DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth
Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less
RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878
2013-11-01
Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53
NASA Technical Reports Server (NTRS)
Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.
1997-01-01
The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.
Recognition of Local DNA Structures by p53 Protein
Brázda, Václav; Coufal, Jan
2017-01-01
p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
Evaluation of nuclear unrest and p53 immunostaining in Wilms' tumor.
Salama, Asmaa; Kamel, Ahmad
2011-03-01
Nuclear unrest is a term applied to Wilms' tumors (WT) that show nuclear abnormalities close to anaplasia but without abnormal mitoses. p53 is claimed to be associated with anaplasia and poor prognosis. This study was undertaken to evaluate the clinical significance of nuclear unrest and p53 immunostaining in Wilms' tumor. This is a retrospective study of 63 patients who presented at NCI with Wilms' tumors, and underwent preoperative chemotherapy followed by nephrectomy. Histopathologic assessment and p53 immunohistochemistry were done. WT with nuclear unrest grade III closely resembled anaplastic tumors and both of them (group 1) constituted 19% of cases. Group 1 constituted 29% of cases showing blastema dominant morphology compared to 9.4% of cases without blastema dominant morphology with significant statistical difference (p=0.047). Almost 83% of cases that achieved 1st complete remission were stages I, II and III, while 17% were stages IV and V with significant statistical difference (p<0.001). Stage affected the 3-year relapse-free-survival (RFS) significantly (p=0.014) as it was more in stages I, II and III than in stages IV and V (75.4% versus 50%). Blastema dominant morphology and high risk state significantly lowered the 3-year overall survival (OS) into 54.8% in comparison to 80.9% for cases with non-blastema dominant morphology (p=0.042). Regarding p53 immunohistochemistry, group 1 tumors showed positive p53 more than group 2 with significant statistical difference (p=0.014). p53 Positive immunostaining was significantly associated with high risk nephroblastoma (p=0.004). Tumor stage and blastema dominant morphology are potent prognostic factors. p53 is linked to blastema dominant morphology. WT with nuclear unrest grade III closely resembles anaplastic WT. It may be appropriate to group tumors with nuclear unrest grade III with anaplastic histology regarding treatment stratification. Copyright © 2011. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Toru; Ohashi, Sachiyo; Kobayashi, Shunsuke
In cancer cells, anticancer reagents often trigger nuclear accumulation of YB-1, which participates in the progression of cancer malignancy. YB-1 has a non-canonical nuclear localization signal (YB-NLS). Here we found that four nucleocytoplasmic-shuttling RNA-binding proteins and p53 interact specifically with the YB-NLS and co-accumulate with YB-1 in the nucleus of actinomycin D-treated cells. To elucidate the roles of these YB-NLS-binding proteins, we performed a dominant-negative experiment in which a large excess of YB-NLS interacts with the YB-NLS-binding proteins, and showed inhibitory effects on actinomycin D-induced nuclear transport of endogenous YB-1 and subsequent MDR1 gene expression. Furthermore, the YB-NLS-expressing cells weremore » also found to show increased drug sensitivity. Our results suggest that these YB-NLS-associating proteins are key factors for nuclear translocation/accumulation of YB-1 in cancer cells. - Highlights: • Four nucleocytoplasmic-shuttling proteins and p53 associate with YB-NLS. • They showed nuclear co-accumulation with YB-1 in actinomycin D-treated cells. • Overexpression of YB-NLS was carried out to take YB-NLS-binding proteins from YB-1. • YB-NLS inhibited actinomycin D-induced nuclear localization of endogenous YB-1. • YB-NLS suppressed actinomycin D-induced expression of MDR1.« less
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less
Ehm, Patrick; Nalaskowski, Marcus M; Wundenberg, Torsten; Jücker, Manfred
2015-01-01
The inositol 5-phosphatase SHIP1 is a negative regulator of signaling processes in haematopoietic cells. By converting PI(3,4,5)P3 to PtdIns(3,4)P2 at the plasma membrane, SHIP1 modifies PI3-kinase mediated signaling. We have recently demonstrated that SHIP1 is a nucleo-cytoplasmic shuttling protein and SHIP1 nuclear puncta partially colocalize with FLASH, a component of nuclear bodies. In this study, we demonstrate that endogenous SHIP1 localizes to intranucleolar regions of both normal and leukemic haematopoietic cells. In addition, we report that ectopically expressed SHIP1 accumulates in nucleolar cavities and colocalizes with the tumor suppressor protein p53 and components of PML nuclear bodies (e.g. SP100, SUMO-1 and CK2). Moreover, SHIP1 also colocalizes in nucleolar cavities with components of the ubiquitin-proteasome pathway. By using confocal microscopy data, we generated 3D-models revealing the enormous extent of the SHIP1 aggresomes in the nucleolus. Furthermore, treatment of cells with the proteasome inhibitor MG132 causes an enlargement of nucleolar SHIP1 containing structures. Unexpectedly, this accumulation can be partially prevented by treatment with the inhibitor of nuclear protein export Leptomycin B. In recent years, several proteins aggregating in nucleolar cavities were shown to be key factors of neurodegenerative diseases and cancerogenesis. Our findings support current relevance of nuclear localized SHIP1.
Cross Talk between PML and p53 during Poliovirus Infection: Implications for Antiviral Defense
Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K.
2006-01-01
PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation. PMID:16912307
Cross talk between PML and p53 during poliovirus infection: implications for antiviral defense.
Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K
2006-09-01
PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation.
2010-01-01
Introduction Women with ductal hyperplasia including usual ductal hyperplasia (UDH) and atypical ductal hyperplasia (ADH) have an increased risk of developing invasive ductal carcinoma (IDC) of breast. The importance of several molecular markers in breast cancer has been of considerable interest during recent years such as p53 and estrogen receptor alpha (ERα). However, p53 nuclear accumulation and ERα expression have not been assessed in ductal hyperplasia co-existing with ductal carcinoma in situ (DCIS) or IDC versus pure ductal hyperplasia without DCIS or IDC. Materials and methods We investigated p53 nuclear accumulation and ERα expression in breast ductal hyperplasia in a cohort of 215 Chinese women by immunohistochemistry (IHC), which included 129 cases of pure ductal hyperplasia, 86 cases of ductal hyperplasia co-existing with DCIS (41 cases) or IDC (45 cases). Results Nuclear p53 accumulation was identified in 22.8% of ADH (31/136), 41.5% of DCIS (17/41) and 42.2% of IDC (19/45), and no case of UDH (0/79). No difference in nuclear p53 accumulation was observed between pure ADH and ADH co-existing with DCIS (ADH/DCIS) or IDC (ADH/IDC) (P > 0.05). The positive rate of ERα expression was lower in ADH (118/136, 86.8%) than that in UDH (79/79, 100%) (P < 0.001), but higher than that in DCIS (28/41, 68.3%) or IDC (26/45, 57.8%) respectively (P < 0.001). The frequency of ERα expression was lower in ADH/DCIS (23/29, 79.31%) and ADH/IDC (23/30, 76.67%) than that in pure ADH (72/77, 93.51%) respectively (P < 0.05). There was a negative weak correlation between p53 nuclear accumulation and ERα expression as for ADH (coefficient correlation -0.51; P < 0.001). Conclusions Different pathological types of ductal hyperplasia of breast are accompanied by diversity in patterns of nuclear p53 accumulation and ERα expression. At least some pure ADH is molecularly distinct from ADH/CIS or ADH/IDC which indicated the two types of ADH are molecularly distinct entities
Ehm, Patrick; Nalaskowski, Marcus M; Wundenberg, Torsten; Jücker, Manfred
2015-01-01
The inositol 5-phosphatase SHIP1 is a negative regulator of signaling processes in haematopoietic cells. By converting PI(3,4,5)P3 to PtdIns(3,4)P2 at the plasma membrane, SHIP1 modifies PI3-kinase mediated signaling. We have recently demonstrated that SHIP1 is a nucleo-cytoplasmic shuttling protein and SHIP1 nuclear puncta partially colocalize with FLASH, a component of nuclear bodies. In this study, we demonstrate that endogenous SHIP1 localizes to intranucleolar regions of both normal and leukemic haematopoietic cells. In addition, we report that ectopically expressed SHIP1 accumulates in nucleolar cavities and colocalizes with the tumor suppressor protein p53 and components of PML nuclear bodies (e.g. SP100, SUMO-1 and CK2). Moreover, SHIP1 also colocalizes in nucleolar cavities with components of the ubiquitin-proteasome pathway. By using confocal microscopy data, we generated 3D-models revealing the enormous extent of the SHIP1 aggresomes in the nucleolus. Furthermore, treatment of cells with the proteasome inhibitor MG132 causes an enlargement of nucleolar SHIP1 containing structures. Unexpectedly, this accumulation can be partially prevented by treatment with the inhibitor of nuclear protein export Leptomycin B. In recent years, several proteins aggregating in nucleolar cavities were shown to be key factors of neurodegenerative diseases and cancerogenesis. Our findings support current relevance of nuclear localized SHIP1. PMID:25723258
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
2014-01-01
Background Squamous cell carcinoma of tongue (SCCT) is expected to harbor unique clinico-pathological and molecular genetic features since a significant proportion of patients are young and exhibit no association with tobacco or alcohol. Methods We determined P53, epidermal growth factor receptor, microsatellite instability, human papilloma virus infection and loss of heterozygosity status at several tumor suppressor loci in one hundred and twenty one oral SCCT (SSCOT) samples and analyzed their association with clinico-pathological features and patient survival. Results Our results revealed a significantly higher incidence of p53 nuclear stabilization in early (as against late) onset SCCOT. FHIT loss was significantly associated with p53 nuclear stabilization and the association was stronger in patients with no history of tobacco use. Samples harboring mutation in p53 DNA binding domain or exhibiting p53 nuclear stabilization, were significantly associated with poor survival. Conclusion Our study has therefore identified distinct features in SCCOT tumorigenesis with respect to age and tobacco exposure and revealed possible prognostic utility of p53. PMID:25152695
Guo, Gang; Yu, Miao; Xiao, Wei; Celis, Esteban; Cui, Yan
2017-01-01
Mutations in tumor suppressor p53 remain a vital mechanism of tumor escape from apoptosis and senescence. Emerging evidence suggests that p53 dysfunction also fuels inflammation and supports tumor immune evasion, thereby serving as an immunological driver of tumorigenesis. Therefore, targeting p53 in the tumor microenvironment (TME) also represents an immunologically desirable strategy for reversing immunosuppression and enhancing antitumor immunity. Using a pharmacological p53 activator nutlin-3a, we show that local p53 activation in TME comprising overt tumor infiltrating leukocytes (TILeus) induces systemic antitumor immunity and tumor regression, but not in TME with scarce TILeus, such as B16 melanoma. Maneuvers that recruit leukocytes to TME, such as TLR3 ligand in B16 tumors, greatly enhanced nutlin-induced antitumor immunity and tumor control. Mechanistically, nutlin-3a-induced antitumor immunity was contingent on two non-redundant but immunologically synergistic p53-dependent processes: reversal of immunosuppression in TME and induction of tumor immunogenic cell death (ICD), leading to activation and expansion of polyfunctional CD8 CTLs and tumor regression. Our study demonstrates that unlike conventional tumoricidal therapies, which rely on effective p53 targeting in each tumor cell and often associate with systemic toxicity, this immune-based strategy requires only limited local p53 activation to alter the immune landscape of TME and subsequently amplify immune response to systemic antitumor immunity. Hence, targeting the p53 pathway in TME can be exploited to reverse immunosuppression and augment therapeutic benefits beyond tumoricidal effects to harness tumor-specific, durable, and systemic antitumor immunity with minimal toxicity. PMID:28280037
Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer
Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel
2016-01-01
Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766
Regulation of autophagy by cytoplasmic p53
Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2009-01-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice
Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.
2014-01-01
Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632
Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang
2017-11-03
Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping
DOE Office of Scientific and Technical Information (OSTI.GOV)
An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min
Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less
Nuclear localization of Schizosaccharomyces pombe Mcm2/Cdc19p requires MCM complex assembly.
Pasion, S G; Forsburg, S L
1999-12-01
The minichromosome maintenance (MCM) proteins MCM2-MCM7 are conserved eukaryotic replication factors that assemble in a heterohexameric complex. In fission yeast, these proteins are nuclear throughout the cell cycle. In studying the mechanism that regulates assembly of the MCM complex, we analyzed the cis and trans elements required for nuclear localization of a single subunit, Mcm2p. Mutation of any single mcm gene leads to redistribution of wild-type MCM subunits to the cytoplasm, and this redistribution depends on an active nuclear export system. We identified the nuclear localization signal sequences of Mcm2p and showed that these are required for nuclear targeting of other MCM subunits. In turn, Mcm2p must associate with other MCM proteins for its proper localization; nuclear localization of MCM proteins thus requires assembly of MCM proteins in a complex. We suggest that coupling complex assembly to nuclear targeting and retention ensures that only intact heterohexameric MCM complexes remain nuclear.
Nuclear Localization of Schizosaccharomyces pombe Mcm2/Cdc19p Requires MCM Complex Assembly
Pasion, Sally G.; Forsburg, Susan L.
1999-01-01
The minichromosome maintenance (MCM) proteins MCM2–MCM7 are conserved eukaryotic replication factors that assemble in a heterohexameric complex. In fission yeast, these proteins are nuclear throughout the cell cycle. In studying the mechanism that regulates assembly of the MCM complex, we analyzed the cis and trans elements required for nuclear localization of a single subunit, Mcm2p. Mutation of any single mcm gene leads to redistribution of wild-type MCM subunits to the cytoplasm, and this redistribution depends on an active nuclear export system. We identified the nuclear localization signal sequences of Mcm2p and showed that these are required for nuclear targeting of other MCM subunits. In turn, Mcm2p must associate with other MCM proteins for its proper localization; nuclear localization of MCM proteins thus requires assembly of MCM proteins in a complex. We suggest that coupling complex assembly to nuclear targeting and retention ensures that only intact heterohexameric MCM complexes remain nuclear. PMID:10588642
Sajeevan, Thara Purath; Saraswathi, Tillai Rajasekaran; Ranganathan, Kannan; Joshua, Elizabeth; Rao, Uma Devi K
2014-07-01
p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA) is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC) and periapical cyst (PA). A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%), whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1) OKC showed p53 expression in 6 cases (60%) whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2) The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.
Around and beyond 53BP1 Nuclear Bodies.
Fernandez-Vidal, Anne; Vignard, Julien; Mirey, Gladys
2017-12-05
Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.
Around and beyond 53BP1 Nuclear Bodies
Fernandez-Vidal, Anne; Vignard, Julien
2017-01-01
Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction. PMID:29206178
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407
Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M
1998-07-01
Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR
The small molecule 2-phenylethynesulfonamide induces covalent modification of p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent
p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less
Assessment of mdm2 Alterations on p53 Expression in Breast Cancer
2000-10-01
Figure 2. Schematic Comparison of mdm2 with PCR Products of Various Sizes. nuclear localization signal I p53 binding site X acidic domain zinc...susceptibility gene isolated by controlled homozygous functional knockout of allelic loci in mammalian cells. Cell. 85: 319-329, 1996. 36. Li, L., Li, X ...twelve years. Chinese Journal of Parasitology and Parasitic Diseases 10: 112-114, 1992. 7. Gao DQ, Cansesaa L, Mouradian MM, Jose P. Dopamine D2-long
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu
2012-06-29
Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed
Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef
2003-09-17
The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.
Accumulation of p53 in infectious mononucleosis tissues.
Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L
2000-11-01
Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company
Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation.
Jung, Yu Yeon; Son, Dong Ju; Lee, Hye Lim; Kim, Dae Hwan; Song, Min Jong; Ham, Young Wan; Kim, Youngsoo; Han, Sang Bae; Park, Mi Hee; Hong, Jin Tae
2017-08-01
Parkin is associated with various inflammatory diseases, including Parkinson's disease (PD) and rheumatoid arthritis (RA). However, the precise role of Parkin in RA is unclear. The present study addressed this issue by comparing the development of RA between non-transgenic (non-Tg) mice and PARK2 knockout (KO) mice. We found that cyclooxygenase-2 and inducible nitric oxide synthase expression and nuclear factor-κB activity were reduced but p53 activation was increased in PARK2 KO as compared to non-Tg mice. These effects were associated with reduced p53 degradation. Parkin was found to interact with p53; however, this was abolished in Parkin KO mice, which prevented p53 degradation. Treatment of PARK2 KO mice with p53 inhibitor increased Parkin expression as well as inflammation and RA development while decreasing nuclear p53 translocation, demonstrating that PARK2 deficiency inhibits inflammation in RA via suppression of p53 degradation. These results suggest that RA development may be reduced in PD patients. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.
Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.
1995-01-01
We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohan, Vijay; Agarwal, Rajesh; Singh, Rana P., E-mail: ranaps@hotmail.com
Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survivalmore » of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer
Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S
2009-03-04
Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.
Negative feedback regulation of wild-type p53 biosynthesis.
Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W
1995-01-01
When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087
2014-01-01
Activation of nuclear factor-kappa B (NF- κB) as a mechanism of host defense against infection and stress is the central mediator of inflammatory responses. A normal (acute) inflammatory response is activated on urgent basis and is auto-regulated. Chronic inflammation that results due to failure in the regulatory mechanism, however, is largely considered as a critical determinant in the initiation and progression of various forms of cancer. Mechanistically, NF- κB favors this process by inducing various genes responsible for cell survival, proliferation, migration, invasion while at the same time antagonizing growth regulators including tumor suppressor p53. It has been shown by various independent investigations that a down regulation of NF- κB activity directly, or indirectly through the activation of the p53 pathway reduces tumor growth substantially. Therefore, there is a huge effort driven by many laboratories to understand the NF- κB signaling pathways to intervene the function of this crucial player in inflammation and tumorigenesis in order to find an effective inhibitor directly, or through the p53 tumor suppressor. We discuss here on the role of NF- κB in chronic inflammation and cancer, highlighting mutual antagonism between NF- κB and p53 pathways in the process. We also discuss prospective pharmacological modulators of these two pathways, including those that were already tested to affect this mutual antagonism. PMID:25152696
Yu, Qingfen; Ye, Wei; Wang, Wei; Chen, Hai-Feng
2013-01-01
The transactivation domain (TAD) of tumor suppressor p53 can bind with the nuclear coactivator binding domain (NCBD) of cyclic-AMP response element binding protein (CBP) and activate transcription. NMR experiments demonstrate that both apo-NCBD and TAD are intrinsic disordered and bound NCBD/TAD undergoes a transition to well folded. The recognition mechanism between intrinsic disordered proteins is still hotly debated. Molecular dynamics (MD) simulations in explicit solvent are used to study the recognition mechanism between intrinsic disordered TAD and NCBD. The average RMSD values between bound and corresponding apo states and Kolmogorov-Smirnov P test analysis indicate that TAD and NCBD may follow an induced fit mechanism. Quantitative analysis indicates there is also a global conformational selection. In summary, the recognition of TAD and NCBD might obey a local induced fit and global conformational selection. These conclusions are further supported by high-temperature unbinding kinetics and room temperature landscape analysis. These methods can be used to study the recognition mechanism of other intrinsic disordered proteins. PMID:23555731
A stapled p53 helix overcomes HDMX-mediated suppression of p53.
Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D
2010-11-16
Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.
Yoshida, Midori; Katsuda, Shin-ichi; Maekawa, Akihiko
2012-01-01
Involvements of estrogen receptor (ER)α, proliferating cell nuclear antigen (PCNA) and p53 in the uterine carcinogenesis process in Donryu rats, a high yield strain of the uterine cancer were investigated immunohistochemically. ERα was expressed in atypical endometrial hyperplasia, accepted as a precancerous lesion of the uterine tumors, as well as well- and in moderately-differentiated endometrial adenocarcinomas, and the intensities of expression were similar to those in the luminal epithelial cells of the atrophic uterus at 15 months of age. The expression, however, was negative in the tumor cells of poorly differentiated type. Good growth of implanted grafts of the poorly-differentiated adenocarcinomas in both sexes with or without gonadectomy supported the estrogen independency of tumor progression to malignancy. PCNA labeling indices were increased with tumor development from atypical hyperplasia to adenocarcinoma. The tumor cells in poorly-differentiated adenocarcinomas were positive for p53 positive but negative for p21 expression, suggesting accumulation of mutated p53. These results indicate that the consistent ERα expression is involved in initiation and promotion steps of uterine carcinogenesis, but not progression. In addition, PCNA is related to tumor development and the expression of mutated p53 might be a late event during endometrial carcinogenesis. PMID:23345926
Baldelli, Sara; Ciriolo, Maria Rosa
2016-12-20
p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress.
Baldelli, Sara; Ciriolo, Maria Rosa
2016-01-01
p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress. PMID:28025407
Nuclear TP53: An unraveled function as transcriptional repressor of PINK1.
Checler, Frédéric; Goiran, Thomas; Alves da Costa, Cristine
2018-05-11
The tumor suppressor TP53/p53 is a key protein in both neurodegenerative diseases and cancer. Thus, TP53-linked cell death appears exacerbated in several age-related neuropathologies, while TP53 mutation-associated phenotypes indicate a loss of function accounting for approximately half of cancers. Thus, TP53 plays a pivotal role in these phenotypically distinct pathologies, a hypothesis reinforced by recent epidemiological studies suggesting an opposite risk to develop one type of pathology relative to the other. Dysfunctions in mitophagic processes also occur in both types of pathologies and again, TP53 has been proposed as one of the regulators of this cellular process. The consensus view postulates that TP53 exerts both anti- and pro-autophagy functions that are directly driven by a specific subcellular localization. Thus, TP53 positively modulates autophagy via the transcriptional control of several genes while it is acknowledged that its anti-autophagy phenotype is exclusively linked to a transcription-independent cytosolic control of an AMPK-MTOR cascade. Our study indicates that TP53 can also downregulate the specialized autophagy-related mitophagy response via the transcriptional repression of PINK1. This is the first demonstration of an anti-mitophagic control by nuclear TP53.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology
Prognostic significance of p16INK4a/p53 in Tunisian patients with breast carcinoma.
Karray-Chouayekh, Sondes; Baccouche, Sami; Khabir, Abdelmajid; Sellami-Boudawara, Tahia; Daoud, Jamel; Frikha, Mounir; Jlidi, Rachid; Gargouri, Ali; Mokdad-Gargouri, Raja
2011-09-01
Infiltrating ductal carcinoma (IDC) of the breast is a result of genetic alterations that affect the regulation of the cell cycle check-point and apoptosis. The aim of the present study was analysis using immunohistochemical localization of mouse double minute-2 (mdm2), p16INK4a, p53, bax and bcl-2 markers in Tunisian patients with breast IDC and to determine if there was correlation with the major clinico-pathological parameters and with survival of patients. We showed that the expression of p53, p16INK4a, mdm2, bcl-2, and bax was observed in 46.3%, 20.7%, 38%, 50% and 11.9% of cases, respectively. Statistical analysis revealed that positive expression of mdm2 was associated with larger tumors (P=0.013), whereas bax positivity was more prevalent in younger patients and in tumors of smaller size (P=0.008 and P=0.012 respectively). Furthermore, the expression of p16INK4a correlated with advanced grade (P<0.0001), triple negative tumors (ER-/PR-/HER2-, P=0.001) and mdm2 expression (P=0.017). The absence of nuclear p53 accumulation was predictive of good prognosis as well as when it was associated with negative expression of p16INK4a. Our findings suggest that among the biomarkers tested, p16INK4a might have a useful clinical and prognostic significance in infiltrating ductal carcinoma of the breast. Copyright © 2010 Elsevier GmbH. All rights reserved.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
1994-01-01
Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have
Regulation of p53 Stability and Apoptosis by a ROR Agonist
Wang, Yongjun; Solt, Laura A.; Kojetin, Douglas J.; Burris, Thomas P.
2012-01-01
Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer. PMID:22509368
Regulation of p53 stability and apoptosis by a ROR agonist.
Wang, Yongjun; Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P
2012-01-01
Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Yamamoto, Toshiyuki; Nishioka, Kiyoshi
2005-05-01
Systemic sclerosis (SSc) is a connective tissue disorder characterized by excessive deposition of extracellular matrix in the affected skin as well as various internal organs, vascular injury and immune abnormality; however, the etiology of SSc remains still unknown. We previously established an experimental mouse model for scleroderma by repeated local injections of bleomycin, a DNA damaging agent. In this study, we examined the induction of apoptosis and the expression of p53, p21 (Waf1/Cip1), and proliferating cell nuclear antigen (PCNA) in the lesional skin following bleomycin exposure in this model. Dermal sclerosis was induced by alternate day's injections of bleomycin for 4 weeks. TUNEL assay showed that apoptotic cells began to appear at 1 week after bleomycin exposure, and were prominently detected at 3-4 weeks. Immunohistochemical examination showed increased expression of p53 and p21 mainly in the infiltrating mononuclear cells at 2 weeks after bleomycin treatment. Bleomycin treatment markedly enhanced PCNA expression at 1-2 weeks, mainly in mesenchyme, as compared with control phosphate buffered saline treatment. Reverse transcriptase-polymerase chain reaction analysis showed that the expression of p53 and p21 mRNA was concurrently upregulated at 1-2 weeks after bleomycin treatment. Taken together, coordinate increased levels of p53 and p21 preceded the maximal induction of apoptosis and dermal sclerosis. Our findings suggest that apoptotic processes are involved in the pathophysiology of bleomycin-induced scleroderma, which may be mediated, in part, by the upregulation of p53 and p21.
Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele
2009-04-15
The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.
Felix, A; El-Naggar, A K; Press, M F; Ordonez, N G; Fonseca, I; Tucker, S L; Luna, M A; Batsakis, J G
1996-06-01
Salivary duct carcinoma (SDC), a rare neoplasm of the major salivary glands, is a high-grade carcinoma with a predilection for elderly men. The authors investigated the prognostic role of p53, c-erbB2, proliferating cell nuclear antigen (PCNA), and DNA flow cytometry in a pathobiological evaluation of a cohort of 30 patients with these neoplasms. The patient group comprised 24 men and 6 women, with ages ranging from 22 to 87 years (mean = 61 years). Twenty-eight tumors were located in the parotid gland and two in the submandibular gland. Tumor size ranged from 1.0 to 8.0 cm (mean = 3.48 cm). Regional metastases were found in 73.3% (22 patients), systemic metastases in 43.3% (13 patients), and recurrences in 8 (26.6%) patients. DNA aneuploidy was found in 18 tumors (58.0%) and DNA diploidy in 12 (42%), with proliferative fractions ranging from 8.60% to 15.5 (mean = 10.6%). p53 protein nuclear immunostaining was positive in 56.6% and c-erbB2 overexpression was observed in 63% of the tumors. PCNA positivity ranged from 16.5% to 91.0%, with a mean of 49.5%. p53 immunopositivity, DNA aneuploidy, high growth, and proliferative fractions by PCNA and flow cytometry did not correlate with patient outcome. These results indicate that tumor size (P = .05), distant metastasis (P = .006), and C-erbB2 amplification (P = .04) are independent prognostic parameters in patients with salivary duct carcinoma.
Nuclear localisation of 53BP1 is regulated by phosphorylation of the nuclear localisation signal.
von Morgen, Patrick; Lidak, Tomas; Horejsi, Zuzana; Macurek, Libor
2018-06-01
Repair of damaged DNA is essential for maintaining genomic stability. TP53-binding protein 1 (53BP1) plays an important role in repair of the DNA double-strand breaks. Nuclear localisation of 53BP1 depends on importin β and nucleoporin 153, but the type and location of 53BP1 nuclear localisation signal (NLS) have yet to be determined. Here, we show that nuclear import of 53BP1 depends on two basic regions, namely 1667-KRK-1669 and 1681-KRGRK-1685, which are both needed for importin binding. Lysine 1667 is essential for interaction with importin and its substitution to arginine reduced nuclear localisation of 53BP1. Furthermore, we have found that CDK1-dependent phosphorylation of 53BP1 at S1678 impairs importin binding during mitosis. Phosphorylation-mimicking mutant S1678D showed reduced nuclear localisation, suggesting that phosphorylation of the NLS interferes with nuclear import of the 53BP1 CONCLUSIONS: We show that 53BP1 contains a classical bipartite NLS 1666-GKRKLITSEEERSPAKRGRKS-1686, which enables the importin-mediated nuclear transport of 53BP1. Additionally, we found that posttranslational modification within the NLS region can regulate 53BP1 nuclear import. Our results indicate that integrity of the NLS is important for 53BP1 nuclear localisation. Precise mapping of the NLS will facilitate further studies on the effect of posttranslational modifications and somatic mutations on the nuclear localisation 53BP1 and DNA repair. © 2018 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.
Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K
2017-10-01
Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (<5 cm) tumour) were recruited. The gene products of c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p < 0.0001) in the positivity rate of c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neboori, Hanmanth J.R.; Haffty, Bruce G., E-mail: hafftybg@umdnj.edu; Wu Hao
2012-08-01
Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log-rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence-free survival (IBRFS), distant metastasis-free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survivalmore » (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their
The p53 breast cancer tissue biomarker in Indian women
Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev
2011-01-01
Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177
INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.
2007-01-01
Introgen and its wholly owned European subsidiary Gendux AB are developing an adenoviral p53 gene therapy as a treatment for cancer in the US and Europe, respectively. Phase III trials in patients with head and neck cancer are ongoing, and a number of clinical trials in other cancer indications have been completed. INGN 201 is being reviewed by the EMEA for approval in Li-Fraumeni syndrome (LFS) under the provisions of exceptional circumstance; the therapy is available on a compassionate use basis to eligible LFS cancer patients under a protocol authorised by the US FDA. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. The p53 protein is one of the most intricate elements in the apoptotic signalling cascade, and a mutation in the gene encoding it is believed to result in a decreased ability of a cell to apoptose. Thus replacing this gene via adenovirally-mediated p53 gene therapy is hoped to result in increased apoptosis where it is administered.INGN 201 is available for licensing, although Introgen favours retaining partial or full rights to the therapy in the US. Introgen entered into a license agreement with The University of Texas System and MD Anderson Cancer Center in 1994. The technologies licenced include p53 and fus1 (INGN 401). The collaboration has yielded exclusive patent and licensing rights to numerous technologies. Introgen entered into a collaboration with Rhône-Poulenc Rorer Pharmaceuticals (now sanofi-aventis) to develop therapeutics based on p53 inhibition in October 1994. However, in June 2001 this relationship was restructured and Introgen assumed responsibility for the worldwide development of all p53 products including INGN 201, and acquired all marketing and commercialisation rights with respect to those products. Introgen initiated two phase III trials in head and neck cancer (in June 2000 and May 2001) at about 80 sites in the US, Canada and Europe
Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.
La Perle, K M; Jhiang, S M; Capen, C C
2000-08-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice =28 weeks of age or p53-/- mice = 17 weeks of age; however, an older (170-day-old) male p53-/- mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas.
Binding of Y-P30 to Syndecan 2/3 Regulates the Nuclear Localization of CASK
Landgraf, Peter; Mikhaylova, Marina; Macharadze, Tamar; Borutzki, Corinna; Zenclussen, Ana-Claudia; Wahle, Petra; Kreutz, Michael R.
2014-01-01
The survival promoting peptide Y-P30 has documented neuroprotective effects as well as cell survival and neurite outgrowth promoting activity in vitro and in vivo. Previous work has shown that multimerization of the peptide with pleiotrophin (PTN) and subsequent binding to syndecan (SDC) -2 and -3 is involved in its neuritogenic effects. In this study we show that Y-P30 application regulates the nuclear localization of the SDC binding partner Calcium/calmodulin-dependent serine kinase (CASK) in neuronal primary cultures during development. In early development at day in vitro (DIV) 8 when mainly SDC-3 is expressed supplementation of the culture medium with Y-P30 reduces nuclear CASK levels whereas it has the opposite effect at DIV 18 when SDC-2 is the dominant isoform. In the nucleus CASK regulates gene expression via its association with the T-box transcription factor T-brain-1 (Tbr-1) and we indeed found that gene expression of downstream targets of this complex, like the GluN2B NMDA-receptor, exhibits a corresponding down- or up-regulation at the mRNA level. The differential effect of Y-P30 on the nuclear localization of CASK correlates with its ability to induce shedding of the ectodomain of SDC-2 but not -3. shRNA knockdown of SDC-2 at DIV 18 and SDC-3 at DIV 8 completely abolished the effect of Y-P30 supplementation on nuclear CASK levels. During early development a protein knockdown of SDC-3 also attenuated the effect of Y-P30 on axon outgrowth. Taken together these data suggest that Y-P30 can control the nuclear localization of CASK in a SDC-dependent manner. PMID:24498267
Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C
2014-01-01
In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616
Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas
La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.
2000-01-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169
Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73
NASA Astrophysics Data System (ADS)
Zhang, Heng; Wu, Shengnan
2011-01-01
p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo
2017-12-01
Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence
Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues
2015-01-01
Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773
PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.
Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues
2015-11-17
Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.
Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan
Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less
p53 AND MDM2 PROTEIN EXPRESSION IN ACTINIC CHEILITIS
de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida
2008-01-01
Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia. PMID:19082401
p53 and MDM2 protein expression in actinic cheilitis.
de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida
2008-01-01
Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia.
The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential
Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre
2015-01-01
Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205
Combined radiation and p53 gene therapy of malignant glioma cells.
Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A
1999-01-01
More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We
Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A
1998-01-01
A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Finlay, C.A.; Hinds, P.W.; Tan, T.H.
1988-02-01
The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less
MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.
Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M
2018-04-17
The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.
Nguyen, Kim; Parry, Jesse J.; Rogers, Buck E.; Anderson, Carolyn J.
2011-01-01
Objectives Radiolabeled somatostatin analogs have become important agents for molecular imaging and targeted radiotherapy of somatostatin receptor-positive tumors. Here we determine the effect of the tumor suppressor protein, p53, on trafficking 64Cu to tumor cell nuclei from DOTA vs.CB-TE2A-conjugated agonist Y3-TATE and the antagonist 64Cu-CB-TE2A-sst2-ANT in cell lines that are positive or negative for p53. Methods Receptor binding, internalization, cAMP and nuclear localization studies were performed with the SSTr2 agonists, 64Cu-CB-TE2A-Y3-TATE and 64Cu-DOTA-Y3-TATE vs. antagonist, 64Cu-CB-TE2A-sst2-ANT, in SSTr2-transfected p53 +/+ and −/− HCT116 colorectal carcinoma cells. Results The antagonist, 64Cu-CB-TE2A-sst2-ANT, bound 8-9-fold more SSTr2 binding sites than did the 64Cu-labeled agonists. 64Cu-CB-TE2A-Y3-TATE was more efficiently internalized than 64Cu-DOTA-Y3-TATE, while 64Cu-CB-TE2A-sst2-ANT showed lower, yet significant levels of internalization. CB-TE2A-Y3-TATE acted as a full agonist, inhibiting cAMP production, whereas CB-TE2A-sst2-ANT showed no inhibition of cAMP production.The 64Cu from agonists 64Cu-DOTA-Y3-TATE and 64Cu-CB-TE2A-Y3-TATE showed greater nuclear localization at 24 h in p53 +/+ vs. −/− cells; however, there was no difference in the levels of 64Cu from the antagonist based on p53 status. Surprisingly, the DOTA and CB-TE2A-conjugated agonists showed similar nuclear localization in the p53 +/+ and −/− cells, suggesting no difference in 64Cu release from these chelators in the HCT116 cell lines. Conclusion Based on thesein vitro data, the agonist 64Cu-CB-TE2A-Y3-TATE demonstrated the most promise as an agent for targeted radiotherapy in p53 positive, SSTr2-positive tumors. PMID:22056254
Dang, Van-Dinh; Levin, Henry L.
2000-01-01
Retroviruses, such as human immunodeficiency virus, that infect nondividing cells generate integration precursors that must cross the nuclear envelope to reach the host genome. As a model for retroviruses, we investigated the nuclear entry of Tf1, a long-terminal-repeat-containing retrotransposon of the fission yeast Schizosaccharomyces pombe. Because the nuclear envelope of yeasts remains intact throughout the cell cycle, components of Tf1 must be transported through the envelope before integration can occur. The nuclear localization of the Gag protein of Tf1 is different from that of other proteins tested in that it has a specific requirement for the FXFG nuclear pore factor, Nup124p. Using extensive mutagenesis, we found that Gag contained three nuclear localization signals (NLSs) which, when included individually in a heterologous protein, were sufficient to direct nuclear import. In the context of the intact transposon, mutations in the NLS that mapped to the first 10 amino acid residues of Gag significantly impaired Tf1 retrotransposition and abolished nuclear localization of Gag. Interestingly, this NLS activity in the heterologous protein was specifically dependent upon the presence of Nup124p. Deletion analysis of heterologous proteins revealed the surprising result that the residues in Gag with the NLS activity were independent from the residues that conveyed the requirement for Nup124p. In fact, a fragment of Gag that lacked NLS activity, residues 10 to 30, when fused to a heterologous protein, was sufficient to cause the classical NLS of simian virus 40 to require Nup124p for nuclear import. Within the context of the current understanding of nuclear import, these results represent the novel case of a short amino acid sequence that specifies the need for a particular nuclear pore complex protein. PMID:11003674
Dang, V D; Levin, H L
2000-10-01
Retroviruses, such as human immunodeficiency virus, that infect nondividing cells generate integration precursors that must cross the nuclear envelope to reach the host genome. As a model for retroviruses, we investigated the nuclear entry of Tf1, a long-terminal-repeat-containing retrotransposon of the fission yeast Schizosaccharomyces pombe. Because the nuclear envelope of yeasts remains intact throughout the cell cycle, components of Tf1 must be transported through the envelope before integration can occur. The nuclear localization of the Gag protein of Tf1 is different from that of other proteins tested in that it has a specific requirement for the FXFG nuclear pore factor, Nup124p. Using extensive mutagenesis, we found that Gag contained three nuclear localization signals (NLSs) which, when included individually in a heterologous protein, were sufficient to direct nuclear import. In the context of the intact transposon, mutations in the NLS that mapped to the first 10 amino acid residues of Gag significantly impaired Tf1 retrotransposition and abolished nuclear localization of Gag. Interestingly, this NLS activity in the heterologous protein was specifically dependent upon the presence of Nup124p. Deletion analysis of heterologous proteins revealed the surprising result that the residues in Gag with the NLS activity were independent from the residues that conveyed the requirement for Nup124p. In fact, a fragment of Gag that lacked NLS activity, residues 10 to 30, when fused to a heterologous protein, was sufficient to cause the classical NLS of simian virus 40 to require Nup124p for nuclear import. Within the context of the current understanding of nuclear import, these results represent the novel case of a short amino acid sequence that specifies the need for a particular nuclear pore complex protein.
Adiposity is associated with p53 gene mutations in breast cancer.
Ochs-Balcom, Heather M; Marian, Catalin; Nie, Jing; Brasky, Theodore M; Goerlitz, David S; Trevisan, Maurizio; Edge, Stephen B; Winston, Janet; Berry, Deborah L; Kallakury, Bhaskar V; Freudenheim, Jo L; Shields, Peter G
2015-10-01
Mutations in the p53 gene are among the most frequent genetic events in human cancer and may be triggered by environmental and occupational exposures. We examined the association of clinical and pathological characteristics of breast tumors and breast cancer risk factors according to the prevalence and type of p53 mutations. Using tumor blocks from incident cases from a case-control study in western New York, we screened for p53 mutations in exons 2-11 using the Affymetrix p53 Gene Chip array and analyzed case-case comparisons using logistic regression. The p53 mutation frequency among cases was 28.1 %; 95 % were point mutations (13 % of which were silent) and the remainder were single base pair deletions. Sixty seven percent of all point mutations were transitions; 24 % of them are G:C>A:T at CpG sites. Positive p53 mutation status was associated with poorer differentiation (OR, 95 % CI 2.29, 1.21-4.32), higher nuclear grade (OR, 95 % CI 1.99, 1.22-3.25), and increased Ki-67 status (OR, 95 % CI 1.81, 1.10-2.98). Cases with P53 mutations were more likely to have a combined ER-positive and PR-negative status (OR, 95 % CI 1.65, 1.01-2.71), and a combined ER-negative and PR-negative status (OR, 95 % CI 2.18, 1.47-3.23). Body mass index >30 kg/m(2), waist circumference >79 cm, and waist-to-hip ratio >0.86 were also associated with p53 status; obese breast cancer cases are more likely to have p53 mutations (OR, 95 % CI 1.78, 1.19-2.68). We confirmed that p53 mutations are associated with less favorable tumor characteristics and identified an association of p53 mutation status and adiposity.
Lai, R; el Dabbagh, L; Mourad, W A
1996-06-01
Neoplastic transformation can be associated with mutations of the p53 gene. This leads to stabilization of its protein product and to its accumulation, which allows immunohistochemical detection. Mutant p53 expression has been seen in many neoplasms, including renal cell carcinoma (RCC). We recently described putative precursor lesions of RCC. The lesions were defined as intratubular epithelial dysplasia (IED) of kidney tubules adjacent to RCC. They were seen in one-third of the cases studied. The findings were based only on light microscopic analysis. We hypothesized that neoplastic transformation would be manifested by mutant p53 expression in the kidney tubules adjacent to RCC and not in nonneoplastic kidneys. Immunohistochemical staining for p53 in 24 cases of RCC with adjacent kidneys was performed. We used the DO-7 monoclonal antibody reactive for the N-terminal of the p53 protein on formalin-fixed paraffin-embedded tissue. Sections from 14 kidneys resected for nonneoplastic conditions were used as controls. Twenty-one (87%) of the 24 cases of RCC had nuclear p53 expression in the tumor cells. This included 14 cases (58%) with intense reactivity and 7 cases (29%) with weaker p53 immunoreactivity. Of the 24 cases of RCC, IED was identified in 13 cases (54%). Immunoreactivity for p53 was focally seen in tubules of all the lesions, as well as in the nonlesional areas. Six of the lesions exhibited intense nuclear staining. The kidneys adjacent to the RCC, with no evidence of IED, showed focally intense positive p53 nuclear staining in four cases. None of the control specimens showed p53 expression. Our findings provide supportive evidence that previously described IED in kidneys adjacent to RCC are most likely precursor lesions of the neoplasm. Aberrant expression of p53 in areas without evidence of IED may suggest that neoplastic transformation manifested by p53 mutation in kidney tubules may be seen before the development of the morphologic features of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira
2013-10-01
X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the
Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2
Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja
2012-01-01
Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a
2014-01-01
Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be
p53 Involvement in the Control of Murine Hair Follicle Regression
Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.
2001-01-01
p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365
Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina
2013-01-01
The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961
Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry
Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.
2015-01-01
p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145
Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.
Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel
2016-04-12
p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.
Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M
1996-12-20
In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.
Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.
el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.
1997-01-01
We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405
Expression of p53, p21 and cyclin D1 in penile cancer: p53 predicts poor prognosis.
Gunia, Sven; Kakies, Christoph; Erbersdobler, Andreas; Hakenberg, Oliver W; Koch, Stefan; May, Matthias
2012-03-01
To evaluate the role of p53, p21 and cyclin D1 expression in patients with penile cancer (PC). Paraffin-embedded tissues from PC specimens from six pathology departments were subjected to a central histopathological review performed by one pathologist. The tissue microarray technique was used for immunostaining which was evaluated by two independent pathologists and correlated with cancer-specific survival (CSS). κ-statistics were used to assess interobserver variability. Uni- and multivariable Cox proportional hazards analysis was applied to assess the independent effects of several prognostic factors on CSS over a median of 32 months (IQR 6-66 months). Specimens and clinical data from 110 men treated surgically for primary PC were collected. p53 staining was positive in 30 and negative in 62 specimens. κ-statistics showed substantial interobserver reproducibility of p53 staining evaluation (κ=0.73; p<0.001). The 5-year CSS rate for the entire study cohort was 74%. Five-year CSS was 84% in p53-negative and 51% in p53-positive PC patients (p=0.003). Multivariable analysis showed p53 (HR=3.20; p=0.041) and pT-stage (HR=4.29; p<0.001) as independent significant prognostic factors for CSS. Cyclin D1 and p21 expression were not correlated with survival. However, incorporating p21 into a multivariable Cox model did contribute to improved model quality for predicting CSS. In patients with PC, the expression of p53 in the primary tumour specimen can be reproducibly assessed and is negatively associated with cancer specific survival.
Nup53 Is Required for Nuclear Envelope and Nuclear Pore Complex Assembly
Hawryluk-Gara, Lisa A.; Platani, Melpomeni; Santarella, Rachel
2008-01-01
Transport across the nuclear envelope (NE) is mediated by nuclear pore complexes (NPCs). These structures are composed of various subcomplexes of proteins that are each present in multiple copies and together establish the eightfold symmetry of the NPC. One evolutionarily conserved subcomplex of the NPC contains the nucleoporins Nup53 and Nup155. Using truncation analysis, we have defined regions of Nup53 that bind to neighboring nucleoporins as well as those domains that target Nup53 to the NPC in vivo. Using this information, we investigated the role of Nup53 in NE and NPC assembly using Xenopus egg extracts. We show that both events require Nup53. Importantly, the analysis of Nup53 fragments revealed that the assembly activity of Nup53 depleted extracts could be reconstituted using a region of Nup53 that binds specifically to its interacting partner Nup155. On the basis of these results, we propose that the formation of a Nup53–Nup155 complex plays a critical role in the processes of NPC and NE assembly. PMID:18256286
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun
2015-03-01
The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.
de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad
2016-01-01
O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830
Lee, Jeong Eun; Lim, Mi Sun; Park, Jae Hyeon; Park, Chang Hwan; Koh, Hyun Chul
2014-05-01
Chlorpyrifos (CPF) is one of the most widely used organophosphate insecticides with several harmful effects, including neurotoxicity. Although many studies have addressed the neurotoxicity induced by CPF, most data on neurodevelopmental damage was obtained from animal models. We are the first group to use human neural precursor cells (hNPCs) derived from human embryonic stem cells (hESCs) as a developing neuron model to evaluate the mechanisms involved in CPF-induced neurotoxicity. CPF was cytotoxic to these cells in a concentration-dependent manner, as shown by decreased cell viability and increased lactate dehydrogenase release. Furthermore, CPF reduced the expression of AKT and ERK proteins which are involved in intracellular survival pathways. Exposure of hNPCs to CPF led to the production of reactive oxygen species (ROS), and the antioxidant N-acetyl-cystein (NAC) attenuated ROS production induced by CPF. In addition, CPF increased cytochrome c release into the cytosol and activated caspase-9 and -3, indicating that cell death induced by CPF was due to apoptosis in hNPCs. Consistent with these findings, CPF treatment reduced the level of Bcl-2 protein and increased the level of Bax protein. Especially, CPF increased the translocation of BAX into the mitochondria. CPF also induced nuclear accumulation of NF-κB and p53 proteins in a concentration-dependent manner, and their inhibitors attenuated CPF-induced cytotoxicity. In addition, an inhibitor of NF-κB nuclear translocation blocked the increase of p53 in CPF-treated hNPCs. These findings show that CPF induced hNPCs death in part through NF-κB activation via ROS generation, enabling the interaction of p53 with Bcl-2 and Bax and subsequent release of cytochrome c. Collectively, these results represent a unique molecular characterization of CPF-induced cytotoxicity in hNPCs. These data suggest that CPF may affect neurodevelopment in a manner similar to that of several known and suspected neurotoxicants. Crown
Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut
2013-01-01
To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol−1 (15.1 kJ mol−1). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared
PML is a ROS sensor activating p53 upon oxidative stress
Soilihi, Hassane
2017-01-01
Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625
PML is a ROS sensor activating p53 upon oxidative stress.
Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues
2017-11-06
Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.
Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B
2017-01-01
PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I
ERIC Educational Resources Information Center
Seth, Rohit; Corniola, Rikki S.; Gower-Winter, Shannon D.; Morgan, Thomas J., Jr.; Bishop, Brian; Levenson, Cathy W.
2015-01-01
Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Che Mingxin; DeSilvio, Michelle; Pollack, Alan
2007-11-15
Purpose: The goal of this study was to verify the significance of p53 as a prognostic factor in Radiation Therapy Oncology Group 9202, which compared short-term androgen deprivation (STAD) with radiation therapy (RT) to long-term androgen deprivation + RT in men with locally advanced prostate cancer (Pca). Methods and Materials: Tumor tissue was sufficient for p53 analysis in 777 cases. p53 status was determined by immunohistochemistry. Abnormal p53 expression was defined as 20% or more tumor cells with positive nuclei. Univariate and multivariate Cox proportional hazards models were used to evaluate the relationships of p53 status to patient outcomes. Results:more » Abnormal p53 was detected in 168 of 777 (21.6%) cases, and was significantly associated with cause-specific mortality (adjusted hazard ratio [HR] = 1.89; 95% confidence interval (CI) 1.14 - 3.14; p = 0.014) and distant metastasis (adjusted HR = 1.72; 95% CI 1.13-2.62; p = 0.013). When patients were divided into subgroups according to assigned treatment, only the subgroup of patients who underwent STAD + RT showed significant correlation between p53 status and cause-specific mortality (adjusted HR = 2.43; 95% CI = 1.32-4.49; p = 0.0044). When patients were divided into subgroups according to p53 status, only the subgroup of patients with abnormal p53 showed significant association between assigned treatment and cause-specific mortality (adjusted HR = 3.81; 95% CI 1.40-10.37; p = 0.0087). Conclusions: Abnormal p53 is a significant prognostic factor for patients with prostate cancer who undergo short-term androgen deprivation and radiotherapy. Long-term androgen deprivation may significantly improve the cause-specific survival for those with abnormal p53.« less
Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin
2014-03-18
Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.
[Interaction between p53 and MDM2 in human lung cancer cells].
Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J
2014-01-01
The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) - mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and
Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T
1999-06-01
The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.
Guo, Yunjun; Parry, Jesse J; Laforest, Richard; Rogers, Buck E; Anderson, Carolyn J
2013-09-01
Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with (64)Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti-epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. We previously showed that nuclear localization of (64)Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with (64)Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor-bearing mice, with and without cisplatin, which upregulates wild-type p53. Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and -/- (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of (64)Cu from (64)Cu-acetate and (64)Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor-bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Together, these data suggest that (64)Cu specifically delivered to epidermal growth factor receptor-positive tumors by cetuximab can suppress tumor growth despite the KRAS status and present
Guo, Yunjun; Parry, Jesse J.; Laforest, Richard; Rogers, Buck E.; Anderson, Carolyn J.
2014-01-01
Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with 64Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti–epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. Methods We previously showed that nuclear localization of 64Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with 64Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor–bearing mice, with and without cisplatin, which upregulates wild-type p53. Results Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and −/− (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of 64Cu from 64Cuacetate and 64Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor–bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Conclusion Together, these data suggest that 64Cu specifically delivered to epidermal growth factor receptor–positive tumors by cetuximab can suppress tumor growth despite the KRAS
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-01-01
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Lin, Feng; Gao, Li; Su, Zhenyu; Cao, Xiaofang; Zhan, Yuanbo; Li, Ying; Zhang, Bin
2018-07-01
Oral squamous cell carcinoma (OSCC), one of the 10 most common types of neoplasms in the US, constitutes ~90% of all cases of oral malignancies. Chemoresistance and metastasis are difficult to avoid during the course of treatment, leading to a poor prognosis and a high mortality rate for patients with OSCC. Autophagy, a critical conserved cellular process, has been reported to be highly associated with the regulation of chemoresistance and metastasis of cancer cells. The present study investigated the role of karyopherin α2 (KPNA2), a member of the importin α family, which may serve an important role in p53 nucleocytoplasmic transport in the process of OSCC autophagy. In the CAL‑27, SCC‑15 and Tca8113 OSCC cell lines, we observed that the downregulation of KPNA2 suppressed cell migration and cisplatin resistance, using wound‑healing, Transwell and CCK‑8 assays. Additionally, the results of western blot analysis and transmission electron microscopy (TEM) analysis indicated that the knockdown of KPNA2 inhibited autophagy. We confirmed that the inhibition of autophagy with anti‑autophagy agents decreased the migration and cisplatin resistance of OSCC cells. We hypothesized that the suppression of cell migration and cisplatin resistance induced by KPNA2 knockdown may be associated with the inhibition of autophagy. To identify the underlying mechanism, further experiments determined that KPNA2 affects the level of autophagy via regulating the p53 nuclear import. Thus, the present study demonstrated that the function of KPNA2 in the process of autophagy may be p53‑dependent, and by regulating the translocation of p53, KPNA2 can support autophagy to promote the chemoresistance and metastasis of OSCC cells.
R248Q mutation--Beyond p53-DNA binding.
Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L
2015-12-01
R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.
Ok, Chi Young; Tzankov, Alexandar; Manyam, Ganiraju C.; Sun, Ruifan; Visco, Carlo; Zhang, Mingzhi; Montes-Moreno, Santiago; Dybkaer, Karen; Chiu, April; Orazi, Attilio; Zu, Youli; Bhagat, Govind; Richards, Kristy L.; Hsi, Eric D.; Choi, William W.L.; van Krieken, J. Han; Huh, Jooryung; Ponzoni, Maurilio; Ferreri, Andrés J.M.; Møller, Michael B.; Wang, Jinfeng; Parsons, Ben M.; Winter, Jane N.; Piris, Miguel A.; Pham, Lan V.; Medeiros, L. Jeffrey; Young, Ken H.
2015-01-01
Dysregulated NF-κB signaling is critical for lymphomagenesis. The regulation, function, and clinical relevance of c-Rel/NF-κB activation in diffuse large B-cell lymphoma (DLBCL) have not been well studied. In this study we analyzed the prognostic significance and gene-expression signature of c-Rel nuclear expression as surrogate of c-Rel activation in 460 patients with de novo DLBCL. Nuclear c-Rel expression, observed in 137 (26.3%) DLBCL patients frequently associated with extranoal origin, did not show significantly prognostic impact in the overall- or germinal center B-like-DLBCL cohort, likely due to decreased pAKT and Myc levels, up-regulation of FOXP3, FOXO3, MEG3 and other tumor suppressors coincided with c-Rel nuclear expression, as well as the complicated relationships between NF-κB members and their overlapping function. However, c-Rel nuclear expression correlated with significantly poorer survival in p63+ and BCL-2− activated B-cell-like-DLBCL, and in DLBCL patients with TP53 mutations. Multivariate analysis indicated that after adjusting clinical parameters, c-Rel positivity was a significantly adverse prognostic factor in DLBCL patients with wild type TP53. Gene expression profiling suggested dysregulations of cell cycle, metabolism, adhesion, and migration associated with c-Rel activation. In contrast, REL amplification did not correlate with c-Rel nuclear expression and patient survival, likely due to co-amplification of genes that negatively regulate NF-κB activation. These insights into the expression, prognostic impact, regulation and function of c-Rel as well as its crosstalk with the p53 pathway underscore the importance of c-Rel and have significant therapeutic implications. PMID:26324762
Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy.
Simon, Christian M; Dai, Ya; Van Alstyne, Meaghan; Koutsioumpa, Charalampia; Pagiazitis, John G; Chalif, Joshua I; Wang, Xiaojian; Rabinowitz, Joseph E; Henderson, Christopher E; Pellizzoni, Livio; Mentis, George Z
2017-12-26
The hallmark of spinal muscular atrophy (SMA), an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Yoneda-Kato, Noriko; Kato, Jun-Ya
2008-01-01
Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation.
Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M
2001-03-01
Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi Fuming; Saha, Abhik; Murakami, Masanao
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less
Sharma, Mayuri; Kamil, Jeremy P.; Coughlin, Margaret; Reim, Natalia I.
