Regulation of autophagy by cytoplasmic p53

PubMed Central

Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2009-01-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

Regulation of autophagy by cytoplasmic p53.

PubMed

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice

PubMed Central

Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.

2014-01-01

Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632

Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

PubMed

Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

2017-11-03

Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping

Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

Nuclear localization of Schizosaccharomyces pombe Mcm2/Cdc19p requires MCM complex assembly.

PubMed

Pasion, S G; Forsburg, S L

1999-12-01

The minichromosome maintenance (MCM) proteins MCM2-MCM7 are conserved eukaryotic replication factors that assemble in a heterohexameric complex. In fission yeast, these proteins are nuclear throughout the cell cycle. In studying the mechanism that regulates assembly of the MCM complex, we analyzed the cis and trans elements required for nuclear localization of a single subunit, Mcm2p. Mutation of any single mcm gene leads to redistribution of wild-type MCM subunits to the cytoplasm, and this redistribution depends on an active nuclear export system. We identified the nuclear localization signal sequences of Mcm2p and showed that these are required for nuclear targeting of other MCM subunits. In turn, Mcm2p must associate with other MCM proteins for its proper localization; nuclear localization of MCM proteins thus requires assembly of MCM proteins in a complex. We suggest that coupling complex assembly to nuclear targeting and retention ensures that only intact heterohexameric MCM complexes remain nuclear.

Nuclear Localization of Schizosaccharomyces pombe Mcm2/Cdc19p Requires MCM Complex Assembly

PubMed Central

Pasion, Sally G.; Forsburg, Susan L.

1999-01-01

The minichromosome maintenance (MCM) proteins MCM2–MCM7 are conserved eukaryotic replication factors that assemble in a heterohexameric complex. In fission yeast, these proteins are nuclear throughout the cell cycle. In studying the mechanism that regulates assembly of the MCM complex, we analyzed the cis and trans elements required for nuclear localization of a single subunit, Mcm2p. Mutation of any single mcm gene leads to redistribution of wild-type MCM subunits to the cytoplasm, and this redistribution depends on an active nuclear export system. We identified the nuclear localization signal sequences of Mcm2p and showed that these are required for nuclear targeting of other MCM subunits. In turn, Mcm2p must associate with other MCM proteins for its proper localization; nuclear localization of MCM proteins thus requires assembly of MCM proteins in a complex. We suggest that coupling complex assembly to nuclear targeting and retention ensures that only intact heterohexameric MCM complexes remain nuclear. PMID:10588642

Immunohistochemical study of p53 and proliferating cell nuclear antigen expression in odontogenic keratocyst and periapical cyst.

PubMed

Sajeevan, Thara Purath; Saraswathi, Tillai Rajasekaran; Ranganathan, Kannan; Joshua, Elizabeth; Rao, Uma Devi K

2014-07-01

p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA) is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC) and periapical cyst (PA). A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%), whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1) OKC showed p53 expression in 6 cases (60%) whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2) The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.

Around and beyond 53BP1 Nuclear Bodies.

PubMed

Fernandez-Vidal, Anne; Vignard, Julien; Mirey, Gladys

2017-12-05

Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.

Around and beyond 53BP1 Nuclear Bodies

PubMed Central

Fernandez-Vidal, Anne; Vignard, Julien

2017-01-01

Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction. PMID:29206178

A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

PubMed Central

Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

2016-01-01

p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

Co-expression of p53 and MDM2 in human atherosclerosis: implications for the regulation of cellularity of atherosclerotic lesions.

PubMed

Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M

1998-07-01

Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR

The small molecule 2-phenylethynesulfonamide induces covalent modification of p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent

p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less

Assessment of mdm2 Alterations on p53 Expression in Breast Cancer

DTIC Science & Technology

2000-10-01

Figure 2. Schematic Comparison of mdm2 with PCR Products of Various Sizes. nuclear localization signal I p53 binding site X acidic domain zinc...susceptibility gene isolated by controlled homozygous functional knockout of allelic loci in mammalian cells. Cell. 85: 319-329, 1996. 36. Li, L., Li, X ...twelve years. Chinese Journal of Parasitology and Parasitic Diseases 10: 112-114, 1992. 7. Gao DQ, Cansesaa L, Mouradian MM, Jose P. Dopamine D2-long

Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

2012-06-29

Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed

Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

PubMed

Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

2003-09-17

The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

Accumulation of p53 in infectious mononucleosis tissues.

PubMed

Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

2000-11-01

Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation.

PubMed

Jung, Yu Yeon; Son, Dong Ju; Lee, Hye Lim; Kim, Dae Hwan; Song, Min Jong; Ham, Young Wan; Kim, Youngsoo; Han, Sang Bae; Park, Mi Hee; Hong, Jin Tae

2017-08-01

Parkin is associated with various inflammatory diseases, including Parkinson's disease (PD) and rheumatoid arthritis (RA). However, the precise role of Parkin in RA is unclear. The present study addressed this issue by comparing the development of RA between non-transgenic (non-Tg) mice and PARK2 knockout (KO) mice. We found that cyclooxygenase-2 and inducible nitric oxide synthase expression and nuclear factor-κB activity were reduced but p53 activation was increased in PARK2 KO as compared to non-Tg mice. These effects were associated with reduced p53 degradation. Parkin was found to interact with p53; however, this was abolished in Parkin KO mice, which prevented p53 degradation. Treatment of PARK2 KO mice with p53 inhibitor increased Parkin expression as well as inflammation and RA development while decreasing nuclear p53 translocation, demonstrating that PARK2 deficiency inhibits inflammation in RA via suppression of p53 degradation. These results suggest that RA development may be reduced in PD patients. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.

PubMed Central

Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.

1995-01-01

We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469

A novel alkaloid, evodiamine causes nuclear localization of cytochrome-c and induces apoptosis independent of p53 in human lung cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohan, Vijay; Agarwal, Rajesh; Singh, Rana P., E-mail: ranaps@hotmail.com

Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survivalmore » of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer

Histone deacetylase inhibitors prevent p53-dependent and p53-independent Bax-mediated neuronal apoptosis through two distinct mechanisms.

PubMed

Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S

2009-03-04

Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.

Negative feedback regulation of wild-type p53 biosynthesis.

PubMed Central

Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

1995-01-01

When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

Chronic inflammation and cancer: potential chemoprevention through nuclear factor kappa B and p53 mutual antagonism

PubMed Central

2014-01-01

Activation of nuclear factor-kappa B (NF- κB) as a mechanism of host defense against infection and stress is the central mediator of inflammatory responses. A normal (acute) inflammatory response is activated on urgent basis and is auto-regulated. Chronic inflammation that results due to failure in the regulatory mechanism, however, is largely considered as a critical determinant in the initiation and progression of various forms of cancer. Mechanistically, NF- κB favors this process by inducing various genes responsible for cell survival, proliferation, migration, invasion while at the same time antagonizing growth regulators including tumor suppressor p53. It has been shown by various independent investigations that a down regulation of NF- κB activity directly, or indirectly through the activation of the p53 pathway reduces tumor growth substantially. Therefore, there is a huge effort driven by many laboratories to understand the NF- κB signaling pathways to intervene the function of this crucial player in inflammation and tumorigenesis in order to find an effective inhibitor directly, or through the p53 tumor suppressor. We discuss here on the role of NF- κB in chronic inflammation and cancer, highlighting mutual antagonism between NF- κB and p53 pathways in the process. We also discuss prospective pharmacological modulators of these two pathways, including those that were already tested to affect this mutual antagonism. PMID:25152696

Global Conformational Selection and Local Induced Fit for the Recognition between Intrinsic Disordered p53 and CBP

PubMed Central

Yu, Qingfen; Ye, Wei; Wang, Wei; Chen, Hai-Feng

2013-01-01

The transactivation domain (TAD) of tumor suppressor p53 can bind with the nuclear coactivator binding domain (NCBD) of cyclic-AMP response element binding protein (CBP) and activate transcription. NMR experiments demonstrate that both apo-NCBD and TAD are intrinsic disordered and bound NCBD/TAD undergoes a transition to well folded. The recognition mechanism between intrinsic disordered proteins is still hotly debated. Molecular dynamics (MD) simulations in explicit solvent are used to study the recognition mechanism between intrinsic disordered TAD and NCBD. The average RMSD values between bound and corresponding apo states and Kolmogorov-Smirnov P test analysis indicate that TAD and NCBD may follow an induced fit mechanism. Quantitative analysis indicates there is also a global conformational selection. In summary, the recognition of TAD and NCBD might obey a local induced fit and global conformational selection. These conclusions are further supported by high-temperature unbinding kinetics and room temperature landscape analysis. These methods can be used to study the recognition mechanism of other intrinsic disordered proteins. PMID:23555731

A stapled p53 helix overcomes HDMX-mediated suppression of p53.

PubMed

Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D

2010-11-16

Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.

Involvements of Estrogen Receptor, Proliferating Cell Nuclear Antigen and p53 in Endometrial Adenocarcinoma Development in Donryu Rats

PubMed Central

Yoshida, Midori; Katsuda, Shin-ichi; Maekawa, Akihiko

2012-01-01

Involvements of estrogen receptor (ER)α, proliferating cell nuclear antigen (PCNA) and p53 in the uterine carcinogenesis process in Donryu rats, a high yield strain of the uterine cancer were investigated immunohistochemically. ERα was expressed in atypical endometrial hyperplasia, accepted as a precancerous lesion of the uterine tumors, as well as well- and in moderately-differentiated endometrial adenocarcinomas, and the intensities of expression were similar to those in the luminal epithelial cells of the atrophic uterus at 15 months of age. The expression, however, was negative in the tumor cells of poorly differentiated type. Good growth of implanted grafts of the poorly-differentiated adenocarcinomas in both sexes with or without gonadectomy supported the estrogen independency of tumor progression to malignancy. PCNA labeling indices were increased with tumor development from atypical hyperplasia to adenocarcinoma. The tumor cells in poorly-differentiated adenocarcinomas were positive for p53 positive but negative for p21 expression, suggesting accumulation of mutated p53. These results indicate that the consistent ERα expression is involved in initiation and promotion steps of uterine carcinogenesis, but not progression. In addition, PCNA is related to tumor development and the expression of mutated p53 might be a late event during endometrial carcinogenesis. PMID:23345926

Altered S-nitrosylation of p53 is responsible for impaired antioxidant response in skeletal muscle during aging.

PubMed

Baldelli, Sara; Ciriolo, Maria Rosa

2016-12-20

p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress.

Altered S-nitrosylation of p53 is responsible for impaired antioxidant response in skeletal muscle during aging

PubMed Central

Baldelli, Sara; Ciriolo, Maria Rosa

2016-01-01

p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress. PMID:28025407

Nuclear TP53: An unraveled function as transcriptional repressor of PINK1.

PubMed

Checler, Frédéric; Goiran, Thomas; Alves da Costa, Cristine

2018-05-11

The tumor suppressor TP53/p53 is a key protein in both neurodegenerative diseases and cancer. Thus, TP53-linked cell death appears exacerbated in several age-related neuropathologies, while TP53 mutation-associated phenotypes indicate a loss of function accounting for approximately half of cancers. Thus, TP53 plays a pivotal role in these phenotypically distinct pathologies, a hypothesis reinforced by recent epidemiological studies suggesting an opposite risk to develop one type of pathology relative to the other. Dysfunctions in mitophagic processes also occur in both types of pathologies and again, TP53 has been proposed as one of the regulators of this cellular process. The consensus view postulates that TP53 exerts both anti- and pro-autophagy functions that are directly driven by a specific subcellular localization. Thus, TP53 positively modulates autophagy via the transcriptional control of several genes while it is acknowledged that its anti-autophagy phenotype is exclusively linked to a transcription-independent cytosolic control of an AMPK-MTOR cascade. Our study indicates that TP53 can also downregulate the specialized autophagy-related mitophagy response via the transcriptional repression of PINK1. This is the first demonstration of an anti-mitophagic control by nuclear TP53.

The nucleolus directly regulates p53 export and degradation.

PubMed

Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

2011-09-05

The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

PubMed

Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

2016-03-01

The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

Prognostic significance of p16INK4a/p53 in Tunisian patients with breast carcinoma.

