A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

PubMed Central

Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

2016-01-01

p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

Simultaneous activation of p53 and inhibition of XIAP enhance the activation of apoptosis signaling pathways in AML

PubMed Central

Carter, Bing Z.; Mak, Duncan H.; Schober, Wendy D.; Koller, Erich; Pinilla, Clemencia; Vassilev, Lyubomir T.; Reed, John C.

2010-01-01

Activation of p53 by murine double minute (MDM2) antagonist nutlin-3a or inhibition of X-linked inhibitor of apoptosis (XIAP) induces apoptosis in acute myeloid leukemia (AML) cells. We demonstrate that concomitant inhibition of MDM2 by nutlin-3a and of XIAP by small molecule antagonists synergistically induced apoptosis in p53 wild-type OCI-AML3 and Molm13 cells. Knockdown of p53 by shRNA blunted the synergy, and down-regulation of XIAP by antisense oligonucleotide (ASO) enhanced nutlin-3a–induced apoptosis, suggesting that the synergy was mediated by p53 activation and XIAP inhibition. This is supported by data showing that inhibition of both MDM2 and XIAP by their respective ASOs induced significantly more cell death than either ASO alone. Importantly, p53 activation and XIAP inhibition enhanced apoptosis in blasts from patients with primary AML, even when the cells were protected by stromal cells. Mechanistic studies demonstrated that XIAP inhibition potentiates p53-induced apoptosis by decreasing p53-induced p21 and that p53 activation enhances XIAP inhibition-induced cell death by promoting mitochondrial release of second mitochondria-derived activator of caspases (SMAC) and by inducing the expression of caspase-6. Because both XIAP and p53 are presently being targeted in ongoing clinical trials in leukemia, the combination strategy holds promise for expedited translation into the clinic. PMID:19897582

Inhibition of Mdm2 Sensitizes Human Retinal Pigment Epithelial Cells to Apoptosis

PubMed Central

Ray, Ramesh M.; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

2011-01-01

Purpose. Because recent studies indicate that blocking the interaction between p53 and Mdm2 results in the nongenotoxic activation of p53, the authors sought to investigate whether the inhibition of p53-Mdm2 binding activates p53 and sensitizes human retinal epithelial cells to apoptosis. Methods. Apoptosis was evaluated by the activation of caspases and DNA fragmentation assays. The Mdm2 antagonist Nutlin-3 was used to dissociate p53 from Mdm2 and, thus, to increase p53 activity. Knockdown of p53 expression was accomplished by using p53 siRNA. Results. ARPE-19 and primary RPE cells expressed high levels of the antiapoptotic proteins Bcl-2 and Bcl-xL. Exposure of these cells to camptothecin (CPT) or TNF-α/ cycloheximide (CHX) failed to induce apoptosis. In contrast, treatment with the Mdm2 antagonist Nutlin-3 in the absence of CPT or TNF-α/CHX increased apoptosis. Activation of p53 in response to Nutlin-3 also increased levels of Noxa, p53-upregulated modulator of apoptosis (PUMA), and Siva-1, decreased expression of Bcl-2 and Bcl-xL, and simultaneously increased caspases-9 and -3 activities and DNA fragmentation. Knockdown of p53 decreased the basal expression of p21Cip1 and Bcl-2, inhibited the Nutlin-3–induced upregulation of Siva-1 and PUMA expression, and consequently inhibited caspase-3 activation. Conclusions. These results indicate that the normally available pool of intracellular p53 is predominantly engaged in the regulation of cell cycle checkpoints by p21Cip1 and does not trigger apoptosis in response to DNA-damaging agents. However, the blockage of p53 binding to Mdm2 frees a pool of p53 that is sufficient, even in the absence of DNA-damaging agents, to increase the expression of proapoptotic targets and to override the resistance of RPE cells to apoptosis. PMID:21345989

Abrogation of p53 by its antisense in MCF-7 breast carcinoma cells increases cyclin D1 via activation of Akt and promotion of cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar

2007-11-15

The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expressionmore » levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.« less

Stabilization and activation of p53 are regulated independently by different phosphorylation events

PubMed Central

Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

1998-01-01

Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

Inhibition of SIRT1 Catalytic Activity Increases p53 Acetylation but Does Not Alter Cell Survival following DNA Damage

PubMed Central

Solomon, Jonathan M.; Pasupuleti, Rao; Xu, Lei; McDonagh, Thomas; Curtis, Rory; DiStefano, Peter S.; Huber, L. Julie

2006-01-01

Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527, a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1 in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary epithelial cells. PMID:16354677

2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

PubMed

Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

2016-09-06

The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

PubMed Central

Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

2010-01-01

Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

PubMed Central

2010-01-01

Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

PubMed Central

Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

2014-01-01

In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

PubMed Central

Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

2012-01-01

Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

TRIM25 has a dual function in the p53/Mdm2 circuit.

PubMed

Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

2015-11-12

P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

PubMed

Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

2003-09-17

The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

2013-06-15

Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

PubMed

He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

2016-01-01

The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

Regulation of autophagy by cytoplasmic p53.

PubMed

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

ROS-dependent activation of JNK converts p53 into an efficient inhibitor of oncogenes leading to robust apoptosis

PubMed Central

Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G

2014-01-01

Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150

P53 protein in proliferation, repair and apoptosis of cells.

PubMed

Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

2014-05-01

The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

PubMed

Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

2007-11-07

Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

PubMed

Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

2000-11-23

Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Soo Kyung; Gwak, Jungsug; Song, Im-Sook

Highlights: {yields} TopIn activates p53-dependent transcription in colon cancer cells. {yields} TopIn induces apoptosis in colon cancer cells. {yields} TopIn selectively inhibits topoisomerase I activity. {yields} TopIn does not affect the activity of BCRP and MDR-1. -- Abstract: The tumor suppressor p53 plays an important role in cellular emergency mechanisms through regulating the genes involved in cell cycle arrest and apoptosis. To identify small molecules that can activate p53-responsive transcription, we performed chemical screening using genetically engineered HCT116 reporter cells. We found that TopIn (7-phenyl-6H-[1,2,5]oxadiazolo[3,4-e]indole 3-oxide) efficiently activated p53-mediated transcriptional activity and induced phosphorylation of p53 at Ser15, thereby stabilizingmore » the p53 protein. Furthermore, TopIn upregulated the expression of p21{sup WAF1/CIP1}, a downstream target of p53, and suppressed cellular proliferation in various colon cancer cells. Additionally, TopIn induced DNA fragmentation, caspase-3/7 activation and poly ADP ribose polymerase cleavage, typical biochemical markers of apoptosis, in p53 wild-type and mutated colon cancer cells. Finally, we found that TopIn inhibited topoisomerase I activity, but not topoisomerase II, in vitro and induced the formation of the topoisomerase I-DNA complex in HCT116 colon cancer cells. Unlike camptothecin (CPT) and its derivative SN38, TopIn did not affect the activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP) or multidrug-resistant protein-1 (MDR-1). These results suggest that TopIn may present a promising new topoisomerase I-targeting anti-tumor therapeutics.« less

p53-regulated autophagy is controlled by glycolysis and determines cell fate

PubMed Central

Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

2015-01-01

The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

PubMed Central

Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

2000-01-01

p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

PubMed Central

Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

2016-01-01

Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

PubMed

Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.

Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

PubMed Central

Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160

Regulation of autophagy by cytoplasmic p53

PubMed Central

Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2009-01-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

PubMed

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Transcriptional inhibition of p21{sup WAF1/CIP1} gene (CDKN1) expression by survivin is at least partially p53-dependent: Evidence for survivin acting as a transcription factor or co-factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang

2012-05-04

Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less

Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

PubMed Central

Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

2015-01-01

ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

TRIM25 enhances cell growth and cell survival by modulating p53 signals via interaction with G3BP2 in prostate cancer.

PubMed

Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi

2018-04-01

Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.

The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

PubMed

Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

2018-03-23

p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

PubMed Central

Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

2016-01-01

Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

PubMed

Rani, Reena; Li, Jie; Pang, Qishen

2008-12-01

Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

PubMed Central

Rani, Reena; Li, Jie; Pang, Qishen

2008-01-01

Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX

PubMed Central

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-01-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX.

PubMed

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-11-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

PubMed Central

Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

2012-01-01

Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

PubMed

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression

PubMed Central

Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella

2016-01-01

SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916

Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells

PubMed Central

2011-01-01

Background Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. Results We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. Conclusions we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. PMID:21801448

Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells.

PubMed

Liu, Juan; Uematsu, Hiroshi; Tsuchida, Nobuo; Ikeda, Masa-Aki

2011-07-31

Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells.

p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

PubMed

Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

2009-04-01

Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

PubMed Central

Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

2010-01-01

The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

EBNA3C regulates p53 through induction of Aurora kinase B

PubMed Central

Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

2015-01-01

In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

PubMed

Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

2015-10-01

The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

Novel Derivative of Benzofuran Induces Cell Death Mostly by G2/M Cell Cycle Arrest through p53-dependent Pathway but Partially by Inhibition of NF-κB*

PubMed Central

Manna, Sunil K.; Bose, Julie S.; Gangan, Vijay; Raviprakash, Nune; Navaneetha, Thota; Raghavendra, Pongali B.; Babajan, Banaganapalli; Kumar, Chitta S.; Jain, Swatantra K.

2010-01-01

The Dracaena resin is widely used in traditional medicine as an anticancer agent, and benzofuran lignan is the active component. In this report, we provide evidence that the synthetic derivative of benzofuran lignan (Benfur) showed antitumor activities. It induced apoptosis in p53-positive cells. Though it inhibited endotoxin-induced nuclear factor κB (NF-κB) activation in both p53-positive and -negative cells, the activation of caspase 3 was observed in p53-positive cells. It showed partial cell death effect in both p53-positive and -negative cells through inhibition of NF-κB. Cell cycle analysis using flow cytometry showed that treatment with this novel benozofuran lignan derivative to Jurkat T-cells, but not U-937 cells, resulted in a G2/M arrest in a dose- and time-dependent manner. It increased amounts of p21, p27, and cyclin B, but not phospho-Rb through p53 nuclear translocation in Jurkat T-cells, but not in U-937 cells. It inhibited amounts of MDM2 (murine double minute 2) by repressing the transcription factor Sp1, which was also proved in silico. It induced cell death in tumor cells, but not in primary T-cells. Overall, our data suggest that Benfur-mediated cell death is partially dependent upon NF-κB, but predominantly dependent on p53. Thus, this novel benzofuran lignan derivative can be effective chemopreventive or chemotherapeutic agent against malignant T-cells. PMID:20472557

Zn(II)-curc targets p53 in thyroid cancer cells.

PubMed

Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

2015-10-01

TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

NASA Technical Reports Server (NTRS)

Kohli, M.; Jorgensen, T. J.

1999-01-01

The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

Notch1 Signaling Sensitizes Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis in Human Hepatocellular Carcinoma Cells by Inhibiting Akt/Hdm2-mediated p53 Degradation and Up-regulating p53-dependent DR5 Expression*

PubMed Central

Wang, Chunmei; Qi, Runzi; Li, Nan; Wang, Zhengxin; An, Huazhang; Zhang, Qinghua; Yu, Yizhi; Cao, Xuetao

2009-01-01

Notch signaling plays a critical role in regulating cell proliferation, differentiation, and apoptosis. Our previous study showed that overexpression of Notch1 could inhibit human hepatocellular carcinoma (HCC) cell growth by arresting the cell cycle and inducing apoptosis. HCC cells are resistant to apoptotic induction by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), so new therapeutic approaches have been explored to sensitize HCC cells to TRAIL-induced apoptosis. We are wondering whether and how Notch1 signaling can enhance the sensitivity of HCC cells to TRAIL-induced apoptosis. In this study, we found that overexpression of ICN, the constitutive activated form of Notch1, up-regulated p53 protein expression in HCC cells by inhibiting proteasome degradation. p53 up-regulation was further observed in human primary hepatocellular carcinoma cells after activation of Notch signaling. Inhibition of the Akt/Hdm2 pathway by Notch1 signaling was responsible for the suppression of p53 proteasomal degradation, thus contributing to the Notch1 signaling-mediated up-regulation of p53 expression. Accordingly, Notch1 signaling could make HCC cells more sensitive to TRAIL-induced apoptosis, whereas Notch1 signaling lost the synergistic promotion of TRAIL-induced apoptosis in p53-silenced HepG2 HCC cells and p53-defective Hep3B HCC cells. The data suggest that enhancement of TRAIL-induced apoptosis by Notch1 signaling is dependent upon p53 up-regulation. Furthermore, Notch1 signaling could enhance DR5 expression in a p53-dependent manner. Taken together, Notch1 signaling sensitizes TRAIL-induced apoptosis in HCC cells by inhibiting Akt/Hdm2-mediated p53 degradation and up-regulating p53-dependent DR5 expression. Thus, our results suggest that activation of Notch1 signaling may be a promising approach to improve the therapeutic efficacy of TRAIL-resistant HCC. PMID:19376776

Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

PubMed

Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

2011-09-27

Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

PubMed

Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

2018-05-18

The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells*

PubMed Central

de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

2016-01-01

O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830

The Role of JMY in p53 Regulation.

PubMed

Adighibe, Omanma; Pezzella, Francesco

2018-05-31

Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

Induction of apoptosis in Ehrlich ascites tumour cells via p53 activation by a novel small-molecule MDM2 inhibitor - LQFM030.