2014-01-01
Herpesvirus nucleocapsids traverse the nuclear envelope into the cytoplasm in a process called nuclear egress that includes disruption of the nuclear lamina. In several herpesviruses, a key player in nuclear egress is a complex of two proteins, whose homologs in human cytomegalovirus (HCMV) are UL50 and UL53. However, their roles in nuclear egress during HCMV infection have not been shown. Based largely on transfection studies, UL50 and UL53 have been proposed to facilitate disruption of the nuclear lamina by recruiting cellular protein kinase C (PKC), as occurs with certain other herpesviruses, and/or the viral protein kinase UL97 to phosphorylate lamins. To investigate these issues during HCMV infection, we generated viral mutants null for UL50 or UL53. Correlative light electron microscopic analysis of null mutant-infected cells showed the presence of intranuclear nucleocapsids and the absence of cytoplasmic nucleocapsids. Confocal immunofluorescence microscopy revealed that UL50 and UL53 are required for disruption of the nuclear lamina. A subpopulation of UL97 colocalized with the nuclear rim, and this was dependent on UL50 and, to a lesser extent, UL53. However, PKC was not recruited to the nuclear rim, and its localization was not affected by the absence of UL50 or UL53. Immunoprecipitation from cells infected with HCMV expressing tagged UL53 detected UL97 but not PKC. In summary, HCMV UL50 and UL53 are required for nuclear egress and disruption of nuclear lamina during HCMV infection, and they recruit UL97, not PKC, for these processes. Thus, despite the strong conservation of herpesvirus nuclear egress complexes, a key function can differ among them. PMID:24155370
Sharma, Mayuri; Kamil, Jeremy P; Coughlin, Margaret; Reim, Natalia I; Coen, Donald M
2014-01-01
Herpesvirus nucleocapsids traverse the nuclear envelope into the cytoplasm in a process called nuclear egress that includes disruption of the nuclear lamina. In several herpesviruses, a key player in nuclear egress is a complex of two proteins, whose homologs in human cytomegalovirus (HCMV) are UL50 and UL53. However, their roles in nuclear egress during HCMV infection have not been shown. Based largely on transfection studies, UL50 and UL53 have been proposed to facilitate disruption of the nuclear lamina by recruiting cellular protein kinase C (PKC), as occurs with certain other herpesviruses, and/or the viral protein kinase UL97 to phosphorylate lamins. To investigate these issues during HCMV infection, we generated viral mutants null for UL50 or UL53. Correlative light electron microscopic analysis of null mutant-infected cells showed the presence of intranuclear nucleocapsids and the absence of cytoplasmic nucleocapsids. Confocal immunofluorescence microscopy revealed that UL50 and UL53 are required for disruption of the nuclear lamina. A subpopulation of UL97 colocalized with the nuclear rim, and this was dependent on UL50 and, to a lesser extent, UL53. However, PKC was not recruited to the nuclear rim, and its localization was not affected by the absence of UL50 or UL53. Immunoprecipitation from cells infected with HCMV expressing tagged UL53 detected UL97 but not PKC. In summary, HCMV UL50 and UL53 are required for nuclear egress and disruption of nuclear lamina during HCMV infection, and they recruit UL97, not PKC, for these processes. Thus, despite the strong conservation of herpesvirus nuclear egress complexes, a key function can differ among them.
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
The Isoforms of the p53 Protein
Khoury, Marie P.; Bourdon, Jean-Christophe
2010-01-01
p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pasdeloup, David; Poisson, Nicolas; Raux, Helene
2005-04-10
Rabies virus P protein is a co-factor of the viral RNA polymerase. It has been shown previously that P mRNA directs the synthesis of four N-terminally truncated P products P2, P3, P4, and P5 due to translational initiation by a leaky scanning mechanism at internal Met codons. Whereas P and P2 are located in the cytoplasm, P3, P4, and P5 are found in the nucleus. Here, we have analyzed the molecular basis of the subcellular localization of these proteins. Using deletion mutants fused to GFP protein, we show the presence of a nuclear localization signal (NLS) in the C-terminal partmore » of P (172-297). This domain contains a short lysine-rich stretch ({sup 211}KKYK{sup 214}) located in close proximity with arginine 260 as revealed by the crystal structure of P. We demonstrate the critical role of lysine 214 and arginine 260 in NLS activity. In the presence of Leptomycin B, P is retained in the nucleus indicating that it contains a CRM1-dependent nuclear export signal (NES). The subcellular distribution of P deletion mutants indicates that the domain responsible for export is the amino-terminal part of the protein. The use of fusion proteins that have amino terminal fragments of P fused to {beta}-galactosidase containing the NLS of SV40 T antigen allows us to identify a NES between residues 49 and 58. The localization of NLS and NES determines the cellular distribution of the P gene products.« less
Expressions of p53 and p21 in primary gastric lymphomas.
Go, J. H.; Yang, W. I.
2001-01-01
The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353
Solomon, Monica Charlotte; Vidyasagar, M S; Fernandes, Donald; Guddattu, Vasudev; Mathew, Mary; Shergill, Ankur Kaur; Carnelio, Sunitha; Chandrashekar, Chetana
2016-12-01
Oral squamous cell carcinomas comprise a heterogeneous tumor cell population with varied molecular characteristics, which makes prognostication of these tumors a complex and challenging issue. Thus, molecular profiling of these tumors is advantageous for an accurate prognostication and treatment planning. This is a retrospective study on a cohort of primary locally advanced oral squamous cell carcinomas (n = 178) of an Indian rural population. The expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in a cohort of primary locally advanced oral squamous cell carcinomas was evaluated. A potential biomarker that can predict the tumor response to treatment was identified. Formalin-fixed paraffin-embedded tumor blocks of (n = 178) of histopathologically diagnosed cases of locally advanced oral squamous cell carcinomas were selected. Tissue microarray blocks were constructed with 2 cores of 2 mm diameter from each tumor block. Four-micron-thick sections were cut from these tissue microarray blocks. These tissue microarray sections were immunohistochemically stained for EGFR, p53, Bcl-2, cyclin D1 and p16. In this cohort, EGFR was the most frequently expressed 150/178 (84%) biomarker of the cases. Kaplan-Meier analysis showed a significant association (p = 0.038) between expression of p53 and a poor prognosis. A Poisson regression analysis showed that tumors that expressed p53 had a two times greater chance of recurrence (unadjusted IRR-95% CI 2.08 (1.03, 4.5), adjusted IRR-2.29 (1.08, 4.8) compared with the tumors that did not express this biomarker. Molecular profiling of oral squamous cell carcinomas will enable us to categorize our patients into more realistic risk groups. With biologically guided tumor characterization, personalized treatment protocols can be designed for individual patients, which will improve the quality of life of these patients.
Prm3p is a pheromone-induced peripheral nuclear envelope protein required for yeast nuclear fusion.
Shen, Shu; Tobery, Cynthia E; Rose, Mark D
2009-05-01
Nuclear membrane fusion is the last step in the mating pathway of the yeast Saccharomyces cerevisiae. We adapted a bioinformatics approach to identify putative pheromone-induced membrane proteins potentially required for nuclear membrane fusion. One protein, Prm3p, was found to be required for nuclear membrane fusion; disruption of PRM3 caused a strong bilateral defect, in which nuclear congression was completed but fusion did not occur. Prm3p was localized to the nuclear envelope in pheromone-responding cells, with significant colocalization with the spindle pole body in zygotes. A previous report, using a truncated protein, claimed that Prm3p is localized to the inner nuclear envelope. Based on biochemistry, immunoelectron microscopy and live cell microscopy, we find that functional Prm3p is a peripheral membrane protein exposed on the cytoplasmic face of the outer nuclear envelope. In support of this, mutations in a putative nuclear localization sequence had no effect on full-length protein function or localization. In contrast, point mutations and deletions in the highly conserved hydrophobic carboxy-terminal domain disrupted both protein function and localization. Genetic analysis, colocalization, and biochemical experiments indicate that Prm3p interacts directly with Kar5p, suggesting that nuclear membrane fusion is mediated by a protein complex.
Modulation of p53 cellular function and cell death by African swine fever virus.
Granja, Aitor G; Nogal, María L; Hurtado, Carolina; Salas, José; Salas, María L; Carrascosa, Angel L; Revilla, Yolanda
2004-07-01
Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells.
Modulation of p53 Cellular Function and Cell Death by African Swine Fever Virus
Granja, Aitor G.; Nogal, María L.; Hurtado, Carolina; Salas, José; Salas, María L.; Carrascosa, Angel L.; Revilla, Yolanda
2004-01-01
Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells. PMID:15194793
Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent
2013-01-01
We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J
2012-01-01
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
Morris, Gerwyn; Maes, Michael
2012-11-01
Fukuda's criteria are adequate to make a distinction between Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS) and chronic fatigue (CF), but ME/CFS patients should be subdivided into those with (termed ME) and without (termed CFS) post exertional malaise [Maes et al. 2012]. ME/CFS is considered to be a neuro-immune disease. ME/CFS is characterized by activated immuno-inflammatory pathways, including increased levels of pro-inflammatory cytokines, nuclear factor κB (NF-κB) and aberrations in mitochondrial functions, including lowered ATP. These processes may explain typical symptoms of ME/CFS, e.g. fatigue, malaise, hyperalgesia, and neurologic and autonomic symptoms. Here we hypothesize that increased NF-κB together with a loss of p53 are key phenomena in ME/CFS that further explain ME/CFS symptoms, such as fatigue and neurocognitive dysfunction, and explain ME symptoms, such as post-exertional malaise following mental and physical activities. Inactivation of p53 impairs aerobic mitochondrial functions and causes greater dependence on anaerobic glycolysis, elevates lactate levels, reduces mitochondrial density in skeletal muscle and reduces endurance during physical exercise. Lowered p53 and increased NF-κB are associated with elevated reactive oxygen species. Increased NF-κB induces the production of pro-inflammatory cytokines, which increase glycolysis and further compromise mitochondrial functions. All these factors together may contribute to mitochondrial exhaustion and indicate that the demand for extra ATP upon the commencement of increased activity cannot be met. In conditions of chronic inflammation and oxidative stress, high NF-κB and low p53 may conspire to promote neuron and glial cell survival at a price of severely compromised metabolic brain function. Future research should examine p53 signaling in ME/CFS. Copyright © 2012. Published by Elsevier Ltd.
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
41 CFR 109-45.309-53 - Nuclear-related or proliferation sensitive property.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Nuclear-related or proliferation sensitive property. 109-45.309-53 Section 109-45.309-53 Public Contracts and Property Management... Personal Property § 109-45.309-53 Nuclear-related or proliferation sensitive property. Nuclear-related or...
Yoneda-Kato, Noriko; Kato, Jun-ya
2008-01-01
Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation. PMID:17967869
Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe
2016-03-10
In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.
Chaperone-mediated autophagy degrades mutant p53
Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying
2013-01-01
Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohareer, Krishnaveni; Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046; Sahdev, Sudhir
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors,more » which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.« less
p53 improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.
Park, Joon-Young; Wang, Ping-Yuan; Matsumoto, Takumi; Sung, Ho Joong; Ma, Wenzhe; Choi, Jeong W; Anderson, Stasia A; Leary, Scot C; Balaban, Robert S; Kang, Ju-Gyeong; Hwang, Paul M
2009-09-25
Exercise capacity is a physiological characteristic associated with protection from both cardiovascular and all-cause mortality. p53 regulates mitochondrial function and its deletion markedly diminishes exercise capacity, but the underlying genetic mechanism orchestrating this is unclear. Understanding the biology of how p53 improves exercise capacity may provide useful insights for improving both cardiovascular as well as general health. The purpose of this study was to understand the genetic mechanism by which p53 regulates aerobic exercise capacity. Using a variety of physiological, metabolic, and molecular techniques, we further characterized maximum exercise capacity and the effects of training, measured various nonmitochondrial and mitochondrial determinants of exercise capacity, and examined putative regulators of mitochondrial biogenesis. As p53 did not affect baseline cardiac function or inotropic reserve, we focused on the involvement of skeletal muscle and now report a wider role for p53 in modulating skeletal muscle mitochondrial function. p53 interacts with Mitochondrial Transcription Factor A (TFAM), a nuclear-encoded gene important for mitochondrial DNA (mtDNA) transcription and maintenance, and regulates mtDNA content. The increased mtDNA in p53(+/+) compared to p53(-/-) mice was more marked in aerobic versus glycolytic skeletal muscle groups with no significant changes in cardiac tissue. These in vivo observations were further supported by in vitro studies showing overexpression of p53 in mouse myoblasts increases both TFAM and mtDNA levels whereas depletion of TFAM by shRNA decreases mtDNA content. Our current findings indicate that p53 promotes aerobic metabolism and exercise capacity by using different mitochondrial genes and mechanisms in a tissue-specific manner.
Polato, Federica; Rusconi, Paolo
2014-01-01
Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652
Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53
Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia
2015-01-01
Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255
Meng, Ning; Zhao, Jing; Su, Le; Zhao, Baoxiang; Zhang, Yun; Zhang, Shangli; Miao, Junying
2012-02-01
Lipopolysaccharide (LPS)-induced vascular endothelial cell (VEC) dysfunction is an important contributing factor in vascular diseases. Recently, we found that LPS impaired VEC by inducing autophagy. Our previous researches showed that a butyrolactone derivative, 3-benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one (3BDO) selectively protected VEC function. The objective of the present study is to investigate whether and how 3BDO inhibits LPS-induced VEC autophagic injury. Our results showed that LPS induced autophagy and led to increase of reactive oxygen species (ROS) and decrease of mitochondrial membrane potential (MMP) in Human umbilical vein vascular endothelial cells (HUVECs). Furthermore, LPS significantly increased p8 and p53 protein levels and the nuclear translocation of p53. All of these effects of LPS on HUVECs were strongly inhibited by 3BDO. Importantly, the ROS scavenger N-acetylcysteine (NAC) could inhibited LPS-induced autophagy and knockdown of p8 by RNA interference inhibited the autophagy, p53 protein level increase, the translocation of p53 into nuclei and the ROS level increase induced by LPS in HUVECs. The data suggested that 3BDO inhibited LPS-induced autophagy in HUVECs through inhibiting the ROS overproduction, the increase of p8 and p53 expression and the nuclear translocation of p53. Our findings provide a potential tool for understanding the mechanism underlying LPS-induced autophagy in HUVECs and open the door to a novel therapeutic drug for LPS-induced vascular diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.
Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent
2013-09-01
We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra
2017-09-29
p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
p53 mutations promote proteasomal activity.
Oren, Moshe; Kotler, Eran
2016-07-27
p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.
Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J
2005-12-08
TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.
Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.
Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel
2012-01-01
γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.
Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.
2017-01-01
Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158
Oksayan, Sibil; Wiltzer, Linda; Rowe, Caitlin L.; Blondel, Danielle; Jans, David A.; Moseley, Gregory W.
2012-01-01
Regulated nucleocytoplasmic transport of proteins is central to cellular function and dysfunction during processes such as viral infection. Active protein trafficking into and out of the nucleus is dependent on the presence within cargo proteins of intrinsic specific modular signals for nuclear import (nuclear localization signals, NLSs) and export (nuclear export signals, NESs). Rabies virus (RabV) phospho (P) protein, which is largely responsible for antagonising the host anti-viral response, is expressed as five isoforms (P1–P5). The subcellular trafficking of these isoforms is thought to depend on a balance between the activities of a dominant N-terminal NES (N-NES) and a distinct C-terminal NLS (C-NLS). Specifically, the N-NES-containing isoforms P1 and P2 are cytoplasmic, whereas the shorter P3–P5 isoforms, which lack the N-NES, are believed to be nuclear through the activity of the C-NLS. Here, we show for the first time that RabV P contains an additional strong NLS in the N-terminal region (N-NLS), which, intriguingly, overlaps with the N-NES. This arrangement represents a novel nuclear trafficking module where the N-NLS is inactive in P1 but becomes activated in P3, concomitant with truncation of the N-NES, to become the principal targeting signal conferring nuclear accumulation. Understanding this unique switch arrangement of overlapping, co-regulated NES/NLS sequences is vital to delineating the critical role of RabV P protein in viral infection. PMID:22700958
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.
Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi
2018-04-19
Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.
Mechanisms that enhance sustainability of p53 pulses.
Kim, Jae Kyoung; Jackson, Trachette L
2013-01-01
The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.
Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.
Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun
2014-07-23
The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K
2011-09-27
Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less
Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage
Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.
2009-01-01
Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133
Babar, Prasad H; Dey, Vishakha; Jaiswar, Praveen; Patankar, Swati
Many Plasmodium falciparum proteins do not share homology with, and are generally longer than their respective orthologs. This, to some extent, can be attributed to insertions. Here, we studied a P. falciparum RNA hypermethylase, trimethylguanosine synthase (PfTGS1) that harbors a 76 amino acid insertion in its methyltransferase domain. Bioinformatics analysis revealed that this insertion was present in TGS1 orthologs from other Plasmodium species as well. Interestingly, a classical nuclear localization signal (NLS) was predicted in the insertions of primate parasite TGS1 proteins. To check whether these predicted NLS are functional, we developed an in vivo heterologous system using S. cerevisiae. The predicted NLS when fused to dimeric GFP were able to localize the fusion protein to the nucleus in yeast indicating that it is indeed recognized by the yeast nuclear import machinery. We further showed that the PfTGS1 NLS binds to P. falciparum importin-α in vitro, confirming that the NLS is also recognized by the P. falciparum classical nuclear import machinery. Thus, in this study we report a novel function of the insertion in PfTGS1. Copyright © 2016 Elsevier B.V. All rights reserved.
p53-independent p21 induction by MELK inhibition.
Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun
2017-08-29
MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.
p53-independent p21 induction by MELK inhibition
Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun
2017-01-01
MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit
2017-01-01
Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454
p53 in pure epithelioid PEComa: an immunohistochemistry study and gene mutation analysis.
Bing, Zhanyong; Yao, Yuan; Pasha, Theresa; Tomaszewski, John E; Zhang, Paul J
2012-04-01
Pure epithelioid PEComa (PEP; so-called epithelioid angiomyolipoma) is rare and is more often associated with aggressive behaviors. The pathogenesis of PEP has been poorly understood. The authors studied p53 expression and gene mutation in PEPs by immunohistochemistry, single-strand conformation polymorphism, and direct sequencing in paraffin material from 8 PEPs. A group of classic angiomyolipomas (AMLs) were also analyzed for comparison. Five PEPs were from kidneys and 1 each from the heart, the liver, and the uterus. PEPs showed much stronger p53 nuclear staining (Allred score 6.4 ± 2.5) than the classic AML (2.3 ± 2.9) (P < .01). There was no p53 single-strand conformation polymorphism identified in either the PEPs or the 8 classic AMLs. p53 mutation analyses by direct sequencing of exons 5 to 9 showed 4 mutations in 3 of 8 PEPs but none in any of the 8 classic AMLs. The mutations included 2 missense mutations in a hepatic PEComa and 2 silent mutations in 2 renal PEPs. Both the missense mutations in the hepatic PEComa involved the exon 5, one involving codon 165, with change from CAG to CAC (coding amino acid changed from glutamine to histidine), and the other involving codon 182, with change from TGC to TAC (coding amino acid changed from cysteine to tyrosine). The finding of stronger p53 expression and mutations in epithelioid angiomyolipomas might have contributed to their less predictable behavior. However, the abnormal p53 expression cannot be entirely explained by p53 mutations in the exons examined in the PEPs.
Neoplasia of the ampulla of Vater. Ki-ras and p53 mutations.
Scarpa, A.; Capelli, P.; Zamboni, G.; Oda, T.; Mukai, K.; Bonetti, F.; Martignoni, G.; Iacono, C.; Serio, G.; Hirohashi, S.
1993-01-01
Eleven tumors of the ampulla of Vater (5 stage IV and 2 stage II adenocarcinomas, 1 stage II papillary carcinoma, 1 neuroendocrine carcinoma, and 2 adenomas, one with foci of carcinoma) were examined for Ki-ras and p53 gene mutations by single-strand conformation polymorphism analysis and direct sequencing of polymerase chain reaction-amplified DNA fragments. Ki-ras mutations were found in one adenocarcinoma and in the adenoma with foci of carcinoma, both involving mainly the intraduodenal bile duct component of the ampulla. Seven cases showed p53 gene mutations: four advanced-stage adenocarcinomas, the papillary carcinoma, the neuroendocrine carcinoma, and the adenoma with foci of carcinoma. Nuclear accumulation of p53 protein was immunohistochemically detected in the morphologically high-grade areas of the five cancers harboring a p53 gene missense point mutation. The adenomas, the two frame shift-mutated cancers, and the adenomatous and low-grade cancer areas of mutated carcinomas were immunohistochemically negative. Our data suggest that in ampullary neoplasia 1) p53 mutations are common abnormalities associated with the transformation of adenomas and low-grade cancers into morphologically high-grade carcinomas, and 2) Ki-ras mutations are relatively less frequent and might be restricted to tumors originating from the bile duct component of the ampulla. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8475992
Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika
2016-01-01
Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325
Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53
Murakami, Yohei; Takada, Shoji
2012-01-01
Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606
p53 mutation and expression in lymphoma.
Adamson, D. J.; Thompson, W. D.; Dawson, A. A.; Bennett, B.; Haites, N. E.
1995-01-01
Mutation and abnormal expression of p53 was studied in 38 lymphomas [five Hodgkin's disease and 33 non-Hodgkin's lymphoma (NHL)]. CM1 polyclonal antibody was used to detect overexpression of p53. Three missense mutations were characterised in three cases of NHL after screening exons 5-8 of p53 of all the tumours with single-strand conformation polymorphism (SSCP) analysis. Only two out of three tumours with a missense mutation showed abnormal expression of p53 as measured by CM1. Conversely, seven out of nine tumours with positive CM1 staining had no point mutation demonstrated. Overexpression of p53 in the cases of NHL occurred in three out of twenty four low-grade tumours and five out of nine high-grade tumours (Kiel classification). The results suggest that abnormalities of p53 are commoner in high-grade than low-grade NHL, and that positive immunocytochemistry cannot be used to determine which tumours have mutations of p53. Images Figure 1 Figure 2 PMID:7599045
Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G
2016-01-01
Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. The results obtained were analyzed using Spearman's Co-relation. The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found.
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
p53 genes function to restrain mobile elements
Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.
2016-01-01
Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264
Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan
2018-03-23
p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Sonntag, Eric; Wagner, Sabrina; Strojan, Hanife; Wangen, Christina; Lenac Rovis, Tihana; Lisnic, Berislav; Jonjic, Stipan; Schlötzer-Schrehardt, Ursula; Marschall, Manfred
2018-01-01
The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC) that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV) capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction. PMID:29342872
Milbradt, Jens; Sonntag, Eric; Wagner, Sabrina; Strojan, Hanife; Wangen, Christina; Lenac Rovis, Tihana; Lisnic, Berislav; Jonjic, Stipan; Sticht, Heinrich; Britt, William J; Schlötzer-Schrehardt, Ursula; Marschall, Manfred
2018-01-13
The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC) that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV) capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction.
Prodosmo, Andrea; Buffone, Amelia; Mattioni, Manlio; Barnabei, Agnese; Persichetti, Agnese; De Leo, Aurora; Appetecchia, Marialuisa; Nicolussi, Arianna; Coppa, Anna; Sciacchitano, Salvatore; Giordano, Carolina; Pinnarò, Paola; Sanguineti, Giuseppe; Strigari, Lidia; Alessandrini, Gabriele; Facciolo, Francesco; Cosimelli, Maurizio; Grazi, Gian Luca; Corrado, Giacomo; Vizza, Enrico; Giannini, Giuseppe; Soddu, Silvia
2016-09-06
Variant ATM heterozygotes have an increased risk of developing cancer, cardiovascular diseases, and diabetes. Costs and time of sequencing and ATM variant complexity make large-scale, general population screenings not cost-effective yet. Recently, we developed a straightforward, rapid, and inexpensive test based on p53 mitotic centrosomal localization (p53-MCL) in peripheral blood mononuclear cells (PBMCs) that diagnoses mutant ATM zygosity and recognizes tumor-associated ATM polymorphisms. Fresh PBMCs from 496 cancer patients were analyzed by p53-MCL: 90 cases with familial BRCA1/2-positive and -negative breast and/or ovarian cancer, 337 with sporadic cancers (ovarian, lung, colon, and post-menopausal breast cancers), and 69 with breast/thyroid cancer. Variants were confirmed by ATM sequencing. A total of seven individuals with ATM variants were identified, 5/65 (7.7 %) in breast cancer cases of familial breast and/or ovarian cancer and 2/69 (2.9 %) in breast/thyroid cancer. No variant ATM carriers were found among the other cancer cases. Excluding a single case in which both BRCA1 and ATM were mutated, no p53-MCL alterations were observed in BRCA1/2-positive cases. These data validate p53-MCL as reliable and specific test for germline ATM variants, confirm ATM as breast cancer susceptibility gene, and highlight a possible association with breast/thyroid cancers.
Rubbi, Carlos P.; Milner, Jo
2003-01-01
p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953
Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K
2001-07-20
Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.
Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun
2016-11-22
Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.
TRIM65 negatively regulates p53 through ubiquitination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yang; Ma, Chengyuan; Zhou, Tong
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less
Knockdown of zebrafish Fancd2 causes developmental abnormalities via p53-dependent apoptosis.
Liu, Ting Xi; Howlett, Niall G; Deng, Min; Langenau, David M; Hsu, Karl; Rhodes, Jennifer; Kanki, John P; D'Andrea, Alan D; Look, A Thomas
2003-12-01
Mechanisms underlying the multiple developmental defects observed in Fanconi anemia (FA) patients are not well defined. We have identified the zebrafish homolog of human FANCD2, which encodes a nuclear effector protein that is monoubiquitinated in response to DNA damage, targeting it to nuclear foci where it preserves chromosomal integrity. Fancd2-deficient zebrafish embryos develop defects similar to those found in children with FA, including shortened body length, microcephaly, and microophthalmia, which are due to extensive cellular apoptosis. Developmental defects and increased apoptosis in Fancd2-deficient zebrafish were corrected by injection of human FANCD2 or zebrafish bcl2 mRNA, or by knockdown of p53, indicating that in the absence of Fancd2, developing tissues spontaneously undergo p53-dependent apoptosis. Thus, Fancd2 is essential during embryogenesis to prevent inappropriate apoptosis in neural cells and other tissues undergoing high levels of proliferative expansion, implicating this mechanism in the congenital abnormalities observed in human infants with FA.
Saha, Shilpi; Bhattacharjee, Pushpak; Guha, Deblina; Kajal, Kirti; Khan, Poulami; Chakraborty, Sreeparna; Mukherjee, Shravanti; Paul, Shrutarshi; Manchanda, Rajkumar; Khurana, Anil; Nayak, Debadatta; Chakrabarty, Rathin; Sa, Gaurisankar; Das, Tanya
2015-08-01
Adverse side effects of chemotherapy during cancer treatment have shifted considerable focus towards therapies that are not only targeted but are also devoid of toxic side effects. We evaluated the antitumorigenic activity of sulphur, and delineated the molecular mechanisms underlying sulphur-induced apoptosis in non-small cell lung carcinoma (NSCLC) cells. A search for the underlying mechanism revealed that the choice between the two cellular processes, NFκBp65-mediated survival and p53-mediated apoptosis, was decided by the competition for a limited pool of transcriptional coactivator protein p300 in NSCLC cells. In contrast, sulphur inhibited otherwise upregulated survival signaling in NSCLC cells by perturbing the nuclear translocation of p65NFκB, its association with p300 histone acetylase, and subsequent transcription of Bcl-2. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic mitochondrial death cascade. Overall, the findings of this preclinical study clearly delineated the molecular mechanism underlying the apoptogenic effect of the non-toxic homeopathic remedy, sulphur, in NSCLC cells.
Görner, Wolfram; Durchschlag, Erich; Martinez-Pastor, Maria Teresa; Estruch, Francisco; Ammerer, Gustav; Hamilton, Barbara; Ruis, Helmut; Schüller, Christoph
1998-01-01
Msn2p and the partially redundant factor Msn4p are key regulators of stress-responsive gene expression in Saccharomyces cerevisiae. They are required for the transcription of a number of genes coding for proteins with stress-protective functions. Both Msn2p and Msn4p are Cys2His2 zinc finger proteins and bind to the stress response element (STRE). In vivo footprinting studies show that the occupation of STREs is enhanced in stressed cells and dependent on the presence of Msn2p and Msn4p. Both factors accumulate in the nucleus under stress conditions, such as heat shock, osmotic stress, carbon-source starvation, and in the presence of ethanol or sorbate. Stress-induced nuclear localization was found to be rapid, reversible, and independent of protein synthesis. Nuclear localization of Msn2p and Msn4p was shown to be correlated inversely to cAMP levels and protein kinase A (PKA) activity. A region with significant homologies shared between Msn2p and Msn4p is sufficient to confer stress-regulated localization to a SV40–NLS–GFP fusion protein. Serine to alanine or aspartate substitutions in a conserved PKA consensus site abolished cAMP-driven nuclear export and cytoplasmic localization in unstressed cells. We propose stress and cAMP-regulated intracellular localization of Msn2p to be a key step in STRE-dependent transcription and in the general stress response. PMID:9472026
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santhanam, U.; Ray, A.; Sehgal, P.B.