PubMed

Karray-Chouayekh, Sondes; Baccouche, Sami; Khabir, Abdelmajid; Sellami-Boudawara, Tahia; Daoud, Jamel; Frikha, Mounir; Jlidi, Rachid; Gargouri, Ali; Mokdad-Gargouri, Raja

2011-09-01

Infiltrating ductal carcinoma (IDC) of the breast is a result of genetic alterations that affect the regulation of the cell cycle check-point and apoptosis. The aim of the present study was analysis using immunohistochemical localization of mouse double minute-2 (mdm2), p16INK4a, p53, bax and bcl-2 markers in Tunisian patients with breast IDC and to determine if there was correlation with the major clinico-pathological parameters and with survival of patients. We showed that the expression of p53, p16INK4a, mdm2, bcl-2, and bax was observed in 46.3%, 20.7%, 38%, 50% and 11.9% of cases, respectively. Statistical analysis revealed that positive expression of mdm2 was associated with larger tumors (P=0.013), whereas bax positivity was more prevalent in younger patients and in tumors of smaller size (P=0.008 and P=0.012 respectively). Furthermore, the expression of p16INK4a correlated with advanced grade (P<0.0001), triple negative tumors (ER-/PR-/HER2-, P=0.001) and mdm2 expression (P=0.017). The absence of nuclear p53 accumulation was predictive of good prognosis as well as when it was associated with negative expression of p16INK4a. Our findings suggest that among the biomarkers tested, p16INK4a might have a useful clinical and prognostic significance in infiltrating ductal carcinoma of the breast. Copyright © 2010 Elsevier GmbH. All rights reserved.

Stimulation of autophagy by the p53 target gene Sestrin2.

PubMed

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

PubMed Central

1994-01-01

Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have

Regulation of p53 Stability and Apoptosis by a ROR Agonist

PubMed Central

Wang, Yongjun; Solt, Laura A.; Kojetin, Douglas J.; Burris, Thomas P.

2012-01-01

Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer. PMID:22509368

Regulation of p53 stability and apoptosis by a ROR agonist.

PubMed

Wang, Yongjun; Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P

2012-01-01

Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

PubMed

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

PubMed

Cox, Darren P

2012-01-01

Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

Increased expression of p53 and p21 (Waf1/Cip1) in the lesional skin of bleomycin-induced scleroderma.

PubMed

Yamamoto, Toshiyuki; Nishioka, Kiyoshi

2005-05-01

Systemic sclerosis (SSc) is a connective tissue disorder characterized by excessive deposition of extracellular matrix in the affected skin as well as various internal organs, vascular injury and immune abnormality; however, the etiology of SSc remains still unknown. We previously established an experimental mouse model for scleroderma by repeated local injections of bleomycin, a DNA damaging agent. In this study, we examined the induction of apoptosis and the expression of p53, p21 (Waf1/Cip1), and proliferating cell nuclear antigen (PCNA) in the lesional skin following bleomycin exposure in this model. Dermal sclerosis was induced by alternate day's injections of bleomycin for 4 weeks. TUNEL assay showed that apoptotic cells began to appear at 1 week after bleomycin exposure, and were prominently detected at 3-4 weeks. Immunohistochemical examination showed increased expression of p53 and p21 mainly in the infiltrating mononuclear cells at 2 weeks after bleomycin treatment. Bleomycin treatment markedly enhanced PCNA expression at 1-2 weeks, mainly in mesenchyme, as compared with control phosphate buffered saline treatment. Reverse transcriptase-polymerase chain reaction analysis showed that the expression of p53 and p21 mRNA was concurrently upregulated at 1-2 weeks after bleomycin treatment. Taken together, coordinate increased levels of p53 and p21 preceded the maximal induction of apoptosis and dermal sclerosis. Our findings suggest that apoptotic processes are involved in the pathophysiology of bleomycin-induced scleroderma, which may be mediated, in part, by the upregulation of p53 and p21.

Tripeptidyl peptidase II plays a role in the radiation response of selected primary cell types but not based on nuclear translocation and p53 stabilization.

PubMed

Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele

2009-04-15

The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.

Prognostic significance of biomarkers (c-erbB-2, p53, proliferating cell nuclear antigen, and DNA content) in salivary duct carcinoma.

PubMed

Felix, A; El-Naggar, A K; Press, M F; Ordonez, N G; Fonseca, I; Tucker, S L; Luna, M A; Batsakis, J G

1996-06-01

Salivary duct carcinoma (SDC), a rare neoplasm of the major salivary glands, is a high-grade carcinoma with a predilection for elderly men. The authors investigated the prognostic role of p53, c-erbB2, proliferating cell nuclear antigen (PCNA), and DNA flow cytometry in a pathobiological evaluation of a cohort of 30 patients with these neoplasms. The patient group comprised 24 men and 6 women, with ages ranging from 22 to 87 years (mean = 61 years). Twenty-eight tumors were located in the parotid gland and two in the submandibular gland. Tumor size ranged from 1.0 to 8.0 cm (mean = 3.48 cm). Regional metastases were found in 73.3% (22 patients), systemic metastases in 43.3% (13 patients), and recurrences in 8 (26.6%) patients. DNA aneuploidy was found in 18 tumors (58.0%) and DNA diploidy in 12 (42%), with proliferative fractions ranging from 8.60% to 15.5 (mean = 10.6%). p53 protein nuclear immunostaining was positive in 56.6% and c-erbB2 overexpression was observed in 63% of the tumors. PCNA positivity ranged from 16.5% to 91.0%, with a mean of 49.5%. p53 immunopositivity, DNA aneuploidy, high growth, and proliferative fractions by PCNA and flow cytometry did not correlate with patient outcome. These results indicate that tumor size (P = .05), distant metastasis (P = .006), and C-erbB2 amplification (P = .04) are independent prognostic parameters in patients with salivary duct carcinoma.

Nuclear localisation of 53BP1 is regulated by phosphorylation of the nuclear localisation signal.

PubMed

von Morgen, Patrick; Lidak, Tomas; Horejsi, Zuzana; Macurek, Libor

2018-06-01

Repair of damaged DNA is essential for maintaining genomic stability. TP53-binding protein 1 (53BP1) plays an important role in repair of the DNA double-strand breaks. Nuclear localisation of 53BP1 depends on importin β and nucleoporin 153, but the type and location of 53BP1 nuclear localisation signal (NLS) have yet to be determined. Here, we show that nuclear import of 53BP1 depends on two basic regions, namely 1667-KRK-1669 and 1681-KRGRK-1685, which are both needed for importin binding. Lysine 1667 is essential for interaction with importin and its substitution to arginine reduced nuclear localisation of 53BP1. Furthermore, we have found that CDK1-dependent phosphorylation of 53BP1 at S1678 impairs importin binding during mitosis. Phosphorylation-mimicking mutant S1678D showed reduced nuclear localisation, suggesting that phosphorylation of the NLS interferes with nuclear import of the 53BP1 CONCLUSIONS: We show that 53BP1 contains a classical bipartite NLS 1666-GKRKLITSEEERSPAKRGRKS-1686, which enables the importin-mediated nuclear transport of 53BP1. Additionally, we found that posttranslational modification within the NLS region can regulate 53BP1 nuclear import. Our results indicate that integrity of the NLS is important for 53BP1 nuclear localisation. Precise mapping of the NLS will facilitate further studies on the effect of posttranslational modifications and somatic mutations on the nuclear localisation 53BP1 and DNA repair. © 2018 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.

Combined use of nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 for hepatocellular carcinoma detection in high-risk chronic hepatitis C patients.

PubMed

Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K

2017-10-01

Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (<5 cm) tumour) were recruited. The gene products of c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p < 0.0001) in the positivity rate of c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.

Low p53 Binding Protein 1 (53BP1) Expression Is Associated With Increased Local Recurrence in Breast Cancer Patients Treated With Breast-Conserving Surgery and Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neboori, Hanmanth J.R.; Haffty, Bruce G., E-mail: hafftybg@umdnj.edu; Wu Hao

2012-08-01

Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log-rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence-free survival (IBRFS), distant metastasis-free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survivalmore » (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their

The p53 breast cancer tissue biomarker in Indian women

PubMed Central

Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev

2011-01-01

Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177

INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.

PubMed

2007-01-01

Introgen and its wholly owned European subsidiary Gendux AB are developing an adenoviral p53 gene therapy as a treatment for cancer in the US and Europe, respectively. Phase III trials in patients with head and neck cancer are ongoing, and a number of clinical trials in other cancer indications have been completed. INGN 201 is being reviewed by the EMEA for approval in Li-Fraumeni syndrome (LFS) under the provisions of exceptional circumstance; the therapy is available on a compassionate use basis to eligible LFS cancer patients under a protocol authorised by the US FDA. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. The p53 protein is one of the most intricate elements in the apoptotic signalling cascade, and a mutation in the gene encoding it is believed to result in a decreased ability of a cell to apoptose. Thus replacing this gene via adenovirally-mediated p53 gene therapy is hoped to result in increased apoptosis where it is administered.INGN 201 is available for licensing, although Introgen favours retaining partial or full rights to the therapy in the US. Introgen entered into a license agreement with The University of Texas System and MD Anderson Cancer Center in 1994. The technologies licenced include p53 and fus1 (INGN 401). The collaboration has yielded exclusive patent and licensing rights to numerous technologies. Introgen entered into a collaboration with Rhône-Poulenc Rorer Pharmaceuticals (now sanofi-aventis) to develop therapeutics based on p53 inhibition in October 1994. However, in June 2001 this relationship was restructured and Introgen assumed responsibility for the worldwide development of all p53 products including INGN 201, and acquired all marketing and commercialisation rights with respect to those products. Introgen initiated two phase III trials in head and neck cancer (in June 2000 and May 2001) at about 80 sites in the US, Canada and Europe

Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.

PubMed

La Perle, K M; Jhiang, S M; Capen, C C

2000-08-01

Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice p53-/- mice p53-/- mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas.

Binding of Y-P30 to Syndecan 2/3 Regulates the Nuclear Localization of CASK

PubMed Central

Landgraf, Peter; Mikhaylova, Marina; Macharadze, Tamar; Borutzki, Corinna; Zenclussen, Ana-Claudia; Wahle, Petra; Kreutz, Michael R.

2014-01-01

The survival promoting peptide Y-P30 has documented neuroprotective effects as well as cell survival and neurite outgrowth promoting activity in vitro and in vivo. Previous work has shown that multimerization of the peptide with pleiotrophin (PTN) and subsequent binding to syndecan (SDC) -2 and -3 is involved in its neuritogenic effects. In this study we show that Y-P30 application regulates the nuclear localization of the SDC binding partner Calcium/calmodulin-dependent serine kinase (CASK) in neuronal primary cultures during development. In early development at day in vitro (DIV) 8 when mainly SDC-3 is expressed supplementation of the culture medium with Y-P30 reduces nuclear CASK levels whereas it has the opposite effect at DIV 18 when SDC-2 is the dominant isoform. In the nucleus CASK regulates gene expression via its association with the T-box transcription factor T-brain-1 (Tbr-1) and we indeed found that gene expression of downstream targets of this complex, like the GluN2B NMDA-receptor, exhibits a corresponding down- or up-regulation at the mRNA level. The differential effect of Y-P30 on the nuclear localization of CASK correlates with its ability to induce shedding of the ectodomain of SDC-2 but not -3. shRNA knockdown of SDC-2 at DIV 18 and SDC-3 at DIV 8 completely abolished the effect of Y-P30 supplementation on nuclear CASK levels. During early development a protein knockdown of SDC-3 also attenuated the effect of Y-P30 on axon outgrowth. Taken together these data suggest that Y-P30 can control the nuclear localization of CASK in a SDC-dependent manner. PMID:24498267

Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

PubMed Central

Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

2014-01-01

In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas

PubMed Central

La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.

2000-01-01

Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169

Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73

NASA Astrophysics Data System (ADS)

Zhang, Heng; Wu, Shengnan

2011-01-01

p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

PubMed Central

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

PubMed

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

TP53 Mutation Status of Tubo-ovarian and Peritoneal High-grade Serous Carcinoma with a Wild-type p53 Immunostaining Pattern.

PubMed

Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo

2017-12-01

Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence

PubMed Central

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-01-01

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.

PubMed

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-11-17

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.

Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan

Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less

p53 AND MDM2 PROTEIN EXPRESSION IN ACTINIC CHEILITIS

PubMed Central

de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida

2008-01-01

Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia. PMID:19082401

p53 and MDM2 protein expression in actinic cheilitis.

PubMed

de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida

2008-01-01

Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia.

