1) was examined in 123 feline mammary lesions (18 non-neoplastic lesions including six fibroadenomatous hyperplasia and 12 duct ectasia, 17 adenomas and 88 carcinomas) in relation to histological grade, oestrogen receptor alpha (ERalpha) status, proliferation index (Ki67) and p53 expression. There was positive staining for TopBP1 in 122 of 123 feline mammary lesions, although nine samples had fewer than 20% positive cells. The percentage of cells positive for TopBP1 increased with histological grade. Most staining was nuclear but both nuclear and cytoplasmic staining was observed as the degree of malignancy increased. TopBP1 is expressed in feline mammary tumours and its expression is correlated with histological grade. Many neoplasms which over-express p53 or are ERalpha negative show TopBP1 immunoreactivity.
Modulation of p53 cellular function and cell death by African swine fever virus.
Granja, Aitor G; Nogal, María L; Hurtado, Carolina; Salas, José; Salas, María L; Carrascosa, Angel L; Revilla, Yolanda
2004-07-01
Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells.
Modulation of p53 Cellular Function and Cell Death by African Swine Fever Virus
Granja, Aitor G.; Nogal, María L.; Hurtado, Carolina; Salas, José; Salas, María L.; Carrascosa, Angel L.; Revilla, Yolanda
2004-01-01
Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells. PMID:15194793
Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.
Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel
2012-01-01
γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Che Mingxin; DeSilvio, Michelle; Pollack, Alan
2007-11-15
Purpose: The goal of this study was to verify the significance of p53 as a prognostic factor in Radiation Therapy Oncology Group 9202, which compared short-term androgen deprivation (STAD) with radiation therapy (RT) to long-term androgen deprivation + RT in men with locally advanced prostate cancer (Pca). Methods and Materials: Tumor tissue was sufficient for p53 analysis in 777 cases. p53 status was determined by immunohistochemistry. Abnormal p53 expression was defined as 20% or more tumor cells with positive nuclei. Univariate and multivariate Cox proportional hazards models were used to evaluate the relationships of p53 status to patient outcomes. Results:more » Abnormal p53 was detected in 168 of 777 (21.6%) cases, and was significantly associated with cause-specific mortality (adjusted hazard ratio [HR] = 1.89; 95% confidence interval (CI) 1.14 - 3.14; p = 0.014) and distant metastasis (adjusted HR = 1.72; 95% CI 1.13-2.62; p = 0.013). When patients were divided into subgroups according to assigned treatment, only the subgroup of patients who underwent STAD + RT showed significant correlation between p53 status and cause-specific mortality (adjusted HR = 2.43; 95% CI = 1.32-4.49; p = 0.0044). When patients were divided into subgroups according to p53 status, only the subgroup of patients with abnormal p53 showed significant association between assigned treatment and cause-specific mortality (adjusted HR = 3.81; 95% CI 1.40-10.37; p = 0.0087). Conclusions: Abnormal p53 is a significant prognostic factor for patients with prostate cancer who undergo short-term androgen deprivation and radiotherapy. Long-term androgen deprivation may significantly improve the cause-specific survival for those with abnormal p53.« less
Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra
2008-07-01
To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.
Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua
2017-01-01
Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in “high-risk” category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01). In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands. PMID:28206977
Li, Qinglin; Huang, Ping; Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua
2017-04-25
Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in "high-risk" category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01).In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands.
2014-01-01
Activation of nuclear factor-kappa B (NF- κB) as a mechanism of host defense against infection and stress is the central mediator of inflammatory responses. A normal (acute) inflammatory response is activated on urgent basis and is auto-regulated. Chronic inflammation that results due to failure in the regulatory mechanism, however, is largely considered as a critical determinant in the initiation and progression of various forms of cancer. Mechanistically, NF- κB favors this process by inducing various genes responsible for cell survival, proliferation, migration, invasion while at the same time antagonizing growth regulators including tumor suppressor p53. It has been shown by various independent investigations that a down regulation of NF- κB activity directly, or indirectly through the activation of the p53 pathway reduces tumor growth substantially. Therefore, there is a huge effort driven by many laboratories to understand the NF- κB signaling pathways to intervene the function of this crucial player in inflammation and tumorigenesis in order to find an effective inhibitor directly, or through the p53 tumor suppressor. We discuss here on the role of NF- κB in chronic inflammation and cancer, highlighting mutual antagonism between NF- κB and p53 pathways in the process. We also discuss prospective pharmacological modulators of these two pathways, including those that were already tested to affect this mutual antagonism. PMID:25152696
Hsieh, Shu-Ling; Chen, Chi-Tsai; Wang, Jyh-Jye; Kuo, Yu-Hao; Li, Chien-Chun; Hsieh, Lan-Chi; Wu, Chih-Chung
2015-12-01
Sedanolide (SN), a phthalide-like compound from celery seed oil, possesses antioxidant effects. However, the effect of SN on cell death in human liver cancer cells has yet to be determined. In this study, cell viability determination, monodansylcadaverine (MDC) fluorescent staining and immunoblot analysis were performed to determine autophagy induction and autophagy-induced protein expression changes via molecular examination after human liver cancer (J5) cells were treated with SN. Our studies demonstrate that SN suppressed J5 cell viability by inducing autophagy. Phosphoinositide 3-kinase (PI3K)-I, mammalian target of rapamycin (mTOR) and Akt protein levels decreased, whereas PI3K-III, LC3-II and Beclin-1 protein levels increased following SN treatment in J5 cells. In addition, SN treatment upregulated nuclear p53 and damage-regulated autophagy modulator (DRAM) and downregulated cytosolic p53 and Tp53-induced glycolysis and apoptosis regulator (TIGAR) expression in J5 cells. Furthermore, the cytosolic phosphorylation of inhibitor of kappa B (IκB) and nuclear p65 and the DNA-binding activity of NF-κB increased after SN treatment. These results suggest that SN induces J5 cell autophagy by regulating PI3K, p53 and NF-κB autophagy-associated signaling pathways in J5 cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage
Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.
2009-01-01
Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133
Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B
2017-01-01
PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I - LO1413. The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study. The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 13. 3. 2017Accepted: 26. 3. 2017.
Ciepliński, Klaudiusz; Jóźwik, Maciej; Semczuk-Sikora, Anna; Gogacz, Marek; Lewkowicz, Dorota; Ignatov, Atanas; Semczuk, Andrzej
2018-02-01
The expression of p53 has been studied not only in primary human ovarian carcinomas, but also in borderline ovarian tumors, however, the results were discordant. Expression patterns of proteins involved in cell proliferation and apoptosis have been investigated in various human neoplasms, including female genital tract neoplasms. The aim of this investigation was to assess the staining pattern and immunolocalization of p53 and selected proliferative markers (Ki-67, MCM3, PCNA, and topoisomerase IIα) in borderline ovarian tumors (BOTs). The study group consisted of 42 women who underwent pelvic surgery between 2006-2015. The median patients' age was 46 years. The immunoperoxidase technique was employed using antibodies against p53, Ki-67, MCM3, PCNA, and topoisomerase IIα. For p53, nuclear expression was observed in BOTs, however, cytoplasmatic immunoreactivity was also detected. Altogether, 25 (60%) tumors demonstrated positive p53 immunostaining, including overexpression found in 6 (14%). There were no significant differences in p53 expression between subgroups of clinicopathological variables. Immunoexpression of Ki-67, MCM3, PCNA, and topoisomerase IIα was nuclear. Ki-67 expression was positive in 12 (29%) cases and there was a trend towards a relationship between patients' age and Ki-67 staining (P=0.08). Interestingly, a significantly higher Ki-67 expression was found in tumors of ≥10 cm in diameter compared to smaller tumors (P=0.008). MCM3 expression was detected in 38 (90%) tumors, and PCNA expression in 28 (67%), yet none of clinicopathological factors was related to them. Topoisomerase IIα expression was present in 14 (33%) cases and, interestingly, its significantly higher expression was observed in BOTs of ≥10 cm in diameter compared to smaller tumors (P=0.008). Moreover, Spearman's correlation revealed highly significant positive associations between Ki-67 and topoisomerase IIα (R=0.403, P=0.008) and Ki-67 and MCM3 (R=0.469, P=0.001). We report a high positive immunostaining rate for p53, suggesting a role of TP53 alterations in the development of BOTs in humans. The new finding of higher topoisomerase IIα immunostaining positivity in BOTs of ≥10 cm may be clinically relevant and requires further studies on larger patient groups.
Activation of Postnatal Neural Stem Cells Requires Nuclear Receptor TLX
Niu, Wenze; Zou, Yuhua; Shen, ChengCheng; Zhang, Chun-Li
2011-01-01
Neural stem cells (NSCs) continually produce new neurons in postnatal brains. However, the majority of these cells stay in a non-dividing, inactive state. The molecular mechanism that is required for these cells to enter proliferation still remains largely unknown. Here, we show that nuclear receptor TLX (NR2E1) controls the activation status of postnatal NSCs in mice. Lineage tracing indicates that TLX-expressing cells give rise to both activated and inactive postnatal NSCs. Surprisingly, loss of TLX function does not result in spontaneous glial differentiation, but rather leads to a precipitous age-dependent increase of inactive cells with marker expression and radial morphology for NSCs. These inactive cells are mis-positioned throughout the granular cell layer of the dentate gyrus during development and can proliferate again after reintroducing ectopic TLX. RNA-seq analysis of sorted NSCs revealed a TLX-dependent global expression signature, which includes the p53 signaling pathway. TLX regulates p21 expression in a p53-dependent manner and acute removal of p53 can rescue the proliferation defect of TLX-null NSCs in culture. Together, these findings suggest that TLX acts as an essential regulator that ensures the proliferative ability of postnatal NSCs by controlling their activation through genetic interaction with p53 and other signaling pathways. PMID:21957244
Activation of postnatal neural stem cells requires nuclear receptor TLX.
Niu, Wenze; Zou, Yuhua; Shen, Chengcheng; Zhang, Chun-Li
2011-09-28
Neural stem cells (NSCs) continually produce new neurons in postnatal brains. However, the majority of these cells stay in a nondividing, inactive state. The molecular mechanism that is required for these cells to enter proliferation still remains largely unknown. Here, we show that nuclear receptor TLX (NR2E1) controls the activation status of postnatal NSCs in mice. Lineage tracing indicates that TLX-expressing cells give rise to both activated and inactive postnatal NSCs. Surprisingly, loss of TLX function does not result in spontaneous glial differentiation, but rather leads to a precipitous age-dependent increase of inactive cells with marker expression and radial morphology for NSCs. These inactive cells are mispositioned throughout the granular cell layer of the dentate gyrus during development and can proliferate again after reintroduction of ectopic TLX. RNA-seq analysis of sorted NSCs revealed a TLX-dependent global expression signature, which includes the p53 signaling pathway. TLX regulates p21 expression in a p53-dependent manner, and acute removal of p53 can rescue the proliferation defect of TLX-null NSCs in culture. Together, these findings suggest that TLX acts as an essential regulator that ensures the proliferative ability of postnatal NSCs by controlling their activation through genetic interaction with p53 and other signaling pathways.
CRISPR-mediated direct mutation of cancer genes in the mouse liver
Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S.; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G.; Zhang, Feng; Anderson, Daniel G.; Sharp, Phillip A.; Jacks, Tyler
2014-01-01
The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem (ES) cells1. Here we describe a new method of cancer model generation using the CRISPR/Cas system in vivo in wild-type mice. We have used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs)2–4 to the liver and directly target the tumor suppressor genes Pten5 and p536, alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology7, 8. Simultaneous targeting of Pten and p53 induced liver tumors that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumor tissue revealed insertion or deletion (indel) mutations of the tumor suppressor genes, including bi-allelic mutations of both Pten and p53 in tumors. Furthermore, co-injection of Cas9 plasmids harboring sgRNAs targeting the β-Catenin gene (Ctnnb1) and a single-stranded DNA (ssDNA) oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-Catenin. This study demonstrates the feasibility of direct mutation of tumor suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics. PMID:25119044
The Neuronal Ischemic Tolerance Is Conditioned by the Tp53 Arg72Pro Polymorphism.
Ramos-Araque, Maria E; Rodriguez, Cristina; Vecino, Rebeca; Cortijo Garcia, Elisa; de Lera Alfonso, Mercedes; Sanchez Barba, Mercedes; Colàs-Campàs, Laura; Purroy, Francisco; Arenillas, Juan F; Almeida, Angeles; Delgado-Esteban, Maria
2018-04-23
Cerebral preconditioning (PC) confers endogenous brain protection after stroke. Ischemic stroke patients with a prior transient ischemic attack (TIA) may potentially be in a preconditioned state. Although PC has been associated with the activation of pro-survival signals, the mechanism by which preconditioning confers neuroprotection is not yet fully clarified. Recently, we have described that PC-mediated neuroprotection against ischemic insult is promoted by p53 destabilization, which is mediated by its main regulator MDM2. Moreover, we have previously described that the human Tp53 Arg72Pro single nucleotide polymorphism (SNP) controls susceptibility to ischemia-induced neuronal apoptosis and governs the functional outcome of patients after stroke. Here, we studied the contribution of the human Tp53 Arg72Pro SNP on PC-induced neuroprotection after ischemia. Our results showed that cortical neurons expressing the Pro72-p53 variant exhibited higher PC-mediated neuroprotection as compared with Arg72-p53 neurons. PC prevented ischemia-induced nuclear and cytosolic p53 stabilization in Pro72-p53 neurons. However, PC failed to prevent mitochondrial p53 stabilization, which occurs in Arg72-p53 neurons after ischemia. Furthermore, PC promoted neuroprotection against ischemia by controlling the p53/active caspase-3 pathway in Pro72-p53, but not in Arg72-p53 neurons. Finally, we found that good prognosis associated to TIA within 1 month prior to ischemic stroke was restricted to patients harboring the Pro72 allele. Our findings demonstrate that the Tp53 Arg72Pro SNP controls PC-promoted neuroprotection against a subsequent ischemic insult by modulating mitochondrial p53 stabilization and then modulates TIA-induced ischemic tolerance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santhanam, U.; Ray, A.; Sehgal, P.B.
1991-09-01
The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less
Sham, C L; To, K F; Chan, Paul K S; Lee, Dennis L Y; Tong, Michael C F; van Hasselt, C Andrew
2012-04-01
The purpose of this study of human papillomavirus (HPV), Epstein-Barr virus (EBV), p21, and p53 in sinonasal inverted papilloma (IP) was to help elucidate its pathogenesis. Seventy-three IPs, 48 nasal polyps, and 85 hypertrophied turbinates were subjected to HPV polymerase chain reaction (PCR) study. Seventy-three IPs, 30 nasal polyps, and 32 hypertrophied turbinates were subjected to EBV in situ hybridization (ISH), p21, and p53 immunohistochemical (IHC) studies. HPV was positive in 3 of 73 IPs (4.1%). All specimens were EBV negative. In all, 99% of IPs showed strong and diffuse p21 nuclear reactivity. Most nasal polyps and hypertrophied turbinates showed weak to moderate immunoreactivity of the basal and parabasal cells. Only focal p53 immunoreactivity of the basal and parabasal cells was found in 19% of IPs and 40% of nasal polyps. HPV prevalence of our IP is low. EBV is not present in IP. High p21 and low p53 expression in IP suggests a non-p53-dependent regulation pathway. Copyright © 2011 Wiley Periodicals, Inc.
Combined radiation and p53 gene therapy of malignant glioma cells.
Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A
1999-01-01
More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.
Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen
2018-06-01
The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
Knockdown of zebrafish Fancd2 causes developmental abnormalities via p53-dependent apoptosis.
Liu, Ting Xi; Howlett, Niall G; Deng, Min; Langenau, David M; Hsu, Karl; Rhodes, Jennifer; Kanki, John P; D'Andrea, Alan D; Look, A Thomas
2003-12-01
Mechanisms underlying the multiple developmental defects observed in Fanconi anemia (FA) patients are not well defined. We have identified the zebrafish homolog of human FANCD2, which encodes a nuclear effector protein that is monoubiquitinated in response to DNA damage, targeting it to nuclear foci where it preserves chromosomal integrity. Fancd2-deficient zebrafish embryos develop defects similar to those found in children with FA, including shortened body length, microcephaly, and microophthalmia, which are due to extensive cellular apoptosis. Developmental defects and increased apoptosis in Fancd2-deficient zebrafish were corrected by injection of human FANCD2 or zebrafish bcl2 mRNA, or by knockdown of p53, indicating that in the absence of Fancd2, developing tissues spontaneously undergo p53-dependent apoptosis. Thus, Fancd2 is essential during embryogenesis to prevent inappropriate apoptosis in neural cells and other tissues undergoing high levels of proliferative expansion, implicating this mechanism in the congenital abnormalities observed in human infants with FA.
Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.
Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi
2018-04-19
Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.
The p53 breast cancer tissue biomarker in Indian women
Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev
2011-01-01
Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177
Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G
2016-01-01
Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. The results obtained were analyzed using Spearman's Co-relation. The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found.
Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel
2008-12-01
Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.
Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.
La Perle, K M; Jhiang, S M; Capen, C C
2000-08-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice =28 weeks of age or p53-/- mice = 17 weeks of age; however, an older (170-day-old) male p53-/- mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas.
Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin
2013-05-01
DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.
Production of muons from heavy-flavour hadron decays in p-Pb collisions at √{sNN} = 5.02 TeV
NASA Astrophysics Data System (ADS)
Acharya, S.; Adamová, D.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmad, N.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Albuquerque, D. S. D.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altsybeev, I.; Alves Garcia Prado, C.; An, M.; Andrei, C.; Andrews, H. A.; Andronic, A.; Anguelov, V.; Anson, C.; Antičić, T.; Antinori, F.; Antonioli, P.; Anwar, R.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Ball, M.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barioglio, L.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Batista Camejo, A.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Beltran, L. G. E.; Belyaev, V.; Bencedi, G.; Beole, S.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biro, G.; Biswas, R.; Biswas, S.; Blair, J. T.; Blau, D.; Blume, C.; Boca, G.; Bock, F.; Bogdanov, A.; Boldizsár, L.; Bombara, M.; Bonomi, G.; Bonora, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Botta, E.; Bourjau, C.; Braun-Munzinger, P.; Bregant, M.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buhler, P.; Buitron, S. A. I.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Cabala, J.; Caffarri, D.; Caines, H.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Capon, A. A.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Ceballos Sanchez, C.; Cerello, P.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chauvin, A.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Cho, S.; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Concas, M.; Conesa Balbastre, G.; Conesa del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Costanza, S.; Crkovská, J.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danisch, M. C.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; De, S.; De Caro, A.; de Cataldo, G.; de Conti, C.; de Cuveland, J.; De Falco, A.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; De Souza, R. D.; Degenhardt, H. F.; Deisting, A.; Deloff, A.; Deplano, C.; Dhankher, P.; Di Bari, D.; Di Mauro, A.; Di Nezza, P.; Di Ruzza, B.; Diaz Corchero, M. A.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Duggal, A. K.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Endress, E.; Engel, H.; Epple, E.; Erazmus, B.; Erhardt, F.; Espagnon, B.; Esumi, S.; Eulisse, G.; Eum, J.; Evans, D.; Evdokimov, S.; Fabbietti, L.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernández Téllez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Francisco, A.; Frankenfeld, U.; Fronze, G. G.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gajdosova, K.; Gallio, M.; Galvan, C. D.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Garg, K.; Garg, P.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Gay Ducati, M. B.; Germain, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Goméz Coral, D. M.; Gomez Ramirez, A.; Gonzalez, A. S.; Gonzalez, V.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Graham, K. L.; Greiner, L.; Grelli, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grion, N.; Gronefeld, J. M.; Grosa, F.; Grosse-Oetringhaus, J. F.; Grosso, R.; Gruber, L.; Grull, F. R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Guzman, I. B.; Haake, R.; Hadjidakis, C.; Hamagaki, H.; Hamar, G.; Hamon, J. C.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Hellbär, E.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Herrmann, F.; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hippolyte, B.; Hladky, J.; Hohlweger, B.; Horak, D.; Hornung, S.; Hosokawa, R.; Hristov, P.; Hughes, C.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Isakov, V.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacak, B.; Jacazio, N.; Jacobs, P. M.; Jadhav, M. B.; Jadlovska, S.; Jadlovsky, J.; Jaelani, S.; Jahnke, C.; Jakubowska, M. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jercic, M.; Jimenez Bustamante, R. T.; Jones, P. G.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Ketzer, B.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Khatun, A.; Khuntia, A.; Kielbowicz, M. M.; Kileng, B.; Kim, D.; Kim, D. W.; Kim, D. J.; Kim, H.; Kim, J. S.; Kim, J.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobdaj, C.; Kofarago, M.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.; Koyithatta Meethaleveedu, G.; Králik, I.; Kravčáková, A.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kundu, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lapidus, K.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lavicka, R.; Lazaridis, L.; Lea, R.; Leardini, L.; Lee, S.; Lehas, F.; Lehner, S.; Lehrbach, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Litichevskyi, V.; Ljunggren, H. M.; Llope, W. J.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Loncar, P.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.; Lupi, M.; Lutz, T. H.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martin, N. A.; Martinengo, P.; Martinez, J. A. L.; Martínez, M. I.; Martínez García, G.; Martinez Pedreira, M.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Mastroserio, A.; Mathis, A. M.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzilli, M.; Mazzoni, M. A.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Mhlanga, S.; Miake, Y.; Mieskolainen, M. M.; Mihaylov, D. L.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Mischke, A.; Mishra, A. N.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Mohisin Khan, M.; Montes, E.; Moreira De Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Münning, K.; Munzer, R. H.; Murakami, H.; Murray, S.; Musa, L.; Musinsky, J.; Myers, C. J.; Naik, B.; Nair, R.; Nandi, B. K.; Nania, R.; Nappi, E.; Narayan, A.; Naru, M. U.; Natal da Luz, H.; Nattrass, C.; Navarro, S. R.; Nayak, K.; Nayak, R.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Negrao De Oliveira, R. A.; Nellen, L.; Nesbo, S. V.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Ohlson, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira Da Silva, A. C.; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Oravec, M.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Pachmayer, Y.; Pacik, V.; Pagano, D.; Pagano, P.; Paić, G.; Palni, P.; Pan, J.; Pandey, A. K.; Panebianco, S.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.; Park, W. J.; Parmar, S.; Passfeld, A.; Pathak, S. P.; Paticchio, V.; Patra, R. N.; Paul, B.; Pei, H.; Peitzmann, T.; Peng, X.; Pereira, L. G.; Pereira Da Costa, H.; Peresunko, D.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Pezzi, R. P.; Piano, S.; Pikna, M.; Pillot, P.; Pimentel, L. O. D. L.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Płoskoń, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Poppenborg, H.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Pozdniakov, V.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Rana, D. B.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Ratza, V.; Ravasenga, I.; Read, K. F.; Redlich, K.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rodríguez Cahuantzi, M.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Rokita, P. S.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Rotondi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rueda, O. V.; Rui, R.; Russo, R.; Rustamov, A.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Saarinen, S.; Sadhu, S.; Sadovsky, S.; Šafařík, K.; Saha, S. K.; Sahlmuller, B.; Sahoo, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Sandoval, A.; Sarkar, D.; Sarkar, N.; Sarma, P.; Sas, M. H. P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R. P.; Scheid, H. S.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schmidt, M. O.; Schmidt, M.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sett, P.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Sheikh, A. I.; Shigaki, K.; Shou, Q.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Song, J.; Song, M.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spiriti, E.; Sputowska, I.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stankus, P.; Stenlund, E.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Sumowidagdo, S.; Suzuki, K.; Swain, S.; Szabo, A.; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thakur, D.; Thakur, S.; Thomas, D.; Tieulent, R.; Tikhonov, A.; Timmins, A. R.; Toia, A.; Tripathy, S.; Trogolo, S.; Trombetta, G.; Trubnikov, V.; Trzaska, W. H.; Trzeciak, B. A.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Umaka, E. N.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vala, M.; Van Der Maarel, J.; Van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vázquez Doce, O.; Vechernin, V.; Veen, A. M.; Velure, A.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Vértesi, R.; Vickovic, L.; Vigolo, S.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Virgili, T.; Vislavicius, V.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Voscek, D.; Vranic, D.; Vrláková, J.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilk, G.; Wilkinson, J.; Willems, G. A.; Williams, M. C. S.; Windelband, B.; Witt, W. E.; Yalcin, S.; Yang, P.; Yano, S.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yoon, J. H.; Yurchenko, V.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zhu, X.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zimmermann, S.; Zinovjev, G.; Zmeskal, J.
2017-07-01
The production of muons from heavy-flavour hadron decays in p-Pb collisions at √{sNN} = 5.02 TeV was studied for 2
Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S
2009-03-04
Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi Fuming; Saha, Abhik; Murakami, Masanao
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less
Wartlick, Friedrich; Bopp, Anita; Henninger, Christian; Fritz, Gerhard
2013-12-01
Here, we investigated the influence of Rac family small GTPases on mechanisms of the DNA damage response (DDR) stimulated by topoisomerase II poisons. To this end, we examined the influence of the Rac-specific small molecule inhibitor EHT1864 on Ser139 phosphorylation of histone H2AX, a widely used marker of the DDR triggered by DNA double-strand breaks. EHT1864 attenuated the doxorubicin-stimulated DDR in a subset of cell lines tested, including HepG2 hepatoma cells. EHT1864 reduced the level of DNA strand breaks and increased viability following treatment of HepG2 cells with topo II poisons. Protection by EHT1864 was observed in both p53 wildtype (HepG2) and p53 deficient (Hep3B) human hepatoma cells and, furthermore, remained unaffected upon pharmacological inhibition of p53 in HepG2. Apparently, the impact of Rac on the DDR is independent of p53. Protection from doxorubicin-induced DNA damage by EHT1864 comprises both S and G2 phase cells. The inhibitory effect of EHT1864 on doxorubicin-stimulated DDR was mimicked by pharmacological inhibition of various protein kinases, including JNK, ERK, PI3K, PAK and CK1. EHT1864 and protein kinase inhibitors also attenuated the formation of the topo II-DNA cleavable complex. Moreover, EHT1864 mitigated the constitutive phosphorylation of topoisomerase IIα at positions S1106, S1213 and S1247. Doxorubicin transport, nuclear import/export of topoisomerase II and Hsp90-related mechanisms are likely not of relevance for doxorubicin-stimulated DDR impaired by EHT1864. We suggest that multiple kinase-dependent but p53- and heat shock protein-independent Rac-regulated nuclear mechanisms are required for activation of the DDR following treatment with topo II poisons. © 2013.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kasper, Jocelyn S.; Harvard Medical School, Boston, MA; Arai, Takehiro
CUL7 is a member of the cullin RING ligase family and forms an SCF-like complex with SKP1 and FBXW8. CUL7 is required for normal mouse embryonic development and cellular proliferation, and is highly homologous to PARC, a p53-associated, parkin-like cytoplasmic protein. We determined that CUL7, in a manner similar to PARC, can bind directly to p53 but does not affect p53 expression. We identified a discrete, co-linear domain in CUL7 that is conserved in PARC and HERC2, and is necessary and sufficient for p53-binding. The presence of p53 stabilized expression of this domain and we demonstrate that this p53-binding domainmore » of CUL7 contributes to the cytoplasmic localization of CUL7. The results support the model that p53 plays a role in regulation of CUL7 activity.« less
Chang, Ji Suk; Henry, Kenneth; Geli, María Isabel; Lemmon, Sandra K.
2006-01-01
Scd5p regulates endocytosis and cortical actin organization as a targeting subunit for the Ser/Thr protein phosphatase-1 (PP1) in yeast. To identify localization signals in Scd5p required for cell surface recruitment, visualization of GFP-tagged Scd5 truncations and deletions was performed. Scd5p contains a PP1 binding site, a 3-repeat region of 20 amino acids (3R), and a 9-repeat region of 12 amino acids (9R). We found that the 9R is critical for cortical localization of Scd5p, but cortical recruitment is not essential for Scd5p's function in actin organization and endocytosis. We propose that Scd5p can target PP1 to endocytic factors in the cytoplasm that have been disassembled and/or inactivated by phosphorylation. We also found that Scd5p undergoes nuclear-cytoplasmic shuttling in a Crm1p-dependent manner. Scd5p-ΔCT lacking the 9R region and its nuclear export signal (NES) accumulates in the nucleus, causing cortical actin and endocytic defects. Cytoplasmic localization and function of Scd5p-ΔCT is restored by NES addition. However, removal of Scd5p's nuclear localization signal prevents nuclear entry, but endocytosis and actin organization remain relatively normal. These results indicate that nuclear-cytoplasmic shuttling is not required for regulation of Scd5p's cortical function and suggest that Scd5p has an independent nuclear function. PMID:16251346
Nuclear localisation of 53BP1 is regulated by phosphorylation of the nuclear localisation signal.
von Morgen, Patrick; Lidak, Tomas; Horejsi, Zuzana; Macurek, Libor
2018-06-01
Repair of damaged DNA is essential for maintaining genomic stability. TP53-binding protein 1 (53BP1) plays an important role in repair of the DNA double-strand breaks. Nuclear localisation of 53BP1 depends on importin β and nucleoporin 153, but the type and location of 53BP1 nuclear localisation signal (NLS) have yet to be determined. Here, we show that nuclear import of 53BP1 depends on two basic regions, namely 1667-KRK-1669 and 1681-KRGRK-1685, which are both needed for importin binding. Lysine 1667 is essential for interaction with importin and its substitution to arginine reduced nuclear localisation of 53BP1. Furthermore, we have found that CDK1-dependent phosphorylation of 53BP1 at S1678 impairs importin binding during mitosis. Phosphorylation-mimicking mutant S1678D showed reduced nuclear localisation, suggesting that phosphorylation of the NLS interferes with nuclear import of the 53BP1 CONCLUSIONS: We show that 53BP1 contains a classical bipartite NLS 1666-GKRKLITSEEERSPAKRGRKS-1686, which enables the importin-mediated nuclear transport of 53BP1. Additionally, we found that posttranslational modification within the NLS region can regulate 53BP1 nuclear import. Our results indicate that integrity of the NLS is important for 53BP1 nuclear localisation. Precise mapping of the NLS will facilitate further studies on the effect of posttranslational modifications and somatic mutations on the nuclear localisation 53BP1 and DNA repair. © 2018 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.
Chen, Ying; Camacho, Sandra Catalina; Silvers, Thomas R; Razak, Albiruni R A; Gabrail, Nashat Y; Gerecitano, John F; Kalir, Eva; Pereira, Elena; Evans, Brad R; Ramus, Susan J; Huang, Fei; Priedigkeit, Nolan; Rodriguez, Estefania; Donovan, Michael; Khan, Faisal; Kalir, Tamara; Sebra, Robert; Uzilov, Andrew; Chen, Rong; Sinha, Rileen; Halpert, Richard; Billaud, Jean-Noel; Shacham, Sharon; McCauley, Dilara; Landesman, Yosef; Rashal, Tami; Kauffman, Michael; Mirza, Mansoor R; Mau-Sørensen, Morten; Dottino, Peter; Martignetti, John A
2017-03-15
Purpose: The high fatality-to-case ratio of ovarian cancer is directly related to platinum resistance. Exportin-1 (XPO1) is a nuclear exporter that mediates nuclear export of multiple tumor suppressors. We investigated possible clinicopathologic correlations of XPO1 expression levels and evaluated the efficacy of XPO1 inhibition as a therapeutic strategy in platinum-sensitive and -resistant ovarian cancer. Experimental Design: XPO1 expression levels were analyzed to define clinicopathologic correlates using both TCGA/GEO datasets and tissue microarrays (TMA). The effect of XPO1 inhibition, using the small-molecule inhibitors KPT-185 and KPT-330 (selinexor) alone or in combination with a platinum agent on cell viability, apoptosis, and the transcriptome was tested in immortalized and patient-derived ovarian cancer cell lines (PDCL) and platinum-resistant mice (PDX). Seven patients with late-stage, recurrent, and heavily pretreated ovarian cancer were treated with an oral XPO1 inhibitor. Results: XPO1 RNA overexpression and protein nuclear localization were correlated with decreased survival and platinum resistance in ovarian cancer. Targeted XPO1 inhibition decreased cell viability and synergistically restored platinum sensitivity in both immortalized ovarian cancer cells and PDCL. The XPO1 inhibitor-mediated apoptosis occurred through both p53-dependent and p53-independent signaling pathways. Selinexor treatment, alone and in combination with platinum, markedly decreased tumor growth and prolonged survival in platinum-resistant PDX and mice. In selinexor-treated patients, tumor growth was halted in 3 of 5 patients, including one with a partial response, and was safely tolerated by all. Conclusions: Taken together, these results provide evidence that XPO1 inhibition represents a new therapeutic strategy for overcoming platinum resistance in women with ovarian cancer. Clin Cancer Res; 23(6); 1552-63. ©2016 AACR . ©2016 American Association for Cancer Research.
Nieva, Jorge; Song, Byeong-Doo; Rogel, Joseph K.; Kujawara, David; Altobel, Lawrence; Izharrudin, Alicia; Boldt, Grant E.; Grover, Rajesh K.; Wentworth, Anita D.; Wentworth, Paul
2011-01-01
SUMMARY Epidemiologic and clinical evidence points to an increased risk of cancer when coupled with chronic inflammation. However, the molecular mechanisms that underpin this interrelationship remain largely unresolved. Herein we show that the inflammation-derived cholesterol 5,6-secosterol aldehydes, atheronal-A (KA) and –B (ALD), but not the PUFA-derived aldehydes 4-hydroxynonenal (HNE) and 4-hydroxyhexenal (HHE), induce misfolding of wild-type p53 into an amyloidogenic form that binds thioflavin T and Congo Red dyes but cannot bind to a consensus DNA sequence. Treatment of lung carcinoma cells with KA and ALD leads to a loss of function of extracted p53, as determined by analysis of extracted nuclear protein and in activation of p21. Our results uncover a plausible chemical link between inflammation and cancer and expands the already pivotal role of p53 dysfunction and cancer risk. PMID:21802012
Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo
2015-01-01
ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792
Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas
La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.
2000-01-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169
Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.
Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun
2014-07-23
The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nuclear localisation of LASP-1 correlates with poor long-term survival in female breast cancer.
Frietsch, J J; Grunewald, T G P; Jasper, S; Kammerer, U; Herterich, S; Kapp, M; Honig, A; Butt, E
2010-05-25
LIM and SH3 protein 1 (LASP-1) is a nucleo-cytoplasmatic signalling protein involved in cell proliferation and migration and is upregulated in breast cancer in vitro studies have shown that LASP-1 might be regulated by prostate-derived ETS factor (PDEF), p53 and/or LASP1 gene amplification. This current study analysed the prognostic significance of LASP-1 on overall survival (OS) in 177 breast cancer patients and addressed the suggested mechanisms of LASP-1-regulation. Nucleo-cytoplasmatic LASP-1-positivity of breast carcinoma samples was correlated with long-term survival, clinicopathological parameters, Ki67-positivity and PDEF expression. Rate of LASP1 amplification was determined in micro-dissected primary breast cancer cells using quantitative RT-PCR. Cell-phase dependency of nuclear LASP-1-localisation was studied in synchronised cells. In addition, LASP-1, PDEF and p53 expression was compared in cell lines of different tumour entities to define principles for LASP-1-regulation. We showed that LASP-1 overexpression is not due to LASP1 gene amplification. Moreover, no correlation between p53-mutations or PDEF-expression and LASP-1-status was observed. However, nuclear LASP-1-localisation in breast carcinomas is increased during proliferation with peak in G2/M-phase and correlated significantly with Ki67-positivity and poor OS. Our results provide evidence that nuclear LASP-1-positivity may serve as a negative prognostic indicator for long-term survival of breast cancer patients.
Nasal biopsies of children exposed to air pollutants.
Calderón-Garcidueñas, L; Rodriguez-Alcaraz, A; Valencia-Salazar, G; Mora-Tascareño, A; García, R; Osnaya, N; Villarreal-Calderón, A; Devlin, R B; Van Dyke, T
2001-01-01
Southwest Metropolitan Mexico City (SWMMC) atmosphere is a complex mixture of air pollutants, including ozone, particulate matter, and aldehydes. Children in SWMMC are exposed chronically and sequentially to numerous toxicants, and they exhibit significant nasal damage. The objective of this study was to assess p53 accumulation by immunohistochemistry in nasal biopsies of SWMMC children. We evaluated 111 biopsies from 107 children (83 exposed SWMMC children and 24 control children residents in a pollutant-compliant Caribbean island). Complete clinical histories and physical examinations, including an ear-nose-throat (ENT) exam were done. There was a significant statistical difference in the upper and lower respiratory symptomatology and ENT findings between control and exposed children (p < 0.001). Control children gave no respiratory symptomatology in the 3 months prior to the study; their biopsies exhibited normal ciliated respiratory epithelium and were p53-negative. SWMMC children complained of epistaxis, nasal obstruction. and crusting. Irregular areas of whitish-gray recessed mucosa over the inferior and middle turbinates were seen in 25% of SWMMC children, and their nasal biopsies displayed basal cell hyperplasia, decreased numbers of ciliated and goblet cells, neutrophilic epithelial infiltrates, squamous metaplasia. and mild dysplasia. Four of 21 SWMMC children with grossly abnormal mucosal changes exhibited strong transmural nuclear p53 staining in their nasal biopsies (p 0.005, odds ratio 26). In the context of lifetime exposures to toxic and potentially carcinogenic air pollutants, p53 nasal induction in children could potentially represent. a) a checkpoint response to toxic exposures, setting up a selective condition for p53 mutation, or b) a p53 mutation has already occurred as a result of such selection. Because the biological significance of p53 nuclear accumulation in the nasal biopsies of these children is not clear at this point, we strongly suggest that children with macroscopic nasal mucosal abnormalities should be closely monitored by the ENT physician. Parents should be advised to decrease the children's number of outdoor exposure hours and encourage a balanced diet with an important component of fresh fruits and vegetables.
p53 improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.
Park, Joon-Young; Wang, Ping-Yuan; Matsumoto, Takumi; Sung, Ho Joong; Ma, Wenzhe; Choi, Jeong W; Anderson, Stasia A; Leary, Scot C; Balaban, Robert S; Kang, Ju-Gyeong; Hwang, Paul M
2009-09-25
Exercise capacity is a physiological characteristic associated with protection from both cardiovascular and all-cause mortality. p53 regulates mitochondrial function and its deletion markedly diminishes exercise capacity, but the underlying genetic mechanism orchestrating this is unclear. Understanding the biology of how p53 improves exercise capacity may provide useful insights for improving both cardiovascular as well as general health. The purpose of this study was to understand the genetic mechanism by which p53 regulates aerobic exercise capacity. Using a variety of physiological, metabolic, and molecular techniques, we further characterized maximum exercise capacity and the effects of training, measured various nonmitochondrial and mitochondrial determinants of exercise capacity, and examined putative regulators of mitochondrial biogenesis. As p53 did not affect baseline cardiac function or inotropic reserve, we focused on the involvement of skeletal muscle and now report a wider role for p53 in modulating skeletal muscle mitochondrial function. p53 interacts with Mitochondrial Transcription Factor A (TFAM), a nuclear-encoded gene important for mitochondrial DNA (mtDNA) transcription and maintenance, and regulates mtDNA content. The increased mtDNA in p53(+/+) compared to p53(-/-) mice was more marked in aerobic versus glycolytic skeletal muscle groups with no significant changes in cardiac tissue. These in vivo observations were further supported by in vitro studies showing overexpression of p53 in mouse myoblasts increases both TFAM and mtDNA levels whereas depletion of TFAM by shRNA decreases mtDNA content. Our current findings indicate that p53 promotes aerobic metabolism and exercise capacity by using different mitochondrial genes and mechanisms in a tissue-specific manner.
Role of Nuclear Pools of Aminoacyl-tRNA Synthetases in tRNA Nuclear Export
Azad, Abul K.; Stanford, David R.; Sarkar, Srimonti; Hopper, Anita K.
2001-01-01
Reports of nuclear tRNA aminoacylation and its role in tRNA nuclear export (Lund and Dahlberg, 1998; Sarkar et al., 1999; Grosshans et al., 2000a) have led to the prediction that there should be nuclear pools of aminoacyl-tRNA synthetases. We report that in budding yeast there are nuclear pools of tyrosyl-tRNA synthetase, Tys1p. By sequence alignments we predicted a Tys1p nuclear localization sequence and showed it to be sufficient for nuclear location of a passenger protein. Mutations of this nuclear localization sequence in endogenous Tys1p reduce nuclear Tys1p pools, indicating that the motif is also important for nucleus location. The mutations do not significantly affect catalytic activity, but they do cause defects in export of tRNAs to the cytosol. Despite export defects, the cells are viable, indicating that nuclear tRNA aminoacylation is not required for all tRNA nuclear export paths. Because the tRNA nuclear exportin, Los1p, is also unessential, we tested whether tRNA aminoacylation and Los1p operate in alternative tRNA nuclear export paths. No genetic interactions between aminoacyl-tRNA synthetases and Los1p were detected, indicating that tRNA nuclear aminoacylation and Los1p operate in the same export pathway or there are more than two pathways for tRNA nuclear export. PMID:11359929
Role of nuclear pools of aminoacyl-tRNA synthetases in tRNA nuclear export.
Azad, A K; Stanford, D R; Sarkar, S; Hopper, A K
2001-05-01
Reports of nuclear tRNA aminoacylation and its role in tRNA nuclear export (Lund and Dahlberg, 1998; Sarkar et al., 1999; Grosshans et al., 20001) have led to the prediction that there should be nuclear pools of aminoacyl-tRNA synthetases. We report that in budding yeast there are nuclear pools of tyrosyl-tRNA synthetase, Tys1p. By sequence alignments we predicted a Tys1p nuclear localization sequence and showed it to be sufficient for nuclear location of a passenger protein. Mutations of this nuclear localization sequence in endogenous Tys1p reduce nuclear Tys1p pools, indicating that the motif is also important for nucleus location. The mutations do not significantly affect catalytic activity, but they do cause defects in export of tRNAs to the cytosol. Despite export defects, the cells are viable, indicating that nuclear tRNA aminoacylation is not required for all tRNA nuclear export paths. Because the tRNA nuclear exportin, Los1p, is also unessential, we tested whether tRNA aminoacylation and Los1p operate in alternative tRNA nuclear export paths. No genetic interactions between aminoacyl-tRNA synthetases and Los1p were detected, indicating that tRNA nuclear aminoacylation and Los1p operate in the same export pathway or there are more than two pathways for tRNA nuclear export.
Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E.; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S.; Kaneki, Masao
2015-01-01
Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-Nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson’s disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. PMID:25389371
p53 AND MDM2 PROTEIN EXPRESSION IN ACTINIC CHEILITIS
de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida
2008-01-01
Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia. PMID:19082401
p53 and MDM2 protein expression in actinic cheilitis.
de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida
2008-01-01
Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia.
Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.
Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald
2017-06-01
p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p < 0.001). The p53 and Bcl-2 immunoreactivity was increased in aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.
Kurihara, Shuichi; Oda, Yoshinao; Ohishi, Yoshihiro; Iwasa, Atsuko; Takahira, Tomonari; Kaneki, Eisuke; Kobayashi, Hiroaki; Wake, Norio; Tsuneyoshi, Masazumi
2008-08-01
Classification and terminology of non-low-grade endometrial sarcomas, which show significant nuclear atypia, have been controversial. Currently, these tumors seem to be classified all together into "undifferentiated endometrial sarcoma (UES)." However, it remains unclear whether these non-low-grade sarcomas are universally "undifferentiated." We divided these sarcomas morphologically into undifferentiated endometrial sarcoma with nuclear uniformity (UES-U) and undifferentiated endometrial sarcoma with nuclear pleomorphism (UES-P), and compared their molecular genetic and immunohistochemical profiles. Eighteen low-grade endometrial stromal sarcomas (ESS-LG), 7 UES-U, and 6 UES-P were examined. All the patients with ESS-LG were still alive, either with or without disease, whereas 4 of the 5 patients with advanced stage UES-U and all 3 of the patients with advanced stage UES-P had died of the disease. JAZF1-JJAZ1 fusion transcript was detected in 6 (50%) out of 12 ESS-LG and in 1 (33%) of 3 UES-U, whereas it was not detected in any of the cases of UES-P. ESS-LG and UES-U frequently showed positive immunoreaction for estrogen receptor (ESS-LG: 94%, UES-U: 57%) and progesterone receptor (ESS-LG: 94%, UES-U: 57%), whereas all the UES-P were negative for these receptors. Nuclear beta-catenin expression was more frequently recognized in ESS-LG (47%) and UES-U (85%), compared with UES-P (33%). Moreover, nuclear accumulation of p53 and TP53 gene missense mutations were limited to 3 UES-P cases. Our data suggest that UES-U shares some molecular genetic and immunohistochemical characteristics with ESS-LG, but UES-P considerably differs from ESS-LG.
Solomon, Monica Charlotte; Vidyasagar, M S; Fernandes, Donald; Guddattu, Vasudev; Mathew, Mary; Shergill, Ankur Kaur; Carnelio, Sunitha; Chandrashekar, Chetana
2016-12-01
Oral squamous cell carcinomas comprise a heterogeneous tumor cell population with varied molecular characteristics, which makes prognostication of these tumors a complex and challenging issue. Thus, molecular profiling of these tumors is advantageous for an accurate prognostication and treatment planning. This is a retrospective study on a cohort of primary locally advanced oral squamous cell carcinomas (n = 178) of an Indian rural population. The expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in a cohort of primary locally advanced oral squamous cell carcinomas was evaluated. A potential biomarker that can predict the tumor response to treatment was identified. Formalin-fixed paraffin-embedded tumor blocks of (n = 178) of histopathologically diagnosed cases of locally advanced oral squamous cell carcinomas were selected. Tissue microarray blocks were constructed with 2 cores of 2 mm diameter from each tumor block. Four-micron-thick sections were cut from these tissue microarray blocks. These tissue microarray sections were immunohistochemically stained for EGFR, p53, Bcl-2, cyclin D1 and p16. In this cohort, EGFR was the most frequently expressed 150/178 (84%) biomarker of the cases. Kaplan-Meier analysis showed a significant association (p = 0.038) between expression of p53 and a poor prognosis. A Poisson regression analysis showed that tumors that expressed p53 had a two times greater chance of recurrence (unadjusted IRR-95% CI 2.08 (1.03, 4.5), adjusted IRR-2.29 (1.08, 4.8) compared with the tumors that did not express this biomarker. Molecular profiling of oral squamous cell carcinomas will enable us to categorize our patients into more realistic risk groups. With biologically guided tumor characterization, personalized treatment protocols can be designed for individual patients, which will improve the quality of life of these patients.
Sahm, Felix; Reuss, David; Koelsche, Christian; Capper, David; Schittenhelm, Jens; Heim, Stephanie; Jones, David T W; Pfister, Stefan M; Herold-Mende, Christel; Wick, Wolfgang; Mueller, Wolf; Hartmann, Christian; Paulus, Werner; von Deimling, Andreas
2014-10-01
Astrocytoma and oligodendroglioma are histologically and genetically well-defined entities. The majority of astrocytomas harbor concurrent TP53 and ATRX mutations, while most oligodendrogliomas carry the 1p/19q co-deletion. Both entities share high frequencies of IDH mutations. In contrast, oligoastrocytomas (OA) appear less clearly defined and, therefore, there is an ongoing debate whether these tumors indeed constitute an entity or whether they represent a mixed bag containing both astrocytomas and oligodendrogliomas. We investigated 43 OA diagnosed in different institutions employing histology, immunohistochemistry and in situ hybridization addressing surrogates for the molecular genetic markers IDH1R132H, TP53, ATRX and 1p/19q loss. In all but one OA the combination of nuclear p53 accumulation and ATRX loss was mutually exclusive with 1p/19q co-deletion. In 31/43 OA, only alterations typical for oligodendroglioma were observed, while in 11/43 OA, only indicators for mutations typical for astrocytomas were detected. A single case exhibited a distinct pattern, nuclear expression of p53, ATRX loss, IDH1 mutation and partial 1p/19q loss. However, this was the only patient undergoing radiotherapy prior to surgery, possibly contributing to the acquisition of this uncommon combination. In OA with oligodendroglioma typical alterations, the portions corresponding to astrocytic part were determined as reactive, while in OA with astrocytoma typical alterations the portions corresponding to oligodendroglial differentiation were neoplastic. These data provide strong evidence against the existence of an independent OA entity.
Production of muons from heavy-flavour hadron decays in p–Pb collisions at s NN = 5.02 TeV
Acharya, S.; Adamová, D.; Aggarwal, M. M.; ...
2017-03-28
The production of muons from heavy-flavour hadron decays in p–Pb collisions at √ sNN = 5.02 TeV was studied for 2< p T <16 GeV/c with the ALICE detector at the CERN LHC. The measurement was performed at forward (p-going direction) and backward (Pb-going direction) rapidity, in the ranges of rapidity in the centre-of-mass system (cms) 2.03 cms <3.53 and –4.46cms <–2.96, respectively. The production cross sections and nuclear modification factors are presented as a function of transverse momentum (p T). At forward rapidity, the nuclear modification factor is compatible with unity while at backward rapidity, in the interval 2.5more » < p T < 3.5 GeV/c, it is above unity by more than 2σ. The ratio of the forward-to-backward production cross sections is also measured in the overlapping interval 2.96<|y cms| < 3.53 and is smaller than unity by 3.7σ in 2.5< p T <3.5 GeV/c. The data are described by model calculations including cold nuclear matter effects.« less
Nooij, Linda S; Ter Haar, Natalja T; Ruano, Dina; Rakislova, Natalia; van Wezel, Tom; Smit, Vincent T H B M; Trimbos, Baptist J B M Z; Ordi, Jaume; van Poelgeest, Mariette I E; Bosse, Tjalling
2017-11-15
Purpose: Vulvar cancer (VC) can be subclassified by human papillomavirus (HPV) status. HPV-negative VCs frequently harbor TP53 mutations; however, in-depth analysis of other potential molecular genetic alterations is lacking. We comprehensively assessed somatic mutations in a large series of vulvar (pre)cancers. Experimental Design: We performed targeted next-generation sequencing (17 genes), p53 immunohistochemistry and HPV testing on 36 VC and 82 precursors (sequencing cohort). Subsequently, the prognostic significance of the three subtypes identified in the sequencing cohort was assessed in a series of 236 VC patients (follow-up cohort). Results: Frequent recurrent mutations were identified in HPV-negative vulvar (pre)cancers in TP53 (42% and 68%), NOTCH1 (28% and 41%), and HRAS (20% and 31%). Mutation frequency in HPV-positive vulvar (pre)cancers was significantly lower ( P = 0.001). Furthermore, a substantial subset of the HPV-negative precursors (35/60, 58.3%) and VC (10/29, 34.5%) were TP53 wild-type (wt), suggesting a third, not-previously described, molecular subtype. Clinical outcomes in the three different subtypes (HPV + , HPV - /p53wt, HPV - /p53abn) were evaluated in a follow-up cohort consisting of 236 VC patients. Local recurrence rate was 5.3% for HPV + , 16.3% for HPV - /p53wt and 22.6% for HPV - /p53abn tumors ( P = 0.044). HPV positivity remained an independent prognostic factor for favorable outcome in the multivariable analysis ( P = 0.020). Conclusions: HPV - and HPV + vulvar (pre)cancers display striking differences in somatic mutation patterns. HPV - /p53wt VC appear to be a distinct clinicopathologic subgroup with frequent NOTCH1 mutations. HPV + VC have a significantly lower local recurrence rate, independent of clinicopathological variables, opening opportunities for reducing overtreatment in VC. Clin Cancer Res; 23(22); 6781-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Immunological and biochemical evidence for nuclear localization of annexin in peas
NASA Technical Reports Server (NTRS)
Clark, G. B.; Dauwalder, M.; Roux, S. J.