1991-09-01
The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less
Alvisi, Gualtiero; Ripalti, Alessandro; Ngankeu, Apollinaire; Giannandrea, Maila; Caraffi, Stefano G; Dias, Manisha M; Jans, David A
2006-10-01
The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 (ppUL44), is essential for viral replication. The C-terminal residues (amino acids 1220-1242) of pUL54 have been reported to be sufficient for ppUL44 binding in vitro. Although believed to be important for functioning in the nuclei of infected cells, no data are available on either the interaction of pUL54 with ppUL44 in living mammalian cells or the mechanism of pUL54 nuclear transport and its relationship with that of ppUL44. The present study examines for the first time the nuclear import pathway of pUL54 and its interaction with ppUL44 using dual color, quantitative confocal laser scanning microscopy on live transfected cells and quantitative gel mobility shift assays. We showed that of two nuclear localization signals (NLSs) located at amino acids 1153-1159 (NLSA) and 1222-1227 (NLSB), NLSA is sufficient to confer nuclear localization on green fluorescent protein (GFP) by mediating interaction with importin alpha/beta. We also showed that pUL54 residues 1213-1242 are sufficient to confer ppUL44 binding abilities on GFP and that pUL54 and ppUL44 can be transported to the nucleus as a complex. Our work thus identified distinct sites within the HCMV DNA polymerase, which represent potential therapeutic targets and establishes the molecular basis of UL54 nuclear import.
Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.
Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald
2017-06-01
p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p < 0.001). The p53 and Bcl-2 immunoreactivity was increased in aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less
Nieva, Jorge; Song, Byeong-Doo; Rogel, Joseph K.; Kujawara, David; Altobel, Lawrence; Izharrudin, Alicia; Boldt, Grant E.; Grover, Rajesh K.; Wentworth, Anita D.; Wentworth, Paul
2011-01-01
SUMMARY Epidemiologic and clinical evidence points to an increased risk of cancer when coupled with chronic inflammation. However, the molecular mechanisms that underpin this interrelationship remain largely unresolved. Herein we show that the inflammation-derived cholesterol 5,6-secosterol aldehydes, atheronal-A (KA) and –B (ALD), but not the PUFA-derived aldehydes 4-hydroxynonenal (HNE) and 4-hydroxyhexenal (HHE), induce misfolding of wild-type p53 into an amyloidogenic form that binds thioflavin T and Congo Red dyes but cannot bind to a consensus DNA sequence. Treatment of lung carcinoma cells with KA and ALD leads to a loss of function of extracted p53, as determined by analysis of extracted nuclear protein and in activation of p21. Our results uncover a plausible chemical link between inflammation and cancer and expands the already pivotal role of p53 dysfunction and cancer risk. PMID:21802012
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.
2011-01-01
The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641
Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena
2006-01-01
The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 42 Public Health 5 2013-10-01 2013-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 42 Public Health 5 2014-10-01 2014-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 42 Public Health 5 2010-10-01 2010-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 42 Public Health 5 2011-10-01 2011-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
42 CFR 482.53 - Condition of participation: Nuclear medicine services.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 42 Public Health 5 2012-10-01 2012-10-01 false Condition of participation: Nuclear medicine... HOSPITALS Optional Hospital Services § 482.53 Condition of participation: Nuclear medicine services. If the hospital provides nuclear medicine services, those services must meet the needs of the patients in...
Smoking, p53 Mutation, and Lung Cancer
Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.
2014-01-01
This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106
Romanenko, Alina; Lee, Chyi Chia R.; Yamamoto, Shinji; Hori, Taka‐aki; Wanibuchi, Hideki; Zaparin, Wadim; Vinnichenko, Wladimir; Vozianov, Alexander
1999-01-01
During the 11‐year period subsequent to the Chernobyl accident, the incidence of urinary bladder cancer in Ukraine has increased from 26.2 to 36.1 per 100,000 population. Cesium‐137 (137Cs) accounts for 80–90% of the incorporated radioactivity in this population, which has been exposed to long‐term, low‐dose ionizing radiation, and 80% of the more labile pool of cesium is excreted via the urine. The present study was performed to evaluate the histopathological features and the immunohistochemical status of p53, p21WAF1/Cip1, cyclin D1 and PCNA (proliferating cell nuclear antigen) in urinary bladder mucos a of 55 males (49‐92 years old) with benign prostatic hyperplasia who underwent surgery in Kiev, Ukraine, in 1995 and 1996. Group I (28 patients) inhabiting radiocontaminated areas of the country, group II (17 patients) from Kiev city with less radiocontamination and a control group III (10 patients) living in so‐called “clean” areas of Ukraine were compared. In groups I and II, an increase in multiple areas of moderate or severe dysplasia or carcinoma in situ was seen in 42 (93%) of 45 cases. In addi tion, two small transitional cell carcinomas were found in one patient in each of groups I and II. Nuclear accumulation of p53, PCNA, cyclin D1, and to a lesser extent p21WAF1/Cip1, was significantly increased in both groups I and II as compared with the control group III, indicating possible transformation events or enhancement of repair activities, that may precede the defect in the regulatory pathway itself, at least in the G1 phase of the cell cycle. Our results suggest that early malignant transformation is taking place in the bladder urothelium of people in the radiocontaminated areas of Ukraine and that this could possibly lead sometime in the future to an increased incidence of urinary bladder cancer. PMID:10189884
Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.
Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D
2016-10-01
TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.
Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma
Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie
2016-01-01
Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vergis, Roy; Corbishley, Catherine M.; Thomas, Karen
Purpose: Established prognostic factors in localized prostate cancer explain only a moderate proportion of variation in outcome. We analyzed tumor expression of apoptotic markers with respect to outcome in men with localized prostate cancer in two randomized controlled trials of radiotherapy dose escalation. Methods and Materials: Between 1995 and 2001, 308 patients with localized prostate cancer received neoadjuvant androgen deprivation and radical radiotherapy at our institution in one of two dose-escalation trials. The biopsy specimens in 201 cases were used to make a biopsy tissue microarray. We evaluated tumor expression of Bcl-2, p53, and MDM2 by immunohistochemistry with respect tomore » outcome. Results: Median follow-up was 7 years, and 5-year freedom from biochemical failure (FFBF) was 70.4% (95% CI, 63.5-76.3%). On univariate analysis, expression of Bcl-2 (p < 0.001) and p53 (p = 0.017), but not MDM2 (p = 0.224), was significantly associated with FFBF. Expression of Bcl-2 remained significantly associated with FFBF (p = 0.001) on multivariate analysis, independently of T stage, Gleason score, initial prostate-specific antigen level, and radiotherapy dose. Seven-year biochemical control was 61% vs. 41% (p = 0.0122) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-positive tumors and 87% vs. 81% (p = 0.423) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-negative tumors. There was no statistically significant interaction between dose and Bcl-2 expression. Conclusions: Bcl-2 expression was a significant, independent determinant of biochemical control after neoadjuvant androgen deprivation and radical radiotherapy for prostate cancer. These data generate the hypothesis that Bcl-2 expression could be used to inform the choice of radiotherapy dose in individual patients.« less
Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S; Kaneki, Masao
2014-11-11
Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson's disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. Copyright © 2014, American Association for the Advancement of Science.
Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E.; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S.; Kaneki, Masao
2015-01-01
Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-Nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson’s disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. PMID:25389371
Mapping of CIP/KIP inhibitors, G1 cyclins D1, D3, E and p53 proteins in the rat term placenta.
Korgun, Emin Turkay; Unek, Gozde; Herrera, Emilio; Jones, Carolyn J; Wadsack, Christian; Kipmen-Korgun, Dijle; Desoye, Gernot
2011-09-01
As cell cycle regulation is fundamental to the normal growth and development of the placenta, the aim of the present study was to determine the immunolocalizations of cell cycle related proteins, which have key roles in proliferation, differentiation and apoptosis during the development of the rat placenta. Here immunohistochemistry has been used to localize G1 cyclins (D1, D3, E), which are major determinants of proliferation, CIP/KIP inhibitors (p21, p27, p57), p53 as a master regulator and proliferating cell nuclear antigen in all cell types of the rat term placenta. The proportion of each cell type immunolabeled was counted. Cyclin D1 and cyclin D3 were present mostly in cells of the fetal aspect of the placenta, whereas the G1/S cyclin E was present only in the spongio- and labyrinthine trophoblast populations. Among the CIP/KIP inhibitors, p21 was present only in cells of the fetal aspect whereas p27 and p57 were found in all cell types studied. p53 was only found in a small proportion of cells with no co-localization of p53 and p21. The data suggest that the cells of the fetal side of the rat placenta still have some proliferation potential which is kept in check by expression of the CIP/KIP cell cycle inhibitors, whereas cells of the maternal aspect have lost this potential. Apoptosis is only marginal in the term rat placenta. In conclusion, proliferation and apoptosis in rat placental cells appears controlled mostly by the CIP/KIP inhibitors in late pregnancy.
System-based strategies for p53 recovery.
Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I
2018-06-01
The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.
Battle against cancer: an everlasting saga of p53.
Hao, Qian; Cho, William C
2014-12-01
Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua
2017-01-01
Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in “high-risk” category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01). In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands. PMID:28206977
Li, Qinglin; Huang, Ping; Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua
2017-04-25
Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in "high-risk" category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01).In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands.
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L
2018-05-31
The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Brownell, Sara E.; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F. Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S.; Stearns, Tim
2016-01-01
Abstract The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course‐based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students′ high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA‐binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161–178, 2017. PMID:27873457
Transcriptional specificity in various p53-mutant cells.
Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi
2013-03-01
Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.
Lorenz, Laurel D.; Rivera Cardona, Jessenia; Lambert, Paul F.
2013-01-01
The human papillomavirus DNA genome undergoes three distinct stages of replication: establishment, maintenance and amplification. We show that the HPV16 E6 protein is required for the maintenance of the HPV16 DNA genome as an extrachromosomal, nuclear plasmid in its natural host cell, the human keratinocyte. Based upon mutational analyses, inactivation of p53 by E6, but not necessarily E6-mediated degradation of p53, was found to correlate with the ability of E6 to support maintenance of the HPV16 genome as a nuclear plasmid. Inactivation of p53 with dominant negative p53 rescued the ability of HPV16 E6STOP and E6SAT mutant genomes to replicate as extrachromosomal genomes, though not to the same degree as observed for the HPV16 E6 wild-type (WT) genome. Inactivation of p53 also rescued the ability of HPV18 and HPV31 E6-deficient genomes to be maintained at copy numbers comparable to that of HPV18 and HPV31 E6WT genomes at early passages, though upon further passaging copy numbers for the HPV18 and 31 E6-deficient genomes lessened compared to that of the WT genomes. We conclude that inactivation of p53 is necessary for maintenance of HPV16 and for HPV18 and 31 to replicate at WT copy number, but that additional functions of E6 independent of inactivating p53 must also contribute to the maintenance of these genomes. Together these results suggest that re-activation of p53 may be a possible means for eradicating extrachromosomal HPV16, 18 or 31 genomes in the context of persistent infections. PMID:24204267
Cui, Hong; Ghosh, Santanu K; Jayaram, Makkuni
2009-04-20
The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1-STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a "partitioning center" represents yet another facet of the benign parasitism of the yeast plasmid.
Cui, Hong; Ghosh, Santanu K.
2009-01-01
The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1–STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a “partitioning center” represents yet another facet of the benign parasitism of the yeast plasmid. PMID:19364922
Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lieber, Charles S.; Department of Medicine, Mount Sinai School of Medicine, New York, NY 10029; Leo, Maria Anna
2008-08-22
Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-{gamma} coactivator1{alpha} (PGC-1{alpha}). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (pmore » = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1{alpha} hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5.« less
Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel
2008-12-01
Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.
The Role of JMY in p53 Regulation.
Adighibe, Omanma; Pezzella, Francesco
2018-05-31
Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.
A systematic review of p53 regulation of oxidative stress in skeletal muscle.
Beyfuss, Kaitlyn; Hood, David A
2018-12-01
transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2016-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena
2016-01-01
Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Involvement of stromal p53 in tumor-stroma interactions
Bar, Jair; Moskovits, Neta; Oren, Moshe
2009-01-01
p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385
Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X
2017-10-01
The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.
P53 Suppression of Homologous Recombination and Tumorigenesis
2013-01-01
absence or mutation of p53 and the mechanism of p53 control of HR in an in vivo system. p53 is often a targeted therapy and further insight into the...function of p53 in DNA repair pathways can be vital to finding novel points of targeted therapy . Our data will add insight to the important paradigm...cancers. Cisplatin works by the aquation of a chloride ligand that results in the formation of a DNA adduct, usually crosslinking the DNA, which impedes
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-08-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.
Zuckerbraun, Brian S; Shapiro, Richard A; Billiar, Timothy R; Tzeng, Edith
2003-08-19
The 42/44-kD mitogen-activated protein kinases (extracellular signal-regulated kinases, ERKs) regulate smooth muscle cell (SMC) cell-cycle progression and can either promote or inhibit proliferation depending on the activation status of the small GTPase RhoA. RhoA is involved in the regulation of the actin cytoskeleton and converges on multiple signaling pathways. However, the mechanism by which RhoA modulates ERK signaling is not well defined. The purpose of this investigation was to examine whether RhoA regulates ERK downstream signaling and cellular proliferation through its effects on the cytoskeleton and the nuclear localization of ERK. Treatment of SMCs with Clostridia botulinum C3 exoenzyme, which inhibits RhoA activation, decreased SMC proliferation to 24+/-7% of that of controls and increased p21Waf1/Cip1 transcription and protein levels. These effects of RhoA were reversed by inhibition of ERK phosphorylation. However, inactivation of RhoA did not alter levels of ERK phosphorylation but did increase nuclear localization of phosphorylated ERK. In addition, immunostaining demonstrated that phosphorylated ERK associated with the actin cytoskeleton, which was disrupted by C3 exoenzyme. Leptomycin B, an inhibitor of Crm1 that results in ERK nuclear accumulation, similarly increased p21Waf1/Cip1. RhoA inhibition increased levels of phosphorylated ERK in the cell nucleus. Inhibition of RhoA or pharmacological inhibition of nuclear export resulted in increased p21Waf1/Cip1 expression and decreased SMC proliferation, effects that were partially dependent on ERK. RhoA regulation of the actin cytoskeleton may determine ERK subcellular localization and its subsequent effects on SMC proliferation.
The Transcription Factor p53 Influences Microglial Activation Phenotype
Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.
2011-01-01
Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312
Sham, C L; To, K F; Chan, Paul K S; Lee, Dennis L Y; Tong, Michael C F; van Hasselt, C Andrew
2012-04-01
The purpose of this study of human papillomavirus (HPV), Epstein-Barr virus (EBV), p21, and p53 in sinonasal inverted papilloma (IP) was to help elucidate its pathogenesis. Seventy-three IPs, 48 nasal polyps, and 85 hypertrophied turbinates were subjected to HPV polymerase chain reaction (PCR) study. Seventy-three IPs, 30 nasal polyps, and 32 hypertrophied turbinates were subjected to EBV in situ hybridization (ISH), p21, and p53 immunohistochemical (IHC) studies. HPV was positive in 3 of 73 IPs (4.1%). All specimens were EBV negative. In all, 99% of IPs showed strong and diffuse p21 nuclear reactivity. Most nasal polyps and hypertrophied turbinates showed weak to moderate immunoreactivity of the basal and parabasal cells. Only focal p53 immunoreactivity of the basal and parabasal cells was found in 19% of IPs and 40% of nasal polyps. HPV prevalence of our IP is low. EBV is not present in IP. High p21 and low p53 expression in IP suggests a non-p53-dependent regulation pathway. Copyright © 2011 Wiley Periodicals, Inc.
Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio
2017-01-01
The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.
Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S
2000-01-01
Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko
2015-01-01
A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-01-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474
Amin, A R M Ruhul; Khuri, Fadlo R; Chen, Zhuo Georgia; Shin, Dong M
2009-06-01
We have previously reported that the green tea polyphenol epigallocatechin-3-gallate (EGCG) and the epidermal growth factor receptor-tyrosine kinase inhibitor erlotinib had synergistic growth-inhibitory effects in cell culture and a nude mouse xenograft model of squamous cell carcinoma of the head and neck. However, the mechanism of their antitumor synergism is not fully understood. In the current study, we investigate the mechanism of their synergistic growth-inhibitory effects. The treatment of squamous cell carcinoma of the head and neck cell lines with erlotinib time-dependently increased the expression of cell cycle regulatory proteins p21 and p27 and apoptosis regulatory protein Bim. EGCG alone had very little or no effect on the expression of these proteins among the cell lines. However, simultaneous treatment with EGCG and erlotinib strongly inhibited erlotinib-induced expression of p21 and p27 without affecting the expression of Bim. Moreover, erlotinib increased the expression of p53 protein, the ablation of which by short hairpin RNA strongly inhibited EGCG- and erlotinib-mediated growth inhibition and the expression of p21, p27, and Bim. In addition, combined treatment with erlotinib and EGCG inhibited the protein level of p65 subunit of nuclear factor-kappaB and its transcriptional target Bcl-2, but failed to do so in cells with ablated p53. Taken together, our results, for the first time, suggest that erlotinib treatment activates p53, which plays a critical role in synergistic growth inhibition by erlotinib and EGCG via inhibiting nuclear factor-kappaB signaling pathway. Characterizing the underlying mechanisms of EGCG and erlotinib synergism will provide an important rationale for chemoprevention or treatment trials using this combination.
Phosphorylation of p53 modifies sensitivity to ionizing radiation.
Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi
2011-06-01
Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.
p53 downregulates the Fanconi anaemia DNA repair pathway
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-01-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104
HIPK2 modulates p53 activity towards pro-apoptotic transcription.
Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella
2009-10-14
Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co
Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.
Garner, Elizabeth; Raj, Kenneth
2008-02-01
There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.
Oncoprotein p28 GANK binds to RelA and retains NF-kappaB in the cytoplasm through nuclear export.
Chen, Yao; Li, Hong Hai; Fu, Jing; Wang, Xue Feng; Ren, Yi Bin; Dong, Li Wei; Tang, Shan Hua; Liu, Shu Qing; Wu, Meng Chao; Wang, Hong Yang
2007-12-01
p28(GANK) (also known as PSMD10, p28 and gankyrin) is an ankyrin repeat anti-apoptotic oncoprotein that is commonly overexpressed in hepatocellular carcinomas and increases the degradation of p53 and Rb. NF-kappaB (nuclear factor-kappaB) is known to be sequestered in the cytoplasm by I kappaB (inhibitor of NF-kappaB) proteins, but much less is known about the cytoplasmic retention of NF-kappaB by other cellular proteins. Here we show that p28(GANK) inhibits NF-kappaB activity. As a nuclear-cytoplasmic shuttling protein, p28(GANK) directly binds to NF-kappaB/RelA and exports RelA from nucleus through a chromosomal region maintenance-1 (CRM-1) dependent pathway, which results in the cytoplasmic retention of NF-kappaB/RelA. We demonstrate that all the ankyrin repeats of p28(GANK) are required for the interaction with RelA and that the N terminus of p28(GANK), which contains the nuclear export sequence (NES), is responsible for suppressing NF-kappaB/RelA nuclear translocation. These results suggest that overexpression of p28(GANK) prevents the nuclear localization and inhibits the activity of NF-kappaB/RelA.
Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília
2016-01-01
Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173
Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo
2015-01-01
ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine
Super p53 for Treatment of Ovarian Cancer
2016-07-01
WSLP ( polymer ) has been successfully synthesized, and a subset of adenoviral constructs have been cloned (p53, p53-CC, EGFP control). Major results...therapy, carboplatin, paclitaxel, polymeric drug delivery, polymer -adenovirus hybrid 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18...modified p53, tumor suppressor, high grade serous carcinoma, combination therapy, carboplatin, paclitaxel, polymeric drug delivery, polymer
p73 coordinates with Δ133p53 to promote DNA double-strand break repair.
Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun
2018-03-06
Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.
Liu, Pei-Yao; Chan, James Yi-Hsin; Lin, Hsiu-Chen; Wang, Sung-Ling; Liu, Shu-Ting; Ho, Ching-Liang; Chang, Li-Chien; Huang, Shih-Ming
2008-07-01
Zac1 is a novel seven-zinc finger protein which possesses the ability to bind specifically to GC-rich DNA elements. Zac1 not only promotes apoptosis and cell cycle arrest but also acts as a transcriptional cofactor for p53 and a number of nuclear receptors. Our previous study indicated that the enhancement of p53 activity by Zac1 is much more pronounced in HeLa cells compared with other cell lines tested. This phenomenon might be due to the coactivator effect of Zac1 on p53 and the ability of Zac1 to reverse E6 inhibition of p53. In the present study, we showed that Zac1 acted synergistically with either p53 or a histone deacetylase inhibitor, trichostatin A, to enhance p21(WAF1/Cip1) promoter activity. We showed that Zac1 physically interacted with some nuclear receptor corepressors such as histone deacetylase 1 (HDAC1) and mSin3a, and the induction of p21(WAF1/Cip1) gene and protein by Zac1 was suppressed by either overexpressing HDAC1 or its deacetylase-dead mutant. In addition, our data suggest that trichostatin A-induced p21(WAF1/Cip1) protein expression might be mediated through a p53-independent and HDAC deacetylase-independent pathway. Taken together, our data suggest that Zac1 might be involved in regulating the p21(WAF1/Cip1) gene and protein expression through its protein-protein interaction with p53 and HDAC1 in HeLa cells.
Hekmat-Scafe, Daria S; Brownell, Sara E; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S; Stearns, Tim
2017-03-04
The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course-based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students' high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA-binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161-178, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.
Modeling the Etiology of p53-mutated Cancer Cells*
Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.
2016-01-01
p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024
Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena
2016-11-02
Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
MicroRNAs as Key Effectors in the p53 Network.
Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni
2017-01-01
The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.
Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M
2009-10-01
The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.
P53 Suppression of Homologous Recombination and Tumorigenesis
2011-01-01
huge strides have been made in the numbers of mice breed and relevant cells collected for the purposes of experiments outlined in the aims below. The PI... breeding colony of R172P, R172H, Wild type and p53 null mice in order to have sufficient numbers of animals to perform the in vivo pun assay. Mouse...Strains and Breeding Cohorts Mice heterozygous for the point mutations p53R172P and p53R172H both on a C57BL/6 genetic background were kindly
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke
1997-05-01
Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less
Immunohistochemical detection of p53 protein in ameloblastoma types.
el-Sissy, N A
1999-05-01
Overexpression of p53 protein in unicystic ameloblastoma (uAB) is denser than in the conventional ameloblastoma (cAB) type, indicating increased wild type p53--suppressing the growth potential of uAB and denoting the early event of neoplastic transformation, probably of a previous odontogenic cyst. Overexpression of p53 in borderline cAB and malignant ameloblastoma (mAB) types might reflect a mutational p53 protein playing an oncogenic role, promoting tumour growth. Overexpression of p53 protein could be a valid screening method for predicting underlying malignant genetic changes in AB types, through increased frequency of immunoreactive cells or increased staining density.
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Uo, Takuma; Veenstra, Timothy D.; Morrison, Richard S.
2009-01-01
Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and —independent intrinsic apoptotic programs require the pro-apoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing post-mitochondrial events including cleavage of caspase-9 and -3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions. PMID:19261878
Zn(II)-curc targets p53 in thyroid cancer cells.
Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella
2015-10-01
TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.
Immunological and biochemical evidence for nuclear localization of annexin in peas
NASA Technical Reports Server (NTRS)
Clark, G. B.; Dauwalder, M.; Roux, S. J.
1998-01-01
Immunofluorescent localization of annexins using an anti-pea annexin polyclonal antibody (anti-p35) in pea (Pisum sativum) leaf and stem epidermal peels showed staining of the nuclei and the cell periphery. Nuclear staining was also seen in cell teases prepared from pea plumules. The amount of nuclear stain was reduced both by fixation time and by dehydration and organic solvent treatment. Observation with confocal microscopy demonstrated that the anti-p35 stain was diffusely distributed throughout the nuclear structure. Immunoblots of purified nuclei, nuclear envelope matrix, nucleolar, and chromatin fractions showed a cross-reactive protein band of 35 kDa. These data are the first to show annexins localized in plant cell nuclei where they may play a role in nuclear function.
p53 suppresses hyper-recombination by modulating BRCA1 function
Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui
2015-01-01
Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908
Expression of C-terminal deleted p53 isoforms in neuroblastoma
Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha
2006-01-01
The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100
Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra
2008-07-01
To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.
p53 in breast cancer subtypes and new insights into response to chemotherapy.
Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues
2013-08-01
Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together
KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage
Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie
2017-01-01
Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943
Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi
2018-04-01
Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.
p53 -Dependent and -Independent Nucleolar Stress Responses
Olausson, Karl Holmberg; Nistér, Monica; Lindström, Mikael S.
2012-01-01
The nucleolus has emerged as a cellular stress sensor and key regulator of p53-dependent and -independent stress responses. A variety of abnormal metabolic conditions, cytotoxic compounds, and physical insults induce alterations in nucleolar structure and function, a situation known as nucleolar or ribosomal stress. Ribosomal proteins, including RPL11 and RPL5, become increasingly bound to the p53 regulatory protein MDM2 following nucleolar stress. Ribosomal protein binding to MDM2 blocks its E3 ligase function leading to stabilization and activation of p53. In this review we focus on a number of novel regulators of the RPL5/RPL11-MDM2-p53 complex including PICT1 (GLTSCR2), MYBBP1A, PML and NEDD8. p53-independent pathways mediating the nucleolar stress response are also emerging and in particular the negative control that RPL11 exerts on Myc oncoprotein is of importance, given the role of Myc as a master regulator of ribosome biogenesis. We also briefly discuss the potential of chemotherapeutic drugs that specifically target RNA polymerase I to induce nucleolar stress. PMID:24710530
Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panta, Sushil; Yamakuchi, Munekazu; Kagoshima University Hospital, Kagoshima
In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclearmore » localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β{sub 3}-integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β{sub 3}-integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β{sub 3}-integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β{sub 3}-integrin pathway in endothelial cells.« less
On p53 revival using system oriented drug dosage design.
Haseeb, Muhammad; Azam, Shumaila; Bhatti, A I; Azam, Rizwan; Ullah, Mukhtar; Fazal, Sahar
2017-02-21
We propose a new paradigm in the drug design for the revival of the p53 pathway in cancer cells. It is shown that the current strategy of using small molecule based Mdm2 inhibitors is not enough to adequately revive p53 in cancerous cells, especially when it comes to the extracting pulsating behavior of p53. This fact has come to notice when a novel method for the drug dosage design is introduced using system oriented concepts. As a test case, small molecule drug Mdm2 repressor Nutlin 3a is considered. The proposed method determines the dose of Nutlin to revive p53 pathway functionality. For this purpose, PBK dynamics of Nutlin have also been integrated with p53 pathway model. The p53 pathway is the focus of researchers for the last thirty years for its pivotal role as a frontline cancer suppressant protein due to its effect on cell cycle checkpoints and cell apoptosis in response to a DNA strand break. That is the reason for finding p53 being absent in more than 50% of tumor cancers. Various drugs have been proposed to revive p53 in cancer cells. Small molecule based drugs are at the foremost and are the subject of advanced clinical trials. The dosage design of these drugs is an important issue. We use control systems concepts to develop the drug dosage so that the cancer cells can be treated in appropriate time. We investigate by using a computational model how p53 protein responds to drug Nutlin 3a, an agent that interferes with the MDM2-mediated p53 regulation. The proposed integrated model describes in some detail the regulation network of p53 including the negative feedback loop mediated by MDM2 and the positive feedback loop mediated by Mdm2 mRNA as well as the reversible represses of MDM2 caused by Nutlin. The reported PBK dynamics of Nutlin 3a are also incorporated to see the full effect. It has been reported that p53 response to stresses in two ways. Either it has a sustained (constant) p53 response, or there are oscillations in p53 concentration. The
Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.
Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L
1999-12-01
The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy
Zhang, Jin; Chen, Xiangling; Kent, Michael S.; Rodriguez, Carlos O.; Chen, Xinbin
2009-01-01
Spontaneous tumors in the dog offer a unique opportunity as models to study human cancer etiology and therapy. p53, the most commonly mutated gene in human cancers, is found to be altered in dog cancers. However, little is known about the role of p53 in dog tumorigenesis. Here, we found that upon exposure to DNA damage agents or Mdm2 inhibitor nutlin-3, canine p53 is accumulated and capable of inducing its target genes, MDM2 and p21. We also found that upon DNA damage, canine p53 is accumulated in the nucleus, followed by MDM2 nuclear translocation and increased 53BP1 foci formation. In addition, we found that canine p63 and p73 are up-regulated by DNA damage agents. Furthermore, colony formation assay showed that canine tumor cells are sensitive to DNA damage agents and nutlin-3 in a p53-dependent manner. Surprisingly, canine p21 is expressed as two isoforms. Thus, we generated multiple canine p21 mutants and found that aa 129 to 142 is required, whereas aa 139 is one of the key determinants, for two p21 isoform expression. Finally, we showed that although the full-length human p21 cDNA expresses one polypeptide, aa 139 appears to play a similar role as that in canine p21 for various migration patterns. Taken together, our results indicate that canine p53 family proteins have biological activities similar to human counterparts. These similarities make the dog as an excellent out-bred spontaneous tumor model and the dog can serve as a translation model from bench-top to cage-side and then to bed-side. PMID:19147538
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less
Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function
Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.