The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

PubMed Central

Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

2015-01-01

Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We

Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

PubMed

Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

1998-01-01

A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

PubMed

Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

2018-04-17

The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

Evaluation of copper-64-labeled somatostatin agonists and antagonist in sstr2-transfected cell lines that are positive and negative for p53: implications for cancer therapy

PubMed Central

Nguyen, Kim; Parry, Jesse J.; Rogers, Buck E.; Anderson, Carolyn J.

2011-01-01

Objectives Radiolabeled somatostatin analogs have become important agents for molecular imaging and targeted radiotherapy of somatostatin receptor-positive tumors. Here we determine the effect of the tumor suppressor protein, p53, on trafficking 64Cu to tumor cell nuclei from DOTA vs.CB-TE2A-conjugated agonist Y3-TATE and the antagonist 64Cu-CB-TE2A-sst2-ANT in cell lines that are positive or negative for p53. Methods Receptor binding, internalization, cAMP and nuclear localization studies were performed with the SSTr2 agonists, 64Cu-CB-TE2A-Y3-TATE and 64Cu-DOTA-Y3-TATE vs. antagonist, 64Cu-CB-TE2A-sst2-ANT, in SSTr2-transfected p53 +/+ and −/− HCT116 colorectal carcinoma cells. Results The antagonist, 64Cu-CB-TE2A-sst2-ANT, bound 8-9-fold more SSTr2 binding sites than did the 64Cu-labeled agonists. 64Cu-CB-TE2A-Y3-TATE was more efficiently internalized than 64Cu-DOTA-Y3-TATE, while 64Cu-CB-TE2A-sst2-ANT showed lower, yet significant levels of internalization. CB-TE2A-Y3-TATE acted as a full agonist, inhibiting cAMP production, whereas CB-TE2A-sst2-ANT showed no inhibition of cAMP production.The 64Cu from agonists 64Cu-DOTA-Y3-TATE and 64Cu-CB-TE2A-Y3-TATE showed greater nuclear localization at 24 h in p53 +/+ vs. −/− cells; however, there was no difference in the levels of 64Cu from the antagonist based on p53 status. Surprisingly, the DOTA and CB-TE2A-conjugated agonists showed similar nuclear localization in the p53 +/+ and −/− cells, suggesting no difference in 64Cu release from these chelators in the HCT116 cell lines. Conclusion Based on thesein vitro data, the agonist 64Cu-CB-TE2A-Y3-TATE demonstrated the most promise as an agent for targeted radiotherapy in p53 positive, SSTr2-positive tumors. PMID:22056254

Nuclear Import of the Retrotransposon Tf1 Is Governed by a Nuclear Localization Signal That Possesses a Unique Requirement for the FXFG Nuclear Pore Factor Nup124p

PubMed Central

Dang, Van-Dinh; Levin, Henry L.

2000-01-01

Retroviruses, such as human immunodeficiency virus, that infect nondividing cells generate integration precursors that must cross the nuclear envelope to reach the host genome. As a model for retroviruses, we investigated the nuclear entry of Tf1, a long-terminal-repeat-containing retrotransposon of the fission yeast Schizosaccharomyces pombe. Because the nuclear envelope of yeasts remains intact throughout the cell cycle, components of Tf1 must be transported through the envelope before integration can occur. The nuclear localization of the Gag protein of Tf1 is different from that of other proteins tested in that it has a specific requirement for the FXFG nuclear pore factor, Nup124p. Using extensive mutagenesis, we found that Gag contained three nuclear localization signals (NLSs) which, when included individually in a heterologous protein, were sufficient to direct nuclear import. In the context of the intact transposon, mutations in the NLS that mapped to the first 10 amino acid residues of Gag significantly impaired Tf1 retrotransposition and abolished nuclear localization of Gag. Interestingly, this NLS activity in the heterologous protein was specifically dependent upon the presence of Nup124p. Deletion analysis of heterologous proteins revealed the surprising result that the residues in Gag with the NLS activity were independent from the residues that conveyed the requirement for Nup124p. In fact, a fragment of Gag that lacked NLS activity, residues 10 to 30, when fused to a heterologous protein, was sufficient to cause the classical NLS of simian virus 40 to require Nup124p for nuclear import. Within the context of the current understanding of nuclear import, these results represent the novel case of a short amino acid sequence that specifies the need for a particular nuclear pore complex protein. PMID:11003674

Nuclear import of the retrotransposon Tf1 is governed by a nuclear localization signal that possesses a unique requirement for the FXFG nuclear pore factor Nup124p.

PubMed

Dang, V D; Levin, H L

2000-10-01

Retroviruses, such as human immunodeficiency virus, that infect nondividing cells generate integration precursors that must cross the nuclear envelope to reach the host genome. As a model for retroviruses, we investigated the nuclear entry of Tf1, a long-terminal-repeat-containing retrotransposon of the fission yeast Schizosaccharomyces pombe. Because the nuclear envelope of yeasts remains intact throughout the cell cycle, components of Tf1 must be transported through the envelope before integration can occur. The nuclear localization of the Gag protein of Tf1 is different from that of other proteins tested in that it has a specific requirement for the FXFG nuclear pore factor, Nup124p. Using extensive mutagenesis, we found that Gag contained three nuclear localization signals (NLSs) which, when included individually in a heterologous protein, were sufficient to direct nuclear import. In the context of the intact transposon, mutations in the NLS that mapped to the first 10 amino acid residues of Gag significantly impaired Tf1 retrotransposition and abolished nuclear localization of Gag. Interestingly, this NLS activity in the heterologous protein was specifically dependent upon the presence of Nup124p. Deletion analysis of heterologous proteins revealed the surprising result that the residues in Gag with the NLS activity were independent from the residues that conveyed the requirement for Nup124p. In fact, a fragment of Gag that lacked NLS activity, residues 10 to 30, when fused to a heterologous protein, was sufficient to cause the classical NLS of simian virus 40 to require Nup124p for nuclear import. Within the context of the current understanding of nuclear import, these results represent the novel case of a short amino acid sequence that specifies the need for a particular nuclear pore complex protein.

Adiposity is associated with p53 gene mutations in breast cancer.

PubMed

Ochs-Balcom, Heather M; Marian, Catalin; Nie, Jing; Brasky, Theodore M; Goerlitz, David S; Trevisan, Maurizio; Edge, Stephen B; Winston, Janet; Berry, Deborah L; Kallakury, Bhaskar V; Freudenheim, Jo L; Shields, Peter G

2015-10-01

Mutations in the p53 gene are among the most frequent genetic events in human cancer and may be triggered by environmental and occupational exposures. We examined the association of clinical and pathological characteristics of breast tumors and breast cancer risk factors according to the prevalence and type of p53 mutations. Using tumor blocks from incident cases from a case-control study in western New York, we screened for p53 mutations in exons 2-11 using the Affymetrix p53 Gene Chip array and analyzed case-case comparisons using logistic regression. The p53 mutation frequency among cases was 28.1 %; 95 % were point mutations (13 % of which were silent) and the remainder were single base pair deletions. Sixty seven percent of all point mutations were transitions; 24 % of them are G:C>A:T at CpG sites. Positive p53 mutation status was associated with poorer differentiation (OR, 95 % CI 2.29, 1.21-4.32), higher nuclear grade (OR, 95 % CI 1.99, 1.22-3.25), and increased Ki-67 status (OR, 95 % CI 1.81, 1.10-2.98). Cases with P53 mutations were more likely to have a combined ER-positive and PR-negative status (OR, 95 % CI 1.65, 1.01-2.71), and a combined ER-negative and PR-negative status (OR, 95 % CI 2.18, 1.47-3.23). Body mass index >30 kg/m(2), waist circumference >79 cm, and waist-to-hip ratio >0.86 were also associated with p53 status; obese breast cancer cases are more likely to have p53 mutations (OR, 95 % CI 1.78, 1.19-2.68). We confirmed that p53 mutations are associated with less favorable tumor characteristics and identified an association of p53 mutation status and adiposity.

Mutant p53 expression in kidney tubules adjacent to renal cell carcinoma: evidence of a precursor lesion.

PubMed

Lai, R; el Dabbagh, L; Mourad, W A

1996-06-01

Neoplastic transformation can be associated with mutations of the p53 gene. This leads to stabilization of its protein product and to its accumulation, which allows immunohistochemical detection. Mutant p53 expression has been seen in many neoplasms, including renal cell carcinoma (RCC). We recently described putative precursor lesions of RCC. The lesions were defined as intratubular epithelial dysplasia (IED) of kidney tubules adjacent to RCC. They were seen in one-third of the cases studied. The findings were based only on light microscopic analysis. We hypothesized that neoplastic transformation would be manifested by mutant p53 expression in the kidney tubules adjacent to RCC and not in nonneoplastic kidneys. Immunohistochemical staining for p53 in 24 cases of RCC with adjacent kidneys was performed. We used the DO-7 monoclonal antibody reactive for the N-terminal of the p53 protein on formalin-fixed paraffin-embedded tissue. Sections from 14 kidneys resected for nonneoplastic conditions were used as controls. Twenty-one (87%) of the 24 cases of RCC had nuclear p53 expression in the tumor cells. This included 14 cases (58%) with intense reactivity and 7 cases (29%) with weaker p53 immunoreactivity. Of the 24 cases of RCC, IED was identified in 13 cases (54%). Immunoreactivity for p53 was focally seen in tubules of all the lesions, as well as in the nonlesional areas. Six of the lesions exhibited intense nuclear staining. The kidneys adjacent to the RCC, with no evidence of IED, showed focally intense positive p53 nuclear staining in four cases. None of the control specimens showed p53 expression. Our findings provide supportive evidence that previously described IED in kidneys adjacent to RCC are most likely precursor lesions of the neoplasm. Aberrant expression of p53 in areas without evidence of IED may suggest that neoplastic transformation manifested by p53 mutation in kidney tubules may be seen before the development of the morphologic features of

Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira

2013-10-01

X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the �

Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2

PubMed Central

Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja

2012-01-01

Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

PubMed

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

PubMed Central

2014-01-01

Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be

p53 Involvement in the Control of Murine Hair Follicle Regression

PubMed Central

Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.

2001-01-01

p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365

The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

PubMed Central

Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

2013-01-01

The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry

PubMed Central

Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.

2015-01-01

p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145

Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

PubMed

Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

2016-04-12

p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

p53 and PCNA expression in advanced colorectal cancer: response to chemotherapy and long-term prognosis.

PubMed

Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M

1996-12-20

In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.

Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

PubMed Central

el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

1997-01-01

We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

Expression of p53, p21 and cyclin D1 in penile cancer: p53 predicts poor prognosis.

PubMed

Gunia, Sven; Kakies, Christoph; Erbersdobler, Andreas; Hakenberg, Oliver W; Koch, Stefan; May, Matthias

2012-03-01

To evaluate the role of p53, p21 and cyclin D1 expression in patients with penile cancer (PC). Paraffin-embedded tissues from PC specimens from six pathology departments were subjected to a central histopathological review performed by one pathologist. The tissue microarray technique was used for immunostaining which was evaluated by two independent pathologists and correlated with cancer-specific survival (CSS). κ-statistics were used to assess interobserver variability. Uni- and multivariable Cox proportional hazards analysis was applied to assess the independent effects of several prognostic factors on CSS over a median of 32 months (IQR 6-66 months). Specimens and clinical data from 110 men treated surgically for primary PC were collected. p53 staining was positive in 30 and negative in 62 specimens. κ-statistics showed substantial interobserver reproducibility of p53 staining evaluation (κ=0.73; p<0.001). The 5-year CSS rate for the entire study cohort was 74%. Five-year CSS was 84% in p53-negative and 51% in p53-positive PC patients (p=0.003). Multivariable analysis showed p53 (HR=3.20; p=0.041) and pT-stage (HR=4.29; p<0.001) as independent significant prognostic factors for CSS. Cyclin D1 and p21 expression were not correlated with survival. However, incorporating p21 into a multivariable Cox model did contribute to improved model quality for predicting CSS. In patients with PC, the expression of p53 in the primary tumour specimen can be reproducibly assessed and is negatively associated with cancer specific survival.