1998-01-01
Immunofluorescent localization of annexins using an anti-pea annexin polyclonal antibody (anti-p35) in pea (Pisum sativum) leaf and stem epidermal peels showed staining of the nuclei and the cell periphery. Nuclear staining was also seen in cell teases prepared from pea plumules. The amount of nuclear stain was reduced both by fixation time and by dehydration and organic solvent treatment. Observation with confocal microscopy demonstrated that the anti-p35 stain was diffusely distributed throughout the nuclear structure. Immunoblots of purified nuclei, nuclear envelope matrix, nucleolar, and chromatin fractions showed a cross-reactive protein band of 35 kDa. These data are the first to show annexins localized in plant cell nuclei where they may play a role in nuclear function.
Goodin, Michael M.; Austin, Jennifer; Tobias, Renée; Fujita, Miki; Morales, Christina; Jackson, Andrew O.
2001-01-01
We have characterized the interaction and nuclear localization of the nucleocapsid (N) protein and phosphoprotein (P) of sonchus yellow net nucleorhabdovirus. Expression studies with plant and yeast cells revealed that both N and P are capable of independent nuclear import. Site-specific mutagenesis and deletion analyses demonstrated that N contains a carboxy-terminal bipartite nuclear localization signal (NLS) located between amino acids 465 and 481 and that P contains a karyophillic region between amino acids 40 and 124. The N NLS was fully capable of functioning outside of the context of the N protein and was able to direct the nuclear import of a synthetic protein fusion consisting of green fluorescent protein fused to glutathione S-transferase (GST). Expression and mapping studies suggested that the karyophillic domain in P is located within the N-binding domain. Coexpression of N and P drastically affected their localization patterns relative to those of individually expressed proteins and resulted in a shift of both proteins to a subnuclear region. Yeast two-hybrid and GST pulldown experiments verified the N-P and P-P interactions, and deletion analyses have identified the N and P interacting domains. N NLS mutants were not transported to the nucleus by import-competent P, presumably because N binding masks the P NLS. Taken together, our results support a model for independent entry of N and P into the nucleus followed by associations that mediate subnuclear localization. PMID:11533202
[Interaction between p53 and MDM2 in human lung cancer cells].
Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J
2014-01-01
The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) - mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.
Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku
2016-01-01
Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981
PML is a ROS sensor activating p53 upon oxidative stress
Soilihi, Hassane
2017-01-01
Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625
PML is a ROS sensor activating p53 upon oxidative stress.
Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues
2017-11-06
Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.
Nagai, Yuri; Nogami, Satoru; Kumagai-Sano, Fumi; Ohya, Yoshikazu
2003-03-01
VMA1-derived endonuclease (VDE), a site-specific endonuclease in Saccharomyces cerevisiae, enters the nucleus to generate a double-strand break in the VDE-negative allelic locus, mediating the self-propagating gene conversion called homing. Although VDE is excluded from the nucleus in mitotic cells, it relocalizes at premeiosis, becoming localized in both the nucleus and the cytoplasm in meiosis. The nuclear localization of VDE is induced by inactivation of TOR kinases, which constitute central regulators of cell differentiation in S. cerevisiae, and by nutrient depletion. A functional genomic approach revealed that at least two karyopherins, Srp1p and Kap142p, are required for the nuclear localization pattern. Genetic and physical interactions between Srp1p and VDE imply direct involvement of karyopherin-mediated nuclear transport in this process. Inactivation of TOR signaling or acquisition of an extra nuclear localization signal in the VDE coding region leads to artificial nuclear localization of VDE and thereby induces homing even during mitosis. These results serve as evidence that VDE utilizes the host systems of nutrient signal transduction and nucleocytoplasmic transport to ensure the propagation of its coding region.
Nagai, Yuri; Nogami, Satoru; Kumagai-Sano, Fumi; Ohya, Yoshikazu
2003-01-01
VMA1-derived endonuclease (VDE), a site-specific endonuclease in Saccharomyces cerevisiae, enters the nucleus to generate a double-strand break in the VDE-negative allelic locus, mediating the self-propagating gene conversion called homing. Although VDE is excluded from the nucleus in mitotic cells, it relocalizes at premeiosis, becoming localized in both the nucleus and the cytoplasm in meiosis. The nuclear localization of VDE is induced by inactivation of TOR kinases, which constitute central regulators of cell differentiation in S. cerevisiae, and by nutrient depletion. A functional genomic approach revealed that at least two karyopherins, Srp1p and Kap142p, are required for the nuclear localization pattern. Genetic and physical interactions between Srp1p and VDE imply direct involvement of karyopherin-mediated nuclear transport in this process. Inactivation of TOR signaling or acquisition of an extra nuclear localization signal in the VDE coding region leads to artificial nuclear localization of VDE and thereby induces homing even during mitosis. These results serve as evidence that VDE utilizes the host systems of nutrient signal transduction and nucleocytoplasmic transport to ensure the propagation of its coding region. PMID:12588991
Ding, Defang; Zhang, Yaping; Wang, Jing; Wang, Xufei; Fan, Dunhuang; He, Linfeng; Zhang, Xuxia; Gao, Yun; Li, Qiang; Chen, Honghong
2016-01-01
The biodosimetric information is critical for evaluating the human health hazards caused by radon and its progeny. Here, we demonstrated that the formation of phosphorylated histone variant H2AX (γ-H2AX), p53-binding protein 1 (53BP1) and phosphorylated KRAB-associated protein 1 (pKAP-1) foci and their linear tracks in human peripheral blood lymphocytes (HPBLs) in vitro exposed to radon and its progeny were dependent on the cumulative absorbed dose of radon exposure but was unrelated to the concentration of radon. Among them, γ-H2AX foci and its linear tracks were the most sensitive indicators with the lowest estimable cumulative absorbed dose of 1.74 mGy from their linear dose-response curves and sustained for 12 h after termination of radon exposure. In addition, three types of foci showed an overdispersed non-Poisson distribution in HPBLs. The ratios of pKAP-1/γ-H2AX foci co-localization, 53BP1/γ-H2AX foci co-localization and 53BP1/pKAP-1 foci co-localization were significantly increased in HPBLs exposed to radon while they were unrelated to the cumulative dose of radon exposure, suggesting that γ-H2AX, pKAP-1 and 53BP1 play an important role in the repair of heterochromatic double-strand breaks. Altogether, our findings provide an experimental basis for estimating the biological dose of internal α-particle irradiation from radon and its progeny exposure in humans. PMID:27922110
ER-associated SNAREs and Sey1p mediate nuclear fusion at two distinct steps during yeast mating.
Rogers, Jason V; Arlow, Tim; Inkellis, Elizabeth R; Koo, Timothy S; Rose, Mark D
2013-12-01
During yeast mating, two haploid nuclei fuse membranes to form a single diploid nucleus. However, the known proteins required for nuclear fusion are unlikely to function as direct fusogens (i.e., they are unlikely to directly catalyze lipid bilayer fusion) based on their predicted structure and localization. Therefore we screened known fusogens from vesicle trafficking (soluble N-ethylmaleimide-sensitive factor attachment protein receptors [SNAREs]) and homotypic endoplasmic reticulum (ER) fusion (Sey1p) for additional roles in nuclear fusion. Here we demonstrate that the ER-localized SNAREs Sec20p, Ufe1p, Use1p, and Bos1p are required for efficient nuclear fusion. In contrast, Sey1p is required indirectly for nuclear fusion; sey1Δ zygotes accumulate ER at the zone of cell fusion, causing a block in nuclear congression. However, double mutants of Sey1p and Sec20p, Ufe1p, or Use1p, but not Bos1p, display extreme ER morphology defects, worse than either single mutant, suggesting that retrograde SNAREs fuse ER in the absence of Sey1p. Together these data demonstrate that SNAREs mediate nuclear fusion, ER fusion after cell fusion is necessary to complete nuclear congression, and there exists a SNARE-mediated, Sey1p-independent ER fusion pathway.
p53 Involvement in the Control of Murine Hair Follicle Regression
Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.
2001-01-01
p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365
Görner, Wolfram; Durchschlag, Erich; Martinez-Pastor, Maria Teresa; Estruch, Francisco; Ammerer, Gustav; Hamilton, Barbara; Ruis, Helmut; Schüller, Christoph
1998-01-01
Msn2p and the partially redundant factor Msn4p are key regulators of stress-responsive gene expression in Saccharomyces cerevisiae. They are required for the transcription of a number of genes coding for proteins with stress-protective functions. Both Msn2p and Msn4p are Cys2His2 zinc finger proteins and bind to the stress response element (STRE). In vivo footprinting studies show that the occupation of STREs is enhanced in stressed cells and dependent on the presence of Msn2p and Msn4p. Both factors accumulate in the nucleus under stress conditions, such as heat shock, osmotic stress, carbon-source starvation, and in the presence of ethanol or sorbate. Stress-induced nuclear localization was found to be rapid, reversible, and independent of protein synthesis. Nuclear localization of Msn2p and Msn4p was shown to be correlated inversely to cAMP levels and protein kinase A (PKA) activity. A region with significant homologies shared between Msn2p and Msn4p is sufficient to confer stress-regulated localization to a SV40–NLS–GFP fusion protein. Serine to alanine or aspartate substitutions in a conserved PKA consensus site abolished cAMP-driven nuclear export and cytoplasmic localization in unstressed cells. We propose stress and cAMP-regulated intracellular localization of Msn2p to be a key step in STRE-dependent transcription and in the general stress response. PMID:9472026
The Impact of a Common MDM2 SNP on the Sensitivity of Breast Cancer to Treatment
2012-06-01
1993; Kussie, 1996 ; Lin, 1994; Freedman, 1999). Apart from its p53 ubiquitination function, MDM2 has other functions including nuclear- cytoplasmic...MDM2; however, it can be degraded by MDM2 (Shvarts, 1997; Shvarts, 1996 ; Okamoto, 2005). Appropriate expression of p53 propels cells down apoptotic...prognostic value for various endpoints in multiple tumor types (Bueso-Ramos, 1996 ; Khor, 2005; Kim, 2011; Marchetti, 1995;Marchetti, 1995; McCann, 1995
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neboori, Hanmanth J.R.; Haffty, Bruce G., E-mail: hafftybg@umdnj.edu; Wu Hao
2012-08-01
Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log-rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence-free survival (IBRFS), distant metastasis-free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survivalmore » (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their clinical significance.« less
Dang, Van-Dinh; Levin, Henry L.
2000-01-01
Retroviruses, such as human immunodeficiency virus, that infect nondividing cells generate integration precursors that must cross the nuclear envelope to reach the host genome. As a model for retroviruses, we investigated the nuclear entry of Tf1, a long-terminal-repeat-containing retrotransposon of the fission yeast Schizosaccharomyces pombe. Because the nuclear envelope of yeasts remains intact throughout the cell cycle, components of Tf1 must be transported through the envelope before integration can occur. The nuclear localization of the Gag protein of Tf1 is different from that of other proteins tested in that it has a specific requirement for the FXFG nuclear pore factor, Nup124p. Using extensive mutagenesis, we found that Gag contained three nuclear localization signals (NLSs) which, when included individually in a heterologous protein, were sufficient to direct nuclear import. In the context of the intact transposon, mutations in the NLS that mapped to the first 10 amino acid residues of Gag significantly impaired Tf1 retrotransposition and abolished nuclear localization of Gag. Interestingly, this NLS activity in the heterologous protein was specifically dependent upon the presence of Nup124p. Deletion analysis of heterologous proteins revealed the surprising result that the residues in Gag with the NLS activity were independent from the residues that conveyed the requirement for Nup124p. In fact, a fragment of Gag that lacked NLS activity, residues 10 to 30, when fused to a heterologous protein, was sufficient to cause the classical NLS of simian virus 40 to require Nup124p for nuclear import. Within the context of the current understanding of nuclear import, these results represent the novel case of a short amino acid sequence that specifies the need for a particular nuclear pore complex protein. PMID:11003674
Dang, V D; Levin, H L
2000-10-01
Retroviruses, such as human immunodeficiency virus, that infect nondividing cells generate integration precursors that must cross the nuclear envelope to reach the host genome. As a model for retroviruses, we investigated the nuclear entry of Tf1, a long-terminal-repeat-containing retrotransposon of the fission yeast Schizosaccharomyces pombe. Because the nuclear envelope of yeasts remains intact throughout the cell cycle, components of Tf1 must be transported through the envelope before integration can occur. The nuclear localization of the Gag protein of Tf1 is different from that of other proteins tested in that it has a specific requirement for the FXFG nuclear pore factor, Nup124p. Using extensive mutagenesis, we found that Gag contained three nuclear localization signals (NLSs) which, when included individually in a heterologous protein, were sufficient to direct nuclear import. In the context of the intact transposon, mutations in the NLS that mapped to the first 10 amino acid residues of Gag significantly impaired Tf1 retrotransposition and abolished nuclear localization of Gag. Interestingly, this NLS activity in the heterologous protein was specifically dependent upon the presence of Nup124p. Deletion analysis of heterologous proteins revealed the surprising result that the residues in Gag with the NLS activity were independent from the residues that conveyed the requirement for Nup124p. In fact, a fragment of Gag that lacked NLS activity, residues 10 to 30, when fused to a heterologous protein, was sufficient to cause the classical NLS of simian virus 40 to require Nup124p for nuclear import. Within the context of the current understanding of nuclear import, these results represent the novel case of a short amino acid sequence that specifies the need for a particular nuclear pore complex protein.
Müller, Brigitte; Ellinwood, N. M.; Lorenz, Birgit; Stieger, Knut
2018-01-01
Gene editing is an attractive potential treatment of inherited retinopathies. However, it often relies on endogenous DNA repair. Retinal DNA repair is incompletely characterized in humans and animal models. We investigated recruitment of the double stranded break (DSB) repair complex of γH2AX and 53bp1 in both developing and mature mouse neuroretinas. We evaluated the immunofluorescent retinal expression of these proteins during development (P07-P30) in normal and retinal degeneration models, as well as in potassium bromate induced DSB repair in normal adult (3 months) retinal explants. The two murine retinopathy models used had different mutations in Pde6b: the severe rd1 and the milder rd10 models. Compared to normal adult retina, we found increased numbers of γH2AX positive foci in all retinal neurons of the developing retina in both model and control retinas, as well as in wild type untreated retinal explant cultures. In contrast, the 53bp1 staining of the retina differed both in amount and character between cell types at all ages and in all model systems. There was strong pan nuclear staining in ganglion, amacrine, and horizontal cells, and cone photoreceptors, which was attenuated. Rod photoreceptors did not stain unequivocally. In all samples, 53bp1 stained foci only rarely occurred. Co-localization of 53bp1 and γH2AX staining was a very rare event (< 1% of γH2AX foci in the ONL and < 3% in the INL), suggesting the potential for alternate DSB sensing and repair proteins in the murine retina. At a minimum, murine retinal DSB repair does not appear to follow canonical pathways, and our findings suggests further investigation is warranted. PMID:29765300
Uo, Takuma; Veenstra, Timothy D.; Morrison, Richard S.
2009-01-01
Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and —independent intrinsic apoptotic programs require the pro-apoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing post-mitochondrial events including cleavage of caspase-9 and -3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions. PMID:19261878
Miyamoto, Kei; Nagai, Kouhei; Kitamura, Naoya; Nishikawa, Tomoaki; Ikegami, Haruka; Binh, Nguyen T.; Tsukamoto, Satoshi; Matsumoto, Mai; Tsukiyama, Tomoyuki; Minami, Naojiro; Yamada, Masayasu; Ariga, Hiroyoshi; Miyake, Masashi; Kawarasaki, Tatsuo; Matsumoto, Kazuya; Imai, Hiroshi
2011-01-01
Nuclear reprogramming of differentiated cells can be induced by oocyte factors. Despite numerous attempts, these factors and mechanisms responsible for successful reprogramming remain elusive. Here, we identify one such factor, necessary for the development of nuclear transfer embryos, using porcine oocyte extracts in which some reprogramming events are recapitulated. After incubating somatic nuclei in oocyte extracts from the metaphase II stage, the oocyte proteins that were specifically and abundantly incorporated into the nuclei were identified by mass spectrometry. Among 25 identified proteins, we especially focused on a multifunctional protein, DJ-1. DJ-1 is present at a high concentration in oocytes from the germinal vesicle stage until embryos at the four-cell stage. Inhibition of DJ-1 function compromises the development of nuclear transfer embryos but not that of fertilized embryos. Microarray analysis of nuclear transfer embryos in which DJ-1 function is inhibited shows perturbed expression of P53 pathway components. In addition, embryonic arrest of nuclear transfer embryos injected with anti–DJ-1 antibody is rescued by P53 inhibition. We conclude that DJ-1 is an oocyte factor that is required for development of nuclear transfer embryos. This study presents a means for identifying natural reprogramming factors in mammalian oocytes and a unique insight into the mechanisms underlying reprogramming by nuclear transfer. PMID:21482765
Adiposity is associated with p53 gene mutations in breast cancer.
Ochs-Balcom, Heather M; Marian, Catalin; Nie, Jing; Brasky, Theodore M; Goerlitz, David S; Trevisan, Maurizio; Edge, Stephen B; Winston, Janet; Berry, Deborah L; Kallakury, Bhaskar V; Freudenheim, Jo L; Shields, Peter G
2015-10-01
Mutations in the p53 gene are among the most frequent genetic events in human cancer and may be triggered by environmental and occupational exposures. We examined the association of clinical and pathological characteristics of breast tumors and breast cancer risk factors according to the prevalence and type of p53 mutations. Using tumor blocks from incident cases from a case-control study in western New York, we screened for p53 mutations in exons 2-11 using the Affymetrix p53 Gene Chip array and analyzed case-case comparisons using logistic regression. The p53 mutation frequency among cases was 28.1 %; 95 % were point mutations (13 % of which were silent) and the remainder were single base pair deletions. Sixty seven percent of all point mutations were transitions; 24 % of them are G:C>A:T at CpG sites. Positive p53 mutation status was associated with poorer differentiation (OR, 95 % CI 2.29, 1.21-4.32), higher nuclear grade (OR, 95 % CI 1.99, 1.22-3.25), and increased Ki-67 status (OR, 95 % CI 1.81, 1.10-2.98). Cases with P53 mutations were more likely to have a combined ER-positive and PR-negative status (OR, 95 % CI 1.65, 1.01-2.71), and a combined ER-negative and PR-negative status (OR, 95 % CI 2.18, 1.47-3.23). Body mass index >30 kg/m(2), waist circumference >79 cm, and waist-to-hip ratio >0.86 were also associated with p53 status; obese breast cancer cases are more likely to have p53 mutations (OR, 95 % CI 1.78, 1.19-2.68). We confirmed that p53 mutations are associated with less favorable tumor characteristics and identified an association of p53 mutation status and adiposity.
1994-01-01
Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
Zhang, Jin; Chen, Xiangling; Kent, Michael S.; Rodriguez, Carlos O.; Chen, Xinbin
2009-01-01
Spontaneous tumors in the dog offer a unique opportunity as models to study human cancer etiology and therapy. p53, the most commonly mutated gene in human cancers, is found to be altered in dog cancers. However, little is known about the role of p53 in dog tumorigenesis. Here, we found that upon exposure to DNA damage agents or Mdm2 inhibitor nutlin-3, canine p53 is accumulated and capable of inducing its target genes, MDM2 and p21. We also found that upon DNA damage, canine p53 is accumulated in the nucleus, followed by MDM2 nuclear translocation and increased 53BP1 foci formation. In addition, we found that canine p63 and p73 are up-regulated by DNA damage agents. Furthermore, colony formation assay showed that canine tumor cells are sensitive to DNA damage agents and nutlin-3 in a p53-dependent manner. Surprisingly, canine p21 is expressed as two isoforms. Thus, we generated multiple canine p21 mutants and found that aa 129 to 142 is required, whereas aa 139 is one of the key determinants, for two p21 isoform expression. Finally, we showed that although the full-length human p21 cDNA expresses one polypeptide, aa 139 appears to play a similar role as that in canine p21 for various migration patterns. Taken together, our results indicate that canine p53 family proteins have biological activities similar to human counterparts. These similarities make the dog as an excellent out-bred spontaneous tumor model and the dog can serve as a translation model from bench-top to cage-side and then to bed-side. PMID:19147538
Morris, Gerwyn; Maes, Michael
2012-11-01
Fukuda's criteria are adequate to make a distinction between Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS) and chronic fatigue (CF), but ME/CFS patients should be subdivided into those with (termed ME) and without (termed CFS) post exertional malaise [Maes et al. 2012]. ME/CFS is considered to be a neuro-immune disease. ME/CFS is characterized by activated immuno-inflammatory pathways, including increased levels of pro-inflammatory cytokines, nuclear factor κB (NF-κB) and aberrations in mitochondrial functions, including lowered ATP. These processes may explain typical symptoms of ME/CFS, e.g. fatigue, malaise, hyperalgesia, and neurologic and autonomic symptoms. Here we hypothesize that increased NF-κB together with a loss of p53 are key phenomena in ME/CFS that further explain ME/CFS symptoms, such as fatigue and neurocognitive dysfunction, and explain ME symptoms, such as post-exertional malaise following mental and physical activities. Inactivation of p53 impairs aerobic mitochondrial functions and causes greater dependence on anaerobic glycolysis, elevates lactate levels, reduces mitochondrial density in skeletal muscle and reduces endurance during physical exercise. Lowered p53 and increased NF-κB are associated with elevated reactive oxygen species. Increased NF-κB induces the production of pro-inflammatory cytokines, which increase glycolysis and further compromise mitochondrial functions. All these factors together may contribute to mitochondrial exhaustion and indicate that the demand for extra ATP upon the commencement of increased activity cannot be met. In conditions of chronic inflammation and oxidative stress, high NF-κB and low p53 may conspire to promote neuron and glial cell survival at a price of severely compromised metabolic brain function. Future research should examine p53 signaling in ME/CFS. Copyright © 2012. Published by Elsevier Ltd.
Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong
2007-01-01
Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291
Role of nuclear bodies in apoptosis signalling.
Krieghoff-Henning, Eva; Hofmann, Thomas G
2008-11-01
Promyelocytic leukemia nuclear bodies (PML NBs) are dynamic macromolecular multiprotein complexes that recruit and release a plethora of proteins. A considerable number of PML NB components play vital roles in apoptosis, senescence regulation and tumour suppression. The molecular basis by which PML NBs control these cellular responses is still just beginning to be understood. In addition to PML itself, numerous further tumour suppressors including transcriptional regulator p53, acetyl transferase CBP (CREB binding protein) and protein kinase HIPK2 (homeodomain interacting protein kinase 2) are recruited to PML NBs in response to genotoxic stress or oncogenic transformation and drive the senescence and apoptosis response by regulating p53 activity. Moreover, in response to death-receptor activation, PML NBs may act as nuclear depots that release apoptotic factors, such as the FLASH (FLICE-associated huge) protein, to amplify the death signal. PML NBs are also associated with other nuclear domains including Cajal bodies and nucleoli and share apoptotic regulators with these domains, implying crosstalk between NBs in apoptosis regulation. In conclusion, PML NBs appear to regulate cell death decisions through different, pathway-specific molecular mechanisms.
Driscoll, James J.; Gauerke, Steven; Monahan, Brian C.
2009-01-01
Hidradenocarcinomas are rare, aggressive adnexal tumors of sweat gland origin that demonstrate a high potential for local recurrence, metastasis and poor outcome. These neoplasms can derive from preexisting clear cell hidradenomas, but more commonly appear de novo with the molecular events responsible for the pathogenesis currently unknown. Molecular markers of pathogenesis as well as effective forms of adjuvant chemotherapy are missing due to the lack of accurate diagnosis, paucity of cases and confusion with other visceral solid tumors. Here, we report a 37-year-old man who presented with a rapidly growing, painful palpable mass located in the right inguinal area. The patient was a nonsmoker, did not consume alcohol and had a medical history remarkable only for a lower abdominal superficial skin lesion in the same area that had been excised 11 years earlier. Although initially slow growing, the lesion eventually expanded, was surgically excised and was diagnosed as a hidradenoma. There was no family history of malignancy and the patient had not experienced any constitutional symptoms. We probed the immunohistochemical status and detected negative staining for the estrogen, progesterone and Her2 receptors, while strong, diffuse nuclear staining was seen in the majority of cells consistent with p53 overexpression. Similarly, strong nuclear reactivity was seen with p63 and p73 antibodies. The p63 gene contains 2 separate promoters which express at least 6 major transcripts that lead to 2 fundamentally different classes of proteins; 3 isoforms (TAp63α, β and γ) encode proteins that induce apoptosis, whereas the other 3 isoforms (ΔNp63α, β and γ) may exert inhibitory effects on p53. Interest in p63 stems from this ‘two genes in one’-concept. Importantly, the nuclear presence of ΔNp63 was detected widespread throughout the tumor. We have identified a subtype of hidradenocarcinomas that express ΔNp63 and uncovered an unforeseen commonality with triple-negative breast tumors. To our knowledge, this is the first report of a sweat gland tumor that displayed expression of both ΔNp63 and p73 and demonstrated a triple-negative receptor status. Such a link between 2 seemingly disparate tumor types indicates a mutual pathway of tumorigenesis and suggests the potential for common therapeutic regimens. PMID:20740144
Driscoll, James J; Gauerke, Steven; Monahan, Brian C
2009-03-14
Hidradenocarcinomas are rare, aggressive adnexal tumors of sweat gland origin that demonstrate a high potential for local recurrence, metastasis and poor outcome. These neoplasms can derive from preexisting clear cell hidradenomas, but more commonly appear de novo with the molecular events responsible for the pathogenesis currently unknown. Molecular markers of pathogenesis as well as effective forms of adjuvant chemotherapy are missing due to the lack of accurate diagnosis, paucity of cases and confusion with other visceral solid tumors. Here, we report a 37-year-old man who presented with a rapidly growing, painful palpable mass located in the right inguinal area. The patient was a nonsmoker, did not consume alcohol and had a medical history remarkable only for a lower abdominal superficial skin lesion in the same area that had been excised 11 years earlier. Although initially slow growing, the lesion eventually expanded, was surgically excised and was diagnosed as a hidradenoma. There was no family history of malignancy and the patient had not experienced any constitutional symptoms. We probed the immunohistochemical status and detected negative staining for the estrogen, progesterone and Her2 receptors, while strong, diffuse nuclear staining was seen in the majority of cells consistent with p53 overexpression. Similarly, strong nuclear reactivity was seen with p63 and p73 antibodies. The p63 gene contains 2 separate promoters which express at least 6 major transcripts that lead to 2 fundamentally different classes of proteins; 3 isoforms (TAp63alpha, beta and gamma) encode proteins that induce apoptosis, whereas the other 3 isoforms (DeltaNp63alpha, beta and gamma) may exert inhibitory effects on p53. Interest in p63 stems from this 'two genes in one'-concept. Importantly, the nuclear presence of DeltaNp63 was detected widespread throughout the tumor. We have identified a subtype of hidradenocarcinomas that express DeltaNp63 and uncovered an unforeseen commonality with triple-negative breast tumors. To our knowledge, this is the first report of a sweat gland tumor that displayed expression of both DeltaNp63 and p73 and demonstrated a triple-negative receptor status. Such a link between 2 seemingly disparate tumor types indicates a mutual pathway of tumorigenesis and suggests the potential for common therapeutic regimens.
Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nery, Flavia C.; Departamento de Genetica e Evolucao, Universidade Estadual de Campinas, Campinas, SP; Rui, Edmilson
Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could bemore » confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro.« less
Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro
2003-01-01
We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.
Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S; Kaneki, Masao
2014-11-11
Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson's disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. Copyright © 2014, American Association for the Advancement of Science.
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
Galvão, Hebel Cavalcanti; Gordón-Núñez, Manuel Antonio; de Amorim, Rivadavio Fernandes Batista; Freitas, Roseana de Almeida; de Souza, Lelia Batista
2013-01-01
Even though odontogenic cysts share a similar histogenesis, they show different growth and differentiation profile due to differences in the proliferative cellular activity. We perform an immunohistochemical assessment of protein 53 (p53), proliferating cell nuclear antigen (PCNA), B-cell lymphoma 2 (bcl-2), and murine double minute 2 (MDM2) expression in odontogenic cysts and keratocystic odontogenic tumor analyzing their correlation with the biological behavior of these lesions. By the streptavidin-biotin-peroxidase method with antibodies against p53, PCNA, bcl-2, and MDM2 proteins, 11 radicular cysts, 11 dentigerous cysts, and 11 keratocystic odontogenic tumor were analyzed. The non-parametric Mann-Whitney U-test and Kruskall-Wallis test (P ≤ 0.05) were used to analyze the data. Immunopositivity for PCNA was observed in all cases appraised, predominantly in the suprabasal layer of keratocystic odontogenic tumor epithelial lining (SD ± 19.44), but no significant differences were found among the groups of lesions. Bcl-2 immunoexpression was observed especially in the basal layer of keratocystic odontogenic tumor. PCNA LI was significantly higher than bcl-2 LI in keratocystic odontogenic tumor. MDM2 and p53 immunoexpression were not detected in the lesions studied. Among the evaluated lesions, the keratocystic odontogenic tumor showed different immunoexpression of the proliferation and apoptosis markers. The results of this study suggest that the keratocystic odontogenic tumor presents distinct biological behavior of the odontogenic cysts, as for the processes of proliferation, apoptosis, and differentiation, reinforcing the information in favor of the neoplastic nature of this lesion.
Lin, Feng; Gao, Li; Su, Zhenyu; Cao, Xiaofang; Zhan, Yuanbo; Li, Ying; Zhang, Bin
2018-07-01
Oral squamous cell carcinoma (OSCC), one of the 10 most common types of neoplasms in the US, constitutes ~90% of all cases of oral malignancies. Chemoresistance and metastasis are difficult to avoid during the course of treatment, leading to a poor prognosis and a high mortality rate for patients with OSCC. Autophagy, a critical conserved cellular process, has been reported to be highly associated with the regulation of chemoresistance and metastasis of cancer cells. The present study investigated the role of karyopherin α2 (KPNA2), a member of the importin α family, which may serve an important role in p53 nucleocytoplasmic transport in the process of OSCC autophagy. In the CAL‑27, SCC‑15 and Tca8113 OSCC cell lines, we observed that the downregulation of KPNA2 suppressed cell migration and cisplatin resistance, using wound‑healing, Transwell and CCK‑8 assays. Additionally, the results of western blot analysis and transmission electron microscopy (TEM) analysis indicated that the knockdown of KPNA2 inhibited autophagy. We confirmed that the inhibition of autophagy with anti‑autophagy agents decreased the migration and cisplatin resistance of OSCC cells. We hypothesized that the suppression of cell migration and cisplatin resistance induced by KPNA2 knockdown may be associated with the inhibition of autophagy. To identify the underlying mechanism, further experiments determined that KPNA2 affects the level of autophagy via regulating the p53 nuclear import. Thus, the present study demonstrated that the function of KPNA2 in the process of autophagy may be p53‑dependent, and by regulating the translocation of p53, KPNA2 can support autophagy to promote the chemoresistance and metastasis of OSCC cells.
Barone, Eugenio; Cenini, Giovanna; Di Domenico, Fabio; Noel, Teresa; Wang, Chi; Perluigi, Marzia; St Clair, Daret K; Butterfield, D Allan
2015-11-01
Superoxide dismutases (SODs) are the primary reactive oxygen species (ROS)-scavenging enzymes of the cell and catalyze the dismutation of superoxide radicals O2- to H2O2 and molecular oxygen (O2). Among the three forms of SOD identified, manganese-containing SOD (MnSOD, SOD2) is a homotetramer located wholly in the mitochondrial matrix. Because of the SOD2 strategic location, it represents the first mechanism of defense against the augmentation of ROS/reactive nitrogen species levels in the mitochondria for preventing further damage. This study seeks to understand the effects that the partial lack (SOD2(-/+) ) or the overexpression (TgSOD2) of MnSOD produces on oxidative/nitrative stress basal levels in different brain isolated cellular fractions (i.e., mitochondrial, nuclear, cytosolic) as well as in the whole-brain homogenate. Furthermore, because of the known interaction between SOD2 and p53 protein, this study seeks to clarify the impact that the double mutation has on oxidative/nitrative stress levels in the brain of mice carrying the double mutation (p53(-/-) × SOD2(-/+) and p53(-/-) × TgSOD2). We show that each mutation affects mitochondrial, nuclear, and cytosolic oxidative/nitrative stress basal levels differently, but, overall, no change or reduction of oxidative/nitrative stress levels was found in the whole-brain homogenate. The analysis of well-known antioxidant systems such as thioredoxin-1 and Nrf2/HO-1/BVR-A suggests their potential role in the maintenance of the cellular redox homeostasis in the presence of changes of SOD2 and/or p53 protein levels. © 2015 Wiley Periodicals, Inc.
Nuclear localization of coactivator RAC3 is mediated by a bipartite NLS and importin {alpha}3
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeung, Percy Luk; Zhang, Aihua; Chen, J. Don
2006-09-15
The nuclear receptor coactivator RAC3 (also known as SRC-3/ACTR/AIB1/p/CIP/TRAM-1) belongs to the p160 coactivator family, which are involved in several physiological processes and diseases. Here we have investigated how RAC3 is translocated into the nucleus and show that it is mediated through a bipartite NLS and importin {alpha}3. This bipartite NLS is located within the conserved bHLH domain, and its mutation abolished nuclear localization. The NLS is also sufficient to cause nuclear import of EGFP, and the activity requires basic amino acids within the NLS. RAC3 binds strongly to importin {alpha}3, which also depends on the basic amino acids. Functionally,more » RAC3 cytoplasmic mutant loses its ability to enhance transcription, suggesting that nuclear localization is essential for coactivator function. Together, these results reveal a previous unknown mechanism for nuclear translocation of p160 coactivators and a critical function of the conserved bHLH within the coactivator.« less
Ibañez, Irene L.; Bracalente, Candelaria; Notcovich, Cintia; Tropper, Ivanna; Molinari, Beatriz L.; Policastro, Lucía L.; Durán, Hebe
2012-01-01
The Cyclin-dependent kinase inhibitor 1B (p27Kip1) is a key protein in the decision between proliferation and cell cycle exit. Quiescent cells show nuclear p27Kip1, but this protein is exported to the cytoplasm in response to proliferating signals. We recently reported that catalase treatment increases the levels of p27Kip1 in vitro and in vivo in a murine model. In order to characterize and broaden these findings, we evaluated the regulation of p27Kip1 by hydrogen peroxide (H2O2) in human melanoma cells and melanocytes. We observed a high percentage of p27Kip1 positive nuclei in melanoma cells overexpressing or treated with exogenous catalase, while non-treated controls showed a cytoplasmic localization of p27Kip1. Then we studied the levels of p27Kip1 phosphorylated (p27p) at serine 10 (S10) and at threonine 198 (T198) because phosphorylation at these sites enables nuclear exportation of this protein, leading to accumulation and stabilization of p27pT198 in the cytoplasm. We demonstrated by western blot a decrease in p27pS10 and p27pT198 levels in response to H2O2 removal in melanoma cells, associated with nuclear p27Kip1. Melanocytes also exhibited nuclear p27Kip1 and lower levels of p27pS10 and p27pT198 than melanoma cells, which showed cytoplasmic p27Kip1. We also showed that the addition of H2O2 (0.1 µM) to melanoma cells arrested in G1 by serum starvation induces proliferation and increases the levels of p27pS10 and p27pT198 leading to cytoplasmic localization of p27Kip1. Nuclear localization and post-translational modifications of p27Kip1 were also demonstrated by catalase treatment of colorectal carcinoma and neuroblastoma cells, extending our findings to these other human cancer types. In conclusion, we showed in the present work that H2O2 scavenging prevents nuclear exportation of p27Kip1, allowing cell cycle arrest, suggesting that cancer cells take advantage of their intrinsic pro-oxidant state to favor cytoplasmic localization of p27Kip1. PMID:22970236
ER-associated SNAREs and Sey1p mediate nuclear fusion at two distinct steps during yeast mating
Rogers, Jason V.; Arlow, Tim; Inkellis, Elizabeth R.; Koo, Timothy S.; Rose, Mark D.
2013-01-01
During yeast mating, two haploid nuclei fuse membranes to form a single diploid nucleus. However, the known proteins required for nuclear fusion are unlikely to function as direct fusogens (i.e., they are unlikely to directly catalyze lipid bilayer fusion) based on their predicted structure and localization. Therefore we screened known fusogens from vesicle trafficking (soluble N-ethylmaleimide–sensitive factor attachment protein receptors [SNAREs]) and homotypic endoplasmic reticulum (ER) fusion (Sey1p) for additional roles in nuclear fusion. Here we demonstrate that the ER-localized SNAREs Sec20p, Ufe1p, Use1p, and Bos1p are required for efficient nuclear fusion. In contrast, Sey1p is required indirectly for nuclear fusion; sey1Δ zygotes accumulate ER at the zone of cell fusion, causing a block in nuclear congression. However, double mutants of Sey1p and Sec20p, Ufe1p, or Use1p, but not Bos1p, display extreme ER morphology defects, worse than either single mutant, suggesting that retrograde SNAREs fuse ER in the absence of Sey1p. Together these data demonstrate that SNAREs mediate nuclear fusion, ER fusion after cell fusion is necessary to complete nuclear congression, and there exists a SNARE-mediated, Sey1p-independent ER fusion pathway. PMID:24152736
p53 in pure epithelioid PEComa: an immunohistochemistry study and gene mutation analysis.
Bing, Zhanyong; Yao, Yuan; Pasha, Theresa; Tomaszewski, John E; Zhang, Paul J
2012-04-01
Pure epithelioid PEComa (PEP; so-called epithelioid angiomyolipoma) is rare and is more often associated with aggressive behaviors. The pathogenesis of PEP has been poorly understood. The authors studied p53 expression and gene mutation in PEPs by immunohistochemistry, single-strand conformation polymorphism, and direct sequencing in paraffin material from 8 PEPs. A group of classic angiomyolipomas (AMLs) were also analyzed for comparison. Five PEPs were from kidneys and 1 each from the heart, the liver, and the uterus. PEPs showed much stronger p53 nuclear staining (Allred score 6.4 ± 2.5) than the classic AML (2.3 ± 2.9) (P < .01). There was no p53 single-strand conformation polymorphism identified in either the PEPs or the 8 classic AMLs. p53 mutation analyses by direct sequencing of exons 5 to 9 showed 4 mutations in 3 of 8 PEPs but none in any of the 8 classic AMLs. The mutations included 2 missense mutations in a hepatic PEComa and 2 silent mutations in 2 renal PEPs. Both the missense mutations in the hepatic PEComa involved the exon 5, one involving codon 165, with change from CAG to CAC (coding amino acid changed from glutamine to histidine), and the other involving codon 182, with change from TGC to TAC (coding amino acid changed from cysteine to tyrosine). The finding of stronger p53 expression and mutations in epithelioid angiomyolipomas might have contributed to their less predictable behavior. However, the abnormal p53 expression cannot be entirely explained by p53 mutations in the exons examined in the PEPs.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohareer, Krishnaveni; Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046; Sahdev, Sudhir
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors,more » which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.« less
Proteomic Analysis of the Multimeric Nuclear Egress Complex of Human Cytomegalovirus*
Milbradt, Jens; Kraut, Alexandra; Hutterer, Corina; Sonntag, Eric; Schmeiser, Cathrin; Ferro, Myriam; Wagner, Sabrina; Lenac, Tihana; Claus, Claudia; Pinkert, Sandra; Hamilton, Stuart T.; Rawlinson, William D.; Sticht, Heinrich; Couté, Yohann; Marschall, Manfred
2014-01-01
Herpesviral capsids are assembled in the host cell nucleus before being translocated into the cytoplasm for further maturation. The crossing of the nuclear envelope represents a major event that requires the formation of the nuclear egress complex (NEC). Previous studies demonstrated that human cytomegalovirus (HCMV) proteins pUL50 and pUL53, as well as their homologs in all members of Herpesviridae, interact with each other at the nuclear envelope and form the heterodimeric core of the NEC. In order to characterize further the viral and cellular protein content of the multimeric NEC, the native complex was isolated from HCMV-infected human primary fibroblasts at various time points and analyzed using quantitative proteomics. Previously postulated components of the HCMV-specific NEC, as well as novel potential NEC-associated proteins such as emerin, were identified. In this regard, interaction and colocalization between emerin and pUL50 were confirmed by coimmunoprecipitation and confocal microscopy analyses, respectively. A functional validation of viral and cellular NEC constituents was achieved through siRNA-mediated knockdown experiments. The important role of emerin in NEC functionality was demonstrated by a reduction of viral replication when emerin expression was down-regulated. Moreover, under such conditions, reduced production of viral proteins and deregulation of viral late cytoplasmic maturation were observed. Combined, these data prove the functional importance of emerin as an NEC component, associated with pUL50, pUL53, pUL97, p32/gC1qR, and further regulatory proteins. Summarized, our findings provide the first proteomics-based characterization and functional validation of the HCMV-specific multimeric NEC. PMID:24969177
Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora
2013-01-01
A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845
NASA Technical Reports Server (NTRS)
Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)
1998-01-01
The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.
Lysosome-mediated Cell Death and Autophagy-Dependent Multidrug Resistance in Breast Cancer
2008-10-01
gene links mitochondria and cell death, the data suggests that Bcl2 may be involved in autophagic cell death and AD-MDR. GeneGo analysis also...GSK3 beta GSK3 beta E2A p53 p21 p21 E2F1 PPAR -gamma JNK1(MA PK8) JNK1(M APK8) ESR1 (nuclear) RARalpha Androgen receptor Androge n receptor p53...RelA (p65 NF-kB subunit) Erk (MAPK1/3 ) Erk (MAPK1/ 3) PPAR - gamma SOX9 Bcl-2 Bcl-2 RARalpha SP1 EGFR EGFR RelA (p65 NF- kB subunit) RARalpha RelA
Prodosmo, Andrea; Buffone, Amelia; Mattioni, Manlio; Barnabei, Agnese; Persichetti, Agnese; De Leo, Aurora; Appetecchia, Marialuisa; Nicolussi, Arianna; Coppa, Anna; Sciacchitano, Salvatore; Giordano, Carolina; Pinnarò, Paola; Sanguineti, Giuseppe; Strigari, Lidia; Alessandrini, Gabriele; Facciolo, Francesco; Cosimelli, Maurizio; Grazi, Gian Luca; Corrado, Giacomo; Vizza, Enrico; Giannini, Giuseppe; Soddu, Silvia
2016-09-06
Variant ATM heterozygotes have an increased risk of developing cancer, cardiovascular diseases, and diabetes. Costs and time of sequencing and ATM variant complexity make large-scale, general population screenings not cost-effective yet. Recently, we developed a straightforward, rapid, and inexpensive test based on p53 mitotic centrosomal localization (p53-MCL) in peripheral blood mononuclear cells (PBMCs) that diagnoses mutant ATM zygosity and recognizes tumor-associated ATM polymorphisms. Fresh PBMCs from 496 cancer patients were analyzed by p53-MCL: 90 cases with familial BRCA1/2-positive and -negative breast and/or ovarian cancer, 337 with sporadic cancers (ovarian, lung, colon, and post-menopausal breast cancers), and 69 with breast/thyroid cancer. Variants were confirmed by ATM sequencing. A total of seven individuals with ATM variants were identified, 5/65 (7.7 %) in breast cancer cases of familial breast and/or ovarian cancer and 2/69 (2.9 %) in breast/thyroid cancer. No variant ATM carriers were found among the other cancer cases. Excluding a single case in which both BRCA1 and ATM were mutated, no p53-MCL alterations were observed in BRCA1/2-positive cases. These data validate p53-MCL as reliable and specific test for germline ATM variants, confirm ATM as breast cancer susceptibility gene, and highlight a possible association with breast/thyroid cancers.
FOXM1 in sarcoma: role in cell cycle, pluripotency genes and stem cell pathways.
Kelleher, Fergal C; O'Sullivan, Hazel
2016-07-05
FOXM1 is a pro-proliferative transcription factor that promotes cell cycle progression at the G1-S, and G2-M transitions. It is activated by phosphorylation usually mediated by successive cyclin - cyclin dependent kinase complexes, and is highly expressed in sarcoma. p53 down regulates FOXM1 and FOXM1 inhibition is also partly dependent on Rb and p21. Abnormalities of p53 or Rb are frequent in sporadic sarcomas with bone or soft tissue sarcoma, accounting for 36% of index cancers in the high penetrance TP53 germline disorder, Li-Fraumeni syndrome.FOXM1 stimulates transcription of pluripotency related genes including SOX2, KLF4, OCT4, and NANOG many of which are important in sarcoma, a disorder of mesenchymal stem cell/ partially committed progenitor cells. In a selected specific, SOX2 is uniformly expressed in synovial sarcoma. Embryonic pathways preferentially used in stem cell such as Hippo, Hedgehog, and Wnt dominate in FOXM1 stoichiometry to alter rates of FOXM1 production or degradation. In undifferentiated pleomorphic sarcoma, liposarcoma, and fibrosarcoma, dysregulation of the Hippo pathway increases expression of the effector co-transcriptional activator Yes-Associated Protein (YAP). A complex involving YAP and the transcription factor TEAD elevates FOXM1 in these sarcoma subtypes. In another scenario 80% of desmoid tumors have nuclear localization of β-catenin, the Wnt pathway effector molecule. Thiazole antibiotics inhibit FOXM1 and because they have an auto-regulator loop FOXM1 expression is also inhibited. Current systemic treatment of sarcoma is of limited efficacy and inhibiting FOXM1 represents a potential new strategy.
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-03-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.
Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie
2016-01-01
The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952
Golusiński, W; Szmeja, Z; Olofsson, J; Biczysko, W; Krygier-Stojałowska, A; Majewski, P
1996-01-01
A comparison was performed of staining intensity of immunohistochemical proliferating antigens (p53, PCNA, Ki67), DNA flow cytometry and ultrastructure of the carcinoma cells in 120 cases of laryngeal cancer. Clinically very advanced tumors were in majority (T3 - 43%, T4 - 18%). A 5 graded scale was adapted to evaluate the level of immunohistochemical staining of the carcinoma cell nuclei. A positive staining was obtained in 70% for p53, 57% for Ki67 and in 80(2/3) for PCNA. 62% of the cases were DNA diploid and 38% DNA aneuploid. The DNA diploid carcinomas were accompanied by the enlargement of the cell nuclei, preserving of the nuclei's wide margins of heterochromatine, enlargement of the nuclear area and increase of the number of nuclei. In the aneuploid-polyploid cancer the nuclei had a substantial polymorphism with large cleaved nuclei and with significant variation in size, and with nuclear envelope. A frequent finding was euchromatization of chromatine. Dense chromatine appeared in the form of small clumps spread over the whole area of these irregular nuclei. Enlargement and activation of nucleoli occurred. There was a positive correlation (Chi-square) between T- and N-stage and immunohistochemical staining. There was also a positive correlation in staining intensity between p53, Ki67 and PCNA. There is also strong correlation between these markers of proliferative activity and the degree of aggressiveness of the tumour.
Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lieber, Charles S.; Department of Medicine, Mount Sinai School of Medicine, New York, NY 10029; Leo, Maria Anna
2008-08-22
Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-{gamma} coactivator1{alpha} (PGC-1{alpha}). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (pmore » = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1{alpha} hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5.« less
Saha, Shilpi; Bhattacharjee, Pushpak; Guha, Deblina; Kajal, Kirti; Khan, Poulami; Chakraborty, Sreeparna; Mukherjee, Shravanti; Paul, Shrutarshi; Manchanda, Rajkumar; Khurana, Anil; Nayak, Debadatta; Chakrabarty, Rathin; Sa, Gaurisankar; Das, Tanya
2015-08-01
Adverse side effects of chemotherapy during cancer treatment have shifted considerable focus towards therapies that are not only targeted but are also devoid of toxic side effects. We evaluated the antitumorigenic activity of sulphur, and delineated the molecular mechanisms underlying sulphur-induced apoptosis in non-small cell lung carcinoma (NSCLC) cells. A search for the underlying mechanism revealed that the choice between the two cellular processes, NFκBp65-mediated survival and p53-mediated apoptosis, was decided by the competition for a limited pool of transcriptional coactivator protein p300 in NSCLC cells. In contrast, sulphur inhibited otherwise upregulated survival signaling in NSCLC cells by perturbing the nuclear translocation of p65NFκB, its association with p300 histone acetylase, and subsequent transcription of Bcl-2. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic mitochondrial death cascade. Overall, the findings of this preclinical study clearly delineated the molecular mechanism underlying the apoptogenic effect of the non-toxic homeopathic remedy, sulphur, in NSCLC cells.
Binding of Y-P30 to Syndecan 2/3 Regulates the Nuclear Localization of CASK
Landgraf, Peter; Mikhaylova, Marina; Macharadze, Tamar; Borutzki, Corinna; Zenclussen, Ana-Claudia; Wahle, Petra; Kreutz, Michael R.
2014-01-01
The survival promoting peptide Y-P30 has documented neuroprotective effects as well as cell survival and neurite outgrowth promoting activity in vitro and in vivo. Previous work has shown that multimerization of the peptide with pleiotrophin (PTN) and subsequent binding to syndecan (SDC) -2 and -3 is involved in its neuritogenic effects. In this study we show that Y-P30 application regulates the nuclear localization of the SDC binding partner Calcium/calmodulin-dependent serine kinase (CASK) in neuronal primary cultures during development. In early development at day in vitro (DIV) 8 when mainly SDC-3 is expressed supplementation of the culture medium with Y-P30 reduces nuclear CASK levels whereas it has the opposite effect at DIV 18 when SDC-2 is the dominant isoform. In the nucleus CASK regulates gene expression via its association with the T-box transcription factor T-brain-1 (Tbr-1) and we indeed found that gene expression of downstream targets of this complex, like the GluN2B NMDA-receptor, exhibits a corresponding down- or up-regulation at the mRNA level. The differential effect of Y-P30 on the nuclear localization of CASK correlates with its ability to induce shedding of the ectodomain of SDC-2 but not -3. shRNA knockdown of SDC-2 at DIV 18 and SDC-3 at DIV 8 completely abolished the effect of Y-P30 supplementation on nuclear CASK levels. During early development a protein knockdown of SDC-3 also attenuated the effect of Y-P30 on axon outgrowth. Taken together these data suggest that Y-P30 can control the nuclear localization of CASK in a SDC-dependent manner. PMID:24498267
Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.
Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P
2011-09-26
HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.
Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation
2011-01-01
Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362
Scholtysek, Carina; Krukiewicz, Aleksandra A; Alonso, José-Luis; Sharma, Karan P; Sharma, Pal C; Goldmann, Wolfgang H
2009-02-13
Saw Palmetto Berry Extract (SPBE) is applied for prostate health and treatment of urinary tract infections, nonbacterial prostitis and Benign Prostatic Hyperplasia (BPH) in man. An assumption is that SPBE affects tumor cell progression and migration in breast and prostate tissue. In this work, DU-145 cells were used to demonstrate that SPBE and its sterol components, beta-sitosterol and stigmasterol, inhibit prostate cancer growth by increasing p53 protein expression and also inhibit carcinoma development by decreasing p21 and p27 protein expression. In the presence of cholesterol, these features are not only reversed but increased significantly. The results show for the first time the potential of SPBE, beta-sitosterol and stigmasterol as potential anti-tumor agents. Since the protein p53 is also regarded as nuclear matrix protein facilitating actin cytoskeletal binding, 2D tractions were measured. The cell adhesion strength in the presence of SPBE, beta-sitosterol and cholesterol and the observation was that the increase in p53 expression triggered an increase in the intracellular force generation. The results suggest a dual function of p53 in cells.
10 CFR 74.53 - Process monitoring.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 10 Energy 2 2013-01-01 2013-01-01 false Process monitoring. 74.53 Section 74.53 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) MATERIAL CONTROL AND ACCOUNTING OF SPECIAL NUCLEAR MATERIAL Formula Quantities of Strategic Special Nuclear Material § 74.53 Process monitoring. (a) Licensees subject to § 74.51...
10 CFR 74.53 - Process monitoring.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 10 Energy 2 2011-01-01 2011-01-01 false Process monitoring. 74.53 Section 74.53 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) MATERIAL CONTROL AND ACCOUNTING OF SPECIAL NUCLEAR MATERIAL Formula Quantities of Strategic Special Nuclear Material § 74.53 Process monitoring. (a) Licensees subject to § 74.51...
10 CFR 74.53 - Process monitoring.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 10 Energy 2 2012-01-01 2012-01-01 false Process monitoring. 74.53 Section 74.53 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) MATERIAL CONTROL AND ACCOUNTING OF SPECIAL NUCLEAR MATERIAL Formula Quantities of Strategic Special Nuclear Material § 74.53 Process monitoring. (a) Licensees subject to § 74.51...
10 CFR 74.53 - Process monitoring.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 2 2014-01-01 2014-01-01 false Process monitoring. 74.53 Section 74.53 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) MATERIAL CONTROL AND ACCOUNTING OF SPECIAL NUCLEAR MATERIAL Formula Quantities of Strategic Special Nuclear Material § 74.53 Process monitoring. (a) Licensees subject to § 74.51...
Zhuang, Chunlin; Miao, Zhenyuan; Wu, Yuelin; Guo, Zizhao; Li, Jin; Yao, Jianzhong; Xing, Chengguo; Sheng, Chunquan; Zhang, Wannian
2014-02-13
Simultaneous inactivation of p53 and hyperactivation of nuclear factor-κB (NF-κB) is a common occurrence in human cancer. Currently, antitumor agents are being designed to selectively activate p53 or inhibit NF-κB. However, there is no concerted effort yet to deliberately design inhibitors that can simultaneously do both. This paper provided a proof-of-concept study that p53-MDM2 interaction and NF-κB pathway can be simultaneously targeted by a small-molecule inhibitor. A series of pyrrolo[3,4-c]pyrazole derivatives were rationally designed and synthesized as the first-in-class inhibitors of p53-MDM2 interaction and NF-κB pathway. Most of the compounds were identified to possess nanomolar p53-MDM2 inhibitory activity. Compounds 5q and 5s suppressed NF-κB activation through inhibition of IκBα phosphorylation and elevation of the cytoplasmic levels of p65 and phosphorylated IKKα/β. Biochemical assay for the kinases also supported the fact that pyrrolo[3,4-c]pyrazole compounds directly targeted the NF-κB pathway. In addition, four compounds (5j, 5q, 5s, and 5u) effectively inhibited tumor growth in the A549 xenograft model. Further pharmacokinetic study revealed that compound 5q exhibited excellent oral bioavailability (72.9%).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Finlay, C.A.; Hinds, P.W.; Tan, T.H.
1988-02-01
The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less
Sonntag, Eric; Milbradt, Jens; Svrlanska, Adriana; Strojan, Hanife; Häge, Sigrun; Kraut, Alexandra; Hesse, Anne-Marie; Amin, Bushra; Sonnewald, Uwe; Couté, Yohann; Marschall, Manfred
2017-10-01
Nuclear egress of herpesvirus capsids is mediated by a multi-component nuclear egress complex (NEC) assembled by a heterodimer of two essential viral core egress proteins. In the case of human cytomegalovirus (HCMV), this core NEC is defined by the interaction between the membrane-anchored pUL50 and its nuclear cofactor, pUL53. NEC protein phosphorylation is considered to be an important regulatory step, so this study focused on the respective role of viral and cellular protein kinases. Multiply phosphorylated pUL50 varieties were detected by Western blot and Phos-tag analyses as resulting from both viral and cellular kinase activities. In vitro kinase analyses demonstrated that pUL50 is a substrate of both PKCα and CDK1, while pUL53 can also be moderately phosphorylated by CDK1. The use of kinase inhibitors further illustrated the importance of distinct kinases for core NEC phosphorylation. Importantly, mass spectrometry-based proteomic analyses identified five major and nine minor sites of pUL50 phosphorylation. The functional relevance of core NEC phosphorylation was confirmed by various experimental settings, including kinase knock-down/knock-out and confocal imaging, in which it was found that (i) HCMV core NEC proteins are not phosphorylated solely by viral pUL97, but also by cellular kinases; (ii) both PKC and CDK1 phosphorylation are detectable for pUL50; (iii) no impact of PKC phosphorylation on NEC functionality has been identified so far; (iv) nonetheless, CDK1-specific phosphorylation appears to be required for functional core NEC interaction. In summary, our findings provide the first evidence that the HCMV core NEC is phosphorylated by cellular kinases, and that the complex pattern of NEC phosphorylation has functional relevance.
Lin, Hung-Yun; Hsieh, Meng-Ti; Cheng, Guei-Yun; Lai, Hsuan-Yu; Chin, Yu-Tang; Shih, Ya-Jung; Nana, André Wendindondé; Lin, Shin-Ying; Yang, Yu-Chen S H; Tang, Heng-Yuan; Chiang, I-Jen; Wang, Kuan
2017-09-01
Nonpeptide hormones, such as thyroid hormone, dihydrotestosterone, and estrogen, have been shown to stimulate cancer proliferation via different mechanisms. Aside from their cytosolic or membrane-bound receptors, there are receptors on integrin α v β 3 for nonpeptide hormones. Interaction between hormones and integrin α v β 3 can induce signal transduction and eventually stimulate cancer cell proliferation. Resveratrol induces inducible COX-2-dependent antiproliferation via integrin α v β 3 . Resveratrol and hormone-induced signals are both transduced by activated extracellular-regulated kinases 1 and 2 (ERK1/2); however, hormones promote cell proliferation, while resveratrol induces antiproliferation in cancer cells. Hormones inhibit resveratrol-stimulated phosphorylation of p53 on Ser15, resveratrol-induced nuclear COX-2 accumulation, and formation of p53-COX-2 nuclear complexes. Subsequently, hormones impair resveratrol-induced COX-2-/p53-dependent gene expression. The inhibitory effects of hormones on resveratrol action can be blocked by different antagonists of specific nonpeptide hormone receptors but not integrin α v β 3 blockers. Results suggest that nonpeptide hormones inhibit resveratrol-induced antiproliferation in cancer cells downstream of the interaction between ligand and receptor and ERK1/2 activation to interfere with nuclear COX-2 accumulation. Thus, the surface receptor sites for resveratrol and nonpeptide hormones are distinct and can induce discrete ERK1/2-dependent downstream antiproliferation biological activities. It also indicates the complex pathways by which antiproliferation is induced by resveratrol in various physiological hormonal environments. . © 2017 New York Academy of Sciences.
Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.
2011-01-01
The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641
Pratheeshkumar, Poyil; Kuttan, Girija
2011-07-01
In this study, we investigated the effect of vernolide-A on the induction of apoptosis as well as its regulatory effect on the activation of transcription factors in B16F-10 melanoma cells. Treatment of B16F-10 cells with nontoxic concentrations of vernolide-A showed the presence of apoptotic bodies and induced DNA fragmentation in a dose-dependent manner. Cell-cycle analysis and TUNEL assays also confirmed the observation. The proapoptotic genes, p53, Bax, caspase-9, and caspase-3, were upregulated in vernolide-A-treated cells, whereas the antiapoptotic gene, Bcl-2, was downregulated. vernolide-A treatment also showed a downregulation of cyclin D1 expression and upregulated p21 and p27 gene expression in B16F-10 melanoma cells. The study also reveals that vernolide-A treatment could alter the production and expression of proinflammatory cytokines and could inhibit the activation and nuclear translocation of p65, p50, and c-Rel subunits of nuclear factor-κB and other transcription factors, such as c-fos, activated transcription factor-2, and cyclic adenosine monophosphate response-element-binding protein in B16F-10 melanoma cells. These results suggest that vernolide-A induces apoptosis via activation of p53-induced, caspase-3-mediated proapoptotic signaling and suppression of NF-κB-induced, bcl-2-mediated survival signaling.
Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W
2015-08-21
Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.
Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.
2015-01-01
Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280
Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya
2016-12-01
Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright © 2016 Elsevier Inc. All rights reserved.
2013-08-01
The views, opinions and/or findings contained in this report are those of the author( s ) and should not be construed as an official Department of...on p53. To assess whether BRCA1 nuclear export following IR in prostate cancer cells is also p53 dependent, we next performed the above experiments...Task 1B. Previous reports suggest that IR-induced BRCA1 export is also dependent on CRM1. To test this hypothesis, we proposed that the CRM1
Kuo, Chun-Ting; Chang, Chieh; Lee, Wen-Sen
2015-01-01
To investigate the molecular mechanism underlying folic acid (FA)-induced anti-colon caner activity, we showed that FA caused G0/G1 arrest in COLO-205. FA activated the proto-oncogene tyrosine-protein kinase Src (c-SRC)-mediated signaling pathway to enhance nuclear factor of kappa light polypeptide gene enhancer in B-cells (NFκB) nuclear translocation and binding onto the tumor protein p53 (TP53) gene promoter, and up-regulated expressions of TP53, cyclin-dependent kinase inhibitor 1A (CDKN1A) and cyclin-dependent kinase inhibitor 1B (CDKN1B). Knock-down of TP53 abolished FA-induced increases in the levels of CDKN1A and CDKN1B protein and G0/G1 arrest in COLO-205. Knock-down of folate receptor alpha (FRα) abolished FA-induced activations in the c-SRC-mediated pathway and increases in the levels of CDKN1A, CDKN1B and TP53 protein. These data suggest that FA inhibited COLO-205 proliferation through activating the FRα/c-SRC/mitogen-activated protein kinase 3/1 (ERK1/2)/NFκB/TP53 pathway-mediated up-regulations of CDKN1A and CDKN1B protein. In vivo studies demonstrated that daily i.p. injections of FA led to profound regression of the COLO-205 tumors and prolong the lifespan. In these tumors, the levels of CDKN1A, CDKN1B and TP53 protein were increased and von willebrand factor (VWF) protein levels were decreased. These findings suggest that FA inhibits COLO-205 colon cancer growth through anti-cancer cell proliferation and anti-angiogenesis. PMID:26056802
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Ronghai; Zhang, Ping, E-mail: zpskx001@163.com; Li, Jinhang
The hypoxia-inducible factor (HIF) is recognized as the master regulator of hypoxia response. HIF-α subunits expression are tightly regulated. In this study, our data show that ts20 cells still expressed detectable E1 protein even at 39.5° C for 12 h, and complete depletion of E1 protein expression at 39.5° C by siRNA enhanced HIF-1α and P53 protein expression. Further inhibition of E1 at 39.5 °C by siRNA, or E1 inhibitor Ube1-41 completely blocked HIF-1α degradation. Moreover, immunoprecipitations of co-transfection of HA-ubiquitin and FLAG–HIF–1α plasmids directly confirmed the involvement of ubiquitin in the hypoxic degradation of HIF-1α. Additionally, hypoxic HIF-1 α degradation is independent ofmore » HAF, RACK1, sumoylation or nuclear/cytoplasmic localization. Taken together, our data suggest that constitutive HIF-1α protein degradation in hypoxia is absolutely ubiquitination-dependent, and unidentified E3 ligase may exist for this degradation pathway. - Highlights: • HIF-1α protein is constitutively degraded in hypoxic conditions. • Requirement of ubiquitination for HIF-1α degradation in hypoxia. • Hypoxic HIF-1α degradation is independent of HAF, RACK1, sumoylation or nuclear/cytoplasmic localization.« less
Neoplasia of the ampulla of Vater. Ki-ras and p53 mutations.
Scarpa, A.; Capelli, P.; Zamboni, G.; Oda, T.; Mukai, K.; Bonetti, F.; Martignoni, G.; Iacono, C.; Serio, G.; Hirohashi, S.
1993-01-01
Eleven tumors of the ampulla of Vater (5 stage IV and 2 stage II adenocarcinomas, 1 stage II papillary carcinoma, 1 neuroendocrine carcinoma, and 2 adenomas, one with foci of carcinoma) were examined for Ki-ras and p53 gene mutations by single-strand conformation polymorphism analysis and direct sequencing of polymerase chain reaction-amplified DNA fragments. Ki-ras mutations were found in one adenocarcinoma and in the adenoma with foci of carcinoma, both involving mainly the intraduodenal bile duct component of the ampulla. Seven cases showed p53 gene mutations: four advanced-stage adenocarcinomas, the papillary carcinoma, the neuroendocrine carcinoma, and the adenoma with foci of carcinoma. Nuclear accumulation of p53 protein was immunohistochemically detected in the morphologically high-grade areas of the five cancers harboring a p53 gene missense point mutation. The adenomas, the two frame shift-mutated cancers, and the adenomatous and low-grade cancer areas of mutated carcinomas were immunohistochemically negative. Our data suggest that in ampullary neoplasia 1) p53 mutations are common abnormalities associated with the transformation of adenomas and low-grade cancers into morphologically high-grade carcinomas, and 2) Ki-ras mutations are relatively less frequent and might be restricted to tumors originating from the bile duct component of the ampulla. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8475992
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
MDM2 controls NRF2 antioxidant activity in prevention of diabetic kidney disease.
Guo, Weiying; Tian, Dan; Jia, Ye; Huang, Wenlin; Jiang, Mengnan; Wang, Junnan; Sun, Weixia; Wu, Hao
2018-04-26
Oxidative stress and P53 contribute to the pathogenesis of diabetic kidney disease (DKD). Nuclear factor erythroid 2-related factor 2 (NRF2) is a master regulator of cellular antioxidant defense system, is negatively regulated by P53 and prevents DKD. Recent findings revealed an important role of mouse double minute 2 (MDM2) in protection against DKD. However, the mechanism remained unclear. We hypothesized that MDM2 enhances NRF2 antioxidant signaling in DKD given that MDM2 is a key negative regulator of P53. The MDM2 inhibitor nutlin3a elevated renal P53, inhibited NRF2 signaling and induced oxidative stress, inflammation, fibrosis, DKD-like renal pathology and albuminuria in the wild-type (WT) non-diabetic mice. These effects exhibited more prominently in nutlin3a-treated WT diabetic mice. Interestingly, nutlin3a failed to induce greater renal injuries in the Nrf2 knockout (KO) mice under both the diabetic and non-diabetic conditions, indicating that NRF2 predominantly mediates MDM2's action. On the contrary, P53 inhibition by pifithrin-α activated renal NRF2 signaling and the expression of Mdm2, and attenuated DKD in the WT diabetic mice, but not in the Nrf2 KO diabetic mice. In high glucose-treated mouse mesangial cells, P53 gene silencing completely abolished nutlin3a's inhibitory effect on NRF2 signaling. The present study demonstrates for the first time that MDM2 controls renal NRF2 antioxidant activity in DKD via inhibition of P53, providing MDM2 activation and P53 inhibition as novel strategies in the management of DKD. Copyright © 2018 Elsevier B.V. All rights reserved.
Kumar, Ajay; Corey, Catherine; Scott, Iain; Shiva, Sruti; D'Cunha, Jonathan
2016-01-01
Minnelide/Triptolide (TL) has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC). However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS). Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2), along with diminished cellular glutathione (GSH) content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC). TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y), restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pasdeloup, David; Poisson, Nicolas; Raux, Helene
2005-04-10
Rabies virus P protein is a co-factor of the viral RNA polymerase. It has been shown previously that P mRNA directs the synthesis of four N-terminally truncated P products P2, P3, P4, and P5 due to translational initiation by a leaky scanning mechanism at internal Met codons. Whereas P and P2 are located in the cytoplasm, P3, P4, and P5 are found in the nucleus. Here, we have analyzed the molecular basis of the subcellular localization of these proteins. Using deletion mutants fused to GFP protein, we show the presence of a nuclear localization signal (NLS) in the C-terminal partmore » of P (172-297). This domain contains a short lysine-rich stretch ({sup 211}KKYK{sup 214}) located in close proximity with arginine 260 as revealed by the crystal structure of P. We demonstrate the critical role of lysine 214 and arginine 260 in NLS activity. In the presence of Leptomycin B, P is retained in the nucleus indicating that it contains a CRM1-dependent nuclear export signal (NES). The subcellular distribution of P deletion mutants indicates that the domain responsible for export is the amino-terminal part of the protein. The use of fusion proteins that have amino terminal fragments of P fused to {beta}-galactosidase containing the NLS of SV40 T antigen allows us to identify a NES between residues 49 and 58. The localization of NLS and NES determines the cellular distribution of the P gene products.« less
Rusinova, G G; Vyazovskaya, N S; Azizova, T V; Revina, V S; Glazkova, I V; Generozov, E V; Zakharzhevskaya, N B; Guryanov, M Yu; Belosokhov, M V; Osovets, S V
2015-01-01
to assess mutational events in exons 5, 7, and 8 of the p53 gene and to reveal mutant p53 protein in verified cases of morphologically altered (proliferative and precancerous changes, lung cancer) and histologically unaltered, lung tissues in workers exposed to occupational radiation. The investigation used formalin-fixed paraffin-embedded unaltered and altered lung tissue blocks (FFPBs) obtained from the human radiobiological tissue repository. The shelf-life of FFPBs was 5-31 years. An immunohistochemical technique using mouse antibodies against p53 protein (
Tanase, Anna-Maria; Marchio, Agnès; Dumitrascu, Traian; Dima, Simona; Herlea, Vlad; Oprisan, Gabriela; Dejean, Anne; Popescu, Irinel; Pineau, Pascal
2015-05-01
Genomic analysis of hepatocellular carcinoma (HCC) has been shown to provide clues about local risk factors. In the last decades, the mortality from malignant liver tumors increased sharply in Romania, where both hepatitis viruses and environmental pollutants are known to be highly prevalent. To date, HCC from this country has not been subject to molecular characterization. We analyzed a series of 48 consecutive HCC cases. Point mutations were searched in 9 nuclear genes and the mitochondrial D-loop. Oxidative stress response was monitored through measurement of gene expression (NRF2, KEAP1, SRXN1, and CES1) by qRT-PCR. An atypical mutation spectrum was observed, as more than 40% of DNA changes were oxidative stress-associated T>C or T>G lesions (T>S). These mutations affected primarily genes encoding for β-catenin and NRF2 (P<0.0001). Besides, tumors from patients born in Greater Bucharest carried TP53 mutations more frequently than others (45 vs 10%, P=0.02). Finally, a R249S mutation of TP53, well-known hallmark of aflatoxin B1 exposure, was found. Our findings indicate, therefore, that distinct mutagenic processes affect Romanian patients with HCC. Further analyses are now warranted in order to identify causal lifestyle or environmental factors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohsaki, Eriko; Ueda, Keiji, E-mail: kueda@virus.me
The Kaposi's sarcoma-associated herpesvirus (KSHV) genome is stably maintained in KSHV-infected PEL cell lines during cell division. We previously showed that accumulation of LANA in the nuclear matrix fraction could be important for the latent DNA replication, and that the functional significance of LANA should be its recruitment of ori-P to the nuclear matrix. Here, we investigated whether the forced localization of the LANA-DNA binding domain (DBD) to the nuclear matrix facilitated ori-P-containing plasmid replication. We demonstrated that chimeric proteins constructed by fusion of LANA DBD with the nuclear mitotic apparatus protein (NuMA), which is one of the components ofmore » the nuclear matrix, could bind with ori-P and enhance replication of an ori-P-containing plasmid, compared with that in the presence of DBD alone. These results further suggested that the ori-P recruitment to the nuclear matrix through the binding with DBD is important for latent viral DNA replication. - Highlights: •KSHV replication in latency depends on LANA localization to the nuclear matrix. •LANA DBD was fused with NuMA, a nuclear matrix protein, at the N- and C-terminus. •NuMA-DBD was in the nuclear matrix and supported the ori-P dependent replication. •LANA in the nuclear matrix should be important for the KSHV replication in latency.« less
Role of Nuclear Matrix in Estrogen Regulated Gene Expression in Human Breast Cancer Cells
1998-08-01
reticular pattern evenly distributed throughout the nucleus, excluding the nucleolus (Figure 4A). This is not so for T47D cells where a composite pattern...acetylation is required to maintain the unfolded nucleosome structure associated with transcribing DNA. Journal of Biological Chemistry 273:14516...nuclear matrix include ER, YY1, AML-1, Spl, Oct1, mutant p53, and Rb [25,28,31,34-40]. Appendix A, part 4 reviews alterations in nuclear matrix composition
Mutant p53 dictates the oncogenic activity of c-Abl in triple-negative breast cancers
Morrison, Chevaun D; Chang, Jenny C; Keri, Ruth A; Schiemann, William P
2017-01-01
We recently established c-Abl as a potent suppressor of triple-negative breast cancer (TNBC) progression through its reactivation of a p53:p21 signaling axis coupled to senescence. Moreover, we observed co-expression of p53 and c-Abl to be essential for normal mammary epithelial cell physiology, as this relationship is lost upon breast cancer progression. Cytoplasmic c-Abl activity is markedly increased in some TNBCs and contributes to disease progression; however, the mechanisms underlying these events remain largely unknown. In addressing this question, we show here that c-Abl is predominantly restricted to the cytoplasm of human MDA-MB-231 TNBC cells, and to the nucleus of human MCF-7 luminal A cells. TTK is a mitotic protein kinase that phosphorylates c-Abl on Thr735, thereby creating a recognition binding motif for 14-3-3 adaptor proteins in response to oxidative stress. By interrogating the METABRIC database, we observed a significant correlation between p53 expression and that of c-Abl and TTK in basal-like breast cancers. Moreover, heterologous expression of TTK in MCF-7 cells significantly stimulated their growth in part via a c-Abl-dependent mechanism. Conversely, depleting TTK expression in MDA-MB-231 cells not only inhibited their organoid growth in 3D-cultures, but also sensitized them to the tumor suppressing activities of c-Abl independent of its subcellular localization. Moreover, we show that mutant p53 forms cytoplasmic complexes with c-Abl, thereby dictating the subcellular localization of c-Abl and the sensitivity of MDA-MB-231 cells to Imatinib. In response to nutrient deprivation, c-Abl:p53 complexes readily accumulate in the nucleus, resulting in the hyperactivation of c-Abl and initiation of its anti-tumor activities. Collectively, we identified a novel mutant p53:c-Abl cytoplasmic signaling complex that promotes MDA-MB-231 cell growth and highlights the contextual cues that confer oncogenic activity to c-Abl in breast cancer. PMID:28661474
Alvisi, Gualtiero; Ripalti, Alessandro; Ngankeu, Apollinaire; Giannandrea, Maila; Caraffi, Stefano G; Dias, Manisha M; Jans, David A
2006-10-01
The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 (ppUL44), is essential for viral replication. The C-terminal residues (amino acids 1220-1242) of pUL54 have been reported to be sufficient for ppUL44 binding in vitro. Although believed to be important for functioning in the nuclei of infected cells, no data are available on either the interaction of pUL54 with ppUL44 in living mammalian cells or the mechanism of pUL54 nuclear transport and its relationship with that of ppUL44. The present study examines for the first time the nuclear import pathway of pUL54 and its interaction with ppUL44 using dual color, quantitative confocal laser scanning microscopy on live transfected cells and quantitative gel mobility shift assays. We showed that of two nuclear localization signals (NLSs) located at amino acids 1153-1159 (NLSA) and 1222-1227 (NLSB), NLSA is sufficient to confer nuclear localization on green fluorescent protein (GFP) by mediating interaction with importin alpha/beta. We also showed that pUL54 residues 1213-1242 are sufficient to confer ppUL44 binding abilities on GFP and that pUL54 and ppUL44 can be transported to the nucleus as a complex. Our work thus identified distinct sites within the HCMV DNA polymerase, which represent potential therapeutic targets and establishes the molecular basis of UL54 nuclear import.
Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki
2013-12-01
p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.
Thomasova, Dana; Mulay, Shrikant R; Bruns, Hauke; Anders, Hans-Joachim
2012-01-01
Murine double minute-2 (MDM2) is an intracellular molecule with multiple biologic functions. It serves as a negative regulator of p53 and thereby limits cell cycle arrest and apoptosis. Because MDM2 blockade suppresses tumor cell growth in vitro and in vivo, respective MDM2 inhibition is currently evaluated as anti-cancer therapy in clinical trials. However, the anti-proliferative effects of MDM2 inhibition also impair regenerative cell growth upon tissue injury. This was so far documented for tubular repair upon postischemic acute kidney injury and might apply to wound healing responses in general. Furthermore, MDM2 has numerous p53-independent effects. As a new entry, MDM2 was identified to act as a co-transcription factor for nuclear factor-kappa-light-enhancer of activated B cells (NF-κB) at cytokine promoters. This explains the potent anti-inflammatory effects of MDM2 inhibitors in vitro and in vivo. For example, the NF-κB-antagonistic and p53-agonistic activities of MDM2 inhibitors elicit potent therapeutic effects on experimental lymphoproliferative autoimmune disorders such as systemic lupus erythematosus. In this review, we discuss the classic p53-dependent, the recently discovered p53-independent, and the NF-κB-agonistic biologic functions of MDM2. We describe its complex regulatory role on p53 and NF-κB signaling and name areas of research that may help to foresee previously unexpected effects or potential alternative indications of therapeutic MDM2 blockade. PMID:23308042
Diao, Jianxin; Li, Haiye; Huang, Wei; Ma, Wenxiao; Dai, Huan; Liu, Yawei; Wang, Ming; Hua, He Yu; Ou, Jinying; Sun, Xiaomin; Sun, Xuegang; Yang, Yungao
2017-01-01
Background & Aims: San huang yin chi decoction(SHYCD) is derived from the yin chen hao decoction, a well-known and canonical Chinese medicine formula from the “Treatise on Febrile Diseases”. Over the past decade, SHYCD has been used to treat and prevent the liver cirrhosis and liver failure. In the present study, we investigated the effects of SHYCD for acute on chronic liver failure(ACLF) and explored its potential mechanism. an ACLF rat model, which induced by carbon tetrachloride (CCl4) combined with D-galactosamine (D-GalN) and lipopolysaccharide(LPS), was used and confirmed by B-ultrasound analysis. Rats were randomly divided into control group, model group, SHYCD-H group, SHYCD-M group, SHYCD-L group, AGNHW group. Compared with the ACLF model group, High, medium, and low doses of SHYCD reduced ALT, AST, TBIL, NH3, IL-1β, IL-6, and TNFα expression levels in the serum, Shorten PT and INR time,and increased Fbg content in the whole blood, increased survival rate of the rats, improved liver pathological changes. APE1 / Ref-1 was mainly expressed in the nucleus, but the nucleus and cytoplasm were co-expressed after hepatocyte injury. SHYCD significantly downregulated APE1/Ref-1 expression in the cytoplasm. Increased APE1/Ref-1, Bcl-2, reduced p53, caspase-3, Bax, and Cyt-c in the total protein. Base on the results, we conclused that High, medium, and low doses of SHYCD could be applied in prevention and treatment of ACLF, and dose-dependent. The possible mechanism is to promote the APE1 / Ref-1 from the cytoplasm to the nuclear transfer, regulation of p53 apoptosis signal pathway prevention and treatment of ACLF. PMID:29156683
FOXM1 in sarcoma: role in cell cycle, pluripotency genes and stem cell pathways
Kelleher, Fergal C.; O'sullivan, Hazel
2016-01-01
FOXM1 is a pro-proliferative transcription factor that promotes cell cycle progression at the G1-S, and G2-M transitions. It is activated by phosphorylation usually mediated by successive cyclin – cyclin dependent kinase complexes, and is highly expressed in sarcoma. p53 down regulates FOXM1 and FOXM1 inhibition is also partly dependent on Rb and p21. Abnormalities of p53 or Rb are frequent in sporadic sarcomas with bone or soft tissue sarcoma, accounting for 36% of index cancers in the high penetrance TP53 germline disorder, Li-Fraumeni syndrome. FOXM1 stimulates transcription of pluripotency related genes including SOX2, KLF4, OCT4, and NANOG many of which are important in sarcoma, a disorder of mesenchymal stem cell/ partially committed progenitor cells. In a selected specific, SOX2 is uniformly expressed in synovial sarcoma. Embryonic pathways preferentially used in stem cell such as Hippo, Hedgehog, and Wnt dominate in FOXM1 stoichiometry to alter rates of FOXM1 production or degradation. In undifferentiated pleomorphic sarcoma, liposarcoma, and fibrosarcoma, dysregulation of the Hippo pathway increases expression of the effector co-transcriptional activator Yes-Associated Protein (YAP). A complex involving YAP and the transcription factor TEAD elevates FOXM1 in these sarcoma subtypes. In another scenario 80% of desmoid tumors have nuclear localization of β-catenin, the Wnt pathway effector molecule. Thiazole antibiotics inhibit FOXM1 and because they have an auto-regulator loop FOXM1 expression is also inhibited. Current systemic treatment of sarcoma is of limited efficacy and inhibiting FOXM1 represents a potential new strategy. PMID:27074562
Balasundaram, David; Benedik, Michael J.; Morphew, Mary; Dang, Van-Dinh; Levin, Henry L.
1999-01-01
The long terminal repeat (LTR)-containing retrotransposon Tf1 propagates within the fission yeast Schizosaccharomyces pombe as the result of several mechanisms that are typical of both retrotransposons and retroviruses. To identify host factors that contribute to the transposition process, we mutagenized cultures of S. pombe and screened them for strains that were unable to support Tf1 transposition. One such strain contained a mutation in a gene we named nup124. The product of this gene contains 11 FXFG repeats and is a component of the nuclear pore complex. In addition to the reduced levels of Tf1 transposition, the nup124-1 allele caused a significant reduction in the nuclear localization of Tf1 Gag. Surprisingly, the mutation in nup124-1 did not cause any reduction in the growth rate, the nuclear localization of specific nuclear localization signal-containing proteins, or the cytoplasmic localization of poly(A) mRNA. A two-hybrid analysis and an in vitro precipitation assay both identified an interaction between Tf1 Gag and the N terminus of Nup124p. These results provide evidence for an unusual mechanism of nuclear import that relies on a direct interaction between a nuclear pore factor and Tf1 Gag. PMID:10409764
Balasundaram, D; Benedik, M J; Morphew, M; Dang, V D; Levin, H L
1999-08-01
The long terminal repeat (LTR)-containing retrotransposon Tf1 propagates within the fission yeast Schizosaccharomyces pombe as the result of several mechanisms that are typical of both retrotransposons and retroviruses. To identify host factors that contribute to the transposition process, we mutagenized cultures of S. pombe and screened them for strains that were unable to support Tf1 transposition. One such strain contained a mutation in a gene we named nup124. The product of this gene contains 11 FXFG repeats and is a component of the nuclear pore complex. In addition to the reduced levels of Tf1 transposition, the nup124-1 allele caused a significant reduction in the nuclear localization of Tf1 Gag. Surprisingly, the mutation in nup124-1 did not cause any reduction in the growth rate, the nuclear localization of specific nuclear localization signal-containing proteins, or the cytoplasmic localization of poly(A) mRNA. A two-hybrid analysis and an in vitro precipitation assay both identified an interaction between Tf1 Gag and the N terminus of Nup124p. These results provide evidence for an unusual mechanism of nuclear import that relies on a direct interaction between a nuclear pore factor and Tf1 Gag.
Tu, Wei; Zhang, Qian; Liu, Yin; Han, Lianyong; Wang, Qin; Chen, Panpan; Zhang, Shun; Wang, Aiguo; Zhou, Xue
2018-05-15
There has been a great concern about the neurotoxicity of fluoride since it can pass through the blood-brain barrier and accumulate in the brain. It has been suggested that apoptosis plays a vital role in neurotoxicity of fluoride. However, whether p53-mediated apoptotic pathway is involved is still unclear. Our results showed that apoptosis was induced after treatment with 40 and 60 mg/L of NaF for 24 h in human neuroblastoma SH-SY5Y cells. Exposure to 60 mg/L of NaF for 24 h significantly upregulated the levels of p53 and apoptosis-related proteins including PUMA, cytochrome c (cyto c), cleaved caspase-3 and cleaved PARP, whereas downregulated Bcl-2 in SH-SY5Y cells. Meanwhile, fluoride increased p53 nuclear translocation, cyto c release from mitochondria to cytoplasm and mitochondrial translocation of Bax in SH-SY5Y cells. Fluoride-induced increases of apoptotic rates and apoptosis-related protein levels were significantly attenuated by inhibiting p53 transcriptional activity with pifithrin-α. In addition, fluoride inhibited the deacetylase activity of SIRT1 and increased p53 (acetyl K382) level in SH-SY5Y cells. Apoptosis and upregulation of cleaved caspase-3, cleaved PARP and p53 (acetyl K382) induced by fluoride could be ameliorated by SIRT1 overexpression or its activator resveratrol in SH-SY5Y cells. Taken together, our study demonstrates that fluoride induces apoptosis by inhibiting the deacetylase activity of SIRT1 to activate mitochondrial p53 pathway in SH-SY5Y cells, which depends on p53 transcriptional activity. Thus, SIRT1 may be a promising target to protect against neurotoxicity induced by fluoride. Copyright © 2018 Elsevier Inc. All rights reserved.
Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena
2016-01-01
Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871
Saporita, Anthony J.; Ai, Junkui; Wang, Zhou
2010-01-01
BACKGROUND Androgen receptor (AR) is the key molecule in androgen-refractory prostate cancer. Despite androgen ablative conditions, AR remains active and is necessary for the growth of androgen-refractory prostate cancer cells. Nuclear localization of AR is a prerequisite for its transcriptional activation. We examined AR localization in androgen-dependent and androgen-refractory prostate cancer cells. METHODS AND RESULTS We demonstrate increased nuclear localization of a GFP-tagged AR in the absence of hormone in androgen-refractory C4-2 cells compared to parental androgen-sensitive human prostate cancer LNCaP cells. Analysis of AR mutants impaired in ligand-binding indicates that the nuclear localization of AR in C4-2 cells is truly androgen-independent. The hsp90 inhibitor, 17-allylamino-17-demethoxygeldanamycin (17-AAG), inhibits basal PSA expression and disrupts the ligand-independent nuclear localization of AR at doses much lower than required to inhibit androgen-induced nuclear import. CONCLUSIONS Hsp90 is a key regulator of ligand-independent nuclear localization and activation of AR in androgen-refractory prostate cancer cells. PMID:17221841
Growth hormone is a cellular senescence target in pituitary and nonpituitary cells
Chesnokova, Vera; Zhou, Cuiqi; Ben-Shlomo, Anat; Zonis, Svetlana; Tani, Yuji; Ren, Song-Guang; Melmed, Shlomo
2013-01-01
Premature proliferative arrest in benign or early-stage tumors induced by oncoproteins, chromosomal instability, or DNA damage is associated with p53/p21 activation, culminating in either senescence or apoptosis, depending on cell context. Growth hormone (GH) elicits direct peripheral metabolic actions as well as growth effects mediated by insulin-like growth factor 1 (IGF1). Locally produced peripheral tissue GH, in contrast to circulating pituitary-derived endocrine GH, has been proposed to be both proapoptotic and prooncogenic. Pituitary adenomas expressing and secreting GH are invariably benign and exhibit DNA damage and a senescent phenotype. We therefore tested effects of nutlin-induced p53-mediated senescence in rat and human pituitary cells. We show that DNA damage senescence induced by nutlin triggers the p53/p21 senescent pathway, with subsequent marked induction of intracellular pituitary GH in vitro. In contrast, GH is not induced in cells devoid of p53. Furthermore we show that p53 binds specific GH promoter motifs and enhances GH transcription and secretion in senescent pituitary adenoma cells and also in nonpituitary (human breast and colon) cells. In vivo, treatment with nutlin results in up-regulation of both p53 and GH in the pituitary gland, as well as increased GH expression in nonpituitary tissues (lung and liver). Intracrine GH acts in pituitary cells as an apoptosis switch for p53-mediated senescence, likely protecting the pituitary adenoma from progression to malignancy. Unlike in the pituitary, in nonpituitary cells GH exerts antiapoptotic properties. Thus, the results show that GH is a direct p53 transcriptional target and fulfills criteria as a p53 target gene. Induced GH is a readily measurable cell marker for p53-mediated cellular senescence. PMID:23940366
Regulation of calcium signals in the nucleus by a nucleoplasmic reticulum
Echevarría, Wihelma; Leite, M. Fatima; Guerra, Mateus T.; Zipfel, Warren R.; Nathanson, Michael H.
2013-01-01
Calcium is a second messenger in virtually all cells and tissues1. Calcium signals in the nucleus have effects on gene transcription and cell growth that are distinct from those of cytosolic calcium signals; however, it is unknown how nuclear calcium signals are regulated. Here we identify a reticular network of nuclear calcium stores that is continuous with the endoplasmic reticulum and the nuclear envelope. This network expresses inositol 1,4,5-trisphosphate (InsP3) receptors, and the nuclear component of InsP3-mediated calcium signals begins in its locality. Stimulation of these receptors with a little InsP3 results in small calcium signals that are initiated in this region of the nucleus. Localized release of calcium in the nucleus causes nuclear protein kinase C (PKC) to translocate to the region of the nuclear envelope, whereas release of calcium in the cytosol induces translocation of cytosolic PKC to the plasma membrane. Our findings show that the nucleus contains a nucleoplasmic reticulum with the capacity to regulate calcium signals in localized subnuclear regions. The presence of such machinery provides a potential mechanism by which calcium can simultaneously regulate many independent processes in the nucleus. PMID:12717445
DOE Office of Scientific and Technical Information (OSTI.GOV)
Komissarova, Elena V.; Rossman, Toby G., E-mail: toby.rossman@nyumc.or
2010-03-15
Arsenite is an environmental pollutant. Exposure to inorganic arsenic in drinking water is associated with elevated cancer risk, especially in skin. Arsenite alone does not cause skin cancer in animals, but arsenite can enhance the carcinogenicity of solar UV. Arsenite is not a significant mutagen at non-toxic concentrations, but it enhances the mutagenicity of other carcinogens. The tumor suppressor protein P53 and nuclear enzyme PARP-1 are both key players in DNA damage response. This laboratory demonstrated earlier that in cells treated with arsenite, the P53-dependent increase in p21{sup WAF1/CIP1} expression, normally a block to cell cycle progression after DNA damage,more » is deficient. Here we show that although long-term exposure of human keratinocytes (HaCaT) to a nontoxic concentration (0.1 muM) of arsenite decreases the level of global protein poly(ADP-ribosyl)ation, it increases poly(ADP-ribosyl)ation of P53 protein and PARP-1 protein abundance. We also demonstrate that exposure to 0.1 muM arsenite depresses the constitutive expression of p21 mRNA and P21 protein in HaCaT cells. Poly(ADP-ribosyl)ation of P53 is reported to block its activation, DNA binding and its functioning as a transcription factor. Our results suggest that arsenite's interference with activation of P53 via poly(ADP-ribosyl)ation may play a role in the comutagenic and cocarcinogenic effects of arsenite.« less
McGowan, Eileen M.; Tran, Nham; Alling, Nikki; Yagoub, Daniel; Sedger, Lisa M.; Martiniello-Wilks, Rosetta
2012-01-01
As part of a cell’s inherent protection against carcinogenesis, p14ARF is upregulated in response to hyperproliferative signalling to induce cell cycle arrest. This property makes p14ARF a leading candidate for cancer therapy. This study explores the consequences of reactivating p14ARF in breast cancer and the potential of targeting p14ARF in breast cancer treatment. Our results show that activation of the p14ARF-p53-p21-Rb pathway in the estrogen sensitive MCF-7 breast cancer cells induces many hallmarks of senescence including a large flat cell morphology, multinucleation, senescence-associated-β-gal staining, and rapid G1 and G2/M phase cell cycle arrest. P14ARF also induces the expression of the proto-oncogene cyclin D1, which is most often associated with a transition from G1-S phase and is highly expressed in breast cancers with poor clinical prognosis. In this study, siRNA knockdown of cyclin D1, p21 and p53 show p21 plays a pivotal role in the maintenance of high cyclin D1 expression, cell cycle and growth arrest post-p14ARF induction. High p53 and p14ARF expression and low p21/cyclin D1 did not cause cell-cycle arrest. Knockdown of cyclin D1 stops proliferation but does not reverse senescence-associated cell growth. Furthermore, cyclin D1 accumulation in the nucleus post-p14ARF activation correlated with a rapid loss of nucleolar Ki-67 protein and inhibition of DNA synthesis. Latent effects of the p14ARF-induced cellular processes resulting from high nuclear cyclin D1 accumulation included a redistribution of Ki-67 into the nucleoli, aberrant nuclear growth (multinucleation), and cell proliferation. Lastly, downregulation of cyclin D1 through inhibition of ER abrogated latent recurrence. The mediation of these latent effects by continuous expression of p14ARF further suggests a novel mechanism whereby dysregulation of cyclin D1 could have a double-edged effect. Our results suggest that p14ARF induced-senescence is related to late-onset breast cancer in estrogen responsive breast cancers and/or the recurrence of more aggressive breast cancer post-therapy. PMID:22860097
Stress-induced interaction between p38 MAPK and HSP70
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gong, Xiaowei, E-mail: gongxw@fimmu.com; Luo, Tingting; Deng, Peng
2012-08-24
Highlights: Black-Right-Pointing-Pointer HSP70 interacts to p38 MAPK in vitro and in vivo. Black-Right-Pointing-Pointer HSP70 co-localizes with p38 MAPK in the nucleus upon stress. Black-Right-Pointing-Pointer HSP70 is involved in the nuclear phosphorylation of MK2 by p38 MAPK. -- Abstract: p38 MAPK, one of the four MAPK subfamilies in mammalian cells, is activated by environmental stresses and pro-inflammatory cytokines, playing fundamental roles in many biological processes. Despite all that is known on the structure and functions of p38, many questions still exist. The coupling of activation and nuclear translocation represents an important aspect of p38 signaling. In our effort in exploring themore » potential chaperone for p38 translocation, we performed an endogenous pull-down assay and identified HSP70 as a potential interacting protein of p38. We confirmed the interaction between p38 and HSP70 in vitro and in vivo, and identified their interaction domains. We also showed stress-induced nuclear co-localization of these two proteins. Our preliminary result indicated that HSP70 was related to the phosphorylation of MK2, a specific nuclear downstream target of p38, suggesting HSP70 is a potential chaperone for the nuclear translocation of p38.« less
Nariai, Y; Mishima, K; Yoshimura, Y; Sekine, J
2011-04-01
This study was designed to investigate the feasibility of using Fas-associated phosphatase-1 (FAP-1), nuclear factor kappa B (NF-κB) and p53 as markers for chemo-radio sensitivity in oral squamous cell carcinoma (OSCC). FAP-1 plays a role as an anti-apoptotic factor through Fas-dependent apoptosis after chemo-radiotherapy. NF-κB and p53 might be involved in modulation of FAP-1 expression. FAP-1, NF-κB and p53 expression were immunohistochemically examined using biopsy specimens in 50 OSCC patients treated with chemotherapy and/or radiotherapy. FAP-1 was expressed in 52%, NF-κB in 52% and p53 in 46% of patients. There was no significant difference in FAP-1, p53 or NF-κB expression according to the clinicopathological features. No correlation was found among FAP-1, p53 or NF-κB expression. FAP-1-positive cases showed a poorer survival rate than FAP-1-negative cases (P = 0.0409) and NF-κB-positive cases showed a poorer survival rate than NF-κB-negative cases (P = 0.0018). Multivariate analysis showed that FAP-1 expression, NF-κB expression, clinical stage and age were significant independent variables for survival (clinical stage: P = 0.0016; age: P = 0.0016; NF-κB: P = 0.0314; FAP-1: P = 0.0366). These results suggest that FAP-1 and NF-κB might play a role as chemo-radioresistant factor during chemo-radiotherapy, and FAP-1 and NF-κB expression in OSCC would be feasible markers for chemo-radio sensitivity and prognosis. Copyright © 2010 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
1985-01-01
SEC53, a gene that is required for completion of assembly of proteins in the endoplasmic reticulum in yeast, has been cloned, sequenced, and the product localized by cell fractionation. Complementation of a sec53 mutation is achieved with unique plasmids from genomic or cDNA expression banks. These inserts contain the authentic gene, a cloned copy of which integrates at the sec53 locus. An open reading frame in the insert predicts a 29-kD protein with no significant hydrophobic character. This prediction is confirmed by detection of a 28-kD protein overproduced in cells that carry SEC53 on a multicopy plasmid. To follow Sec53p more directly, a LacZ-SEC53 gene fusion has been constructed which allows the isolation of a hybrid protein for use in production of antibody. With such an antibody, quantitative immune decoration has shown that the sec53-6 mutation decreases the level of Sec53p at 37 degrees C, while levels comparable to wild-type are seen at 24 degrees C. An eightfold overproduction of Sec53p accompanies transformation of cells with a multicopy plasmid containing SEC53. Cell fractionation, performed with conditions that preserve the lumenal content of the endoplasmic reticulum (ER), shows Sec53p highly enriched in the cytosol fraction. We suggest that Sec53p acts indirectly to facilitate assembly in the ER, possibly by interacting with a stable ER component, or by providing a small molecule, other than an oligosaccharide precursor, necessary for the assembly event. PMID:3905826
York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.
2016-01-01
Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821
York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B
2017-09-01
Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.
Targeting MDM2 for Treatment of Adenoid Cystic Carcinoma
Warner, Kristy A.; Nör, Felipe; Acasigua, Gerson A.; Martins, Manoela D.; Zhang, Zhaocheng; McLean, Scott A.; Spector, Matthew E.; Chepeha, Douglas B.; Helman, Joseph; Wick, Michael J.; Moskaluk, Christopher A.; Castilho, Rogerio M.; Pearson, Alexander T.; Wang, Shaomeng; Nör, Jacques E.
2016-01-01
Purpose There are no effective treatment options for patients with advanced adenoid cystic carcinoma (ACC). Here, we evaluated the effect of a new small molecule inhibitor of the MDM2-p53 interaction (MI-773) in preclinical models of ACC. Experimental Design To evaluate the anti-tumor effect of MI-773, we administered it to mice harboring 3 different patient-derived xenograft (PDX) models of ACC expressing functional p53. The effect of MI-773 on MDM2, p53, phospho-p53 and p21 was examined by Western blots in 5 low passage primary human ACC cell lines and in MI-773-treated PDX tumors. Results Single agent MI-773 caused tumor regression in the 3 PDX models of ACC studied here. For example, we observed a tumor growth inhibition (TGI) index of 127% in UM-PDX-HACC-5 tumors that was associated with an increase in the fraction of apoptotic cells (p=0.015). The number of p53-positive cells was increased in MI-773-treated PDX tumors (p<0.001), with a correspondent shift in p53 localization from the nucleus to the cytoplasm. Western blots demonstrated that MI-773 potently induced expression of p53 and its downstream targets p21, MDM2 and induced phosphorylation of p53 (serine 392) in low passage primary human ACC cells. Notably, MI-773 induced a dose-dependent increase in the fraction of apoptotic ACC cells and in the fraction of cells in the G1 phase of cell cycle (p<0.05). Conclusions Collectively, these data demonstrate that therapeutic inhibition of the MDM2-p53 interaction with MI-773 activates downstream effectors of apoptosis and causes robust tumor regression in preclinical models of adenoid cystic carcinoma. PMID:26936915
Magliocco, Anthony; Zhang, Qiang; Wang, Dian; Klimowicz, Alex; Harris, Jonathan; Simko, Jeff; DeLaney, Thomas; Kraybill, William; Kirsch, David G.