2011-01-01
The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107
Mutant p53 dictates the oncogenic activity of c-Abl in triple-negative breast cancers
Morrison, Chevaun D; Chang, Jenny C; Keri, Ruth A; Schiemann, William P
2017-01-01
We recently established c-Abl as a potent suppressor of triple-negative breast cancer (TNBC) progression through its reactivation of a p53:p21 signaling axis coupled to senescence. Moreover, we observed co-expression of p53 and c-Abl to be essential for normal mammary epithelial cell physiology, as this relationship is lost upon breast cancer progression. Cytoplasmic c-Abl activity is markedly increased in some TNBCs and contributes to disease progression; however, the mechanisms underlying these events remain largely unknown. In addressing this question, we show here that c-Abl is predominantly restricted to the cytoplasm of human MDA-MB-231 TNBC cells, and to the nucleus of human MCF-7 luminal A cells. TTK is a mitotic protein kinase that phosphorylates c-Abl on Thr735, thereby creating a recognition binding motif for 14-3-3 adaptor proteins in response to oxidative stress. By interrogating the METABRIC database, we observed a significant correlation between p53 expression and that of c-Abl and TTK in basal-like breast cancers. Moreover, heterologous expression of TTK in MCF-7 cells significantly stimulated their growth in part via a c-Abl-dependent mechanism. Conversely, depleting TTK expression in MDA-MB-231 cells not only inhibited their organoid growth in 3D-cultures, but also sensitized them to the tumor suppressing activities of c-Abl independent of its subcellular localization. Moreover, we show that mutant p53 forms cytoplasmic complexes with c-Abl, thereby dictating the subcellular localization of c-Abl and the sensitivity of MDA-MB-231 cells to Imatinib. In response to nutrient deprivation, c-Abl:p53 complexes readily accumulate in the nucleus, resulting in the hyperactivation of c-Abl and initiation of its anti-tumor activities. Collectively, we identified a novel mutant p53:c-Abl cytoplasmic signaling complex that promotes MDA-MB-231 cell growth and highlights the contextual cues that confer oncogenic activity to c-Abl in breast cancer. PMID:28661474
Expression of P53 protein after exposure to ionizing radiation
NASA Astrophysics Data System (ADS)
Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.
2001-10-01
One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.
An adaptive molecular timer in p53-meidated cell fate decision
NASA Astrophysics Data System (ADS)
Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei
The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.
Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng
2011-02-11
The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.
Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*
Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng
2011-01-01
The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Ralhan, Ranju; Sandhya, Agarwal; Meera, Mathur; Bohdan, Wasylyk; Nootan, Shukla K.
2000-01-01
MDM2, a critical element of cellular homeostasis mechanisms, is involved in complex interactions with important cell-cycle and stress-response regulators including p53. The mdm2-P2 promoter is a transcriptional target of p53. The aim of this study was to determine the association between mdm2-P2 transcripts and the status of the p53 gene in betel- and tobacco-related oral squamous cell carcinomas (SCCs) to understand the mechanism of deregulation of MDM2 and p53 expression and their prognostic implications in oral tumorigenesis. Elevated levels of MDM2 proteins were observed in 11 of 25 (44%) oral hyperplastic lesions, nine of 15 (60%) dysplastic lesions, and 71 of 100 (71%) SCCs. The intriguing feature of the study was the identification and different subcellular localization of three isoforms of MDM2 (ie, 90 kd, 76 kd, and 57 kd) in oral SCCs and their correlation with p53 overexpression in each tumor. The hallmark of the study was the detection of mdm2-P2 transcripts in 12 of 20 oral SCCs overexpressing both MDM2 and p53 proteins while harboring wild-type p53 alleles. Furthermore, mdm2 amplification was an infrequent event in betel- and tobacco-associated oral tumorigenesis. The differential compartmentalization of the three isoforms of MDM2 suggests that each has a distinct function, potentially in the regulation of p53 and other gene products implicated in oral tumorigenesis. In conclusion, we report herein the first evidence suggesting that enhanced translation of mdm2-P2 transcripts (S-mdm2) may represent an important mechanism of overexpression and consequent stabilization and functional inactivation of wild-type p53 serving as an adverse prognosticator in betel- and tobacco-related oral cancer. The clinical significance of the functional inactivation of wild-type p53 by MDM2 is underscored by the significantly shorter median disease-free survival time (16 months) observed in p53/MDM2-positive cases as compared to those which did not show co-expression of
Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Jiawen; Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg; Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg
Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involvedmore » in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response
The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status.
Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer
2011-03-11
The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21- combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21- carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status.
NASA Technical Reports Server (NTRS)
Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)
1998-01-01
The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.
Dickinson, Douglas; Yu, Hongfang; Ohno, Seiji; Thomas, Cristina; DeRossi, Scott; Ma, Yat-Ho; Yates, Nicole; Hahn, Emily; Bisch, Frederick; Yamamoto, Tetsuya; Hsu, Stephen
2015-01-01
The submandibular salivary glands of non-obese diabetic (NOD) mice, a model for Sjogren’s syndrome and type-1 diabetes, show an elevated level of proliferating cell nuclear antigen (PCNA), a protein involved in cell proliferation and repair of DNA damage. We reported previously that epigallocatechin-3-gallate (EGCG), the most abundant green tea catechin, normalizes the PCNA level. PCNA’s activity can be regulated by the cyclin-dependent kinase inhibitor p21, which is also important for epithelial cell differentiation. In turn, expression of p21 and PCNA are partially regulated by Rb phosphorylation levels. EGCG was found to modulate p21 expression in epithelial cells, suggesting that EGCG-induced p21 could be associated with down-regulation of PCNA in vivo. The current study examined the protein levels of p21 and p53 (which can up-regulate p21) in NOD mice fed with either water or EGCG, and the effect of EGCG on p21 and p53 in cell line models with either normal or defective Rb. In NOD mice, the p21 level was low, and EGCG normalized it. In contrast to HSG cells with functional Rb, negligible expression of p21 in NS-SV-AC cells that lack Rb was not altered by EGCG treatment. Inhibition of p53 by siRNA demonstrated that p21 and p53 were induced independently in HSG cells by a physiological concentration range of EGCG, suggesting p53 could be an important but not conditional factor associated with p21 expression. In conclusion, PCNA and p21 levels are altered inversely in the NOD model for SS and in HSG cells, and warrant further study as candidate new markers for salivary dysfunction associated with xerostomia. Induction of p21 by EGCG could provide clinically useful normalization of salivary glands by promoting differentiation and reducing PCNA levels. PMID:24329914
p53 regulates the mevalonate pathway in human glioblastoma multiforme
Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M
2015-01-01
The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958
p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.
Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar
2017-06-23
Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication
Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra
2017-01-01
Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53–induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262
p53 Specifically Binds Triplex DNA In Vitro and in Cells
Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej
2016-01-01
Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
p53 as an Effector or Inhibitor of Therapy Response
Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues
2016-01-01
Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. PMID:26637438
The transcription factor p53: Not a repressor, solely an activator
Fischer, Martin; Steiner, Lydia; Engeland, Kurt
2014-01-01
The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
2010-01-01
Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557
Family matters: sibling rivalry and bonding between p53 and p63 in cancer.
Romano, Rose-Anne; Sinha, Satrajit
2014-04-01
The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Payandeh, Mehrdad; Sadeghi, Masoud; Sadeghi, Edris; Madani, Seyed-Hamid
2016-01-01
In breast cancer (BC), it has been suggested that nuclear overexpression of p53 protein might be an indicator of poor prognosis. The aim of the current study was to evaluate the expression of p53 BC in Kurdish women from the West of Iran and its correlation with other clinicopathology figures. In the present retrospective study, 231 patients were investigated for estrogen receptor (ER) and progesterone receptor (PR) positivity, defined as ≥10% positive tumor cells with nuclear staining. A binary logistic regression model was selected using Akaike Information Criteria (AIC) in stepwise selection for determination of important factors. ER, PR, the human epidermal growth factor receptor 2 (HER2) and p53 were positive in 58.4%, 55.4%, 59.7% and 45% of cases, respectively. Ki67 index was divided into two groups: 54.5% had Ki67<20% and 45.5% had Ki67 ≥20%. Of 214 patients, 137(64%) had lymph node metastasis and of 186 patients, 122(65.6%) had vascular invasion. Binary logistic regression analysis showed that there was inverse significant correlation between lymph node metastasis (P=0.008, OR 0.120 and 95%CI 0.025-0.574), ER status (P=0.006, OR 0.080, 95%CI 0.014-0.477) and a direct correlation between HER2 (P=005, OR 3.047, 95%CI 1.407-6.599) with the expression of p53. As in a number of studies, expression of p53 had a inverse correlation with lymph node metastasis and ER status and also a direct correlation with HER2 status. Also, p53-positivity is more likely in triple negative BC compared to other subtypes.
27 CFR 53.175 - Readjustment for local advertising charges.
Code of Federal Regulations, 2010 CFR
2010-04-01
... television station, or appears in a newspaper or magazine, or is displayed by means of an outdoor advertising... advertising charges. 53.175 Section 53.175 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... Readjustment for local advertising charges. (a) In general. If a manufacturer has paid the tax imposed by...
Rechter, Sabine; Scott, Gillian M.; Eickhoff, Jan; Zielke, Katrin; Auerochs, Sabrina; Müller, Regina; Stamminger, Thomas; Rawlinson, William D.; Marschall, Manfred
2009-01-01
Replication of human cytomegalovirus (HCMV) is subject to regulation by cellular protein kinases. Recently, we and others reported that inhibition of cyclin-dependent protein kinases (CDKs) or the viral CDK ortholog pUL97 can induce intranuclear speckled aggregation of the viral mRNA export factor, pUL69. Here we provide the first evidence for a direct regulatory role of CDKs on pUL69 functionality. Although replication of all HCMV strains was dependent on CDK activity, we found strain-specific differences in the amount of CDK inhibitor-induced pUL69 aggregate formation. In all cases analyzed, the inhibitor-induced pUL69 aggregates were clearly localized within viral replication centers but not subnuclear splicing, pore complex, or aggresome structures. The CDK9 and cyclin T1 proteins colocalized with these pUL69 aggregates, whereas other CDKs behaved differently. Phosphorylation analyses in vivo and in vitro demonstrated pUL69 was strongly phosphorylated in HCMV-infected fibroblasts and that CDKs represent a novel class of pUL69-phosphorylating kinases. Moreover, the analysis of CDK inhibitors in a pUL69-dependent nuclear mRNA export assay provided evidence for functional impairment of pUL69 under suppression of CDK activity. Thus, our data underline the crucial importance of CDKs for HCMV replication, and indicate a direct impact of CDK9-cyclin T1 on the nuclear localization and activity of the viral regulator pUL69. PMID:19179338
Serum p53 antibody as a potential tumor marker in extrahepatic cholangiocarcinoma.
Okada, Rei; Shimada, Hideaki; Otsuka, Yuichiro; Tsuchiya, Masaru; Ishii, Jun; Katagiri, Toshio; Maeda, Tetsuya; Kubota, Yoshihisa; Nemoto, Tetsuo; Kaneko, Hironori
2017-12-01
Only a few studies have evaluated the clinicopathological significance of the p53 protein expression and s-p53-Abs level in patients with cholangiocarcinoma. We therefore analyzed the clinicopathological and prognostic significance of s-p53-Abs in patients with extrahepatic cholangiocarcinoma. We prospectively evaluated s-p53-Abs levels before and after surgery in 61 patients with extrahepatic cholangiocarcinoma to determine the relationship between clinicopathological factors and the prognostic significance of s-p53-Abs. Among a total of 61 primary extrahepatic cholangiocarcinoma cases, 23% were positive for s-p53-Abs. Combination of s-p53-Abs with the conventional serum markers carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) significantly increased the rate of positive extrahepatic cholangiocarcinoma cases (57% for CEA and/or CA19-9 vs. 75% for CEA and/or CA19-9 and/or s-p53-Abs, P = 0.035). There were no significant differences in clinicopathological factors between the p53-seropositive and p53-seronegative patients. An immunohistochemical analysis showed the presence of significant associations between the intensity (P = 0.003) and extent (P = 0.001) of p53 immunoreactivity and p53-seropositivitly. Although s-p53-Abs was not a significant prognostic factor for the survival in either univariate or multivariate analyses, p53 immunoreactivity was independently associated with a poor survival. Among patients positive for s-p53-Abs before surgery, the s-p53-Abs levels were reduced after surgery in most. These findings suggested that s-p53-Abs might be associated with p53 immunoreactivity. In addition, s-p53-Abs may be useful for a diagnosis, but was not useful for predicting tumor recurrence or the survival. This study was registered as UMIN000014530.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region.
p53 as an Effector or Inhibitor of Therapy Response.
Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues
2015-12-04
Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.
Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin
2013-05-01
DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.
Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu
2016-01-01
Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798
Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.
2000-01-01
p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327
Distinct downstream targets manifest p53-dependent pathologies in mice.
Pant, V; Xiong, S; Chau, G; Tsai, K; Shetty, G; Lozano, G
2016-11-03
Mdm2, the principal negative regulator of p53, is critical for survival, a fact clearly demonstrated by the p53-dependent death of germline or conditional mice following deletion of Mdm2. On the other hand, Mdm2 hypomorphic (Mdm2 Puro/Δ7-12 ) or heterozygous (Mdm2 +/- ) mice that express either 30 or 50% of normal Mdm2 levels, respectively, are viable but present distinct phenotypes because of increased p53 activity. Mdm2 levels are also transcriptionally regulated by p53. We evaluated the significance of this reciprocal relationship in a new hypomorphic mouse model inheriting an aberrant Mdm2 allele with insertion of the neomycin cassette and deletion of 184-bp sequence in intron 3. These mice also carry mutations in the Mdm2 P2-promoter and thus express suboptimal levels of Mdm2 entirely encoded from the P1-promoter. Resulting mice exhibit abnormalities in skin pigmentation and reproductive tissue architecture, and are subfertile. Notably, all these phenotypes are rescued on a p53-null background. Furthermore, these phenotypes depend on distinct p53 downstream activities as genetic ablation of the pro-apoptotic gene Puma reverts the reproductive abnormalities but not skin hyperpigmentation, whereas deletion of cell cycle arrest gene p21 does not rescue either phenotype. Moreover, p53-mediated upregulation of Kitl influences skin pigmentation. Altogether, these data emphasize tissue-specific p53 activities that regulate cell fate.
Therapeutic targeting of the p53 pathway in cancer stem cells
Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.
2013-01-01
Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602
Subash-Babu, Pandurangan; Li, David K; Alshatwi, Ali A
2017-10-02
We aimed to explore the cytotoxic and apoptotic effect of friedelin on breast cancer MCF-7 cells. Cytotoxic effect of friedelin on MCF-7 cells was analyzed using MTT, cell and nuclear morphology. The apoptosis mechanism of friedelin on MCF-7 cells was analyzed using real-time PCR. Friedelin potentially inhibit 78% of MCF-7 cell's growth, the IC 50 value was 1.8μM in 24h and 1.2μM in 48h. Friedelin increased ROS significantly and DNA damage was confirmed by tunel assay. We found characteristically 52% apoptotic cells and 6% necrotic cells in PI, AO/ErBr staining after 48h treatment with 1.2μM of friedelin. Apoptosis was confirmed by significantly (p≤0.001) increased tumor suppressor gene Cdkn1a, pRb2, p53, Nrf2, caspase-3 and decreased Bcl-2, mdm2 & PCNA expression after 48h. In conclusion, friedelin effectively inhibit breast cancer MCF-7 cell growth, it was associated with early expression of Cdkn1a, pRb2 and activation of p53 and caspases. Copyright © 2017. Published by Elsevier GmbH.
Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.
2008-01-01
Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558
p53 as a retrovirus-induced oxidative stress modulator.
Kim, Soo Jin; Wong, Paul K Y
2015-01-01
Infection of astrocytes by the neuropathogenic mutant of Moloney murine leukemia virus, ts1, exhibits increased levels of reactive oxygen species (ROS) and signs of oxidative stress compared with uninfected astrocytes. Previously, we have demonstrated that ts1 infection caused two separate events of ROS upregulation. The first upregulation occurs during early viral establishment in host cells and the second during the virus-mediated apoptotic process. In this study, we show that virus-mediated ROS upregulation activates the protein kinase, ataxia telangiectasia mutated, which in turn phosphorylates serine 15 on p53. This activation of p53 however, is unlikely associated with ts1-induced cell death. Rather p53 appears to be involved in suppressing intracellular ROS levels in astrocytes under oxidative stress. The activated p53 appears to delay retroviral gene expression by suppressing NADPH oxidase, a superoxide-producing enzyme. These results suggest that p53 plays a role as a retrovirus-mediated oxidative stress modulator. © 2015 The Authors.
Autoantibody recognition mechanisms of p53 epitopes
NASA Astrophysics Data System (ADS)
Phillips, J. C.
2016-06-01
There is an urgent need for economical blood based, noninvasive molecular biomarkers to assist in the detection and diagnosis of cancers in a cost-effective manner at an early stage, when curative interventions are still possible. Serum autoantibodies are attractive biomarkers for early cancer detection, but their development has been hindered by the punctuated genetic nature of the ten million known cancer mutations. A landmark study of 50,000 patients (Pedersen et al., 2013) showed that a few p53 15-mer epitopes are much more sensitive colon cancer biomarkers than p53, which in turn is a more sensitive cancer biomarker than any other protein. The function of p53 as a nearly universal ;tumor suppressor; is well established, because of its strong immunogenicity in terms of not only antibody recruitment, but also stimulation of autoantibodies. Here we examine dimensionally compressed bioinformatic fractal scaling analysis for identifying the few sensitive epitopes from the p53 amino acid sequence, and show how it could be used for early cancer detection (ECD). We trim 15-mers to 7-mers, and identify specific 7-mers from other species that could be more sensitive to aggressive human cancers, such as liver cancer. Our results could provide a roadmap for ECD.
Sen, Gouri Sankar; Mohanty, Suchismita; Hossain, Dewan Md Sakib; Bhattacharyya, Sankar; Banerjee, Shuvomoy; Chakraborty, Juni; Saha, Shilpi; Ray, Pallab; Bhattacharjee, Pushpak; Mandal, Debaprasad; Bhattacharya, Arindam; Chattopadhyay, Samit; Das, Tanya; Sa, Gaurisankar
2011-01-01
Breast cancer cells often develop multiple mechanisms of drug resistance during tumor progression, which is the major reason for the failure of breast cancer therapy. High constitutive activation of NFκB has been found in different cancers, creating an environment conducive for chemotherapeutic resistance. Here we report that doxorubicin-induced SMAR1-dependent transcriptional repression and SMAR1-independent degradation of IkBα resulted in nuclear translocation of p65NFκB and its association with p300 histone acetylase and subsequent transcription of Bcl-2 to impart protective response in drug-resistant cells. Consistently SMAR1-silenced drug-resistant cells exhibited IkBα-mediated inhibition of p65NFκB and induction of p53-dependent apoptosis. Interestingly, curcumin pretreatment of drug-resistant cells alleviated SMAR1-mediated p65NFκB activation and hence restored doxorubicin sensitivity. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic death cascade. Importantly, promyelocyte leukemia-mediated SMAR1 sequestration that relieved the repression of apoptosis-inducing genes was indispensable for such chemo-sensitizing ability of curcumin. A simultaneous decrease in drug-induced systemic toxicity by curcumin might also have enhanced the efficacy of doxorubicin by improving the intrinsic defense machineries of the tumor-bearer. Overall, the findings of this preclinical study clearly demonstrate the effectiveness of curcumin to combat doxorubicin-resistance. We, therefore, suggest curcumin as a potent chemo-sensitizer to improve the therapeutic index of this widely used anti-cancer drug. Taken together, these results suggest that curcumin can be developed into an adjuvant chemotherapeutic drug. PMID:22013068
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.
Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M
2015-06-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Hsieh, Shu-Ling; Chen, Chi-Tsai; Wang, Jyh-Jye; Kuo, Yu-Hao; Li, Chien-Chun; Hsieh, Lan-Chi; Wu, Chih-Chung
2015-12-01
Sedanolide (SN), a phthalide-like compound from celery seed oil, possesses antioxidant effects. However, the effect of SN on cell death in human liver cancer cells has yet to be determined. In this study, cell viability determination, monodansylcadaverine (MDC) fluorescent staining and immunoblot analysis were performed to determine autophagy induction and autophagy-induced protein expression changes via molecular examination after human liver cancer (J5) cells were treated with SN. Our studies demonstrate that SN suppressed J5 cell viability by inducing autophagy. Phosphoinositide 3-kinase (PI3K)-I, mammalian target of rapamycin (mTOR) and Akt protein levels decreased, whereas PI3K-III, LC3-II and Beclin-1 protein levels increased following SN treatment in J5 cells. In addition, SN treatment upregulated nuclear p53 and damage-regulated autophagy modulator (DRAM) and downregulated cytosolic p53 and Tp53-induced glycolysis and apoptosis regulator (TIGAR) expression in J5 cells. Furthermore, the cytosolic phosphorylation of inhibitor of kappa B (IκB) and nuclear p65 and the DNA-binding activity of NF-κB increased after SN treatment. These results suggest that SN induces J5 cell autophagy by regulating PI3K, p53 and NF-κB autophagy-associated signaling pathways in J5 cells.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Mutant p53 expression in fallopian tube epithelium drives cell migration.
Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E
2015-10-01
Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.
Saldaña-Meyer, Ricardo; González-Buendía, Edgar; Guerrero, Georgina; Narendra, Varun; Bonasio, Roberto; Recillas-Targa, Félix; Reinberg, Danny
2014-01-01
The multifunctional CCCTC-binding factor (CTCF) protein exhibits a broad range of functions, including that of insulator and higher-order chromatin organizer. We found that CTCF comprises a previously unrecognized region that is necessary and sufficient to bind RNA (RNA-binding region [RBR]) and is distinct from its DNA-binding domain. Depletion of cellular CTCF led to a decrease in not only levels of p53 mRNA, as expected, but also those of Wrap53 RNA, an antisense transcript originated from the p53 locus. PAR-CLIP-seq (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation [PAR-CLIP] combined with deep sequencing) analyses indicate that CTCF binds a multitude of transcripts genome-wide as well as to Wrap53 RNA. Apart from its established role at the p53 promoter, CTCF regulates p53 expression through its physical interaction with Wrap53 RNA. Cells harboring a CTCF mutant in its RBR exhibit a defective p53 response to DNA damage. Moreover, the RBR facilitates CTCF multimerization in an RNA-dependent manner, which may bear directly on its role in establishing higher-order chromatin structures in vivo. PMID:24696455
Apoptotic cell death in erythrocytes of p53-deficient medaka (Oryzias latipes) after γ-irradiation.
Sayed, Alaa El-Din Hamid; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi
2016-10-01
Previous studies have examined the effects of γ-irradiation (γ-IR) on wild-type and p53 mutant Medaka (Oryzias latipes) 24 hours after irradiation and in the present work, apoptosis and alterations in erythrocytes of 4, 8 and 24 h and 14 days after gamma-ray irradiation were reported as genotoxic biomarkers of γ-irradiation. Sexually mature wild-type, WT (Hd-rR) and p53(-/-) adult female medaka (O. latipes) were exposed to 4 Gy dose of γ-IR and sampling were collected after 4, 8 and 24 h and 14 days. Apoptosis and morphological alterations were observed from 4 h after irradiation and remarkably increased 8 h after irradiation in the wild-type. Apoptotic cell death has been observed 8 h after irradiation most prominently but subtle in p53 mutant medaka. All these phenotypes were recovered 14 days after irradiation in both strains. Although no micronuclei were seen in any group, nuclear abnormalities were observed in red blood cells. Both apoptosis and morphological alterations in erythrocytes were decreased after 24 and 14 days after γ-irradiation. We conclude that apoptosis and malformations caused by 4 Gy γ-irradiation in the erythrocytes of medaka fish occurs from 4-24 h and the initial response until 8 h was p53-dependent.
Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nery, Flavia C.; Departamento de Genetica e Evolucao, Universidade Estadual de Campinas, Campinas, SP; Rui, Edmilson
Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could bemore » confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro.« less
Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya
2016-12-01
Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright
p53 and metabolism: from mechanism to therapeutics
Simabuco, Fernando M.; Morale, Mirian G.; Pavan, Isadora C.B.; Morelli, Ana P.; Silva, Fernando R.; Tamura, Rodrigo E.
2018-01-01
The tumor cell changes itself and its microenvironment to adapt to different situations, including action of drugs and other agents targeting tumor control. Therefore, metabolism plays an important role in the activation of survival mechanisms to keep the cell proliferative potential. The Warburg effect directs the cellular metabolism towards an aerobic glycolytic pathway, despite the fact that it generates less adenosine triphosphate than oxidative phosphorylation; because it creates the building blocks necessary for cell proliferation. The transcription factor p53 is the master tumor suppressor; it binds to more than 4,000 sites in the genome and regulates the expression of more than 500 genes. Among these genes are important regulators of metabolism, affecting glucose, lipids and amino acids metabolism, oxidative phosphorylation, reactive oxygen species (ROS) generation and growth factors signaling. Wild-type and mutant p53 may have opposing effects in the expression of these metabolic genes. Therefore, depending on the p53 status of the cell, drugs that target metabolism may have different outcomes and metabolism may modulate drug resistance. Conversely, induction of p53 expression may regulate differently the tumor cell metabolism, inducing senescence, autophagy and apoptosis, which are dependent on the regulation of the PI3K/AKT/mTOR pathway and/or ROS induction. The interplay between p53 and metabolism is essential in the decision of cell fate and for cancer therapeutics. PMID:29805774
Replication of damaged DNA in vitro is blocked by p53
Zhou, Jianmin; Prives, Carol
2003-01-01
The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603
Mechanism of p53-Dependent Apoptosis and its Role in Breast Cancer Therapy
1999-07-01
inducibly express p53 as previously described (Chen et a!., 1996). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A62-91)-l, -5, and -6 cells...1994) was used as template, ( a ) Levels of p53, p21 and actin in p53-3 and p53(gln22-ser23/A62-91)-2 and -14 cells were assayed by Western blot...CGG TAC CCC TGT CAT CTT CTG TC; and reverse primer C393 as used for generating p53(A62-91). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A74
Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.
He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu
2015-02-10
Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.
Cerebellum Development and Tumorigenesis: A p53-Centric Perspective.
Barthelery, Nicolas J; Manfredi, James J
2016-05-01
The p53 protein has been extensively studied for its role in suppressing tumorigenesis, in part through surveillance and maintenance of genomic stability. p53 has been associated with the induction of a variety of cellular outcomes including cell cycle arrest, senescence, and apoptosis. This occurs primarily, but not exclusively, through transcriptional activation of specific target genes. By contrast, the participation of p53 in normal developmental processes has been largely understudied. This review focuses on possible functions of p53 in cerebellar development. It can be argued that a better understanding of such mechanisms will provide needed insight into the genesis of certain embryonic cancers including medulloblastomas, and thus lead to more effective therapies. Copyright © 2016 Elsevier Ltd. All rights reserved.