PubMed

da Mota, Mariana F; Cortez, Alane P; Benfica, Polyana L; Rodrigues, Bruna Dos S; Castro, Thalyta F; Macedo, Larissa M; Castro, Carlos H; Lião, Luciano M; de Carvalho, Flávio S; Romeiro, Luiz A S; Menegatti, Ricardo; Verli, Hugo; Villavicencio, Bianca; Valadares, Marize C

2016-09-01

The activation of the p53 pathway through the inhibition of MDM2 has been proposed as a novel therapeutic strategy against tumours. A series of cis-imidazoline analogues, termed nutlins, were reported to displace the recombinant p53 protein from its complex with MDM2 by binding to MDM2 in the p53 pocket, and exhibited an antitumour activity both in vitro and in vivo. Thus, the purpose of this study was to evaluate the antitumour properties of LQFM030 (2), a nutlin analogue created by employing the strategy of molecular simplification. LQFM030 (2) cytotoxicity was evaluated in Ehrlich ascites tumour (EAT) cells, p53 wild type, by the trypan blue exclusion test, and the mechanisms involved in EAT cell death were investigated by light and fluorescence microscopy, flow cytometry, real-time PCR and Western blotting. Our results demonstrate that LQFM030 has dose-dependent antiproliferative activity and cytotoxic activity on EAT cells, induces the accumulation of p53 protein and promotes cell cycle arrest and apoptosis. p53 gene transcription was unaffected by LQFM030 (2); however, MDM2 mRNA increased and MDM2 protein decreased. These results suggest that the small-molecule p53 activator LQFM030 (2) has the potential for further development as a novel cancer therapeutic agent. © 2016 Royal Pharmaceutical Society.

p53 downregulates the Fanconi anaemia DNA repair pathway

PubMed Central

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-01-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

p53 downregulates the Fanconi anaemia DNA repair pathway.

PubMed

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

PubMed Central

Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

2006-01-01

The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

PubMed

Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

2012-02-01

Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

PubMed

Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

2016-07-02

Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

Fluoride induces apoptosis via inhibiting SIRT1 activity to activate mitochondrial p53 pathway in human neuroblastoma SH-SY5Y cells.

PubMed

Tu, Wei; Zhang, Qian; Liu, Yin; Han, Lianyong; Wang, Qin; Chen, Panpan; Zhang, Shun; Wang, Aiguo; Zhou, Xue

2018-05-15

There has been a great concern about the neurotoxicity of fluoride since it can pass through the blood-brain barrier and accumulate in the brain. It has been suggested that apoptosis plays a vital role in neurotoxicity of fluoride. However, whether p53-mediated apoptotic pathway is involved is still unclear. Our results showed that apoptosis was induced after treatment with 40 and 60 mg/L of NaF for 24 h in human neuroblastoma SH-SY5Y cells. Exposure to 60 mg/L of NaF for 24 h significantly upregulated the levels of p53 and apoptosis-related proteins including PUMA, cytochrome c (cyto c), cleaved caspase-3 and cleaved PARP, whereas downregulated Bcl-2 in SH-SY5Y cells. Meanwhile, fluoride increased p53 nuclear translocation, cyto c release from mitochondria to cytoplasm and mitochondrial translocation of Bax in SH-SY5Y cells. Fluoride-induced increases of apoptotic rates and apoptosis-related protein levels were significantly attenuated by inhibiting p53 transcriptional activity with pifithrin-α. In addition, fluoride inhibited the deacetylase activity of SIRT1 and increased p53 (acetyl K382) level in SH-SY5Y cells. Apoptosis and upregulation of cleaved caspase-3, cleaved PARP and p53 (acetyl K382) induced by fluoride could be ameliorated by SIRT1 overexpression or its activator resveratrol in SH-SY5Y cells. Taken together, our study demonstrates that fluoride induces apoptosis by inhibiting the deacetylase activity of SIRT1 to activate mitochondrial p53 pathway in SH-SY5Y cells, which depends on p53 transcriptional activity. Thus, SIRT1 may be a promising target to protect against neurotoxicity induced by fluoride. Copyright © 2018 Elsevier Inc. All rights reserved.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

PubMed

Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

2018-06-01

The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

PubMed

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

PubMed Central

2014-01-01

Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies. PMID:24927749

Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leão, Mariana; Gomes, Sara; Bessa, Cláudia

In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either permore » se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.« less

Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.

PubMed

Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M

2009-10-01

The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.

A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

PubMed Central

Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

2018-01-01

Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

PubMed Central

Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

2016-01-01

Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

PubMed

Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

2013-05-01

DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

PubMed

Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

2016-01-05

On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

PubMed Central

Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

2016-01-01

On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

WNT activation by lithium abrogates TP53 mutation associated radiation resistance in medulloblastoma.

PubMed

Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri

2014-12-24

TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.

Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation.

PubMed

Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P; Whelan, Rebecca J; Patankar, Manish S

2016-06-08

The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors.

Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation

PubMed Central

Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P.; Whelan, Rebecca J.; Patankar, Manish S.

2016-01-01

The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors. PMID:27270209

Integrated High Throughput Analysis Identifies GSK3 as a Crucial Determinant of p53-Mediated Apoptosis in Lung Cancer Cells.

PubMed

Zhang, Yu; Zhu, Chenyang; Sun, Bangyao; Lv, Jiawei; Liu, Zhonghua; Liu, Shengwang; Li, Hai

2017-01-01

p53 dysfunction is frequently observed in lung cancer. Although restoring the tumour suppressor function of p53 is recently approved as a putative strategy for combating cancers, the lack of understanding of the molecular mechanism underlying p53-mediated lung cancer suppression has limited the application of p53-based therapies in lung cancer. Using RNA sequencing, we determined the transcriptional profile of human non-small cell lung carcinoma A549 cells after treatment with two p53-activating chemical compounds, nutlin and RITA, which could induce A549 cell cycle arrest and apoptosis, respectively. Bioinformatics analysis of genome-wide gene expression data showed that distinct transcription profiles were induced by nutlin and RITA and 66 pathways were differentially regulated by these two compounds. However, only two of these pathways, 'Adherens junction' and 'Axon guidance', were found to be synthetic lethal with p53 re-activation, as determined via integrated analysis of genome-wide gene expression profile and short hairpin RNA (shRNA) screening. Further functional protein association analysis of significantly regulated genes associated with these two synthetic lethal pathways indicated that GSK3 played a key role in p53-mediated A549 cell apoptosis, and then gene function study was performed, which revealed that GSK3 inhibition promoted p53-mediated A549 cell apoptosis in a p53 post-translational activity-dependent manner. Our findings provide us with new insights regarding the mechanism by which p53 mediates A549 apoptosis and may cast light on the development of more efficient p53-based strategies for treating lung cancer. © 201 The Author(s). Published by S. Karger AG, Basel.

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

PubMed Central

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-01-01

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

PubMed

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

PubMed

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-08-27

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

PubMed Central

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-01-01

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096

Delayed cell cycle progression in selenoprotein W depleted cells is regulated by a mitogen-activated protein kinase kinase 4–p38–p53 pathway

USDA-ARS?s Scientific Manuscript database

Selenoprotein W (SEPW1) is a ubiquitous, highly conserved thioredoxin-like protein whose depletion causes a p53- and p21Cip1-dependent G1-phase cell cycle arrest in breast and prostate epithelial cells. SEPW1 depletion increases phosphorylation of Ser33 in p53, which is associated with decreased p53...

Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

PubMed Central

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

2016-01-01

Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

PubMed

Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

2012-06-01

Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

PubMed

Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

2010-11-01

Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

Bim directly antagonizes Bcl-xl in doxorubicin-induced prostate cancer cell apoptosis independently of p53.

PubMed

Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei

2016-01-01

Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.

Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53

PubMed Central

York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.

2016-01-01

Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821

Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

PubMed

York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

2017-09-01

Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

PubMed

Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

2017-04-01

Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

PubMed

Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

2018-03-01

Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

Reciprocal regulation of p53 and malic enzymes modulates metabolism and senescence.

PubMed

Jiang, Peng; Du, Wenjing; Mancuso, Anthony; Wellen, Kathryn E; Yang, Xiaolu

2013-01-31

Cellular senescence both protects multicellular organisms from cancer and contributes to their ageing. The pre-eminent tumour suppressor p53 has an important role in the induction and maintenance of senescence, but how it carries out this function remains poorly understood. In addition, although increasing evidence supports the idea that metabolic changes underlie many cell-fate decisions and p53-mediated tumour suppression, few connections between metabolic enzymes and senescence have been established. Here we describe a new mechanism by which p53 links these functions. We show that p53 represses the expression of the tricarboxylic-acid-cycle-associated malic enzymes ME1 and ME2 in human and mouse cells. Both malic enzymes are important for NADPH production, lipogenesis and glutamine metabolism, but ME2 has a more profound effect. Through the inhibition of malic enzymes, p53 regulates cell metabolism and proliferation. Downregulation of ME1 and ME2 reciprocally activates p53 through distinct MDM2- and AMP-activated protein kinase-mediated mechanisms in a feed-forward manner, bolstering this pathway and enhancing p53 activation. Downregulation of ME1 and ME2 also modulates the outcome of p53 activation, leading to strong induction of senescence, but not apoptosis, whereas enforced expression of either malic enzyme suppresses senescence. Our findings define physiological functions of malic enzymes, demonstrate a positive-feedback mechanism that sustains p53 activation, and reveal a connection between metabolism and senescence mediated by p53.

Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach

DTIC Science & Technology

2006-01-01

B) Cells were transfected with 1 mg of the indicated luciferase reporter constructs and 50 ng of pRL- Renilla . 24 hrs post transfections p53 was...induced by removal of tetracyline. Cells were lysed and assayed for luciferase and Renilla activities 24 hrs after induction of p53. The indicated

Curcumin induces permanent growth arrest of human colon cancer cells: link between senescence and autophagy.

PubMed

Mosieniak, Grazyna; Adamowicz, Marek; Alster, Olga; Jaskowiak, Hubert; Szczepankiewicz, Andrzej A; Wilczynski, Grzegorz M; Ciechomska, Iwona A; Sikora, Ewa

2012-06-01

Curcumin, a natural polyphenol derived from the rhizome of Curcuma longa, is a potent anticancer agent, which restricts tumor cell growth both in vitro and in vivo. Thus far curcumin was shown to induce death of cancer cells. This study reports the induction of cellular senescence of human colon cancer cells HCT116 upon curcumin treatment. The SA-β-galactosidase activation was observed both in p53+/+ and p53-/- cells, however the latter ones were less sensitive to the prosenescent activity of curcumin. Upregulation of p53 and p21 proteins was observed in p53+/+ HCT116, while p53-independent induction of p21 was noticed in p53-/- HCT116. Moreover, the senescence of HCT116 cells was accompanied by autophagy, that was confirmed by electron microscopy observations of autophagosomes in the curcumin-treated cells as well as LC3-II expression, punctue staining of LC3 and increased content of acidic vacuoles. Inhibition of autophagy, due to the diminished expression of ATG5 by RNAi decreased the number of senescent cells induced by curcumin, but did not lead to increased cell death. Altogether, we demonstrated a new antitumor activity of curcumin leading to cancer cell senescence and revealed the presence of a functional link between senescence and autophagy in curcumin-treated cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

Novel function of STAT1beta in B cells: induction of cell death by a mechanism different from that of STAT1alpha.

PubMed

Najjar, Imen; Schischmanoff, Pierre Olivier; Baran-Marszak, Fanny; Deglesne, Pierre-Antoine; Youlyouz-Marfak, Ibtissam; Pampin, Mathieu; Feuillard, Jean; Bornkamm, Georg W; Chelbi-Alix, Mounira K; Fagard, Remi

2008-12-01

Alternate splicing of STAT1 produces two isoforms: alpha, known as the active form, and beta, previously shown to act as a dominant-negative factor. Most studies have dealt with STAT1alpha, showing its involvement in cell growth control and cell death. To examine the specific function of either isoform in cell death, a naturally STAT1-deficient human B cell line was transfected to express STAT1alpha or STAT1beta. STAT1alpha, expressed alone, enhanced cell death, potentiated the fludarabine-induced apoptosis, and enhanced the nuclear location, the phosphorylation, and the transcriptional activity of p53. Unexpectedly, STAT1beta, expressed alone, induced cell death through a mechanism that was independent of the nuclear function of p53. Indeed, in STAT1beta-expressing B cells, p53 was strictly cytoplasmic where it formed clusters, and there was no induction of the transcriptional activity of p53. These data reveal a novel role of STAT1beta in programmed cell death, which is independent of p53.

Induction of Mitotic Cell Death by Overriding G2/M Checkpoint in Endometrial Cancer Cells with Non-functional p53

PubMed Central

Meng, Xiangbing; Laidler, Laura L.; Kosmacek, Elizabeth A.; Yang, Shujie; Xiong, Zhi; Zhu, Danlin; Wang, Xinjun; Dai, Donghai; Zhang, Yuping; Wang, Xiaofang; Brachova, Pavla; Albitar, Lina; Liu, Dawei; Ianzini, Fiorenza; Mackey, Michael A.; Leslie, Kimberly K.