2018-01-01
Background Sarcoma mortality remains high despite adjuvant chemotherapy. Biomarker predictors of treatment response and outcome could improve treatment selection. Methods Tissue microarrays (TMAs) were created using pre- and posttreatment tumor from two prospective trials (MGH pilot and RTOG 9514) of neoadjuvant/adjuvant MAID chemotherapy and preoperative radiation. Biomarkers were measured using automated computerized imaging (AQUA or ACIS). Expression was correlated with disease-free survival (DFS), distant disease-free survival (DDFS), and overall survival (OS). Results Specimens from 60 patients included 23 pretreatment (PRE), 40 posttreatment (POST), and 12 matched pairs (MPs). In the MP set, CAIX, GLUT1, and PARP1 expression significantly decreased following neoadjuvant therapy, but p53 nuclear/cytoplasmic (N/C) ratio increased. In the PRE set, no biomarker expression was associated with DFS, DDFS, or OS. In the POST set, increased p53 N/C ratio was associated with a significantly decreased DFS and DDFS (HR 4.13, p=0.017; HR 4.16, p=0.016), while increased ERCC1 and XPF expression were associated with an improved DFS and DDFS. No POST biomarkers were associated with OS. Conclusions PRE biomarker expression did not predict survival outcomes. Expression pattern changes after neoadjuvant chemoradiation supports the concepts of tumor reoxygenation, altered HIF-1α signaling, and a p53 nuclear accumulation DNA damage response. Clinical Trial Registration NRG Oncology RTOG 9514 is registered with ClinicalTrials.gov. The ClinicalTrials.gov Identifier is NCT00002791. PMID:29681762
The Tumor Suppressor Gene, RASSF1A, Is Essential for Protection against Inflammation -Induced Injury
Fiteih, Yahya; Law, Jennifer; Volodko, Natalia; Mohamed, Anwar; El-Kadi, Ayman O. S.; Liu, Lei; Odenbach, Jeff; Thiesen, Aducio; Onyskiw, Christina; Ghazaleh, Haya Abu; Park, Jikyoung; Lee, Sean Bong; Yu, Victor C.; Fernandez-Patron, Carlos; Alexander, R. Todd; Wine, Eytan; Baksh, Shairaz
2013-01-01
Ras association domain family protein 1A (RASSF1A) is a tumor suppressor gene silenced in cancer. Here we report that RASSF1A is a novel regulator of intestinal inflammation as Rassf1a+/−, Rassf1a−/− and an intestinal epithelial cell specific knockout mouse (Rassf1a IEC-KO) rapidly became sick following dextran sulphate sodium (DSS) administration, a chemical inducer of colitis. Rassf1a knockout mice displayed clinical symptoms of inflammatory bowel disease including: increased intestinal permeability, enhanced cytokine/chemokine production, elevated nuclear factor of kappa light polypeptide gene enhancer in B-cells (NFκB) activity, elevated colonic cell death and epithelial cell injury. Furthermore, epithelial restitution/repair was inhibited in DSS-treated Rassf1a−/− mice with reduction of several makers of proliferation including Yes associated protein (YAP)-driven proliferation. Surprisingly, tyrosine phosphorylation of YAP was detected which coincided with increased nuclear p73 association, Bax-driven epithelial cell death and p53 accumulation resulting in enhanced apoptosis and poor survival of DSS-treated Rassf1a knockout mice. We can inhibit these events and promote the survival of DSS-treated Rassf1a knockout mice with intraperitoneal injection of the c-Abl and c-Abl related protein tyrosine kinase inhibitor, imatinib/gleevec. However, p53 accumulation was not inhibited by imatinib/gleevec in the Rassf1a−/− background which revealed the importance of p53-dependent cell death during intestinal inflammation. These observations suggest that tyrosine phosphorylation of YAP (to drive p73 association and up-regulation of pro-apoptotic genes such as Bax) and accumulation of p53 are consequences of inflammation-induced injury in DSS-treated Rassf1a−/− mice. Mechanistically, we can detect robust associations of RASSF1A with membrane proximal Toll-like receptor (TLR) components to suggest that RASSF1A may function to interfere and restrict TLR-driven activation of NFκB. Failure to restrict NFκB resulted in the inflammation-induced DNA damage driven tyrosine phosphorylation of YAP, subsequent p53 accumulation and loss of intestinal epithelial homeostasis. PMID:24146755
Nakae, Shunsuke; Kato, Takema; Murayama, Kazuhiro; Sasaki, Hikaru; Abe, Masato; Kumon, Masanobu; Kumai, Tadashi; Yamashiro, Kei; Inamasu, Joji; Hasegawa, Mitsuhiro; Kurahashi, Hiroki; Hirose, Yuichi
2017-01-01
Most IDH mutant gliomas harbor either 1p/19q co-deletions or TP53 mutation; 1p/19q co-deleted tumors have significantly better prognoses than tumors harboring TP53 mutations. To investigate the clinical factors that contribute to differences in tumor progression of IDH mutant gliomas, we classified recurrent tumor patterns based on MRI and correlated these patterns with their genomic characterization. Accordingly, in IDH mutant gliomas (N = 66), 1p/19 co-deleted gliomas only recurred locally, whereas TP53 mutant gliomas recurred both locally and in remote intracranial regions. In addition, diffuse tensor imaging suggested that remote intracranial recurrence in the astrocytomas, IDH-mutant with TP53 mutations may occur along major fiber bundles. Remotely recurrent tumors resulted in a higher mortality and significantly harbored an 8q gain; astrocytomas with an 8q gain resulted in significantly shorter overall survival than those without an 8q gain. OncoScan® arrays and next-generation sequencing revealed specific 8q regions (i.e., between 8q22 and 8q24) show a high copy number. In conclusion, only tumors with TP53 mutations showed patterns of remote recurrence in IDH mutant gliomas. Furthermore, an 8q gain was significantly associated with remote intracranial recurrence and can be considered a poor prognostic factor in astrocytomas, IDH-mutant. PMID:29156679
Aravindan, Sheeja; Natarajan, Mohan; Herman, Terence S; Awasthi, Vibhudutta; Aravindan, Natarajan
2013-03-04
Heterogeneously distributed hypoxic areas are a characteristic property of locally advanced breast cancers (BCa) and generally associated with therapeutic resistance, metastases, and poor patient survival. About 50% of locally advanced BCa, where radiotherapy is less effective are suggested to be due to hypoxic regions. In this study, we investigated the potential of bioactive phytochemicals in radio-sensitizing hypoxic BCa cells. Hypoxic (O2-2.5%; N2-92.5%; CO2-5%) MCF-7 cells were exposed to 4 Gy radiation (IR) alone or after pretreatment with Curcumin (CUR), curcumin analog EF24, neem leaf extract (NLE), Genistein (GEN), Resveratrol (RES) or raspberry extract (RSE). The cells were examined for inhibition of NFκB activity, transcriptional modulation of 88 NFκB signaling pathway genes, activation and cellular localization of radio-responsive NFκB related mediators, eNos, Erk1/2, SOD2, Akt1/2/3, p50, p65, pIκBα, TNFα, Birc-1, -2, -5 and associated induction of cell death. EMSA revealed that cells exposed to phytochemicals showed complete suppression of IR-induced NFκB. Relatively, cells exposed EF24 revealed a robust inhibition of IR-induced NFκB. QPCR profiling showed induced expression of 53 NFκB signaling pathway genes after IR. Conversely, 53, 50, 53, 53, 53 and 53 of IR-induced genes were inhibited with EF24, NLE, CUR, GEN, RES and RSE respectively. In addition, 25, 29, 24, 16, 11 and 21 of 35 IR-suppressed genes were further inhibited with EF24, NLE, CUR, GEN, RES and RSE respectively. Immunoblotting revealed a significant attenuating effect of IR-modulated radio-responsive eNos, Erk1/2, SOD2, Akt1/2/3, p50, p65, pIκBα, TNFα, Birc-1, -2 and -5 with EF24, NLE, CUR, GEN, RES or RSE. Annexin V-FITC staining showed a consistent and significant induction of IR-induced cell death with these phytochemicals. Notably, EF24 robustly conferred IR-induced cell death. Together, these data identifies the potential hypoxic cell radio-sensitizers and further implies that the induced radio-sensitization may be exerted by selectively targeting IR-induced NFκB signaling.
Hainan, Lan; Huilin, Liu; Khan, Mahamad; Xin, Zheng; YuJiang, Yang; Hui, Zhang; Naiquan, Yao
2018-06-08
Traditional views suggest that growth hormone and the growth hormone receptor (GH/GHR complex) exert their functions only on the plasma membrane. This paradigm, however, has been challenged by recent new findings that the GH/GHR complex could translocate into cell nuclei where they could still exhibit important physiological functions. We also reported the nuclear localization of porcine GH/GHR and their potential functions in porcine hepatocytes. However, the basic path of pGH/GHR's nuclear translocation remains unclear. Combining previous research results and our current findings, we proposed two basic routes of pGH/GHR's nuclear transportation as follows: 1) after pGH binding to GHR, pGH/GHR enters into the cytoplasm though clathrin- or caveolin-mediated endocytosis, then the pGH/GHR complex enters into early endosomes (Rab5-positive), and the endosome carries the GH/GHR complex to the endoplasmic reticulum (ER). After endosome docking on the ER, the endosome starts fission, and the pGH/GHR complex enters into the ER lumen. Then the pGH/GHR complex transports into the cytoplasm, possibly by the ERAD pathway. Subsequently, the pGH/GHR complex interacts with IMPα/β, which, in turn, mediates GH/GHR nuclear localization; 2) pGH binds with the GHR on the cell membrane and, subsequently, pGH/GHR internalizes into the cell and enters into the endosome (this endosome may belong to a class of endosomes called envelope-associated endosomes (NAE)). Then, the endosome carries the pGH/GHR to the nuclear membrane. After docking on the nuclear membrane, the pGH/GHR complex fuses with the nuclear membrane and then enters into the cell nucleus. Copyright © 2018 Elsevier Inc. All rights reserved.
Hawkins, Charlene
2014-01-01
The Est1 (ever shorter telomeres 1) protein is an essential component of yeast telomerase, a ribonucleoprotein complex that restores the repetitive sequences at chromosome ends (telomeres) that would otherwise be lost during DNA replication. Previous work has shown that the telomerase RNA component (TLC1) transits through the cytoplasm during telomerase biogenesis, but mechanisms of protein import have not been addressed. Here we identify three nuclear localization sequences (NLSs) in Est1p. Mutation of the most N-terminal NLS in the context of full-length Est1p reduces Est1p nuclear localization and causes telomere shortening—phenotypes that are rescued by fusion with the NLS from the simian virus 40 (SV40) large-T antigen. In contrast to that of the TLC1 RNA, Est1p nuclear import is facilitated by Srp1p, the yeast homolog of importin α. The reduction in telomere length observed at the semipermissive temperature in a srp1 mutant strain is rescued by increased Est1p expression, consistent with a defect in Est1p nuclear import. These studies suggest that at least two nuclear import pathways are required to achieve normal telomere length homeostasis in yeast. PMID:24906415
Nuclear actions of insulin-like growth factor binding protein-3.
Baxter, Robert C
2015-09-10
In addition to its actions outside the cell, cellular uptake and nuclear import of insulin-like growth factor binding protein-3 (IGFBP-3) has been recognized for almost two decades, but knowledge of its nuclear actions has been slow to emerge. IGFBP-3 has a functional nuclear localization signal and interacts with the nuclear transport protein importin-β. Within the nucleus IGFBP-3 appears to have a role in transcriptional regulation. It can bind to the nuclear receptor, retinoid X receptor-α and several of its dimerization partners, including retinoic acid receptor, vitamin D receptor (VDR), and peroxisome proliferator-activated receptor-γ (PPARγ). These interactions modulate the functions of these receptors, for example inhibiting VDR-dependent transcription in osteoblasts and PPARγ-dependent transcription in adipocytes. Nuclear IGFBP-3 can be detected by immunohistochemistry in cancer and other tissues, and its presence in the nucleus has been shown in many cell culture studies to be necessary for its pro-apoptotic effect, which may also involve interaction with the nuclear receptor Nur77, and export from the nucleus. IGFBP-3 is p53-inducible and in response to DNA damage, forms a complex with the epidermal growth factor receptor (EGFR), translocating to the nucleus to interact with DNA-dependent protein kinase. Inhibition of EGFR kinase activity or downregulation of IGFBP-3 can inhibit DNA double strand-break repair by nonhomologous end joining. IGFBP-3 thus has the ability to influence many cell functions through its interactions with intranuclear pathways, but the importance of these interactions in vivo, and their potential to be targeted for therapeutic benefit, require further investigation. Copyright © 2015 Elsevier B.V. All rights reserved.
A systematic review of p53 regulation of oxidative stress in skeletal muscle.
Beyfuss, Kaitlyn; Hood, David A
2018-12-01
p53 is a tumor suppressor protein involved in regulating a wide array of signaling pathways. The role of p53 in the cell is determined by the type of imposed oxidative stress, its intensity and duration. The last decade of research has unravelled a dual nature in the function of p53 in mediating the oxidative stress burden. However, this is dependent on the specific properties of the applied stress and thus requires further analysis. A systematic review was performed following an electronic search of Pubmed, Google Scholar, and ScienceDirect databases. Articles published in the English language between January 1, 1990 and March 1, 2017 were identified and isolated based on the analysis of p53 in skeletal muscle in both animal and cell culture models. Literature was categorized according to the modality of imposed oxidative stress including exercise, diet modification, exogenous oxidizing agents, tissue manipulation, irradiation, and hypoxia. With low to moderate levels of oxidative stress, p53 is involved in activating pathways that increase time for cell repair, such as cell cycle arrest and autophagy, to enhance cell survival. However, with greater levels of stress intensity and duration, such as with irradiation, hypoxia, and oxidizing agents, the role of p53 switches to facilitate increased cellular stress levels by initiating DNA fragmentation to induce apoptosis, thereby preventing aberrant cell proliferation. Current evidence confirms that p53 acts as a threshold regulator of cellular homeostasis. Therefore, within each modality, the intensity and duration are parameters of the oxidative stressor that must be analyzed to determine the role p53 plays in regulating signaling pathways to maintain cellular health and function in skeletal muscle. Acadl: acyl-CoA dehydrogenase, long chain; Acadm: acyl-CoA dehydrogenase, C-4 to C-12 straight chain; AIF: apoptosis-inducing factor; Akt: protein kinase B (PKB); AMPK: AMP-activated protein kinase; ATF-4: activating transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p53 apoptosis effector related to PMP-22; PGC-1α: Peroxisome proliferator-activated receptor gamma coactivator 1-alpha; PGM: phosphoglucomutase; PI3K: Phosphatidylinositol-4,5-bisphosphate 3-kinase; PKCβ: protein kinase c beta; PTEN: phosphatase and tensin homolog; PTIO: 2-phenyl-4, 4, 5, 5,-tetramethylimidazoline-1-oxyl 3-oxide (PTIO) has been used as a nitric oxide (NO) scavenger; Puma: The p53 upregulated modulator of apoptosis; PW1: paternally expressed 3 (Peg3); RNS: Reactive nitrogen species; SIRT1: sirtuin 1; SCO2: cytochrome c oxidase assembly protein; SOD2: superoxide dismutase 2; Tfam: transcription factor A mitochondrial; TIGAR: Trp53 induced glycolysis repulatory phosphatase; TNF-a: tumor necrosis factor a; TRAF2: TNF receptor associated factor 2; TRAIL: type II transmembrane protein.
Oksayan, Sibil; Wiltzer, Linda; Rowe, Caitlin L.; Blondel, Danielle; Jans, David A.; Moseley, Gregory W.
2012-01-01
Regulated nucleocytoplasmic transport of proteins is central to cellular function and dysfunction during processes such as viral infection. Active protein trafficking into and out of the nucleus is dependent on the presence within cargo proteins of intrinsic specific modular signals for nuclear import (nuclear localization signals, NLSs) and export (nuclear export signals, NESs). Rabies virus (RabV) phospho (P) protein, which is largely responsible for antagonising the host anti-viral response, is expressed as five isoforms (P1–P5). The subcellular trafficking of these isoforms is thought to depend on a balance between the activities of a dominant N-terminal NES (N-NES) and a distinct C-terminal NLS (C-NLS). Specifically, the N-NES-containing isoforms P1 and P2 are cytoplasmic, whereas the shorter P3–P5 isoforms, which lack the N-NES, are believed to be nuclear through the activity of the C-NLS. Here, we show for the first time that RabV P contains an additional strong NLS in the N-terminal region (N-NLS), which, intriguingly, overlaps with the N-NES. This arrangement represents a novel nuclear trafficking module where the N-NLS is inactive in P1 but becomes activated in P3, concomitant with truncation of the N-NES, to become the principal targeting signal conferring nuclear accumulation. Understanding this unique switch arrangement of overlapping, co-regulated NES/NLS sequences is vital to delineating the critical role of RabV P protein in viral infection. PMID:22700958
Nup53 Is Required for Nuclear Envelope and Nuclear Pore Complex Assembly
Hawryluk-Gara, Lisa A.; Platani, Melpomeni; Santarella, Rachel
2008-01-01
Transport across the nuclear envelope (NE) is mediated by nuclear pore complexes (NPCs). These structures are composed of various subcomplexes of proteins that are each present in multiple copies and together establish the eightfold symmetry of the NPC. One evolutionarily conserved subcomplex of the NPC contains the nucleoporins Nup53 and Nup155. Using truncation analysis, we have defined regions of Nup53 that bind to neighboring nucleoporins as well as those domains that target Nup53 to the NPC in vivo. Using this information, we investigated the role of Nup53 in NE and NPC assembly using Xenopus egg extracts. We show that both events require Nup53. Importantly, the analysis of Nup53 fragments revealed that the assembly activity of Nup53 depleted extracts could be reconstituted using a region of Nup53 that binds specifically to its interacting partner Nup155. On the basis of these results, we propose that the formation of a Nup53–Nup155 complex plays a critical role in the processes of NPC and NE assembly. PMID:18256286
Ralhan, Ranju; Sandhya, Agarwal; Meera, Mathur; Bohdan, Wasylyk; Nootan, Shukla K.
2000-01-01
MDM2, a critical element of cellular homeostasis mechanisms, is involved in complex interactions with important cell-cycle and stress-response regulators including p53. The mdm2-P2 promoter is a transcriptional target of p53. The aim of this study was to determine the association between mdm2-P2 transcripts and the status of the p53 gene in betel- and tobacco-related oral squamous cell carcinomas (SCCs) to understand the mechanism of deregulation of MDM2 and p53 expression and their prognostic implications in oral tumorigenesis. Elevated levels of MDM2 proteins were observed in 11 of 25 (44%) oral hyperplastic lesions, nine of 15 (60%) dysplastic lesions, and 71 of 100 (71%) SCCs. The intriguing feature of the study was the identification and different subcellular localization of three isoforms of MDM2 (ie, 90 kd, 76 kd, and 57 kd) in oral SCCs and their correlation with p53 overexpression in each tumor. The hallmark of the study was the detection of mdm2-P2 transcripts in 12 of 20 oral SCCs overexpressing both MDM2 and p53 proteins while harboring wild-type p53 alleles. Furthermore, mdm2 amplification was an infrequent event in betel- and tobacco-associated oral tumorigenesis. The differential compartmentalization of the three isoforms of MDM2 suggests that each has a distinct function, potentially in the regulation of p53 and other gene products implicated in oral tumorigenesis. In conclusion, we report herein the first evidence suggesting that enhanced translation of mdm2-P2 transcripts (S-mdm2) may represent an important mechanism of overexpression and consequent stabilization and functional inactivation of wild-type p53 serving as an adverse prognosticator in betel- and tobacco-related oral cancer. The clinical significance of the functional inactivation of wild-type p53 by MDM2 is underscored by the significantly shorter median disease-free survival time (16 months) observed in p53/MDM2-positive cases as compared to those which did not show co-expression of these proteins (median time, 26 months; P = 0.02). PMID:10934161
Plant Nucleolar Stress Response, a New Face in the NAC-Dependent Cellular Stress Responses.
Ohbayashi, Iwai; Sugiyama, Munetaka
2017-01-01
The nucleolus is the most prominent nuclear domain, where the core processes of ribosome biogenesis occur vigorously. All these processes are finely orchestrated by many nucleolar factors to build precisely ribosome particles. In animal cells, perturbations of ribosome biogenesis, mostly accompanied by structural disorders of the nucleolus, cause a kind of cellular stress to induce cell cycle arrest, senescence, or apoptosis, which is called nucleolar stress response. The best-characterized pathway of this stress response involves p53 and MDM2 as key players. p53 is a crucial transcription factor that functions in response to not only nucleolar stress but also other cellular stresses such as DNA damage stress. These cellular stresses release p53 from the inhibition by MDM2, an E3 ubiquitin ligase targeting p53, in various ways, which leads to p53-dependent activation of a set of genes. In plants, genetic impairments of ribosome biogenesis factors or ribosome components have been shown to cause characteristic phenotypes, including a narrow and pointed leaf shape, implying a common signaling pathway connecting ribosomal perturbations and certain aspects of growth and development. Unlike animals, however, plants have neither p53 nor MDM2 family proteins. Then the question arises whether plant cells have a nucleolar stress response pathway. In recent years, it has been reported that several members of the plant-specific transcription factor family NAC play critical roles in the pathways responsive to various cellular stresses. In this mini review, we outline the plant cellular stress response pathways involving NAC transcription factors with reference to the p53-MDM2-dependent pathways of animal cells, and discuss the possible involvement of a plant-unique, NAC-mediated pathway in the nucleolar stress response in plants.
Takahashi, Kazuhide; Suzuki, Katsuo
2010-11-01
Membrane targeting of WAVE2 along microtubules to phosphatidylinositol 3,4,5-triphosphate (PIP(3)) in response to an extracellular stimulus requires Rac1, Pak1, stathmin, and EB1. However, whether WAVE2 interacts directly with PIP(3) or not remains unclear. We demonstrate that insulin-like growth factor I (IGF-I) induces WAVE2 membrane targeting, accompanied by phosphorylation of Pak1 at serine 199/204 (Ser199/204) and stathmin at Ser38 in the inner cytoplasmic region. This is spatially independent of the membrane region where the IGF-I receptor (IGF-IR) is locally activated. WAVE2, phosphorylated Pak1, and phosphorylated stathmin located at the microtubule ends began to accumulate at the leading edge of cells in close proximity to PIP(3) that was produced in a phosphatidylinositol 3-kinase (PI 3-kinase)-dependent manner. The PIP(3)-beads binding assay revealed that insulin receptor substrate p53 (IRSp53) and actin rather than WAVE2 bound to PIP(3). IRSp53 constitutively associated with WAVE2 and these two proteins colocalized with PIP(3) at the leading edge after IGF-I stimulation. Suppression of IRSp53 expression by two independent small interfering RNAs (siRNAs) completely inhibited IGF-I-induced membrane targeting and local accumulation of WAVE2 at the leading edge of cells. We propose that IRSp53 constitutively forms a complex with WAVE2 and is crucial for membrane targeting followed by local accumulation of WAVE2 at the leading edge of cells through linking WAVE2 to PIP(3) that is produced near locally activated IGF-IR in response to IGF-I. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Identification of the interleukin 4 receptor alpha gene as a direct target for p73.
Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi
2003-12-01
p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.
Subash-Babu, Pandurangan; Li, David K; Alshatwi, Ali A
2017-10-02
We aimed to explore the cytotoxic and apoptotic effect of friedelin on breast cancer MCF-7 cells. Cytotoxic effect of friedelin on MCF-7 cells was analyzed using MTT, cell and nuclear morphology. The apoptosis mechanism of friedelin on MCF-7 cells was analyzed using real-time PCR. Friedelin potentially inhibit 78% of MCF-7 cell's growth, the IC 50 value was 1.8μM in 24h and 1.2μM in 48h. Friedelin increased ROS significantly and DNA damage was confirmed by tunel assay. We found characteristically 52% apoptotic cells and 6% necrotic cells in PI, AO/ErBr staining after 48h treatment with 1.2μM of friedelin. Apoptosis was confirmed by significantly (p≤0.001) increased tumor suppressor gene Cdkn1a, pRb2, p53, Nrf2, caspase-3 and decreased Bcl-2, mdm2 & PCNA expression after 48h. In conclusion, friedelin effectively inhibit breast cancer MCF-7 cell growth, it was associated with early expression of Cdkn1a, pRb2 and activation of p53 and caspases. Copyright © 2017. Published by Elsevier GmbH.
Dickinson, Douglas; Yu, Hongfang; Ohno, Seiji; Thomas, Cristina; DeRossi, Scott; Ma, Yat-Ho; Yates, Nicole; Hahn, Emily; Bisch, Frederick; Yamamoto, Tetsuya; Hsu, Stephen
2015-01-01
The submandibular salivary glands of non-obese diabetic (NOD) mice, a model for Sjogren’s syndrome and type-1 diabetes, show an elevated level of proliferating cell nuclear antigen (PCNA), a protein involved in cell proliferation and repair of DNA damage. We reported previously that epigallocatechin-3-gallate (EGCG), the most abundant green tea catechin, normalizes the PCNA level. PCNA’s activity can be regulated by the cyclin-dependent kinase inhibitor p21, which is also important for epithelial cell differentiation. In turn, expression of p21 and PCNA are partially regulated by Rb phosphorylation levels. EGCG was found to modulate p21 expression in epithelial cells, suggesting that EGCG-induced p21 could be associated with down-regulation of PCNA in vivo. The current study examined the protein levels of p21 and p53 (which can up-regulate p21) in NOD mice fed with either water or EGCG, and the effect of EGCG on p21 and p53 in cell line models with either normal or defective Rb. In NOD mice, the p21 level was low, and EGCG normalized it. In contrast to HSG cells with functional Rb, negligible expression of p21 in NS-SV-AC cells that lack Rb was not altered by EGCG treatment. Inhibition of p53 by siRNA demonstrated that p21 and p53 were induced independently in HSG cells by a physiological concentration range of EGCG, suggesting p53 could be an important but not conditional factor associated with p21 expression. In conclusion, PCNA and p21 levels are altered inversely in the NOD model for SS and in HSG cells, and warrant further study as candidate new markers for salivary dysfunction associated with xerostomia. Induction of p21 by EGCG could provide clinically useful normalization of salivary glands by promoting differentiation and reducing PCNA levels. PMID:24329914
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bejerman, Nicolás, E-mail: n.bejerman@uq.edu.au; Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072; Giolitti, Fabián
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cellmore » periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.« less
Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena
2016-11-02
Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Morgan, R. Garrett; Ives, Stephen J.; Walker, Ashley E.; Cawthon, Richard M.; Andtbacka, Robert H.I.; Noyes, Dirk; Lesniewski, Lisa A.; Richardson, Russell S.; Donato, Anthony J.
2014-01-01
Objective Telomere shortening in arteries could lead to telomere uncapping and cellular senescence, which in turn could promote the development of hypertension. Methods and results To assess the novel role of arterial telomere dysfunction in hypertension, we compared mean telomere length (qPCR), telomere uncapping (serine 139 phosphorylated histone γ-H2A.X (γ-H2) localized to telomeres: ChIP), and tumor suppressor protein p53 (P53)/cyclin-dependent kinase inhibitor 1A (P21)-induced senescence (P53 bound to P21 gene promoter: ChIP) in arteries from 55 age-matched hypertensive and nonhypertensive individuals. Arterial mean telomere length was not different in hypertensive patients compared with nonhypertensive individuals (P = 0.29). Arterial telomere uncapping and P53/P21- induced senescence were two-fold greater in hypertensive patients compared with nonhypertensive individuals (P = 0.04 and P = 0.02, respectively). Arterial mean telomere length was not associated with telomere uncapping or P53/P21-induced senescence (r=– 0.02, P = 0.44 and r = 0.01, P = 0.50, respectively), but telomere uncapping was a highly influential covariate for the hypertension group difference in P53/P21-induced senescence (r = 0.62, P < 0.001, ηp2 = 0.35). Finally, telomere uncapping was a significant predictor of hypertension status (P = 0.03), whereas mean telomere length was not (P = 0.68). Conclusion Collectively, these findings demonstrate that arterial telomere uncapping and P53/P21-induced senescence are linked to hypertension independently of mean telomere length, and telomere uncapping influences hypertension status more than mean telomere length. PMID:24686009
Heyne, Kristina; Kölsch, Kathrin; Bruand, Marine; Kremmer, Elisabeth; Grässer, Friedrich A; Mayer, Jens; Roemer, Klaus
2015-01-01
Humans and primates are long-lived animals with long reproductive phases. One factor that appears to contribute to longevity and fertility in humans, as well as to cancer-free survival, is the transcription factor and tumor suppressor p53, controlled by its main negative regulator MDM2. However, p53 and MDM2 homologs are found throughout the metazoan kingdom from Trichoplacidae to Hominidae. Therefore the question arises, if p53/MDM2 contributes to the shaping of primate features, then through which mechanisms. Previous findings have indicated that the appearances of novel p53-regulated genes and wild-type p53 variants during primate evolution are important in this context. Here, we report on another mechanism of potential relevance. Human endogenous retrovirus K subgroup HML-2 (HERV-K(HML-2)) type 1 proviral sequences were formed in the genomes of the predecessors of contemporary Hominoidea and can be identified in the genomes of Nomascus leucogenys (gibbon) up to Homo sapiens. We previously reported on an alternative splicing event in HERV-K(HML-2) type 1 proviruses that can give rise to nuclear protein of 9 kDa (Np9). We document here the evolution of Np9-coding capacity in human, chimpanzee and gorilla, and show that the C-terminal half of Np9 binds directly to MDM2, through a domain of MDM2 that is known to be contacted by various cellular proteins in response to stress. Np9 can inhibit the MDM2 ubiquitin ligase activity toward p53 in the cell nucleus, and can support the transactivation of genes by p53. Our findings point to the possibility that endogenous retrovirus protein Np9 contributes to the regulation of the p53-MDM2 pathway specifically in humans, chimpanzees and gorillas. PMID:26103464
R248Q mutation--Beyond p53-DNA binding.
Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L
2015-12-01
R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.
Lee, Jeong Eun; Lim, Mi Sun; Park, Jae Hyeon; Park, Chang Hwan; Koh, Hyun Chul
2014-05-01
Chlorpyrifos (CPF) is one of the most widely used organophosphate insecticides with several harmful effects, including neurotoxicity. Although many studies have addressed the neurotoxicity induced by CPF, most data on neurodevelopmental damage was obtained from animal models. We are the first group to use human neural precursor cells (hNPCs) derived from human embryonic stem cells (hESCs) as a developing neuron model to evaluate the mechanisms involved in CPF-induced neurotoxicity. CPF was cytotoxic to these cells in a concentration-dependent manner, as shown by decreased cell viability and increased lactate dehydrogenase release. Furthermore, CPF reduced the expression of AKT and ERK proteins which are involved in intracellular survival pathways. Exposure of hNPCs to CPF led to the production of reactive oxygen species (ROS), and the antioxidant N-acetyl-cystein (NAC) attenuated ROS production induced by CPF. In addition, CPF increased cytochrome c release into the cytosol and activated caspase-9 and -3, indicating that cell death induced by CPF was due to apoptosis in hNPCs. Consistent with these findings, CPF treatment reduced the level of Bcl-2 protein and increased the level of Bax protein. Especially, CPF increased the translocation of BAX into the mitochondria. CPF also induced nuclear accumulation of NF-κB and p53 proteins in a concentration-dependent manner, and their inhibitors attenuated CPF-induced cytotoxicity. In addition, an inhibitor of NF-κB nuclear translocation blocked the increase of p53 in CPF-treated hNPCs. These findings show that CPF induced hNPCs death in part through NF-κB activation via ROS generation, enabling the interaction of p53 with Bcl-2 and Bax and subsequent release of cytochrome c. Collectively, these results represent a unique molecular characterization of CPF-induced cytotoxicity in hNPCs. These data suggest that CPF may affect neurodevelopment in a manner similar to that of several known and suspected neurotoxicants. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.
Sequence and characterization of cytoplasmic nuclear protein import factor p97
1995-01-01
Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630
Lee, Yuan-Hao; Wang, Exing; Kumar, Neeru; Glickman, Randolph D
2014-05-01
The signaling pathways via mTOR (mammalian target of rapamycin) and AMPK (AMP-activated protein kinase) play key roles in transcription, translation and carcinogenesis, and may be activated by light exposure. These pathways can be modulated by naturally occurring compounds, such as the triterpenoid, ursolic acid (UA). Previously, the transcription factors p53 and NF-κB, which transactivate mitochondrial apoptosis-related genes, were shown to be differentially modulated by UA. UA-modulated apoptosis, following exposure to UV-VIS radiation (ultraviolet to visible light broadband radiation, hereafter abbreviated to UVR), is observed to correspond to differential levels of oxidative stress in retinal pigment epithelial (RPE) and skin melanoma (SM) cells. The cellular response to this phytochemical was characterized using western blot, flow cytometry, microscopy with reactive oxidative species probes MitoTracker and dihydroethidium, and membrane permeability assay. UA pretreatment potentiated cell cycle arrest and UVR-induced apoptosis selectively in SM cells while reducing photo-oxidative stress in the DNA of RPE cells presumably by antioxidant activity of UA. Mechanistically, the nuclear transportation of p65 and p53 was reduced by UA administration prior to UVR exposure while the levels of p65 and p53 nuclear transportation in SM cells were sustained at a substantially higher level. Finally, the mitochondrial functional assay showed that UVR induced the collapse of the mitochondrial membrane potential, and this effect was exacerbated by rapamycin or UA pretreatment in SM preferentially. These results were consistent with reduced proliferation observed in the clonogenic assay, indicating that UA treatment enhanced the phototoxicity of UVR, by modulating the activation of p53 and NF-κB and initiating a mitogenic response to optical radiation that triggered mitochondria-dependent apoptosis, particularly in skin melanoma cells. The study indicates that this compound has multiple actions with the potential for protecting normal cells while sensitizing skin melanoma cells to UV irradiation.
Resource Management in Peace and War
1990-04-01
the relatively uncon- strained use of available military forces and weapons, including nuclear, chemical, biological , or other weapons capable of...The Zero-Sum Solution, 1985 (New York: Simon & Schuster, 1985), p. 333. 50. John Naisbitt, Megatrends (New York: Warner Books, 1984), pp. 53-60. 51
Thotala, D K; Hallahan, D E; Yazlovitskaya, E M
2012-03-01
Exposure of the brain to ionizing radiation can cause neurocognitive deficiencies. The pathophysiology of these neurological changes is complex and includes radiation-induced apoptosis in the subgranular zone of the hippocampus. We have recently found that inhibition of glycogen synthase kinase 3β (GSK-3β) resulted in significant protection from radiation-induced apoptosis in hippocampal neurons. The molecular mechanisms of this cytoprotection include abrogation of radiation-induced accumulation of p53. Here we show that pretreatment of irradiated HT-22 hippocampal-derived neurons with small molecule inhibitors of GSK-3β SB216763 or SB415286, or with GSK-3β-specific shRNA resulted in accumulation of the p53-specific E3 ubiquitin ligase MDM2. Knockdown of MDM2 using specific shRNA or chemical inhibition of MDM2-p53 interaction prevented the protective changes triggered by GSK-3β inhibition in irradiated HT-22 neurons and restored radiation cytotoxicity. We found that this could be due to regulation of apoptosis by subcellular localization and interaction of GSK-3β, p53 and MDM2. These data suggest that the mechanisms of radioprotection by GSK-3β inhibitors in hippocampal neurons involve regulation of MDM2-dependent p53 accumulation and interactions between GSK-3β, MDM2 and p53.
Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.
Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M
2009-10-01
The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.
10 CFR 75.53 - Criminal penalties.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 10 Energy 2 2011-01-01 2011-01-01 false Criminal penalties. 75.53 Section 75.53 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) SAFEGUARDS ON NUCLEAR MATERIAL-IMPLEMENTATION OF US/IAEA AGREEMENT Enforcement § 75.53 Criminal penalties. (a) Section 223 of the Atomic Energy Act of 1954, as amended, provides...
10 CFR 75.53 - Criminal penalties.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Criminal penalties. 75.53 Section 75.53 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) SAFEGUARDS ON NUCLEAR MATERIAL-IMPLEMENTATION OF US/IAEA AGREEMENT Enforcement § 75.53 Criminal penalties. (a) Section 223 of the Atomic Energy Act of 1954, as amended, provides...
Babar, Prasad H; Dey, Vishakha; Jaiswar, Praveen; Patankar, Swati
Many Plasmodium falciparum proteins do not share homology with, and are generally longer than their respective orthologs. This, to some extent, can be attributed to insertions. Here, we studied a P. falciparum RNA hypermethylase, trimethylguanosine synthase (PfTGS1) that harbors a 76 amino acid insertion in its methyltransferase domain. Bioinformatics analysis revealed that this insertion was present in TGS1 orthologs from other Plasmodium species as well. Interestingly, a classical nuclear localization signal (NLS) was predicted in the insertions of primate parasite TGS1 proteins. To check whether these predicted NLS are functional, we developed an in vivo heterologous system using S. cerevisiae. The predicted NLS when fused to dimeric GFP were able to localize the fusion protein to the nucleus in yeast indicating that it is indeed recognized by the yeast nuclear import machinery. We further showed that the PfTGS1 NLS binds to P. falciparum importin-α in vitro, confirming that the NLS is also recognized by the P. falciparum classical nuclear import machinery. Thus, in this study we report a novel function of the insertion in PfTGS1. Copyright © 2016 Elsevier B.V. All rights reserved.
Takeda, Tomoya; Tsubaki, Masanobu; Sakamoto, Kotaro; Ichimura, Eri; Enomoto, Aya; Suzuki, Yuri; Itoh, Tatsuki; Imano, Motohiro; Tanabe, Genzoh; Muraoka, Osamu; Matsuda, Hideaki; Satou, Takao; Nishida, Shozo
2016-09-01
Advanced metastatic melanoma, one of the most aggressive malignancies, is currently without reliable therapy. Therefore, new therapies are urgently needed. Mangiferin is a naturally occurring glucosylxanthone and exerts many beneficial biological activities. However, the effect of mangiferin on metastasis and tumor growth of metastatic melanoma remains unclear. In this study, we evaluated the effect of mangiferin on metastasis and tumor growth in a mouse metastatic melanoma model. We found that mangiferin inhibited spontaneous metastasis and tumor growth. Furthermore, mangiferin suppressed the nuclear translocation of nuclear factor kappa B (NF-κB) and expression of phosphorylated NF-κB-inducing kinase (NIK), inhibitor of kappa B kinase (IKK), and inhibitor of kappa B (IκB) and increases the expression of IκB protein in vivo. In addition, we found that mangiferin inhibited the expression of matrix metalloproteinases (MMPs) and very late antigens (VLAs) in vivo. Mangiferin treatment also increased the expression of cleaved caspase-3, cleaved Poly ADP ribose polymerase-1 (PARP-1), p53 upregulated modulator of apoptosis (PUMA), p53, and phosphorylated p53 proteins, and decreased the expression of Survivin and Bcl-associated X (Bcl-xL) proteins in vivo. These results indicate that mangiferin selectivity suppresses the NF-κB pathway via inhibition of NIK activation, thereby inhibiting metastasis and tumor growth. Importantly, the number of reported NIK selective inhibitors is limited. Taken together, our data suggest that mangiferin may be a potential therapeutic agent with a new mechanism of targeting NIK for the treatment of metastatic melanoma. Copyright © 2016 Elsevier Inc. All rights reserved.
Apoptotic cell death in erythrocytes of p53-deficient medaka (Oryzias latipes) after γ-irradiation.
Sayed, Alaa El-Din Hamid; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi
2016-10-01
Previous studies have examined the effects of γ-irradiation (γ-IR) on wild-type and p53 mutant Medaka (Oryzias latipes) 24 hours after irradiation and in the present work, apoptosis and alterations in erythrocytes of 4, 8 and 24 h and 14 days after gamma-ray irradiation were reported as genotoxic biomarkers of γ-irradiation. Sexually mature wild-type, WT (Hd-rR) and p53(-/-) adult female medaka (O. latipes) were exposed to 4 Gy dose of γ-IR and sampling were collected after 4, 8 and 24 h and 14 days. Apoptosis and morphological alterations were observed from 4 h after irradiation and remarkably increased 8 h after irradiation in the wild-type. Apoptotic cell death has been observed 8 h after irradiation most prominently but subtle in p53 mutant medaka. All these phenotypes were recovered 14 days after irradiation in both strains. Although no micronuclei were seen in any group, nuclear abnormalities were observed in red blood cells. Both apoptosis and morphological alterations in erythrocytes were decreased after 24 and 14 days after γ-irradiation. We conclude that apoptosis and malformations caused by 4 Gy γ-irradiation in the erythrocytes of medaka fish occurs from 4-24 h and the initial response until 8 h was p53-dependent.
Deng, Zhantao; Liu, Xiaozhou; Jin, Jiewen; Xu, Haidong; Gao, Qian; Wang, Yong; Zhao, Jianning
2016-01-01
Purpose: The purpose of this study was to investigate the profile of histone deacetylase (HDAC) activity and expression in osteosarcoma cells and tissues from osteosarcoma patients and to examine the mechanism by which a histone deacetylase (HDAC) inhibitor, Trichostatin A (TSA), promotes the apoptosis of osteosarcoma cells. Methods: HDAC activity and histone acetyltransferase (HAT) activity were determined in nuclear extracts of MG63 cells, hFOB 1.19 cells and tissues from 6 patients with primary osteosarcoma. The protein expression of Class I HDACs (1, 2, 3 and 8) and the activation of the p53 signaling pathway were examined by Western blot. Cell growth and apoptosis were determined by 3-(4, 5-dimethyl-2-thiazolyl)-2H-tetrazolium bromide (MTT) assay and flow cytometry, respectively. Results: Nuclear HDAC activity and class I HDAC expression were significantly higher in MG63 cells than in hFOB 1.19 cells, and a similar trend was observed in the human osteosarcoma tissues compared with the paired adjacent non-cancerous tissues. TSA significantly inhibited the growth of MG63 cells and promoted apoptosis in a dose-dependent manner through p53 signaling pathway activation. Conclusion: Class I HDACs play a central role in the pathogenesis of osteosarcoma, and HDAC inhibitors may thus have promise as new therapeutic agents against osteosarcoma. PMID:27877082
UV irradiation/cold shock-mediated apoptosis is switched to bubbling cell death at low temperatures.
Chen, Szu-Jung; Lin, Pei-Wen; Lin, Hsin-Ping; Huang, Shenq-Shyang; Lai, Feng-Jie; Sheu, Hamm-Ming; Hsu, Li-Jin; Chang, Nan-Shan
2015-04-10
When COS7 fibroblasts and other cells were exposed to UVC irradiation and cold shock at 4°C for 5 min, rapid upregulation and nuclear accumulation of NOS2, p53, WWOX, and TRAF2 occurred in 10-30 min. By time-lapse microscopy, an enlarging gas bubble containing nitric oxide (NO) was formed in the nucleus in each cell that finally popped out to cause "bubbling death". Bubbling occurred effectively at 4 and 22°C, whereas DNA fragmentation was markedly blocked at 4°C. When temperature was increased to 37°C, bubbling was retarded and DNA fragmentation occurred in 1 hr, suggesting that bubbling death is switched to apoptosis with increasing temperatures. Bubbling occurred prior to nuclear uptake of propidium iodide and DAPI stains. Arginine analog Nω-LAME inhibited NO synthase NOS2 and significantly suppressed the bubbling death. Unlike apoptosis, there were no caspase activation and flip-over of membrane phosphatidylserine (PS) during bubbling death. Bubbling death was significantly retarded in Wwox knockout MEF cells, as well as in cells overexpressing TRAF2 and dominant-negative p53. Together, UV/cold shock induces bubbling death at 4°C and the event is switched to apoptosis at 37°C. Presumably, proapoptotic WWOX and p53 block the protective TRAF2 to execute the bubbling death.
UV irradiation/cold shock-mediated apoptosis is switched to bubbling cell death at low temperatures
Lin, Hsin-Ping; Huang, Shenq-Shyang; Sheu, Hamm-Ming; Hsu, Li-Jin; Chang, Nan-Shan
2015-01-01
When COS7 fibroblasts and other cells were exposed to UVC irradiation and cold shock at 4°C for 5 min, rapid upregulation and nuclear accumulation of NOS2, p53, WWOX, and TRAF2 occurred in 10–30 min. By time-lapse microscopy, an enlarging gas bubble containing nitric oxide (NO) was formed in the nucleus in each cell that finally popped out to cause “bubbling death”. Bubbling occurred effectively at 4 and 22°C, whereas DNA fragmentation was markedly blocked at 4°C. When temperature was increased to 37°C, bubbling was retarded and DNA fragmentation occurred in 1 hr, suggesting that bubbling death is switched to apoptosis with increasing temperatures. Bubbling occurred prior to nuclear uptake of propidium iodide and DAPI stains. Arginine analog Nω-LAME inhibited NO synthase NOS2 and significantly suppressed the bubbling death. Unlike apoptosis, there were no caspase activation and flip-over of membrane phosphatidylserine (PS) during bubbling death. Bubbling death was significantly retarded in Wwox knockout MEF cells, as well as in cells overexpressing TRAF2 and dominant-negative p53. Together, UV/cold shock induces bubbling death at 4°C and the event is switched to apoptosis at 37°C. Presumably, proapoptotic WWOX and p53 block the protective TRAF2 to execute the bubbling death. PMID:25779665
Das, Ujjal; Manna, Krishnendu; Khan, Amitava; Sinha, Mahuya; Biswas, Sushobhan; Sengupta, Aaveri; Chakraborty, Anindita; Dey, Sanjit
2017-01-01
The present study was aimed to evaluate the radioprotective effect of ferulic acid (FA), a naturally occurring plant flavonoid in terms of DNA damage and damage related alterations of repair pathways by gamma radiation. FA was administered at a dose of 50 mg/kg body weight for five consecutive days prior to exposing the swiss albino mice to a single dose of 10 Gy gamma radiation. Ionising radiation induces oxidative damage manifested by decreased expression of Cu, Zn-SOD (SOD stands for super oxide dismutase), Mn-SOD and catalase. Gamma radiation promulgated reactive oxygen species (ROS) mediated DNA damage and modified repair pathways. ROS enhanced nuclear translocation of p53, activated ATM (ataxia telangiectasia-mutated protein), increased expression of GADD45a (growth arrest and DNA-damage-inducible protein) gene and inactivated Non homologous end joining (NHEJ) repair pathway. The comet formation in irradiated mice peripheral blood mononuclear cells (PBMC) reiterated the DNA damage in IR exposed groups. FA pretreatment significantly prevented the comet formation and regulated the nuclear translocation of p53, inhibited ATM activation and expression of GADD45a gene. FA promoted the nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and activated NHEJ repair pathway to overcome ROS mediated oxidative stress and DNA damage. Therefore, the current study stated that FA can challenge the oxidative stress by (i) inducing nuclear translocation of Nrf2, (ii) scavenging ROS, and (iii) activating NHEJ DNA repair process.
Understanding the Structural Ensembles of a Highly Extended Disordered Protein†
Daughdrill, Gary W.; Kashtanov, Stepan; Stancik, Amber; Hill, Shannon E.; Helms, Gregory; Muschol, Martin
2013-01-01
Developing a comprehensive description of the equilibrium structural ensembles for intrinsically disordered proteins (IDPs) is essential to understanding their function. The p53 transactivation domain (p53TAD) is an IDP that interacts with multiple protein partners and contains numerous phosphorylation sites. Multiple techniques were used to investigate the equilibrium structural ensemble of p53TAD in its native and chemically unfolded states. The results from these experiments show that the native state of p53TAD has dimensions similar to a classical random coil while the chemically unfolded state is more extended. To investigate the molecular properties responsible for this behavior, a novel algorithm that generates diverse and unbiased structural ensembles of IDPs was developed. This algorithm was used to generate a large pool of plausible p53TAD structures that were reweighted to identify a subset of structures with the best fit to small angle X-ray scattering data. High weight structures in the native state ensemble show features that are localized to protein binding sites and regions with high proline content. The features localized to the protein binding sites are mostly eliminated in the chemically unfolded ensemble; while, the regions with high proline content remain relatively unaffected. Data from NMR experiments support these results, showing that residues from the protein binding sites experience larger environmental changes upon unfolding by urea than regions with high proline content. This behavior is consistent with the urea-induced exposure of nonpolar and aromatic side-chains in the protein binding sites that are partially excluded from solvent in the native state ensemble. PMID:21979461
Milbradt, Jens; Webel, Rike; Auerochs, Sabrina; Sticht, Heinrich; Marschall, Manfred
2010-04-30
The nucleocytoplasmic egress of viral capsids is a rate-limiting step in the replication of the human cytomegalovirus (HCMV). As reported recently, an HCMV-specific nuclear egress complex is composed of viral and cellular proteins, in particular protein kinases with the capacity to induce destabilization of the nuclear lamina. Viral protein kinase pUL97 and cellular protein kinase C (PKC) play important roles by phosphorylating several types of nuclear lamins. Using pUL97 mutants, we show that the lamin-phosphorylating activity of pUL97 is associated with a reorganization of nuclear lamin A/C. Either pUL97 or PKC has the potential to induce distinct punctate lamina-depleted areas at the periphery of the nuclear envelope, which were detectable in transiently transfected and HCMV-infected cells. Using recombinant HCMV, which produces green fluorescent protein-labeled viral capsids, the direct transition of viral capsids through these areas could be visualized. This process was sensitive to an inhibitor of pUL97/PKC activity. The pUL97-mediated phosphorylation of lamin A/C at Ser(22) generated a novel binding motif for the peptidyl-prolyl cis/trans-isomerase Pin1. In HCMV-infected fibroblasts, the physiological localization of Pin1 was altered, leading to recruitment of Pin1 to viral replication centers and to the nuclear lamina. The local increase in Pin1 peptidyl-prolyl cis/trans-isomerase activity may promote conformational modulation of lamins. Thus, we postulate a novel phosphorylation-triggered mechanism for the reorganization of the nuclear lamina in HCMV-infected cells.
Milbradt, Jens; Webel, Rike; Auerochs, Sabrina; Sticht, Heinrich; Marschall, Manfred
2010-01-01
The nucleocytoplasmic egress of viral capsids is a rate-limiting step in the replication of the human cytomegalovirus (HCMV). As reported recently, an HCMV-specific nuclear egress complex is composed of viral and cellular proteins, in particular protein kinases with the capacity to induce destabilization of the nuclear lamina. Viral protein kinase pUL97 and cellular protein kinase C (PKC) play important roles by phosphorylating several types of nuclear lamins. Using pUL97 mutants, we show that the lamin-phosphorylating activity of pUL97 is associated with a reorganization of nuclear lamin A/C. Either pUL97 or PKC has the potential to induce distinct punctate lamina-depleted areas at the periphery of the nuclear envelope, which were detectable in transiently transfected and HCMV-infected cells. Using recombinant HCMV, which produces green fluorescent protein-labeled viral capsids, the direct transition of viral capsids through these areas could be visualized. This process was sensitive to an inhibitor of pUL97/PKC activity. The pUL97-mediated phosphorylation of lamin A/C at Ser22 generated a novel binding motif for the peptidyl-prolyl cis/trans-isomerase Pin1. In HCMV-infected fibroblasts, the physiological localization of Pin1 was altered, leading to recruitment of Pin1 to viral replication centers and to the nuclear lamina. The local increase in Pin1 peptidyl-prolyl cis/trans-isomerase activity may promote conformational modulation of lamins. Thus, we postulate a novel phosphorylation-triggered mechanism for the reorganization of the nuclear lamina in HCMV-infected cells. PMID:20202933
Knappskog, Stian; Chrisanthar, Ranjan; Løkkevik, Erik; Anker, Gun; Østenstad, Bjørn; Lundgren, Steinar; Risberg, Terje; Mjaaland, Ingvil; Leirvaag, Beryl; Miletic, Hrvoje; Lønning, Per E
2012-03-15
Mutations affecting p53 or its upstream activator Chk2 are associated with resistance to DNA-damaging chemotherapy in breast cancer. ATM (Ataxia Telangiectasia Mutated protein) is the key activator of p53 and Chk2 in response to genotoxic stress. Here, we sought to evaluate ATM's potential role in resistance to chemotherapy. We sequenced ATM and assessed gene expression levels in pre-treatment biopsies from 71 locally advanced breast cancers treated in the neoadjuvant setting with doxorubicin monotherapy or mitomycin combined with 5-fluorouracil. Findings were confirmed in a separate patient cohort treated with epirubicin monotherapy. Each tumor was previously analyzed for CHEK2 and TP53 mutation status. While ATM mutations were not associated with chemo-resistance, low ATM expression levels predicted chemo-resistance among patients with tumors wild-type for TP53 and CHEK2 (P = 0.028). Analyzing the ATM-chk2-p53 cascade, low ATM levels (defined as the lower 5 to 50% percentiles) or mutations inactivating TP53 or CHEK2 robustly predicted anthracycline resistance (P-values varying between 0.001 and 0.027 depending on the percentile used to define "low" ATM levels). These results were confirmed in an independent cohort of 109 patients treated with epirubicin monotherapy. In contrast, ATM-levels were not suppressed in resistant tumors harboring TP53 or CHEK2 mutations (P > 0.5). Our data indicate loss of function of the ATM-Chk2-p53 cascade to be strongly associated with resistance to anthracycline/mitomycin-containing chemotherapy in breast cancer.