1985-01-01
SEC53, a gene that is required for completion of assembly of proteins in the endoplasmic reticulum in yeast, has been cloned, sequenced, and the product localized by cell fractionation. Complementation of a sec53 mutation is achieved with unique plasmids from genomic or cDNA expression banks. These inserts contain the authentic gene, a cloned copy of which integrates at the sec53 locus. An open reading frame in the insert predicts a 29-kD protein with no significant hydrophobic character. This prediction is confirmed by detection of a 28-kD protein overproduced in cells that carry SEC53 on a multicopy plasmid. To follow Sec53p more directly, a LacZ-SEC53 gene fusion has been constructed which allows the isolation of a hybrid protein for use in production of antibody. With such an antibody, quantitative immune decoration has shown that the sec53-6 mutation decreases the level of Sec53p at 37 degrees C, while levels comparable to wild-type are seen at 24 degrees C. An eightfold overproduction of Sec53p accompanies transformation of cells with a multicopy plasmid containing SEC53. Cell fractionation, performed with conditions that preserve the lumenal content of the endoplasmic reticulum (ER), shows Sec53p highly enriched in the cytosol fraction. We suggest that Sec53p acts indirectly to facilitate assembly in the ER, possibly by interacting with a stable ER component, or by providing a small molecule, other than an oligosaccharide precursor, necessary for the assembly event. PMID:3905826
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morita, Akinori, E-mail: morita@tokushima-u.ac.jp; Ariyasu, Shinya; Wang, Bing
2014-08-08
Highlights: • A bidentate HQ derivative, AS-2, suppresses p53-dependent apoptosis by DNA damage. • AS-2 does not significantly affect nuclear p53 response. • UV-excited blue emission of AS-2 clearly showed its extranuclear localization. • AS-2 prevents mitochondrial dysfunction despite the increase of mitochondrial p53. • AS-2 protects mice from a radiation dose that causes lethal hematopoietic syndrome. - Abstract: In a previous study, we reported that some tetradentate zinc(II) chelators inhibit p53 through the denaturation of its zinc-requiring structure but a chelator, Bispicen, a potent inhibitor of in vitro apoptosis, failed to show any efficient radioprotective effect against irradiated micemore » because the toxicity of the chelator to mice. The unsuitability of using tetradentate chelators as radioprotectors prompted us to undertake a more extensive search for p53-inhibiting agents that are weaker zinc(II) chelators and therefore less toxic. Here, we show that an 8-hydroxyquinoline (8HQ) derivative, AS-2, suppresses p53-dependent apoptosis through a transcription-independent mechanism. A mechanistic study using cells with different p53 characteristics revealed that the suppressive effect of AS-2 on apoptosis is specifically mediated through p53. In addition, AS-2 was less effective in preventing p53-mediated transcription-dependent events than pifithrin-μ (PFTμ), an inhibitor of transcription-independent apoptosis by p53. Fluorescence visualization of the extranuclear distribution of AS-2 also supports that it is ineffective on the transcription-dependent pathway. Further investigations revealed that AS-2 suppressed mitochondrial apoptotic events, such as the mitochondrial release of intermembrane proteins and the loss of mitochondrial membrane potential, although AS-2 resulted in an increase in the mitochondrial translocation of p53 as opposed to the decrease of cytosolic p53, and did not affect the apoptotic interaction of p53 with Bcl-2
Development of an adenoviral vector with robust expression driven by p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology
2008-02-05
Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less
Rogers, Jason V; Rose, Mark D
2014-12-02
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide-sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p's functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. Copyright © 2015 Rogers and Rose.
p53 predictive value for pT1-2 N0 disease at radical cystectomy.
Shariat, Shahrokh F; Lotan, Yair; Karakiewicz, Pierre I; Ashfaq, Raheela; Isbarn, Hendrik; Fradet, Yves; Bastian, Patrick J; Nielsen, Matthew E; Capitanio, Umberto; Jeldres, Claudio; Montorsi, Francesco; Müller, Stefan C; Karam, Jose A; Heukamp, Lukas C; Netto, George; Lerner, Seth P; Sagalowsky, Arthur I; Cote, Richard J
2009-09-01
Approximately 15% to 30% of patients with pT1-2N0M0 urothelial carcinoma of the bladder experience disease progression despite radical cystectomy with curative intent. We determined whether p53 expression would improve the prediction of disease progression after radical cystectomy for pT1-2N0M0 UCB. In a multi-institutional retrospective cohort we identified 324 patients with pT1-2N0M0 urothelial carcinoma of the bladder who underwent radical cystectomy. Analysis focused on a testing cohort of 272 patients and an external validation of 52. Competing risks regression models were used to test the association of variables with cancer specific mortality after accounting for nonbladder cancer caused mortality. In the testing cohort 91 patients (33.5%) had altered p53 expression (p53alt). On multivariate competing risks regression analysis altered p53 achieved independent status for predicting disease recurrence and cancer specific mortality (each p <0.001). Adding p53 increased the accuracy of multivariate competing risks regression models predicting recurrence and cancer specific mortality by 5.7% (62.0% vs 67.7%) and 5.4% (61.6% vs 67.0%), respectively. Alterations in p53 represent a highly promising marker of disease recurrence and cancer specific mortality after radical cystectomy for urothelial carcinoma of the bladder. Analysis confirmed previous findings and showed that considering p53 can result in substantial accuracy gains relative to the use of standard predictors. The value and the level of the current evidence clearly exceed previous proof of the independent predictor status of p53 for predicting recurrence and cancer specific mortality.
P53 Gene Mutagenesis in Breast Cancer
2005-03-01
the wild type T peak. 12 Table 1. Sonic ntations dected by SINtA Individual Cell Sequence Amino Acid Species Conservation 3 ID’ ID Change2 Change... differences in the content of toxic substances in the diet (Biggs et al., 1993; Blaszyk et al., 1996). The development of this p53 mutation load...Changes in the P53 Gene in Single Cells Individual Sequence Amino acid Species conservation ’ ID’ Cell ID change’ change Monkey Mouse Rat Chicken
Targeting p53-MDM2-MDMX Loop for Cancer Therapy
Zhang, Qi; Zeng, Shelya X.
2015-01-01
The tumor suppressor p53 plays a central role in anti-tumorigenesis and cancer therapy. It has been described as “the guardian of the genome”, because it is essential for conserving genomic stability by preventing mutation, and its mutation and inactivation are highly related to all human cancers. Two important p53 regulators, MDM2 and MDMX, inactivate p53 by directly inhibiting its transcriptional activity and mediating its ubiquitination in a feedback fashion, as their genes are also the transcriptional targets of p53. On account of the importance of the p53-MDM2- MDMX loop in the initiation and development of wild type p53-containing tumors, intensive studies over the past decade have been aiming to identify small molecules or peptides that could specifically target individual protein molecules of this pathway for developing better anti-cancer therapeutics. In this chapter, we review the approaches for screening and discovering efficient and selective MDM2 inhibitors with emphasis on the most advanced synthetic small molecules that interfere with the p53-MDM2 interaction and are currently on Phase I clinical trials. Other therapeutically useful strategies targeting this loop, which potentially improve the prospects of cancer therapy and prevention, will also be discussed briefly. PMID:25201201
Rogers, Jason V.; Rose, Mark D.
2014-01-01
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide–sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p’s functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. PMID:25467943
The impact of p53 on the early stage replication of retrovirus.
Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan
2017-08-09
The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Radiation-Induced Salivary Gland Dysfunction Results From p53-Dependent Apoptosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Avila, Jennifer L.; Grundmann, Oliver; Burd, Randy
2009-02-01
Purpose: Radiotherapy for head-and-neck cancer causes adverse secondary side effects in the salivary glands and results in diminished quality of life for the patient. A previous in vivo study in parotid salivary glands demonstrated that targeted head-and-neck irradiation resulted in marked increases in phosphorylated p53 (serine{sup 18}) and apoptosis, which was suppressed in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Methods and Materials: Transgenic and knockout mouse models were exposed to irradiation, and p53-mediated transcription, apoptosis, and salivary gland dysfunction were analyzed. Results: The proapoptotic p53 target genes PUMA and Bax were induced in parotid salivary glandsmore » of mice at early time points after therapeutic radiation. This dose-dependent induction requires expression of p53 because no radiation-induced expression of PUMA and Bax was observed in p53-/- mice. Radiation also induced apoptosis in the parotid gland in a dose-dependent manner, which was p53 dependent. Furthermore, expression of p53 was required for the acute and chronic loss of salivary function after irradiation. In contrast, apoptosis was not induced in p53-/- mice, and their salivary function was preserved after radiation exposure. Conclusions: Apoptosis in the salivary glands after therapeutic head-and-neck irradiation is mediated by p53 and corresponds to salivary gland dysfunction in vivo.« less
Functional Analysis of Interactions Between 53BP1, BRCA1 and p53
2004-07-01
deficiency synergize in tumorigenesis. Furthermore, the loss of a single 53BP1 allele enhances the susceptibility to cancer in the absence of p53. 14...specific antibodies against these sites and showed that at least two of them (S25 and S29) are phosphorylated in vivo by ATM, the kinase mutated in cancer ...characterized by chromosomal aberrations, genetic instability and cancer predisposition. +HU 153BP1 Fig. 5: Lack of 53BP1 prevents the efficient accumulation
York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.
2016-01-01
Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821
York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B
2017-09-01
Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.
Distinct tumor protein p53 mutants in breast cancer subgroups.
Dumay, Anne; Feugeas, Jean-Paul; Wittmer, Evelyne; Lehmann-Che, Jacqueline; Bertheau, Philippe; Espié, Marc; Plassa, Louis-François; Cottu, Paul; Marty, Michel; André, Fabrice; Sotiriou, Christos; Pusztai, Lajos; de Thé, Hugues
2013-03-01
Tumor protein p53 (TP53) is mutated in approximately 30% of breast cancers, but this frequency fluctuates widely between subclasses. We investigated the p53 mutation status in 572 breast tumors, classified into luminal, basal and molecular apocrine subgroups. As expected, the lowest mutation frequency was observed in luminal (26%), and the highest in basal (88%) tumors. Luminal tumors showed significantly higher frequency of substitutions (82 vs. 65%), notably A/T to G/C transitions (31 vs. 15%), whereas molecular apocrine and basal tumors presented much higher frequencies of complex mutations (deletions/insertions) (36 and 33%, respectively, vs. 18%). Accordingly, missense mutations were significantly more frequent in luminal tumors (75 vs. 54%), whereas basal tumors displayed significantly increased rates of TP53 truncations (43 vs. 25%), resulting in loss of function and/or expression. Interestingly, as basal tumors, molecular apocrine tumors presented with a high rate of complex mutations, but paradoxically, these were not associated with increased frequency of p53 truncation. As in luminal tumors, this could reflect a selective pressure for p53 gain of function, possibly through P63/P73 inactivation. Collectively, these observations point not only to different mechanisms of TP53 alterations, but also to different functional consequences in the different breast cancer subtypes. Copyright © 2012 UICC.
REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO
XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.
2015-01-01
The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern
Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Yamaji, Taiki; Loda, Massimo; Fuchs, Charles S
2007-01-01
Downregulation of p27 (cyclin-dependent kinase inhibitor-1B, CDKN1B or KIP1) is caused by increased ubiquitin-mediated proteasomal degradation in colorectal cancer, and has been associated with poor prognosis. CpG island methylator phenotype (CIMP) is a phenotype of colorectal cancer with extensive promoter methylation, and associated with high degree of microsatellite instability (MSI-H) and BRAF mutations. We have recently shown that both CIMP and MSI-H are inversely associated with downregulation of p21 (CDKN1A or CIP1), another cyclin-dependent kinase inhibitor. However, no study to date has examined relationship between p27 and CIMP status in colorectal cancer. Using MethyLight assays, we measured DNA methylation in five CIMP-specific gene promoters {CACNA1G, CDKN2A (p16), CRABP1, MLH1 and NEUROG1} in 706 colorectal cancer samples obtained from two large prospective cohorts. Among the 706 tumors, 112 (16%) were CIMP-high tumors with >or=4/5 methylated promoters. We assessed p27 and p53 expressions by immunohistochemistry. Loss of nuclear p27 expression {observed in 231 tumors (33%)} was significantly associated with CIMP-high, MSI-H and BRAF mutations, and these associations were much more pronounced among p53-negative tumors than p53-positive tumors. When CIMP-high and non-CIMP-high tumors were stratified by MSI status (or KRAS and BRAF status), CIMP-high and MSI-H (but not BRAF mutations) were still significantly associated with nuclear p27 loss. Nuclear p27 loss did not appear to be directly related to CDKN2A (p16) methylation. We conclude that downregulation of nuclear p27 is associated with CIMP-high and MSI-H in colorectal cancer. These associations are stronger among p53 wild-type tumors, implying important interplay of p27 and p53 functions (or dysfunctions) in the development of various molecular subtypes of colorectal cancer.
TRIM25 has a dual function in the p53/Mdm2 circuit.
Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C
2015-11-12
P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.
Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro
2003-01-01
We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Xia; School of Ocean, Shandong University, Weihai 264209; Wu, William K.K.
2011-03-01
Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G{sub 2}/M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine,more » suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21{sup Waf1/Cip1}. In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B{sub 1}, a cyclin required for progression through the G{sub 2}/M phase. Taken together, DHA induces G{sub 2}/M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.« less
p53 on the crossroad between regeneration and cancer.
Charni, Meital; Aloni-Grinstein, Ronit; Molchadsky, Alina; Rotter, Varda
2017-01-01
Regeneration and tumorigenesis share common molecular pathways, nevertheless the outcome of regeneration is life, whereas tumorigenesis leads to death. Although the process of regeneration is strictly controlled, malignant transformation is unrestrained. In this review, we discuss the involvement of TP53, the major tumor-suppressor gene, in the regeneration process. We point to the role of p53 as coordinator assuring that regeneration will not shift to carcinogenesis. The fluctuation in p53 activity during the regeneration process permits a tight control. On one hand, its inhibition at the initial stages allows massive proliferation, on the other its induction at advanced steps of regeneration is essential for preservation of robustness and fidelity of the regeneration process. A better understanding of the role of p53 in regulation of regeneration may open new opportunities for implementation of TP53-based therapies, currently available for cancer patients, in regenerative medicine.
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-03-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.
[Study on serum p53 protein in cops in Guangzhou city].
Zhu, Wen-Chang; Chen, Qing; Chu, Xin-Wei; Luo, Chen-Ling; Wu, Min; Wang, Ya-Xian; Chen, Si-Dong
2003-10-01
Serum p53 protein overexpression was detected in population exposed to traffic exhaust gas to study the relation between traffic exhaust gas and the increased risk in p53 gene mutation. Serum p53 protein expression was measured by enzyme-linked immunosorbent assay. Relationship between different types of job and serum p53 protein overexpression were studied by pearson Chi-square tests. Results on serum p53 protein overexpression on jobs outside of office (5.74%) were not significantly higher than jobs inside the office. However, it suggested that traffic police men (12.12%) working outside of office, with whose length of service longer than 30 years had a significant overexpression of serum p53 protein than the others (5.36%) whose length of service was less than 30 years (P < 0.05, OR = 2.43, 95% CI: 1.11 - 5.33). Overexpression rate of p53 protein appeared to be 6.89% in the group whose average weekly exposure hours were more than 40 hours, which was significant higher than the group whose exposed hours were less than 40 hours (P < 0.05, OR = 1.71, 95% CI: 1.03 - 2.81). The result suggested that traffic exhaust gas was likely to cause mutation of p53 gene and increasing the incidence of lung cancer.
Selective activation of p53-mediated tumour suppression in high-grade tumours.
Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P
2010-11-25
Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.
P53 protein in proliferation, repair and apoptosis of cells.
Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara
2014-05-01
The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.
Boisvert, Maude; Bouchard-Lévesque, Véronique; Fernandes, Sandra
2014-01-01
ABSTRACT Nuclear targeting of capsid proteins (VPs) is important for genome delivery and precedes assembly in the replication cycle of porcine parvovirus (PPV). Clusters of basic amino acids, corresponding to potential nuclear localization signals (NLS), were found only in the unique region of VP1 (VP1up, for VP1 unique part). Of the five identified basic regions (BR), three were important for nuclear localization of VP1up: BR1 was a classic Pat7 NLS, and the combination of BR4 and BR5 was a classic bipartite NLS. These NLS were essential for viral replication. VP2, the major capsid protein, lacked these NLS and contained no region with more than two basic amino acids in proximity. However, three regions of basic clusters were identified in the folded protein, assembled into a trimeric structure. Mutagenesis experiments showed that only one of these three regions was involved in VP2 transport to the nucleus. This structural NLS, termed the nuclear localization motif (NLM), is located inside the assembled capsid and thus can be used to transport trimers to the nucleus in late steps of infection but not for virions in initial infection steps. The two NLS of VP1up are located in the N-terminal part of the protein, externalized from the capsid during endosomal transit, exposing them for nuclear targeting during early steps of infection. Globally, the determinants of nuclear transport of structural proteins of PPV were different from those of closely related parvoviruses. IMPORTANCE Most DNA viruses use the nucleus for their replication cycle. Thus, structural proteins need to be targeted to this cellular compartment at two distinct steps of the infection: in early steps to deliver viral genomes to the nucleus and in late steps to assemble new viruses. Nuclear targeting of proteins depends on the recognition of a stretch of basic amino acids by cellular transport proteins. This study reports the identification of two classic nuclear localization signals in the minor
Mathematical Modeling of E6-p53 interactions in Cervical Cancer
Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar
2017-04-01
Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License
p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells
Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua
2011-01-01
Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149
Mathematical Modeling of E6-p53 interactions in Cervical Cancer
Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, AI; Ullah, Mukhtar
2017-01-01
Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. PMID:28547941
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Sequence and characterization of cytoplasmic nuclear protein import factor p97
1995-01-01
Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630
The tumour suppressor CYLD regulates the p53 DNA damage response
Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis
2016-01-01
The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390
Clinical and pathologic relevance of p53 index in canine osseous tumors.
Loukopoulos, P; Thornton, J R; Robinson, W F
2003-05-01
The clinicopathologic value of the immunohistochemical (IHC) expression of p53 protein was evaluated in 167 canine osseous tumors. p53 staining frequency and intensity in tumor cells was expressed as a p53 index. p53 index was significantly higher in osteosarcomas than in other sarcomas, chondrosarcoma, multilobular tumor of bone, and tumors initially misdiagnosed as osteosarcomas as well as in appendicular versus axial and in distal versus proximal osteosarcomas. A strong correlation is demonstrated between the p53 index and a range of clinicopathologic parameters in osteosarcoma, including the tumor site, histologic grade and score, mitotic index, degree of tumor necrosis, and pleomorphism. Chondroblastic osteosarcomas had significantly higher and telangiectatic osteosarcomas significantly lower p53 index than did osteosarcomas belonging to other histopathologic subtypes, a fact that tends to reinforce the perception of these osteosarcomas as distinct clinicopathologic entities. Entire males had higher p53 index than did neutered males. p53 index was higher in Rottweilers than in Great Danes and Terriers, confirming breed susceptibilities to osteosarcoma. p53 index showed no association with age, primary or secondary site status, or the presence of metastases or other tumor types. Biopsy samples had a higher p53 index than did postmortem samples, either because of differences in sample processing or the possibility that p53 overexpression is more evident at the earlier stages of osteosarcoma pathogenesis, presumably represented by the biopsy material. IHC examination for p53 and the derived index has the potential to be used as an additional diagnostic tool and prognostic indicator for osseous tumors.
p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis
Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying
2014-01-01
Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761
p53 is a key regulator for osthole-triggered cancer pathogenesis.
Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan
2014-01-01
Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.
Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku
2016-01-01
Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981
Enhanced radiosensitization of p53 mutant cells by oleamide.
Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil
2006-04-01
Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.
MicroRNA-125b is a novel negative regulator of p53.
Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing
2009-04-01
The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.
MicroRNA-125b is a novel negative regulator of p53
Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing
2009-01-01
The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287
Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.
Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin
2017-12-15
TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.
Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M
2016-02-15
The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. © 2015 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.
EBNA3C regulates p53 through induction of Aurora kinase B
Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.
2015-01-01
In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063
Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora
2013-01-01
A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845
Lee, Dong-Kee; Kang, Jae-Eun; Park, Hye-Jin; Kim, Myung-Hwa; Yim, Tae-Hee; Kim, Jung-Min; Heo, Min-Kyu; Kim, Kyu-Yeun; Kwon, Ho Jeong; Hur, Man-Wook
2005-07-29
The POZ domain is a highly conserved protein-protein interaction motif found in many regulatory proteins. Nuclear factor-kappaB (NF-kappaB) plays a key role in the expression of a variety of genes in response to infection, inflammation, and stressful conditions. We found that the POZ domain of FBI-1 (factor that binds to the inducer of short transcripts of human immunodeficiency virus-1) interacted with the Rel homology domain of the p65 subunit of NF-kappaB in both in vivo and in vitro protein-protein interaction assays. FBI-1 enhanced NF-kappaB-mediated transcription of E-selectin genes in HeLa cells upon phorbol 12-myristate 13-acetate stimulation and overcame gene repression by IkappaB alpha or IkappaB beta. In contrast, the POZ domain of FBI-1, which is a dominant-negative form of FBI-1, repressed NF-kappaB-mediated transcription, and the repression was cooperative with IkappaB alpha or IkappaB beta. In contrast, the POZ domain tagged with a nuclear localization sequence polypeptide of FBI-1 enhanced NF-kappaB-responsive gene transcription, suggesting that the molecular interaction between the POZ domain and the Rel homology domain of p65 and the nuclear localization by the nuclear localization sequence are important in the transcription enhancement mediated by FBI-1. Confocal microscopy showed that FBI-1 increased NF-kappaB movement into the nucleus and increased the stability of NF-kappaB in the nucleus, which enhanced NF-kappaB-mediated transcription of the E-selectin gene. FBI-1 also interacted with IkappaB alpha and IkappaB beta.
The Origins and Evolution of the p53 Family of Genes
Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.
2010-01-01
A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
The role of p53 in cancer drug resistance and targeted chemotherapy.
Hientz, Karin; Mohr, André; Bhakta-Guha, Dipita; Efferth, Thomas
2017-01-31
Cancer has long been a grievous disease complicated by innumerable players aggravating its cure. Many clinical studies demonstrated the prognostic relevance of the tumor suppressor protein p53 for many human tumor types. Overexpression of mutated p53 with reduced or abolished function is often connected to resistance to standard medications, including cisplatin, alkylating agents (temozolomide), anthracyclines, (doxorubicin), antimetabolites (gemcitabine), antiestrogenes (tamoxifen) and EGFR-inhibitors (cetuximab). Such mutations in the TP53 gene are often accompanied by changes in the conformation of the p53 protein. Small molecules that restore the wild-type conformation of p53 and, consequently, rebuild its proper function have been identified. These promising agents include PRIMA-1, MIRA-1, and several derivatives of the thiosemicarbazone family. In addition to mutations in p53 itself, p53 activity may be also be impaired due to alterations in p53's regulating proteins such as MDM2. MDM2 functions as primary cellular p53 inhibitor and deregulation of the MDM2/p53-balance has serious consequences. MDM2 alterations often result in its overexpression and therefore promote inhibition of p53 activity. To deal with this problem, a judicious approach is to employ MDM2 inhibitors. Several promising MDM2 inhibitors have been described such as nutlins, benzodiazepinediones or spiro-oxindoles as well as novel compound classes such as xanthone derivatives and trisubstituted aminothiophenes. Furthermore, even naturally derived inhibitor compounds such as α-mangostin, gambogic acid and siladenoserinols have been discovered. In this review, we discuss in detail such small molecules that play a pertinent role in affecting the p53-MDM2 signaling axis and analyze their potential as cancer chemotherapeutics.
1997-10-01
and Biomedical Laboratories. PI - Signature Date TABLE OF CONTENTS Report Documentation Page ii Foreword m Introduction 1-2 Experimental Methods...life studies of P53 or p53as in G1, S, and G2/ M was unsuccessful as reported last year. Long cell cycle times may be responsible for lack of separation...of S-phase 5 cells from G2/ M -phase cells by centrifugal elutriation. Attempts to synchronize cells by density arrest and/or serum starvation resulted
Robustness of the p53 network and biological hackers.
Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G
2005-06-06
The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877
Kalmodia, Sushma; Parameswaran, Sowmya; Ganapathy, Kalaivani; Yang, Wenrong; Barrow, Colin J; Kanwar, Jagat R; Roy, Kislay; Vasudevan, Madavan; Kulkarni, Kirti; Elchuri, Sailaja V; Krishnakumar, Subramanian
2017-12-15
Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB). Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs) to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Reciprocal regulation of p53 and malic enzymes modulates metabolism and senescence.
Jiang, Peng; Du, Wenjing; Mancuso, Anthony; Wellen, Kathryn E; Yang, Xiaolu
2013-01-31
Cellular senescence both protects multicellular organisms from cancer and contributes to their ageing. The pre-eminent tumour suppressor p53 has an important role in the induction and maintenance of senescence, but how it carries out this function remains poorly understood. In addition, although increasing evidence supports the idea that metabolic changes underlie many cell-fate decisions and p53-mediated tumour suppression, few connections between metabolic enzymes and senescence have been established. Here we describe a new mechanism by which p53 links these functions. We show that p53 represses the expression of the tricarboxylic-acid-cycle-associated malic enzymes ME1 and ME2 in human and mouse cells. Both malic enzymes are important for NADPH production, lipogenesis and glutamine metabolism, but ME2 has a more profound effect. Through the inhibition of malic enzymes, p53 regulates cell metabolism and proliferation. Downregulation of ME1 and ME2 reciprocally activates p53 through distinct MDM2- and AMP-activated protein kinase-mediated mechanisms in a feed-forward manner, bolstering this pathway and enhancing p53 activation. Downregulation of ME1 and ME2 also modulates the outcome of p53 activation, leading to strong induction of senescence, but not apoptosis, whereas enforced expression of either malic enzyme suppresses senescence. Our findings define physiological functions of malic enzymes, demonstrate a positive-feedback mechanism that sustains p53 activation, and reveal a connection between metabolism and senescence mediated by p53.
Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status
Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L
2000-01-01
p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365
Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.
Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido
2008-07-01
We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
Huang, Shengkai; Li, Yan; Yuan, Xinghua; Zhao, Mei; Wang, Jia; Li, You; Li, Yuan; Lin, Hong; Zhang, Qiao; Wang, Wenjie; Li, Dongdong; Dong, Xin; Li, Lanfen; Liu, Min; Huang, Weiyan; Huang, Changzhi
2018-06-13
Ubiquilin4 (Ubqln4), a member of the UbL-UBA protein family, serves as an adaptor in the degradation of specific substrates via the proteasomal pathway. However, the biological function of Ubqln4 remains largely unknown, especially in cancer. Here, we reported that Ubqln4 was downregulated in gastric cancer tissues and functioned as a tumor suppressor by inhibiting gastric cancer cell proliferation in vivo and in vitro. Overexpression of Ubqln4-induced cellular senescence and G1-S cell cycle arrest in gastric cancer cells and activated the p53/p21 axis. Moreover, Ubqln4 regulated p21 through both p53-dependent and p53-independent manners. Ubqln4 interacted with RNF114, an E3 ubiquitin ligase of p21, and negatively regulated its expression level, which in turn stabilized p21 by attenuating proteasomal degradation of p21. These effects of Ubqln4 were partly abrogated in gastric cancer cells upon silencing of p21. Our findings not only establish the anti-tumor potential of Ubqln4 in gastric cancer but also reveal a role for Ubqln4 in regulation of the cell cycle and cellular senescence via stabilizing p21.
Super p53 for Treatment of Ovarian Cancer
2017-09-01
System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-11-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
p53 Is a Host Cell Regulator during Herpes Simplex Encephalitis.
Maruzuru, Yuhei; Koyanagi, Naoto; Takemura, Naoki; Uematsu, Satoshi; Matsubara, Daisuke; Suzuki, Yutaka; Arii, Jun; Kato, Akihisa; Kawaguchi, Yasushi
2016-08-01
p53 is a critical host cell factor in the cellular response to a broad range of stress factors. We recently reported that p53 is required for efficient herpes simplex virus 1 (HSV-1) replication in cell culture. However, a defined role for p53 in HSV-1 replication and pathogenesis in vivo remains elusive. In this study, we examined the effects of p53 on HSV-1 infection in vivo using p53-deficient mice. Following intracranial inoculation, p53 knockout reduced viral replication in the brains of mice and led to significantly reduced rates of mortality due to herpes simplex encephalitis. These results suggest that p53 is an important host cell regulator of HSV-1 replication and pathogenesis in the central nervous system (CNS). HSV-1 causes sporadic cases of encephalitis, which, even with antiviral therapy, can result in severe neurological defects and even death. Many host cell factors involved in the regulation of CNS HSV-1 infection have been investigated using genetically modified mice. However, most of these factors are immunological regulators and act via immunological pathways in order to restrict CNS HSV-1 infection. They therefore provide limited information on intrinsic host cell regulators that may be involved in the facilitation of CNS HSV-1 infection. Here we demonstrate that a host cell protein, p53, which has generally been considered a host cell restriction factor for various viral infections, is required for efficient HSV-1 replication and pathogenesis in the CNS of mice. This is the first report showing that p53 positively regulates viral replication and pathogenesis in vivo and provides insights into its molecular mechanism, which may suggest novel clinical treatment options for herpes simplex encephalitis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito
2012-07-13
Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zonesmore » in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.« less
Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17
Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.