2012-01-01

Objective Endometrial tumors with non-functional p53, such as serous uterine endometrial carcinomas, are aggressive malignancies with a poor outcome, yet they have an Achilles’ heel: due to loss of p53 function, these tumors may be sensitive to treatments which abrogate the G2/M checkpoint. Our objective was to exploit this weakness to induce mitotic cell death using two strategies: (1) EGFR inhibitor gefitinib combined with paclitaxel to arrest cells at mitosis, or (2) BI2536, an inhibitor of polo-like kinase 1 (PLK1), to block PLK1 activity. Methods We examined the impact of combining gefitinib and paclitaxel or PLK1 inhibitor on expression of G2/M checkpoint controllers, cell viability, and cell cycle progression in endometrial cancer cells with mutant p53. Results In cells lacking normal p53 activity, each treatment activated CDC25C and inactivated Wee1, which in turn activated cdc2 and sent cells rapidly through the G2/M checkpoint and into mitosis. Live cell imaging demonstrated irreversible mitotic arrest and eventual cell death. Combinatorial therapy with paclitaxel and gefitinib was highly synergistic and resulted in a 10-fold reduction in the IC50 for paclitaxel, from 14 nM as a single agent to 1.3 nM in the presence of gefitinib. However, BI2536 alone at low concentrations (5 nM) was the most effective treatment and resulted in massive mitotic cell death. In a xenograft mouse model with p53-deficient cells, low dose BI2536 significantly inhibited tumor growth. Conclusions These findings reveal induction of mitotic cell death as a therapeutic strategy for endometrial tumors lacking functional p53. PMID:23146687

Downregulated long non-coding RNA MEG3 in breast cancer regulates proliferation, migration and invasion by depending on p53’s transcriptional activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Lin; Li, Yu; Yang, Bangxiang, E-mail: b19933009@qq.coom

Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition ofmore » proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.« less

p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

PubMed Central

Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

2011-01-01

Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

Reversion of apoptotic resistance of TP53-mutated Burkitt lymphoma B-cells to spindle poisons by exogenous activation of JNK and p38 MAP kinases.

PubMed

Farhat, M; Poissonnier, A; Hamze, A; Ouk-Martin, C; Brion, J-D; Alami, M; Feuillard, J; Jayat-Vignoles, C

2014-05-01

Defects in apoptosis are frequently the cause of cancer emergence, as well as cellular resistance to chemotherapy. These phenotypes may be due to mutations of the tumor suppressor TP53 gene. In this study, we examined the effect of various mitotic spindle poisons, including the new isocombretastatin derivative isoNH2CA-4 (a tubulin-destabilizing molecule, considered to bind to the colchicine site by analogy with combretastatin A-4), on BL (Burkitt lymphoma) cells. We found that resistance to spindle poison-induced apoptosis could be reverted in tumor protein p53 (TP53)-mutated cells by EBV (Epstein Barr virus) infection. This reversion was due to restoration of the intrinsic apoptotic pathway, as assessed by relocation of the pro-apoptotic molecule Bax to mitochondria, loss of mitochondrial integrity and activation of the caspase cascade with PARP (poly ADP ribose polymerase) cleavage. EBV sensitized TP53-mutated BL cells to all spindle poisons tested, including vincristine and taxol, an effect that was systematically downmodulated by pretreatment of cells with inhibitors of p38 and c-Jun N-terminal kinase (JNK) mitogen-activated protein kinases. Exogenous activation of p38 and JNK pathways by dihydrosphingosine reverted resistance of TP53-mutated BL cells to spindle poisons. Dihydrosphingosine treatment of TP53-deficient Jurkat and K562 cell lines was also able to induce cell death. We conclude that activation of p38 and JNK pathways may revert resistance of TP53-mutated cells to spindle poisons. This opens new perspectives for developing alternative therapeutic strategies when the TP53 gene is inactivated.

Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

PubMed Central

Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

2016-01-01

The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

Cyclin-dependent kinases regulate apoptosis of intestinal epithelial cells

PubMed Central

Bhattacharya, Sujoy; Ray, Ramesh M.; Johnson, Leonard R.

2014-01-01

Homeostasis of the gastrointestinal epithelium is dependent upon a balance between cell proliferation and apoptosis. Cyclin-dependent kinases (Cdks) are well known for their role in cell proliferation. Previous studies from our group have shown that polyamine-depletion of intestinal epithelial cells (IEC-6) decreases cyclin-dependent kinase 2 (Cdk2) activity, increases p53 and p21Cip1 protein levels, induces G1 arrest, and protects cells from camptothecin (CPT)-induced apoptosis. Although emerging evidence suggests that members of the Cdk family are involved in the regulation of apoptosis, their roles directing apoptosis of IEC-6 cells are not known. In this study, we report that inhibition of Cdk1, 2, and 9 (with the broad range Cdk inhibitor, AZD5438) in proliferating IEC-6 cells triggered DNA damage, activated p53 signaling, inhibited proliferation, and induced apoptosis. By contrast, inhibition of Cdk2 (with NU6140) increased p53 protein and activity, inhibited proliferation, but had no effect on apoptosis. Notably, AZD5438 sensitized, whereas, NU6140 rescued proliferating IEC-6 cells from CPT-induced apoptosis. However, in colon carcinoma (Caco2) cells with mutant p53, treatment with either AZD5438 or NU6140 blocked proliferation, albeit more robustly with AZD5438. Both Cdk inhibitors induced apoptosis in Caco2 cells in a p53-independent manner. In serum starved quiescent IEC-6 cells, both AZD5438 and NU6140 decreased TNF- /CPT-induced activation of p53 and, consequently, rescued cells from apoptosis, indicating that sustained Cdk activity is required for apoptosis of quiescent cells. Furthermore, AZD5438 partially reversed the protective effect of polyamine depletion whereas NU6140 had no effect. Together, these results demonstrate that Cdks possess opposing roles in the control of apoptosis in quiescent and proliferating cells. In addition, Cdk inhibitors uncouple proliferation from apoptosis in a p53-dependent manner. PMID:24242917

Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Sang Eun; Min, Yong Ki; Ha, Jae Du

2007-07-06

Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser{sup 6}, Ser{sup 15}, and Ser{sup 20}, which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21{sup WAF1/CIP}. Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular targetmore » of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent.« less

Wild-type p53 reactivation by small-molecule Minnelide™ in human papillomavirus (HPV)-positive head and neck squamous cell carcinoma.

PubMed

Caicedo-Granados, Emiro; Lin, Rui; Fujisawa, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok

2014-12-01

The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

PubMed Central

Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

2014-01-01

The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

PubMed

Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

1998-01-01

A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

Phosphorylation of p53 modifies sensitivity to ionizing radiation.

PubMed

Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi

2011-06-01

Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.

Modulation of p53 cellular function and cell death by African swine fever virus.

PubMed

Granja, Aitor G; Nogal, María L; Hurtado, Carolina; Salas, José; Salas, María L; Carrascosa, Angel L; Revilla, Yolanda

2004-07-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells.

Modulation of p53 Cellular Function and Cell Death by African Swine Fever Virus

PubMed Central

Granja, Aitor G.; Nogal, María L.; Hurtado, Carolina; Salas, José; Salas, María L.; Carrascosa, Angel L.; Revilla, Yolanda

2004-01-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells. PMID:15194793

Effects of the Kava Chalcone Flavokawain A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53

PubMed Central

Tang, Yaxiong; Simoneau, Anne R.; Xie, Jun; Shahandeh, Babbak; Zi, Xiaolin

2010-01-01

Flavokawain A is the predominant chalcone from kava extract. We have assessed the mechanisms of flavokawain A's action on cell cycle regulation. In a p53 wild-type, low-grade, and papillary bladder cancer cell line (RT4), flavokawain A increased p21/WAF1 and p27/KIP1, which resulted in a decrease in cyclin-dependent kinase-2 (CDK2) kinase activity and subsequent G1 arrest. The increase of p21/WAF1 protein corresponded to an increased mRNA level, whereas p27/KIP1 accumulation was associated with the down-regulation of SKP2 and then increased the stability of the p27/KIP1 protein. The accumulation of p21/WAF1 and p27/KIP1 was independent of cell cycle position and thus not a result of the cell cycle arrest. In contrast, flavokawain A induced a G2-M arrest in six p53 mutant-type, high-grade bladder cancer cell lines (T24, UMUC3, TCCSUP, 5637, HT1376, and HT1197). Flavokawain A significantly reduced the expression of CDK1-inhibitory kinases, Myt1 and Wee1, and caused cyclin B1 protein accumulation leading to CDK1 activation in T24 cells. Suppression of p53 expression by small interfering RNA in RT4 cells restored Cdc25C expression and down-regulated p21/WAF1 expression, which allowed Cdc25C and CDK1 activation and then led to a G2-M arrest and an enhanced growth-inhibitory effect by flavokawain A. Consistently, flavokawain A also caused a pronounced CDK1 activation and G2-M arrest in p53 knockout but not in p53 wild-type HCT116 cells. This selectivity of flavokawain A for inducing a G2-M arrest in p53-defective cells deserves further investigation as a new mechanism for the prevention and treatment of bladder cancer. PMID:19138991

Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

PubMed

Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

2017-08-01

Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

PubMed

Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

2015-03-01

The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

PubMed

Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

2017-01-01

The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

PubMed Central

Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

2013-01-01

The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

PubMed

Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

2016-01-01

Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

2014-06-15

Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less

COH-203, a novel microtubule inhibitor, exhibits potent anti-tumor activity via p53-dependent senescence in hepatocellular carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, Huan; Zuo, Dai-Ying; Bai, Zhao-Shi

Highlights: • COH-203 exhibits anti-hepatoma effects in vitro and in vivo with low toxicity. • COH-203 inhibits tubulin polymerization. • COH-203 induces mitotic arrest followed by mitotic slippage in BEL-7402 cells. • COH-203 induces p53-dependent senescence in BEL-7402 cells. - Abstract: 5-(3-Hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-3H-1, 2-dithiol-3-one (COH-203) is a novel synthesized analogue of combretastatin A-4 that can be classified as a microtubule inhibitor. In this study, we evaluated the anti-hepatoma effect of COH-203 in vitro and in vivo and explored the underlying molecular mechanisms. COH-203 was shown to be more effective in inhibiting the proliferation of liver cancer cells compared with normal livermore » cells. COH-203 also displayed potent anti-tumor activity in a hepatocellular carcinoma xenograft model without significant toxicity. Mechanistic studies demonstrated that treatment with COH-203 induced mitotic arrest by inhibiting tubulin polymerization in BEL-7402 liver cancer cells. Long-term COH-203 treatment in BEL-7402 cells led to mitotic slippage followed by senescence via the p14{sup Arf}–p53–p21 and p16{sup INK4α}–Rb pathways. Furthermore, suppression of p53 via pifithrin-α (p53 inhibitor) and p53-siRNA attenuated COH-203-induced senescence in BEL-7402 cells, suggesting that COH-203 induced senescence p53-dependently. In conclusion, we report for the first time that COH-203, one compound in the combretastatin family, promotes anti-proliferative activity through the induction of p-53 dependent senescence. Our findings will provide a molecular rationale for the development of COH-203 as a promising anti-tumor agent.« less

The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522; Tooyama, Ikuo

2012-04-13

Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor ofmore » p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.« less

Extracellular NAMPT/visfatin causes p53 deacetylation via NAD production and SIRT1 activation in breast cancer cells.

PubMed

Behrouzfar, Kiarash; Alaee, Mohammad; Nourbakhsh, Mitra; Gholinejad, Zafar; Golestani, Abolfazl

2017-08-01

Visfatin, which is secreted as an adipokine and cytokine, has been implicated in cancer development and progression. In this study, we investigated the NAD-producing ability of visfatin and its relationship with SIRT1 (silent information regulator 2) and p53 to clarify the role of visfatin in breast cancer. MCF-7 breast cancer cells were cultured and treated with visfatin. SIRT1 activity was assessed by measuring fluorescence intensity from fluoro-substrate peptide. To investigate the effect of visfatin on p53 acetylation, SDS-PAGE followed by western blotting was performed using specific antibodies against p53 and its acetylated form. Total NAD was measured both in cell lysate and the extracellular medium by colorimetric method. Visfatin increased both extracellular and intracellular NAD concentrations. It also induced proliferation of breast cancer cells, an effect that was abolished by inhibition of its enzymatic activity. Visfatin significantly increased SIRT1 activity, accompanied by induction of p53 deacetylation. In conclusion, the results show that extracellular visfatin produces NAD that causes upregulation of SIRT1 activity and p53 deacetylation. These findings explain the relationship between visfatin and breast cancer progression. Copyright © 2017 John Wiley & Sons, Ltd.

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance.

PubMed

Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R

2016-04-12

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.

Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

PubMed

Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

2017-11-03

Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.

Proton induces apoptosis of hypoxic tumor cells by the p53-dependent and p38/JNK MAPK signaling pathways.

PubMed

Lee, Kheun Byeol; Kim, Kye-Ryung; Huh, Tae-Lin; Lee, You Mie

2008-12-01

Tumor hypoxia is a main obstacle for radiation therapy. To investigate whether exposure to a proton beam can overcome radioresistance in hypoxic tumor cells, three kinds of cancer cells, Lewis lung carcinoma (LLC) cells, hepatoma HepG2 and Molt-4 leukemia cells, were treated with a proton beam (35 MeV, 1, 2, 5, 10 Gy) in the presence or absence of hypoxia. Cell death rates were determined 72 h after irradiation. Hypoxic cells exposed to the proton beam underwent a typical apoptotic program, showing condensed nuclei, fragmented DNA ladders, and poly-ADP-ribose polymerase (PARP) cleavage. Fluorescence-activated cell sorter analysis revealed a significant increase in Annexin-V-positive cells. Cells treated with the proton beam and hypoxia displayed increased expression of p53, p21 and Bax, but decreased levels of phospho-Rb, Bcl-2 and XIAP, as well as activated caspase-9 and -3. The proton beam with hypoxia induced cell death in wild-type HCT116 cells, but not in a p53 knockout cell line, demonstrating a requirement for p53. As reactive oxygen species (ROS) were also significantly increased, apoptosis could also be abolished by treatment with the anti-oxidant N-acetyl cysteine (NAC). P38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) were activated by the treatment, and their respective DN mutants restored the cell death induced by either proton therapy alone or with hypoxia. In conclusion, proton beam treatment did not differently regulate cancer cell apoptosis either in normoxic or hypoxic conditions via a p53-dependent mechanism and by the activation of p38/JNK MAPK pathways through ROS.