Fuentes, Rolly G; Toume, Kazufumi; Arai, Midori A; Sadhu, Samir K; Ahmed, Firoj; Ishibashi, Masami
2015-04-24
Scopadulciol (1), a scopadulan-type diterpenoid, was isolated from Scoparia dulcis along with three other compounds (2-4) by an activity-guided approach using the TCF reporter (TOP) luciferase-based assay system. A fluorometric microculture cytotoxicity assay (FMCA) revealed that compound 1 was cytotoxic to AGS human gastric adenocarcinoma cells. The treatment of AGS cells with 1 decreased β-catenin levels and also inhibited its nuclear localization. The pretreatment of AGS cells with a proteasome inhibitor, either MG132 or epoxomicin, protected against the degradation of β-catenin induced by 1. The 1-induced degradation of β-catenin was also abrogated in the presence of pifithrin-α, an inhibitor of p53 transcriptional activity. Compound 1 inhibited TOP activity in AGS cells and downregulated the protein levels of cyclin D1, c-myc, and survivin. Compound 1 also sensitized AGS cells to tumor necrosis factor-related apoptosis ligand (TRAIL)-induced apoptosis by increasing the levels of the death receptors, DR4 and DR5, and decreasing the level of the antiapoptotic protein Bcl-2. Collectively, our results demonstrated that 1 induced the p53- and proteasome-dependent degradation of β-catenin, which resulted in the inhibition of TCF/β-catenin transcription in AGS cells. Furthermore, 1 enhanced apoptosis in TRAIL-resistant AGS when combined with TRAIL.
Sheikh, Rafiq A; Min, Byung Hee; Yasmeen, Shagufta; Teplitz, Raymond; Tesluk, Henry; Ruebner, Boris Henry; Tobi, Martin; Hatfield, James; Fligiel, Suzanne; Lawson, Michael J
2003-01-01
Variations of Ki-67, p53, and Adnab-9 monoclonal antibody reactions in colonic adenomas may be associated with colonic cancer risk. We studied the predictive value of these markers for adverse behavior in severely dysplastic colorectal adenomas, such as an associated carcinoma, multiplicity of adenomas, and subsequent development of adenomas. For this purpose we compared theclinical, gross, and histologic characteristics of highly dysplastic index polyps in 42 patients with Ki 67, p53, and Adnab-9 immunostaining and other molecular markers. Polyps were removed endoscopically, and severely dysplastic polyps were stained immunohistochemically with Ki-67, Adnab-9, and p53 protein by the avidin biotin conjugate (ABC) technique. Quantitative DNA (QDNA) was analyzed by computer-assisted image analysis. Ki-67 immunohistochemistry showed reversal of normal distribution of nuclear staining from the normal basal position to the upper third of the colonic crypts. This abnormality of immunostaining in dysplastic adenomas was the earliest detected by the panel we used. A statistically significant correlation was seen between invasiveness of carcinoma in the index polyp and polyp size (P = 0.003), sessile morphology (P = 0.037), and villous or tubulovillous histology (P = 0.019). In the index adenoma, p53 positivity was correlated with multiplicity at initial examination (P = 0.053), villous histology (P = 0.053), invasiveness of carcinoma (P < 0.003), and recurrence of colorectal adenomas (P = 0.025). Although p53 positivity and aneuploidy were correlated with invasiveness of carcinoma in the index polyp (P = 0.025), Adnab-9 positivity was not. However, Adnab-9 positivity in the index polyp was associated with multiplicity of adenomas (P = 0.04) as well as recurrence of adenomas (P < 0.024). In conclusion, in addition to the morphologic and histologic markers already known, Ki-67, Adnab-9 antibody, and p53 protein may be prognostic indicators useful in follow-up of patients with severely dysplastic colorectal adenomas. Adnab-9 antibody may identify a field defect in above-average-risk adenoma-bearing patients.
Suppression of HPV E6 and E7 expression by BAF53 depletion in cervical cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Kiwon; Lee, Ah-Young; Kwon, Yunhee Kim
Highlights: {yields} Integration of HPV into host genome critical for activation of E6 and E7 oncogenes. {yields} BAF53 is essential for higher-order chromatin structure. {yields} BAF53 knockdown suppresses E6 and E7 from HPV integrants, but not from episomal HPVs. {yields} BAF53 knockdown decreases H3K9Ac and H4K12Ac on P105 promoter of integrated HPV 18. {yields} BAF53 knockdown restores the p53-dependent signaling pathway in HeLa and SiHa cells. -- Abstract: Deregulation of the expression of human papillomavirus (HPV) oncogenes E6 and E7 plays a pivotal role in cervical carcinogenesis because the E6 and E7 proteins neutralize p53 and Rb tumor suppressor pathways,more » respectively. In approximately 90% of all cervical carcinomas, HPVs are found to be integrated into the host genome. Following integration, the core-enhancer element and P105 promoter that control expression of E6 and E7 adopt a chromatin structure that is different from that of episomal HPV, and this has been proposed to contribute to activation of E6 and E7 expression. However, the molecular basis underlying this chromatin structural change remains unknown. Previously, BAF53 has been shown to be essential for the integrity of higher-order chromatin structure and interchromosomal interactions. Here, we examined whether BAF53 is required for activated expression of E6 and E7 genes. We found that BAF53 knockdown led to suppression of expression of E6 and E7 genes from HPV integrants in cervical carcinoma cell lines HeLa and SiHa. Conversely, expression of transiently transfected HPV18-LCR-Luciferase was not suppressed by BAF53 knockdown. The level of the active histone marks H3K9Ac and H4K12Ac on the P105 promoter of integrated HPV 18 was decreased in BAF53 knockdown cells. BAF53 knockdown restored the p53-dependent signaling pathway in HeLa and SiHa cells. These results suggest that activated expression of the E6 and E7 genes of integrated HPV is dependent on BAF53-dependent higher-order chromatin structure or nuclear motor activity.« less
Quan, XinXin; Yu, Jennifer; Bussey, Howard; Stochaj, Ursula
2007-07-01
In the budding yeast Saccharomyces cerevisiae, four members of the importin-beta family of nuclear carriers, Xpo1p/Crm1p, Cse1p, Msn5p and Los1p, function as exporters of protein and tRNA. Under normal growth conditions GFP-tagged exporters are predominantly associated with nuclei. The presence of Snf1 kinase, a key regulator of cell growth and a metabolic sensor, controls the localization of GFP-exporters. Additional glucose-dependent, but Snf1-independent, mechanisms regulate carrier distribution and a switch from fermentable to non-fermentable carbon sources relocates all of the carriers, suggesting a link to the nutritional status of the cell. Moreover, stress controls the proper localization of GFP-exporters, which mislocalize upon exposure to heat, ethanol and starvation. Stress may activate the MAPK cell integrity cascade, and we tested the role of this pathway in exporter localization. Under non-stress conditions, the proper distribution of GFP-Cse1p and Xpo1p/Crm1p-GFP requires kinases of the cell integrity cascade. By contrast, Msn5p-GFP and Los1p-GFP rely on the MAPK module to relocate to the cytoplasm when cells are stressed with ethanol. Our results indicate that the association of nuclear exporters with nuclei is controlled by multiple mechanisms that are organized in a hierarchical fashion and linked to the physiological state of the cell.
Cytoplasmic ASPP1 inhibits apoptosis through the control of YAP
Vigneron, Arnaud M.; Ludwig, Robert L.; Vousden, Karen H.
2010-01-01
The ASPP (apoptosis-stimulating protein of p53) family of proteins can function in the nucleus to modulate the transcriptional activity of p53, with ASPP1 and ASPP2 contributing to the expression of apoptotic target genes. In this study, we describe a new function for cytoplasmic ASPP1 in controlling YAP (Yes-associated protein)/TAZ. ASPP1 can inhibit the interaction of YAP with LATS1 (large tumor suppressor 1), a kinase that phosphorylates YAP/TAZ and promotes cytoplasmic sequestration and protein degradation. This function of ASPP1 therefore enhances nuclear accumulation of YAP/TAZ and YAP/TAZ-dependent transcriptional regulation. The consequence of YAP/TAZ activation by ASPP1 is to inhibit apoptosis, in part through the down-regulation of Bim expression, leading to resistance to anoikis and enhanced cell migration. These results reveal a potential oncogenic role for cytoplasmic ASPP1, in contrast to the tumor-suppressive activity described previously for nuclear ASPP1. PMID:21041411
Lee, Yoon-Jin; Kim, Soo A; Lee, Sang-Han
2016-05-01
Intra-articular injection of local anesthetics (LAs) is a common procedure for therapeutic purposes. However, LAs have been found toxic to articular cartilage, and hyaluronan may attenuate this toxicity. In this study we investigated whether hyaluronan attenuated lidocaine-induced chondrotoxicity, and if so, to elucidate the underlying mechanisms. Human chondrocyte cell line SW1353 and newly isolated murine chondrocytes were incubated in culture medium containing hyaluronan and/or lidocaine for 72 h. Cell viability was evaluated using MTT assay. Cell apoptosis was detected with DAPI staining, caspase 3/7 activity assay and flow cytometry. Cell cycle distributions, ROS levels and mitochondrial membrane potential (ΔΨm) were determined using flow cytometry. The expression of p53 and p53-regulated gene products was measured with Western blotting. Lidocaine (0.005%-0.03%) dose-dependently decreased the viability of SW1353 cells. This local anesthetic (0.015%, 0.025%) induced apoptosis, G2/M phase arrest and loss of ΔΨm, and markedly increased ROS production in SW1353 cells. Hyaluronan (50-800 μg/mL) alone did not affect the cell viability, but co-treatment with hyaluronan (200 μg/mL) significantly attenuated lidocaine-induced apoptosis and other abnormalities in SW1353 cells. Furthermore, co-treatment with lidocaine and hyaluronan significantly decreased the levels of p53 and its transcription targets Bax and p21 in SW1353 cells, although treatment with lidocaine alone did not significantly change these proteins. Similar results were obtained in ex vivo cultured murine chondrocytes. Hyaluronan suppresses lidocaine-induced apoptosis of human chondrocytes in vitro through inhibiting the p53-dependent mitochondrial apoptotic pathway.
Lee, Yoon-Jin; Kim, Soo A; Lee, Sang-Han
2016-01-01
Aim: Intra-articular injection of local anesthetics (LAs) is a common procedure for therapeutic purposes. However, LAs have been found toxic to articular cartilage, and hyaluronan may attenuate this toxicity. In this study we investigated whether hyaluronan attenuated lidocaine-induced chondrotoxicity, and if so, to elucidate the underlying mechanisms. Methods: Human chondrocyte cell line SW1353 and newly isolated murine chondrocytes were incubated in culture medium containing hyaluronan and/or lidocaine for 72 h. Cell viability was evaluated using MTT assay. Cell apoptosis was detected with DAPI staining, caspase 3/7 activity assay and flow cytometry. Cell cycle distributions, ROS levels and mitochondrial membrane potential (ΔΨm) were determined using flow cytometry. The expression of p53 and p53-regulated gene products was measured with Western blotting. Results: Lidocaine (0.005%−0.03%) dose-dependently decreased the viability of SW1353 cells. This local anesthetic (0.015%, 0.025%) induced apoptosis, G2/M phase arrest and loss of ΔΨm, and markedly increased ROS production in SW1353 cells. Hyaluronan (50−800 μg/mL) alone did not affect the cell viability, but co-treatment with hyaluronan (200 μg/mL) significantly attenuated lidocaine-induced apoptosis and other abnormalities in SW1353 cells. Furthermore, co-treatment with lidocaine and hyaluronan significantly decreased the levels of p53 and its transcription targets Bax and p21 in SW1353 cells, although treatment with lidocaine alone did not significantly change these proteins. Similar results were obtained in ex vivo cultured murine chondrocytes. Conclusion: Hyaluronan suppresses lidocaine-induced apoptosis of human chondrocytes in vitro through inhibiting the p53-dependent mitochondrial apoptotic pathway. PMID:27041463
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhuravlev, B. V., E-mail: zhurav@ippe.ru; Lychagin, A. A.; Titarenko, N. N.
The spectra of neutrons from the (p, n) reactions on {sup 47}Ti, {sup 48}Ti, {sup 49}Ti, {sup 53}Cr, and {sup 54}Cr nuclei were measured in the proton-energy range 7-11 MeV. The measurements were performed with the aid of a fast-neutron spectrometer by the time-of-flight method over the base of the EGP-15 tandem accelerator of the Institute for Physics and Power Engineering (IPPE, Obninsk). Owing to a high resolution and a high stability of the time-of-flight spectrometer used, low-lying discrete levels could be identified reliably along with a continuum section of neutron spectra. An analysis of measured data was performed withinmore » the statistical equilibrium and preequilibrium models of nuclear reactions. The relevant calculations were performed by using the exact formalism of Hauser-Feshbach statistical theory supplemented with the generalized model of a superfluid nucleus, the back-shifted Fermi gas model, and the Gilbert-Cameron composite formula for the nuclear level density. The nuclear level densities for {sup 47}V, {sup 48}V, {sup 49}V, {sup 53}Mn, and {sup 54}Mn were determined along with their energy dependences and model parameters. The results are discussed together with available experimental data and recommendations of model systematics.« less
Kim, Kwang Seok; Choi, Kyu Jin; Bae, Sangwoo
2016-01-01
Since checkpoint kinase 1 (Chk1) is an essential factor for cell viability following DNA damage, the inhibition of Chk1 has been a major focus of pharmaceutical development to enhance the sensitivity of tumor cells to chemo- and radiotherapy that damage DNA. However, due to the off-target effects of conventional Chk1-targeting strategies and the toxicity of Chk1 inhibitors, alternative strategies are required to target Chk1. To facilitate such efforts, in this study, we identified a specific Chk1-binding 12-mer peptide from the screening of a phage display library and characterized the peptide in terms of cellular cytotoxicity, and in terms of its effect on Chk1 activity and sensitivity to genotoxic agents. This peptide, named N-terminal Chk1-binding peptide (Chk1-NP), bound the kinase domain of Chk1. Simulation of the binding revealed that the very N-terminus of the Chk1 kinase domain is the potential peptide binding site. Of note, the polyarginine-mediated internalization of Chk1-NP redistributed nuclear Chk1 with a prominent decrease in the nucleus in the absence of DNA damage. Treatment with Chk1-NP peptide alone decreased the viability of p53-defective HeLa cells, but not that of p53-functional NCI-H460 cells under normal conditions. The treatment of HeLa or NCI-H460 cells with the peptide significantly enhanced radiation sensitivity following ionizing radiation (IR) with a greater enhancement observed in HeLa cells. Moreover, the IR-induced destabilization of Chk1 was aggravated by treatment with Chk1-NP. Therefore, the decreased nuclear localization and protein levels of Chk1 seem to be responsible for the enhanced cancer cell killing following combined treatment with IR and Chk1-NP. The approach using the specific Chk1-binding peptide may facilitate the mechanistic understanding and potential modulation of Chk1 activities and may provide a novel rationale for the development of specific Chk1-targeting agents. PMID:28025997
Epidemiologic and molecular characteristics of borderline and malignant epithelial ovarian tumors
NASA Astrophysics Data System (ADS)
Bastos, Eugenia Maria Chaves De Moraes
Data from the Cancer and Steroid Hormone Study, a multicenter, population-based, case-control study were used to identify risk factors for epithelial ovarian cancer according to tumor behavior, histologic types, as well as p53 expression. Cases were women between 20 to 54 years old diagnosed with epithelial ovarian cancer from 1980 to 1982. Controls were women selected by random digit dialing. Tumor samples were analyzed for p53 overexpression using immunohistochemistry. Case-case and case-control conditional logistic regression models matched on age and diagnosing centers were used to calculate odds ratios (OR's) and 95% confidence intervals (CI's) for borderline, malignant, mucinous, and nonmucinous tumors, and p53 positive and p53 negative cases. The OR's for high number of lifetime ovulatory cycles (376-533 compared with less than 234) were 3.1 (95% CI 1.6-6.1) for malignant and 1.4 (95% CI 0.5-3.7) for borderline cases. The high number of ovulatory cycles was also a strong risk factor among nonmucinous cases. OR's for current and recent ex-smokers compared with never smokers were 2.8 (95% CI 1.7-4.8) for mucinous and 0.9 (95% CI 0.7-1.1) for nonmucinous types. Infertility showed a positive association with borderline ovarian cancer. Family history of ovarian or breast cancer was positively associated with malignant and nonmucinous cases. Parity had an inverse association with malignant ovarian cancer cases. When cases were subdivided by p53 results, the OR for tobacco smoking and p53 positive ovarian cancer was elevated for mucinous (OR = 3.9; 95% CI 0.8-18) at localized stage. Alcohol use showed a positive association with p53 positive malignant cases at advanced stage (OR = 2.0; 95% CI 1.2-3.2) and with p53 positive nonmucinous cases at advanced stage (OR = 2.1; 95% CI 1.2-3.4). A positive association between high number of ovulatory cycles and p53 positive malignant cases was observed in cases with localized stage (OR = 6.6; 95% CI 1.0-45) and advanced stage (OR = 7.0; 95% CI 1.6-30). Our findings suggest that ovarian tumors defined according to borderline versus malignant tumor behavior and mucinous versus nonmucinous histology, and p53 status show different associations for some risk factors, suggesting that cases defined by these subsets could have different etiologic pathways. However, the interpretation of results from subgroup analysis should consider the possibility of findings due to chance or artifact. Future studies should consider borderline, malignant, mucinous and other histologic types as separate endpoints.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vergis, Roy; Corbishley, Catherine M.; Thomas, Karen
Purpose: Established prognostic factors in localized prostate cancer explain only a moderate proportion of variation in outcome. We analyzed tumor expression of apoptotic markers with respect to outcome in men with localized prostate cancer in two randomized controlled trials of radiotherapy dose escalation. Methods and Materials: Between 1995 and 2001, 308 patients with localized prostate cancer received neoadjuvant androgen deprivation and radical radiotherapy at our institution in one of two dose-escalation trials. The biopsy specimens in 201 cases were used to make a biopsy tissue microarray. We evaluated tumor expression of Bcl-2, p53, and MDM2 by immunohistochemistry with respect tomore » outcome. Results: Median follow-up was 7 years, and 5-year freedom from biochemical failure (FFBF) was 70.4% (95% CI, 63.5-76.3%). On univariate analysis, expression of Bcl-2 (p < 0.001) and p53 (p = 0.017), but not MDM2 (p = 0.224), was significantly associated with FFBF. Expression of Bcl-2 remained significantly associated with FFBF (p = 0.001) on multivariate analysis, independently of T stage, Gleason score, initial prostate-specific antigen level, and radiotherapy dose. Seven-year biochemical control was 61% vs. 41% (p = 0.0122) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-positive tumors and 87% vs. 81% (p = 0.423) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-negative tumors. There was no statistically significant interaction between dose and Bcl-2 expression. Conclusions: Bcl-2 expression was a significant, independent determinant of biochemical control after neoadjuvant androgen deprivation and radical radiotherapy for prostate cancer. These data generate the hypothesis that Bcl-2 expression could be used to inform the choice of radiotherapy dose in individual patients.« less
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 42 Public Health 5 2013-10-01 2013-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 42 Public Health 5 2014-10-01 2014-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 42 Public Health 5 2011-10-01 2011-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 42 Public Health 5 2012-10-01 2012-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
Morgan, R Garrett; Ives, Stephen J; Walker, Ashley E; Cawthon, Richard M; Andtbacka, Robert H I; Noyes, Dirk; Lesniewski, Lisa A; Richardson, Russell S; Donato, Anthony J
2014-06-01
Telomere shortening in arteries could lead to telomere uncapping and cellular senescence, which in turn could promote the development of hypertension. To assess the novel role of arterial telomere dysfunction in hypertension, we compared mean telomere length (qPCR), telomere uncapping (serine 139 phosphorylated histone γ-H2A.X (γ-H2) localized to telomeres: ChIP), and tumor suppressor protein p53 (P53)/cyclin-dependent kinase inhibitor 1A (P21)-induced senescence (P53 bound to P21 gene promoter: ChIP) in arteries from 55 age-matched hypertensive and nonhypertensive individuals. Arterial mean telomere length was not different in hypertensive patients compared with nonhypertensive individuals (P = 0.29). Arterial telomere uncapping and P53/P21-induced senescence were two-fold greater in hypertensive patients compared with nonhypertensive individuals (P = 0.04 and P = 0.02, respectively). Arterial mean telomere length was not associated with telomere uncapping or P53/P21-induced senescence (r = -0.02, P = 0.44 and r = 0.01, P = 0.50, respectively), but telomere uncapping was a highly influential covariate for the hypertension group difference in P53/P21-induced senescence (r = 0.62, P < 0.001, η(p)(2) = 0.35). Finally, telomere uncapping was a significant predictor of hypertension status (P = 0.03), whereas mean telomere length was not (P = 0.68). Collectively, these findings demonstrate that arterial telomere uncapping and P53/P21-induced senescence are linked to hypertension independently of mean telomere length, and telomere uncapping influences hypertension status more than mean telomere length.
Smith, Kate M; Di Antonio, Veronica; Bellucci, Luca; Thomas, David R; Caporuscio, Fabiana; Ciccarese, Francesco; Ghassabian, Hanieh; Wagstaff, Kylie M; Forwood, Jade K; Jans, David A; Palù, Giorgio; Alvisi, Gualtiero
2018-08-01
Nuclear import involves the recognition by importin (IMP) superfamily members of nuclear localization signals (NLSs) within protein cargoes destined for the nucleus, the best understood being recognition of classical NLSs (cNLSs) by the IMPα/β1 heterodimer. Although the cNLS consensus [K-(K/R)-X-(K/R) for positions P2-P5] is generally accepted, recent studies indicated that the contribution made by different residues at the P4 position can vary. Here, we apply a combination of microscopy, molecular dynamics, crystallography, in vitro binding, and bioinformatics approaches to show that the nature of residues at P4 indeed modulates cNLS function in the context of a prototypical Simian Virus 40 large tumor antigen-derived cNLS (KKRK, P2-5). Indeed, all hydrophobic substitutions in place of R impaired binding to IMPα and nuclear targeting, with the largest effect exerted by a G residue at P4. Substitution of R with neutral hydrophobic residues caused the loss of electrostatic and van der Waals interactions between the P4 residue side chains and IMPα. Detailed bioinformatics analysis confirmed the importance of the P4 residue for cNLS function across the human proteome, with specific residues such as G being associated with low activity. Furthermore, we validate our findings for two additional cNLSs from human cytomegalovirus (HCMV) DNA polymerase catalytic subunit UL54 and processivity factor UL44, where a G residue at P4 results in a 2-3-fold decrease in NLS activity. Our results thus showed that the P4 residue makes a hitherto poorly appreciated contribution to nuclear import efficiency, which is essential to determining the precise nuclear levels of cargoes. Copyright © 2018 Elsevier B.V. All rights reserved.
Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Jiawen; Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg; Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg
Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involvedmore » in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in radio-resistance.« less
Honda, Akinobu; Chigwechokha, Petros Kingstone; Kamada-Futagami, Yuko; Komatsu, Masaharu; Shiozaki, Kazuhiro
2018-06-01
Sialidase catalyzes the removal of sialic acids from glycoconjugates. Different from Neu1 and Neu3 sialidases, Neu4 enzymatic properties such as substrate specificity and subcellular localization are not well-conserved among vertebrates. In fish only zebrafish and medaka neu4 genes have been cloned and their polypeptides have been characterized so far. Thus, characterization of Neu4 from other fish species is necessary to evaluate Neu4 physiological functions. Here, Nile tilapia was chosen for the characterization of Neu4 polypeptide considering that it is one of the major cultured fish all over the world and that its genomic sequences are now available. Coding DNA sequence of tilapia Neu4 was identified as 1,497 bp and its recombinant protein showed broad substrate specificity and optimal sialidase enzyme activity pH at 4.0. Neu4 activity was sustained even in neutral and alkali pH. Interestingly, immunofluorescence analysis revealed that major subcellular localization of tilapia Neu4 was nuclear, quite distinct from zebrafish (ER) and medaka Neu4 (lysosome). Bioinformatic analysis showed the existence of putative nuclear localization signal (NLS) in tilapia Neu4. In general, it is known that importin families bind to several proteins via NLS and transfer them into nucleus. Therefore, to determine the involvement of putative NLS in Neu4 nuclear localization, Neu4 mutant deleting NLS was constructed and expressed in cultured cells. As a result, NLS deletion significantly diminished the nuclear localization. Furthermore, treatment of importazole, interrupter of binding importin β and RanGTP, significantly suppressed Neu4 nuclear localization. In summary, tilapia Neu4 is a unique sialidase localized at nucleus and its transport system into nucleus is regulated by importin. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy
2011-01-01
Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846
Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy
2011-09-23
Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.
2013-01-01
Background Heterogeneously distributed hypoxic areas are a characteristic property of locally advanced breast cancers (BCa) and generally associated with therapeutic resistance, metastases, and poor patient survival. About 50% of locally advanced BCa, where radiotherapy is less effective are suggested to be due to hypoxic regions. In this study, we investigated the potential of bioactive phytochemicals in radio-sensitizing hypoxic BCa cells. Methods Hypoxic (O2-2.5%; N2-92.5%; CO2-5%) MCF-7 cells were exposed to 4 Gy radiation (IR) alone or after pretreatment with Curcumin (CUR), curcumin analog EF24, neem leaf extract (NLE), Genistein (GEN), Resveratrol (RES) or raspberry extract (RSE). The cells were examined for inhibition of NFκB activity, transcriptional modulation of 88 NFκB signaling pathway genes, activation and cellular localization of radio-responsive NFκB related mediators, eNos, Erk1/2, SOD2, Akt1/2/3, p50, p65, pIκBα, TNFα, Birc-1, -2, -5 and associated induction of cell death. Results EMSA revealed that cells exposed to phytochemicals showed complete suppression of IR-induced NFκB. Relatively, cells exposed EF24 revealed a robust inhibition of IR-induced NFκB. QPCR profiling showed induced expression of 53 NFκB signaling pathway genes after IR. Conversely, 53, 50, 53, 53, 53 and 53 of IR-induced genes were inhibited with EF24, NLE, CUR, GEN, RES and RSE respectively. In addition, 25, 29, 24, 16, 11 and 21 of 35 IR-suppressed genes were further inhibited with EF24, NLE, CUR, GEN, RES and RSE respectively. Immunoblotting revealed a significant attenuating effect of IR-modulated radio-responsive eNos, Erk1/2, SOD2, Akt1/2/3, p50, p65, pIκBα, TNFα, Birc-1, -2 and −5 with EF24, NLE, CUR, GEN, RES or RSE. Annexin V-FITC staining showed a consistent and significant induction of IR-induced cell death with these phytochemicals. Notably, EF24 robustly conferred IR-induced cell death. Conclusions Together, these data identifies the potential hypoxic cell radio-sensitizers and further implies that the induced radio-sensitization may be exerted by selectively targeting IR-induced NFκB signaling. PMID:23452621
Romanenko, Alina; Lee, Chyi Chia R.; Yamamoto, Shinji; Hori, Taka‐aki; Wanibuchi, Hideki; Zaparin, Wadim; Vinnichenko, Wladimir; Vozianov, Alexander
1999-01-01
During the 11‐year period subsequent to the Chernobyl accident, the incidence of urinary bladder cancer in Ukraine has increased from 26.2 to 36.1 per 100,000 population. Cesium‐137 (137Cs) accounts for 80–90% of the incorporated radioactivity in this population, which has been exposed to long‐term, low‐dose ionizing radiation, and 80% of the more labile pool of cesium is excreted via the urine. The present study was performed to evaluate the histopathological features and the immunohistochemical status of p53, p21WAF1/Cip1, cyclin D1 and PCNA (proliferating cell nuclear antigen) in urinary bladder mucos a of 55 males (49‐92 years old) with benign prostatic hyperplasia who underwent surgery in Kiev, Ukraine, in 1995 and 1996. Group I (28 patients) inhabiting radiocontaminated areas of the country, group II (17 patients) from Kiev city with less radiocontamination and a control group III (10 patients) living in so‐called “clean” areas of Ukraine were compared. In groups I and II, an increase in multiple areas of moderate or severe dysplasia or carcinoma in situ was seen in 42 (93%) of 45 cases. In addi tion, two small transitional cell carcinomas were found in one patient in each of groups I and II. Nuclear accumulation of p53, PCNA, cyclin D1, and to a lesser extent p21WAF1/Cip1, was significantly increased in both groups I and II as compared with the control group III, indicating possible transformation events or enhancement of repair activities, that may precede the defect in the regulatory pathway itself, at least in the G1 phase of the cell cycle. Our results suggest that early malignant transformation is taking place in the bladder urothelium of people in the radiocontaminated areas of Ukraine and that this could possibly lead sometime in the future to an increased incidence of urinary bladder cancer. PMID:10189884
Functional Effect of Pim1 Depends upon Intracellular Localization in Human Cardiac Progenitor Cells
Samse, Kaitlen; Emathinger, Jacqueline; Hariharan, Nirmala; Quijada, Pearl; Ilves, Kelli; Völkers, Mirko; Ormachea, Lucia; De La Torre, Andrea; Orogo, Amabel M.; Alvarez, Roberto; Din, Shabana; Mohsin, Sadia; Monsanto, Megan; Fischer, Kimberlee M.; Dembitsky, Walter P.; Gustafsson, Åsa B.; Sussman, Mark A.
2015-01-01
Human cardiac progenitor cells (hCPC) improve heart function after autologous transfer in heart failure patients. Regenerative potential of hCPCs is severely limited with age, requiring genetic modification to enhance therapeutic potential. A legacy of work from our laboratory with Pim1 kinase reveals effects on proliferation, survival, metabolism, and rejuvenation of hCPCs in vitro and in vivo. We demonstrate that subcellular targeting of Pim1 bolsters the distinct cardioprotective effects of this kinase in hCPCs to increase proliferation and survival, and antagonize cellular senescence. Adult hCPCs isolated from patients undergoing left ventricular assist device implantation were engineered to overexpress Pim1 throughout the cell (PimWT) or targeted to either mitochondrial (Mito-Pim1) or nuclear (Nuc-Pim1) compartments. Nuc-Pim1 enhances stem cell youthfulness associated with decreased senescence-associated β-galactosidase activity, preserved telomere length, reduced expression of p16 and p53, and up-regulation of nucleostemin relative to PimWT hCPCs. Alternately, Mito-Pim1 enhances survival by increasing expression of Bcl-2 and Bcl-XL and decreasing cell death after H2O2 treatment, thereby preserving mitochondrial integrity superior to PimWT. Mito-Pim1 increases the proliferation rate by up-regulation of cell cycle modulators Cyclin D, CDK4, and phospho-Rb. Optimal stem cell traits such as proliferation, survival, and increased youthful properties of aged hCPCs are enhanced after targeted Pim1 localization to mitochondrial or nuclear compartments. Targeted Pim1 overexpression in hCPCs allows for selection of the desired phenotypic properties to overcome patient variability and improve specific stem cell characteristics. PMID:25882843
Functional Effect of Pim1 Depends upon Intracellular Localization in Human Cardiac Progenitor Cells.
Samse, Kaitlen; Emathinger, Jacqueline; Hariharan, Nirmala; Quijada, Pearl; Ilves, Kelli; Völkers, Mirko; Ormachea, Lucia; De La Torre, Andrea; Orogo, Amabel M; Alvarez, Roberto; Din, Shabana; Mohsin, Sadia; Monsanto, Megan; Fischer, Kimberlee M; Dembitsky, Walter P; Gustafsson, Åsa B; Sussman, Mark A
2015-05-29
Human cardiac progenitor cells (hCPC) improve heart function after autologous transfer in heart failure patients. Regenerative potential of hCPCs is severely limited with age, requiring genetic modification to enhance therapeutic potential. A legacy of work from our laboratory with Pim1 kinase reveals effects on proliferation, survival, metabolism, and rejuvenation of hCPCs in vitro and in vivo. We demonstrate that subcellular targeting of Pim1 bolsters the distinct cardioprotective effects of this kinase in hCPCs to increase proliferation and survival, and antagonize cellular senescence. Adult hCPCs isolated from patients undergoing left ventricular assist device implantation were engineered to overexpress Pim1 throughout the cell (PimWT) or targeted to either mitochondrial (Mito-Pim1) or nuclear (Nuc-Pim1) compartments. Nuc-Pim1 enhances stem cell youthfulness associated with decreased senescence-associated β-galactosidase activity, preserved telomere length, reduced expression of p16 and p53, and up-regulation of nucleostemin relative to PimWT hCPCs. Alternately, Mito-Pim1 enhances survival by increasing expression of Bcl-2 and Bcl-XL and decreasing cell death after H2O2 treatment, thereby preserving mitochondrial integrity superior to PimWT. Mito-Pim1 increases the proliferation rate by up-regulation of cell cycle modulators Cyclin D, CDK4, and phospho-Rb. Optimal stem cell traits such as proliferation, survival, and increased youthful properties of aged hCPCs are enhanced after targeted Pim1 localization to mitochondrial or nuclear compartments. Targeted Pim1 overexpression in hCPCs allows for selection of the desired phenotypic properties to overcome patient variability and improve specific stem cell characteristics. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Ishii, Hideaki H; Gobé, Glenda C; Pan, Wenshen; Yoneyama, Juichi; Ebihara, Yoshiro
2002-09-01
Patients with gastric carcinomas have a poor prognosis and low survival rates. The aim of the present paper was to characterize cellular and molecular properties to provide insight into aspects of tumor progression in early compared with advanced gastric cancers. One hundred and nine graded gastric carcinomas (early or advanced stage, undifferentiated or differentiated type) with paired non-cancer tissue were studied to define the correlation between apoptosis (morphology, terminal deoxyribonucleotidyl transferase-mediated dUTP-digoxigenin nick end-labeling), cell proliferation (Ki-67 expression, morphology) and expression and localization of two proteins frequently having altered expression in cancers, namely p53 and c-myc. Overall, apoptosis was lower in early stage, differentiated and undifferentiated gastric carcinomas compared with advanced-stage cancers. Cell proliferation was comparatively high in all stages. There was a high level of p53 positivity in all stages. Only the early- and advanced-stage undifferentiated cancers that were p53 positive had a significantly higher level of apoptosis (P < 0.05). Cell proliferation was significantly greater (P < 0.05) only in the early undifferentiated cancers that had either c-myc or p53-positivity. The results indicate that low apoptosis and high cell proliferation combine to drive gastric cancer development. The molecular controls for high cell proliferation of the early stage undifferentiated gastric cancers involve overexpression of both p53 and c-myc. Overexpression of p53 may also control cancer development in that its expression is associated with higher levels of apoptosis in early and late-stage undifferentiated, cancers. Copyright 2002 Blackwell Publishing Asia Pty Ltd
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balermpas, Panagiotis; Michel, Yvonne; Wagenblast, Jens
2013-07-15
Background: To examine whether nuclear NF-κB expression correlates with outcome in patients with head and neck squamous cell carcinoma (HNSCC) treated with primary chemoradiation therapy (CRT). Methods and Materials: Between 2007 and 2010, 101 patients with locally advanced primary HNSCC were treated with definitive simultaneous CRT. Pretreatment biopsy specimens were analyzed for NF-κB p65 (RelA) nuclear immunoreactivity. A sample was assigned to be positive with more than 5% positive nuclear expression. The predictive relevance of NF-κB and clinicopathologic factors for overall survival (OS), progression-free survival (PFS), local progression-free survival (LPFS), and metastasis-free survival (DMFS) was examined by univariate and multivariatemore » analysis. Results: No significant differences between the groups were observed with regard to age, sex, total radiation dose, fractionation mode, total chemotherapy applied, T stage or grading. Patients with p65 nuclear positive biopsy specimens showed significantly a higher rate of lymph node metastasis (cN2c or cN3 status, P=.034). Within a mean follow-up time of 25 months (range, 2.33-62.96 months) OS, PFS, and DMFS were significantly poorer in the p65 nuclear positive group (P=.008, P=.027, and P=.008, respectively). These correlations remained significant in multivariate analysis. Conclusion: NF-κB/p65 nuclear expression is associated with increased lymphatic and hematogenous tumor dissemination and decreased survival in HNSCC patients treated with primary CRT. Our results may foster further investigation of a predictive relevance of NF-κB/p65 and its role as a suitable target for a molecular-based targeted therapy in HNSCC cancer.« less
Haoudi, Abdelali; Daniels, Rodney C; Wong, Eric; Kupfer, Gary; Semmes, O John
2003-09-26
The virally encoded oncoprotein Tax has been implicated in HTLV-1-mediated cellular transformation. The exact mechanism by which this protein contributes to the oncogenic process is not known. However, it has been hypothesized that Tax induces genomic instability via repression of cellular DNA repair. We examined the effect of de novo Tax expression upon the cell cycle, because appropriate activation of cell cycle checkpoints is essential to a robust damage-repair response. Upon induction of tax expression, Jurkat T-cells displayed a pronounced accumulation in G2/M that was reversible by caffeine. We examined the G2-specific checkpoint signaling response in these cells and found activation of the ATM/chk2-mediated pathway, whereas the ATR/chk1-mediated response was unaffected. Immunoprecipitation with anti-chk2 antibody results in co-precipitation of Tax demonstrating a direct interaction of Tax with a chk2-containing complex. We also show that Tax targets a discrete nuclear site and co-localizes with chk2 and not chk1. This nuclear site, previously identified as Tax Speckled Structures (TSS), also contains the early damage response factor 53BP1. The recruitment of 53BP1 to TSS is dependent upon ATM signaling and requires expression of Tax. Specifically, Tax expression induces redistribution of diffuse nuclear 53BP1 to the TSS foci. Taken together these data suggest that the TSS describe a unique nuclear site involved in DNA damage recognition, repair response, and cell cycle checkpoint activation. We suggest that association of Tax with this multifunctional subnuclear site results in disruption of a subset of the site-specific activities and contributes to cellular genomic instability.
2012-01-01
Introduction Mutations affecting p53 or its upstream activator Chk2 are associated with resistance to DNA-damaging chemotherapy in breast cancer. ATM (Ataxia Telangiectasia Mutated protein) is the key activator of p53 and Chk2 in response to genotoxic stress. Here, we sought to evaluate ATM's potential role in resistance to chemotherapy. Methods We sequenced ATM and assessed gene expression levels in pre-treatment biopsies from 71 locally advanced breast cancers treated in the neoadjuvant setting with doxorubicin monotherapy or mitomycin combined with 5-fluorouracil. Findings were confirmed in a separate patient cohort treated with epirubicin monotherapy. Each tumor was previously analyzed for CHEK2 and TP53 mutation status. Results While ATM mutations were not associated with chemo-resistance, low ATM expression levels predicted chemo-resistance among patients with tumors wild-type for TP53 and CHEK2 (P = 0.028). Analyzing the ATM-chk2-p53 cascade, low ATM levels (defined as the lower 5 to 50% percentiles) or mutations inactivating TP53 or CHEK2 robustly predicted anthracycline resistance (P-values varying between 0.001 and 0.027 depending on the percentile used to define "low" ATM levels). These results were confirmed in an independent cohort of 109 patients treated with epirubicin monotherapy. In contrast, ATM-levels were not suppressed in resistant tumors harboring TP53 or CHEK2 mutations (P > 0.5). Conclusions Our data indicate loss of function of the ATM-Chk2-p53 cascade to be strongly associated with resistance to anthracycline/mitomycin-containing chemotherapy in breast cancer. PMID:22420423
Dong, Yang; Cao, Aili; Shi, Jianrong; Yin, Peihao; Wang, Li; Ji, Guang; Xie, Jianqun; Wu, Dazheng
2014-04-01
Tangeretin, a natural polymethoxyflavone present in citrus peel oil, is known to have anticancer activities in breast cancer, colorectal carcinoma and lung carcinoma, yet, the underlying mechanisms of tangeretin in human gastric cancer AGS cells have not been investigated to date. In the present study, the apoptotic mechanisms of tangeretin in AGS cells were explored. It was observed that tangeretin increased the apoptotic rates of AGS cells following treatment with tangeretin for 48 h in a dose-dependent manner by Annexin V-FITC and PI double staining. In addition, characteristic apoptotic morphology such as nuclear shrinkage and apoptotic bodies was observed after Hoechst 33258 staining. Flow cytometric assay showed that treatment of AGS cells with tangeretin decreased the mitochondrial membrane potential (MMP) in a dose-dependent manner, which indicated that mitochondrial dysfunction was involved in the tangeretin-induced apoptosis. Caspase-3, -8 and -9 activities were increased by tangeretin in a dose-dependent manner. Western blotting showed that the protein levels of pro-apoptotic proteins including cleaved caspase-3, cleaved caspase-8, cleaved caspase-9, Bax, Bid, tBid, p53, p21/cip1, Fas and FasL were significantly upregulated by tangeretin. In addition, PFT-α (a p53 inhibitor) reduced the apoptotic rates and the expression of p53, p21, caspase-3 and caspase-9 induced by tangeretin, indicating that tangeretin-induced apoptosis was p53-dependent. In conclusion, these results suggest that tangeretin induces the apoptosis of AGS cells mainly through p53-dependent mitochondrial dysfunction and the Fas/FasL-mediated extrinsic pathway.
Cui, Hong; Ghosh, Santanu K; Jayaram, Makkuni
2009-04-20
The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1-STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a "partitioning center" represents yet another facet of the benign parasitism of the yeast plasmid.
Sur, Monalisa; Sur, Ranjan K; Cooper, Kum; Bizos, Damon
2003-02-01
Pre-brachytherapy biopsies and post-brachytherapy oesophagectomy specimens of 10 patients with early squamous cell carcinoma of the middle third of the oesophagus were examined for the expression of p53, bcl-2 and apoptosis using immunohistochemical markers. There was no expression of p53 in one patient in both pre- and post-brachytherapy specimens. In 8 patients, p53 staining was strongly positive (3+) with approximately 50% or more cells, and with diffuse and no specific pattern in the pre-brachytherapy biopsies. The tumour areas of the post-brachytherapy specimens of this group showed strong 3+ positivity with p53 (10-50% positive cell count), with the pattern being focal and peripheral in the tumour islands. The centre of the tumour islands showed necrosis and/or keratinisation. In one patient, the pre-brachytherapy biopsy showed expression of p53 while the post-brachytherapy specimen was negative. bcl-2 expression in both pre- and post-brachytherapy was equivocal and inconclusive in both the pre- and post-brachytherapy specimens. Apoptosis was negative in all the pre- and post-brachytherapy tissue sections in the presence of positive controls. Brachytherapy does not cause cell death by apoptosis but by necrosis and maturation of the cells into better differentiated cells, which is caused by OH free radical, and induction of the keratin gene respectively. It is possible that brachytherapy may cause destruction of cells containing wild-type p53, while mutant p53 in cells located at the tumour periphery escape the effect of brachytherapy. This may be responsible for the high incidence of local recurrence and distant metastasis in oesophageal cancer treated with radiotherapy. There is no effect of brachytherapy on bcl-2 expression in oesophageal cancer.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke
1997-05-01
Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less
Wei, W; Chen, Z-J; Zhang, K-S; Yang, X-L; Wu, Y-M; Chen, X-H; Huang, H-B; Liu, H-L; Cai, S-H; Du, J; Wang, H-S
2014-10-02
There is an urgent clinical need for safe and effective treatment agents and therapy targets for estrogen receptor negative (ER-) breast cancer. G protein-coupled receptor 30 (GPR30), which mediates non-genomic signaling of estrogen to regulate cell growth, is highly expressed in ER--breast cancer cells. We here showed that activation of GPR30 by the receptor-specific agonist G-1 inhibited the growth of ER--breast cancer cells in vitro. Treatment of ER--breast cancer cells with G-1 resulted in G2/M-phase arrest, downregulation of G2-checkpoint regulator cyclin B, and induction of mitochondrial-related apoptosis. The G-1 treatment increased expression of p53 and its phosphorylation levels at Serine 15, promoted its nuclear translocation, and inhibited its ubiquitylation, which mediated the growth arrest effects on cell proliferation. Further, the G-1 induced sustained activation and nuclear translocation of ERK1/2, which was mediated by GPR30/epidermal growth factor receptor (EGFR) signals, also mediated its inhibition effects of G-1. With extensive use of siRNA-knockdown experiments and inhibitors, we found that upregulation of p21 by the cross-talk of GPR30/EGFR and p53 was also involved in G-1-induced cell growth arrest. In vivo experiments showed that G-1 treatment significantly suppressed the growth of SkBr3 xenograft tumors and increased the survival rate, associated with proliferation suppression and upregulation of p53, p21 while downregulation of cyclin B. The discovery of multiple signal pathways mediated the suppression effects of G-1 makes it a promising candidate drug and lays the foundation for future development of GPR30-based therapies for ER- breast cancer treatment.
Zuckerbraun, Brian S; Shapiro, Richard A; Billiar, Timothy R; Tzeng, Edith
2003-08-19
The 42/44-kD mitogen-activated protein kinases (extracellular signal-regulated kinases, ERKs) regulate smooth muscle cell (SMC) cell-cycle progression and can either promote or inhibit proliferation depending on the activation status of the small GTPase RhoA. RhoA is involved in the regulation of the actin cytoskeleton and converges on multiple signaling pathways. However, the mechanism by which RhoA modulates ERK signaling is not well defined. The purpose of this investigation was to examine whether RhoA regulates ERK downstream signaling and cellular proliferation through its effects on the cytoskeleton and the nuclear localization of ERK. Treatment of SMCs with Clostridia botulinum C3 exoenzyme, which inhibits RhoA activation, decreased SMC proliferation to 24+/-7% of that of controls and increased p21Waf1/Cip1 transcription and protein levels. These effects of RhoA were reversed by inhibition of ERK phosphorylation. However, inactivation of RhoA did not alter levels of ERK phosphorylation but did increase nuclear localization of phosphorylated ERK. In addition, immunostaining demonstrated that phosphorylated ERK associated with the actin cytoskeleton, which was disrupted by C3 exoenzyme. Leptomycin B, an inhibitor of Crm1 that results in ERK nuclear accumulation, similarly increased p21Waf1/Cip1. RhoA inhibition increased levels of phosphorylated ERK in the cell nucleus. Inhibition of RhoA or pharmacological inhibition of nuclear export resulted in increased p21Waf1/Cip1 expression and decreased SMC proliferation, effects that were partially dependent on ERK. RhoA regulation of the actin cytoskeleton may determine ERK subcellular localization and its subsequent effects on SMC proliferation.
Han, Juan; Tang, Feng-ming; Pu, Dan; Xu, Dan; Wang, Tao; Li, Weimin
2014-01-01
Overexpression of heterogeneous nuclear ribonucleoprotein B1 (hnRNP B1), a nuclear RNA binding protein, has been reported to occur in early-stage lung cancer and in premalignant lesions. DNA-dependent protein kinase (DNA-PK) is known to be involved in the repair of double-strand DNA breaks. Reduced capacity to repair DNA has been associated with the risk of lung cancer. We investigated a link between hnRNP B1 and DNA-PK and their effects on proliferation, cell cycle, and apoptosis in the human lung adenocarcinoma cell line A549. We found that hnRNP B1 and DNA-PK interact with each other in a complex fashion. Reducing hnRNP B1 expression in A549 cells with the use of RNAi led to upregulation of p53 activity through upregulation of DNA-PK activity but without inducing p53 expression. Further, suppression of hnRNP B1 in A549 cells slowed cell proliferation, promoted apoptosis, and induced cell cycle arrest at the G1 stage. The presence of NU7026 reduced the arrest of cells at the G1 stage and reduced the apoptosis rate while promoting cell growth. Taken together, our results demonstrate that by regulating DNA-PK activity, hnRNP B1 can affect p53-mediated cell cycle progression and apoptosis, resulting in greater cell survival and subsequent proliferation.
Zimnik, Susan; Gaestel, Matthias; Niedenthal, Rainer
2009-03-01
Post-translational modifications control the physiological activity of the signal transducer and activator of transcription STAT1. While phosphorylation at tyrosine Y701 is a prerequisite for STAT1 dimerization, its SUMOylation represses the transcriptional activity. Recently, we have demonstrated that SUMOylation at lysine K703 inhibits the phosphorylation of nearby localized Y701 of STAT1. Here, we analysed the influence of phosphorylation of Y701 on SUMOylation of K703 in vivo. For that reason, an Ubc9/substrate dimerization-dependent SUMOylation (USDDS) system was developed, which consists of fusions of the SUMOylation substrate and of the SUMO-conjugating enzyme Ubc9 to the chemically activatable heterodimerization domains FKBP and FRB, respectively. When FKBP fusion proteins of STAT1, p53, CRSP9, FOS, CSNK2B, HES1, TCF21 and MYF6 are coexpressed with Ubc9-FRB, treatment of HEK293 cells with the rapamycin-related dimerizer compound AP21967 induces SUMOylation of these proteins in vivo. For STAT1-FKBP and p53-FKBP we show that this SUMOylation takes place at their specific SUMOylation sites in vivo. Using USDDS, we then demonstrate that STAT1 phosphorylation at Y701 induced by interferon-beta treatment inhibits SUMOylation of K703 in vivo. Thus, pY701 and SUMO-K703 of STAT1 represent mutually exclusive modifications, which prevent signal integration at this molecule and probably ensure the existence of differentially modified subpopulations of STAT1 necessary for its regulated nuclear cytoplasmic activation/inactivation cycle.
The Nuclear Receptor TLX Is Required for Gliomagenesis within the Adult Neurogenic Niche
Zou, Yuhua; Niu, Wenze; Qin, Song; Downes, Michael; Burns, Dennis K.
2012-01-01
Neural stem cells (NSCs) continually generate functional neurons in the adult brain. Due to their ability to proliferate, deregulated NSCs or their progenitors have been proposed as the cells of origin for a number of primary central nervous system neoplasms, including infiltrating gliomas. The orphan nuclear receptor TLX is required for proliferation of adult NSCs, and its upregulation promotes brain tumor formation. However, it is unknown whether TLX is required for gliomagenesis. We examined the genetic interactions between TLX and several tumor suppressors, as well as the role of TLX-dependent NSCs during gliomagenesis, using mouse models. Here, we show that TLX is essential for the proliferation of adult NSCs with a single deletion of p21, p53, or Pten or combined deletion of Pten and p53. While brain tumors still form in Tlx mutant mice, these tumors are less infiltrative and rarely associate with the adult neurogenic niches, suggesting a non-stem-cell origin. Taken together, these results indicate a critical role for TLX in NSC-dependent gliomagenesis and implicate TLX as a therapeutic target to inhibit the development of NSC-derived brain tumors. PMID:23028043
The nuclear receptor TLX is required for gliomagenesis within the adult neurogenic niche.