2012-01-01
Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468
Detection of p53 mutations in proliferating vascular cells in glioblastoma multiforme.
Kawasoe, Takuma; Takeshima, Hideo; Yamashita, Shinji; Mizuguchi, Sohei; Fukushima, Tsuyoshi; Yokogami, Kiyotaka; Yamasaki, Kouji
2015-02-01
Glioblastoma multiforme (GBM), one of the most aggressive tumors in humans, is highly angiogenic. However, treatment with the angiogenesis inhibitor bevacizumab has not significantly prolonged overall patient survival times. GBM resistance to angiogenesis inhibitors is attributed to multiple interacting mechanisms. Although mesenchymal transition via glioma stem-like cells has attracted attention, it is considered a poor biomarker. There is no simple method for differentiating tumor-derived and reactive vascular cells from normal cells. The authors attempted to detect the mesenchymal transition of tumor cells by means of p53 and isocitrate dehydrogenase 1 (IDH1) immunohistochemistry. Using antibody against p53 and IDH1 R132H, the authors immunohistochemically analyzed GBM tissue from patients who had undergone surgery at the University of Miyazaki Hospital during August 2005-December 2011. They focused on microvascular proliferation with a p53-positive ratio exceeding 50%. They compared TP53 mutations in original tumor tissues and in p53-positive and p53-negative microvascular proliferation cells collected by laser microdissection. Among 61 enrolled GBM patients, the first screening step (immunostaining) identified 46 GBMs as p53 positive, 3 of which manifested areas of prominent p53-positive microvascular proliferation (>50%). Histologically, areas of p53-positive microvascular proliferation tended to be clustered, and they coexisted with areas of p53-negative microvascular proliferation. Both types of microvascular proliferation cells were clearly separated from original tumor cells by glial fibrillary acidic protein, epidermal growth factor receptor, and low-/high-molecular-weight cytokeratin. DNA sequencing analysis disclosed that p53-positive microvascular proliferation cells exhibited TP53 mutations identical to those observed in the original tumor; p53-negative microvascular proliferation cells contained a normal allele. Although immunostaining indicated
CRISPR-Cas9-based target validation for p53-reactivating model compounds
Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten
2015-01-01
Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461
Morris, Joanna S; Nixon, Colin; Bruck, Alicia; Nasir, Lubna; Morgan, Iain M; Philbey, Adrian W
2008-02-01
The immunohistochemical expression of topoisomerase IIbeta binding protein 1 (TopBP1) was examined in 123 feline mammary lesions (18 non-neoplastic lesions including six fibroadenomatous hyperplasia and 12 duct ectasia, 17 adenomas and 88 carcinomas) in relation to histological grade, oestrogen receptor alpha (ERalpha) status, proliferation index (Ki67) and p53 expression. There was positive staining for TopBP1 in 122 of 123 feline mammary lesions, although nine samples had fewer than 20% positive cells. The percentage of cells positive for TopBP1 increased with histological grade. Most staining was nuclear but both nuclear and cytoplasmic staining was observed as the degree of malignancy increased. TopBP1 is expressed in feline mammary tumours and its expression is correlated with histological grade. Many neoplasms which over-express p53 or are ERalpha negative show TopBP1 immunoreactivity.
Roles of HAUSP-mediated p53 regulation in central nervous system development.
Kon, N; Zhong, J; Kobayashi, Y; Li, M; Szabolcs, M; Ludwig, T; Canoll, P D; Gu, W
2011-08-01
The deubiquitinase HAUSP (herpesvirus-associated ubiquitin-specific protease; also called USP7) has a critical role in regulating the p53-Mdm2 (murine double minute 2) pathway. By using the conventional knockout approach, we previously showed that hausp inactivation leads to early embryonic lethality. To fully understand the physiological functions of hausp, we have generated mice lacking hausp specifically in the brain and examined the impacts of this manipulation on brain development. We found that deletion of hausp in neural cells resulted in neonatal lethality. The brains from these mice displayed hypoplasia and deficiencies in development, which were mainly caused by p53-mediated apoptosis. Detailed analysis also showed an increase of both p53 levels and p53-dependent transcriptional activation in hausp knockout brains. Notably, neural cell survival and brain development of hausp-mutant mice can largely be restored in the p53-null background. Nevertheless, in contrast to the case of mdm2- and mdm4 (murine double minute 4)-mutant mice, inactivation of p53 failed to completely rescue the neonatal lethality of these hausp-mutant mice. These results indicate that HAUSP-mediated p53 regulation is crucial for brain development, and also suggest that both the p53-dependent and the p53-independent functions of HAUSP contribute to the neonatal lethality of hausp-mutant mice.
Ciepliński, Klaudiusz; Jóźwik, Maciej; Semczuk-Sikora, Anna; Gogacz, Marek; Lewkowicz, Dorota; Ignatov, Atanas; Semczuk, Andrzej
2018-02-01
The expression of p53 has been studied not only in primary human ovarian carcinomas, but also in borderline ovarian tumors, however, the results were discordant. Expression patterns of proteins involved in cell proliferation and apoptosis have been investigated in various human neoplasms, including female genital tract neoplasms. The aim of this investigation was to assess the staining pattern and immunolocalization of p53 and selected proliferative markers (Ki-67, MCM3, PCNA, and topoisomerase IIα) in borderline ovarian tumors (BOTs). The study group consisted of 42 women who underwent pelvic surgery between 2006-2015. The median patients' age was 46 years. The immunoperoxidase technique was employed using antibodies against p53, Ki-67, MCM3, PCNA, and topoisomerase IIα. For p53, nuclear expression was observed in BOTs, however, cytoplasmatic immunoreactivity was also detected. Altogether, 25 (60%) tumors demonstrated positive p53 immunostaining, including overexpression found in 6 (14%). There were no significant differences in p53 expression between subgroups of clinicopathological variables. Immunoexpression of Ki-67, MCM3, PCNA, and topoisomerase IIα was nuclear. Ki-67 expression was positive in 12 (29%) cases and there was a trend towards a relationship between patients' age and Ki-67 staining (P=0.08). Interestingly, a significantly higher Ki-67 expression was found in tumors of ≥10 cm in diameter compared to smaller tumors (P=0.008). MCM3 expression was detected in 38 (90%) tumors, and PCNA expression in 28 (67%), yet none of clinicopathological factors was related to them. Topoisomerase IIα expression was present in 14 (33%) cases and, interestingly, its significantly higher expression was observed in BOTs of ≥10 cm in diameter compared to smaller tumors (P=0.008). Moreover, Spearman's correlation revealed highly significant positive associations between Ki-67 and topoisomerase IIα (R=0.403, P=0.008) and Ki-67 and MCM3 (R=0.469, P=0.001). We
Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.
Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi
2016-03-01
Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.
Miller, Matthew S; Furlong, Wendy E; Pennell, Leesa; Geadah, Marc; Hertel, Laura
2010-07-01
The products of numerous open reading frames (ORFs) present in the genome of human cytomegalovirus (CMV) have not been characterized. Here, we describe the identification of a new CMV protein localizing to the nuclear envelope and in cytoplasmic vesicles at late times postinfection. Based on this distinctive localization pattern, we called this new protein nuclear rim-associated cytomegaloviral protein, or RASCAL. Two RASCAL isoforms exist, a short version of 97 amino acids encoded by the majority of CMV strains and a longer version of 176 amino acids encoded by the Towne, Toledo, HAN20, and HAN38 strains. Both isoforms colocalize with lamin B in deep intranuclear invaginations of the inner nuclear membrane (INM) and in novel cytoplasmic vesicular structures possibly derived from the nuclear envelope. INM infoldings have been previously described as sites of nucleocapsid egress, which is mediated by the localized disruption of the nuclear lamina, promoted by the activities of viral and cellular kinases recruited by the lamina-associated proteins UL50 and UL53. RASCAL accumulation at the nuclear membrane required the presence of UL50 but not of UL53. RASCAL and UL50 also appeared to specifically interact, suggesting that RASCAL is a new component of the nuclear egress complex (NEC) and possibly involved in mediating nucleocapsid egress from the nucleus. Finally, the presence of RASCAL within cytoplasmic vesicles raises the intriguing possibility that this protein might participate in additional steps of virion maturation occurring after capsid release from the nucleus.
Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R
2012-05-01
Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.
Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo
2011-01-01
Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less
Tan, Zhi-Hui; Zhang, Yu; Tian, Yan; Tan, Wei; Li, Ying-Hua
2016-11-20
Cervical cancer is the second most common cancer of woman in the world, and human papillomavirus (HPV) infection plays an important role in the development of most of the cases. IκB kinase β (IKKβ) is a kinase-mediating nuclear factor kappa B (NF-κB) activation by phosphorylating the inhibitor of NF-κB (IκB) and is related by some diseases caused by virus infection. However, there is little known about the correlation between IKKβ and HPV infection in cervical cancer. This study aimed to investigate the expression of IKKβ protein in cervical cancer tissues and effects of inflammation on HPV positive or negative cervical cancer cells through detecting the expression of IKKβ, IκBα, p53, and p21 proteins after treated with lipopolysaccharide (LPS) to mimic bacterial infection. We also examined the effects of LPS on cervical cancer cells after blocking IKKβ with pharmacological inhibitor. Thirty-six matched specimens of cervical cancer and adjacent normal tissues were collected and analyzed in the study. The expression of IKKβ in the tissue specimens was determined by immunohistochemical staining. In addition, Western blot was used to detect the expression level changes of IKKβ, IκBα, p53, and p21 after LPS stimulated in the HPV16+ (SiHa) and HPV16- (C33A) cervical cancer cell lines. Furthermore, the effects of IKKβ inhibitor SC-514 on LPS-induced expression change of these proteins were investigated. The expression of IKKβ was higher in cervical cancer than adjacent normal tissues, and there was no significant difference between tumor differentiation, size, and invasive depth with IKKβ expression. The LPS, which increased the expression level of IKKβ protein but decreased in the IκBα, p53 and p21 proteins, was illustrated in HPV16+ (SiHa) but not in HPV16- (C33A) cells. Moreover, IKKβ inhibitor SC-514 totally reversed the upregulation of IKKβ and downregulation of p53 and p21 by LPS in SiHa cells. IKKβ may mediate the downregulation of p53 and
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.
Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu
2016-11-04
Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au
2014-06-15
Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less
Nucleophosmin regulates the stability and transcriptional activity of p53.
Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe
2002-07-01
Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.
Manna, Sunil K.; Bose, Julie S.; Gangan, Vijay; Raviprakash, Nune; Navaneetha, Thota; Raghavendra, Pongali B.; Babajan, Banaganapalli; Kumar, Chitta S.; Jain, Swatantra K.
2010-01-01
The Dracaena resin is widely used in traditional medicine as an anticancer agent, and benzofuran lignan is the active component. In this report, we provide evidence that the synthetic derivative of benzofuran lignan (Benfur) showed antitumor activities. It induced apoptosis in p53-positive cells. Though it inhibited endotoxin-induced nuclear factor κB (NF-κB) activation in both p53-positive and -negative cells, the activation of caspase 3 was observed in p53-positive cells. It showed partial cell death effect in both p53-positive and -negative cells through inhibition of NF-κB. Cell cycle analysis using flow cytometry showed that treatment with this novel benozofuran lignan derivative to Jurkat T-cells, but not U-937 cells, resulted in a G2/M arrest in a dose- and time-dependent manner. It increased amounts of p21, p27, and cyclin B, but not phospho-Rb through p53 nuclear translocation in Jurkat T-cells, but not in U-937 cells. It inhibited amounts of MDM2 (murine double minute 2) by repressing the transcription factor Sp1, which was also proved in silico. It induced cell death in tumor cells, but not in primary T-cells. Overall, our data suggest that Benfur-mediated cell death is partially dependent upon NF-κB, but predominantly dependent on p53. Thus, this novel benzofuran lignan derivative can be effective chemopreventive or chemotherapeutic agent against malignant T-cells. PMID:20472557
Takeda, Yohei; Yashima, Kazuo; Hayashi, Akihiro; Sasaki, Shuji; Kawaguchi, Koichiro; Harada, Kenichi; Murawaki, Yoshikazu; Ito, Hisao
2012-01-01
protein may partly contribute to the induction of nuclear P53 expression. PMID:22737274
Interaction of the Tumor Suppressor p53 with Replication Protein A.
1996-08-01
The DNA replication factor RPA physically associates with the tumor suppressor protein p53, an interaction that could be important for the function...binding single-stranded DNA, this mutant of RPA fails to support DNA replication . Therefore the region of RPA which interacts with p53 is essential for...of p53, p21/WAFl/CIPl, inhibits the cell-cycle by associating with cyclin-cdk kinases. It also inhibits DNA replication by interacting with a
Liang, Yayun; Mafuvadze, Benford; Besch-Williford, Cynthia; Hyder, Salman M
2018-01-01
Background Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53) lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous
Detection of genotoxic and non-genotoxic carcinogens in Xpc(-/-)p53(+/-) mice.
Melis, Joost P M; Speksnijder, Ewoud N; Kuiper, Raoul V; Salvatori, Daniela C F; Schaap, Mirjam M; Maas, Saskia; Robinson, Joke; Verhoef, Aart; van Benthem, Jan; Luijten, Mirjam; van Steeg, Harry
2013-01-15
An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Copyright © 2012 Elsevier Inc. All rights reserved.
Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis
2012-01-01
Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545
Preeclampsia is associated with alterations in the p53-pathway in villous trophoblast.
Sharp, Andrew N; Heazell, Alexander E P; Baczyk, Dora; Dunk, Caroline E; Lacey, Helen A; Jones, Carolyn J P; Perkins, Jonathan E; Kingdom, John C P; Baker, Philip N; Crocker, Ian P
2014-01-01
Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT-α). Equally, Mdm2 was knocked-down with siRNA. Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation.
UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation
Du, Cheng; Wu, Hong; Leng, Roger P.
2016-01-01
Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821
p53-regulated autophagy is controlled by glycolysis and determines cell fate
Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.
2015-01-01
The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205
p53-dependent cell death/apoptosis is required for a productive adenovirus infection.
Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W
1998-09-01
The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.
Kumar, Ajay; Corey, Catherine; Scott, Iain; Shiva, Sruti; D'Cunha, Jonathan
2016-01-01
Minnelide/Triptolide (TL) has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC). However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS). Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2), along with diminished cellular glutathione (GSH) content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC). TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y), restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.
A SENSITIVE IMMUNOFLUORESCENCE ASSAY FOR DETECTION OF P53 PROTEIN ACCUMULATION IN SPUTUM
p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...
Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils
Stegh, Alexander H.
2012-01-01
Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435
Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W
2010-11-01
Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.
Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation
Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise
2016-01-01
Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201
Barone, Eugenio; Cenini, Giovanna; Di Domenico, Fabio; Noel, Teresa; Wang, Chi; Perluigi, Marzia; St Clair, Daret K; Butterfield, D Allan
2015-11-01
Superoxide dismutases (SODs) are the primary reactive oxygen species (ROS)-scavenging enzymes of the cell and catalyze the dismutation of superoxide radicals O2- to H2O2 and molecular oxygen (O2). Among the three forms of SOD identified, manganese-containing SOD (MnSOD, SOD2) is a homotetramer located wholly in the mitochondrial matrix. Because of the SOD2 strategic location, it represents the first mechanism of defense against the augmentation of ROS/reactive nitrogen species levels in the mitochondria for preventing further damage. This study seeks to understand the effects that the partial lack (SOD2(-/+) ) or the overexpression (TgSOD2) of MnSOD produces on oxidative/nitrative stress basal levels in different brain isolated cellular fractions (i.e., mitochondrial, nuclear, cytosolic) as well as in the whole-brain homogenate. Furthermore, because of the known interaction between SOD2 and p53 protein, this study seeks to clarify the impact that the double mutation has on oxidative/nitrative stress levels in the brain of mice carrying the double mutation (p53(-/-) × SOD2(-/+) and p53(-/-) × TgSOD2). We show that each mutation affects mitochondrial, nuclear, and cytosolic oxidative/nitrative stress basal levels differently, but, overall, no change or reduction of oxidative/nitrative stress levels was found in the whole-brain homogenate. The analysis of well-known antioxidant systems such as thioredoxin-1 and Nrf2/HO-1/BVR-A suggests their potential role in the maintenance of the cellular redox homeostasis in the presence of changes of SOD2 and/or p53 protein levels. © 2015 Wiley Periodicals, Inc.
p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.
Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida
2015-04-01
Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. © 2015. Published by The Company of Biologists Ltd.
Preeclampsia Is Associated with Alterations in the p53-Pathway in Villous Trophoblast
Sharp, Andrew N.; Heazell, Alexander E. P.; Baczyk, Dora; Dunk, Caroline E.; Lacey, Helen A.; Jones, Carolyn J. P.; Perkins, Jonathan E.; Kingdom, John C. P.; Baker, Philip N.; Crocker, Ian P.
2014-01-01
Background Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Methods Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT- α). Equally, Mdm2 was knocked-down with siRNA. Results Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. Conclusions These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation. PMID:24498154
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Experimental Therapy of Advanced Breast Cancer: Targeting NFAT1-MDM2-p53 Pathway.
Qin, Jiang-Jiang; Wang, Wei; Zhang, Ruiwen
2017-01-01
Advanced breast cancer, especially advanced triple-negative breast cancer, is typically more aggressive and more difficult to treat than other breast cancer phenotypes. There is currently no curable option for breast cancer patients with advanced diseases, highlighting the urgent need for novel treatment strategies. We have recently discovered that the nuclear factor of activated T cells 1 (NFAT1) activates the murine double minute 2 (MDM2) oncogene. Both MDM2 and NFAT1 are overexpressed and constitutively activated in breast cancer, particularly in advanced breast cancer, and contribute to its initiation, progression, and metastasis. MDM2 regulates cancer cell proliferation, cell cycle progression, apoptosis, migration, and invasion through both p53-dependent and -independent mechanisms. We have proposed to target the NFAT1-MDM2-p53 pathway for the treatment of human cancers, especially breast cancer. We have recently identified NFAT1 and MDM2 dual inhibitors that have shown excellent in vitro and in vivo activities against breast cancer, including triple-negative breast cancer. Herein, we summarize recent advances made in the understanding of the oncogenic functions of MDM2 and NFAT1 in breast cancer, as well as current targeting strategies and representative inhibitors. We also propose several strategies for inhibiting the NFAT1-MDM2-p53 pathway, which could be useful for developing more specific and effective inhibitors for breast cancer therapy. Copyright © 2017. Published by Elsevier Inc.
p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis.
Napoletano, Francesco; Gibert, Benjamin; Yacobi-Sharon, Keren; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Teil, Margaux; Chatelain, Gilles; Walter, Ludivine; Arama, Eli; Mollereau, Bertrand
2017-09-01
The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis.
p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis
Napoletano, Francesco; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Chatelain, Gilles; Walter, Ludivine; Arama, Eli
2017-01-01
The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis. PMID:28945745
AAVPG: A vigilant vector where transgene expression is induced by p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.
2013-12-15
Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less
Synthesis and evaluation of modified chalcone based p53 stabilizing agents.
Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdel-Hamid; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib
2017-09-01
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (CAL-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI 50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI 50 of 0.473±0.043µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-h post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities. Copyright © 2017 Elsevier Ltd. All rights reserved.
Methionine sulfoxide reductase A regulates cell growth through the p53-p21 pathway
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choi, Seung Hee; Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr
2011-12-09
Highlights: Black-Right-Pointing-Pointer Down-regulation of MsrA inhibits normal cell proliferation. Black-Right-Pointing-Pointer MsrA deficiency leads to an increase in p21 by enhanced p53 acetylation. Black-Right-Pointing-Pointer Down-regulation of MsrA causes cell cycle arrest at the G{sub 2}/M stage. Black-Right-Pointing-Pointer MsrA is a regulator of cell growth that mediates the p53-p21 pathway. -- Abstract: MsrA is an oxidoreductase that catalyzes the stereospecific reduction of methionine-S-sulfoxide to methionine. Although MsrA is well-characterized as an antioxidant and has been implicated in the aging process and cellular senescence, its roles in cell proliferation are poorly understood. Here, we report a critical role of MsrA in normal cellmore » proliferation and describe the regulation mechanism of cell growth by this protein. Down-regulation of MsrA inhibited cell proliferation, but MsrA overexpression did not promote it. MsrA deficiency led to an increase in p21, a major cyclin-dependent kinase inhibitor, thereby causing cell cycle arrest at the G{sub 2}/M stage. While protein levels of p53 were not altered upon MsrA deficiency, its acetylation level was significantly elevated, which subsequently activated p21 transcription. The data suggest that MsrA is a regulator of cell growth that mediates the p53-p21 pathway.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling
Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W
2015-08-21
Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.
Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.
2015-01-01
Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280
The impact of p53 protein core domain structural alteration on ovarian cancer survival.
Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E
2003-09-15
Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.
The p53-Deficient Mouse as a Breast Cancer Model
1995-10-01
M.A. Gryka , F.Z. Bischoff, M.A. Tain- Halachmi, R.T. Bronson, and R.A. Weinberg. 1994. Tumor sky, and S.H. Friend. 1990. Germ line p53 mutations in a...J. Kassel, M.A. Gryka , F.Z. Bischoff, Weaver-Feldhaus, W. Ding, Z. Gholami, P. Soderkvist, L. M.A. Tainsky, and S.H. Friend. 1990. Germ line p53
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-01-01
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096
Sánchez-Aguilera, Abel; Sánchez-Beato, Margarita; García, Juan F; Prieto, Ignacio; Pollan, Marina; Piris, Miguel A
2002-02-15
p14(ARF), the alternative product from the human INK4a/ARF locus, antagonizes Hdm2 and mediates p53 activation in response to oncogenic stimuli. An immunohistochemical study of p14(ARF) expression in 74 samples of aggressive B-cell lymphomas was performed, demonstrating an array of different abnormalities. A distinct nucleolar expression pattern was detected in nontumoral tissue and a subset of lymphomas (50/74). In contrast, a group of cases (8/74) showed absence of p14(ARF) expression, dependent either on promoter hypermethylation or gene loss. Additionally, 16 out of 74 cases displayed an abnormal nuclear p14(ARF) overexpression not confined to the nucleoli, as confirmed by confocal microscopy, and that was associated with high levels of p53 and Hdm2. A genetic study of these cases failed to show any alteration in the p14(ARF) gene, but revealed the presence of p53 mutations in over 50% of these cases. An increased growth fraction and a more aggressive clinical course, with a shortened survival time, also characterized the group of tumors with p14(ARF) nuclear overexpression. Moreover, this p14(ARF) expression pattern was more frequent in tumors displaying accumulated alterations in the p53, p16(INK4a), and p27(KIP1) tumor supressors. These observations, together with the consideration of the central role of p14(ARF) in cell cycle control, suggest that p14(ARF) abnormal nuclear overexpression is a sensor of malfunction of the major cell cycle regulatory pathways, and consequently a marker of a high tumor aggressivity.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence.
Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J
2009-06-19
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence
Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.
2009-01-01
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo. PMID:19393630
Insights into wild-type and mutant p53 functions provided by genetically engineered mice.
Donehower, Lawrence A
2014-06-01
Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
Structure and stability insights into tumour suppressor p53 evolutionary related proteins.
Pagano, Bruno; Jama, Abdullah; Martinez, Pierre; Akanho, Ester; Bui, Tam T T; Drake, Alex F; Fraternali, Franca; Nikolova, Penka V
2013-01-01
The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs) of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.
Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I
2013-04-16
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy
Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.
2013-01-01
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378
Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.
Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya
2009-07-01
p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.
Anti-cancer peptides from ras-p21 and p53 proteins.
Pincus, Matthew R; Fenelus, Maly; Sarafraz-Yazdi, Ehsan; Adler, Victor; Bowne, Wilbur; Michl, Josef
2011-01-01
We have employed computer-based molecular modeling approaches to design peptides from the ras-p21 and p53 proteins that either induce tumor cell reversion to the untransformed phenotype or induce tumor cell necrosis without affecting normal cells. For rasp21, we have computed and superimposed the average low energy structures for the wild-type protein and oncogenic forms of this protein and found that specific domains change conformation in the oncogenic proteins. We have synthesized peptides corresponding to these and found that ras peptides, 35-47 (PNC-7) and 96-110 (PNC-2), block oncogenic ras-p21-induced oocyte maturation but have no effect on insulin-induced oocyte maturation that requires activation of endogenous wild-type ras-p21. These results show signal transduction pathway differences between oncogenic and activated wild-type ras-p21. Both peptides, attached to a membrane-penetrating peptide (membrane residency peptide or MRP), either induce phenotypic reversion to the untransformed phenotype or tumor cell necrosis of several ras-transformed cell lines, but have no effect on the growth of normal cells. Using other computational methods, we have designed two peptides, PNC-27 and 28, containing HDM-2-protein-binding domain sequences from p53 linked on their C-termini to the MRP that induce pore formation in the membranes of a wide range of cancer cells but not any normal cells tested. This is due to the expression of HDM-2 in the cancer cell membrane that does not occur in normal cells. These peptides eradicate a highly malignant tumor in nude mice with no apparent side effects. Both ras and p53 peptides show promise as anti-tumor agents in humans.
β-Catenin C-terminal signals suppress p53 and are essential for artery formation
Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.
2016-01-01
Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244
Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.
Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina
2010-05-01
Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.
The UMD-p53 database: new mutations and analysis tools.
Béroud, Christophe; Soussi, Thierry
2003-03-01
The tumor suppressor gene TP53 (p53) is the most extensively studied gene involved in human cancers. More than 1,400 publications have reported mutations of this gene in 150 cancer types for a total of 14,971 mutations. To exploit this huge bulk of data, specific analytic tools were highly warranted. We therefore developed a locus-specific database software called UMD-p53. This database compiles all somatic and germline mutations as well as polymorphisms of the TP53 gene which have been reported in the published literature since 1989, or unpublished data submitted to the database curators. The database is available at www.umd.necker.fr or at http://p53.curie.fr/. In this paper, we describe recent developments of the UMD-p53 database. These developments include new fields and routines. For example, the analysis of putative acceptor or donor splice sites is now automated and gives new insight for the causal role of "silent mutations." Other routines have also been created such as the prescreening module, the UV module, and the cancer distribution module. These new improvements will help users not only for molecular epidemiology and pharmacogenetic studies but also for patient-based studies. To achieve theses purposes we have designed a procedure to check and validate data in order to reach the highest quality data. Copyright 2003 Wiley-Liss, Inc.
The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.
Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang
2017-05-01
This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
Honda, Akinobu; Chigwechokha, Petros Kingstone; Kamada-Futagami, Yuko; Komatsu, Masaharu; Shiozaki, Kazuhiro
2018-06-01
Sialidase catalyzes the removal of sialic acids from glycoconjugates. Different from Neu1 and Neu3 sialidases, Neu4 enzymatic properties such as substrate specificity and subcellular localization are not well-conserved among vertebrates. In fish only zebrafish and medaka neu4 genes have been cloned and their polypeptides have been characterized so far. Thus, characterization of Neu4 from other fish species is necessary to evaluate Neu4 physiological functions. Here, Nile tilapia was chosen for the characterization of Neu4 polypeptide considering that it is one of the major cultured fish all over the world and that its genomic sequences are now available. Coding DNA sequence of tilapia Neu4 was identified as 1,497 bp and its recombinant protein showed broad substrate specificity and optimal sialidase enzyme activity pH at 4.0. Neu4 activity was sustained even in neutral and alkali pH. Interestingly, immunofluorescence analysis revealed that major subcellular localization of tilapia Neu4 was nuclear, quite distinct from zebrafish (ER) and medaka Neu4 (lysosome). Bioinformatic analysis showed the existence of putative nuclear localization signal (NLS) in tilapia Neu4. In general, it is known that importin families bind to several proteins via NLS and transfer them into nucleus. Therefore, to determine the involvement of putative NLS in Neu4 nuclear localization, Neu4 mutant deleting NLS was constructed and expressed in cultured cells. As a result, NLS deletion significantly diminished the nuclear localization. Furthermore, treatment of importazole, interrupter of binding importin β and RanGTP, significantly suppressed Neu4 nuclear localization. In summary, tilapia Neu4 is a unique sialidase localized at nucleus and its transport system into nucleus is regulated by importin. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
WWOX and p53 Dysregulation Synergize to Drive the Development of Osteosarcoma.