Nup53 Is Required for Nuclear Envelope and Nuclear Pore Complex Assembly

PubMed Central

Hawryluk-Gara, Lisa A.; Platani, Melpomeni; Santarella, Rachel

2008-01-01

Transport across the nuclear envelope (NE) is mediated by nuclear pore complexes (NPCs). These structures are composed of various subcomplexes of proteins that are each present in multiple copies and together establish the eightfold symmetry of the NPC. One evolutionarily conserved subcomplex of the NPC contains the nucleoporins Nup53 and Nup155. Using truncation analysis, we have defined regions of Nup53 that bind to neighboring nucleoporins as well as those domains that target Nup53 to the NPC in vivo. Using this information, we investigated the role of Nup53 in NE and NPC assembly using Xenopus egg extracts. We show that both events require Nup53. Importantly, the analysis of Nup53 fragments revealed that the assembly activity of Nup53 depleted extracts could be reconstituted using a region of Nup53 that binds specifically to its interacting partner Nup155. On the basis of these results, we propose that the formation of a Nup53–Nup155 complex plays a critical role in the processes of NPC and NE assembly. PMID:18256286

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

PubMed

Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

2015-03-01

The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells*

PubMed Central

de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

2016-01-01

O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830

Nuclear NF-κB contributes to chlorpyrifos-induced apoptosis through p53 signaling in human neural precursor cells.

PubMed

Lee, Jeong Eun; Lim, Mi Sun; Park, Jae Hyeon; Park, Chang Hwan; Koh, Hyun Chul

2014-05-01

Chlorpyrifos (CPF) is one of the most widely used organophosphate insecticides with several harmful effects, including neurotoxicity. Although many studies have addressed the neurotoxicity induced by CPF, most data on neurodevelopmental damage was obtained from animal models. We are the first group to use human neural precursor cells (hNPCs) derived from human embryonic stem cells (hESCs) as a developing neuron model to evaluate the mechanisms involved in CPF-induced neurotoxicity. CPF was cytotoxic to these cells in a concentration-dependent manner, as shown by decreased cell viability and increased lactate dehydrogenase release. Furthermore, CPF reduced the expression of AKT and ERK proteins which are involved in intracellular survival pathways. Exposure of hNPCs to CPF led to the production of reactive oxygen species (ROS), and the antioxidant N-acetyl-cystein (NAC) attenuated ROS production induced by CPF. In addition, CPF increased cytochrome c release into the cytosol and activated caspase-9 and -3, indicating that cell death induced by CPF was due to apoptosis in hNPCs. Consistent with these findings, CPF treatment reduced the level of Bcl-2 protein and increased the level of Bax protein. Especially, CPF increased the translocation of BAX into the mitochondria. CPF also induced nuclear accumulation of NF-κB and p53 proteins in a concentration-dependent manner, and their inhibitors attenuated CPF-induced cytotoxicity. In addition, an inhibitor of NF-κB nuclear translocation blocked the increase of p53 in CPF-treated hNPCs. These findings show that CPF induced hNPCs death in part through NF-κB activation via ROS generation, enabling the interaction of p53 with Bcl-2 and Bax and subsequent release of cytochrome c. Collectively, these results represent a unique molecular characterization of CPF-induced cytotoxicity in hNPCs. These data suggest that CPF may affect neurodevelopment in a manner similar to that of several known and suspected neurotoxicants. Crown

Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

PubMed Central

Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

2013-01-01

To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol−1 (15.1 kJ mol−1). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared

PML is a ROS sensor activating p53 upon oxidative stress

PubMed Central

Soilihi, Hassane

2017-01-01

Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625

PML is a ROS sensor activating p53 upon oxidative stress.

PubMed

Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues

2017-11-06

Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.

[Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

PubMed

Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

2017-01-01

PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I

Zinc Deficiency Induces Apoptosis via Mitochondrial p53- and Caspase-Dependent Pathways in Human Neuronal Precursor Cells

ERIC Educational Resources Information Center

Seth, Rohit; Corniola, Rikki S.; Gower-Winter, Shannon D.; Morgan, Thomas J., Jr.; Bishop, Brian; Levenson, Cathy W.

2015-01-01

Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent…

Prognostic Value of Abnormal p53 Expression in Locally Advanced Prostate Cancer Treated With Androgen Deprivation and Radiotherapy: A Study Based on RTOG 9202

DOE Office of Scientific and Technical Information (OSTI.GOV)

Che Mingxin; DeSilvio, Michelle; Pollack, Alan

2007-11-15

Purpose: The goal of this study was to verify the significance of p53 as a prognostic factor in Radiation Therapy Oncology Group 9202, which compared short-term androgen deprivation (STAD) with radiation therapy (RT) to long-term androgen deprivation + RT in men with locally advanced prostate cancer (Pca). Methods and Materials: Tumor tissue was sufficient for p53 analysis in 777 cases. p53 status was determined by immunohistochemistry. Abnormal p53 expression was defined as 20% or more tumor cells with positive nuclei. Univariate and multivariate Cox proportional hazards models were used to evaluate the relationships of p53 status to patient outcomes. Results:more » Abnormal p53 was detected in 168 of 777 (21.6%) cases, and was significantly associated with cause-specific mortality (adjusted hazard ratio [HR] = 1.89; 95% confidence interval (CI) 1.14 - 3.14; p = 0.014) and distant metastasis (adjusted HR = 1.72; 95% CI 1.13-2.62; p = 0.013). When patients were divided into subgroups according to assigned treatment, only the subgroup of patients who underwent STAD + RT showed significant correlation between p53 status and cause-specific mortality (adjusted HR = 2.43; 95% CI = 1.32-4.49; p = 0.0044). When patients were divided into subgroups according to p53 status, only the subgroup of patients with abnormal p53 showed significant association between assigned treatment and cause-specific mortality (adjusted HR = 3.81; 95% CI 1.40-10.37; p = 0.0087). Conclusions: Abnormal p53 is a significant prognostic factor for patients with prostate cancer who undergo short-term androgen deprivation and radiotherapy. Long-term androgen deprivation may significantly improve the cause-specific survival for those with abnormal p53.« less

The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

PubMed

Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

2014-03-18

Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

[Interaction between p53 and MDM2 in human lung cancer cells].

PubMed

Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

2014-01-01

The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and

Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

PubMed

Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

1999-06-01

The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

The role of p53 in combination radioimmunotherapy with 64Cu-DOTA-cetuximab and cisplatin in a mouse model of colorectal cancer.

PubMed

Guo, Yunjun; Parry, Jesse J; Laforest, Richard; Rogers, Buck E; Anderson, Carolyn J

2013-09-01

Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with (64)Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti-epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. We previously showed that nuclear localization of (64)Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with (64)Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor-bearing mice, with and without cisplatin, which upregulates wild-type p53. Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and -/- (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of (64)Cu from (64)Cu-acetate and (64)Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor-bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Together, these data suggest that (64)Cu specifically delivered to epidermal growth factor receptor-positive tumors by cetuximab can suppress tumor growth despite the KRAS status and present

The Role of p53 in Combination Radioimmunotherapy with 64Cu-DOTA-Cetuximab and Cisplatin in a Mouse Model of Colorectal Cancer

PubMed Central

Guo, Yunjun; Parry, Jesse J.; Laforest, Richard; Rogers, Buck E.; Anderson, Carolyn J.

2014-01-01

Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with 64Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti–epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. Methods We previously showed that nuclear localization of 64Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with 64Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor–bearing mice, with and without cisplatin, which upregulates wild-type p53. Results Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and −/− (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of 64Cu from 64Cuacetate and 64Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor–bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Conclusion Together, these data suggest that 64Cu specifically delivered to epidermal growth factor receptor–positive tumors by cetuximab can suppress tumor growth despite the KRAS

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

PubMed Central

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-01-01

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

PubMed

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

Knockdown of KPNA2 inhibits autophagy in oral squamous cell carcinoma cell lines by blocking p53 nuclear translocation.

PubMed

Lin, Feng; Gao, Li; Su, Zhenyu; Cao, Xiaofang; Zhan, Yuanbo; Li, Ying; Zhang, Bin

2018-07-01

Oral squamous cell carcinoma (OSCC), one of the 10 most common types of neoplasms in the US, constitutes ~90% of all cases of oral malignancies. Chemoresistance and metastasis are difficult to avoid during the course of treatment, leading to a poor prognosis and a high mortality rate for patients with OSCC. Autophagy, a critical conserved cellular process, has been reported to be highly associated with the regulation of chemoresistance and metastasis of cancer cells. The present study investigated the role of karyopherin α2 (KPNA2), a member of the importin α family, which may serve an important role in p53 nucleocytoplasmic transport in the process of OSCC autophagy. In the CAL‑27, SCC‑15 and Tca8113 OSCC cell lines, we observed that the downregulation of KPNA2 suppressed cell migration and cisplatin resistance, using wound‑healing, Transwell and CCK‑8 assays. Additionally, the results of western blot analysis and transmission electron microscopy (TEM) analysis indicated that the knockdown of KPNA2 inhibited autophagy. We confirmed that the inhibition of autophagy with anti‑autophagy agents decreased the migration and cisplatin resistance of OSCC cells. We hypothesized that the suppression of cell migration and cisplatin resistance induced by KPNA2 knockdown may be associated with the inhibition of autophagy. To identify the underlying mechanism, further experiments determined that KPNA2 affects the level of autophagy via regulating the p53 nuclear import. Thus, the present study demonstrated that the function of KPNA2 in the process of autophagy may be p53‑dependent, and by regulating the translocation of p53, KPNA2 can support autophagy to promote the chemoresistance and metastasis of OSCC cells.

R248Q mutation--Beyond p53-DNA binding.

PubMed

Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

2015-12-01

R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

Prognostic impact of c-Rel nuclear expression and REL amplification and crosstalk between c-Rel and the p53 pathway in diffuse large B-cell lymphoma

PubMed Central

Ok, Chi Young; Tzankov, Alexandar; Manyam, Ganiraju C.; Sun, Ruifan; Visco, Carlo; Zhang, Mingzhi; Montes-Moreno, Santiago; Dybkaer, Karen; Chiu, April; Orazi, Attilio; Zu, Youli; Bhagat, Govind; Richards, Kristy L.; Hsi, Eric D.; Choi, William W.L.; van Krieken, J. Han; Huh, Jooryung; Ponzoni, Maurilio; Ferreri, Andrés J.M.; Møller, Michael B.; Wang, Jinfeng; Parsons, Ben M.; Winter, Jane N.; Piris, Miguel A.; Pham, Lan V.; Medeiros, L. Jeffrey; Young, Ken H.

2015-01-01

Dysregulated NF-κB signaling is critical for lymphomagenesis. The regulation, function, and clinical relevance of c-Rel/NF-κB activation in diffuse large B-cell lymphoma (DLBCL) have not been well studied. In this study we analyzed the prognostic significance and gene-expression signature of c-Rel nuclear expression as surrogate of c-Rel activation in 460 patients with de novo DLBCL. Nuclear c-Rel expression, observed in 137 (26.3%) DLBCL patients frequently associated with extranoal origin, did not show significantly prognostic impact in the overall- or germinal center B-like-DLBCL cohort, likely due to decreased pAKT and Myc levels, up-regulation of FOXP3, FOXO3, MEG3 and other tumor suppressors coincided with c-Rel nuclear expression, as well as the complicated relationships between NF-κB members and their overlapping function. However, c-Rel nuclear expression correlated with significantly poorer survival in p63+ and BCL-2− activated B-cell-like-DLBCL, and in DLBCL patients with TP53 mutations. Multivariate analysis indicated that after adjusting clinical parameters, c-Rel positivity was a significantly adverse prognostic factor in DLBCL patients with wild type TP53. Gene expression profiling suggested dysregulations of cell cycle, metabolism, adhesion, and migration associated with c-Rel activation. In contrast, REL amplification did not correlate with c-Rel nuclear expression and patient survival, likely due to co-amplification of genes that negatively regulate NF-κB activation. These insights into the expression, prognostic impact, regulation and function of c-Rel as well as its crosstalk with the p53 pathway underscore the importance of c-Rel and have significant therapeutic implications. PMID:26324762

Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy.

PubMed

Simon, Christian M; Dai, Ya; Van Alstyne, Meaghan; Koutsioumpa, Charalampia; Pagiazitis, John G; Chalif, Joshua I; Wang, Xiaojian; Rabinowitz, Joseph E; Henderson, Christopher E; Pellizzoni, Livio; Mentis, George Z

2017-12-26

The hallmark of spinal muscular atrophy (SMA), an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Shuttling imbalance of MLF1 results in p53 instability and increases susceptibility to oncogenic transformation.

PubMed

Yoneda-Kato, Noriko; Kato, Jun-Ya

2008-01-01

Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation.

Immunohistochemical detection of tumor suppressor gene p53 protein in feline injection site-associated sarcomas.