Zou, Yuhua; Niu, Wenze; Qin, Song; Downes, Michael; Burns, Dennis K; Zhang, Chun-Li
2012-12-01
Neural stem cells (NSCs) continually generate functional neurons in the adult brain. Due to their ability to proliferate, deregulated NSCs or their progenitors have been proposed as the cells of origin for a number of primary central nervous system neoplasms, including infiltrating gliomas. The orphan nuclear receptor TLX is required for proliferation of adult NSCs, and its upregulation promotes brain tumor formation. However, it is unknown whether TLX is required for gliomagenesis. We examined the genetic interactions between TLX and several tumor suppressors, as well as the role of TLX-dependent NSCs during gliomagenesis, using mouse models. Here, we show that TLX is essential for the proliferation of adult NSCs with a single deletion of p21, p53, or Pten or combined deletion of Pten and p53. While brain tumors still form in Tlx mutant mice, these tumors are less infiltrative and rarely associate with the adult neurogenic niches, suggesting a non-stem-cell origin. Taken together, these results indicate a critical role for TLX in NSC-dependent gliomagenesis and implicate TLX as a therapeutic target to inhibit the development of NSC-derived brain tumors.
McDuffie, Lucas A; Sabesan, Arvind; Allgäeuer, Michael; Xin, Liqiang; Koh, Christopher; Heller, Theo; Davis, Jeremy L; Raffeld, Mark; Miettienen, Markku; Quezado, Martha; Rudloff, Udo
2016-09-01
To evaluate possible colon involvement in the 'gastric adenocarcinoma and proximal polyposis of the stomach' (GAPPS) gastrointestinal polyposis syndrome. Prospective clinicopathological evaluation of two GAPPS families and expression of nuclear β-catenin, p53 and Ki67 measured by immunohistochemistry on endoscopic and surgical specimens from patients with GAPPS. Patients with the GAPPS phenotype were more frequently affected by colonic polyps than patients at risk within the same families (p<0.01). Colonic polyps shared immunohistochemical features of fundic gland polyps and gastric cancers including increased expression of nuclear β-catenin, Ki67 and p53. Both gastric and colonic lesions harboured activating somatic variants of β-catenin signalling. Similarities in expression markers in fundic gland and colonic polyps, together with an enrichment of colonic adenomas in family members affected by GAPPS phenotype compared with family members at risk, support mild colonic involvement of this rare cancer syndrome. Colonoscopic screening might be warranted. #09-C-0079; Results. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
2006-10-01
then sequenced (for GeneChip- positiv SSCP (for GeneChip-negative). We have received a total of 43 core breast biopsy DNA samples from the UNC... quantitative luciferase reporter. Both reporters exploit a “rheostatable” promoter for p53 expression and utilize the “delitto perfetto” in vivo... quantitative luciferase-based assay is also being used to characterize the altered function sistent an tion T mutants in greater detail. Preliminary
Kalmodia, Sushma; Parameswaran, Sowmya; Ganapathy, Kalaivani; Yang, Wenrong; Barrow, Colin J; Kanwar, Jagat R; Roy, Kislay; Vasudevan, Madavan; Kulkarni, Kirti; Elchuri, Sailaja V; Krishnakumar, Subramanian
2017-12-15
Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB). Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs) to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Ginés, Alba; Bystrup, Sara; Ruiz de Porras, Vicenç; Guardia, Cristina; Musulén, Eva; Martínez-Cardús, Anna; Manzano, José Luis; Layos, Laura; Abad, Albert; Martínez-Balibrea, Eva
2015-01-01
Chemoresistance is the main cause of treatment failure in advanced colorectal cancer (CRC). However, molecular mechanisms underlying this phenomenon remain to be elucidated. In a previous work we identified low levels of PKM2 as a putative oxaliplatin-resistance marker in HT29 CRC cell lines and also in patients. In order to assess how PKM2 influences oxaliplatin response in CRC cells, we silenced PKM2 using specific siRNAs in HT29, SW480 and HCT116 cells. MTT test demonstrated that PKM2 silencing induced resistance in HT29 and SW480 cells and sensitivity in HCT116 cells. Same experiments in isogenic HCT116 p53 null cells and double silencing of p53 and PKM2 in HT29 cells failed to show an influence of p53. By using trypan blue stain and FITC-Annexin V/PI tests we detected that PKM2 knockdown was associated with an increase in cell viability but not with a decrease in apoptosis activation in HT29 cells. Fluorescence microscopy revealed PKM2 nuclear translocation in response to oxaliplatin in HCT116 and HT29 cells but not in OXA-resistant HTOXAR3 cells. Finally, by using a qPCR Array we demonstrated that oxaliplatin and PKM2 silencing altered cell death gene expression patterns including those of BMF, which was significantly increased in HT29 cells in response to oxaliplatin, in a dose and time-dependent manner, but not in siPKM2-HT29 and HTOXAR3 cells. BMF gene silencing in HT29 cells lead to a decrease in oxaliplatin-induced cell death. In conclusion, our data report new non-glycolytic roles of PKM2 in response to genotoxic damage and proposes BMF as a possible target gene of PKM2 to be involved in oxaliplatin response and resistance in CRC cells. PMID:25955657
Shin, Hyeon-Jun; Kwon, Hyuk-Kwon; Lee, Jae-Hyeok; Gui, Xiangai; Achek, Asma; Kim, Jae-Ho; Choi, Sangdun
2015-11-02
Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is thought to mediate necrosis by inducing DNA damage, although this remains unconfirmed. In this study, we examined the mechanisms of PARP1-mediated necrosis following doxorubicin (DOX)-induced DNA damage in human kidney proximal tubular (HK-2) cells. DOX initiated DNA damage response (DDR) and upregulated PARP1 and p53 expression, resulting in morphological changes similar to those observed during necrosis. Additionally, DOX induced mitochondrial hyper-activation, as evidenced by increased mitochondrial respiration and cytosolic ATP (cATP) production. However, DOX affected mitochondrial mass. DOX-induced DNA damage, cytosolic reactive oxygen species (cROS) generation, and mitochondrial hyper-activation decreased in cells with inhibited PARP1 expression, while generation of nitric oxide (NO) and mitochondrial ROS (mROS) remained unaffected. Moreover, DOX-induced DNA damage, cell cycle changes, and oxidative stress were not affected by p53 inhibition. These findings suggest that DNA damage induced necrosis through a PARP1-dependent and p53-independent pathway.
Shin, Hyeon-Jun; Kwon, Hyuk-Kwon; Lee, Jae-Hyeok; Gui, Xiangai; Achek, Asma; Kim, Jae-Ho; Choi, Sangdun
2015-01-01
Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is thought to mediate necrosis by inducing DNA damage, although this remains unconfirmed. In this study, we examined the mechanisms of PARP1-mediated necrosis following doxorubicin (DOX)-induced DNA damage in human kidney proximal tubular (HK-2) cells. DOX initiated DNA damage response (DDR) and upregulated PARP1 and p53 expression, resulting in morphological changes similar to those observed during necrosis. Additionally, DOX induced mitochondrial hyper-activation, as evidenced by increased mitochondrial respiration and cytosolic ATP (cATP) production. However, DOX affected mitochondrial mass. DOX-induced DNA damage, cytosolic reactive oxygen species (cROS) generation, and mitochondrial hyper-activation decreased in cells with inhibited PARP1 expression, while generation of nitric oxide (NO) and mitochondrial ROS (mROS) remained unaffected. Moreover, DOX-induced DNA damage, cell cycle changes, and oxidative stress were not affected by p53 inhibition. These findings suggest that DNA damage induced necrosis through a PARP1-dependent and p53-independent pathway. PMID:26522181
Lee, Dong-Kee; Kang, Jae-Eun; Park, Hye-Jin; Kim, Myung-Hwa; Yim, Tae-Hee; Kim, Jung-Min; Heo, Min-Kyu; Kim, Kyu-Yeun; Kwon, Ho Jeong; Hur, Man-Wook
2005-07-29
The POZ domain is a highly conserved protein-protein interaction motif found in many regulatory proteins. Nuclear factor-kappaB (NF-kappaB) plays a key role in the expression of a variety of genes in response to infection, inflammation, and stressful conditions. We found that the POZ domain of FBI-1 (factor that binds to the inducer of short transcripts of human immunodeficiency virus-1) interacted with the Rel homology domain of the p65 subunit of NF-kappaB in both in vivo and in vitro protein-protein interaction assays. FBI-1 enhanced NF-kappaB-mediated transcription of E-selectin genes in HeLa cells upon phorbol 12-myristate 13-acetate stimulation and overcame gene repression by IkappaB alpha or IkappaB beta. In contrast, the POZ domain of FBI-1, which is a dominant-negative form of FBI-1, repressed NF-kappaB-mediated transcription, and the repression was cooperative with IkappaB alpha or IkappaB beta. In contrast, the POZ domain tagged with a nuclear localization sequence polypeptide of FBI-1 enhanced NF-kappaB-responsive gene transcription, suggesting that the molecular interaction between the POZ domain and the Rel homology domain of p65 and the nuclear localization by the nuclear localization sequence are important in the transcription enhancement mediated by FBI-1. Confocal microscopy showed that FBI-1 increased NF-kappaB movement into the nucleus and increased the stability of NF-kappaB in the nucleus, which enhanced NF-kappaB-mediated transcription of the E-selectin gene. FBI-1 also interacted with IkappaB alpha and IkappaB beta.
Regulators of apoptosis in cholangiocarcinoma.
Jhala, Nirag C; Vickers, Selwyn M; Argani, Pedram; McDonald, Jay M
2005-04-01
Dysregulation of mediators of apoptosis is associated with carcinogenesis. For biliary duct cancers, p53 gene mutation is an important contributor to carcinogenesis. Mutations in the p53 gene affect transcription of the Fas gene, resulting in lack of Fas expression on cell membrane. It has been previously shown that cloned Fas-negative but not Fas-positive human cholangiocarcinoma cells are resistant to anti-Fas-mediated apoptosis and develop tumors in nude mice. In addition, interferon gamma induces Fas expression in Fas-negative cholangiocarcinoma cells and makes them susceptible to apoptosis. Therefore, it becomes important to characterize immunophenotypic expression of p53 and Fas in normal and neoplastic human tissues of the biliary tract to further understand the pathogenesis of the disease. To date, human studies to characterize differences in immunophenotypic expression of the Fas protein between intrahepatic and extrahepatic biliary duct cancers and in their precursor lesions have not been performed. To report the immunophenotypic expression of p53 and Fas expression in various stages in the development of bile duct cancers (intrahepatic and extrahepatic tumor location) and their association with tumor differentiation. Thirty bile duct cancer samples (13 intrahepatic and 17 extrahepatic) from 18 men and 12 women who ranged in age from 44 to 77 years (mean age, 65.6 years) were retrieved from the surgical pathology files. Hematoxylin-eosin-stained slides were evaluated for the type and grade of tumor and dysplastic changes in the biliary tract epithelium. Additional slides were immunohistochemically stained with p53 and anti-Fas mouse monoclonal antibody. The pattern of Fas distribution and percentage of cells positive for p53 and Fas expression were determined. The percentage of Fas-expressing cells is significantly (P = .01) more frequently noted in extrahepatic tumors compared with intrahepatic tumors. Furthermore, Fas expression decreased from dysplastic epithelium to cholangiocarcinoma (P = .01), and this decreasing trend continued from well to poorly differentiated tumors. Nuclear p53 expression was not identified in normal and dysplastic epithelium but was noted in 30% of carcinomas (P = .02). Fas expression is an early event in pathogenesis of bile duct cancers. Immunophenotypic expression of Fas is associated with well to moderately differentiated tumors but not with poor tumor differentiation.
Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio
2017-01-01
The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.
Fields, A P; Kaufmann, S H; Shaper, J H
1986-05-01
When rat liver nuclei are treated with the sulfhydryl cross-linking reagent sodium tetrathionate (NaTT) prior to nuclease treatment and extraction with 1.6 M NaCl, residual nucleoli and an extensive non-chromatin intranuclear network remain associated with the nuclear envelope. Subsequent treatment of this structure with 1 M NaCl containing 20 mM dithiothreitol (DTT) solubilizes the intranuclear material, while the nuclear envelope remains structurally intact. We have isolated and partially characterized a major polypeptide of the disulfide-stabilized internal nuclear matrix. The polypeptide, which has an apparent molecular mass 38 kD and isoelectric point 5.3, has been localized to the nucleolus of rat liver nuclei by indirect immunofluorescence using a specific polyclonal chicken antiserum. Based on its molecular mass, isoelectric point, intracellular localization and amino acid composition, the 38 kD polypeptide appears to be analogous to the nucleolar phosphoprotein B23 described by Prestayko et al. (Biochemistry 13 (1974) 1945) [20]. Immunologically related polypeptides have likewise been localized to the nucleoli of both hamster and human tissue culture cell lines as well as the cellular slime mold Physarum polycephalum. By immunoblotting, a single 38 kD polypeptide is recognized by the antiserum in rat, mouse, hamster and human cell lines. The antiserum has been utilized to investigate the oligomeric structure of the 38 kD polypeptide and the nature of its association with the rat liver nuclear matrix. By introducing varying numbers of disulfide bonds, we have found that the 38 kD polypeptide becomes incorporated into the internal nuclear matrix in a two-step process. Soluble disulfide-bonded homodimers of the polypeptide are first formed and then are rendered salt-insoluble by more extensive disulfide cross-linking.
Barel, M; Fiandino, A; Lyamani, F; Frade, R
1989-01-01
Epstein-Barr virus and the C3d fragment of the third component of complement are specific extracellular ligands for complement receptor type 2 (CR2). However, intracellular proteins that react specifically with CR2 and are involved in post-membrane signals remain unknown. We recently prepared polyclonal anti-idiotypic anti-CR2 antibodies (Ab2) by using the highly purified CR2 molecule as original immunogen. We showed that Ab2 contained anti-idiotypic specificities that mimicked extracellular domains of CR2 and detected two distinct binding sites on CR2 for its specific extracellular ligands, Epstein-Barr virus and C3d. We postulated that Ab2 might also contain specificities that could mimic intracellular domains of CR2. Here we report that Ab2, which did not react with Raji B-lymphoma cell surface components, detected specifically, among all components solubilized from Raji cell membranes, a single intracellular membrane protein of apparent molecular mass of 53 kDa. This protein was identified as the p53 cellular antioncogene-encoded membrane phosphoprotein by analyzing its antigenic properties with Pab1801, a monoclonal anti-p53 antibody, and by comparing its biochemical properties with those of p53. Additionally, solubilized and purified CR2 bound to solubilized p53 immobilized on Pab1801-Sepharose. p53, like CR2, was localized only in purified plasma membranes and nuclei of Raji cells. These data suggest strongly that p53, a cellular antioncogene-encoded phosphoprotein, reacted specifically with CR2 in Raji membranes. This interaction may represent one of the important steps through which CR2 could be involved in human B-lymphocyte proliferation and transformation. Images PMID:2557614
Rechter, Sabine; Scott, Gillian M.; Eickhoff, Jan; Zielke, Katrin; Auerochs, Sabrina; Müller, Regina; Stamminger, Thomas; Rawlinson, William D.; Marschall, Manfred
2009-01-01
Replication of human cytomegalovirus (HCMV) is subject to regulation by cellular protein kinases. Recently, we and others reported that inhibition of cyclin-dependent protein kinases (CDKs) or the viral CDK ortholog pUL97 can induce intranuclear speckled aggregation of the viral mRNA export factor, pUL69. Here we provide the first evidence for a direct regulatory role of CDKs on pUL69 functionality. Although replication of all HCMV strains was dependent on CDK activity, we found strain-specific differences in the amount of CDK inhibitor-induced pUL69 aggregate formation. In all cases analyzed, the inhibitor-induced pUL69 aggregates were clearly localized within viral replication centers but not subnuclear splicing, pore complex, or aggresome structures. The CDK9 and cyclin T1 proteins colocalized with these pUL69 aggregates, whereas other CDKs behaved differently. Phosphorylation analyses in vivo and in vitro demonstrated pUL69 was strongly phosphorylated in HCMV-infected fibroblasts and that CDKs represent a novel class of pUL69-phosphorylating kinases. Moreover, the analysis of CDK inhibitors in a pUL69-dependent nuclear mRNA export assay provided evidence for functional impairment of pUL69 under suppression of CDK activity. Thus, our data underline the crucial importance of CDKs for HCMV replication, and indicate a direct impact of CDK9-cyclin T1 on the nuclear localization and activity of the viral regulator pUL69. PMID:19179338
Hoang, Lien N; Han, Guangming; McConechy, Melissa; Lau, Sherman; Chow, Christine; Gilks, C Blake; Huntsman, David G; Köbel, Martin; Lee, Cheng-Han
2014-03-01
The great majority of ovarian clear cell carcinomas have a hepatocyte nuclear factor 1 homeobox B (HNF-1β)-positive and oestrogen receptor (ER)-negative immunoprofile. However, the pattern of HNF-1β and ER immunostaining in clear cell carcinomas of the endometrium and the usefulness of this panel in distinguishing clear cell carcinoma from other histological types of endometrial carcinoma have yet to be well defined. We examined the immunostaining patterns of HNF-1β, ER and p53 in 15 morphologically classic pure endometrial clear cell carcinomas, and compared these patterns with 15 endometrioid and 15 serous carcinomas of the endometrium. We observed the presence of diffuse (>70%) moderate to strong nuclear HNF-1β staining and negative ER staining in 14 of 15 clear cell carcinomas, with the remaining case showing both diffuse strong nuclear HNF-1β staining and focal ER staining. In comparison, only one of 15 serous carcinomas and none of 15 endometrioid carcinomas showed a combination of diffuse moderate to strong HNF-1β nuclear staining and negative ER staining. Aberrant p53 immunostaining was observed in five of 15 (33%) clear cell carcinomas. Overall, our findings demonstrate that, similarly to the situation for the ovary, a diagnostic panel of HNF-1β and ER may be considered for separating clear cell carcinoma from endometrioid and serous carcinoma of the endometrium. © 2013 John Wiley & Sons Ltd.
Yanai, Mako; Sakai, Madoka; Makino, Akiko; Tomonaga, Keizo
2017-07-11
Borna disease virus (BoDV), which has a negative-sense, single-stranded RNA genome, causes persistent infection in the cell nucleus. The nuclear export signal (NES) of the viral nucleoprotein (N) consisting of leucine at positions 128 and 131 and isoleucine at positions 133 and 136 overlaps with one of two predicted binding sites for the viral phosphoprotein (P). A previous study demonstrated that higher expression of BoDV-P inhibits nuclear export of N; however, the function of N NES in the interaction with P remains unclear. We examined the subcellular localization, viral polymerase activity, and P-binding ability of BoDV-N NES mutants. We also characterized a recombinant BoDV (rBoDV) harboring an NES mutation of N. BoDV-N with four alanine-substitutions in the leucine and isoleucine residues of the NES impaired its cytoplasmic localization and abolished polymerase activity and P-binding ability. Although an alanine-substitution at position 131 markedly enhanced viral polymerase activity as determined by a minigenome assay, rBoDV harboring this mutation showed expression of viral RNAs and proteins relative to that of wild-type rBoDV. Our results demonstrate that BoDV-N NES has a dual function in BoDV replication, i.e., nuclear export of N and an interaction with P, affecting viral polymerase activity in the nucleus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woolston, Caroline M.; Al-Attar, Ahmad; Storr, Sarah J.
2011-04-01
Purpose: Early-stage invasive breast cancer patients have commonly undergone breast-conserving surgery and radiotherapy. In a large majority of these patients, the treatment is effective; however, a proportion will develop local recurrence. Deregulated redox systems provide cancer cells protection from increased oxidative stress, such as that induced by ionizing radiation. Therefore, the expression of redox proteins was examined in tumor specimens from this defined cohort to determine whether such expression could predict response. Methods and Materials: The nuclear and cytoplasmic expression of nine redox proteins (glutathione, glutathione reductase, glutaredoxin, glutathione peroxidase 1, 3, and 4, and glutathione S-transferase-{theta}, -{pi}, and -{alpha})more » was assessed using conventional immunohistochemistry on a tissue microarray of 224 tumors. Results: A high cytoplasmic expression of glutathione S-transferase-{theta} significantly correlated with a greater risk of local recurrence (p = .008) and, when combined with a low nuclear expression (p = .009), became an independent predictive factor (p = .002) for local recurrence. High cytoplasmic expression of glutathione S-transferase-{theta} also correlated with a worse overall survival (p = .009). Low nuclear and cytoplasmic expression of glutathione peroxidase 3 (p = .002) correlated with a greater risk of local recurrence and was an independent predictive factor (p = .005). These proteins did not correlate with tumor grade, suggesting their function might be specific to the regulation of oxidative stress rather than alterations of tumor phenotype. Only nuclear (p = .005) and cytoplasmic (p = .001) expression of glutathione peroxidase 4 correlated with the tumor grade. Conclusions: Our results support the use of redox protein expression, namely glutathione S-transferase-{theta} and glutathione peroxidase 3, to predict the response to radiotherapy in early-stage breast cancer patients. If incorporated into routine diagnostic tests, they have the potential to aid clinicians in their stratification of patients into more tailored treatment regimens. Future targeted therapies to these systems might improve the efficacy of reactive oxygen species-inducing therapies, such as radiotherapy.« less
Fu, San; Yang, Yanfang; Liu, Dan; Luo, Yan; Ye, Xiaochuan; Liu, Yanwen; Chen, Xin; Wang, Song; Wu, Hezhen; Wang, Yuhang; Hu, Qiwei; You, Pengtao
2017-01-01
In vitro evidence indicates that Smilax china L. rhizome (SCR) can inhibit cell proliferation. Therefore, in the present study, we analyzed the effects in vitro of SCR extracts on human lung adenocarcinoma A549 cells. Our results showed that A549 cell growth was inhibited in a dose- and time-dependent manner after treatment with SCR extracts. Total flavonoids and total tannins from SCR induced A549 apoptosis in a dose-dependent manner, as shown by our flow cytometry analysis, which was consistent with the alterations in nuclear morphology we observed. In addition, the total apoptotic rate induced by total tannins was higher than the rate induced by total flavonoids at the same dose. Cleaved-caspase-3 protein levels in A549 cells after treatment with total flavonoids or total tannins were increased in a dose-dependent manner, followed by the activation of caspase-8 and caspase-9, finally triggering to PARP cleavage. Furthermore, total flavonoids and total tannins increased the expression of Bax, decreased the expression of Bcl-2, and promoted cytochrome [Formula: see text] release. Moreover, MDM2 and p-MDM2 proteins were decreased, while p53 and p-p53 proteins were increased, both in a dose-dependent manner, after A549 treatment with total flavonoids and total tannins. Finally, cleaved-caspase-3 protein levels in the total flavonoids or total tannins-treated H1299 (p53 null) and p53-knockdown A549 cells were increased. Our results indicated that total flavonoids and total tannins from SCR exerted a remarkable effect in reducing A549 growth through their action on mitochondrial pathway and disruption of MDM2-p53 balance. Hence, our findings demonstrated a potential application of total flavonoids and total tannins from SCR in the treatment of human lung adenocarcinoma.
Takeda, Yohei; Yashima, Kazuo; Hayashi, Akihiro; Sasaki, Shuji; Kawaguchi, Koichiro; Harada, Kenichi; Murawaki, Yoshikazu; Ito, Hisao
2012-01-01
AIM: To analyze the expression of the tumor-related proteins in differentiated-type early gastric carcinoma (DEGC) samples. METHODS: Tumor specimens were obtained from 102 patients (75 males and 27 females) who had received an endoscopic tumor resection at Tottori University Hospital between 2007 and 2009. Ninety-one cancer samples corresponded to noninvasive or intramucosal carcinoma according to the Vienna classification system, and 11 samples were submucosal invasive carcinomas. All of the EGCs were histologically differentiated carcinomas. All patients were classified as having Helicobacter pylori (H. pylori) infections by endoscopic atrophic changes or by testing seropositive for H. pylori IgG. All of the samples were histopathologically classified as either tubular or papillary adenocarcinoma according to their structure. The immunohistochemical staining was performed in a blinded manner with respect to the clinical information. Two independent observers evaluated protein expression. All data were statistically analyzed then. RESULTS: The rates of aberrant activation-induced cytidine deaminase (AID) expression and P53 overexpression were both 34.3% in DEGCs. The expression of Mlh1 was lost in 18.6% of DEGCs. Aberrant AID expression was not significantly associated with P53 overexpression in DEGCs. However, AID expression was associated with the severity of mononuclear cell activity in the non-cancerous mucosa adjacent to the tumor (P = 0.064). The rate of P53 expression was significantly greater in flat or depressed tumors than in elevated tumors. The frequency of Mlh1 loss was significantly increased in distal tumors, elevated gross-type tumors, papillary histological-type tumors, and tumors with a severe degree of endoscopic atrophic gastritis (P < 0.05). CONCLUSION: Aberrant AID expression, P53 overexpression, and the loss of Mlh1 were all associated with clinicopathological features and gastric mucosal alterations in DEGCs. The aberrant expression of AID protein may partly contribute to the induction of nuclear P53 expression. PMID:22737274
Rubiolo, J A; López-Alonso, H; Vega, F V; Vieytes, M R; Botana, L M
2012-03-10
To determine the relative toxicity and effects on the cell cycle of okadaic acid and dinophysistoxin-2 in primary hepatocyte cultures. Cytotoxicity was determined by the MTT method, caspase-3 activity and lactate dehydrogenase release to the medium. The cell cycle analysis was performed by imaging flow cytometry and the effect of the toxins on cell proliferation was studied by quantitative PCR and confocal microscopy. We show that dinophysistoxin-2 is less toxic than okadaic acid for primary hepatocytes with a similar difference in potency as that observed in vivo in mice after intraperitoneal injection. Both toxins induced apoptosis with caspase-3 increase. They also inhibited the hepatocytes cell cycle in G1 affecting diploid cells and diploid bi-nucleated cells. In proliferating hepatocytes exposed to the toxins, a decrease of p53 gene expression as well as a lower protein level was detected. Studies of the tubulin cytoskeleton in toxin treated cells, showed nuclear localization of this molecule and a granulated tubulin pattern in the cytoplasm. The results presented in this work show that the difference in toxicity between dinophysistoxin-2 and okadaic acid in cultured primary hepatocytes is the same as that observed in vivo after intraperitoneal injection. Okadaic acid and dinophysistoxin-2 arrest the cell cycle of hepatocytes at G1 even in diploid bi-nucleated cells. p53 and tubulin could be involved in the cell cycle inhibitory effect. Copyright © 2012 Elsevier Inc. All rights reserved.
XRN2 Links Transcription Termination to DNA Damage and Replication Stress.
Morales, Julio C; Richard, Patricia; Patidar, Praveen L; Motea, Edward A; Dang, Tuyen T; Manley, James L; Boothman, David A
2016-07-01
XRN2 is a 5'-3' exoribonuclease implicated in transcription termination. Here we demonstrate an unexpected role for XRN2 in the DNA damage response involving resolution of R-loop structures and prevention of DNA double-strand breaks (DSBs). We show that XRN2 undergoes DNA damage-inducible nuclear re-localization, co-localizing with 53BP1 and R loops, in a transcription and R-loop-dependent process. XRN2 loss leads to increased R loops, genomic instability, replication stress, DSBs and hypersensitivity of cells to various DNA damaging agents. We demonstrate that the DSBs that arise with XRN2 loss occur at transcriptional pause sites. XRN2-deficient cells also exhibited an R-loop- and transcription-dependent delay in DSB repair after ionizing radiation, suggesting a novel role for XRN2 in R-loop resolution, suppression of replication stress, and maintenance of genomic stability. Our study highlights the importance of regulating transcription-related activities as a critical component in maintaining genetic stability.
A new role of GCN2 in the nucleolus.
Nakamura, Akito; Kimura, Hiromichi
2017-04-01
General control nonderepressible 2 (GCN2) is activated by the accumulation of uncharged tRNA in response to amino acid shortage and regulates amino acid starvation response in the cytosol. Here we report the nucleolar localization of GCN2 and the association between GCN2 and small RNA transcripts. Immunofluorescence analysis revealed that GCN2 was constitutively localized to the nucleolus or recruited to the nucleolus by amino acid starvation stress. The nucleolus is the largest structure in the nucleus, where it primarily serves as the site of ribosome and RNA synthesis in addition to acting as a stress sensor through the regulation of p53 function. We found that siRNA-mediated depletion of GCN2 increases small RNA transcripts such as tRNA and 5S rRNA, and induces the p53 pathway activation. Derepression of these transcripts and p53 pathway activation by GCN2 depletion was restored by depletion of B-related factor 1 (BRF1), a primary subunit of RNA polymerase III (pol III) components. These data suggest that the excess amount of small RNA transcripts following GCN2 depletion was responsible for the p53 activation. Our findings reveal a role of GCN2 in the nucleolus that is involved in the expression of small RNA transcripts and serves as alternative stress-sensing machinery for nutrient deficiency. Thus, GCN2 may play pivotal roles in multiple protein translation checkpoints in both the nucleolus and cytosol. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Chang, D.; Haynes, J. I. 2nd; Brady, J. N.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)
1992-01-01
A nuclear localization signal (NLS) has been identified in the N-terminal (Ala1-Pro-Lys-Arg-Lys-Ser-Gly-Val-Ser-Lys-Cys11) amino acid sequence of the polyomavirus major capsid protein VP1. The importance of this amino acid sequence for nuclear transport of VP1 protein was demonstrated by a genetic "subtractive" study using the constructs pSG5VP1 (full-length VP1) and pSG5 delta 5'VP1 (truncated VP1, lacking amino acids Ala1-Cys11). These constructs were used to transfect COS-7 cells, and expression and intracellular localization of the VP1 protein was visualized by indirect immunofluorescence. These studies revealed that the full-length VP1 was expressed and localized in the nucleus, while the truncated VP1 protein was localized in the cytoplasm and not transported to the nucleus. These findings were substantiated by an "additive" approach using FITC-labeled conjugates of synthetic peptides homologous to the NLS of VP1 cross-linked to bovine serum albumin or immunoglobulin G. Both conjugates localized in the nucleus after microinjection into the cytoplasm of 3T6 cells. The importance of individual amino acids found in the basic sequence (Lys3-Arg-Lys5) of the NLS was also investigated. This was accomplished by synthesizing three additional peptides in which lysine-3 was substituted with threonine, arginine-4 was substituted with threonine, or lysine-5 was substituted with threonine. It was found that lysine-3 was crucial for nuclear transport, since substitution of this amino acid with threonine prevented nuclear localization of the microinjected, FITC-labeled conjugate.
Maeda, Tetsuyo; Nakanishi, Yoko; Hirotani, Yukari; Fuchinoue, Fumi; Enomoto, Katsuhisa; Sakurai, Kenichi; Amano, Sadao; Nemoto, Norimichi
2016-03-01
Triple negative breast cancer (TNBC) is immunohistochemically characterised by the lack of expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor type 2 (HER2). TNBC is known for its poor prognosis and high recurrence probability. There is no effective targeted treatment for TNBC, but only adjuvant chemotherapies. There are two TNBC subtypes, basal-like and non-basal-like, which are defined based on positive cytokeratin (CK) 5/6 and/or epidermal growth factor receptor (EGFR) expression. In particular, CK5/6 expression is reported to correlate with TNBC recurrence. TNBC lacks ER-α expression, but some TNBCs are known to express the androgen receptor (AR). Moreover, although p53 accumulation is detected in various malignant tumors, its influence on adjuvant chemotherapy for patients with TNBC remains unclear. The aim of this study was to assess the combined immunohistochemical expression of CK 5/6, AR, and p53 as a potential prognostic marker of adjuvant chemotherapy for patients with TNBC. The expression of CK5/6, AR, and p53 in formalin-fixed and paraffin-embedded (FFPE) surgical sections from 52 patients with TNBC was analysed by immunohistochemistry (IHC) and the co-expression patterns in individual cells were investigated by immunofluorescent (IF) staining. Low AR expression was correlated with high clinical stage (P < 0.05) and low nuclear grade (P < 0.05). The expression of CK5/6 and p53 did not correlate with clinicopathological features. Patients who needed adjuvant chemotherapy presented the worst prognosis. In particular, when the IHC expression pattern was CK5/6 (-), AR (-), and p53 (+), the disease free survival (DFS) and overall survival (OS) were the worst. On the other hand, patients with AR (+) and p53 (-) TNBC presented a good prognosis. The analysis of the co-expression status of these three markers showed that no cells presented both AR and CK5/6 expression. Furthermore, TP53 mRNA expression was higher in patients with AR-negative TNBC (P < 0.05) and in patients with the worst prognosis (P < 0.05) than in the other patients. These results suggested that, in patients with CK5/6-negative TNBC, AR expression correlated with good prognosis, but p53 accumulation correlated with poor prognosis. The present IHC markers allowed us to predict the post-surgery prognosis of patients with TNBC. In conclusion, TNBCs are heterogeneous. Patients with the CK5/6 (-), AR (-), and p53 (+) TNBC subtype, evaluated by IHC, presented the worst prognosis. These IHC markers will be helpful to follow patients with TNBC.
Seismic Surveillance. Nuclear Test Ban Verification
1990-02-26
e.g., see Matthews and Cheadle, 1986). To summarize, data processing tied to 8 msec sampling is a bit coarse for the sedimentary column but...Continental Extensional Tectonics. Geological Society Special Publication No. 28, 53-65. Matthews , D.H. and Cheadle, M.J. 1986: Deep Reflections from the...Laboratory P. 0. Box 73 P.O. Box 1620 Lexington, MA 02173-0073 (3 copies) La Jolla, CA 92038-1620 Prof Fred K. Lamb Prof. William Menke University of
p53 in breast cancer subtypes and new insights into response to chemotherapy.
Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues
2013-08-01
Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together, these data can help to better understand p53-mediated response to doxorubicin-based chemotherapy in breast cancer: in ER(+) TP53 WT breast cancers, ER-induced inhibition of p53 apoptotic response would lead preferentially to tumor cell senescence and subsequent resistance to treatment. Conversely, in ER negative (ER(-)) TP53 mutated breast cancers, accumulation of genetic abnormalities would lead to mitotic catastrophe and subsequent better response. In view of these recent results, p53 impact in breast cancer should be reconsidered. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takeda, Tomoya; Tsubaki, Masanobu; Sakamoto, Kotar
Advanced metastatic melanoma, one of the most aggressive malignancies, is currently without reliable therapy. Therefore, new therapies are urgently needed. Mangiferin is a naturally occurring glucosylxanthone and exerts many beneficial biological activities. However, the effect of mangiferin on metastasis and tumor growth of metastatic melanoma remains unclear. In this study, we evaluated the effect of mangiferin on metastasis and tumor growth in a mouse metastatic melanoma model. We found that mangiferin inhibited spontaneous metastasis and tumor growth. Furthermore, mangiferin suppressed the nuclear translocation of nuclear factor kappa B (NF-κB) and expression of phosphorylated NF-κB-inducing kinase (NIK), inhibitor of kappa Bmore » kinase (IKK), and inhibitor of kappa B (IκB) and increases the expression of IκB protein in vivo. In addition, we found that mangiferin inhibited the expression of matrix metalloproteinases (MMPs) and very late antigens (VLAs) in vivo. Mangiferin treatment also increased the expression of cleaved caspase-3, cleaved Poly ADP ribose polymerase-1 (PARP-1), p53 upregulated modulator of apoptosis (PUMA), p53, and phosphorylated p53 proteins, and decreased the expression of Survivin and Bcl-associated X (Bcl-xL) proteins in vivo. These results indicate that mangiferin selectivity suppresses the NF-κB pathway via inhibition of NIK activation, thereby inhibiting metastasis and tumor growth. Importantly, the number of reported NIK selective inhibitors is limited. Taken together, our data suggest that mangiferin may be a potential therapeutic agent with a new mechanism of targeting NIK for the treatment of metastatic melanoma. - Highlights: • Mangiferin prolongs survival in mice by inhibiting metastasis and tumor growth • Mangiferin selectivity suppresses the NF-κB pathway via inhibition of NIK activation • Mangiferin regulates the expression of MMPs, VLAs, and apoptosis regulatory proteins.« less
Silla, Toomas; Karadoulama, Evdoxia; Mąkosa, Dawid; Lubas, Michal; Jensen, Torben Heick
2018-05-15
Mammalian genomes are promiscuously transcribed, yielding protein-coding and non-coding products. Many transcripts are short lived due to their nuclear degradation by the ribonucleolytic RNA exosome. Here, we show that abolished nuclear exosome function causes the formation of distinct nuclear foci, containing polyadenylated (pA + ) RNA secluded from nucleocytoplasmic export. We asked whether exosome co-factors could serve such nuclear retention. Co-localization studies revealed the enrichment of pA + RNA foci with "pA-tail exosome targeting (PAXT) connection" components MTR4, ZFC3H1, and PABPN1 but no overlap with known nuclear structures such as Cajal bodies, speckles, paraspeckles, or nucleoli. Interestingly, ZFC3H1 is required for foci formation, and in its absence, selected pA + RNAs, including coding and non-coding transcripts, are exported to the cytoplasm in a process dependent on the mRNA export factor AlyREF. Our results establish ZFC3H1 as a central nuclear pA + RNA retention factor, counteracting nuclear export activity. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Tan, Zhi-Hui; Zhang, Yu; Tian, Yan; Tan, Wei; Li, Ying-Hua
2016-11-20
Cervical cancer is the second most common cancer of woman in the world, and human papillomavirus (HPV) infection plays an important role in the development of most of the cases. IκB kinase β (IKKβ) is a kinase-mediating nuclear factor kappa B (NF-κB) activation by phosphorylating the inhibitor of NF-κB (IκB) and is related by some diseases caused by virus infection. However, there is little known about the correlation between IKKβ and HPV infection in cervical cancer. This study aimed to investigate the expression of IKKβ protein in cervical cancer tissues and effects of inflammation on HPV positive or negative cervical cancer cells through detecting the expression of IKKβ, IκBα, p53, and p21 proteins after treated with lipopolysaccharide (LPS) to mimic bacterial infection. We also examined the effects of LPS on cervical cancer cells after blocking IKKβ with pharmacological inhibitor. Thirty-six matched specimens of cervical cancer and adjacent normal tissues were collected and analyzed in the study. The expression of IKKβ in the tissue specimens was determined by immunohistochemical staining. In addition, Western blot was used to detect the expression level changes of IKKβ, IκBα, p53, and p21 after LPS stimulated in the HPV16+ (SiHa) and HPV16- (C33A) cervical cancer cell lines. Furthermore, the effects of IKKβ inhibitor SC-514 on LPS-induced expression change of these proteins were investigated. The expression of IKKβ was higher in cervical cancer than adjacent normal tissues, and there was no significant difference between tumor differentiation, size, and invasive depth with IKKβ expression. The LPS, which increased the expression level of IKKβ protein but decreased in the IκBα, p53 and p21 proteins, was illustrated in HPV16+ (SiHa) but not in HPV16- (C33A) cells. Moreover, IKKβ inhibitor SC-514 totally reversed the upregulation of IKKβ and downregulation of p53 and p21 by LPS in SiHa cells. IKKβ may mediate the downregulation of p53 and p21 by LPS in HPV16+ cervical cancer cells.
Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panta, Sushil; Yamakuchi, Munekazu; Kagoshima University Hospital, Kagoshima
In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclearmore » localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β{sub 3}-integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β{sub 3}-integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β{sub 3}-integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β{sub 3}-integrin pathway in endothelial cells.« less
2014-01-01
Background In Guadeloupe and Martinique, two French Overseas Departments, colorectal cancer (CRC) has become an essential public health issue. However, little is known about CRC characteristics and the p53 status in these populations, particularly in Guadeloupe, whereas certification of a cancer registry has been recently validated. Methods This was a descriptive retrospective study of 201 patients who, between 1995 and 2000, underwent surgery for CRC in the Guadeloupe Teaching Hospital (GlpeTH; 83 patients) and in the Martinique Teaching Hospital (MqueTH; 118 patients). The clinicopathological features and the p53 expression, evaluated with immunohistochemistry, were compared at the time of diagnosis. A relationship between these parameters and the p53 expression was also studied. Data were analysed, using the SPSS computer software version 17.0. Results No statistical difference was found between the two groups of patients regarding age (p = 0.60), percentage of young patients (≤50 years; p = 0.94)), sex (p = 0.47), histological type (p = 0.073) and tumour sites (p = 0.65), although the GlpeTH patients were diagnosed with more distal colon cancers (54.2%) than the Mque TH patients (47.4%). By contrast, a significant difference was found regarding the tumour grade (p < 0.0001), the pTNM stage (p = 0.045) and the pT stage (p < 0.0001). Regarding p53 expression, solely for the MqueTH patients, nuclear expression was associated with pTNM, the percentage of p53 negative tumours increasing with the progression of the pTNM stages (p = 0.029). Conclusions For the first time, this study reveals discrepancies in clinicopathological features and in the p53 status between the two groups of patients. The GlpeTH patients were diagnosed with more moderated CRCs but with few CRCs at pTNM IV stage. By contrast, the MqueTH patients were diagnosed with more differentiated tumours, but with many more CRCs at pTNM IV stage. This paradox may be due to differences in tumour location (distal vs proximal), multiplicity of the genetic profiles of patients, or patients getting treatment elsewhere. Although our study is limited due to its small size, it emphasizes the originality of our results. PMID:24679126
Kim, Min-Kyung; Claiborn, Kathryn C; Levin, Henry L
2005-08-01
Tf1 is a long terminal repeat-containing retrotransposon of Schizosaccharomyces pombe that is studied to further our understanding of retrovirus propagation. One important application is to examine Tf1 as a model for how human immunodeficiency virus type 1 proteins enter the nucleus. The accumulation of Tf1 Gag in the nucleus requires an N-terminal nuclear localization signal (NLS) and the nuclear pore factor Nup124p. Here, we report that NLS activity is regulated by adjacent residues. Five mutant transposons were made, each with sequential tracts of four amino acids in Gag replaced by alanines. All five versions of Tf1 transposed with frequencies that were significantly lower than that of the wild type. Although all five made normal amounts of Gag, two of the mutations did not make cDNA, indicating that Gag contributed to reverse transcription. The localization of the Gag in the nucleus was significantly reduced by mutations A1, A2, and A3. These results identified residues in Gag that contribute to the function of the NLS. The Gags of A4 and A5 localized within the nucleus but exhibited severe defects in the formation of virus-like particles. Of particular interest was that the mutations in Gag-A4 and Gag-A5 caused their nuclear localization to become independent of Nup124p. These results suggested that Nup124p was only required for import of Tf1 Gag because of its extensive multimerization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lanekoff, Ingela; Cha, Jeeyeon; Kyle, Jennifer E.
Here we demonstrate that conditional deletion of mouse uterine Trp53 (p53d/d), molecularly linked to mTORC1 activation and causally linked to premature uterine senescence and preterm birth, results in aberrant lipid signatures within the heterogeneous cell types of embryo implantation sites on day 8 of pregnancy. In situ nanospray desorption electrospray ionization mass spectrometry imaging (nano-DESI MSI) was used to characterize the molecular speciation of free fatty acids, monoacylglycerols, unmodified and oxidized phosphatidylcholine (PC/Ox-PC), and diacylglycerol (DG) species within implantation sites of p53d/d mice and floxed littermates. Implantation sites from p53d/d mice exhibited distinct spatially resolved changes demonstrating accumulation of DGmore » species, depletion of Ox-PC species, and increase in species with more unsaturated acyl chains, including arachidonic and docosahexaenoic acid. Understanding abnormal changes in the abundance and localization of individual lipid species early in the progression to premature birth is important for discovering novel targets for treatments and diagnosis.« less
NASA Astrophysics Data System (ADS)
Lanekoff, Ingela; Cha, Jeeyeon; Kyle, Jennifer E.; Dey, Sudhansu K.; Laskin, Julia; Burnum-Johnson, Kristin E.
2016-09-01
Here we demonstrate that conditional deletion of mouse uterine Trp53 (p53d/d), molecularly linked to mTORC1 activation and causally linked to premature uterine senescence and preterm birth, results in aberrant lipid signatures within the heterogeneous cell types of embryo implantation sites on day 8 of pregnancy. In situ nanospray desorption electrospray ionization mass spectrometry imaging (nano-DESI MSI) was used to characterize the molecular speciation of free fatty acids, monoacylglycerol species, unmodified and oxidized phosphatidylcholine (PC/Ox-PC), and diacylglycerol (DG) species within implantation sites of p53d/d mice and floxed littermates. Implantation sites from p53d/d mice exhibited distinct spatially resolved changes demonstrating accumulation of DG species, depletion of Ox-PC species, and increase in species with more unsaturated acyl chains, including arachidonic and docosahexaenoic acid. Understanding abnormal changes in the abundance and localization of individual lipid species early in the progression to premature birth is an important step toward discovering novel targets for treatments and diagnosis.
Sen, Gouri Sankar; Mohanty, Suchismita; Hossain, Dewan Md Sakib; Bhattacharyya, Sankar; Banerjee, Shuvomoy; Chakraborty, Juni; Saha, Shilpi; Ray, Pallab; Bhattacharjee, Pushpak; Mandal, Debaprasad; Bhattacharya, Arindam; Chattopadhyay, Samit; Das, Tanya; Sa, Gaurisankar
2011-01-01
Breast cancer cells often develop multiple mechanisms of drug resistance during tumor progression, which is the major reason for the failure of breast cancer therapy. High constitutive activation of NFκB has been found in different cancers, creating an environment conducive for chemotherapeutic resistance. Here we report that doxorubicin-induced SMAR1-dependent transcriptional repression and SMAR1-independent degradation of IkBα resulted in nuclear translocation of p65NFκB and its association with p300 histone acetylase and subsequent transcription of Bcl-2 to impart protective response in drug-resistant cells. Consistently SMAR1-silenced drug-resistant cells exhibited IkBα-mediated inhibition of p65NFκB and induction of p53-dependent apoptosis. Interestingly, curcumin pretreatment of drug-resistant cells alleviated SMAR1-mediated p65NFκB activation and hence restored doxorubicin sensitivity. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic death cascade. Importantly, promyelocyte leukemia-mediated SMAR1 sequestration that relieved the repression of apoptosis-inducing genes was indispensable for such chemo-sensitizing ability of curcumin. A simultaneous decrease in drug-induced systemic toxicity by curcumin might also have enhanced the efficacy of doxorubicin by improving the intrinsic defense machineries of the tumor-bearer. Overall, the findings of this preclinical study clearly demonstrate the effectiveness of curcumin to combat doxorubicin-resistance. We, therefore, suggest curcumin as a potent chemo-sensitizer to improve the therapeutic index of this widely used anti-cancer drug. Taken together, these results suggest that curcumin can be developed into an adjuvant chemotherapeutic drug. PMID:22013068
Cui, Hong; Ghosh, Santanu K.
2009-01-01
The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1–STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a “partitioning center” represents yet another facet of the benign parasitism of the yeast plasmid. PMID:19364922
Mizushima, Taichi; Asai-Sato, Mikiko; Akimoto, Kazunori; Nagashima, Yoji; Taguri, Masataka; Sasaki, Kazunori; Nakaya, Masa-aki; Asano, Ryoko; Tokinaga, Aya; Kiyono, Tohru; Hirahara, Fumiki; Ohno, Shigeo; Miyagi, Etsuko
2016-03-01
Atypical protein kinase C λ/ι (aPKCλ/ι) is a regulator of epithelial cellular polarity. It is also overexpressed in several cancers and functions in cell proliferation and invasion. Therefore, we hypothesized that aPKCλ/ι may be involved in development and progression of cervical intraepithelial neoplasia (CIN), the precancerous disease of cervical cancer induced by human papillomavirus. To do this, we investigated the relationship between aPKCλ/ι expression and CIN. aPKCλ/ι expression level and subcellular localization were assessed in 192 CIN biopsy samples and 13 normal epithelial samples using immunohistochemistry. aPKCλ/ι overexpression (normal epithelium, 7.7%; CIN1, 41.7%; CIN2/3, 76.4%) and aPKCλ/ι nuclear localization (normal epithelium, 0.0%; CIN1, 36.9%; CIN2/3, 78.7%) were higher in CIN samples than normal samples (P<0.05), suggesting that CIN grade is related to aPKCλ/ι overexpression and nuclear localization. Then, 140 CIN cases were retrospectively analyzed for 4-yr cumulative disease progression and regression rates using the Cox proportional hazards model. CIN1 cases with aPKCλ/ι overexpression or aPKCλ/ι nuclear localization had a higher progression rate than CIN1 cases with normal aPKCλ/ι expression levels or cytoplasmic localization (62.5% vs. 9.7% and 63.1% vs. 9.4%, respectively; P<0.001). Multivariate analysis indicated that human papillomavirus types 16 and 18, aPKCλ/ι overexpression (hazard ratio=4.26; 95% confidence interval, 1.50-12.1; P=0.007), and aPKCλ/ι nuclear localization (hazard ratio=3.59; 95% confidence interval, 1.24-10.4; P=0.019) were independent risk factors for CIN1 progression. In conclusion, aPKCλ/ι could be useful for the therapeutic management of patients with CIN, particularly those with non-human papillomavirus 16/18 types.
Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R
2012-05-01
Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.
FAP-related desmoid tumors: a series of 44 patients evaluated in a cancer referral center.
Colombo, Chiara; Foo, Wai Chin; Whiting, David; Young, Eric D; Lusby, Kristelle; Pollock, Raphael E; Lazar, Alexander J; Lev, Dina
2012-05-01
Desmoid tumors (DTs), the commonest extra-intestinal manifestation of familial adenomatosis polyposis (FAP), are monoclonal neoplasms demonstrating fibroblastic - myofibroblastic differentiation; they are locally invasive without metastatic capacity. FAP-associated DT natural history knowledge is limited; we examined patient and tumor characteristics for a FAP-DT cohort and evaluated anti-DT therapy molecular target expression levels (immunohistochemical analyses, FAP-DT tissue microarray; TMA). Forty-four patients were classified as intra-abdominal (IA; n=26), abdominal wall (AW)/extra-abdominal (EA; n=12) or concomitant IA/AW (n=6) based on DT primary diagnosis location. Positive family histories were found in 62% of FAP versus 10% of DT patients. Surgery was the mainstay therapy for AW/EW patients, whereas IA DTs received surgery, chemotherapy, radiotherapy, tamoxifen, NSAIDs, and/or imatinib. Eight of 20 completely resected DTs in the IA and AW/EA groups recurred; 12 of 38 patients in these groups (33%) developed secondary lesions elsewhere. Two intestinal mesenteric DT patients died of disease, three from other cancers, 27 are alive with disease and 12 are alive without disease. All evaluable FAP-DT exhibited nuclear β-catenin, 65% were positive for cyclin D1, and 66% expressed nuclear p53. No ERα expression was observed, but ERβ was expressed in 72%. COX2 was expressed in all evaluable FAP-DTs. KIT was rarely found in DTs but both PDGFRs and their ligands were expressed. Comparing biomarker expression (IA vs. EA DTs), only nuclear ER-ß staining was significantly higher in EA lesions (p=0.0070); no other markers were site informative. Enhanced knowledge of FAP-DT molecular underpinnings will facilitate development of novel therapeutic strategies.