Del Mare, Sara; Husanie, Hussam; Iancu, Ortal; Abu-Odeh, Mohammad; Evangelou, Konstantinos; Lovat, Francesca; Volinia, Stefano; Gordon, Jonathan; Amir, Gail; Stein, Janet; Stein, Gary S; Croce, Carlo M; Gorgoulis, Vassilis; Lian, Jane B; Aqeilan, Rami I
2016-10-15
Osteosarcoma is a highly metastatic form of bone cancer in adolescents and young adults that is resistant to existing treatments. Development of an effective therapy has been hindered by very limited understanding of the mechanisms of osteosarcomagenesis. Here, we used genetically engineered mice to investigate the effects of deleting the tumor suppressor Wwox selectively in either osteoblast progenitors or mature osteoblasts. Mice with conditional deletion of Wwox in preosteoblasts (Wwox Δosx1 ) displayed a severe inhibition of osteogenesis accompanied by p53 upregulation, effects that were not observed in mice lacking Wwox in mature osteoblasts. Deletion of p53 in Wwox Δosx1 mice rescued the osteogenic defect. In addition, the Wwox;p53 Δosx1 double knockout mice developed poorly differentiated osteosarcomas that resemble human osteosarcoma in histology, location, metastatic behavior, and gene expression. Strikingly, the development of osteosarcomas in these mice was greatly accelerated compared with mice lacking p53 only. In contrast, combined WWOX and p53 inactivation in mature osteoblasts did not accelerate osteosarcomagenesis compared with p53 inactivation alone. These findings provide evidence that a WWOX-p53 network regulates normal bone formation and that disruption of this network in osteoprogenitors results in accelerated osteosarcoma. The Wwox;p53 Δosx1 double knockout establishes a new osteosarcoma model with significant advancement over existing models. Cancer Res; 76(20); 6107-17. ©2016 AACR. ©2016 American Association for Cancer Research.
Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage.
Karimian, Ansar; Ahmadi, Yasin; Yousefi, Bahman
2016-06-01
An appropriate control over cell cycle progression depends on many factors. Cyclin-dependent kinase (CDK) inhibitor p21 (also known as p21(WAF1/Cip1)) is one of these factors that promote cell cycle arrest in response to a variety of stimuli. The inhibitory effect of P21 on cell cycle progression correlates with its nuclear localization. P21 can be induced by both p53-dependent and p53-independent mechanisms. Some other important functions attributed to p21 include transcriptional regulation, modulation or inhibition of apoptosis. These functions are largely dependent on direct p21/protein interactions and also on p21 subcellular localizations. In addition, p21 can play a role in DNA repair by interacting with proliferating cell nuclear antigen (PCNA). In this review, we will focus on the multiple functions of p21 in cell cycle regulation, apoptosis and gene transcription after DNA damage and briefly discuss the pathways and factors that have critical roles in p21 expression and activity. Copyright © 2016 Elsevier B.V. All rights reserved.
Mitoguazone induces apoptosis via a p53-independent mechanism.
Davidson, K; Petit, T; Izbicka, E; Koester, S; Von Hoff, D D
1998-08-01
Mitoguazone (methylglyoxal bisguanylhydrazone, methyl-GAG or MGBG) is a synthetic polycarbonyl derivative with activity in patients with Hodgkin's and non-Hodgkin's lymphoma, head and neck cancer, prostate cancer, and esophageal cancer. Mitoguazone has also recently been documented to have activity in patients with AIDS-related lymphoma. Among anticancer drugs, mitoguazone has a unique mechanism of action via interference with the polyamine biosynthetic pathway. Polyamines stabilize DNA structure by non-covalent cross-bridging between phosphate groups on opposite strands. In addition, mitoguazone causes uncoupling of oxidative phosphorylation. In this study, the ability of mitoguazone to induce apoptosis by inhibiting the polyamine pathway was assessed in three Burkitt's lymphoma cell lines (Raji, Ramos and Daudi) and one prostate carcinoma cell line (MPC 3). Additional evaluations were performed in two human breast cancer cell lines (MCF7 with wild-type p53 and VM4K with mutated p53) to determine whether the p53 tumor suppressor gene was required for efficient apoptosis induction. The present study demonstrated that mitoguazone induces apoptosis in all the different human cancer cell lines tested in a concentration- and time-dependent way, and triggers a p53-independent programmed cell death in the human breast cancer MCF7 cell line.
p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.
Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C
2001-11-09
Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.
Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish
Kim, Seok-Hyung; Kowalski, Marie L.; Carson, Robert P.; Bridges, L. Richard; Ess, Kevin C.
2013-01-01
SUMMARY Tuberous sclerosis complex (TSC) is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1) kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors. PMID:23580196
Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen
2018-06-01
The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.
JEDINAK, ANDREJ; SLIVA, DANIEL
2009-01-01
In spite of the global consumption of mushrooms, only two epidemiological studies demonstrated an inverse correlation between mushroom intake and the risk of cancer. Therefore, in the present study we evaluated whether extracts from edible mushrooms Agaricus bisporus (portabella), Flammulina velutipes (enoki), Lentinula edodes (shiitake) and Pleurotus ostreatus (oyster) affect the growth of breast and colon cancer cells. Here, we identified as the most potent, P. ostreatus (oyster mushroom) which suppressed proliferation of breast cancer (MCF-7, MDA-MB-231) and colon cancer (HT-29, HCT-116) cells, without affecting proliferation of epithelial mammary MCF-10A and normal colon FHC cells. Flow cytometry revealed that the inhibition of cell proliferation by P. ostreatus was associated with the cell cycle arrest at G0/G1 phase in MCF-7 and HT-29 cells. Moreover, P. ostreatus induced the expression of the tumor suppressor p53 and cyclin-dependent kinase inhibitor p21(CIP1/WAF1), whereas inhibited the phosphorylation of retinoblastoma Rb protein in MCF-7 cells. In addition, P. ostreatus also up-regulated expression of p21 and inhibited Rb phosphorylation in HT-29 cells, suggesting that that P. ostreatus suppresses the proliferation of breast and colon cancer cells via p53-dependent as well as p53-independent pathway. In conclusion, our results indicated that the edible oyster mushroom has potential therapeutic/preventive effects on breast and colon cancer. PMID:19020765
Mechanisms of Breast Carcinogenesis Involving Wild-Type p53
2001-09-01
Nelson, C. E., Gryka , M . A., Litwak, G., Gebhardt, M ., level of p53 that was expressed in the cells in both these studies Bressac, B., Ozturk, M ., Baker...14 Publication resulting from this research: 1. Resnick-Silverman, L., S. St Clair, M . Maurer, K...activation by the tumor suppressor protein p53. Genes Dev 12:2102-7. 2. Tang, H. Y., K. Zhao, J. F. Pizzolato, M . Fonarev, J. C. Langer, and J. J
NASA Technical Reports Server (NTRS)
Goepfert, T. M.; McCarthy, M.; Kittrell, F. S.; Stephens, C.; Ullrich, R. L.; Brinkley, B. R.; Medina, D.
2000-01-01
Mammary epithelial cells from p53 null mice have been shown recently to exhibit an increased risk for tumor development. Hormonal stimulation markedly increased tumor development in p53 null mammary cells. Here we demonstrate that mammary tumors arising in p53 null mammary cells are highly aneuploid, with greater than 70% of the tumor cells containing altered chromosome number and a mean chromosome number of 56. Normal mammary cells of p53 null genotype and aged less than 14 wk do not exhibit aneuploidy in primary cell culture. Significantly, the hormone progesterone, but not estrogen, increases the incidence of aneuploidy in morphologically normal p53 null mammary epithelial cells. Such cells exhibited 40% aneuploidy and a mean chromosome number of 54. The increase in aneuploidy measured in p53 null tumor cells or hormonally stimulated normal p53 null cells was not accompanied by centrosome amplification. These results suggest that normal levels of progesterone can facilitate chromosomal instability in the absence of the tumor suppressor gene, p53. The results support the emerging hypothesis based both on human epidemiological and animal model studies that progesterone markedly enhances mammary tumorigenesis.
Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.
Suppiah, Aravind; Greenman, John
2013-08-07
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.
Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats
Botcheva, Krassimira; McCorkle, Sean R.
2014-11-21
The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less
Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R
2016-04-12
Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.
Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R
2016-01-01
Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462
p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes
Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang
1998-01-01
Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du
2007-07-06
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser{sup 6}, Ser{sup 15}, and Ser{sup 20}, which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21{sup WAF1/CIP}. Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular targetmore » of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent.« less
The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells.
Kim, H; You, S; Foster, L K; Farris, J; Foster, D N
2001-08-23
The steady-state levels of p53 mRNA were dramatically lower in immortal chicken embryo fibroblast (CEF) cell lines compared to primary CEF cells. In the presence of cycloheximide (CHX), the steady-state levels of p53 mRNA markedly increased in immortal CEF cell lines, similar to levels found in primary cells. The de novo synthetic rates of p53 mRNA were relatively similar in primary and immortal cells grown in the presence or absence of CHX. Destabilization of p53 mRNA was observed in the nuclei of immortal, but not primary, CEF cells. The half-life of p53 mRNA in primary cells was found to be a relatively long 23 h compared to only 3 h in immortal cells. The expression of transfected p53 cDNA was inhibited in immortal cells, but restored upon CHX treatment. The 5'-region of the p53 mRNA was shown to be involved in the rapid p53 mRNA destabilization in immortal cells by expression analysis of 5'- and 3'-deleted p53 cDNAs as well as fusion mRNA constructs of N-terminal p53 and N-terminal deleted LacZ genes. Together, it is suggestive that the downregulation of p53 mRNA in immortal CEF cells occurs through a post-transcriptional destabilizing mechanism.
ER-associated SNAREs and Sey1p mediate nuclear fusion at two distinct steps during yeast mating.
Rogers, Jason V; Arlow, Tim; Inkellis, Elizabeth R; Koo, Timothy S; Rose, Mark D
2013-12-01
During yeast mating, two haploid nuclei fuse membranes to form a single diploid nucleus. However, the known proteins required for nuclear fusion are unlikely to function as direct fusogens (i.e., they are unlikely to directly catalyze lipid bilayer fusion) based on their predicted structure and localization. Therefore we screened known fusogens from vesicle trafficking (soluble N-ethylmaleimide-sensitive factor attachment protein receptors [SNAREs]) and homotypic endoplasmic reticulum (ER) fusion (Sey1p) for additional roles in nuclear fusion. Here we demonstrate that the ER-localized SNAREs Sec20p, Ufe1p, Use1p, and Bos1p are required for efficient nuclear fusion. In contrast, Sey1p is required indirectly for nuclear fusion; sey1Δ zygotes accumulate ER at the zone of cell fusion, causing a block in nuclear congression. However, double mutants of Sey1p and Sec20p, Ufe1p, or Use1p, but not Bos1p, display extreme ER morphology defects, worse than either single mutant, suggesting that retrograde SNAREs fuse ER in the absence of Sey1p. Together these data demonstrate that SNAREs mediate nuclear fusion, ER fusion after cell fusion is necessary to complete nuclear congression, and there exists a SNARE-mediated, Sey1p-independent ER fusion pathway.
Yi, Hanjie; Yan, Xianglei; Luo, Qiuyun; Yuan, Luping; Li, Baoxia; Pan, Wentao; Zhang, Lin; Chen, Haibo; Wang, Jing; Zhang, Yubin; Zhai, Yifan; Qiu, Miao-Zhen; Yang, Da-Jun
2018-05-02
Gastric cancer is the leading cause of cancer related death worldwide. Radiation alone or combined with chemotherapy plays important role in locally advanced and metastatic gastric adenocarcinoma. MDM2-p53 interaction and downstream signaling affect cellular response to DNA damage which leads to cell cycle arrest and apoptosis. Therefore, restoring p53 function by inhibiting its interaction with MDM2 is a promising therapeutic strategy for cancer. APG-115 is a novel small molecule inhibitor which blocks the interaction of MDM2 and p53. In this study, we investigated that the radiosensitivity of APG-115 in gastric adenocarcinoma in vitro and in vivo. The role of APG-115 in six gastric cancer cells viability in vitro was determined by CCK-8 assay. The expression level of MDM2, p21, PUMA and BAX in AGS and MKN45 cell lines was measured via real-time PCR (RT-PCR). The function of treatment groups on cell cycle and cell apoptosis were detected through Flow Cytometry assay. Clonogenic assays were used to measure the radiosensitivity of APG-115 in p53 wild type gastric cancer cell lines. Western blot was conducted to detect the protein expressions of mdm2-p53 signal pathway. Xenograft models in nude mice were established to explore the radiosensitivity role of APG-115 in gastric cancer cells in vivo. We found that radiosensitization by APG-115 occurred in p53 wild-type gastric cancer cells. Increasing apoptosis and cell cycle arrest was observed after administration of APG-115 and radiation. Radiosensitivity of APG-115 was mainly dependent on MDM2-p53 signal pathway. In vivo, APG-115 combined with radiation decreased xenograft tumor growth much more significantly than either single treatment. Moreover, the number of proliferating cells (Ki-67) significantly decreased in combination group compared with single treatment group. In summary, we found that combination of MDM2-p53 inhibitor (APG-115) and radiotherapy can enhance antitumor effect both in vitro and in vivo. This
Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo
2015-01-01
The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors.
Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo
2015-01-01
The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors. PMID:26261614
Functional characterization of p53 pathway components in the ancient metazoan Trichoplax adhaerens
NASA Astrophysics Data System (ADS)
Siau, Jia Wei; Coffill, Cynthia R.; Zhang, Weiyun Villien; Tan, Yaw Sing; Hundt, Juliane; Lane, David; Verma, Chandra; Ghadessy, Farid
2016-09-01
The identification of genes encoding a p53 family member and an Mdm2 ortholog in the ancient placozoan Trichoplax adhaerens advocates for the evolutionary conservation of a pivotal stress-response pathway observed in all higher eukaryotes. Here, we recapitulate several key functionalities ascribed to this known interacting protein pair by analysis of the placozoan proteins (Tap53 and TaMdm2) using both in vitro and cellular assays. In addition to interacting with each other, the Tap53 and TaMdm2 proteins are also able to respectively bind human Mdm2 and p53, providing strong evidence for functional conservation. The key p53-degrading function of Mdm2 is also conserved in TaMdm2. Tap53 retained DNA binding associated with p53 transcription activation function. However, it lacked transactivation function in reporter genes assays using a heterologous cell line, suggesting a cofactor incompatibility. Overall, the data supports functional roles for TaMdm2 and Tap53, and further defines the p53 pathway as an evolutionary conserved fulcrum mediating cellular response to stress.
Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer
Suppiah, Aravind; Greenman, John
2013-01-01
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463
Hasty, Paul; Sharp, Zelton Dave; Curiel, Tyler J.; Campisi, Judith
2013-01-01
A balance must be struck between cell growth and stress responses to ensure that cells proliferate without accumulating damaged DNA. This balance means that optimal cell proliferation requires the integration of pro-growth and stress-response pathways. mTOR (mechanistic target of rapamycin) is a pleiotropic kinase found in complex 1 (mTORC1). The mTORC1 pathway governs a response to mitogenic signals with high energy levels to promote protein synthesis and cell growth. In contrast, the p53 DNA damage response pathway is the arbiter of cell proliferation, restraining mTORC1 under conditions of genotoxic stress. Recent studies suggest a complicated integration of these pathways to ensure successful cell growth and proliferation without compromising genome maintenance. Deciphering this integration could be key to understanding the potential clinical usefulness of mTORC1 inhibitors like rapamycin. Here we discuss how these p53-mTORC1 interactions might play a role in the suppression of cancer and perhaps the development of cellular senescence and organismal aging. PMID:23255104
Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.
Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald
2013-04-17
The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.
p53 sequence analysis predicts treatment response and outcome of patients with esophageal carcinoma.
Ribeiro, U; Finkelstein, S D; Safatle-Ribeiro, A V; Landreneau, R J; Clarke, M R; Bakker, A; Swalsky, P A; Gooding, W E; Posner, M C
1998-07-01
The ability to predict biologic behavior and treatment responsiveness would be a valuable asset in the multimodality approach to esophageal carcinoma. The authors examined whether alterations of the p53 gene correlate with clinicopathologic parameters, response to preoperative chemotherapy/radiotherapy, and outcome in patients with esophageal carcinoma. METHODS. Histopathologic/genetic analysis of p53 was performed on formalin fixed, paraffin embedded tissues. Tissue sections were stained immunohistochemically for p53 protein followed by topographic genotyping comprised of polymerase chain reaction amplification and direct sequencing of p53 exons 5-8. All patients received induction chemotherapy (5-fluorouracil, cisplatin, and alpha-interferon) and concurrent external beam radiotherapy (4500 centigrays) followed by resection. p53 analysis performed on 42 tumors from patients with potentially resectable esophageal carcinoma revealed 25 of the 42 tumors (59.5%) to be p53 immunopositive; however, only 17 of the 42 tumors (40.5%) were proven to contain p53 point mutational damage in exons 8 (n=5), 5 (n=5), 7 (n=4), and 6 (n=3). Eight cases were weakly immunopositive and had no genotype mutation suggesting hyperexpression of normal wild-type p53. Genotyping also identified two immunonegative cases with deletion-type mutations (exons 5 and 6). Tissue samples collected before and after chemotherapy/radiotherapy exhibited fidelity in p53 mutational genotype in all cases. The presence of a p53 point mutation positively correlated with pTNM stage (P=0.003) and residual disease in the resected specimen (P=0.01). Moreover, survival of patients with p53 mutations was significantly lower than that of patients without mutations (overall survival of 21.6 months vs. 40 months; P=0.0038; and disease free survival of 14.1 months vs. 38 months; P=0.0004). Histopathologic/genetic analysis is a better determinant of p53 mutational damage than immunohistochemistry alone and can be used
Regulation of p53 Target Gene Expression by Peptidylarginine Deiminase 4 ▿ †
Li, Pingxin; Yao, Hongjie; Zhang, Zhiqiang; Li, Ming; Luo, Yuan; Thompson, Paul R.; Gilmour, David S.; Wang, Yanming
2008-01-01
Histone Arg methylation has been correlated with transcriptional activation of p53 target genes. However, whether this modification is reversed to repress the expression of p53 target genes is unclear. Here, we report that peptidylarginine deiminase 4, a histone citrullination enzyme, is involved in the repression of p53 target genes. Inhibition or depletion of PAD4 elevated the expression of a subset of p53 target genes, including p21/CIP1/WAF1, leading to cell cycle arrest and apoptosis. Moreover, the induction of p21, cell cycle arrest, and apoptosis by PAD4 depletion is p53 dependent. Protein-protein interaction studies showed an interaction between p53 and PAD4. Chromatin immunoprecipitation assays showed that PAD4 is recruited to the p21 promoter in a p53-dependent manner. RNA polymerase II (Pol II) activities and the association of PAD4 are dynamically regulated at the p21 promoter during UV irradiation. Paused RNA Pol II and high levels of PAD4 were detected before UV treatment. At early time points after UV treatment, an increase of histone Arg methylation and a decrease of citrullination were correlated with a transient activation of p21. At later times after UV irradiation, a loss of RNA Pol II and an increase of PAD4 were detected at the p21 promoter. The dynamics of RNA Pol II activities after UV treatment were further corroborated by permanganate footprinting. Together, these results suggest a role of PAD4 in the regulation of p53 target gene expression. PMID:18505818
Ishii, Hideaki H; Gobé, Glenda C; Pan, Wenshen; Yoneyama, Juichi; Ebihara, Yoshiro
2002-09-01
Patients with gastric carcinomas have a poor prognosis and low survival rates. The aim of the present paper was to characterize cellular and molecular properties to provide insight into aspects of tumor progression in early compared with advanced gastric cancers. One hundred and nine graded gastric carcinomas (early or advanced stage, undifferentiated or differentiated type) with paired non-cancer tissue were studied to define the correlation between apoptosis (morphology, terminal deoxyribonucleotidyl transferase-mediated dUTP-digoxigenin nick end-labeling), cell proliferation (Ki-67 expression, morphology) and expression and localization of two proteins frequently having altered expression in cancers, namely p53 and c-myc. Overall, apoptosis was lower in early stage, differentiated and undifferentiated gastric carcinomas compared with advanced-stage cancers. Cell proliferation was comparatively high in all stages. There was a high level of p53 positivity in all stages. Only the early- and advanced-stage undifferentiated cancers that were p53 positive had a significantly higher level of apoptosis (P < 0.05). Cell proliferation was significantly greater (P < 0.05) only in the early undifferentiated cancers that had either c-myc or p53-positivity. The results indicate that low apoptosis and high cell proliferation combine to drive gastric cancer development. The molecular controls for high cell proliferation of the early stage undifferentiated gastric cancers involve overexpression of both p53 and c-myc. Overexpression of p53 may also control cancer development in that its expression is associated with higher levels of apoptosis in early and late-stage undifferentiated, cancers. Copyright 2002 Blackwell Publishing Asia Pty Ltd
Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.
2014-01-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269
Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.
Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru
2011-01-01
MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.
Metformin Restores Parkin-Mediated Mitophagy, Suppressed by Cytosolic p53
Song, Young Mi; Lee, Woo Kyung; Lee, Yong-ho; Kang, Eun Seok; Cha, Bong-Soo; Lee, Byung-Wan
2016-01-01
Metformin is known to alleviate hepatosteatosis by inducing 5’ adenosine monophosphate (AMP)-kinase-independent, sirtuin 1 (SIRT1)-mediated autophagy. Dysfunctional mitophagy in response to glucolipotoxicities might play an important role in hepatosteatosis. Here, we investigated the mechanism by which metformin induces mitophagy through restoration of the suppressed Parkin-mediated mitophagy. To this end, our ob/ob mice were divided into three groups: (1) ad libitum feeding of a standard chow diet; (2) intraperitoneal injections of metformin 300 mg/kg; and (3) 3 g/day caloric restriction (CR). HepG2 cells were treated with palmitate (PA) plus high glucose in the absence or presence of metformin. We detected enhanced mitophagy in ob/ob mice treated with metformin or CR, whereas mitochondrial spheroids were observed in mice fed ad libitum. Metabolically stressed ob/ob mice and PA-treated HepG2 cells showed an increase in expression of endoplasmic reticulum (ER) stress markers and cytosolic p53. Cytosolic p53 inhibited mitophagy by disturbing the mitochondrial translocation of Parkin, as demonstrated by immunoprecipitation. However, metformin decreased ER stress and p53 expression, resulting in induction of Parkin-mediated mitophagy. Furthermore, pifithrin-α, a specific inhibitor of p53, increased mitochondrial incorporation into autophagosomes. Taken together, these results indicate that metformin treatment facilitates Parkin-mediated mitophagy rather than mitochondrial spheroid formation by decreasing the inhibitory interaction with cytosolic p53 and increasing degradation of mitofusins. PMID:26784190
RNA content in the nucleolus alters p53 acetylation via MYBBP1A
Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn
2011-01-01
A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583
Tu, Wei; Zhang, Qian; Liu, Yin; Han, Lianyong; Wang, Qin; Chen, Panpan; Zhang, Shun; Wang, Aiguo; Zhou, Xue
2018-05-15
There has been a great concern about the neurotoxicity of fluoride since it can pass through the blood-brain barrier and accumulate in the brain. It has been suggested that apoptosis plays a vital role in neurotoxicity of fluoride. However, whether p53-mediated apoptotic pathway is involved is still unclear. Our results showed that apoptosis was induced after treatment with 40 and 60 mg/L of NaF for 24 h in human neuroblastoma SH-SY5Y cells. Exposure to 60 mg/L of NaF for 24 h significantly upregulated the levels of p53 and apoptosis-related proteins including PUMA, cytochrome c (cyto c), cleaved caspase-3 and cleaved PARP, whereas downregulated Bcl-2 in SH-SY5Y cells. Meanwhile, fluoride increased p53 nuclear translocation, cyto c release from mitochondria to cytoplasm and mitochondrial translocation of Bax in SH-SY5Y cells. Fluoride-induced increases of apoptotic rates and apoptosis-related protein levels were significantly attenuated by inhibiting p53 transcriptional activity with pifithrin-α. In addition, fluoride inhibited the deacetylase activity of SIRT1 and increased p53 (acetyl K382) level in SH-SY5Y cells. Apoptosis and upregulation of cleaved caspase-3, cleaved PARP and p53 (acetyl K382) induced by fluoride could be ameliorated by SIRT1 overexpression or its activator resveratrol in SH-SY5Y cells. Taken together, our study demonstrates that fluoride induces apoptosis by inhibiting the deacetylase activity of SIRT1 to activate mitochondrial p53 pathway in SH-SY5Y cells, which depends on p53 transcriptional activity. Thus, SIRT1 may be a promising target to protect against neurotoxicity induced by fluoride. Copyright © 2018 Elsevier Inc. All rights reserved.
Polymorphism at codon 36 of the p53 gene.
Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A
1994-01-01
A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.
Rapid and efficient hydrophilicity tuning of p53/mdm2 antagonists*
Srivastava, Stuti; Beck, Barbara; Wang, Wei; Czarna, Anna; Holak, Tad A.; Dömling, Alexander
2009-01-01
The protein-protein interaction of p53 and mdm2 is an important anticancer target. The interface, however, is very hydrophobic and naturally results in very hydrophobic antagonists. We used the Orru three component reaction (O-3CR) along with a rapid and efficient, recently discovered amidation reaction to dramatically improve the water solubility of our recently discovered low molecular weight p53/mdm2 antagonists. Arrays of amides were synthesized with improved hydrophilicity and retainment and/or improvement of p53/mdm2 inhibitory activity. PMID:19548636
Thotala, D K; Hallahan, D E; Yazlovitskaya, E M
2012-03-01
Exposure of the brain to ionizing radiation can cause neurocognitive deficiencies. The pathophysiology of these neurological changes is complex and includes radiation-induced apoptosis in the subgranular zone of the hippocampus. We have recently found that inhibition of glycogen synthase kinase 3β (GSK-3β) resulted in significant protection from radiation-induced apoptosis in hippocampal neurons. The molecular mechanisms of this cytoprotection include abrogation of radiation-induced accumulation of p53. Here we show that pretreatment of irradiated HT-22 hippocampal-derived neurons with small molecule inhibitors of GSK-3β SB216763 or SB415286, or with GSK-3β-specific shRNA resulted in accumulation of the p53-specific E3 ubiquitin ligase MDM2. Knockdown of MDM2 using specific shRNA or chemical inhibition of MDM2-p53 interaction prevented the protective changes triggered by GSK-3β inhibition in irradiated HT-22 neurons and restored radiation cytotoxicity. We found that this could be due to regulation of apoptosis by subcellular localization and interaction of GSK-3β, p53 and MDM2. These data suggest that the mechanisms of radioprotection by GSK-3β inhibitors in hippocampal neurons involve regulation of MDM2-dependent p53 accumulation and interactions between GSK-3β, MDM2 and p53.
González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E
1997-01-01
AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671
Relationships between p53 mutation, HPV status and outcome in oropharyngeal squamous cell carcinoma.
Hong, Angela; Zhang, Xiaoying; Jones, Deanna; Veillard, Anne-Sophie; Zhang, Mei; Martin, Andrew; Lyons, J Guy; Lee, C Soon; Rose, Barbara
2016-02-01
This study aimed to examine the rate and type of p53 mutation in oropharyngeal cancer (OSCC). Relationships were sought between human papillomavirus (HPV) status and p53 mutation. The role of p53 mutation as a prognostic factor independent of HPV status and as a modifier of the effect of HPV on outcomes was also examined. The HPV status of 202 cases was determined by HPV DNA by RT-PCR and p16 immunohistochemistry. P53 mutation in exon 5-8 was determined by pyrosequencing. Findings were correlated with known clinicopathological factors and outcomes. 48% of the cases were HPV positive and they were significantly less likely to have a p53 mutation than HPV-negative OSCCs (25.8% vs 46.7%, p=0.0021). Mutation was most common in exon 5. Among patients with HPV-positive OSCC, there was no significant difference in p53 mutation by smoking status (22.2% for never smokers and 30.8% for current or ex-smokers). Patients with p53 mutant OSCC had significantly worse overall survival (p=0.01). There was no statistical evidence that p53 mutation modified the effect of HPV status on outcomes. In the multivariate analysis, positive HPV status remained the strongest predictor of outcomes. p53 mutation status was not a significant predictor of outcome after adjusting for age, gender, T stage, N stage and HPV status. In summary, HPV-positive OSCC are less likely to have mutant p53 than HPV-negative OSCC. Our study did not show any evidence that p53 mutation could modify the effect of HPV status on outcomes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.