PubMed

Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M

2001-03-01

Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Fuming; Saha, Abhik; Murakami, Masanao

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

Human Cytomegalovirus UL50 and UL53 Recruit Viral Protein Kinase UL97, Not Protein Kinase C, for Disruption of Nuclear Lamina and Nuclear Egress in Infected Cells

PubMed Central

Sharma, Mayuri; Kamil, Jeremy P.; Coughlin, Margaret; Reim, Natalia I.

2014-01-01

Herpesvirus nucleocapsids traverse the nuclear envelope into the cytoplasm in a process called nuclear egress that includes disruption of the nuclear lamina. In several herpesviruses, a key player in nuclear egress is a complex of two proteins, whose homologs in human cytomegalovirus (HCMV) are UL50 and UL53. However, their roles in nuclear egress during HCMV infection have not been shown. Based largely on transfection studies, UL50 and UL53 have been proposed to facilitate disruption of the nuclear lamina by recruiting cellular protein kinase C (PKC), as occurs with certain other herpesviruses, and/or the viral protein kinase UL97 to phosphorylate lamins. To investigate these issues during HCMV infection, we generated viral mutants null for UL50 or UL53. Correlative light electron microscopic analysis of null mutant-infected cells showed the presence of intranuclear nucleocapsids and the absence of cytoplasmic nucleocapsids. Confocal immunofluorescence microscopy revealed that UL50 and UL53 are required for disruption of the nuclear lamina. A subpopulation of UL97 colocalized with the nuclear rim, and this was dependent on UL50 and, to a lesser extent, UL53. However, PKC was not recruited to the nuclear rim, and its localization was not affected by the absence of UL50 or UL53. Immunoprecipitation from cells infected with HCMV expressing tagged UL53 detected UL97 but not PKC. In summary, HCMV UL50 and UL53 are required for nuclear egress and disruption of nuclear lamina during HCMV infection, and they recruit UL97, not PKC, for these processes. Thus, despite the strong conservation of herpesvirus nuclear egress complexes, a key function can differ among them. PMID:24155370

Human cytomegalovirus UL50 and UL53 recruit viral protein kinase UL97, not protein kinase C, for disruption of nuclear lamina and nuclear egress in infected cells.

PubMed

Sharma, Mayuri; Kamil, Jeremy P; Coughlin, Margaret; Reim, Natalia I; Coen, Donald M

2014-01-01

Herpesvirus nucleocapsids traverse the nuclear envelope into the cytoplasm in a process called nuclear egress that includes disruption of the nuclear lamina. In several herpesviruses, a key player in nuclear egress is a complex of two proteins, whose homologs in human cytomegalovirus (HCMV) are UL50 and UL53. However, their roles in nuclear egress during HCMV infection have not been shown. Based largely on transfection studies, UL50 and UL53 have been proposed to facilitate disruption of the nuclear lamina by recruiting cellular protein kinase C (PKC), as occurs with certain other herpesviruses, and/or the viral protein kinase UL97 to phosphorylate lamins. To investigate these issues during HCMV infection, we generated viral mutants null for UL50 or UL53. Correlative light electron microscopic analysis of null mutant-infected cells showed the presence of intranuclear nucleocapsids and the absence of cytoplasmic nucleocapsids. Confocal immunofluorescence microscopy revealed that UL50 and UL53 are required for disruption of the nuclear lamina. A subpopulation of UL97 colocalized with the nuclear rim, and this was dependent on UL50 and, to a lesser extent, UL53. However, PKC was not recruited to the nuclear rim, and its localization was not affected by the absence of UL50 or UL53. Immunoprecipitation from cells infected with HCMV expressing tagged UL53 detected UL97 but not PKC. In summary, HCMV UL50 and UL53 are required for nuclear egress and disruption of nuclear lamina during HCMV infection, and they recruit UL97, not PKC, for these processes. Thus, despite the strong conservation of herpesvirus nuclear egress complexes, a key function can differ among them.

S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

PubMed

Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

2013-12-05

S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

The Isoforms of the p53 Protein

PubMed Central

Khoury, Marie P.; Bourdon, Jean-Christophe

2010-01-01

p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

Nucleocytoplasmic shuttling of the rabies virus P protein requires a nuclear localization signal and a CRM1-dependent nuclear export signal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pasdeloup, David; Poisson, Nicolas; Raux, Helene

2005-04-10

Rabies virus P protein is a co-factor of the viral RNA polymerase. It has been shown previously that P mRNA directs the synthesis of four N-terminally truncated P products P2, P3, P4, and P5 due to translational initiation by a leaky scanning mechanism at internal Met codons. Whereas P and P2 are located in the cytoplasm, P3, P4, and P5 are found in the nucleus. Here, we have analyzed the molecular basis of the subcellular localization of these proteins. Using deletion mutants fused to GFP protein, we show the presence of a nuclear localization signal (NLS) in the C-terminal partmore » of P (172-297). This domain contains a short lysine-rich stretch ({sup 211}KKYK{sup 214}) located in close proximity with arginine 260 as revealed by the crystal structure of P. We demonstrate the critical role of lysine 214 and arginine 260 in NLS activity. In the presence of Leptomycin B, P is retained in the nucleus indicating that it contains a CRM1-dependent nuclear export signal (NES). The subcellular distribution of P deletion mutants indicates that the domain responsible for export is the amino-terminal part of the protein. The use of fusion proteins that have amino terminal fragments of P fused to {beta}-galactosidase containing the NLS of SV40 T antigen allows us to identify a NES between residues 49 and 58. The localization of NLS and NES determines the cellular distribution of the P gene products.« less

Expressions of p53 and p21 in primary gastric lymphomas.

PubMed Central

Go, J. H.; Yang, W. I.

2001-01-01

The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

The prognostic implication of the expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in primary locally advanced oral squamous cell carcinoma cases: a tissue microarray study.

PubMed

Solomon, Monica Charlotte; Vidyasagar, M S; Fernandes, Donald; Guddattu, Vasudev; Mathew, Mary; Shergill, Ankur Kaur; Carnelio, Sunitha; Chandrashekar, Chetana

2016-12-01

Oral squamous cell carcinomas comprise a heterogeneous tumor cell population with varied molecular characteristics, which makes prognostication of these tumors a complex and challenging issue. Thus, molecular profiling of these tumors is advantageous for an accurate prognostication and treatment planning. This is a retrospective study on a cohort of primary locally advanced oral squamous cell carcinomas (n = 178) of an Indian rural population. The expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in a cohort of primary locally advanced oral squamous cell carcinomas was evaluated. A potential biomarker that can predict the tumor response to treatment was identified. Formalin-fixed paraffin-embedded tumor blocks of (n = 178) of histopathologically diagnosed cases of locally advanced oral squamous cell carcinomas were selected. Tissue microarray blocks were constructed with 2 cores of 2 mm diameter from each tumor block. Four-micron-thick sections were cut from these tissue microarray blocks. These tissue microarray sections were immunohistochemically stained for EGFR, p53, Bcl-2, cyclin D1 and p16. In this cohort, EGFR was the most frequently expressed 150/178 (84%) biomarker of the cases. Kaplan-Meier analysis showed a significant association (p = 0.038) between expression of p53 and a poor prognosis. A Poisson regression analysis showed that tumors that expressed p53 had a two times greater chance of recurrence (unadjusted IRR-95% CI 2.08 (1.03, 4.5), adjusted IRR-2.29 (1.08, 4.8) compared with the tumors that did not express this biomarker. Molecular profiling of oral squamous cell carcinomas will enable us to categorize our patients into more realistic risk groups. With biologically guided tumor characterization, personalized treatment protocols can be designed for individual patients, which will improve the quality of life of these patients.

Prm3p is a pheromone-induced peripheral nuclear envelope protein required for yeast nuclear fusion.

PubMed

Shen, Shu; Tobery, Cynthia E; Rose, Mark D

2009-05-01

Nuclear membrane fusion is the last step in the mating pathway of the yeast Saccharomyces cerevisiae. We adapted a bioinformatics approach to identify putative pheromone-induced membrane proteins potentially required for nuclear membrane fusion. One protein, Prm3p, was found to be required for nuclear membrane fusion; disruption of PRM3 caused a strong bilateral defect, in which nuclear congression was completed but fusion did not occur. Prm3p was localized to the nuclear envelope in pheromone-responding cells, with significant colocalization with the spindle pole body in zygotes. A previous report, using a truncated protein, claimed that Prm3p is localized to the inner nuclear envelope. Based on biochemistry, immunoelectron microscopy and live cell microscopy, we find that functional Prm3p is a peripheral membrane protein exposed on the cytoplasmic face of the outer nuclear envelope. In support of this, mutations in a putative nuclear localization sequence had no effect on full-length protein function or localization. In contrast, point mutations and deletions in the highly conserved hydrophobic carboxy-terminal domain disrupted both protein function and localization. Genetic analysis, colocalization, and biochemical experiments indicate that Prm3p interacts directly with Kar5p, suggesting that nuclear membrane fusion is mediated by a protein complex.

Modulation of p53 cellular function and cell death by African swine fever virus.

PubMed

Granja, Aitor G; Nogal, María L; Hurtado, Carolina; Salas, José; Salas, María L; Carrascosa, Angel L; Revilla, Yolanda

2004-07-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells.

Modulation of p53 Cellular Function and Cell Death by African Swine Fever Virus

PubMed Central

Granja, Aitor G.; Nogal, María L.; Hurtado, Carolina; Salas, José; Salas, María L.; Carrascosa, Angel L.; Revilla, Yolanda

2004-01-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells. PMID:15194793

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

PubMed Central

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-01-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

PubMed Central

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

2012-01-01

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

PubMed

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

2012-04-05

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

Increased nuclear factor-κB and loss of p53 are key mechanisms in Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS).

PubMed

Morris, Gerwyn; Maes, Michael

2012-11-01

Fukuda's criteria are adequate to make a distinction between Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS) and chronic fatigue (CF), but ME/CFS patients should be subdivided into those with (termed ME) and without (termed CFS) post exertional malaise [Maes et al. 2012]. ME/CFS is considered to be a neuro-immune disease. ME/CFS is characterized by activated immuno-inflammatory pathways, including increased levels of pro-inflammatory cytokines, nuclear factor κB (NF-κB) and aberrations in mitochondrial functions, including lowered ATP. These processes may explain typical symptoms of ME/CFS, e.g. fatigue, malaise, hyperalgesia, and neurologic and autonomic symptoms. Here we hypothesize that increased NF-κB together with a loss of p53 are key phenomena in ME/CFS that further explain ME/CFS symptoms, such as fatigue and neurocognitive dysfunction, and explain ME symptoms, such as post-exertional malaise following mental and physical activities. Inactivation of p53 impairs aerobic mitochondrial functions and causes greater dependence on anaerobic glycolysis, elevates lactate levels, reduces mitochondrial density in skeletal muscle and reduces endurance during physical exercise. Lowered p53 and increased NF-κB are associated with elevated reactive oxygen species. Increased NF-κB induces the production of pro-inflammatory cytokines, which increase glycolysis and further compromise mitochondrial functions. All these factors together may contribute to mitochondrial exhaustion and indicate that the demand for extra ATP upon the commencement of increased activity cannot be met. In conditions of chronic inflammation and oxidative stress, high NF-κB and low p53 may conspire to promote neuron and glial cell survival at a price of severely compromised metabolic brain function. Future research should examine p53 signaling in ME/CFS. Copyright © 2012. Published by Elsevier Ltd.

Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

PubMed

Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

2016-04-01

P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...

41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...

41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...

41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...

41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...

Shuttling Imbalance of MLF1 Results in p53 Instability and Increases Susceptibility to Oncogenic Transformation▿ †

PubMed Central

Yoneda-Kato, Noriko; Kato, Jun-ya

2008-01-01

Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation. PMID:17967869

Human Cytomegalovirus Nuclear Egress Proteins Ectopically Expressed in the Heterologous Environment of Plant Cells are Strictly Targeted to the Nuclear Envelope.

PubMed

Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe

2016-03-10

In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohareer, Krishnaveni; Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046; Sahdev, Sudhir

2011-11-04

Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors,more » which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.« less

p53 improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.