Hepatitis C virus Core overcomes all-trans retinoic acid-induced apoptosis in human hepatoma cells by inhibiting p14 expression via DNA methylation

PubMed Central

Kwak, Juri; Choi, Jung-Hye; Jang, Kyung Lib

2017-01-01

All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, is known to induce p14 expression via promoter hypomethylation to activate the p14-MDM2-p53 pathway, which leads to activation of the p53-dependent apoptotic pathway and subsequent induction of apoptosis in human hepatoma cells. In the present study, we found that hepatitis C virus (HCV) Core derived from ectopic expression or HCV infection overcomes ATRA-induced apoptosis in p53-positive hepatoma cells. For this effect, HCV Core upregulated both protein levels and enzyme activities of DNA methyltransferase 1 (DNMT1), DNMT3a, and DNMT3b and thereby repressed p14 expression via promoter hypermethylation, resulting in inactivation of the pathway leading to p53 accumulation in the presence of ATRA. As a result, HCV Core prevented ATRA from activating several apoptosis-related molecules, including Bax, p53 upregulated modulator of apoptosis, caspase-9, caspase-3, and poly (ADP-ribose) polymerase. In addition, complementation of p14 in the Core-expressing cells by either ectopic expression or treatment with 5-Aza-2′dC almost completely abolished the potential of HCV Core to suppress ATRA-induced apoptosis. Based on these observations, we conclude that HCV Core executes its oncogenic potential by suppressing the p53-dependent apoptosis induced by ATRA in human hepatoma cells. PMID:29156743

Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53

PubMed Central

Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich

2011-01-01

Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600

MG132 plus apoptosis antigen-1 (APO-1) antibody cooperate to restore p53 activity inducing autophagy and p53-dependent apoptosis in HPV16 E6-expressing keratinocytes.

PubMed

Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio

2017-01-01

The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.

TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, Li; College of Life Sciences, Hainan Normal University, Haikou, Hainan 571158; Huang, Yong

2014-03-07

Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressedmore » cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence.« less

Adenovirally mediated p53 overexpression diversely influence the cell cycle of HEp-2 and CAL 27 cell lines upon cisplatin and methotrexate treatment.

PubMed

Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta

2009-12-01

p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and on the chemotherapeutics' modality of action.

Blocking angiotensin II Type 1 receptor triggers apoptotic cell death in human pancreatic cancer cells.

PubMed

Gong, Qiaoke; Davis, Molly; Chipitsyna, Galina; Yeo, Charles J; Arafat, Hwyda A

2010-07-01

Pancreatic ductal adenocarcinoma (PDA) is an aggressive malignancy with an annual mortality rate close to its annual incidence. We recently demonstrated that angiotensin II (AngII) type 1 receptor (AT1R) might be involved in PDA angiogenesis. This study evaluated the antiproliferative and proapoptotic effects of an AT1R blocker, losartan, in PDA cells with different p53 mutation status. Cell cycle was analyzed by flow cytometric analysis of DNA content; apoptosis by annexin V-fluorescein isothiocyanate (V-FITC) and terminal deoxytransferase (TdT)-mediated dUTP nick-end labeling staining; messenger RNA and protein by real-time polymerase chain reaction and Western blotting; caspase-3 activity by colorimetric assay; and promoter activity by luciferase assay. Losartan dose-dependently decreased cell survival and increased their preG1 accumulation. It also increased p53, p21, p27, and Bax and reduced Bcl-2 and Bcl-xl expression. In wtp53 cells, losartan increased p53 transcription and activated caspase-3 in both cell lines. However, its proapoptotic effects in mtp53 cells were mainly caspase-3-dependent. Our data describe the involvement of AT1R in PDA cell apoptotic machinery and provide the first evidences that losartan stimulates the proapoptotic signaling pathways regardless of the p53 mutation status. As loss of p53 function is frequently observed in PDA patients, our data suggest AT1R blockade as a novel therapeutic strategy to control PDA growth.

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

p205, a potential tumor suppressor, inhibits cell proliferation via multiple pathways of cell cycle regulation.

PubMed

Asefa, Benyam; Dermott, Jonathan M; Kaldis, Philipp; Stefanisko, Karen; Garfinkel, David J; Keller, Jonathan R

2006-02-20

p205 is a member of the interferon-inducible p200 family of proteins that regulate cell proliferation. Over-expression of p205 inhibits cell growth, although its mechanism of action is currently unknown. Therefore, we evaluated the effect of p205 on the p53 and Rb-dependent pathways of cell cycle regulation. p205 expression results in elevated levels of p21, and activates the p21 promoter in vitro in a p53-dependent manner. In addition, p205 induces increased expression of Rb, and binds directly to Rb and p53. Interestingly, p205 also induces growth inhibition independent of p53 and Rb by delaying G2/M progression in proliferating cells, and is a substrate for Cdk2 kinase activity. Finally, we have identified other binding partners of p205 by a yeast two-hybrid screen, including the paired homeodomain protein HoxB2. Taken together, our results indicate that p205 induces growth arrest by interaction with multiple transcription factors that regulate the cell cycle, including but not entirely dependent on the Rb- and p53-mediated pathways of growth inhibition.

Wasabi 6-(methylsulfinyl)hexyl isothiocyanate induces apoptosis in human colorectal cancer cells through p53-independent mitochondrial dysfunction pathway.

PubMed

Yano, Satoshi; Wu, Shusong; Sakao, Kozue; Hou, De-Xing

2018-05-14

6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC), a major bioactive compound in Wasabi [Wasabia japonica (Miq.) Matsum.], has revealed the inhibitory effect on colon carcinogenesis in rat cancer model although the underlying mechanism is unclear. In this study, we used two types of human colorectal cancer cells (HCT116 p53 +/+ and HCT116 p53 -/- ) to investigate the anticancer activity and molecular mechanisms of 6-MSITC. Interestingly, 6-MSITC inhibited the cell proliferation in both types of cells with similar IC 50 value although a light increase in the phosphorylation and accumulation of P53 protein was observed in HCT116 p53 +/+ cells at 24 h after treatment. In addition, 6-MSITC increased the ratio of proapoptotic cells in both types of cells with the same fashion in a p53-independent manner. The data from mitochondrial analysis revealed that 6-MSITC enhanced the ratio of proapoptotic B-cell lymphoma-2-associated X protein/antiapoptotic myeloid cell leukemia 1, and sequentially caused mitochondrial membrane potential (ΔΨ m ) loss, cytochrome c release, and caspase-3 activation in both types of cells. Taken together, Wasabi 6-MSITC induced apoptosis of human colorectal cancer cells in p53-independent mitochondrial dysfunction pathway. These findings suggest that 6-MSITC might be a potential agent for colon cancer chemoprevention although with p53 mutation. © 2018 BioFactors, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

New Insights into the Mechanism of Inhibition of p53 by Simian Virus 40 Large T Antigen

PubMed Central

Sheppard, Hilary M.; Corneillie, Siska I.; Espiritu, Christine; Gatti, Andrea; Liu, Xuan

1999-01-01

Simian virus 40 (SV40) large tumor antigen (T antigen) has been shown to inhibit p53-dependent transcription by preventing p53 from binding to its cognate cis element. Data presented in this report provide the first direct functional evidence that T antigen, under certain conditions, may also repress p53-dependent transcription by a mechanism in which the transactivation domain of p53 is abrogated while DNA binding is unaffected. Specifically, p53 purified as a complex with T antigen from mouse cells was found to bind DNA as a transcriptionally inactive intact complex, while that purified from human cells was found to bind DNA independently of T antigen and could activate p53-dependent transcription. This difference in activity may be dependent on a different interaction of T antigen with mouse and human p53 and, in addition, on the presence of super T, which is found only in transformed rodent cells. These results suggest that subtle yet important differences exist between the inhibition of p53 by T antigen in mouse and human cells. The implications of this finding with respect to SV40-associated malignancies are discussed. PMID:10082540

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

PubMed

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Isoindolinone inhibitors of the murine double minute 2 (MDM2)-p53 protein-protein interaction: structure-activity studies leading to improved potency.

PubMed

Hardcastle, Ian R; Liu, Junfeng; Valeur, Eric; Watson, Anna; Ahmed, Shafiq U; Blackburn, Timothy J; Bennaceur, Karim; Clegg, William; Drummond, Catherine; Endicott, Jane A; Golding, Bernard T; Griffin, Roger J; Gruber, Jan; Haggerty, Karen; Harrington, Ross W; Hutton, Claire; Kemp, Stuart; Lu, Xiaohong; McDonnell, James M; Newell, David R; Noble, Martin E M; Payne, Sara L; Revill, Charlotte H; Riedinger, Christiane; Xu, Qing; Lunec, John

2011-03-10

Inhibition of the MDM2-p53 interaction has been shown to produce an antitumor effect, especially in MDM2 amplified tumors. The isoindolinone scaffold has proved to be versatile for the discovery of MDM2-p53 antagonists. Optimization of previously reported inhibitors, for example, NU8231 (7) and NU8165 (49), was guided by MDM2 NMR titrations, which indicated key areas of the binding interaction to be explored. Variation of the 2-N-benzyl and 3-alkoxy substituents resulted in the identification of 3-(4-chlorophenyl)-3-((1-(hydroxymethyl)cyclopropyl)methoxy)-2-(4-nitrobenzyl)isoindolin-1-one (74) as a potent MDM2-p53 inhibitor (IC(50) = 0.23 ± 0.01 μM). Resolution of the enantiomers of 74 showed that potent MDM2-p53 activity primarily resided with the (+)-R-enantiomer (74a; IC(50) = 0.17 ± 0.02 μM). The cellular activity of key compounds has been examined in cell lines with defined p53 and MDM2 status. Compound 74a activates p53, MDM2, and p21 transcription in MDM2 amplified cells and shows moderate selectivity for wild-type p53 cell lines in growth inhibition assays.

RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice

PubMed Central

Herold, Marco J.

2016-01-01

Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

p53 Restoration in Induction and Maintenance of Senescence: Differential Effects in Premalignant and Malignant Tumor Cells

PubMed Central

Harajly, Mohamad; Zalzali, Hasan; Nawaz, Zafar; Ghayad, Sandra E.; Ghamloush, Farah; Basma, Hussein; Zainedin, Samiha; Rabeh, Wissam; Jabbour, Mark; Tawil, Ayman; Badro, Danielle A.; Evan, Gerard I.

2015-01-01

The restoration of p53 has been suggested as a therapeutic approach in tumors. However, the timing of p53 restoration in relation to its efficacy during tumor progression still is unclear. We now show that the restoration of p53 in murine premalignant proliferating pineal lesions resulted in cellular senescence, while p53 restoration in invasive pineal tumors did not. The effectiveness of p53 restoration was not dependent on p19Arf expression but showed an inverse correlation with Mdm2 expression. In tumor cells, p53 restoration became effective when paired with either DNA-damaging therapy or with nutlin, an inhibitor of p53-Mdm2 interaction. Interestingly, the inactivation of p53 after senescence resulted in reentry into the cell cycle and rapid tumor progression. The evaluation of a panel of human supratentorial primitive neuroectodermal tumors (sPNET) showed low activity of the p53 pathway. Together, these data suggest that the restoration of the p53 pathway has different effects in premalignant versus invasive pineal tumors, and that p53 activation needs to be continually sustained, as reversion from senescence occurs rapidly with aggressive tumor growth when p53 is lost again. Finally, p53 restoration approaches may be worth exploring in sPNET, where the p53 gene is intact but the pathway is inactive in the majority of examined tumors. PMID:26598601

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

PubMed Central

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-01-01

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

PubMed

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-12-13

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53{sup Ser-15} phosphorylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader

2009-06-12

Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser{sup 15}. Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not preventmore » Dubca cell apoptosis, suggesting that p53{sup Ser-15} phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.« less

JS-K, a GST-activated nitric oxide donor prodrug, enhances chemo-sensitivity in renal carcinoma cells and prevents cardiac myocytes toxicity induced by Doxorubicin.

PubMed

Qiu, Mingning; Ke, Longzhi; Zhang, Sai; Zeng, Xin; Fang, Zesong; Liu, Jianjun

2017-08-01

Doxorubicin, a highly effective and widely used anthracycline antibiotic in multiple chemotherapy regimens, has been limited by its cardiotoxicity. The aim of this study is to investigate the effect of nitric oxide donor prodrug JS-K on proliferation and apoptosis in renal carcinoma cells and cardiac myocytes toxicity induced by Doxorubicin and to explore possible p53-related mechanism in renal carcinoma cells. The effect of JS-K on anti-cancer activity of Doxorubicin was investigated in renal carcinoma cells via detecting cell proliferation, cytotoxicity, cell death and apoptosis and expressions of apoptotic-related proteins. Effect of p53 on the combination of JS-K and Doxorubicin was determined using p53 inhibitor Pifithrin-α and p53 activator III. Furthermore, the effect of JS-K on cardiac myocytes toxicity of Doxorubicin was investigated in H9c2 (2-1) cardiac myocytes via measuring cell growth, cell death and apoptosis, expressions of proteins involved in apoptosis and intracellular reactive oxygen species. We demonstrated that JS-K could increase Doxorubicin-induced renal carcinoma cell growth suppression and apoptosis and could increase expressions of proteins that are involved in apoptosis. Additionally, Pifithrin-α reversed the promoting effect of JS-K on Doxorubicin-induced renal carcinoma cell apoptosis; conversely, the p53 activator III exacerbated the promoting effect of JS-K on Doxorubicin-induced renal carcinoma cell apoptosis. Furthermore, JS-K protected H9c2 (2-1) cardiac myocytes against Doxorubicin-induced toxicity and decreased Doxorubicin-induced reactive oxygen species production. JS-K enhances the anti-cancer activity of Doxorubicin in renal carcinoma cells by upregulating p53 expression and prevents cardiac myocytes toxicity of Doxorubicin by decreasing oxidative stress.

Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

PubMed

Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

2008-07-01

We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

Anticancer Activity of Marine Sponge Hyrtios sp. Extract in Human Colorectal Carcinoma RKO Cells with Different p53 Status

PubMed Central

Lim, Hyun Kyung; Bae, Woori; Lee, Hyi-Seung

2014-01-01

Drug development using marine bioresources is limited even though the ocean occupies about 70% of the earth and contains a large number of biological materials. From the screening test of the marine sponge extracts, we found Hyrtios sp. sponge collected from Chuuk island, Micronesia. In this study, the Hyrtios sp. extract was examined for anticancer activity against human colorectal carcinoma RKO cells that are wildtype for p53 and RKO-E6 that are p53 defective. The Hyrtios sp. extract dose-dependently inhibited viability in both cell lines. Multinucleation as an indication of mitotic catastrophe was also observed. Cytotoxicity tests gave significantly different results for RKO and RKO-E6 cells after 48 h exposure to Hyrtios sp. extract. In RKO cells treated with Hyrtios sp. extract, cell death occurred by induction of p53 and p21 proteins. In p53-defective RKO-E6 cells, Hyrtios sp. extract decreased expression of JNK protein and increased p21 protein. These results indicate that Hyrtios sp. extract induced apoptosis via different pathways depending on p53 status and could be a good natural product for developing new anticancer drugs. PMID:25243139

The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

PubMed

Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

2014-01-01

TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

Nitric oxide prodrug JS-K inhibits ubiquitin E1 and kills tumor cells retaining wild-type p53.

PubMed

Kitagaki, J; Yang, Y; Saavedra, J E; Colburn, N H; Keefer, L K; Perantoni, A O

2009-01-29

Nitric oxide (NO) is a major effector molecule in cancer prevention. A number of studies have shown that NO prodrug JS-K (O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate) induces apoptotic cell death in vitro and in vivo, indicating that it is a promising new therapeutic for cancer. However, the mechanism of its tumor-killing activity remains unclear. Ubiquitin plays an important role in the regulation of tumorigenesis and cell apoptosis. Our earlier report has shown that inactivation of the ubiquitin system through blocking E1 (ubiquitin-activating enzyme) activity preferentially induces apoptosis in p53-expressing transformed cells. As E1 has an active cysteine residue that could potentially interact with NO, we hypothesized that JS-K could inactivate E1 activity. E1 activity was evaluated by detecting ubiquitin-E1 conjugates through immunoblotting. JS-K strikingly inhibits the ubiquitin-E1 thioester formation in cells in a dose-dependent manner with an IC(50) of approximately 2 microM, whereas a JS-K analog that cannot release NO did not affect these levels in cells. Moreover, JS-K decreases total ubiquitylated proteins and increases p53 levels, which is mainly regulated by ubiquitin and proteasomal degradation. Furthermore, JS-K preferentially induces cell apoptosis in p53-expressing transformed cells. These findings indicate that JS-K inhibits E1 activity and kills transformed cells harboring wild-type p53.

mTOR inhibitors blunt the p53 response to nucleolar stress by regulating RPL11 and MDM2 levels

PubMed Central

Goudarzi, Kaveh M; Nistér, Monica; Lindström, Mikael S

2014-01-01

Mechanistic target of rapamycin (mTOR) is a master regulator of cell growth through its ability to stimulate ribosome biogenesis and mRNA translation. In contrast, the p53 tumor suppressor negatively controls cell growth and is activated by a wide range of insults to the cell. The mTOR and p53 signaling pathways are connected by a number of different mechanisms. Chemotherapeutics that inhibit ribosome biogenesis often induce nucleolar stress and activation of p53. Here we have investigated how the p53 response to nucleolar stress is affected by simultaneous mTOR inhibition in osteosarcoma and glioma cell lines. We found that inhibitors of the mTOR pathway including rapamycin, wortmannin, and caffeine blunted the p53 response to nucleolar stress induced by actinomycin D. Synthetic inhibitors of mTOR (temsirolimus, LY294.002 and PP242) also impaired actinomycin D triggered p53 stabilization and induction of p21. Ribosomal protein (RPL11) is known to be required for p53 protein stabilization following nucleolar stress. Treatment of cells with mTOR inhibitors may lead to reduced synthesis of RPL11 and thereby destabilize p53. We found that rapamycin mimicked the effect of RPL11 depletion in terms of blunting the p53 response to nucleolar stress. However, the extent to which the levels of p53 and RPL11 were reduced by rapamycin varied between cell lines. Additional mechanisms whereby rapamycin blunts the p53 response to nucleolar stress are likely to be involved. Indeed, rapamycin increased the levels of endogenous MDM2 despite inhibition of its phosphorylation at Ser-166. Our findings may have implications for the design of combinatorial cancer treatments with mTOR pathway inhibitors. PMID:25482947

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

ERK mediated upregulation of death receptor 5 overcomes the lack of p53 functionality in the diaminothiazole DAT1 induced apoptosis in colon cancer models: efficiency of DAT1 in Ras-Raf mutated cells.

PubMed

Thamkachy, Reshma; Kumar, Rohith; Rajasekharan, K N; Sengupta, Suparna

2016-03-08

p53 is a tumour suppressor protein that plays a key role in many steps of apoptosis, and malfunctioning of this transcription factor leads to tumorigenesis. Prognosis of many tumours also depends upon the p53 status. Most of the clinically used anticancer compounds activate p53 dependent pathway of apoptosis and hence require p53 for their mechanism of action. Further, Ras/Raf/MEK/ERK axis is an important signaling pathway activated in many cancers. Dependence of diaminothiazoles, compounds that have gained importance recently due to their anticancer and anti angiogenic activities, were tested in cancer models with varying p53 or Ras/Raf mutational status. In this study we have used p53 mutated and knock out colon cancer cells and xenograft tumours to study the role of p53 in apoptosis mediated by diaminothiazoles. Colon cancer cell lines with varying mutational status for Ras or Raf were also used. We have also examined the toxicity and in vivo efficacy of a lead diaminothiazole 4-Amino-5-benzoyl-2-(4-methoxy phenylamino)thiazole (DAT1) in colon cancer xenografts. We have found that DAT1 is active in both in vitro and in vivo models with nonfunctional p53. Earlier studies have shown that extrinsic pathway plays major role in DAT1 mediated apoptosis. In this study, we have found that DAT1 is causing p53 independent upregulation of the death receptor 5 by activating the Ras/Raf/MEK/ERK signaling pathway both in wild type and p53 suppressed colon cancer cells. These findings are also confirmed by the in vivo results. Further, DAT1 is more efficient to induce apoptosis in colon cancer cells with mutated Ras or Raf. Minimal toxicity in both acute and subacute studies along with the in vitro and in vivo efficacy of DAT1 in cancers with both wild type and nonfunctional p53 place it as a highly beneficial candidate for cancer chemotherapy. Besides, efficiency in cancer cells with mutations in the Ras oncoprotein or its downstream kinase Raf raise interest in diaminothiazole class of compounds for further follow-up.

p53 in survival, death and metabolic health: a lifeguard with a licence to kill.

PubMed

Kruiswijk, Flore; Labuschagne, Christiaan F; Vousden, Karen H

2015-07-01

The function of p53 as a tumour suppressor has been attributed to its ability to promote cell death or permanently inhibit cell proliferation. However, in recent years, it has become clear that p53 can also contribute to cell survival. p53 regulates various metabolic pathways, helping to balance glycolysis and oxidative phosphorylation, limiting the production of reactive oxygen species, and contributing to the ability of cells to adapt to and survive mild metabolic stresses. Although these activities may be integrated into the tumour suppressive functions of p53, deregulation of some elements of the p53-induced response might also provide tumours with a survival advantage.

The effects of a novel aliphatic-chain hydroxamate derivative WMJ-S-001 in HCT116 colorectal cancer cell death

PubMed Central

Huang, Yu-Han; Huang, Shiu-Wen; Hsu, Ya-Fen; Ou, George; Huang, Wei-Jan; Hsu, Ming-Jen

2015-01-01

Hydroxamate derivatives have attracted considerable attention due to their broad pharmacological properties and have been extensively investigated. We recently demonstrated that WMJ-S-001, a novel aliphatic hydroxamate derivative, exhibits anti-inflammatory and anti-angiogenic activities. In this study, we explored the underlying mechanisms by which WMJ-S-001 induces HCT116 colorectal cancer cell death. WMJ-S-001 inhibited cell proliferation and induced cell apoptosis in HCT116 cells. These actions were associated with AMP-activated protein kinase (AMPK) and p38 mitogen-activated protein kinase (MAPK) activation, p53 phosphorylation and acetylation, as well as the modulation of p21cip/Waf1, cyclin D1, survivin and Bax. AMPK-p38MAPK signaling blockade reduced WMJ-S-001-induced p53 phosphorylation. Transfection with AMPK dominant negative mutant (DN) reduced WMJ-S-001’s effects on p53 and Sp1 binding to the survivn promoter region. Transfection with HDAC3-Flag or HDAC4-Flag also abrogated WMJ-S-001’s enhancing effect on p53 acetylation. WMJ-S-001’s actions on p21cip/Waf1, cyclin D1, survivin, Bax were reduced in p53-null HCT116 cells. Furthermore, WMJ-S-001 was shown to suppress the growth of subcutaneous xenografts of HCT116 cells in vivo. In summary, the death of HCT116 colorectal cancer cells exposed to WMJ-S-001 may involve AMPK-p38MAPK-p53-survivin cascade. These results support the role of WMJ-S-001 as a potential drug candidate and warrant the clinical development in the treatment of cancer. PMID:26510776

Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.

PubMed

Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi

2003-04-01

Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.

Osteoblast differentiation and skeletal development are regulated by Mdm2–p53 signaling

PubMed Central

Lengner, Christopher J.; Steinman, Heather A.; Gagnon, James; Smith, Thomas W.; Henderson, Janet E.; Kream, Barbara E.; Stein, Gary S.; Lian, Jane B.; Jones, Stephen N.

2006-01-01

Mdm2 is required to negatively regulate p53 activity at the peri-implantation stage of early mouse development. However, the absolute requirement for Mdm2 throughout embryogenesis and in organogenesis is unknown. To explore Mdm2–p53 signaling in osteogenesis, Mdm2-conditional mice were bred with Col3.6-Cre–transgenic mice that express Cre recombinase in osteoblast lineage cells. Mdm2-conditional Col3.6-Cre mice die at birth and display multiple skeletal defects. Osteoblast progenitor cells deleted for Mdm2 have elevated p53 activity, reduced proliferation, reduced levels of the master osteoblast transcriptional regulator Runx2, and reduced differentiation. In contrast, p53-null osteoprogenitor cells have increased proliferation, increased expression of Runx2, increased osteoblast maturation, and increased tumorigenic potential, as mice specifically deleted for p53 in osteoblasts develop osteosarcomas. These results demonstrate that p53 plays a critical role in bone organogenesis and homeostasis by negatively regulating bone development and growth and by suppressing bone neoplasia and that Mdm2-mediated inhibition of p53 function is a prerequisite for Runx2 activation, osteoblast differentiation, and proper skeletal formation. PMID:16533949

Decursin exerts anti-cancer activity in MDA-MB-231 breast cancer cells via inhibition of the Pin1 activity and enhancement of the Pin1/p53 association.

PubMed

Kim, Ji-Hyun; Jung, Ji Hoon; Kim, Sung-Hoon; Jeong, Soo-Jin

2014-02-01

The peptidyl-prolyl cis/trans isomerase Pin1 is overexpressed in a wide variety of cancer cells and thus considered as an important target molecule for cancer therapy. This study demonstrates that decursin, a bioactive compound from Angelica gigas, exert the anti-cancer effect against breast cancer cells via regulation of Pin1 and its related signaling molecules. We observed that decursin induced G1 arrest with decrease in cyclin D1 level in Pin1-expressing breast cancer cells MDA-MB-231, but not Pin1-non-expressing breast cancer cells MDA-MB-157. In addition, decursin significantly reduced protein expression and enzymatic activity of Pin1 in MDA-MB-231 cells. Further, we found that decursin treatment enhanced the p53 expression level and failed to down-regulate Pin1 in the cells transfected with p53 siRNA, indicating the importance of p53 in the decursin-mediated Pin1 inhibition in MDA-MB-231 cells. Decursin stimulated association between Pin1 to p53. Moreover, decursin facilitated p53 transcription in MDA-MB-231 cells. Overall, our current study suggests the potential of decursin as an attractive cancer therapeutic agent for breast cancer by targeting Pin1 protein. Copyright © 2013 John Wiley & Sons, Ltd.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Fuming; Saha, Abhik; Murakami, Masanao

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53

PubMed Central

Murakami, Yohei; Takada, Shoji

2012-01-01

Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606

The tumour suppressor CYLD regulates the p53 DNA damage response

PubMed Central

Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

2016-01-01

The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR

PubMed Central

Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

2010-01-01

Summary The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca2+-independent-phospholipase A2 (iPLA2). We previously reported that inhibition of iPLA2 arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA2 induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA2. The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA2-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway. PMID:18032786

The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR.