Xie, Xiaolei; Le, Li; Fan, Yanxin; Lv, Lin; Zhang, Junjie
2012-07-01
Mitoribosome in mammalian cells is responsible for synthesis of 13 mtDNA-encoded proteins, which are integral parts of four mitochondrial respiratory chain complexes (I, III, IV and V). ERAL1 is a nuclear-encoded GTPase important for the formation of the 28S small mitoribosomal subunit. Here, we demonstrate that knockdown of ERAL1 by RNA interference inhibits mitochondrial protein synthesis and promotes reactive oxygen species (ROS) generation, leading to autophagic vacuolization in HeLa cells. Cells that lack ERAL1 expression showed a significant conversion of LC3-I to LC3-II and an enhanced accumulation of autophagic vacuoles carrying the LC3 marker, all of which were blocked by the autophagy inhibitor 3-MA as well as by the ROS scavenger NAC. Inhibition of mitochondrial protein synthesis either by ERAL1 siRNA or chloramphenicol (CAP), a specific inhibitor of mitoribosomes, induced autophagy in HTC-116 TP53 (+/+) cells, but not in HTC-116 TP53 (-/-) cells, indicating that tumor protein 53 (TP53) is essential for the autophagy induction. The ROS elevation resulting from mitochondrial protein synthesis inhibition induced TP53 expression at transcriptional levels by enhancing TP53 promoter activity, and increased TP53 protein stability by suppressing TP53 ubiquitination through MAPK14/p38 MAPK-mediated TP53 phosphorylation. Upregulation of TP53 and its downstream target gene DRAM1, but not CDKN1A/p21, was required for the autophagy induction in ERAL1 siRNA or CAP-treated cells. Altogether, these data indicate that autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.
Koike, Etsuko; Iwaya, Keiichi; Watanabe, Akinori; Miyake, Shinji; Sato, Eiichi; Ishikawa, Takashi
2016-01-01
To determine the associations between breast cancer recurrence and cytological findings of fine-needle aspiration cytology (FNAC). The study included 117 women who had undergone a modified radical mastectomy for invasive ductal carcinoma of the breast. FNAC samples of these patients were reexamined, and cytological findings, such as cellular dissociation, nuclear pleomorphism, nuclear atypia, chromatin pattern, and nuclear size, were scored. Uni- and multivariate analyses were performed to determine the prognostic significance of the cytological findings. Corresponding cancer tissues were immunostained for estrogen receptor, progesterone receptor, human epidermal growth factor 2 (HER2), p53, and E-cadherin to determine their associations with cytological findings. Coexpression of Arp2 and WAVE2 was also examined immunohistochemically as a cell locomotion signal. Cellular dissociation (p = 0.0259) and nuclear size (p = 0.0417) were significantly associated with cancer recurrence. Multivariate analysis showed that cellular dissociation and histological grade were significant independent predictors of cancer recurrence. Cellular dissociation was found to be associated with coexpression of Arp2 and WAVE2 (p = 0.0356) and HER2 (p = 0.0469). The cytological finding of cell dissociation was associated with the activation of Arp2 and WAVE2 signals and was an independent predictor of recurrence. © 2016 S. Karger AG, Basel.
Investigation on etiology of hepatic venous obstruction Budd-Chiari syndrome.
Tian, Zhi-Long; Jia, Gao-Lei; Xi, Hai-Lin; Feng, Su; Wang, Xiao-Kai; Li, Rui
2014-12-01
Budd-Chiari syndrome (BCS) is an uncommon clinical condition with a complex etiology. Pathogenesis of BCS is still poorly understood. We included hepatic veno-occlusive lesion tissues of 20 patients (patients group) with hepatic venous obstruction BCS and compared with 20 similar tissues with other etiologies (control group). Morphological changes in hepatic veno-occlusive lesion tissues and the positive expression of proliferating cell nuclear antigen (PCNA), C-myc, and P-53 were observed by the pathological examination (H&E staining) and immunohistochemistry assay. Our results showed that PCNA and C-myc positive cell densities were significantly higher in patient group than control group. P-53 positive cell density showed increasing trends in patients than control group. Moreover, we observed irregular hyperplasia in intimal tissue, fibrous connective tissue, and smooth muscle cell, accompanied by tissue degeneration (hyaloid degeneration and fibrinoid degeneration) and a large quantity of inflammatory cell infiltration. In conclusion, an overexpression of PCNA, C-myc, and a weak positive expression of P53 might launch the extremely irregular hepatic venous intimal hyperplasia, which is probably one of the etiologies of hepatic venous obstruction BCS.
Bougdour, Alexandre; Durandau, Eric; Brenier-Pinchart, Marie-Pierre; Ortet, Philippe; Barakat, Mohamed; Kieffer, Sylvie; Curt-Varesano, Aurélie; Curt-Bertini, Rose-Laurence; Bastien, Olivier; Coute, Yohann; Pelloux, Hervé; Hakimi, Mohamed-Ali
2013-04-17
After invading host cells, Toxoplasma gondii multiplies within a parasitophorous vacuole (PV) that is maintained by parasite proteins secreted from organelles called dense granules. Most dense granule proteins remain within the PV, and few are known to access the host cell cytosol. We identify GRA16 as a dense granule protein that is exported through the PV membrane and reaches the host cell nucleus, where it positively modulates genes involved in cell-cycle progression and the p53 tumor suppressor pathway. GRA16 binds two host enzymes, the deubiquitinase HAUSP and PP2A phosphatase, which exert several functions, including regulation of p53 and the cell cycle. GRA16 alters p53 levels in a HAUSP-dependent manner and induces nuclear translocation of the PP2A holoenzyme. Additionally, certain GRA16-deficient strains exhibit attenuated virulence, indicating the importance of these host alterations in pathogenesis. Therefore, GRA16 represents a potentially emerging subfamily of exported dense granule proteins that modulate host function. Copyright © 2013 Elsevier Inc. All rights reserved.
Landua, John D.; Bu, Wen; Wei, Wei; Li, Fuhai; Wong, Stephen T.C.; Dickinson, Mary E.; Rosen, Jeffrey M.; Lewis, Michael T.
2014-01-01
Cancer stem cells (CSCs, or tumor-initiating cells) may be responsible for tumor formation in many types of cancer, including breast cancer. Using high-resolution imaging techniques, we analyzed the relationship between a Wnt-responsive, CSC-enriched population and the tumor vasculature using p53-null mouse mammary tumors transduced with a lentiviral Wnt signaling reporter. Consistent with their localization in the normal mammary gland, Wnt-responsive cells in tumors were enriched in the basal/myoepithelial population and generally located in close proximity to blood vessels. The Wnt-responsive CSCs did not colocalize with the hypoxia-inducible factor 1α-positive cells in these p53-null basal-like tumors. Average vessel diameter and vessel tortuosity were increased in p53-null mouse tumors, as well as in a human tumor xenograft as compared with the normal mammary gland. The combined strategy of monitoring the fluorescently labeled CSCs and vasculature using high-resolution imaging techniques provides a unique opportunity to study the CSC and its surrounding vasculature. PMID:24797826
Mechanisms of Nuclear Export in Cancer and Resistance to Chemotherapy.
El-Tanani, Mohamed; Dakir, El-Habib; Raynor, Bethany; Morgan, Richard
2016-03-14
Tumour suppressor proteins, such as p53, BRCA1, and ABC, play key roles in preventing the development of a malignant phenotype, but those that function as transcriptional regulators need to enter the nucleus in order to function. The export of proteins between the nucleus and cytoplasm is complex. It occurs through nuclear pores and exported proteins need a nuclear export signal (NES) to bind to nuclear exportin proteins, including CRM1 (Chromosomal Region Maintenance protein 1), and the energy for this process is provided by the RanGTP/RanGDP gradient. Due to the loss of DNA repair and cell cycle checkpoints, drug resistance is a major problem in cancer treatment, and often an initially successful treatment will fail due to the development of resistance. An important mechanism underlying resistance is nuclear export, and a number of strategies that can prevent nuclear export may reverse resistance. Examples include inhibitors of CRM1, antibodies to the nuclear export signal, and alteration of nuclear pore structure. Each of these are considered in this review.
Yao, Wei; Wang, Neng; Qian, Jin; Bai, Lu; Zheng, Xiaoxin; Hou, Guo; Qiu, Xuan; Yang, Bo
2017-11-01
Chronic congestive heart failure (CHF) is the end outcome of organic heart diseases and one of the major diseases harmful to human health. Renal sympathetic denervation (RSD) is the anatomical basis of transcatheter renal sympathetic nerve ablation within the renal artery. To date, the roles of norepinephrine and angiotensin II (Ang II) in myocardial apoptosis and their underlying mechanisms have not been well explored. The aim of the present study was to verify the hypothesis that RSD is likely to inhibit myocardial apoptosis by inhibiting the release of norepinephrine and Ang II. An isoproterenol-induced CHF rat model was established, and the effects of RSD on myocardial apoptosis were examined using flow cytometry and TUNEL staining. The expression of factors associated with myocardial apoptosis, including p53, tumor necrosis factor-α (TNF-α), nuclear factor-κB (NF-κB), caspase-2 and -3, were measured using quantitative polymerase chain reaction and western blot analysis. The results indicated that the mRNA levels of p53, TNF-α, NF-κB, caspase-2 and -3 were significantly reduced in the myocardial tissues of rats in the CHF+RSD group when compared with the levels in the CHF+sham group (P<0.01 for all). In addition, the protein levels of p53, TNF-α, NF-κB and caspases-2 and -3 were decreased by 42.6, 41.3, 46.7, 30.0 and 35.8%, respectively, in myocardial tissues of rats in the CHF+RSD group in comparison with the CHF+sham group (P<0.01 for all). Furthermore, myocardial apoptosis was improved in rats in the CHF+RSD group compared with that in the CHF+sham group (P<0.01). In conclusion, the present study provides a theoretical basis for application of RSD in the treatment of CHF.
Yao, Wei; Wang, Neng; Qian, Jin; Bai, Lu; Zheng, Xiaoxin; Hou, Guo; Qiu, Xuan; Yang, Bo
2017-01-01
Chronic congestive heart failure (CHF) is the end outcome of organic heart diseases and one of the major diseases harmful to human health. Renal sympathetic denervation (RSD) is the anatomical basis of transcatheter renal sympathetic nerve ablation within the renal artery. To date, the roles of norepinephrine and angiotensin II (Ang II) in myocardial apoptosis and their underlying mechanisms have not been well explored. The aim of the present study was to verify the hypothesis that RSD is likely to inhibit myocardial apoptosis by inhibiting the release of norepinephrine and Ang II. An isoproterenol-induced CHF rat model was established, and the effects of RSD on myocardial apoptosis were examined using flow cytometry and TUNEL staining. The expression of factors associated with myocardial apoptosis, including p53, tumor necrosis factor-α (TNF-α), nuclear factor-κB (NF-κB), caspase-2 and −3, were measured using quantitative polymerase chain reaction and western blot analysis. The results indicated that the mRNA levels of p53, TNF-α, NF-κB, caspase-2 and −3 were significantly reduced in the myocardial tissues of rats in the CHF+RSD group when compared with the levels in the CHF+sham group (P<0.01 for all). In addition, the protein levels of p53, TNF-α, NF-κB and caspases-2 and −3 were decreased by 42.6, 41.3, 46.7, 30.0 and 35.8%, respectively, in myocardial tissues of rats in the CHF+RSD group in comparison with the CHF+sham group (P<0.01 for all). Furthermore, myocardial apoptosis was improved in rats in the CHF+RSD group compared with that in the CHF+sham group (P<0.01). In conclusion, the present study provides a theoretical basis for application of RSD in the treatment of CHF. PMID:29104628
Promyelocytic Leukemia Protein, a Protein at the Crossroad of Oxidative Stress and Metabolism.
Tessier, Sarah; Martin-Martin, Natalia; de Thé, Hugues; Carracedo, Arkaitz; Lallemand-Breitenbach, Valérie
2017-03-20
Cellular metabolic activity impacts the production of reactive oxygen species (ROS), both positively through mitochondrial oxidative processes and negatively by promoting the production of reducing agents (including NADPH and reduced glutathione). A defined metabolic state in cancer cells is critical for cell growth and long-term self-renewal, and such state is intrinsically associated with redox balance. Promyelocytic leukemia protein (PML) regulates several biological processes, at least in part, through its ability to control the assembly of PML nuclear bodies (PML NBs). Recent Advances: PML is oxidation-prone, and oxidative stress promotes NB biogenesis. These nuclear subdomains recruit many nuclear proteins and regulate their SUMOylation and other post-translational modifications. Some of these cargos-such as p53, SIRT1, AKT, and mammalian target of rapamycin (mTOR)-are key regulators of cell fate. PML was also recently shown to regulate oxidation. While it was long considered primarily as a tumor suppressor protein, PML-regulated metabolic switch uncovered that this protein could promote survival and/or stemness of some normal or cancer cells. In this study, we review the recent findings on this multifunctional protein. Studying PML scaffolding functions as well as its fine role in the activation of p53 or fatty acid oxidation will bring new insights in how PML could bridge oxidative stress, senescence, cell death, and metabolism. Antioxid. Redox Signal. 26, 432-444.
Nuclear DDX3 expression predicts poor outcome in colorectal and breast cancer
Heerma van Voss, Marise R; Vesuna, Farhad; Bol, Guus M; Meeldijk, Jan; Raman, Ana; Offerhaus, G Johan; Buerger, Horst; Patel, Arvind H; van der Wall, Elsken; van Diest, Paul J; Raman, Venu
2017-01-01
Purpose DEAD box protein 3 (DDX3) is an RNA helicase with oncogenic properties that shuttles between the cytoplasm and nucleus. The majority of DDX3 is found in the cytoplasm, but a subset of tumors has distinct nuclear DDX3 localization of yet unknown biological significance. This study aimed to evaluate the significance of and mechanisms behind nuclear DDX3 expression in colorectal and breast cancer. Methods Expression of nuclear DDX3 and the nuclear exporter chromosome region maintenance 1 (CRM1) was evaluated by immunohistochemistry in 304 colorectal and 292 breast cancer patient samples. Correlations between the subcellular localization of DDX3 and CRM1 and the difference in overall survival between patients with and without nuclear DDX3 were studied. In addition, DDX3 mutants were created for in vitro evaluation of the mechanism behind nuclear retention of DDX3. Results DDX3 was present in the nucleus of 35% of colorectal and 48% of breast cancer patient samples and was particularly strong in the nucleolus. Nuclear DDX3 correlated with worse overall survival in both colorectal (hazard ratio [HR] 2.34, P<0.001) and breast cancer (HR 2.39, P=0.004) patients. Colorectal cancers with nuclear DDX3 expression more often had cytoplasmic expression of the nuclear exporter CRM1 (relative risk 1.67, P=0.04). In vitro analysis of DDX3 deletion mutants demonstrated that CRM1-mediated export was most dependent on the N-terminal nuclear export signal. Conclusion Overall, we conclude that nuclear DDX3 is partially CRM1-mediated and predicts worse survival in colorectal and breast cancer patients, putting it forward as a target for therapeutic intervention with DDX3 inhibitors under development in these cancer types. PMID:28761359
Nuclear DDX3 expression predicts poor outcome in colorectal and breast cancer.
Heerma van Voss, Marise R; Vesuna, Farhad; Bol, Guus M; Meeldijk, Jan; Raman, Ana; Offerhaus, G Johan; Buerger, Horst; Patel, Arvind H; van der Wall, Elsken; van Diest, Paul J; Raman, Venu
2017-01-01
DEAD box protein 3 (DDX3) is an RNA helicase with oncogenic properties that shuttles between the cytoplasm and nucleus. The majority of DDX3 is found in the cytoplasm, but a subset of tumors has distinct nuclear DDX3 localization of yet unknown biological significance. This study aimed to evaluate the significance of and mechanisms behind nuclear DDX3 expression in colorectal and breast cancer. Expression of nuclear DDX3 and the nuclear exporter chromosome region maintenance 1 (CRM1) was evaluated by immunohistochemistry in 304 colorectal and 292 breast cancer patient samples. Correlations between the subcellular localization of DDX3 and CRM1 and the difference in overall survival between patients with and without nuclear DDX3 were studied. In addition, DDX3 mutants were created for in vitro evaluation of the mechanism behind nuclear retention of DDX3. DDX3 was present in the nucleus of 35% of colorectal and 48% of breast cancer patient samples and was particularly strong in the nucleolus. Nuclear DDX3 correlated with worse overall survival in both colorectal (hazard ratio [HR] 2.34, P <0.001) and breast cancer (HR 2.39, P =0.004) patients. Colorectal cancers with nuclear DDX3 expression more often had cytoplasmic expression of the nuclear exporter CRM1 (relative risk 1.67, P =0.04). In vitro analysis of DDX3 deletion mutants demonstrated that CRM1-mediated export was most dependent on the N-terminal nuclear export signal. Overall, we conclude that nuclear DDX3 is partially CRM1-mediated and predicts worse survival in colorectal and breast cancer patients, putting it forward as a target for therapeutic intervention with DDX3 inhibitors under development in these cancer types.
Park, Seong-Yeol; Bae, Young-Seuk
2016-09-09
We previously showed that protein kinase CK2 downregulation mediates senescence through the reactive oxygen species (ROS)-p53-p21(Cip1/WAF1) pathway in various human cells. In the present study, we investigated whether the FoxO3a transcription factor is associated with ROS production during CK2 downregulation-induced senescence in human colon cancer HCT116 and breast cancer MCF-7 cells. FoxO3a overexpression suppressed ROS production and p53 stabilization induced by a CK2α knockdown. CK2α downregulation induced nuclear export of FoxO3a through stimulation of AKT-mediated phosphorylation of FoxO3a and decreased transcription of its target genes (Cu/ZnSOD, MnSOD, and catalase). In contrast, CK2α overexpression inhibited AKT-mediated FoxO3a phosphorylation. This resulted in nuclear accumulation of FoxO3a, and elevated expression of its target genes. Therefore, these data indicate for the first time that CK2 downregulation stimulates ROS generation by inhibiting FoxO3a during premature senescence in human colon and breast cancer cells. Copyright © 2016 Elsevier Inc. All rights reserved.
Shaheen, Sharif M; Akita, Hidetaka; Yamashita, Atsushi; Katoono, Ryo; Yui, Nobuhiko; Biju, Vasudevanpillai; Ishikawa, Mitsuru; Harashima, Hideyoshi
2011-04-01
Recent studies indicate that controlling the nuclear decondensation and intra-nuclear localization of plasmid DNA (pDNA) would result in an increased transfection efficiency. In the present study, we established a technology for imaging the nuclear condensation/decondensation status of pDNA in nuclear subdomains using fluorescence resonance energy transfer (FRET) between quantum dot (QD)-labeled pDNA as donor, and rhodamine-labeled polycations as acceptor. The FRET-occurring pDNA/polycation particle was encapsulated in a nuclear delivery system; a tetra-lamellar multifunctional envelope-type nano device (T-MEND), designed to overcome the endosomal membrane and nuclear membrane via step-wise fusion. Nuclear subdomains (i.e. heterochromatin and euchromatin) were distinguished by Hoechst33342 staining. Thereafter, Z-series of confocal images were captured by confocal laser scanning microscopy. pDNA in condensation/decondensation status in heterochromatin or euchromatin were quantified based on the pixel area of the signals derived from the QD and rhodamine. The results obtained indicate that modulation of the supra-molecular structure of polyrotaxane (DMAE-ss-PRX), a condenser that is cleaved in a reductive environment, conferred euchromatin-preferred decondensation. This represents the first demonstration of the successful control of condensation/decondensation in specific nuclear sub-domain via the use of an artificial DNA condenser.
Shaheen, Sharif M.; Akita, Hidetaka; Yamashita, Atsushi; Katoono, Ryo; Yui, Nobuhiko; Biju, Vasudevanpillai; Ishikawa, Mitsuru; Harashima, Hideyoshi
2011-01-01
Recent studies indicate that controlling the nuclear decondensation and intra-nuclear localization of plasmid DNA (pDNA) would result in an increased transfection efficiency. In the present study, we established a technology for imaging the nuclear condensation/decondensation status of pDNA in nuclear subdomains using fluorescence resonance energy transfer (FRET) between quantum dot (QD)-labeled pDNA as donor, and rhodamine-labeled polycations as acceptor. The FRET-occurring pDNA/polycation particle was encapsulated in a nuclear delivery system; a tetra-lamellar multifunctional envelope-type nano device (T-MEND), designed to overcome the endosomal membrane and nuclear membrane via step-wise fusion. Nuclear subdomains (i.e. heterochromatin and euchromatin) were distinguished by Hoechst33342 staining. Thereafter, Z-series of confocal images were captured by confocal laser scanning microscopy. pDNA in condensation/decondensation status in heterochromatin or euchromatin were quantified based on the pixel area of the signals derived from the QD and rhodamine. The results obtained indicate that modulation of the supra-molecular structure of polyrotaxane (DMAE-ss-PRX), a condenser that is cleaved in a reductive environment, conferred euchromatin-preferred decondensation. This represents the first demonstration of the successful control of condensation/decondensation in specific nuclear sub-domain via the use of an artificial DNA condenser. PMID:21288880
GLTSCR2 promotes the nucleoplasmic translocation and subsequent degradation of nucleolar ARF.
Lee, Sun; Cho, Young-Eun; Kim, Sang-Hoon; Kim, Yong-Jun; Park, Jae-Hoon
2017-03-07
The alternative reading frame protein (p14ARF/ARF) is a key determinant of cell fate, acting as a potent tumor suppressor through a p53/MDM2-dependent pathway or promoting apoptosis in a p53-independent manner. The ARF protein is mainly expressed in the nucleolus and sequestered by nucleophosmin (NPM), whereas ARF-binding proteins, including p53 and MDM2, predominantly reside in the nucleoplasm. This raises the question of how nucleolar ARF binds nucleoplasmic signaling proteins to suppress tumor growth or inhibit cell cycle progression. GLTSCR2 (also known as PICT-1) is a nucleolar protein involved in both tumor suppression and oncogenesis in concert with p53, NPM, and/or MYC. Here, we show that GLTSCR2 increases nucleoplasmic ARF translocation and its degradation. Specifically, GLTSCR2 bound to ARF, and GLTSCR2-ARF complexes were released to the nucleoplasm, where GLTSCR2 increased the binding affinity of ARF for ULF/TRIP12 (a nucleoplasmic E3-ubiquitin ligase of ARF) and enhanced ARF degradation through the polyubiquitination pathway. Our results demonstrate that nucleolar/nucleoplasmic GLTSCR2 is a strong candidate for promoting the subcellular localization and protein stability of ARF.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.
2012-10-25
The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealedmore » that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.« less
Kuball, Jürgen; Wen, Shu Fen; Leissner, Joachim; Atkins, Derek; Meinhardt, Patricia; Quijano, Erlinda; Engler, Heidrun; Hutchins, Beth; Maneval, Daniel C; Grace, Michael J; Fritz, Mary Ann; Störkel, Stefan; Thüroff, Joachim W; Huber, Christoph; Schuler, Martin
2002-02-15
To study safety, feasibility, and biologic activity of adenovirus-mediated p53 gene transfer in patients with bladder cancer. Twelve patients with histologically confirmed bladder cancer scheduled for cystectomy were treated on day 1 with a single intratumoral injection of SCH 58500 (rAd/p53) at cystoscopy at one dose level (7.5 x 10(11) particles) or a single intravesical instillation of SCH 58500 with a transduction-enhancing agent (Big CHAP) at three dose levels (7.5 x 10(11) to 7.5 x 10(13) particles). Cystectomies were performed in 11 patients on day 3, and transgene expression, vector distribution, and biologic markers of transgene activity were assessed by molecular and immunohistochemical methods in tumors and normal bladder samples. Specific transgene expression was detected in tissues from seven of eight assessable patients treated with intravesical instillation of SCH 58500 but in none of three assessable patients treated with intratumoral injection of SCH 58500. Induction of RNA and protein expression of the p53 target gene p21/WAF1 was demonstrated in samples from patients treated with SCH 58500 instillation at higher dose levels. Distribution studies after intravesical instillation of SCH 58500 revealed both high transduction efficacy and vector penetration throughout the whole urothelium and into submucosal tumor cells. No dose-limiting toxicity was observed, and side effects were local and of transient nature. Intravesical instillation of SCH 58500 combined with a transduction-enhancing agent is safe, feasible, and biologically active in patients with bladder cancer. Studies to evaluate the clinical efficacy of this treatment in patients with localized high-risk bladder cancer are warranted.
First determination of ground state electromagnetic moments of 53Fe
NASA Astrophysics Data System (ADS)
Miller, A. J.; Minamisono, K.; Rossi, D. M.; Beerwerth, R.; Brown, B. A.; Fritzsche, S.; Garand, D.; Klose, A.; Liu, Y.; Maaß, B.; Mantica, P. F.; Müller, P.; Nörtershäuser, W.; Pearson, M. R.; Sumithrarachchi, C.
2017-11-01
The hyperfine coupling constants of neutron deficient 53Fe were deduced from the atomic hyperfine spectrum of the 3 d64 s25D4↔3 d64 s 4 p 5F5 transition, measured using the bunched-beam collinear laser spectroscopy technique. The low-energy 53Fe beam was produced by projectile-fragmentation reactions followed by gas stopping, and used for the first time for laser spectroscopy. Ground state magnetic-dipole and electric-quadrupole moments were determined as μ =-0.65 (1 ) μN and Q =+35 (15 ) e2fm2 , respectively. The multiconfiguration Dirac-Fock method was used to calculate the electric field gradient to deduce Q from the quadrupole hyperfine coupling constant, since the quadrupole coupling constant has not been determined for any Fe isotopes. Both experimental values agree well with nuclear shell model calculations using the GXPF1A effective interaction performed in a full f p shell model space, which support the soft nature of the 56Ni nucleus.
Wu, Qimei; Yang, Xiaoyu; Zhang, Lei; Zhang, Yu; Feng, Linyin
2017-11-01
Histone deacetylase 4 (HDAC4) is a class II HDAC which is highly expressed in the brain. Previous reports have shown that HDAC4 is essential for normal brain physiology and its deregulation leads to several neurodegenerative disorders. However, it remains unclear whether dysregulation of HDAC4 is specifically involved in the development of Parkinson's disease. In this study, we demonstrate that intracellular trafficking of HDAC4 is important in regulating dopaminergic cell death. While HDAC4 normally localizes to the cytoplasm, nuclear accumulation of HDAC4 was observed in dopaminergic neurons overexpressing A53T mutant α-synuclein treated with MPP + /MPTP in vitro and in vivo. Nuclear-localized HDAC4 repressed cAMP response element-binding protein (CREB) and myocyte enhancer factor 2A (MEF2A), altered neuronal gene expression, and promoted neuronal apoptosis. Furthermore, cytoplasm-to-nucleus shuttling of HDAC4 was determined by its phosphorylation status, which was regulated by PP2A and PKCε. Treatment with PKCε-specific activators, DCP-LA or Bryostatin 1, provided neuroprotection against MPP + toxicity in a dose-dependent manner. In summary, our research illustrated that intracellular trafficking of HDAC4 contributes to the vulnerability of cells expressing pathogenic α-synuclein mutants in response to oxidative stress and compounds which maintain cytoplasmic localization of HDAC4 such as PKCε activators that may serve as therapeutic agents for Parkinson's disease.
Kodaira, Satoshi; Konishi, Teruaki; Kobayashi, Alisa; Maeda, Takeshi; Ahmad, Tengku Ahbrizal Farizal Tengku; Yang, Gen; Akselrod, Mark S.; Furusawa, Yoshiya; Uchihori, Yukio
2015-01-01
Abstract The geometric locations of ion traversals in mammalian cells constitute important information in the study of heavy ion-induced biological effect. Single ion traversal through a cellular nucleus produces complex and massive DNA damage at a nanometer level, leading to cell inactivation, mutations and transformation. We present a novel approach that uses a fluorescent nuclear track detector (FNTD) for the simultaneous detection of the geometrical images of ion traversals and DNA damage in single cells using confocal microscopy. HT1080 or HT1080–53BP1-GFP cells were cultured on the surface of a FNTD and exposed to 5.1-MeV/n neon ions. The positions of the ion traversals were obtained as fluorescent images of a FNTD. Localized DNA damage in cells was identified as fluorescent spots of γ-H2AX or 53BP1-GFP. These track images and images of damaged DNA were obtained in a short time using a confocal laser scanning microscope. The geometrical distribution of DNA damage indicated by fluorescent γ-H2AX spots in fixed cells or fluorescent 53BP1-GFP spots in living cells was found to correlate well with the distribution of the ion traversals. This method will be useful for evaluating the number of ion hits on individual cells, not only for micro-beam but also for random-beam experiments. PMID:25324538
Racial differences in clinically localized prostate cancers of black and white men.
deVere White, R W; Deitch, A D; Jackson, A G; Gandour-Edwards, R; Marshalleck, J; Soares, S E; Toscano, S N; Lunetta, J M; Stewart, S L
1998-06-01
Tumor grade, deoxyribonucleic acid (DNA) ploidy, proliferation, p53 and bcl-2 expression were examined in clinically localized prostate cancers of black and white American men to learn whether these features showed racial differences. A total of 117 prostate cancers (43 black and 74 white patients) obtained at radical prostatectomy for clinically localized disease were assigned Gleason scores by a single pathologist. Enzymatically dissociated nuclei from archival prostate cancers were examined by DNA flow cytometry using propidium iodide staining and the multicycle program to remove debris and sliced nuclei and to perform cell cycle analysis. For immunostaining after microwave antigen retrieval we used a DO-1/DO-7 monoclonal antibody cocktail for p53 and the clone 124 antibody for bcl-2. Significantly more black than white men had Gleason score 7 tumors. The DNA ploidy distribution of Gleason 6 or less tumors was similar for both races. As anticipated, the ploidy distribution of higher grade prostate cancer in white men was more abnormal but, unexpectedly, this was not found for higher grade prostate cancer in black men. No significant racial differences were found in S phase fractions, p53 or bcl-2 immunopositivity. However, for prostate cancer in black men there was a significant association between bcl-2 immunopositivity and higher S-phase fractions. The aggressive prostate cancers of black men may be characterized by the 2 features of high proliferation and a block to programmed cell death.
Checkpoint Kinase-Dependent Regulation of DNA Repair and Genome Instability in Breast Cancer
2009-06-01
4A-mediated ubiquitination and deg- radation. J. Biol. Chem. 276:48175–48182. 14. Chu, G., and E. Chang. 1988. Xeroderma pigmentosum group E cells lack...a nuclear factor that binds to damaged DNA. Science 242:564–567. 15. Cleaver, J. E. 2005. Cancer in xeroderma pigmentosum and related disorders of...28. Hwang, B. J., J. M. Ford, P. C. Hanawalt, and G. Chu. 1999. Expression of the p48 xeroderma pigmentosum gene is p53-dependent and is involved in
Adam, J.; Adamová, D.; Aggarwal, M. M.; ...
2015-06-09
Here we have studied the transverse-momentum (p T) dependence of the inclusive J/more » $$\\psi$$ production in p-Pb collisions at root $$\\sqrt{s_{N\\ N}}$$ = 5.02 TeV, in three center-of-mass rapidity (y cms) regions, down to zero p T. Results in the forward and backward rapidity ranges (2.03 < y cms < 3.53 and -4.46 < y cms < -2.96) are obtained by studying the J/$$\\psi$$ decay to μ +μ -, while the mid-rapidity region (-1.37 < y cms < 0.43) is investigated by measuring the e +e - decay channel. The p T dependence of the J/$$\\psi$$ production cross section and nuclear modification factor are presented for each of the rapidity intervals, as well as the J/psi mean p T values. Forward and mid-rapidity results show a suppression of the J/$$\\psi$$ yield, with respect to pp collisions, which decreases with increasing p T. At backward rapidity no significant J/$$\\psi$$ suppression is observed. Theoretical models including a combination of cold nuclear matter effects such as shadowing and partonic energy loss, are in fair agreement with the data, except at forward rapidity and low transverse momentum. Finally, the implications of the p-Pb results for the evaluation of cold nuclear matter effects on J/$$\\psi$$ production in Pb-Pb collisions are also discussed.« less
REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO
XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.
2015-01-01
The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern of the mitochondrial redox state in colon cancer and the first to indicate that at tissue level the mitochondrial redox state is p53 dependent. The findings should assist in our understanding on colon cancer pathology and developing new imaging biomarkers for clinical applications. PMID:26207147
Yip, Kenneth W.; Cuddy, Michael; Pinilla, Clemencia; Giulanotti, Marc; Heynen-Genel, Susanne; Matsuzawa, Shu-ichi; Reed, John C.
2014-01-01
PML is a tumor suppressor that promotes apoptosis through both p53-dependent and - independent mechanisms, participates in Rb-mediated cell cycle arrest, inhibits neoangiogenesis, and contributes to maintenance of genomic stability. PML also plays a role in host defense against viruses, conferring antiviral activity. When active, PML localizes to subnuclear structures named PML oncogenic domains (PODs) or PML nuclear bodies (PML-NBs), whereas inactive PML is located diffusely throughout the nucleus of cells, thus providing a morphological indicator. Known activators of PML include arsenicals and interferons, however, these agents induce a plethora of toxic effects, limiting their effectiveness. The objective of the current study was to develop a high content screening (HCS) assay for the identification of chemical activators of PML. We describe methods for automated analysis of POD formation using high throughput microscopy (HTM) to localize PML immunofluorescence in conjunction with image analysis software for POD quantification. Using this HCS assay in 384 well format, we performed pilot screens of a small synthetic chemical library and mixture-based combinatorial libraries, demonstrating the robust performance of the assay. HCS counter-screening assays were also developed for hit characterization, based on immunofluorescence analyses of the subcellular location of phosphorylated H2AX or phosphorylated CHK1, which increase in a punctate nuclear pattern in response to DNA damage. Thus, the HCS assay devised here represents a high throughput screen that can be utilized to discover POD-inducing compounds that may restore the tumor suppressor activity of PML in cancers or possibly promote anti-viral states. PMID:21233309
Ning, Hua; Sun, Zongxiang; Liu, Yunyun; Liu, Lei; Hao, Liuyi; Ye, Yaxin; Feng, Rennan; Li, Jie; Li, Ying; Chu, Xia; Li, Songtao; Sun, Changhao
2016-04-19
The detrimental role of hepatic lipotoxicity has been well-implicated in the pathogenesis of NAFLD. Previously, we reported that inhibiting autophagy aggravated saturated fatty acid (SFA)-induced hepatotoxicity. Insulin, a physiological inhibitor of autophagy, is commonly increased within NAFLD mainly caused by insulin resistance. We therefore hypothesized that insulin augments the sensitivity of hepatocyte to SFA-induced lipotoxicity. The present study was conducted via employing human and mouse hepatocytes, which were exposed to SFAs, insulin, or their combination. Unexpectedly, our results indicated that insulin protected hepatocytes against SFA-induced lipotoxicity, based on the LDH, MTT, and nuclear morphological measurements, and the detection from cleaved-Parp-1 and -caspase-3 expressions. We subsequently clarified that insulin led to a rapid and short-period inhibition of autophagy, which was gradually recovered after 1 h incubation in hepatocytes, and such extent of inhibition was insufficient to aggravate SFA-induced lipotoxicity. The mechanistic study revealed that insulin-induced alleviation of ER stress contributed to its hepatoprotective role. Pre-treating hepatocytes with insulin significantly stimulated phosphorylated-Akt and reversed SFA-induced up-regulation of p53. Chemical inhibition of p53 by pifithrin-α robustly prevented palmitate-induced cell death. The PI3K/Akt pathway blockade by its special antagonist abolished the protective role of insulin against SFA-induced lipotoxicity and p53 up-regulation. Furthermore, we observed that insulin promoted intracellular TG deposits in hepatocytes in the present of palmitate. However, blocking TG accumulation via genetically silencing DGAT-2 did not prevent insulin-protected lipotoxicity. Our study demonstrated that insulin strongly protected against SFA-induced lipotoxicity in hepatocytes mechanistically through alleviating ER stress via a PI3K/Akt/p53 involved pathway but independently from autophagy.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false [Reserved] 71.53 Section 71.53 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PACKAGING AND TRANSPORTATION OF RADIOACTIVE MATERIAL Package Approval Standards § 71.53 [Reserved] ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hashimoto, Yoshifumi; Kumagai, Naomichi; Hosoda, Nao
2014-03-14
Highlights: • So far, eRF3 has been thought to function exclusively in the cytoplasm. • eRF3 is a nucleo-cutoplasmic shuttling protein. • eRF3 has a leptomycin-sensitive nuclear export signal (NES). • Removal of NES by proteolytic cleavage allows eRF3 to translocate to the nucleus. • The processed eRF3 (p-eRF3) interacts with a nuclear tumor suppressor ARF. - Abstract: The eukaryotic releasing factor eRF3 is a multifunctional protein that plays pivotal roles in translation termination as well as the initiation of mRNA decay. eRF3 also functions in the regulation of apoptosis; eRF3 is cleaved at Ala73 by an as yet unidentifiedmore » protease into processed isoform of eRF3 (p-eRF3), which interacts with the inhibitors of apoptosis proteins (IAPs). The binding of p-eRF3 with IAPs leads to the release of active caspases from IAPs, which promotes apoptosis. Although full-length eRF3 is localized exclusively in the cytoplasm, p-eRF3 localizes in the nucleus as well as the cytoplasm. We here focused on the role of p-eRF3 in the nucleus. We identified leptomycin-sensitive nuclear export signal (NES) at amino acid residues 61–71 immediately upstream of the cleavage site Ala73. Thus, the proteolytic cleavage of eRF3 into p-eRF3 leads to release an amino-terminal fragment containing NES to allow the relocalization of eRF3 into the nucleus. Consistent with this, p-eRF3 more strongly interacted with the nuclear ARF tumor suppressor than full-length eRF3. These results suggest that while p-eRF3 interacts with IAPs to promote apoptosis in the cytoplasm, p-eRF3 also has some roles in regulating cell death in the nucleus.« less
Zhang, Ying; Chen, Guangpei; Gu, Zhen; Sun, Haijian; Karaplis, Andrew; Goltzman, David; Miao, Dengshun
2018-01-01
We previously demonstrated that parathyroid hormone-related peptide (PTHrP) 1-84 knockin ( Pthrp KI) mice, which lacked a PTHrP nuclear localization sequence (NLS) and C-terminus, displayed early senescence, defective osteoblastic bone formation, and skeletal growth retardation. However, the mechanism of action of the PTHrP NLS and C-terminus in regulating development of skeleton is still unclear. In this study, we examined alterations of oxidative stress and DNA damage response-related molecules in Pthrp KI skeletal tissue. We found that ROS levels, protein expression levels of γ-H2AX, a DNA damage marker, and the DNA damage response markers p-Chk2 and p53 were up-regulated, whereas gene expression levels of anti-oxidative enzymes were down-regulated significantly. We therefore further disrupted the DNA damage response pathway by deleting the Chk2 in Pthrp KI (Chk2 -/- KI) mice and did comparison with WT, Chk2 -/- and Pthrp KI littermates. The Pthrp KI mice with Chk2 deletion exhibited a longer lifespan, improvement in osteoblastic bone formation and skeletal growth including width of growth plates and length of long bones, trabecular and epiphyseal bone volume, BMD, osteoblast numbers, type I collagen and ALP positive bone areas, the numbers of total colony-forming unit fibroblasts (CFU-f), ALP + CFU-f and the expression levels of osteogenic genes. In addition, the genes associated with anti-oxidative enzymes were up-regulated significantly, whereas the tumor suppressor genes related to senescence were down-regulated in Chk2 -/- KI mice compared to Pthrp KI mice. Our results suggest that Chk2 deletion in Pthrp KI mice can somewhat rescue defects in osteoblastic bone formation and skeletal growth by enhancing endochondral bone formation and osteogenesis. These studies therefore indicate that the DNA damage checkpoint pathway may be a target for the nuclear action of PTHrP to regulate skeletal development and growth.
Zargar-Shoshtari, Kamran; Sharma, Pranav; Spiess, Philippe E
2017-11-02
Biomarkers are increasingly used in the diagnosis and management of various malignancies. Selected biomarkers may also play a role in management of certain cases of penile carcinoma. In this article, we provide an overview of the clinical role of such markers in the management of penile cancer. This is a nonsystematic review of relevant literature assessing biomarkers in penile carcinoma. Evidence of infections with human papillomavirus and its surrogate markers may have important prognostic value in patients with localized or metastatic penile cancer. Squamous cell carcinoma antigen, p53, C-reactive protein, Ki-67, proliferating cell nuclear antigen, cyclin D1, as well as other markers have been studied with various degree of evidence in support of clinical utility in penile cancer. No single marker may have all the answers, and future research should focus on genomic analysis of individual penile tumors, attempting to identify specific targets for treatment. Copyright © 2017 Elsevier Inc. All rights reserved.
ERIC Educational Resources Information Center
Kierulff, Stephen; Zippin, David
This study examines the relationship between knowledge and attitudes with respect to nuclear issues, including the nuclear freeze proposal, MX missle, and Strategic Defense Initiative. Adults (N=750) drawn from a list of registered voters in Los Angeles County were sent a 53-item questionnaire. Of the respondents, 64 percent were male, 53 percent…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Xiaoli; Wen, Zhifeng; Sun, Limei
2013-06-28
Highlights: •TRAF2 appears to interact with TRAF4 in breast cancer cell lines. •TRAF2 affects the localization and function of TRAF4 in breast cancer cell lines. •TRAF4 may play an important role in the activation of NF-κB via TRAF2. -- Abstract: Although numerous studies have shown that tumor necrosis factor receptor-associated factor 4 (TRAF4) plays an important role in the carcinogenesis of many tumor types, its exact molecular mechanism remains elusive. In this study, we examined the regulation function of TRAF2 to the cytoplasmic/nuclear distribution of TRAF4 in the breast cancer cell line. Using cell immunofluorescent staining, we found that TRAF2more » and TRAF4 were co-localized to the cytoplasm in MCF-7 cells. Co-immunoprecipitation showed that TRAF2 could interact with TRAF4 in MCF-10A, MCF-7 and MDA-MB-231 cell lines. Western blotting showed TRAF2 depletion by targeted siRNA in MDA-MB-231 cells led to reduced TRAF4 expression in the cytoplasm and augmented TRAF4 expression in the nucleus. Cytoplasmic expression of TRAF4 was augmented and nuclear expression was reduced when MCF-7 cells were transfected with hTRAF2pLPCX-HA-Flag/P874. MCF-7 cells expressing hTRAF2pLPCX-HA-Flag/P874 had enhanced cell proliferation rates. The nuclear expression of NF-κB significantly increased after TNF-α treatment. When hTRAF2pLPCX-HA-Flag/P874 and the siRNA-TRAF4 plasmid were cotransfected, the nuclear expression of NF-κB was significantly reduced compared with cells transfected with hTRAF2pLPCX-HA-Flag/P874 only. In conclusion, TRAF2 appears to interact with TRAF4 and affect the localization of TRAF4 in breast cancer cell lines. The overexpression of TRAF2 augmented the cytoplasmic expression of TRAF4 which promoted cell proliferation and inhibited cell apoptosis by activating NF-κB nuclear transcription. TRAF4 may play an important role in the activation of NF-κB via TRAF2.« less
Kim, Mi-Sung; Kwon, Jung Yeon; Kang, Nam Joo; Lee, Ki Won; Lee, Hyong Joo
2009-08-01
Mutations in Ras play a critical role in the development of human cancers, including breast cancer. We investigated the possible antiproliferative effects of the naturally occurring dihydrochalcone phloretin [2',4',6'-trihydroxy-3-(4-hydroxyphenyl)-propiophenone] on H-Ras-transformed MCF10A human breast epithelial (H-Ras MCF10A) cells. Phloretin suppressed H-Ras MCF10A cell proliferation in a dose-dependent manner and induced nuclear condensation in the cells, indicating that phloretin-induced cell death occurs mainly via the induction of apoptosis. Prominent upregulation of p53 and Bax and cleavage of poly (ADP)-ribose polymerase were also detected in the phloretin-treated cells. Finally, phloretin markedly increased caspase-3 activity as well as JNK and p38 mitogen-activated protein kinase signaling. Our findings suggest that the phloretin-induced apoptosis of breast tumor cells contributes to the chemopreventive potential of phloretin against breast cancer.
Identification of a subunit of NADH-dehydrogenase as a p49/STRAP-binding protein.
Zhang, Xiaomin; Azhar, Gohar; Helms, Scott; Zhong, Ying; Wei, Jeanne Y
2008-01-29
The p49/STRAP (or SRFBP1) protein was recently identified in our laboratory as a cofactor of serum response factor that contributes to the regulation of SRF target genes in the heart. In the present study, we report that NDUFAB1, a nuclear encoded subunit of NADH dehydrogenase, represented the majority of the cDNA clones that interacted with p49/STRAP in multiple screenings using the yeast two-hybrid system. The p49/STRAP and NDUFAB1 proteins interacted and co-localized with each other in the cell. The p49/STRAP protein contains four classic nuclear localization sequence motifs, and it was observed to be present predominantly in the nucleus. Overexpression of p49/STRAP altered the intracellular level of NAD, and reduced the NAD/NADH ratio. Overexpression of p49/STRAP also induced the deacetylation of serum response factor. These data suggest that p49/STRAP plays a role in the regulation of intracellular processes such as cardiac cellular metabolism, gene expression, and possibly aging.
Kano, M; Matsushita, K; Rahmutulla, B; Yamada, S; Shimada, H; Kubo, S; Hiwasa, T; Matsubara, H; Nomura, F
2016-01-01
Combination therapy of carbon-ion beam with the far upstream element-binding protein (FBP)-interacting repressor, FIR, which interferes with DNA damage repair proteins, was proposed as an approach for esophageal cancer treatment with low side effects regardless of TP53 status. In vivo therapeutic antitumor efficacy of replication-defective adenovirus (E1 and E3 deleted adenovirus serotype 5) encoding human FIR cDNA (Ad-FIR) was demonstrated in the tumor xenograft model of human esophageal squamous cancer cells, TE-2. Bleomycin (BLM) is an anticancer agent that introduces DNA breaks. The authors reported that Ad-FIR involved in the BLM-induced DNA damage repair response and thus applicable for other DNA damaging agents. To examine the effect of Ad-FIR on DNA damage repair, BLM, X-ray and carbon-ion irradiation were used as DNA damaging agents. The biological effects of high linear energy transfer (LET) radiotherapy used with carbon-ion irradiation are more expansive than low-LET conventional radiotherapy, such as X-rays or γ rays. High LET radiotherapy is suitable for the local control of tumors because of its high relative biological effectiveness. Ad-FIR enhanced BLM-induced DNA damage indicated by γH2AX in vitro. BLM treatment increased endogenous nuclear FIR expression in TE-2 cells, and P27Kip1 expression was suppressed by TP53 siRNA and BLM treatment. Further, Ad-FIRΔexon2, a dominant-negative form of FIR that lacks exon2 transcriptional repression domain, decreased Ku86 expression. The combination of Ad-FIR and BLM in TP53 siRNA increased DNA damage. Additionally, Ad-FIR showed synergistic cell toxicity with X-ray in vitro and significantly increased the antitumor efficacy of carbon-ion irradiation in the xenograft mouse model of TE-2 cells (P=0.03, Mann-Whitney's U-test) and was synergistic with the sensitization enhancement ratio (SER) value of 1.15. Therefore, Ad-FIR increased the cell-killing activity of the carbon-ion beam that avoids late-phase severe adverse effects independently of the TP53 status in vitro. Our findings indicated the feasibility of the combination of Ad-FIR with DNA damaging agents for future esophageal cancer treatment.
Jia, Xu; Shanmugam, Chandrakumar; Paluri, Ravi K; Jhala, Nirag C; Behring, Michael P; Katkoori, Venkat R; Sugandha, Shajan P; Bae, Sejong; Samuel, Temesgen; Manne, Upender
2017-03-21
Although loss of heterozygosity (LOH) at chromosome location 18q21 and decreased expression of SMAD4 in invasive colorectal cancers (CRCs) correlate with poor patient survival, the prognostic value of LOH at 18q21 and sub-cellular localization of SMAD4 have not been evaluated in relation to tumor stage. Genomic DNA samples from 209 formalin-fixed, paraffin-embedded sporadic CRC tissues and their matching controls were analyzed for 18q21 LOH, and corresponding tissue sections were evaluated by immunohistochemistry for expression of SMAD4 and assessed for its sub-cellular localization (nuclear vs. cytoplasmic). In addition, 53 frozen CRCs and their matching control tissues were analyzed for their mutational status and mRNA expression of SMAD4. The phenotypic expression pattern and LOH status were evaluated for correlation with patient survival by the use of Kaplan-Meier and Cox regression models. LOH of 18q21 was detected in 61% of the informative cases. In 8% of the cases, missense point mutations were detected in Smad4. In CRCs, relative to controls, there was increased SMAD4 staining in the cytoplasm (74%) and decreased staining in the nuclei (37%). LOH of 18q21 and high cytoplasmic localization of SMAD4 were associated with shortened overall survival of Stage II patients, whereas low nuclear expression of SMAD4 was associated with worse survival, but only for patients with Stage III CRCs. LOH of 18q21 and high cytoplasmic localization of SMAD4 in Stage II CRCs and low nuclear SMAD4 in Stage III CRCs are predictors of shortened patient survival.
Jia, Xu; Shanmugam, Chandrakumar; Paluri, Ravi K.; Jhala, Nirag C.; Behring, Michael P.; Katkoori, Venkat R.; Sugandha, Shajan P.; Bae, Sejong; Samuel, Temesgen; Manne, Upender
2017-01-01
Background Although loss of heterozygosity (LOH) at chromosome location 18q21 and decreased expression of SMAD4 in invasive colorectal cancers (CRCs) correlate with poor patient survival, the prognostic value of LOH at 18q21 and sub-cellular localization of SMAD4 have not been evaluated in relation to tumor stage. Methods Genomic DNA samples from 209 formalin-fixed, paraffin-embedded sporadic CRC tissues and their matching controls were analyzed for 18q21 LOH, and corresponding tissue sections were evaluated by immunohistochemistry for expression of SMAD4 and assessed for its sub-cellular localization (nuclear vs. cytoplasmic). In addition, 53 frozen CRCs and their matching control tissues were analyzed for their mutational status and mRNA expression of SMAD4. The phenotypic expression pattern and LOH status were evaluated for correlation with patient survival by the use of Kaplan-Meier and Cox regression models. Results LOH of 18q21 was detected in 61% of the informative cases. In 8% of the cases, missense point mutations were detected in Smad4. In CRCs, relative to controls, there was increased SMAD4 staining in the cytoplasm (74%) and decreased staining in the nuclei (37%). LOH of 18q21 and high cytoplasmic localization of SMAD4 were associated with shortened overall survival of Stage II patients, whereas low nuclear expression of SMAD4 was associated with worse survival, but only for patients with Stage III CRCs. Conclusions LOH of 18q21 and high cytoplasmic localization of SMAD4 in Stage II CRCs and low nuclear SMAD4 in Stage III CRCs are predictors of shortened patient survival. PMID:28423626
Bubak, Andrew N; Como, Christina N; Blackmon, Anna M; Frietze, Seth; Mescher, Teresa; Jones, Dallas; Cohrs, Randall J; Paucek, Petr; Baird, Nicholas L; Nagel, Maria A
2018-05-19
Varicella zoster virus (VZV) can present as a myelopathy with spinal astrocyte infection. Recent studies support a role for the neurokinin-1 receptor (NK-1R) in virus infections, as well as for cytoskeletal alterations that may promote viral spread. Thus, we examined the role of NK-1R in VZV-infected primary human spinal astrocytes (HA-sps) to shed light on the pathogenesis of VZV myelopathy. Mock- and VZV-infected HA-sps were examined for substance P (subP) production, NK-1R localization, morphological changes and viral spread in the presence or absence of NK-1R antagonists, aprepitant and rolapitant. VZV infection of HA-sps induced nuclear localization of full-length and truncated NK-1R in the absence of the endogenous ligand, subP, and was associated with extensive lamellipodia formation and viral spread that was inhibited by NK-1R antagonists. We have identified a novel, subP-independent, proviral function of nuclear NK-1R associated with lamellipodia formation and viral spread that is distinct from subP-induced NK-1R cell membrane/cytoplasmic localization without lamellipodia formation. These results suggest that binding of a putative viral ligand to NK-1R produces a dramatically different NK-1R downstream effect than binding of subP. Finally, NK-1R antagonists aprepitant and rolapitant provide promising alternatives to nucleoside analogs in treating VZV infections, including myelopathy.