PubMed

Park, Joon-Young; Wang, Ping-Yuan; Matsumoto, Takumi; Sung, Ho Joong; Ma, Wenzhe; Choi, Jeong W; Anderson, Stasia A; Leary, Scot C; Balaban, Robert S; Kang, Ju-Gyeong; Hwang, Paul M

2009-09-25

Exercise capacity is a physiological characteristic associated with protection from both cardiovascular and all-cause mortality. p53 regulates mitochondrial function and its deletion markedly diminishes exercise capacity, but the underlying genetic mechanism orchestrating this is unclear. Understanding the biology of how p53 improves exercise capacity may provide useful insights for improving both cardiovascular as well as general health. The purpose of this study was to understand the genetic mechanism by which p53 regulates aerobic exercise capacity. Using a variety of physiological, metabolic, and molecular techniques, we further characterized maximum exercise capacity and the effects of training, measured various nonmitochondrial and mitochondrial determinants of exercise capacity, and examined putative regulators of mitochondrial biogenesis. As p53 did not affect baseline cardiac function or inotropic reserve, we focused on the involvement of skeletal muscle and now report a wider role for p53 in modulating skeletal muscle mitochondrial function. p53 interacts with Mitochondrial Transcription Factor A (TFAM), a nuclear-encoded gene important for mitochondrial DNA (mtDNA) transcription and maintenance, and regulates mtDNA content. The increased mtDNA in p53(+/+) compared to p53(-/-) mice was more marked in aerobic versus glycolytic skeletal muscle groups with no significant changes in cardiac tissue. These in vivo observations were further supported by in vitro studies showing overexpression of p53 in mouse myoblasts increases both TFAM and mtDNA levels whereas depletion of TFAM by shRNA decreases mtDNA content. Our current findings indicate that p53 promotes aerobic metabolism and exercise capacity by using different mitochondrial genes and mechanisms in a tissue-specific manner.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

PubMed Central

Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

2015-01-01

Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

A butyrolactone derivative suppressed lipopolysaccharide-induced autophagic injury through inhibiting the autoregulatory loop of p8 and p53 in vascular endothelial cells.

PubMed

Meng, Ning; Zhao, Jing; Su, Le; Zhao, Baoxiang; Zhang, Yun; Zhang, Shangli; Miao, Junying

2012-02-01

Lipopolysaccharide (LPS)-induced vascular endothelial cell (VEC) dysfunction is an important contributing factor in vascular diseases. Recently, we found that LPS impaired VEC by inducing autophagy. Our previous researches showed that a butyrolactone derivative, 3-benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one (3BDO) selectively protected VEC function. The objective of the present study is to investigate whether and how 3BDO inhibits LPS-induced VEC autophagic injury. Our results showed that LPS induced autophagy and led to increase of reactive oxygen species (ROS) and decrease of mitochondrial membrane potential (MMP) in Human umbilical vein vascular endothelial cells (HUVECs). Furthermore, LPS significantly increased p8 and p53 protein levels and the nuclear translocation of p53. All of these effects of LPS on HUVECs were strongly inhibited by 3BDO. Importantly, the ROS scavenger N-acetylcysteine (NAC) could inhibited LPS-induced autophagy and knockdown of p8 by RNA interference inhibited the autophagy, p53 protein level increase, the translocation of p53 into nuclei and the ROS level increase induced by LPS in HUVECs. The data suggested that 3BDO inhibited LPS-induced autophagy in HUVECs through inhibiting the ROS overproduction, the increase of p8 and p53 expression and the nuclear translocation of p53. Our findings provide a potential tool for understanding the mechanism underlying LPS-induced autophagy in HUVECs and open the door to a novel therapeutic drug for LPS-induced vascular diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

PubMed

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-09-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

PubMed

Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

2017-10-01

In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

PubMed

Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

2017-09-29

p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

p53 mutations promote proteasomal activity.

PubMed

Oren, Moshe; Kotler, Eran

2016-07-27

p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

PubMed

Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

2005-12-08

TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.

PubMed

Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel

2012-01-01

γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.

Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

PubMed Central

Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

2017-01-01

Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

A Novel Nuclear Trafficking Module Regulates the Nucleocytoplasmic Localization of the Rabies Virus Interferon Antagonist, P Protein*

PubMed Central

Oksayan, Sibil; Wiltzer, Linda; Rowe, Caitlin L.; Blondel, Danielle; Jans, David A.; Moseley, Gregory W.

2012-01-01

Regulated nucleocytoplasmic transport of proteins is central to cellular function and dysfunction during processes such as viral infection. Active protein trafficking into and out of the nucleus is dependent on the presence within cargo proteins of intrinsic specific modular signals for nuclear import (nuclear localization signals, NLSs) and export (nuclear export signals, NESs). Rabies virus (RabV) phospho (P) protein, which is largely responsible for antagonising the host anti-viral response, is expressed as five isoforms (P1–P5). The subcellular trafficking of these isoforms is thought to depend on a balance between the activities of a dominant N-terminal NES (N-NES) and a distinct C-terminal NLS (C-NLS). Specifically, the N-NES-containing isoforms P1 and P2 are cytoplasmic, whereas the shorter P3–P5 isoforms, which lack the N-NES, are believed to be nuclear through the activity of the C-NLS. Here, we show for the first time that RabV P contains an additional strong NLS in the N-terminal region (N-NLS), which, intriguingly, overlaps with the N-NES. This arrangement represents a novel nuclear trafficking module where the N-NLS is inactive in P1 but becomes activated in P3, concomitant with truncation of the N-NES, to become the principal targeting signal conferring nuclear accumulation. Understanding this unique switch arrangement of overlapping, co-regulated NES/NLS sequences is vital to delineating the critical role of RabV P protein in viral infection. PMID:22700958

The expanding universe of p53 targets.

PubMed

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.

PubMed

Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi

2018-04-19

Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.

Mechanisms that enhance sustainability of p53 pulses.

PubMed

Kim, Jae Kyoung; Jackson, Trachette L

2013-01-01

The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.

PubMed

Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun

2014-07-23

The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

PubMed

Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

2011-09-27

Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

2015-11-13

Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

PubMed Central

Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

2009-01-01

Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

An insertion in the methyltransferase domain of P. falciparum trimethylguanosine synthase harbors a classical nuclear localization signal.

PubMed

Babar, Prasad H; Dey, Vishakha; Jaiswar, Praveen; Patankar, Swati

Many Plasmodium falciparum proteins do not share homology with, and are generally longer than their respective orthologs. This, to some extent, can be attributed to insertions. Here, we studied a P. falciparum RNA hypermethylase, trimethylguanosine synthase (PfTGS1) that harbors a 76 amino acid insertion in its methyltransferase domain. Bioinformatics analysis revealed that this insertion was present in TGS1 orthologs from other Plasmodium species as well. Interestingly, a classical nuclear localization signal (NLS) was predicted in the insertions of primate parasite TGS1 proteins. To check whether these predicted NLS are functional, we developed an in vivo heterologous system using S. cerevisiae. The predicted NLS when fused to dimeric GFP were able to localize the fusion protein to the nucleus in yeast indicating that it is indeed recognized by the yeast nuclear import machinery. We further showed that the PfTGS1 NLS binds to P. falciparum importin-α in vitro, confirming that the NLS is also recognized by the P. falciparum classical nuclear import machinery. Thus, in this study we report a novel function of the insertion in PfTGS1. Copyright © 2016 Elsevier B.V. All rights reserved.

p53-independent p21 induction by MELK inhibition.

PubMed

Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

2017-08-29

MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.

p53-independent p21 induction by MELK inhibition

PubMed Central

Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

2017-01-01

MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528

Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

PubMed Central

Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

2017-01-01

Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

p53 in pure epithelioid PEComa: an immunohistochemistry study and gene mutation analysis.

PubMed

Bing, Zhanyong; Yao, Yuan; Pasha, Theresa; Tomaszewski, John E; Zhang, Paul J

2012-04-01

Pure epithelioid PEComa (PEP; so-called epithelioid angiomyolipoma) is rare and is more often associated with aggressive behaviors. The pathogenesis of PEP has been poorly understood. The authors studied p53 expression and gene mutation in PEPs by immunohistochemistry, single-strand conformation polymorphism, and direct sequencing in paraffin material from 8 PEPs. A group of classic angiomyolipomas (AMLs) were also analyzed for comparison. Five PEPs were from kidneys and 1 each from the heart, the liver, and the uterus. PEPs showed much stronger p53 nuclear staining (Allred score 6.4 ± 2.5) than the classic AML (2.3 ± 2.9) (P < .01). There was no p53 single-strand conformation polymorphism identified in either the PEPs or the 8 classic AMLs. p53 mutation analyses by direct sequencing of exons 5 to 9 showed 4 mutations in 3 of 8 PEPs but none in any of the 8 classic AMLs. The mutations included 2 missense mutations in a hepatic PEComa and 2 silent mutations in 2 renal PEPs. Both the missense mutations in the hepatic PEComa involved the exon 5, one involving codon 165, with change from CAG to CAC (coding amino acid changed from glutamine to histidine), and the other involving codon 182, with change from TGC to TAC (coding amino acid changed from cysteine to tyrosine). The finding of stronger p53 expression and mutations in epithelioid angiomyolipomas might have contributed to their less predictable behavior. However, the abnormal p53 expression cannot be entirely explained by p53 mutations in the exons examined in the PEPs.

Neoplasia of the ampulla of Vater. Ki-ras and p53 mutations.

PubMed Central

Scarpa, A.; Capelli, P.; Zamboni, G.; Oda, T.; Mukai, K.; Bonetti, F.; Martignoni, G.; Iacono, C.; Serio, G.; Hirohashi, S.

1993-01-01

Eleven tumors of the ampulla of Vater (5 stage IV and 2 stage II adenocarcinomas, 1 stage II papillary carcinoma, 1 neuroendocrine carcinoma, and 2 adenomas, one with foci of carcinoma) were examined for Ki-ras and p53 gene mutations by single-strand conformation polymorphism analysis and direct sequencing of polymerase chain reaction-amplified DNA fragments. Ki-ras mutations were found in one adenocarcinoma and in the adenoma with foci of carcinoma, both involving mainly the intraduodenal bile duct component of the ampulla. Seven cases showed p53 gene mutations: four advanced-stage adenocarcinomas, the papillary carcinoma, the neuroendocrine carcinoma, and the adenoma with foci of carcinoma. Nuclear accumulation of p53 protein was immunohistochemically detected in the morphologically high-grade areas of the five cancers harboring a p53 gene missense point mutation. The adenomas, the two frame shift-mutated cancers, and the adenomatous and low-grade cancer areas of mutated carcinomas were immunohistochemically negative. Our data suggest that in ampullary neoplasia 1) p53 mutations are common abnormalities associated with the transformation of adenomas and low-grade cancers into morphologically high-grade carcinomas, and 2) Ki-ras mutations are relatively less frequent and might be restricted to tumors originating from the bile duct component of the ampulla. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8475992

Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

PubMed Central

Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

2016-01-01

Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53

PubMed Central

Murakami, Yohei; Takada, Shoji

2012-01-01

Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606

p53 mutation and expression in lymphoma.

PubMed Central

Adamson, D. J.; Thompson, W. D.; Dawson, A. A.; Bennett, B.; Haites, N. E.

1995-01-01

Mutation and abnormal expression of p53 was studied in 38 lymphomas [five Hodgkin's disease and 33 non-Hodgkin's lymphoma (NHL)]. CM1 polyclonal antibody was used to detect overexpression of p53. Three missense mutations were characterised in three cases of NHL after screening exons 5-8 of p53 of all the tumours with single-strand conformation polymorphism (SSCP) analysis. Only two out of three tumours with a missense mutation showed abnormal expression of p53 as measured by CM1. Conversely, seven out of nine tumours with positive CM1 staining had no point mutation demonstrated. Overexpression of p53 in the cases of NHL occurred in three out of twenty four low-grade tumours and five out of nine high-grade tumours (Kiel classification). The results suggest that abnormalities of p53 are commoner in high-grade than low-grade NHL, and that positive immunocytochemistry cannot be used to determine which tumours have mutations of p53. Images Figure 1 Figure 2 PMID:7599045

Immunohistochemical expression of p53 and its clinicopathological correlation with modified Anneroth's histological grading system.

PubMed

Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G

2016-01-01

Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. The results obtained were analyzed using Spearman's Co-relation. The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found.

Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

PubMed

Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

1997-05-01

To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

PubMed

Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

2018-03-23

p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Human Cytomegalovirus Nuclear Capsids Associate with the Core Nuclear Egress Complex and the Viral Protein Kinase pUL97

PubMed Central

Sonntag, Eric; Wagner, Sabrina; Strojan, Hanife; Wangen, Christina; Lenac Rovis, Tihana; Lisnic, Berislav; Jonjic, Stipan; Schlötzer-Schrehardt, Ursula; Marschall, Manfred

2018-01-01

The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC) that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV) capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction. PMID:29342872

Human Cytomegalovirus Nuclear Capsids Associate with the Core Nuclear Egress Complex and the Viral Protein Kinase pUL97.