PubMed

Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

2007-12-01

The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca(2+)-independent-phospholipase A(2) (iPLA(2)). We previously reported that inhibition of iPLA(2) arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA(2) induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA(2). The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA(2)-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway.

Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

PubMed Central

Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

2014-01-01

The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

Glucocorticoid receptor activation inhibits p53-induced apoptosis of MCF10Amyc cells via induction of protein kinase Cε.

PubMed

Aziz, Moammir H; Shen, Hong; Maki, Carl G

2012-08-24

Glucocorticoid receptor (GR) is a ligand-dependent transcription factor that can promote apoptosis or survival in a cell-specific manner. Activated GR has been reported to inhibit apoptosis in mammary epithelial cells and breast cancer cells by increasing pro-survival gene expression. In this study, activated GR inhibited p53-dependent apoptosis in MCF10A cells and human mammary epithelial cells that overexpress the MYC oncogene. Specifically, GR agonists hydrocortisone or dexamethasone inhibited p53-dependent apoptosis induced by cisplatin, ionizing radiation, or the MDM2 antagonist Nutlin-3. In contrast, the GR antagonist RU486 sensitized the cells to apoptosis by these agents. Apoptosis inhibition was associated with maintenance of mitochondrial membrane potential, diminished caspase-3 and -7 activation, and increased expression at both the mRNA and protein level of the anti-apoptotic PKC family member PKCε. Knockdown of PKCε via siRNA targeting reversed the protective effect of dexamethasone and restored apoptosis sensitivity. These data provide evidence that activated GR can inhibit p53-dependent apoptosis through induction of the anti-apoptotic factor PKCε.

Usp5 links suppression of p53 and FAS levels in melanoma to the BRAF pathway

PubMed Central

Potu, Harish; Peterson, Luke F.; Pal, Anupama; Verhaegen, Monique; Cao, Juxiang; Talpaz, Moshe; Donato, Nicholas J.

2014-01-01

Usp5 is a deubiquitinase (DUB) previously shown to regulate unanchored polyubiquitin (Ub) chains, p53 transcriptional activity and double-strand DNA repair. In BRAF mutant melanoma cells, Usp5 activity was suppressed by BRAF inhibitor (vemurafenib) in sensitive but not in acquired or intrinsically resistant cells. Usp5 knockdown overcame acquired vemurafenib resistance and sensitized BRAF and NRAS mutant melanoma cells to apoptosis initiated by MEK inhibitor, cytokines or DNA-damaging agents. Knockdown and overexpression studies demonstrated that Usp5 regulates p53 (and p73) levels and alters cell growth and cell cycle distribution associated with p21 induction. Usp5 also regulates the intrinsic apoptotic pathway by modulating p53-dependent FAS expression. A small molecule DUB inhibitor (EOAI3402143) phenocopied the FAS induction and apoptotic sensitization of Usp5 knockdown and fully blocked melanoma tumor growth in mice. Overall, our results demonstrate that BRAF activates Usp5 to suppress cell cycle checkpoint control and apoptosis by blocking p53 and FAS induction; all of which can be restored by small molecule-mediated Usp5 inhibition. These results suggest that Usp5 inhibition can provide an alternate approach in recovery of diminished p53 (or p73) function in melanoma and can add to the targeted therapies already used in the treatment of melanoma. PMID:24980819

Synthesis of novel forskolin isoxazole derivatives with potent anti-cancer activity against breast cancer cell lines.

PubMed

Burra, Srinivas; Voora, Vani; Rao, Ch Prasad; Vijay Kumar, P; Kancha, Rama Krishna; David Krupadanam, G L

2017-09-15

Forskolin C 1 -isoxazole derivatives (3,5-regioisomers) (11a-e, 14, 15a-h and 15, 16a-g) were synthesized regioselectively by adopting 1,3-dipolar cycloadditions. These derivatives were tested using estrogen receptor positive breast cancer cell lines MCF-7 and BT-474. Majority of the compounds exhibited activity against the p53-positive MCF-7 breast cancer cells but not against the p53-negative BT-474 breast cancer cells. Among forskolin derivatives, compounds 11a, 11c, 14a, 14f, 14g, 14h, 15b, 16g and 17b exhibited higher anti-cancer activity against MCF-7 cell line with an IC 50 ≤1µM. The derivative 14f exhibited highest activity in both p53-positive (MCF-7) and p53-negative (BT-474) breast cancer cell lines with an IC 50 of 0.5µM. Copyright © 2017. Published by Elsevier Ltd.

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance

PubMed Central

Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R

2016-01-01

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462

Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, Chunhua; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu; Ma, Xa

2014-12-15

Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleavedmore » PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly activated in Mn-exposed brain cells. • p53 translocates into mitochondria following Mn exposure. • p53 causes mitochondrial deficit via transcription-dependent and -independent actions. • PFT-α and PFT-μ ameliorate Mn-induced mitochondrial deficit and neuronal apoptosis.« less

P53 Is Involved in a Three-Dimensional Architecture-Mediated Decrease in Chemosensitivity in Colon Cancer.

PubMed

He, Jianming; Liang, Xi; Luo, Fen; Chen, Xuedan; Xu, Xueqing; Wang, Fengchao; Zhang, Zhenping

2016-01-01

Three-dimensional (3D) culture models represent a better approximation of solid tumor tissue architecture, especially cell adhesion, in vivo than two-dimensional (2D) cultures do. Here, we explored the role of architecture in chemosensitivity to platinum in colon cancer. Under the 3D culture condition, colon cancer cells formed multicellular spheroids, consisting of layers of cells. 3D cultures displayed significantly decreased sensitivity to platinum compared with 2D cultures. Platinum increased p53 in a dose-dependent and time-dependent manner. There was no detectable difference in basal p53 levels between 3D cultures and 2D cultures but cisplatin induced less p53 in both HCT116 3D cultures and LoVo 3D cultures. It was not due to cisplatin concentration because cisplatin induced similar γ-H2AX in 3D vs 2D. Knockdown of p53 significantly decreased sensitivity to platinum in 3D cultures. Knockdown of p53 decreased cleaved caspase 3 and apoptosis induced by cisplatin. These findings indicate that 3D architecture confers decreased chemosensitivity to platinum and p53 is involved in the mechanism. Knockdown of p53 decreased cisplatin's induction of c-Jun N-terminal kinase 1/2 (JNK1/2) activation, whereas inhibition of JNK1/2 activation increased chemosensitivity. Inhibition of p38 activation decreased cisplatin's induction of p53, but no difference in p38 activation by cisplatin was observed between 2D cultures and 3D cultures. Taken together, our results suggest that p53 is involved in a 3D architecture-mediated decrease in chemosensitivity to platinum in colon cancer. Mitogen-activated protein kinases (JNK1/2 and p38) do not play a dominant role in the mechanism.

Vectors to Increase Production Efficiency of Inducible Pluripotent Stem Cell (iPSC) | NCI Technology Transfer Center | TTC

Cancer.gov

This invention describes the discovery that specific p53 isoform increase the number of inducible pluripotent stem cells (iPS). It is known that the activity of p53 regulates the self-renewal and pluripotency of normal and cancer stem cells, and also affects re-programming efficiency of iPS cells. This p53 isoform-based technology provides a more natural process of increasing iPS cell production than previous methods of decreasing p53. NCI seeks licensees for this technology.

p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes

PubMed Central

Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang

1998-01-01

Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and is therefore of questionable significance in protection against skin cancer induction. PMID:9708817

Knockdown of hepatoma-derived growth factor-related protein-3 induces apoptosis of H1299 cells via ROS-dependent and p53-independent NF-κB activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Hong Shik; Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791; Baek, Jeong-Hwa

2014-07-11

Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates themore » radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells.« less

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

PubMed Central

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

2012-01-01

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

PubMed

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

2012-04-05

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

PubMed Central

Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

2016-01-01

Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

NF-kappaB and p53 are the dominant apoptosis-inducing transcription factors elicited by the HIV-1 envelope.

PubMed

Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido

2004-03-01

The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.

Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

PubMed Central

Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

2016-01-01

Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

Radiosensitivity profiles from a panel of ovarian cancer cell lines exhibiting genetic alterations in p53 and disparate DNA-dependent protein kinase activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.

2009-09-07

The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expressionmore » levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.« less

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

E2 Proteins from High- and Low-Risk Human Papillomavirus Types Differ in Their Ability To Bind p53 and Induce Apoptotic Cell Death

PubMed Central

Parish, Joanna L.; Kowalczyk, Anna; Chen, Hsin-Tien; Roeder, Geraldine E.; Sessions, Richard; Buckle, Malcolm; Gaston, Kevin

2006-01-01

The E2 proteins from oncogenic (high-risk) human papillomaviruses (HPVs) can induce apoptotic cell death in both HPV-transformed and non-HPV-transformed cells. Here we show that the E2 proteins from HPV type 6 (HPV6) and HPV11, two nononcogenic (low-risk) HPV types, fail to induce apoptosis. Unlike the high-risk HPV16 E2 protein, these low-risk E2 proteins fail to bind p53 and fail to induce p53-dependent transcription activation. Interestingly, neither the ability of p53 to activate transcription nor the ability of p53 to bind DNA, are required for HPV16 E2-induced apoptosis in non-HPV-transformed cells. However, mutations that reduce the binding of the HPV16 E2 protein to p53 inhibit E2-induced apoptosis in non-HPV-transformed cells. In contrast, the interaction between HPV16 E2 and p53 is not required for this E2 protein to induce apoptosis in HPV-transformed cells. Thus, our data suggest that this high-risk HPV E2 protein induces apoptosis via two pathways. One pathway involves the binding of E2 to p53 and can operate in both HPV-transformed and non-HPV-transformed cells. The second pathway requires the binding of E2 to the viral genome and can only operate in HPV-transformed cells. PMID:16611918

Selective activation of p53-mediated tumour suppression in high-grade tumours.

PubMed

Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P

2010-11-25

Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.

p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

PubMed

Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

2016-11-22

Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

Synthesis and evaluation of modified chalcone based p53 stabilizing agents.

PubMed

Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdel-Hamid; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib

2017-09-01

Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (CAL-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI 50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI 50 of 0.473±0.043µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-h post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities. Copyright © 2017 Elsevier Ltd. All rights reserved.

ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

PubMed

Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

2013-01-01

ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

p53 inactivation decreases dependence on estrogen/ERK signalling for proliferation but promotes EMT and susceptility to 3-bromopyruvate in ERα+ breast cancer MCF-7 cells.

PubMed

Rieber, Manuel; Strasberg-Rieber, Mary

2014-03-15

Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.

PubMed

Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun

2005-07-01

Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.

p53-dependent cell death/apoptosis is required for a productive adenovirus infection.

PubMed

Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W

1998-09-01

The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.

Age-Related Susceptibility to Apoptosis in Human Retinal Pigment Epithelial Cells Is Triggered by Disruption of p53–Mdm2 Association

PubMed Central

Bhattacharya, Sujoy; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

2012-01-01

Purpose. Relatively little is known about the contribution of p53/Mdm2 pathway in apoptosis of retinal pigment epithelial (RPE) cells or its possible link to dysfunction of aging RPE or to related blinding disorders such as age-related macular degeneration (AMD). Methods. Age-associated changes in p53 activation were evaluated in primary RPE cultures from human donor eyes of various ages. Apoptosis was evaluated by activation of caspases and DNA fragmentation. Gene-specific small interfering RNA was used to knock down expression of p53. Results. We observed that the basal rate of p53-dependent apoptosis increased in an age-dependent manner in human RPE. The age-dependent increase in apoptosis was linked to alterations in several aspects of the p53 pathway. p53 phosphorylation Ser15 was increased through the stimulation of ATM-Ser1981. p53 acetylation Lys379 was increased through the inhibition of SIRT1/2. These two posttranslational modifications of p53 blocked the sequestration of p53 by Mdm2, thus resulting in an increase in free p53 and of p53 stimulation of apoptosis through increased expression of PUMA (p53 upregulated modulator of apoptosis) and activation of caspase-3. Aged RPE also had reduced expression of antiapoptotic Bcl-2, which contributed to the increase in apoptosis. Of particular interest in these studies was that pharmacologic treatments to block p53 phosphorylation, acetylation, or expression were able to protect RPE cells from apoptosis. Conclusions. Our studies suggest that aging in the RPE leads to alterations of specific checkpoints in the apoptotic pathway, which may represent important molecular targets for the treatment of RPE-related aging disorders such as AMD. PMID:23139272

Downregulation of B-myb promotes senescence via the ROS-mediated p53/p21 pathway, in vascular endothelial cells.