MicroRNA-375 Is Induced in Cisplatin Nephrotoxicity to Repress Hepatocyte Nuclear Factor 1-β*
Hao, Jielu; Lou, Qiang; Wei, Qingqing; Mei, Shuqin; Li, Lin; Wu, Guangyu; Mi, Qing-Sheng; Mei, Changlin; Dong, Zheng
2017-01-01
Nephrotoxicity is a major adverse effect of cisplatin-mediated chemotherapy in cancer patients. The pathogenesis of cisplatin-induced nephrotoxicity remains largely unclear, making it difficult to design effective renoprotective approaches. Here, we have examined the role of microRNAs (miRNAs) in cisplatin-induced nephrotoxicity. We show that cisplatin nephrotoxicity was not affected by overall depletion of both beneficial and detrimental miRNAs from kidney proximal tubular cells in mice in which the miRNA-generating enzyme Dicer had been conditionally knocked out. To identify miRNAs involved in cisplatin nephrotoxicity, we used microarray analysis to profile miRNA expression and identified 47 up-regulated microRNAs and 20 down-regulated microRNAs in kidney cortical tissues. One up-regulated miRNA was miR-375, whose expression was also induced in cisplatin-treated renal tubular cells. Interestingly, inhibition of miR-375 decreased cisplatin-induced apoptosis, suggesting that miR-375 is a cell-damaging or pro-apoptotic agent. Blockade of P53 or NF-κB attenuated cisplatin-induced miR-375 expression, supporting a role of P53 and NF-κB in miR-375 induction. We also identified hepatocyte nuclear factor 1 homeobox B (HNF-1β) as a key downstream target of miR-375. Of note, we further demonstrated that HNF-1β protected renal cells against cisplatin-induced apoptosis. Together, these results suggest that upon cisplatin exposure, P53 and NF-κB collaboratively induce miR-375 expression, which, in turn, represses HNF-1β activity, resulting in renal tubular cell apoptosis and nephrotoxicity. PMID:28119452
DNA damage response in renal ischemia-reperfusion and ATP-depletion injury of renal tubular cells
Ma, Zhengwei; Wei, Qingqing; Dong, Guie; Huo, Yuqing; Dong, Zheng
2014-01-01
Renal ischemia-reperfusion leads to acute kidney injury (AKI) that is characterized pathologically by tubular damage and cell death, followed by tubular repair, atrophy and interstitial fibrosis. Recent work suggested the possible presence of DNA damage response (DDR) in AKI. However, the evidence is sketchy and the role and regulation of DDR in ischemic AKI remain elusive. In this study, we demonstrated the induction of phosphorylation of ATM, H2AX, Chk2 and p53 during renal ischemia-reperfusion in mice, suggesting DDR in kidney tissues. DDR was also induced in vitro during the recovery or “reperfusion” of renal proximal tubular cells (RPTCs) after ATP-depletion. DDR in RPTCs was abrogated by supplying glucose to maintain ATP via glycolysis, indicating that the DDR depends on ATP depletion. The DDR was also suppressed by the general caspase inhibitor z-VAD and the overexpression of Bcl-2, supporting a role of apoptosis-associated DNA damage in the DDR. N-acetylcysteine (NAC), an antioxidant, suppressed the phosphorylation of ATM and p53 and, to a less extent, Chk2, but NAC increased the phosphorylation and nuclear foci formation of H2AX. Interestingly, NAC increased apoptosis, which may account for the observed H2AX activation. Ku55933, an ATM inhibitor, blocked ATM phosphorylation and ameliorated the phosphorylation of Chk2 and p53, but it increased H2AX phosphorylation and nuclear foci formation. Ku55933 also increased apoptosis in RPTCs following ATP-depletion. The results suggest that DDR occurs during renal ischemia-reperfusion in vivo and ATP-depletion injury in vitro. The DDR is partially induced by apoptosis and oxidative stress-related DNA damage. ATM, as a sensor in the DDR, may play a cytoprotective role against tubular cell injury and death. PMID:24726884
Granata, Cesare; Jamnick, Nicholas A; Bishop, David J
2018-04-19
Physical inactivity represents the fourth leading risk factor for mortality, and it has been linked with a series of chronic disorders, the treatment of which absorbs ~ 85% of healthcare costs in developed countries. Conversely, physical activity promotes many health benefits; endurance exercise in particular represents a powerful stimulus to induce mitochondrial biogenesis, and it is routinely used to prevent and treat chronic metabolic disorders linked with sub-optimal mitochondrial characteristics. Given the importance of maintaining a healthy mitochondrial pool, it is vital to better characterize how manipulating the endurance exercise dose affects cellular mechanisms of exercise-induced mitochondrial biogenesis. Herein, we propose a definition of mitochondrial biogenesis and the techniques available to assess it, and we emphasize the importance of standardizing biopsy timing and the determination of relative exercise intensity when comparing different studies. We report an intensity-dependent regulation of exercise-induced increases in nuclear peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) protein content, nuclear phosphorylation of p53 (serine 15), and PGC-1α messenger RNA (mRNA), as well as training-induced increases in PGC-1α and p53 protein content. Despite evidence that PGC-1α protein content plateaus within a few exercise sessions, we demonstrate that greater training volumes induce further increases in PGC-1α (and p53) protein content, and that short-term reductions in training volume decrease the content of both proteins, suggesting training volume is still a factor affecting training-induced mitochondrial biogenesis. Finally, training-induced changes in mitochondrial transcription factor A (TFAM) protein content are regulated in a training volume-dependent manner and have been linked with training-induced changes in mitochondrial content.
Silva, Bárbara Alcaraz; Stambaugh, Jessica R.
2013-01-01
Abstract. Telomeres are at the ends of chromosomes. Previous evidence suggests that laser-induced deoxyribose nucleic acid (DNA) breaks at chromosome ends during anaphase results in delayed cytokinesis. A possible explanation for this delay is that the DNA damage response (DDR) mechanism has been activated. We describe a live imaging method to study the effects of DDR activation following focal point near-infrared femtosecond laser microirradiation either at a single chromosome end or at a chromosome arm in mitotic anaphase cells. Laser microirradiation is used in combination with dual fluorescent labeling to monitor the co-localization of double-strand break marker γH2AX along with the DDR factors in PtK2 (Potorous tridactylus) cells. Laser-induced DNA breaks in chromosome ends as well as in chromosome arms results in recruitment of the following: poly(ADP-ribose) polymerase 1, checkpoint sensors (p-Chk1, p-Chk2), DNA repair protein Ku70/Ku80, and proliferating cell nuclear antigen. However, phosphorylated p53 at serine 15 is detected only at chromosome ends and not at chromosome arms. Full activation of DDR on damaged chromosome ends may explain previously published results that showed the delay of cytokinesis. PMID:24064949
Yi, Hanjie; Yan, Xianglei; Luo, Qiuyun; Yuan, Luping; Li, Baoxia; Pan, Wentao; Zhang, Lin; Chen, Haibo; Wang, Jing; Zhang, Yubin; Zhai, Yifan; Qiu, Miao-Zhen; Yang, Da-Jun
2018-05-02
Gastric cancer is the leading cause of cancer related death worldwide. Radiation alone or combined with chemotherapy plays important role in locally advanced and metastatic gastric adenocarcinoma. MDM2-p53 interaction and downstream signaling affect cellular response to DNA damage which leads to cell cycle arrest and apoptosis. Therefore, restoring p53 function by inhibiting its interaction with MDM2 is a promising therapeutic strategy for cancer. APG-115 is a novel small molecule inhibitor which blocks the interaction of MDM2 and p53. In this study, we investigated that the radiosensitivity of APG-115 in gastric adenocarcinoma in vitro and in vivo. The role of APG-115 in six gastric cancer cells viability in vitro was determined by CCK-8 assay. The expression level of MDM2, p21, PUMA and BAX in AGS and MKN45 cell lines was measured via real-time PCR (RT-PCR). The function of treatment groups on cell cycle and cell apoptosis were detected through Flow Cytometry assay. Clonogenic assays were used to measure the radiosensitivity of APG-115 in p53 wild type gastric cancer cell lines. Western blot was conducted to detect the protein expressions of mdm2-p53 signal pathway. Xenograft models in nude mice were established to explore the radiosensitivity role of APG-115 in gastric cancer cells in vivo. We found that radiosensitization by APG-115 occurred in p53 wild-type gastric cancer cells. Increasing apoptosis and cell cycle arrest was observed after administration of APG-115 and radiation. Radiosensitivity of APG-115 was mainly dependent on MDM2-p53 signal pathway. In vivo, APG-115 combined with radiation decreased xenograft tumor growth much more significantly than either single treatment. Moreover, the number of proliferating cells (Ki-67) significantly decreased in combination group compared with single treatment group. In summary, we found that combination of MDM2-p53 inhibitor (APG-115) and radiotherapy can enhance antitumor effect both in vitro and in vivo. This is the first report on radiosensitivity of APG-115 which shed light on clinical trial of the combination therapy of radiation with APG-115 in gastric adenocarcinoma.
Auto-ubiquitination of Mdm2 Enhances Its Substrate Ubiquitin Ligase Activity*
Ranaweera, Ruchira S.; Yang, Xiaolu
2013-01-01
The RING domain E3 ubiquitin ligase Mdm2 is the master regulator of the tumor suppressor p53. It targets p53 for proteasomal degradation, restraining the potent activity of p53 and enabling cell survival and proliferation. Like most E3 ligases, Mdm2 can also ubiquitinate itself. How Mdm2 auto-ubiquitination may influence its substrate ubiquitin ligase activity is undefined. Here we show that auto-ubiquitination of Mdm2 is an activating event. Mdm2 that has been conjugated to polyubiquitin chains, but not to single ubiquitins, exhibits substantially enhanced activity to polyubiquitinate p53. Mechanistically, auto-ubiquitination of Mdm2 facilitates the recruitment of the E2 ubiquitin-conjugating enzyme. This occurs through noncovalent interactions between the ubiquitin chains on Mdm2 and the ubiquitin binding domain on E2s. Mutations that diminish the noncovalent interactions render auto-ubiquitination unable to stimulate Mdm2 substrate E3 activity. These results suggest a model in which polyubiquitin chains on an E3 increase the local concentration of E2 enzymes and permit the processivity of substrate ubiquitination. They also support the notion that autocatalysis may be a prevalent mode for turning on the activity of latent enzymes. PMID:23671280
Lukman, Suryani; Lane, David P.; Verma, Chandra S.
2013-01-01
The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD). In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs). Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3). Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart). Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1) a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2) possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site. PMID:24324553
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.
2016-06-01
Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3more » antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.« less
Koyama, Masako; Hirano, Hidemi; Shirai, Natsuki; Matsuura, Yoshiyuki
2017-10-01
Xpo1p (yeast CRM1) is the major nuclear export receptor that carries a plethora of proteins and ribonucleoproteins from the nucleus to cytoplasm. The passage of the Xpo1p nuclear export complex through nuclear pore complexes (NPCs) is facilitated by interactions with nucleoporins (Nups) containing extensive repeats of phenylalanine-glycine (so-called FG repeats), although the precise role of each Nup in the nuclear export reaction remains incompletely understood. Here we report structural and biochemical characterization of the interactions between the Xpo1p nuclear export complex and the FG repeats of Nup42p, a nucleoporin localized at the cytoplasmic face of yeast NPCs and has characteristic SxFG/PxFG sequence repeat motif. The crystal structure of Xpo1p-PKI-Nup42p-Gsp1p-GTP complex identified three binding sites for the SxFG/PxFG repeats on HEAT repeats 14-20 of Xpo1p. Mutational analyses of Nup42p showed that the conserved serines and prolines in the SxFG/PxFG repeats contribute to Xpo1p-Nup42p binding. Our structural and biochemical data suggest that SxFG/PxFG-Nups such as Nup42p and Nup159p at the cytoplasmic face of NPCs provide high-affinity docking sites for the Xpo1p nuclear export complex in the terminal stage of NPC passage and that subsequent disassembly of the nuclear export complex facilitates recycling of free Xpo1p back to the nucleus. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
Pavanello, Sofia; Pesatori, Angela-C; Dioni, Laura; Hoxha, Mirjam; Bollati, Valentina; Siwinska, Ewa; Mielzyńska, Danuta; Bolognesi, Claudia; Bertazzi, Pier-Alberto; Baccarelli, Andrea
2010-02-01
Shorter telomere length (TL) in peripheral blood lymphocytes (PBLs) is predictive of lung cancer risk. Polycyclic aromatic hydrocarbons (PAHs) are established lung carcinogens that cause chromosome instability. Whether PAH exposure and its molecular effects are linked with shorter TL has never been evaluated. In the present study, we investigated the effect of chronic exposure to PAHs on TL measured in PBLs of Polish male non-current smoking cokeoven workers and matched controls. PAH exposure and molecular effects were characterized using measures of internal dose (urinary 1-pyrenol), effective dose [anti-benzo[a]pyrene diolepoxide (anti-BPDE)-DNA adduct], genetic instability (micronuclei, MN) and DNA methylation [p53 promoter and Alu and long interspersed nuclear element-1 (LINE-1) repetitive elements, as surrogate measures of global methylation] in PBLs. TL was measured by real-time polymerase chain reaction. Cokeoven workers were heavily exposed to PAHs (79% exceeded the urinary 1-pyrenol biological exposure index) and exhibited lower TL (P = 0.038) than controls, as well as higher levels of genetic and chromosomal alterations [i.e. anti-BPDE-DNA adduct and MN (P < 0.0001)] and epigenetic changes [i.e. p53 gene-specific promoter and global methylation (P
Baliaka, A; Zarogoulidis, P; Domvri, K; Hohenforst-Schmidt, W; Sakkas, A; Huang, H; Le Pivert, P; Koliakos, G; Koliakou, E; Kouzi-Koliakos, K; Tsakiridis, K; Chioti, A; Siotou, E; Cheva, A; Zarogoulidis, K; Sakkas, L
2014-02-01
Lung cancer still remains to be challenged by novel treatment modalities. Novel locally targeted routes of administration are a methodology to enhance treatment and reduce side effects. Intratumoral gene therapy is a method for local treatment and could be used either in early-stage lung cancer before surgery or at advanced stages as palliative care. Novel non-viral vectors are also in demand for efficient gene transfection to target local cancer tissue and at the same time protect the normal tissue. In the current study, C57BL/6 mice were divided into three groups: (a) control, (b) intravenous and (c) intatumoral gene therapy. The novel 2-Diethylaminoethyl-Dextran Methyl Methacrylate Copolymer Non-Viral Vector (Ryujyu Science Corporation) was conjugated with plasmid pSicop53 from the company Addgene for the first time. The aim of the study was to evaluate the safety and efficacy of targeted gene therapy in a Lewis lung cancer model. Indeed, although the pharmacokinetics of the different administration modalities differs, the intratumoral administration presented increased survival and decreased distant metastasis. Intratumoral gene therapy could be considered as an efficient local therapy for lung cancer.
Experimental Therapy of Advanced Breast Cancer: Targeting NFAT1-MDM2-p53 Pathway.
Qin, Jiang-Jiang; Wang, Wei; Zhang, Ruiwen
2017-01-01
Advanced breast cancer, especially advanced triple-negative breast cancer, is typically more aggressive and more difficult to treat than other breast cancer phenotypes. There is currently no curable option for breast cancer patients with advanced diseases, highlighting the urgent need for novel treatment strategies. We have recently discovered that the nuclear factor of activated T cells 1 (NFAT1) activates the murine double minute 2 (MDM2) oncogene. Both MDM2 and NFAT1 are overexpressed and constitutively activated in breast cancer, particularly in advanced breast cancer, and contribute to its initiation, progression, and metastasis. MDM2 regulates cancer cell proliferation, cell cycle progression, apoptosis, migration, and invasion through both p53-dependent and -independent mechanisms. We have proposed to target the NFAT1-MDM2-p53 pathway for the treatment of human cancers, especially breast cancer. We have recently identified NFAT1 and MDM2 dual inhibitors that have shown excellent in vitro and in vivo activities against breast cancer, including triple-negative breast cancer. Herein, we summarize recent advances made in the understanding of the oncogenic functions of MDM2 and NFAT1 in breast cancer, as well as current targeting strategies and representative inhibitors. We also propose several strategies for inhibiting the NFAT1-MDM2-p53 pathway, which could be useful for developing more specific and effective inhibitors for breast cancer therapy. Copyright © 2017. Published by Elsevier Inc.
MDM2 beyond cancer: podoptosis, development, inflammation, and tissue regeneration.
Ebrahim, Martrez; Mulay, Shrikant R; Anders, Hans-Joachim; Thomasova, Dana
2015-11-01
Murine double minute (MDM)-2 is an intracellular molecule with diverse biological functions. It was first described to limit p53-mediated cell cycle arrest and apoptosis, hence, gain of function mutations are associated with malignancies. This generated a rationale for MDM2 being a potential therapeutic target in cancer therapy. Meanwhile, several additional functions and pathogenic roles of MDM2 have been identified that either enforce therapeutic MDM2 blockade or raise caution about potential side effects. MDM2 is also required for organ development and tissue homeostasis because unopposed p53 activation leads to p53-overactivation-dependent cell death, referred to as podoptosis. Podoptosis is caspase-independent and, therefore, different from apoptosis. The mitogenic role of MDM2 is also needed for wound healing upon tissue injury, while MDM2 inhibition impairs re-epithelialization upon epithelial damage. In addition, MDM2 has p53-independent transcription factor-like effects in nuclear factor-kappa beta (NFκB) activation. Therefore, MDM2 promotes tissue inflammation and MDM2 inhibition has potent anti-inflammatory effects in tissue injury. Here we review the biology of MDM2 in the context of tissue development, homeostasis, and injury and discuss how the divergent roles of MDM2 could be used for certain therapeutic purposes. MDM2 blockade had mostly anti-inflammatory and anti-mitotic effects that can be of additive therapeutic efficacy in inflammatory and hyperproliferative disorders such as certain cancers or lymphoproliferative autoimmunity, such as systemic lupus erythematosus or crescentic glomerulonephritis.
Abelev, B.; Adam, J.; Adamová, D.; ...
2014-02-18
We studied inclusive J/ψ production with the ALICE detector in p-Pb collisions at the nucleon-nucleon center of mass energy √s NN = 5.02 TeV at the CERN LHC. The measurement is performed in the center of mass rapidity domains 2.03 < y cms < 3.53 and -4.46 < y cms < -2.96, down to zero transverse momentum, studying the μ + μ - decay mode. In this paper, the J/ψ production cross section and the nuclear modification factor R pPb for the rapidities under study are presented. Moreover, while at forward rapidity, corresponding to the proton direction, amore » suppression of the J/ψ yield with respect to binary-scaled pp collisions is observed, in the backward region no suppression is present. Finally, the ratio of the forward and backward yields is also measured differentially in rapidity and transverse momentum. Theoretical predictions based on nuclear shadowing, as well as on models including, in addition, a contribution from partonic energy loss, are in fair agreement with the experimental results.« less
Vázquez-Ulloa, Elenaé; Ramos-Cruz, Ana Clara; Prada, Diddier; Avilés-Salas, Alejandro; Chávez-Blanco, Alma Delia; Herrera, Luis A.; Lizano, Marcela; Contreras-Paredes, Adriana
2018-01-01
The participation of NOTCH signaling in invasive cervical cancer (ICC) remains controversial since both tumor suppressive and oncogenic properties have been described. Additionally, the role of NUMB, a negative regulator of NOTCH, remains unclear in ICC. We aimed to investigate the role of NOTCH1 and NUMB expression and their localization in cervical intraepithelial neoplasia (CIN) and ICC samples. A total of 144 biopsies were obtained from the Instituto Nacional de Cancerología, México from 2004 to 2017, and were subjected to immunohistochemistry for NOTCH1 and NUMB. We found that nuclear NOTCH1 expression was more frequently found in CIN samples compared with ICC (77.55% vs. 15.79%, p = 0.001). NUMB was almost exclusively found in the nucleus of CIN samples (32.65% vs. 6.32%, p = 0.001). Cytoplasmic expression of NOTCH1 (44.21%) and NUMB (35.79%) was the most frequent localization in ICC. Multivariable-adjusted analysis showed that the loss of nuclear NOTCH1 expression was an independent predictor of malignancy (β = –3.428, 95% confidence interval [95% CI] = –5.127, –1.728, p = 0.001). In contrast, the association between cytoplasmic NUMB expression and cervical cancer was lost after adjusting for nuclear NOTCH1 expression (β = 2.074, 95% [CI] = –0.358, 4.506, P = 0.094). Additionally, patients with cytoplasmic NOTCH1 expression showed a borderline association with longer overall survival (OS) than those with nuclear NOTCH1 expression (P = 0.08). Our data suggest that the loss of nuclear NOTCH1 but not NUMB might be an independent predictor of malignancy in cervical cancer. PMID:29721172
Vázquez-Ulloa, Elenaé; Ramos-Cruz, Ana Clara; Prada, Diddier; Avilés-Salas, Alejandro; Chávez-Blanco, Alma Delia; Herrera, Luis A; Lizano, Marcela; Contreras-Paredes, Adriana
2018-04-10
The participation of NOTCH signaling in invasive cervical cancer (ICC) remains controversial since both tumor suppressive and oncogenic properties have been described. Additionally, the role of NUMB, a negative regulator of NOTCH, remains unclear in ICC. We aimed to investigate the role of NOTCH1 and NUMB expression and their localization in cervical intraepithelial neoplasia (CIN) and ICC samples. A total of 144 biopsies were obtained from the Instituto Nacional de Cancerología, México from 2004 to 2017, and were subjected to immunohistochemistry for NOTCH1 and NUMB. We found that nuclear NOTCH1 expression was more frequently found in CIN samples compared with ICC (77.55% vs. 15.79%, p = 0.001). NUMB was almost exclusively found in the nucleus of CIN samples (32.65% vs. 6.32%, p = 0.001). Cytoplasmic expression of NOTCH1 (44.21%) and NUMB (35.79%) was the most frequent localization in ICC. Multivariable-adjusted analysis showed that the loss of nuclear NOTCH1 expression was an independent predictor of malignancy (β = -3.428, 95% confidence interval [95% CI] = -5.127, -1.728, p = 0.001). In contrast, the association between cytoplasmic NUMB expression and cervical cancer was lost after adjusting for nuclear NOTCH1 expression (β = 2.074, 95% [CI] = -0.358, 4.506, P = 0.094). Additionally, patients with cytoplasmic NOTCH1 expression showed a borderline association with longer overall survival (OS) than those with nuclear NOTCH1 expression ( P = 0.08). Our data suggest that the loss of nuclear NOTCH1 but not NUMB might be an independent predictor of malignancy in cervical cancer.
NASA Astrophysics Data System (ADS)
Kim, S. G.
2016-12-01
Depth determination and source characteristics of the North Korea Nuclear tests (2006, 2009, 2013 and 2016) using seismic arrays with azimuthal optium coverage So Gu Kim1,*, Yefim Gitterman2, Václav Vavryčuk3 and Seoung-kyu Lee1 1Korea Seismological Institute, Goyang 10332, Republic of Korea 2Seismology Division, Geophysical Institute of Israel, P.O.B. 182, Lod 71100, Israel 3Institute of Geophysics, Academy of Sciences, Prague 14100, Czech Republic Abstract The source depths for the North Korean nuclear tests (2006, 2009, 2013 and 2016) were determined using depth phases (pP, sP, pPn and sPn) and Rayleigh wave spectra from local and global arrays. The emplacement depths were estimated at 2.21, 2.10, 2.10 and 2.08 km for the 2006, 2009. 2013 and 2016 nuclear tests respectively. It was also found that the mechanism of the 2006 test generated roughly a reverse faulting accompanying mostly Rayleigh waves, whereas the 2009 and 2013 tests were an oblique-reverse faulting generating SH and Love waves as well as Rayleigh waves. The generation of SH and Love waves for the 2009 and 2013 nuclear tests was attributed to not only release of tectonic stress but also other factors such as relaxation of cavity fractures, source configuration and source mechanism. We infer that the 2009, 2013 and 2016 tests must have well contained nuclear debris through long winding horizontal drifts in the light of the absence of radioisotopes to the atmosphere compared with 2006 test which may have been conducted in the vertical shift as a vertically distributed source. ______________________________________________ *Corresponding author: So Gu Kim (sogukim@hanmail.net)
NASA Technical Reports Server (NTRS)
Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.
1996-01-01
Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.
Mechanisms of Nuclear Export in Cancer and Resistance to Chemotherapy
El-Tanani, Mohamed; Dakir, El-Habib; Raynor, Bethany; Morgan, Richard
2016-01-01
Tumour suppressor proteins, such as p53, BRCA1, and ABC, play key roles in preventing the development of a malignant phenotype, but those that function as transcriptional regulators need to enter the nucleus in order to function. The export of proteins between the nucleus and cytoplasm is complex. It occurs through nuclear pores and exported proteins need a nuclear export signal (NES) to bind to nuclear exportin proteins, including CRM1 (Chromosomal Region Maintenance protein 1), and the energy for this process is provided by the RanGTP/RanGDP gradient. Due to the loss of DNA repair and cell cycle checkpoints, drug resistance is a major problem in cancer treatment, and often an initially successful treatment will fail due to the development of resistance. An important mechanism underlying resistance is nuclear export, and a number of strategies that can prevent nuclear export may reverse resistance. Examples include inhibitors of CRM1, antibodies to the nuclear export signal, and alteration of nuclear pore structure. Each of these are considered in this review. PMID:26985906
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Seong-Yeol; Bae, Young-Seuk, E-mail: ysbae@knu.ac.kr
We previously showed that protein kinase CK2 downregulation mediates senescence through the reactive oxygen species (ROS)–p53–p21{sup Cip1/WAF1} pathway in various human cells. In the present study, we investigated whether the FoxO3a transcription factor is associated with ROS production during CK2 downregulation-induced senescence in human colon cancer HCT116 and breast cancer MCF-7 cells. FoxO3a overexpression suppressed ROS production and p53 stabilization induced by a CK2α knockdown. CK2α downregulation induced nuclear export of FoxO3a through stimulation of AKT-mediated phosphorylation of FoxO3a and decreased transcription of its target genes (Cu/ZnSOD, MnSOD, and catalase). In contrast, CK2α overexpression inhibited AKT-mediated FoxO3a phosphorylation. This resulted inmore » nuclear accumulation of FoxO3a, and elevated expression of its target genes. Therefore, these data indicate for the first time that CK2 downregulation stimulates ROS generation by inhibiting FoxO3a during premature senescence in human colon and breast cancer cells. - Highlights: • FoxO3a overexpression inhibited ROS production mediated by CK2α knockdown. • CK2α downregulation induced nuclear export of FoxO3a via AKT activation. • CK2α downregulation reduced transcription of FoxO3a target genes including SOD. • CK2α upregulation elevated nuclear import and target gene expression of FoxO3a. • This study indicates that CK2 can modulate the intracellular ROS level via FoxO3a.« less
Murtaza, Imtiyaz; Mushtaq, Dhuha; Margoob, Mushtaq A; Dutt, Amit; Wani, Nisar Ahmad; Ahmad, Ishfaq; Bhat, Mohan Lal
2006-07-07
To systematically examine the extent of correlation of risk factors, such as age, consumed dietary habit and familial predisposition with somatic Tp53 molecular lesion causal to elevate carcinogenesis severity of esophageal squamous cell carcinoma (ESCC) among the Kashmiri population of Northern India. All cases (n = 51) and controls (n = 150) were permanent residents of the Kashmir valley. Genetic alterations were determined in exons 5-8 of Tp53 tumor suppressor gene among 45 ESCC cases histologically confirmed by PCR-SSCP analysis. Data for individual cancer cases (n = 45) and inpatient controls (n = 150) with non-cancer disease included information on family history of cancer, thirty prevailing common dietary risk factors along with patient's age group. Correlation of genetic lesion in p53 exons to animistic data from these parameters was generated by Chi-square test to all 45 histologically confirmed ESCC cases along with healthy controls. Thirty-five of 45 (77.8%) histologically characterized tumor samples had analogous somatic mutation as opposed to 1 of 45 normal sample obtained from adjacent region from the same patient showed germline mutation. The SSCP analysis demonstrated that most common p53 gene alterations were found in exon 6 (77.7%), that did not correlate with the age of the individual and clinicopathological parameters but showed significant concordance (P<0.05) with familial history of cancer (CD = 58), suggesting germline predisposition at an unknown locus, and dietary habit of consuming locally grown Brassica vegetable "Hakh" (CD = 19.5), red chillies (CD = 20.2), hot salty soda tea (CD = 2.37) and local baked bread (CD = 1.1). Our study suggests that somatic chromosomal mutations, especially in exon 6 of Tp53 gene, among esophageal cancer patients of an ethnically homogenous population of Kashmir valley are closely related to continued exposure to various common dietary risk factors, especially hot salty tea, meat, baked bread and "Hakh", that are rich in nitrosoamines and familial cancer history.
Ariumi, Yasuo; Ego, Takeshi; Kaida, Atsushi; Matsumoto, Mikiko; Pandolfi, Pier Paolo; Shimotohno, Kunitada
2003-03-20
Several viruses target cellular promyelocytic leukemia (PML)-nuclear bodies (PML-NBs) to induce their disruption, marked morphological changes in these structures or the relocation to PML-NB components to the cytoplasm of infected cells. PML conversely interferes with viral replication. We demonstrate that PML acts as a coactivator for the human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein without direct binding. Tax was identified within interchromatin granule clusters (IGCs)/RNA splicing bodies (SBs), not PML-NBs; Tax expression did not affect PML-NB formation. Moreover, PML and CBP/p300 cooperatively activated Tax-mediated HTLV-1-LTR-dependent gene expression. Interestingly, two PML mutants, PML-RAR and PMLDelta216-331, which fail to form PML-NBs, could also coactivate Tax-mediated trans-acting function but had no effect on retinoic acid receptor (RAR)- or p53-dependent gene expression. In contrast, SMRT (silencing mediator for retinoic acid and thyroid hormone receptors), a nuclear corepressor found within the matrix-associated deacetylase (MAD) nuclear body, relocalized into Tax-associated nuclear bodies upon coexpression with Tax. SMRT coactivated the trans-acting function of Tax through direct binding. Coexpression of SMRT and PML resulted in an additive activation of Tax trans-acting function. Thus, crosstalk between distinct nuclear bodies may control Tax function.
Bill, Kate Lynn J.; Garnett, Jeannine; Meaux, Isabelle; Ma, XiaoYen; Creighton, Chad J.; Bolshakov, Svetlana; Barriere, Cedric; Debussche, Laurent; Lazar, Alexander J.; Prudner, Bethany C.; Casadei, Lucia; Braggio, Danielle; Lopez, Gonzalo; Zewdu, Abbie; Bid, Hemant; Lev, Dina; Pollock, Raphael E.
2016-01-01
Purpose Dedifferentiated liposarcoma (DDLPS) is an aggressive malignancy that can recur locally or disseminate even after multidisciplinary care. Genetically amplified and expressed MDM2, often referred to as a “hallmark” of DDLPS, mostly sustains a wild-type p53 genotype, substantiating the p53-MDM2 axis as a potential therapeutic target for DDLPS. Here we report on the preclinical effects of SAR405838, a novel and highly selective MDM2 small-molecule inhibitor, in both in vitro and in vivo DDLPS models. Experimental Design The therapeutic effectiveness of SAR405838 was compared to the known MDM2 antagonists Nutlin-3a and MI-219. The effects of MDM2 inhibition were assessed in both in vitro and in vivo. In vitro and in vivo microarray analyses were performed to assess differentially expressed genes induced by SAR405838, as well as the pathways that these modulated genes enriched. Results SAR405838 effectively stabilized p53 and activated the p53 pathway, resulting in abrogated cellular proliferation, cell cycle arrest, and apoptosis. Similar results were observed with Nutlin-3a and MI-219; however, significantly higher concentrations were required. In vitro effectiveness of SAR405838 activity was recapitulated in DDLPS xenograft models where significant decreases in tumorigenicity were observed. Microarray analyses revealed genes enriching the p53 signaling pathway as well as genomic stability and DNA damage following SAR405838 treatment. Conclusion SAR405838 is currently in early phase clinical trials for a number of malignancies, including sarcoma, and our in vitro and in vivo results support its use as a potential therapeutic strategy for the treatment of DDLPS. PMID:26475335
Bill, Kate Lynn J; Garnett, Jeannine; Meaux, Isabelle; Ma, XiaoYen; Creighton, Chad J; Bolshakov, Svetlana; Barriere, Cedric; Debussche, Laurent; Lazar, Alexander J; Prudner, Bethany C; Casadei, Lucia; Braggio, Danielle; Lopez, Gonzalo; Zewdu, Abbie; Bid, Hemant; Lev, Dina; Pollock, Raphael E
2016-03-01
Dedifferentiated liposarcoma (DDLPS) is an aggressive malignancy that can recur locally or disseminate even after multidisciplinary care. Genetically amplified and expressed MDM2, often referred to as a "hallmark" of DDLPS, mostly sustains a wild-type p53 genotype, substantiating the MDM2:p53 axis as a potential therapeutic target for DDLPS. Here, we report on the preclinical effects of SAR405838, a novel and highly selective MDM2 small-molecule inhibitor, in both in vitro and in vivo DDLPS models. The therapeutic effectiveness of SAR405838 was compared with the known MDM2 antagonists Nutlin-3a and MI-219. The effects of MDM2 inhibition were assessed in both in vitro and in vivo. In vitro and in vivo microarray analyses were performed to assess differentially expressed genes induced by SAR405838, as well as the pathways that these modulated genes enriched. SAR405838 effectively stabilized p53 and activated the p53 pathway, resulting in abrogated cellular proliferation, cell-cycle arrest, and apoptosis. Similar results were observed with Nutlin-3a and MI-219; however, significantly higher concentrations were required. In vitro effectiveness of SAR405838 activity was recapitulated in DDLPS xenograft models where significant decreases in tumorigenicity were observed. Microarray analyses revealed genes enriching the p53 signaling pathway as well as genomic stability and DNA damage following SAR405838 treatment. SAR405838 is currently in early-phase clinical trials for a number of malignancies, including sarcoma, and our in vitro and in vivo results support its use as a potential therapeutic strategy for the treatment of DDLPS. ©2015 American Association for Cancer Research.
Effects of Debris Entrainment and Multi-Phase Flow on Plug Loading in an MX Trench.
1978-09-15
gas stream of density (pg) and velocity (Vg) is: -., * -) - * 2~ TD FD Pg (V P V) Vp-Vg I CD( TD ) (A.1) 4 where the drag coefficient (CD) is defined by...ATTN: FCPR ATTN: Code L53 , J. Forrest Field Command Naval Facilities Engineering Command Defense Nuclear Agency ATTN: Code 09M22C Livermore Division
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira
2013-10-01
X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared with wild-type p53. These suppressor mutations appear to rescue p53 function by creating novel intradomain interactions that stabilize the core domain, allowing compensation for the destabilizing V157F mutation.« less
Tryptanthrin inhibits MDR1 and reverses doxorubicin resistance in breast cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, S.-T.; National Center of Excellence for Clinical Trial and Research, College of Medicine, National Taiwan University, Taipei 10051, Taiwan; Chen, T.-M.
2007-06-22
Development of agents to overcome multidrug resistance (MDR) is important in cancer chemotherapy. Up to date, few chemicals have been reported to down-regulate MDR1 gene expression. We evaluated the effect of tryptanthrin on P-glycoprotein (P-gp)-mediated MDR in a breast cancer cell line MCF-7. Tryptanthrin could depress overexpression of MDR1 gene. We observed reduction of P-gp protein in parallel with decreases in mRNA in MCF-7/adr cells treated with tryptanthrin. Tryptanthrin suppressed the activity of MDR1 gene promoter. Tryptanthrin also enhanced interaction of the nuclear proteins with the negatively regulatory CAAT region of MDR1 gene promoter in MCF-7/adr. It might result inmore » suppression of MDR1 gene. In addition, tryptanthrin decreased the amount of mutant p53 protein with decreasing mutant p53 protein stability. It might contribute to negative regulation of MDR1 gene. In conclusion, tryptanthrin exhibited MDR reversing effect by down-regulation of MDR1 gene and might be a new adjuvant agent for chemotherapy.« less
Morikawa, Teppei; Kuchiba, Aya; Yamauchi, Mai; Meyerhardt, Jeffrey A; Shima, Kaori; Nosho, Katsuhiko; Chan, Andrew T; Giovannucci, Edward; Fuchs, Charles S; Ogino, Shuji
2011-04-27
Alterations of the WNT signaling pathway and cadherin-associated protein β 1 (CTNNB1 or β-catenin) have been implicated in colorectal carcinogenesis and metabolic diseases. To test the hypothesis that CTNNB1 activation in colorectal cancer modifies prognostic associations of body mass index (BMI) and level of postdiagnosis physical activity. Two US prospective cohort studies (Nurses' Health Study and the Health Professionals Follow-up Study) were used to evaluate CTNNB1 localization by immunohistochemistry in 955 patients with stage I, II, III, or IV colon and rectal cancer from 1980 through 2004. A Cox proportional hazards model was used to compute the hazard ratio (HR) for mortality, adjusting for clinical and tumor features, including microsatellite instability, CpG island methylator phenotype, level of long interspersed nucleotide element 1 methylation, mutations in KRAS, BRAF, or PIK3CA, and tumor protein p53. Colorectal cancer-specific mortality and overall mortality through June 30, 2009. In obese patients (BMI ≥30), positive status for nuclear CTNNB1 was associated with significantly better colorectal cancer-specific survival (adjusted HR, 0.24 [95% confidence interval {CI}, 0.12-0.49], P <.001 for interaction; 5-year survival: 0.85 for patients with positive nuclear CTNNB1 status vs 0.78 for those with negative status) and overall survival (adjusted HR, 0.56 [95% CI, 0.35-0.90], P = .03 for interaction; 5-year survival: 0.77 for patients with positive nuclear CTNNB1 status vs 0.74 for those with negative status), while CTNNB1 status was not associated with prognosis among nonobese patients (BMI <30). Among patients with negative status for nuclear CTNNB1 and cancer in stages I, II, or III, postdiagnosis physical activity was associated with better colorectal cancer-specific survival (adjusted HR, 0.33 [95% CI, 0.13-0.81], P = .05 for interaction; 5-year survival: 0.97 for ≥18 vs 0.89 for <18 metabolic equivalent task hours/week), while postdiagnosis physical activity was not associated with colorectal cancer-specific survival among patients with positive status for nuclear CTNNB1 (adjusted HR, 1.07 [95% CI, 0.50-2.30]). Among obese patients only, activation of CTNNB1 was associated with better colorectal cancer-specific survival and overall survival. Postdiagnosis physical activity was associated with better colorectal cancer-specific survival only among patients with negative status for nuclear CTNNB1. These molecular pathological epidemiology findings suggest that the effects of alterations in the WNT-CTNNB1 pathway on outcome are modified by BMI and physical activity.
Lin, Sheng-Tsai; Tu, Shih-Hsin; Yang, Po-Sheng; Hsu, Sung-Po; Lee, Wei-Hwa; Ho, Chi-Tang; Wu, Chih-Hsiung; Lai, Yu-Hsin; Chen, Ming-Yao; Chen, Li-Ching
2016-09-14
Glucose transporters (GLUTs) are required for glucose uptake in malignant cells, and they can be used as molecular targets for cancer therapy. An RT-PCR analysis was performed to investigate the mRNA levels of 14 subtypes of GLUTs in human colorectal cancer (COLO 205 and HT-29) and normal (FHC) cells. RT-PCR (n = 27) was used to assess the differences in paired tissue samples (tumor vs normal) isolated from colorectal cancer patients. GLUT2 was detected in all tested cells. The average GLUT2 mRNA level in 12 of 27 (44.4%) cases was 2.4-fold higher in tumor compared to normal tissues (*, p = 0.027). Higher GLUT2 mRNA expression was preferentially detected in advanced-stage tumors (stage 0 vs 3 = 16.38-fold, 95% CI = 9.22-26.54-fold; *, p = 0.029). The apple polyphenol phloretin (Ph) and siRNA methods were used to inhibit GLUT2 protein expression. Ph (0-100 μM, for 24 h) induced COLO 205 cell growth cycle arrest in a p53-dependent manner, which was confirmed by pretreatment of the cells with a p53-specific dominant negative expression vector. Hepatocyte nuclear factor 6 (HNF6), which was previously reported to be a transcription factor that activates GLUT2 and p53, was also induced by Ph (0-100 μM, for 24 h). The antitumor effect of Ph (25 mg/kg or DMSO twice a week for 6 weeks) was demonstrated in vivo using BALB/c nude mice bearing COLO 205 tumor xenografts. In conclusion, targeting GLUT2 could potentially suppress colorectal tumor cell invasiveness.
Jensen, Torben Heick; Neville, Megan; Rain, Jean Christophe; McCarthy, Terri; Legrain, Pierre; Rosbash, Michael
2000-01-01
Nuclear export of proteins containing leucine-rich nuclear export signals (NESs) is mediated by the NES receptor CRM1/Crm1p. We have carried out a yeast two-hybrid screen with Crm1p as a bait. The Crm1p-interacting clones were subscreened for nuclear export activity in a visual assay utilizing the Crm1p-inhibitor leptomycin B (LMB). This approach identified three Saccharomyces cerevisiae proteins not previously known to have nuclear export activity. These proteins are the 5′ RNA triphosphatase Ctl1p, the cell cycle-regulated transcription factor Ace2p, and a protein encoded by the previously uncharacterized open reading frame YDR499W. Mutagenesis analysis show that YDR499Wp contains an NES that conforms to the consensus sequence for leucine-rich NESs. Mutagenesis of Ctl1p and Ace2p were unable to identify specific NES residues. However, a 29-amino-acid region of Ace2p, rich in hydrophobic residues, contains nuclear export activity. Ace2p accumulates in the nucleus at the end of mitosis and activates early-G1-specific genes. We now provide evidence that Ace2p is nuclear not only in late M-early G1 but also during other stages of the cell cycle. This feature of Ace2p localization explains its ability to activate genes such as CUP1, which are not expressed in a cell cycle-dependent manner. PMID:11027275
Yrb4p, a yeast ran-GTP-binding protein involved in import of ribosomal protein L25 into the nucleus.
Schlenstedt, G; Smirnova, E; Deane, R; Solsbacher, J; Kutay, U; Görlich, D; Ponstingl, H; Bischoff, F R
1997-01-01
Gsp1p, the essential yeast Ran homologue, is a key regulator of transport across the nuclear pore complex (NPC). We report the identification of Yrb4p, a novel Gsp1p binding protein. The 123 kDa protein was isolated from Saccharomyces cerevisiae cells and found to be related to importin-beta, the mediator of nuclear localization signal (NLS)-dependent import into the nucleus, and to Pse1p. Like importin-beta, Yrb4p and Pse1p specifically bind to Gsp1p-GTP, protecting it from GTP hydrolysis and nucleotide exchange. The GTPase block of Gsp1p complexed to Yrb4p or Pse1p is released by Yrb1p, which contains a Gsp1p binding domain distinct from that of Yrb4p. This might reflect an in vivo function for Yrb1p. Cells disrupted for YRB4 are defective in nuclear import of ribosomal protein L25, but show no defect in the import of proteins containing classical NLSs. Expression of a Yrb4p mutant deficient in Gsp1p-binding is dominant-lethal and blocks bidirectional traffic across the NPC in wild-type cells. L25 binds to Yrb4p and Pse1p and is released by Gsp1p-GTP. Consistent with its putative role as an import receptor for L25-like proteins, Yrb4p localizes to the cytoplasm, the nucleoplasm and the NPC. PMID:9321403
Intracellular distribution of a speech/language disorder associated FOXP2 mutant
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mizutani, Akifumi; Department of Pediatrics, Jichi Medical University, Yakushiji 3311-1, Shimotsukeshi, Tochigi 329-0498; Matsuzaki, Ayumi
Although a mutation (R553H) in the forkhead box (FOX)P2 gene is associated with speech/language disorder, little is known about the function of FOXP2 or its relevance to this disorder. In the present study, we identify the forkhead nuclear localization domains that contribute to the cellular distribution of FOXP2. Nuclear localization of FOXP2 depended on two distally separated nuclear localization signals in the forkhead domain. A truncated version of FOXP2 lacking the leu-zip, Zn{sup 2+} finger, and forkhead domains that was observed in another patient with speech abnormalities demonstrated an aggregated cytoplasmic localization. Furthermore, FOXP2 (R553H) mainly exhibited a cytoplasmic localizationmore » despite retaining interactions with nuclear transport proteins (importin {alpha} and {beta}). Interestingly, wild type FOXP2 promoted the transport of FOXP2 (R553H) into the nucleus. Mutant and wild type FOXP2 heterodimers in the nucleus or FOXP2 R553H in the cytoplasm may underlie the pathogenesis of the autosomal dominant speech/language disorder.« less
Endo, Megumi; Hirose, Mamiko; Honda, Masanao; Koga, Hiroyuki; Morino, Yoshiaki; Kiyomoto, Masato; Wada, Hiroshi
2018-06-15
The marine environment around Japan experienced significant changes during the Cenozoic Era. In this study, we report findings suggesting that this dynamic history left behind traces in the genome of the Japanese sand dollar species Peronella japonica and P. rubra. Although mitochondrial Cytochrome C Oxidase I sequences did not indicate fragmentation of the current local populations of P. japonica around Japan, two different types of intron sequence were found in the Alx1 locus. We inferred that past fragmentation of the populations account for the presence of two types of nuclear sequences as alleles in the Alx1 intron of P. japonica. It is likely that the split populations have intermixed in recent times; hence, we did not detect polymorphisms in the sequences reflecting the current localization of the species. In addition, we found two allelic sequences of theAlx1 intron in the sister species P. rubra. The divergence times of the two types of Alx1 intron sequences were estimated at approximately 14.9 and 4.0 million years ago for P. japonica and P. rubra, respectively. Our study indicates that information from the intron sequences of nuclear genes can enhance our understanding of past genetic events in organisms. Copyright © 2018 Elsevier B.V. All rights reserved.
Ueda, Tetsuo; Taketani, Futoshi; Ota, Takeo; Hara, Yoshiaki
2007-01-01
To evaluate the effect of cataract density on the postoperative refractive outcome. For 59 nuclear cataract eyes, the axial length was preoperatively measured by the IOL Master (Zeiss, Germany) and ultrasound (US; UD-6000, Tomey, Japan) and the cataract density by EAS-1000 (Nidek, Japan). The prediction error was used as evaluation of the accuracy of ocular biometry. There were significant differences between IOL Master and US in the mean error (0.24 +/- 0.63 vs. 0.69 +/- 0.64 dpt, p < 0.001) and the mean absolute error (0.57 +/- 0.36 vs. 0.79 +/- 0.53 dpt, p < 0.001). The cataract density was significantly correlated with the prediction error with IOL Master (r = 0.24, p = 0.03) and US (r = 0.29, p = 0.01). Measurements with the IOL Master are slightly affected by the cataract density due to the refractive index change, but its accuracy is less affected than US. (c) 2007 S. Karger AG, Basel.
Nuclear pore proteins are involved in the biogenesis of functional tRNA.
Simos, G; Tekotte, H; Grosjean, H; Segref, A; Sharma, K; Tollervey, D; Hurt, E C
1996-05-01
Los1p and Pus1p, which are involved in tRNA biogenesis, were found in a genetic screen for components interacting with the nuclear pore protein Nsp1p. LOS1, PUS1 and NSP1 interact functionally, since the combination of mutations in the three genes causes synthetic lethality. Pus1p is an intranuclear protein which exhibits a nucleotide-specific and intron-dependent tRNA pseudouridine synthase activity. Los1p was shown previously to be required for efficient pre-tRNA splicing; we report here that Los1p localizes to the nuclear pores and is linked functionally to several components of the tRNA biogenesis machinery including Pus1p and Tfc4p. When the formation of functional tRNA was analyzed by an in vivo assay, the los1(-) pus1(-) double mutant, as well as several thermosensitive nucleoporin mutants including nsp1, nup116, nup133 and nup85, exhibited loss of suppressor tRNA activity even at permissive temperatures. These data suggest that nuclear pore proteins are required for the biogenesis of functional tRNA.
PAK1 translocates into nucleus in response to prolactin but not to estrogen
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oladimeji, Peter, E-mail: Peter.Oladimeji@rockets.utoledo.edu; Diakonova, Maria, E-mail: mdiakon@utnet.utoledo.edu
2016-04-22
Tyrosyl phosphorylation of the p21-activated serine–threonine kinase 1 (PAK1) has an essential role in regulating PAK1 functions in breast cancer cells. We previously demonstrated that PAK1 serves as a common node for estrogen (E2)- and prolactin (PRL)-dependent pathways. We hypothesize herein that intracellular localization of PAK1 is affected by PRL and E2 treatments differently. We demonstrate by immunocytochemical analysis that PAK1 nuclear translocation is ligand-dependent: only PRL but not E2 stimulated PAK1 nuclear translocation. Tyrosyl phosphorylation of PAK1 is essential for this nuclear translocation because phospho-tyrosyl-deficient PAK1 Y3F mutant is retained in the cytoplasm in response to PRL. We confirmedmore » these data by Western blot analysis of subcellular fractions. In 30 min of PRL treatment, only 48% of pTyr-PAK1 is retained in the cytoplasm of PAK1 WT clone while 52% re-distributes into the nucleus and pTyr-PAK1 shuttles back to the cytoplasm by 60 min of PRL treatment. In contrast, PAK1 Y3F is retained in the cytoplasm. E2 treatment causes nuclear translocation of neither PAK1 WT nor PAK1 Y3F. Finally, we show by an in vitro kinase assay that PRL but not E2 stimulates PAK1 kinase activity in the nuclear fraction. Thus, PAK1 nuclear translocation is ligand-dependent: PRL activates PAK1 and induces translocation of activated pTyr-PAK1 into nucleus while E2 activates pTyr-PAK1 only in the cytoplasm. - Highlights: • Prolactin but not estrogen causes translocation of PAK1 into nucleus. • Tyrosyl phosphorylation of PAK1 is required for nuclear localization. • Prolactin but not estrogen stimulates PAK1 kinase activity in nucleus.« less