PubMed

Milbradt, Jens; Sonntag, Eric; Wagner, Sabrina; Strojan, Hanife; Wangen, Christina; Lenac Rovis, Tihana; Lisnic, Berislav; Jonjic, Stipan; Sticht, Heinrich; Britt, William J; Schlötzer-Schrehardt, Ursula; Marschall, Manfred

2018-01-13

The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC) that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV) capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction.

Detection of ATM germline variants by the p53 mitotic centrosomal localization test in BRCA1/2-negative patients with early-onset breast cancer.

PubMed

Prodosmo, Andrea; Buffone, Amelia; Mattioni, Manlio; Barnabei, Agnese; Persichetti, Agnese; De Leo, Aurora; Appetecchia, Marialuisa; Nicolussi, Arianna; Coppa, Anna; Sciacchitano, Salvatore; Giordano, Carolina; Pinnarò, Paola; Sanguineti, Giuseppe; Strigari, Lidia; Alessandrini, Gabriele; Facciolo, Francesco; Cosimelli, Maurizio; Grazi, Gian Luca; Corrado, Giacomo; Vizza, Enrico; Giannini, Giuseppe; Soddu, Silvia

2016-09-06

Variant ATM heterozygotes have an increased risk of developing cancer, cardiovascular diseases, and diabetes. Costs and time of sequencing and ATM variant complexity make large-scale, general population screenings not cost-effective yet. Recently, we developed a straightforward, rapid, and inexpensive test based on p53 mitotic centrosomal localization (p53-MCL) in peripheral blood mononuclear cells (PBMCs) that diagnoses mutant ATM zygosity and recognizes tumor-associated ATM polymorphisms. Fresh PBMCs from 496 cancer patients were analyzed by p53-MCL: 90 cases with familial BRCA1/2-positive and -negative breast and/or ovarian cancer, 337 with sporadic cancers (ovarian, lung, colon, and post-menopausal breast cancers), and 69 with breast/thyroid cancer. Variants were confirmed by ATM sequencing. A total of seven individuals with ATM variants were identified, 5/65 (7.7 %) in breast cancer cases of familial breast and/or ovarian cancer and 2/69 (2.9 %) in breast/thyroid cancer. No variant ATM carriers were found among the other cancer cases. Excluding a single case in which both BRCA1 and ATM were mutated, no p53-MCL alterations were observed in BRCA1/2-positive cases. These data validate p53-MCL as reliable and specific test for germline ATM variants, confirm ATM as breast cancer susceptibility gene, and highlight a possible association with breast/thyroid cancers.

Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses

PubMed Central

Rubbi, Carlos P.; Milner, Jo

2003-01-01

p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953

Heterogeneous distribution of P53 immunoreactivity in human lung adenocarcinoma correlates with MDM2 protein expression, rather than with P53 gene mutation.

PubMed

Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K

2001-07-20

Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.

p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

PubMed

Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

2016-11-22

Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

TRIM65 negatively regulates p53 through ubiquitination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; Ma, Chengyuan; Zhou, Tong

2016-04-22

Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less

Knockdown of zebrafish Fancd2 causes developmental abnormalities via p53-dependent apoptosis.

PubMed

Liu, Ting Xi; Howlett, Niall G; Deng, Min; Langenau, David M; Hsu, Karl; Rhodes, Jennifer; Kanki, John P; D'Andrea, Alan D; Look, A Thomas

2003-12-01

Mechanisms underlying the multiple developmental defects observed in Fanconi anemia (FA) patients are not well defined. We have identified the zebrafish homolog of human FANCD2, which encodes a nuclear effector protein that is monoubiquitinated in response to DNA damage, targeting it to nuclear foci where it preserves chromosomal integrity. Fancd2-deficient zebrafish embryos develop defects similar to those found in children with FA, including shortened body length, microcephaly, and microophthalmia, which are due to extensive cellular apoptosis. Developmental defects and increased apoptosis in Fancd2-deficient zebrafish were corrected by injection of human FANCD2 or zebrafish bcl2 mRNA, or by knockdown of p53, indicating that in the absence of Fancd2, developing tissues spontaneously undergo p53-dependent apoptosis. Thus, Fancd2 is essential during embryogenesis to prevent inappropriate apoptosis in neural cells and other tissues undergoing high levels of proliferative expansion, implicating this mechanism in the congenital abnormalities observed in human infants with FA.

Sulphur alters NFκB-p300 cross-talk in favour of p53-p300 to induce apoptosis in non-small cell lung carcinoma.

PubMed

Saha, Shilpi; Bhattacharjee, Pushpak; Guha, Deblina; Kajal, Kirti; Khan, Poulami; Chakraborty, Sreeparna; Mukherjee, Shravanti; Paul, Shrutarshi; Manchanda, Rajkumar; Khurana, Anil; Nayak, Debadatta; Chakrabarty, Rathin; Sa, Gaurisankar; Das, Tanya

2015-08-01

Adverse side effects of chemotherapy during cancer treatment have shifted considerable focus towards therapies that are not only targeted but are also devoid of toxic side effects. We evaluated the antitumorigenic activity of sulphur, and delineated the molecular mechanisms underlying sulphur-induced apoptosis in non-small cell lung carcinoma (NSCLC) cells. A search for the underlying mechanism revealed that the choice between the two cellular processes, NFκBp65-mediated survival and p53-mediated apoptosis, was decided by the competition for a limited pool of transcriptional coactivator protein p300 in NSCLC cells. In contrast, sulphur inhibited otherwise upregulated survival signaling in NSCLC cells by perturbing the nuclear translocation of p65NFκB, its association with p300 histone acetylase, and subsequent transcription of Bcl-2. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic mitochondrial death cascade. Overall, the findings of this preclinical study clearly delineated the molecular mechanism underlying the apoptogenic effect of the non-toxic homeopathic remedy, sulphur, in NSCLC cells.

Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity

PubMed Central

Görner, Wolfram; Durchschlag, Erich; Martinez-Pastor, Maria Teresa; Estruch, Francisco; Ammerer, Gustav; Hamilton, Barbara; Ruis, Helmut; Schüller, Christoph

1998-01-01

Msn2p and the partially redundant factor Msn4p are key regulators of stress-responsive gene expression in Saccharomyces cerevisiae. They are required for the transcription of a number of genes coding for proteins with stress-protective functions. Both Msn2p and Msn4p are Cys2His2 zinc finger proteins and bind to the stress response element (STRE). In vivo footprinting studies show that the occupation of STREs is enhanced in stressed cells and dependent on the presence of Msn2p and Msn4p. Both factors accumulate in the nucleus under stress conditions, such as heat shock, osmotic stress, carbon-source starvation, and in the presence of ethanol or sorbate. Stress-induced nuclear localization was found to be rapid, reversible, and independent of protein synthesis. Nuclear localization of Msn2p and Msn4p was shown to be correlated inversely to cAMP levels and protein kinase A (PKA) activity. A region with significant homologies shared between Msn2p and Msn4p is sufficient to confer stress-regulated localization to a SV40–NLS–GFP fusion protein. Serine to alanine or aspartate substitutions in a conserved PKA consensus site abolished cAMP-driven nuclear export and cytoplasmic localization in unstressed cells. We propose stress and cAMP-regulated intracellular localization of Msn2p to be a key step in STRE-dependent transcription and in the general stress response. PMID:9472026

Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santhanam, U.; Ray, A.; Sehgal, P.B.

1991-09-01

The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

Human cytomegalovirus DNA polymerase catalytic subunit pUL54 possesses independently acting nuclear localization and ppUL44 binding motifs.

PubMed

Alvisi, Gualtiero; Ripalti, Alessandro; Ngankeu, Apollinaire; Giannandrea, Maila; Caraffi, Stefano G; Dias, Manisha M; Jans, David A

2006-10-01

The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 (ppUL44), is essential for viral replication. The C-terminal residues (amino acids 1220-1242) of pUL54 have been reported to be sufficient for ppUL44 binding in vitro. Although believed to be important for functioning in the nuclei of infected cells, no data are available on either the interaction of pUL54 with ppUL44 in living mammalian cells or the mechanism of pUL54 nuclear transport and its relationship with that of ppUL44. The present study examines for the first time the nuclear import pathway of pUL54 and its interaction with ppUL44 using dual color, quantitative confocal laser scanning microscopy on live transfected cells and quantitative gel mobility shift assays. We showed that of two nuclear localization signals (NLSs) located at amino acids 1153-1159 (NLSA) and 1222-1227 (NLSB), NLSA is sufficient to confer nuclear localization on green fluorescent protein (GFP) by mediating interaction with importin alpha/beta. We also showed that pUL54 residues 1213-1242 are sufficient to confer ppUL44 binding abilities on GFP and that pUL54 and ppUL44 can be transported to the nucleus as a complex. Our work thus identified distinct sites within the HCMV DNA polymerase, which represent potential therapeutic targets and establishes the molecular basis of UL54 nuclear import.

Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.

PubMed

Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald

2017-06-01

p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p < 0.001). The p53 and Bcl-2 immunoreactivity was increased in aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less

Cholesterol Secosterol Aldehydes Induce Amyloidogenesis and Dysfunction of Wild Type Tumor Protein p53

PubMed Central

Nieva, Jorge; Song, Byeong-Doo; Rogel, Joseph K.; Kujawara, David; Altobel, Lawrence; Izharrudin, Alicia; Boldt, Grant E.; Grover, Rajesh K.; Wentworth, Anita D.; Wentworth, Paul

2011-01-01

SUMMARY Epidemiologic and clinical evidence points to an increased risk of cancer when coupled with chronic inflammation. However, the molecular mechanisms that underpin this interrelationship remain largely unresolved. Herein we show that the inflammation-derived cholesterol 5,6-secosterol aldehydes, atheronal-A (KA) and –B (ALD), but not the PUFA-derived aldehydes 4-hydroxynonenal (HNE) and 4-hydroxyhexenal (HHE), induce misfolding of wild-type p53 into an amyloidogenic form that binds thioflavin T and Congo Red dyes but cannot bind to a consensus DNA sequence. Treatment of lung carcinoma cells with KA and ALD leads to a loss of function of extracted p53, as determined by analysis of extracted nuclear protein and in activation of p21. Our results uncover a plausible chemical link between inflammation and cancer and expands the already pivotal role of p53 dysfunction and cancer risk. PMID:21802012

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

PubMed

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Ensemble-Based Computational Approach Discriminates Functional Activity of p53 Cancer and Rescue Mutants

PubMed Central

Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.

2011-01-01

The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641

Mutant human tumor suppressor p53 modulates the activation of mitogen-activated protein kinase and nuclear factor-kappaB, but not c-Jun N-terminal kinase and activated protein-1.

PubMed

Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena

2006-01-01

The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF

42 CFR 482.53 - Condition of participation: Nuclear medicine services.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 5 2013-10-01 2013-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...

42 CFR 482.53 - Condition of participation: Nuclear medicine services.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 5 2014-10-01 2014-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...

42 CFR 482.53 - Condition of participation: Nuclear medicine services.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...

42 CFR 482.53 - Condition of participation: Nuclear medicine services.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 5 2011-10-01 2011-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...

42 CFR 482.53 - Condition of participation: Nuclear medicine services.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 5 2012-10-01 2012-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...

Smoking, p53 Mutation, and Lung Cancer

PubMed Central

Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.