PubMed

Zhou, Zhihui; Yin, Yanlin; Chang, Qun; Sun, Guanqun; Lin, Jiahui; Dai, Yalei

2017-04-01

To reveal whether B-myb is involved in preventing senescence of vascular endothelial cells, and if so, to identify possible mechanisms for it. C57/BL6 male mice and primary human aortic endothelial cells (HAECs) were used. Bleomycin was applied to induce stress-related premature senescence. B-myb knockdown was achieved using an siRNA technique and cell senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) assay. Intracellular reactive oxygen species (ROS) production was analysed using an ROS assay kit and cell proliferation was evaluated using KFluor488 EdU kit. Capillary tube network formation was determined by Matrigel assay. Expressions of mRNA and protein levels were detected by real-time PCR and western blotting. B-myb expression significantly decreased, while p53 and p21 expressions increased in the aortas of aged mice. This expression pattern was also found in replicative senescent HAECs and senescent HAECs induced by bleomycin. B-myb knockdown resulted in upregulation of p22 phox , ROS accumulation and cell senescence of HAECs. Downregulation of B-myb significantly inhibited cell proliferation and capillary tube network formation and activated the p53/p21 signalling pathway. Blocking ROS production or inhibiting p53 activation remarkably attenuated SA-β-gal activity and delayed cell senescence induced by B-myb-silencing. Downregulation of B-myb induced senescence by upregulation of p22 phox and activation of the ROS/p53/p21 pathway, in our vascular endothelial cells, suggesting that B-myb may be a novel candidate for regulating cell senescence to protect against endothelial senescence-related cardiovascular diseases. © 2016 John Wiley & Sons Ltd.

HIPK2 restricts SIRT1 activity upon severe DNA damage by a phosphorylation-controlled mechanism

PubMed Central

Conrad, E; Polonio-Vallon, T; Meister, M; Matt, S; Bitomsky, N; Herbel, C; Liebl, M; Greiner, V; Kriznik, B; Schumacher, S; Krieghoff-Henning, E; Hofmann, T G

2016-01-01

Upon severe DNA damage a cellular signalling network initiates a cell death response through activating tumour suppressor p53 in association with promyelocytic leukaemia (PML) nuclear bodies. The deacetylase Sirtuin 1 (SIRT1) suppresses cell death after DNA damage by antagonizing p53 acetylation. To facilitate efficient p53 acetylation, SIRT1 function needs to be restricted. How SIRT1 activity is regulated under these conditions remains largely unclear. Here we provide evidence that SIRT1 activity is limited upon severe DNA damage through phosphorylation by the DNA damage-responsive kinase HIPK2. We found that DNA damage provokes interaction of SIRT1 and HIPK2, which phosphorylates SIRT1 at Serine 682 upon lethal damage. Furthermore, upon DNA damage SIRT1 and HIPK2 colocalize at PML nuclear bodies, and PML depletion abrogates DNA damage-induced SIRT1 Ser682 phosphorylation. We show that Ser682 phosphorylation inhibits SIRT1 activity and impacts on p53 acetylation, apoptotic p53 target gene expression and cell death. Mechanistically, we found that DNA damage-induced SIRT1 Ser682 phosphorylation provokes disruption of the complex between SIRT1 and its activator AROS. Our findings indicate that phosphorylation-dependent restriction of SIRT1 activity by HIPK2 shapes the p53 response. PMID:26113041

p53 Hypersensitivity Is the Predominant Mechanism of the Unique Responsiveness of Testicular Germ Cell Tumor (TGCT) Cells to Cisplatin

PubMed Central

Gutekunst, Matthias; Oren, Moshe; Weilbacher, Andrea; Dengler, Michael A.; Markwardt, Christiane; Thomale, Jürgen; Aulitzky, Walter E.; van der Kuip, Heiko

2011-01-01

Consistent with the excellent clinical results in testicular germ cell tumors (TGCT), most cell lines derived from this cancer show an exquisite sensitivity to Cisplatin. It is well accepted that the high susceptibility of TGCT cells to apoptosis plays a central role in this hypersensitive phenotype. The role of the tumor suppressor p53 in this response, however, remains controversial. Here we show that siRNA-mediated silencing of p53 is sufficient to completely abrogate hypersensitivity not only to Cisplatin but also to non-genotoxic inducers of p53 such as the Mdm2 antagonist Nutlin-3 and the proteasome inhibitor Bortezomib. The close relationship between p53 protein levels and induction of apoptosis is lost upon short-term differentiation, indicating that this predominant pro-apoptotic function of p53 is unique in pluripotent embryonal carcinoma (EC) cells. RNA interference experiments as well as microarray analysis demonstrated a central role of the pro-apoptotic p53 target gene NOXA in the p53-dependent apoptotic response of these cells. In conclusion, our data indicate that the hypersensitivity of TGCT cells is a result of their unique sensitivity to p53 activation. Furthermore, in the very specific cellular context of germ cell-derived pluripotent EC cells, p53 function appears to be limited to induction of apoptosis. PMID:21532991

Activation of the miR-34a/SIRT1/p53 Signaling Pathway Contributes to the Progress of Liver Fibrosis via Inducing Apoptosis in Hepatocytes but Not in HSCs.

PubMed

Tian, Xiao-Feng; Ji, Fu-Jian; Zang, Hong-Liang; Cao, Hong

2016-01-01

Liver fibrosis results from a sustained wound healing response to chronic liver injury, and the activation of nonparenchymal hepatic stellate cells (HSCs) is the pivotal process. MicroRNA-34a (miR-34a) is the direct target gene of p53 and activates p53 through sirtuin 1 (SIRT1) simultaneously. The miR-34a/SIRT1/p53 signaling pathway thus forms a positive feedback loop wherein p53 induces miR-34a and miR-34a activates p53 by inhibiting SIRT1, playing an important role in cell proliferation and apoptosis. miR-34a expression has been found to be increased in animal models or in human patients with different liver diseases, including liver fibrosis. However, the exact role of this classical miR-34a/SIRT1/p53 signaling pathway in liver fibrosis remains unclear. In the present study, using a CCl4-induced rat liver fibrosis model, we found that the miR-34a/SIRT1/p53 signaling pathway was activated and could be inhibited by SIRT1 activator SRT1720. Further studies showed that the miR-34a/SIRT1/p53 signaling pathway was activated in hepatocytes but not in HSCs. The activation of this pathway in hepatocytes resulted in the apoptosis of hepatocytes and thus activated HSCs. Our data indicate that the miR-34a/SIRT1/p53 signaling pathway might be a promising therapeutic target for liver fibrosis.

FGF1 protects neuroblastoma SH-SY5Y cells from p53-dependent apoptosis through an intracrine pathway regulated by FGF1 phosphorylation

PubMed Central

Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore

2017-01-01

Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426

Regulation of p53 Stability and Apoptosis by a ROR Agonist

PubMed Central

Wang, Yongjun; Solt, Laura A.; Kojetin, Douglas J.; Burris, Thomas P.

2012-01-01

Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer. PMID:22509368

Regulation of p53 stability and apoptosis by a ROR agonist.

PubMed

Wang, Yongjun; Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P

2012-01-01

Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.

Cell cycle regulation and apoptosis mediated by p53 in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei.

PubMed

Nuñez-Hernandez, Dahlia M; Felix-Portillo, Monserrath; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria

2018-01-01

Although hypoxic aquatic environments cause negative effects on shrimp, these animals can withstand somewhat hypoxia, but the cellular mechanisms underlying this capacity are still poorly understood. In humans, mild hypoxia causes the induction of many proteins to allow cell survival. In contrast, apoptosis is induced during severe hypoxia leading to cell death. p53 is a key transcription factor that determines cells fate towards cell cycle arrest or induction of apoptosis in humans. The aim of this work was to study the role of p53 in cell cycle regulation and apoptosis in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei. p53 was silenced by RNAi and afterwards the shrimp were exposed to hypoxia. Cdk-2 was used as indicator of cell cycle progression while caspase-3 expression and caspase activity were analyzed as indicators of apoptosis. p53 levels in hepatopancreas were significantly higher at 48 h after hypoxic treatment. Increased expression levels of Cdk-2 were found in p53-silenced shrimp after 24 and 48 h in the normoxic treatments as well as 48 h after hypoxia, indicating a possible role of p53 in cell cycle regulation. In response to hypoxia, unsilenced shrimp showed an increase in caspase-3 expression levels, however an increase was also observed in caspase activity at 24 h of normoxic conditions in p53-silenced shrimps. Taken together these results indicate the involvement of p53 in regulation of cell cycle and apoptosis in the white shrimp in response to hypoxia. Copyright © 2017 Elsevier Ltd. All rights reserved.

Combined CSL and p53 downregulation promotes cancer-associated fibroblast activation

PubMed Central

Procopio, Maria-Giuseppina; Laszlo, Csaba; Labban, Dania Al; Kim, Dong Eun; Bordignon, Pino; Jo, Seunghee; Goruppi, Sandro; Menietti, Elena; Ostano, Paola; Ala, Ugo; Provero, Paolo; Hoetzenecker, Wolfram; Neel, Victor; Kilarski, Witek; Swartz, Melody A.; Brisken, Cathrin; Lefort, Karine; Dotto, G. Paolo

2015-01-01

Stromal fibroblast senescence has been linked to aging-associated cancer risk. However, density and proliferation of cancer-associated fibroblasts (CAF) are frequently increased. Loss or down-modulation of the Notch effector CSL/RBP-Jκ in dermal fibroblasts is sufficient for CAF activation and ensuing keratinocyte-derived tumors. We report that CSL silencing induces senescence of primary fibroblasts from dermis, oral mucosa, breast and lung. CSL functions in these cells as direct repressor of multiple senescence- and CAF-effector genes. It also physically interacts with p53, repressing its activity. CSL is down-modulated in stromal fibroblasts of premalignant skin actinic keratosis lesions and squamous cell carcinomas (SCC), while p53 expression and function is down-modulated only in the latter, with paracrine FGF signaling as likely culprit. Concomitant loss of CSL and p53 overcomes fibroblast senescence, enhances expression of CAF effectors and promotes stromal and cancer cell expansion. The findings support a CAF activation/stromal co-evolution model under convergent CSL/p53 control. PMID:26302407

Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa

Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp53 bearing cancer cells.« less

Modeling the Etiology of p53-mutated Cancer Cells*

PubMed Central

Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

2016-01-01

p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

The p53-Reactivating Small Molecule RITA Induces Senescence in Head and Neck Cancer Cells

PubMed Central

Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L.; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N.; Skinner, Heath D.

2014-01-01

TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC. PMID:25119136

p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

PubMed

Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

1996-09-01

Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation

PubMed Central

Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

2009-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types—MDM2, Pirh2, and COP1—and the HECT-domain type—ARF-BP1—have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G1 phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation. PMID:19509332

JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.

PubMed

Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

2009-06-23

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.

Dual targeting of wild-type and mutant p53 by small molecule RITA results in the inhibition of N-Myc and key survival oncogenes and kills neuroblastoma cells in vivo and in vitro.

PubMed

Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina

2013-09-15

Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.

The human T-cell leukemia virus type-1 p30II protein activates p53 and induces the TIGAR and suppresses oncogene-induced oxidative stress during viral carcinogenesis.

PubMed

Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert

2018-05-01

In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

PubMed Central

Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

2011-01-01

We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway.

PubMed

Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W

2015-08-21

Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.

Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

PubMed Central

Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.

2015-01-01

Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280

Mutant p53 dictates the oncogenic activity of c-Abl in triple-negative breast cancers

PubMed Central

Morrison, Chevaun D; Chang, Jenny C; Keri, Ruth A; Schiemann, William P

2017-01-01

We recently established c-Abl as a potent suppressor of triple-negative breast cancer (TNBC) progression through its reactivation of a p53:p21 signaling axis coupled to senescence. Moreover, we observed co-expression of p53 and c-Abl to be essential for normal mammary epithelial cell physiology, as this relationship is lost upon breast cancer progression. Cytoplasmic c-Abl activity is markedly increased in some TNBCs and contributes to disease progression; however, the mechanisms underlying these events remain largely unknown. In addressing this question, we show here that c-Abl is predominantly restricted to the cytoplasm of human MDA-MB-231 TNBC cells, and to the nucleus of human MCF-7 luminal A cells. TTK is a mitotic protein kinase that phosphorylates c-Abl on Thr735, thereby creating a recognition binding motif for 14-3-3 adaptor proteins in response to oxidative stress. By interrogating the METABRIC database, we observed a significant correlation between p53 expression and that of c-Abl and TTK in basal-like breast cancers. Moreover, heterologous expression of TTK in MCF-7 cells significantly stimulated their growth in part via a c-Abl-dependent mechanism. Conversely, depleting TTK expression in MDA-MB-231 cells not only inhibited their organoid growth in 3D-cultures, but also sensitized them to the tumor suppressing activities of c-Abl independent of its subcellular localization. Moreover, we show that mutant p53 forms cytoplasmic complexes with c-Abl, thereby dictating the subcellular localization of c-Abl and the sensitivity of MDA-MB-231 cells to Imatinib. In response to nutrient deprivation, c-Abl:p53 complexes readily accumulate in the nucleus, resulting in the hyperactivation of c-Abl and initiation of its anti-tumor activities. Collectively, we identified a novel mutant p53:c-Abl cytoplasmic signaling complex that promotes MDA-MB-231 cell growth and highlights the contextual cues that confer oncogenic activity to c-Abl in breast cancer. PMID:28661474

The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function

PubMed Central

Lo, Pang-Kuo; Lee, Ji Shin; Sukumar, Saraswati

2011-01-01

We previously identified FOXF1 as a potential tumor suppressor gene with an essential role in preventing DNA rereplication to maintain genomic stability, which is frequently inactivated in breast cancer through the epigenetic mechanism. Here we further addressed the role of the p53-p21WAF1 checkpoint pathway in DNA rereplication induced by silencing of FOXF1. Knockdown of FOXF1 by small interference RNA (siRNA) rendered colorectal p53-null and p21WAF1-null HCT116 cancer cells more susceptible to rereplication and apoptosis than the wild-type parental cells. In parental HCT116 cells with a functional p53 checkpoint, the p53-p21WAF1 checkpoint pathway was activated upon FOXF1 knockdown, which was concurrent with suppression of the CDK2-Rb cascade and induction of G1 arrest. In contrast, these events were not observed in FOXF1-depleted HCT116-p53−/− and HCT116-p21−/− cells, indicating the p53-dependent checkpoint function is vital for inhibiting CDK2 to induce G1 arrest and protect cells from rereplication. The pharmacologic inhibitor (caffeine) of Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3 related (ATR) protein kinases abolished activation of the p53-p21WAF1 pathway upon FOXF1 knockdown, suggesting that suppression of FOXF1 function triggered the ATM/ATR-mediated DNA damage response. Cosilencing of p53 by siRNA synergistically enhanced the effect of FOXF1 depletion on stimulation of DNA rereplication and apoptosis in wild-type HCT116. Finally, we show that FOXF1 expression is predominantly silenced in breast and colorectal cancer cell lines with inactive p53. Our study demonstrated that the p53-p21WAF1 checkpoint pathway is an intrinsically protective mechanism to prevent DNA rereplication induced by silencing of FOXF1. PMID:21964066

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.