2014-01-01

This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106

Urinary Bladder Lesions after the Chernobyl Accident: Immunohistochemical Assessment of p53, Proliferating Cell Nuclear Antigen, Cyclin D1 and p21WAF1/Cip1

PubMed Central

Romanenko, Alina; Lee, Chyi Chia R.; Yamamoto, Shinji; Hori, Taka‐aki; Wanibuchi, Hideki; Zaparin, Wadim; Vinnichenko, Wladimir; Vozianov, Alexander

1999-01-01

During the 11‐year period subsequent to the Chernobyl accident, the incidence of urinary bladder cancer in Ukraine has increased from 26.2 to 36.1 per 100,000 population. Cesium‐137 (137Cs) accounts for 80–90% of the incorporated radioactivity in this population, which has been exposed to long‐term, low‐dose ionizing radiation, and 80% of the more labile pool of cesium is excreted via the urine. The present study was performed to evaluate the histopathological features and the immunohistochemical status of p53, p21WAF1/Cip1, cyclin D1 and PCNA (proliferating cell nuclear antigen) in urinary bladder mucos a of 55 males (49‐92 years old) with benign prostatic hyperplasia who underwent surgery in Kiev, Ukraine, in 1995 and 1996. Group I (28 patients) inhabiting radiocontaminated areas of the country, group II (17 patients) from Kiev city with less radiocontamination and a control group III (10 patients) living in so‐called “clean” areas of Ukraine were compared. In groups I and II, an increase in multiple areas of moderate or severe dysplasia or carcinoma in situ was seen in 42 (93%) of 45 cases. In addi tion, two small transitional cell carcinomas were found in one patient in each of groups I and II. Nuclear accumulation of p53, PCNA, cyclin D1, and to a lesser extent p21WAF1/Cip1, was significantly increased in both groups I and II as compared with the control group III, indicating possible transformation events or enhancement of repair activities, that may precede the defect in the regulatory pathway itself, at least in the G1 phase of the cell cycle. Our results suggest that early malignant transformation is taking place in the bladder urothelium of people in the radiocontaminated areas of Ukraine and that this could possibly lead sometime in the future to an increased incidence of urinary bladder cancer. PMID:10189884

Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.

PubMed

Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D

2016-10-01

TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.

Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma

PubMed Central

Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie

2016-01-01

Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of

Expression of Bcl-2, p53, and MDM2 in Localized Prostate Cancer With Respect to the Outcome of Radical Radiotherapy Dose Escalation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vergis, Roy; Corbishley, Catherine M.; Thomas, Karen

Purpose: Established prognostic factors in localized prostate cancer explain only a moderate proportion of variation in outcome. We analyzed tumor expression of apoptotic markers with respect to outcome in men with localized prostate cancer in two randomized controlled trials of radiotherapy dose escalation. Methods and Materials: Between 1995 and 2001, 308 patients with localized prostate cancer received neoadjuvant androgen deprivation and radical radiotherapy at our institution in one of two dose-escalation trials. The biopsy specimens in 201 cases were used to make a biopsy tissue microarray. We evaluated tumor expression of Bcl-2, p53, and MDM2 by immunohistochemistry with respect tomore » outcome. Results: Median follow-up was 7 years, and 5-year freedom from biochemical failure (FFBF) was 70.4% (95% CI, 63.5-76.3%). On univariate analysis, expression of Bcl-2 (p < 0.001) and p53 (p = 0.017), but not MDM2 (p = 0.224), was significantly associated with FFBF. Expression of Bcl-2 remained significantly associated with FFBF (p = 0.001) on multivariate analysis, independently of T stage, Gleason score, initial prostate-specific antigen level, and radiotherapy dose. Seven-year biochemical control was 61% vs. 41% (p = 0.0122) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-positive tumors and 87% vs. 81% (p = 0.423) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-negative tumors. There was no statistically significant interaction between dose and Bcl-2 expression. Conclusions: Bcl-2 expression was a significant, independent determinant of biochemical control after neoadjuvant androgen deprivation and radical radiotherapy for prostate cancer. These data generate the hypothesis that Bcl-2 expression could be used to inform the choice of radiotherapy dose in individual patients.« less

Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65.

PubMed

Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S; Kaneki, Masao

2014-11-11

Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson's disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. Copyright © 2014, American Association for the Advancement of Science.

Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65

PubMed Central

Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E.; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S.; Kaneki, Masao

2015-01-01

Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-Nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson’s disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. PMID:25389371

Mapping of CIP/KIP inhibitors, G1 cyclins D1, D3, E and p53 proteins in the rat term placenta.

PubMed

Korgun, Emin Turkay; Unek, Gozde; Herrera, Emilio; Jones, Carolyn J; Wadsack, Christian; Kipmen-Korgun, Dijle; Desoye, Gernot

2011-09-01

As cell cycle regulation is fundamental to the normal growth and development of the placenta, the aim of the present study was to determine the immunolocalizations of cell cycle related proteins, which have key roles in proliferation, differentiation and apoptosis during the development of the rat placenta. Here immunohistochemistry has been used to localize G1 cyclins (D1, D3, E), which are major determinants of proliferation, CIP/KIP inhibitors (p21, p27, p57), p53 as a master regulator and proliferating cell nuclear antigen in all cell types of the rat term placenta. The proportion of each cell type immunolabeled was counted. Cyclin D1 and cyclin D3 were present mostly in cells of the fetal aspect of the placenta, whereas the G1/S cyclin E was present only in the spongio- and labyrinthine trophoblast populations. Among the CIP/KIP inhibitors, p21 was present only in cells of the fetal aspect whereas p27 and p57 were found in all cell types studied. p53 was only found in a small proportion of cells with no co-localization of p53 and p21. The data suggest that the cells of the fetal side of the rat placenta still have some proliferation potential which is kept in check by expression of the CIP/KIP cell cycle inhibitors, whereas cells of the maternal aspect have lost this potential. Apoptosis is only marginal in the term rat placenta. In conclusion, proliferation and apoptosis in rat placental cells appears controlled mostly by the CIP/KIP inhibitors in late pregnancy.

System-based strategies for p53 recovery.

PubMed

Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

2018-06-01

The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Prognostic significance of p53 immunohistochemical expression in adenoid cystic carcinoma of the salivary glands: a meta-analysis

PubMed Central

Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua

2017-01-01

Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in “high-risk” category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01). In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands. PMID:28206977

Prognostic significance of p53 immunohistochemical expression in adenoid cystic carcinoma of the salivary glands: a meta-analysis.

PubMed

Li, Qinglin; Huang, Ping; Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua

2017-04-25

Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in "high-risk" category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01).In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands.

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

PubMed

Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

2018-05-31

The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course‐based undergraduate research experience in molecular and cell biology

PubMed Central

Brownell, Sara E.; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F. Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S.; Stearns, Tim

2016-01-01

Abstract The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course‐based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students′ high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA‐binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161–178, 2017. PMID:27873457

Transcriptional specificity in various p53-mutant cells.

PubMed

Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

2013-03-01

Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

Inactivation of p53 Rescues the Maintenance of High Risk HPV DNA Genomes Deficient in Expression of E6

PubMed Central

Lorenz, Laurel D.; Rivera Cardona, Jessenia; Lambert, Paul F.

2013-01-01

The human papillomavirus DNA genome undergoes three distinct stages of replication: establishment, maintenance and amplification. We show that the HPV16 E6 protein is required for the maintenance of the HPV16 DNA genome as an extrachromosomal, nuclear plasmid in its natural host cell, the human keratinocyte. Based upon mutational analyses, inactivation of p53 by E6, but not necessarily E6-mediated degradation of p53, was found to correlate with the ability of E6 to support maintenance of the HPV16 genome as a nuclear plasmid. Inactivation of p53 with dominant negative p53 rescued the ability of HPV16 E6STOP and E6SAT mutant genomes to replicate as extrachromosomal genomes, though not to the same degree as observed for the HPV16 E6 wild-type (WT) genome. Inactivation of p53 also rescued the ability of HPV18 and HPV31 E6-deficient genomes to be maintained at copy numbers comparable to that of HPV18 and HPV31 E6WT genomes at early passages, though upon further passaging copy numbers for the HPV18 and 31 E6-deficient genomes lessened compared to that of the WT genomes. We conclude that inactivation of p53 is necessary for maintenance of HPV16 and for HPV18 and 31 to replicate at WT copy number, but that additional functions of E6 independent of inactivating p53 must also contribute to the maintenance of these genomes. Together these results suggest that re-activation of p53 may be a possible means for eradicating extrachromosomal HPV16, 18 or 31 genomes in the context of persistent infections. PMID:24204267

The selfish yeast plasmid uses the nuclear motor Kip1p but not Cin8p for its localization and equal segregation.

PubMed

Cui, Hong; Ghosh, Santanu K; Jayaram, Makkuni

2009-04-20

The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1-STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a "partitioning center" represents yet another facet of the benign parasitism of the yeast plasmid.

The selfish yeast plasmid uses the nuclear motor Kip1p but not Cin8p for its localization and equal segregation

PubMed Central

Cui, Hong; Ghosh, Santanu K.

2009-01-01

The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1–STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a “partitioning center” represents yet another facet of the benign parasitism of the yeast plasmid. PMID:19364922

Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lieber, Charles S.; Department of Medicine, Mount Sinai School of Medicine, New York, NY 10029; Leo, Maria Anna

2008-08-22

Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-{gamma} coactivator1{alpha} (PGC-1{alpha}). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (pmore » = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1{alpha} hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5.« less

Expression of p53, Bcl-2, VEGF, Ki67 and PCNA and prognostic significance in hepatocellular carcinoma.

PubMed

Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel

2008-12-01

Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.

The Role of JMY in p53 Regulation.

PubMed

Adighibe, Omanma; Pezzella, Francesco

2018-05-31

Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

A systematic review of p53 regulation of oxidative stress in skeletal muscle.

PubMed

Beyfuss, Kaitlyn; Hood, David A

2018-12-01

transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p

Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

PubMed Central

Meng, X; Carlson, NR; Dong, J; Zhang, Y

2016-01-01

The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53

Immunohistochemical analysis of P53 protein in odontogenic cysts

PubMed Central

Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

2010-01-01

The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

PubMed Central

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-01-01

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

p53 downregulates the Fanconi anaemia DNA repair pathway.

PubMed

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

Involvement of stromal p53 in tumor-stroma interactions

PubMed Central

Bar, Jair; Moskovits, Neta; Oren, Moshe

2009-01-01

p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385

Growth hormone-specific induction of the nuclear localization of porcine growth hormone receptor in porcine hepatocytes.

PubMed

Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X

2017-10-01

The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.

P53 Suppression of Homologous Recombination and Tumorigenesis

DTIC Science & Technology

2013-01-01

absence or mutation of p53 and the mechanism of p53 control of HR in an in vivo system. p53 is often a targeted therapy and further insight into the...function of p53 in DNA repair pathways can be vital to finding novel points of targeted therapy . Our data will add insight to the important paradigm...cancers. Cisplatin works by the aquation of a chloride ligand that results in the formation of a DNA adduct, usually crosslinking the DNA, which impedes

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

PubMed

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-08-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

RhoA influences the nuclear localization of extracellular signal-regulated kinases to modulate p21Waf/Cip1 expression.

PubMed

Zuckerbraun, Brian S; Shapiro, Richard A; Billiar, Timothy R; Tzeng, Edith

2003-08-19

The 42/44-kD mitogen-activated protein kinases (extracellular signal-regulated kinases, ERKs) regulate smooth muscle cell (SMC) cell-cycle progression and can either promote or inhibit proliferation depending on the activation status of the small GTPase RhoA. RhoA is involved in the regulation of the actin cytoskeleton and converges on multiple signaling pathways. However, the mechanism by which RhoA modulates ERK signaling is not well defined. The purpose of this investigation was to examine whether RhoA regulates ERK downstream signaling and cellular proliferation through its effects on the cytoskeleton and the nuclear localization of ERK. Treatment of SMCs with Clostridia botulinum C3 exoenzyme, which inhibits RhoA activation, decreased SMC proliferation to 24+/-7% of that of controls and increased p21Waf1/Cip1 transcription and protein levels. These effects of RhoA were reversed by inhibition of ERK phosphorylation. However, inactivation of RhoA did not alter levels of ERK phosphorylation but did increase nuclear localization of phosphorylated ERK. In addition, immunostaining demonstrated that phosphorylated ERK associated with the actin cytoskeleton, which was disrupted by C3 exoenzyme. Leptomycin B, an inhibitor of Crm1 that results in ERK nuclear accumulation, similarly increased p21Waf1/Cip1. RhoA inhibition increased levels of phosphorylated ERK in the cell nucleus. Inhibition of RhoA or pharmacological inhibition of nuclear export resulted in increased p21Waf1/Cip1 expression and decreased SMC proliferation, effects that were partially dependent on ERK. RhoA regulation of the actin cytoskeleton may determine ERK subcellular localization and its subsequent effects on SMC proliferation.

The Transcription Factor p53 Influences Microglial Activation Phenotype

PubMed Central

Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.

2011-01-01

Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312

Prevalence of human papillomavirus, Epstein-Barr virus, p21, and p53 expression in sinonasal inverted papilloma, nasal polyp, and hypertrophied turbinate in Hong Kong patients.

PubMed

Sham, C L; To, K F; Chan, Paul K S; Lee, Dennis L Y; Tong, Michael C F; van Hasselt, C Andrew