PubMed

Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

2015-10-01

Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan

Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less

Regulation of p53 expression and apoptosis by vault RNA2-1-5p in cervical cancer cells.

PubMed

Kong, Lu; Hao, Qi; Wang, Ying; Zhou, Ping; Zou, Binbin; Zhang, Yu-xiang

2015-09-29

nc886 or VRNA2-1 has recently been identified as a noncoding RNA instead of a vault RNA or a pre-microRNA. Several studies have reported that pre-miR-886 plays a tumor-suppressive role in a wide range of cancer cells through its activity as a cellular protein kinase RNA-activated (PKR) ligand and repressor. However, by sequencing stem-PCR products, we found that a microRNA originating from this precursor, vault RNA2-1-5p (VTRNA2-1-5p), occurs in cervical cancer cells. The expression levels of the predicted targets of VTRNA2-1-5p are negatively correlated with VTRNA2-1-5p levels by quantitative reversion transcription PCR (qRT-PCR). Previous results have shown that VTRNA2-1-5p is overexpressed in human cervical squamous cell carcinomas (CSCCs) compared with adjacent healthy tissues. Inhibition of VTRNA2-1-5p increases Bax protein expression and apoptotic cell death in cervical cancer cells. Our findings suggest that VTRNA2-1-5p has oncogenic activity related to the progression of cervical cancer. Here, we report that VTRNA2-1-5p directly targeted p53 expression and functioned as an oncomir in cervical cancer. VTRNA2-1-5p inhibition decreased cervical cancer cell invasion, proliferation, and tumorigenicity while increasing apoptosis and p53 expression. Interestingly, VTRNA2-1-5p inhibition also increased cisplatin-induced apoptosis of HeLa and SiHa cells. In human clinical cervical cancer specimens, low p53 expression and high VTRNA2-1-5p expression were positively associated.In addition, VTRNA2-1-5p was found to directly target the 5' and 3' untranslated regions (UTRs) of p53. We propose that VTRNA2-1-5p is a direct regulator of p53 and suggest that it plays an essential role in the apoptosis and proliferation of cervical cancer cells.

Cellular Stress and p53-Associated Apoptosis by Juniperus communis L. Berry Extract Treatment in the Human SH-SY5Y Neuroblastoma Cells.

PubMed

Lantto, Tiina A; Laakso, Into; Dorman, H J Damien; Mauriala, Timo; Hiltunen, Raimo; Kõks, Sulev; Raasmaja, Atso

2016-07-13

Plant phenolics have shown to activate apoptotic cell death in different tumourigenic cell lines. In this study, we evaluated the effects of juniper berry extract (Juniperus communis L.) on p53 protein, gene expression and DNA fragmentation in human neuroblastoma SH-SY5Y cells. In addition, we analyzed the phenolic composition of the extract. We found that juniper berry extract activated cellular relocalization of p53 and DNA fragmentation-dependent cell death. Differentially expressed genes between treated and non-treated cells were evaluated with the cDNA-RDA (representational difference analysis) method at the early time point of apoptotic process when p53 started to be activated and no caspase activity was detected. Twenty one overexpressed genes related to cellular stress, protein synthesis, cell survival and death were detected. Interestingly, they included endoplasmic reticulum (ER) stress inducer and sensor HSPA5 and other ER stress-related genes CALM2 and YKT6 indicating that ER stress response was involved in juniper berry extract mediated cell death. In composition analysis, we identified and quantified low concentrations of fifteen phenolic compounds. The main groups of them were flavones, flavonols, phenolic acids, flavanol and biflavonoid including glycosides of quercetin, apigenin, isoscutellarein and hypolaetin. It is suggested that juniper berry extract induced the p53-associated apoptosis through the potentiation and synergism by several phenolic compounds.

Metabolic oxidative stress elicited by the copper(II) complex [Cu(isaepy)2] triggers apoptosis in SH-SY5Y cells through the induction of the AMP-activated protein kinase/p38MAPK/p53 signalling axis: evidence for a combined use with 3-bromopyruvate in neuroblastoma treatment.

PubMed

Filomeni, Giuseppe; Cardaci, Simone; Da Costa Ferreira, Ana Maria; Rotilio, Giuseppe; Ciriolo, Maria Rosa

2011-08-01

We have demonstrated previously that the complex bis[(2-oxindol-3-ylimino)-2-(2-aminoethyl)pyridine-N,N']copper(II), named [Cu(isaepy)(2)], induces AMPK (AMP-activated protein kinase)-dependent/p53-mediated apoptosis in tumour cells by targeting mitochondria. In the present study, we found that p38(MAPK) (p38 mitogen-activated protein kinase) is the molecular link in the phosphorylation cascade connecting AMPK to p53. Transfection of SH-SY5Y cells with a dominant-negative mutant of AMPK resulted in a decrease in apoptosis and a significant reduction in phospho-active p38(MAPK) and p53. Similarly, reverse genetics of p38(MAPK) yielded a reduction in p53 and a decrease in the extent of apoptosis, confirming an exclusive hierarchy of activation that proceeds via AMPK/p38(MAPK)/p53. Fuel supplies counteracted [Cu(isaepy)(2)]-induced apoptosis and AMPK/p38(MAPK)/p53 activation, with glucose being the most effective, suggesting a role for energetic imbalance in [Cu(isaepy)(2)] toxicity. Co-administration of 3BrPA (3-bromopyruvate), a well-known inhibitor of glycolysis, and succinate dehydrogenase, enhanced apoptosis and AMPK/p38(MAPK)/p53 signalling pathway activation. Under these conditions, no toxic effect was observed in SOD (superoxide dismutase)-overexpressing SH-SY5Y cells or in PCNs (primary cortical neurons), which are, conversely, sensitized to the combined treatment with [Cu(isaepy)(2)] and 3BrPA only if grown in low-glucose medium or incubated with the glucose-6-phosphate dehydrogenase inhibitor dehydroepiandrosterone. Overall, the results suggest that NADPH deriving from the pentose phosphate pathway contributes to PCN resistance to [Cu(isaepy)(2)] toxicity and propose its employment in combination with 3BrPA as possible tool for cancer treatment. © The Authors Journal compilation © 2011 Biochemical Society

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Differential effects on apoptosis induction in hepatocyte lines by stable expression of hepatitis B virus X protein

PubMed Central

Fiedler, Nicola; Quant, Ellen; Fink, Ludger; Sun, Jianguang; Schuster, Ralph; Gerlich, Wolfram H; Schaefer, Stephan

2006-01-01

AIM: Hepatitis B virus protein X (HBx) has been shown to be weakly oncogenic in vitro. The transforming activities of HBx have been linked with the inhibition of several functions of the tumor suppressor p53. We have studied whether HBx may have different effects on p53 depending on the cell type. METHODS: We used the human hepatoma cell line HepG2 and the immortalized murine hepatocyte line AML12 and analyzed stably transfected clones which expressed physiological amounts of HBx. P53 was induced by UV irradiation. RESULTS: The p53 induction by UV irradiation was unaffected by stable expression of HBx. However, the expression of the cyclin kinase inhibitor p21waf/cip/sdi which gets activated by p53 was affected in the HBx transformed cell line AML12-HBx9, but not in HepG2. In AML-HBx9 cells, p21waf/cip/sdi-protein expression and p21waf/cip/sdi transcription were deregulated. Furthermore, the process of apoptosis was affected in opposite ways in the two cell lines investigated. While stable expression of HBx enhanced apoptosis induced by UV irradiation in HepG2-cells, apoptosis was decreased in HBx transformed AML12-HBx9. P53 repressed transcription from the HBV enhancer I, when expressed from expression vectors or after induction of endogenous p53 by UV irradiation. Repression by endogenous p53 was partially reversible by stably expressed HBx in both cell lines. CONCLUSION: Stable expression of HBx leads to deregulation of apoptosis induced by UV irradiation depending on the cell line used. In an immortalized hepatocyte line HBx acted anti-apoptotic whereas expression in a carcinoma derived hepatocyte line HBx enhanced apoptosis. PMID:16937438

Generation of oscillations by the p53-Mdm2 feedback loop: A theoretical and experimental study

PubMed Central

Lev Bar-Or, Ruth; Maya, Ruth; Segel, Lee A.; Alon, Uri; Levine, Arnold J.; Oren, Moshe

2000-01-01

The intracellular activity of the p53 tumor suppressor protein is regulated through a feedback loop involving its transcriptional target, mdm2. We present a simple mathematical model suggesting that, under certain circumstances, oscillations in p53 and Mdm2 protein levels can emerge in response to a stress signal. A delay in p53-dependent induction of Mdm2 is predicted to be required, albeit not sufficient, for this oscillatory behavior. In line with the predictions of the model, oscillations of both p53 and Mdm2 indeed occur on exposure of various cell types to ionizing radiation. Such oscillations may allow cells to repair their DNA without risking the irreversible consequences of continuous excessive p53 activation. PMID:11016968

Mutant p53 expression in fallopian tube epithelium drives cell migration.

PubMed

Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

2015-10-01

Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.

The RNA surveillance protein SMG1 activates p53 in response to DNA double-strand breaks but not exogenously oxidized mRNA

PubMed Central

Gewandter, Jennifer S; Bambara, Robert A

2011-01-01

DNA damage, stalled replication forks, errors in mRNA splicing and availability of nutrients activate specific phosphatidylinositiol-3-kinase-like kinases (PIKKs) that in turn phosphorylate downstream targets such as p53 on serine 15. While the PIKK proteins ATM and ATR respond to specific DNA lesions, SMG1 responds to errors in mRNA splicing and when cells are exposed to genotoxic stress. Yet, whether genotoxic stress activates SMG1 through specific types of DNA lesions or RNA damage remains poorly understood. Here, we demonstrate that siRNA oligonucleotides targeting the mRNA surveillance proteins SMG1, Upf1, Upf2 or the PIKK protein ATM attenuated p53 (ser15) phosphorylation in cells damaged by high oxygen (hyperoxia), a model of persistent oxidative stress that damages nucleotides. In contrast, loss of SMG1 or ATM, but not Upf1 or Upf2 reduced p53 (ser15) phosphorylation in response to DNA double strand breaks produced by expression of the endonuclease I-PpoI. To determine whether SMG1-dependent activation of p53 was in response to oxidative mRNA damage, mRNA encoding green fluorescence protein (GFP) transcribed in vitro was oxidized by Fenton chemistry and transfected into cells. Although oxidation of GFP mRNA resulted in dose-dependent fragmentation of the mRNA and reduced expression of GFP, it did not stimulate p53 or the p53-target gene p21. These findings establish SMG1 activates p53 in response to DNA double strand breaks independent of the RNA surveillance proteins Upf1 or Upf2; however, these proteins can stimulate p53 in response to oxidative stress but not necessarily oxidized RNA. PMID:21701263

A high-throughput cellular assay to quantify the p53-degradation activity of E6 from different human papillomavirus types.

PubMed

Gagnon, David; Archambault, Jacques

2015-01-01

A subset of human papillomaviruses (HPVs), known as the high-risk types, are the causative agents of cervical cancer and other malignancies of the anogenital region and oral mucosa. The capacity of these viruses to induce cancer and to immortalize cells in culture relies in part on a critical function of their E6 oncoprotein, that of promoting the poly-ubiquitination of the cellular tumor suppressor protein p53 and its subsequent degradation by the proteasome. Here, we describe a cellular assay to measure the p53-degradation activity of E6 from different HPV types. This assay is based on a translational fusion of p53 to Renilla luciferase (Rluc-p53) that remains sensitive to degradation by high-risk E6 and whose steady-state levels can be accurately measured in standard luciferase assays. The p53-degradation activity of any E6 protein can be tested and quantified in transiently transfected cells by determining the amount of E6-expression vector required to reduce by half the levels of RLuc-p53 luciferase activity (50 % effective concentration [EC50]). The high-throughput and quantitative nature of this assay makes it particularly useful to compare the p53-degradation activities of E6 from several HPV types in parallel.

Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

PubMed Central

Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

2018-01-01

Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

Suppression of HPV E6 and E7 expression by BAF53 depletion in cervical cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Kiwon; Lee, Ah-Young; Kwon, Yunhee Kim

Highlights: {yields} Integration of HPV into host genome critical for activation of E6 and E7 oncogenes. {yields} BAF53 is essential for higher-order chromatin structure. {yields} BAF53 knockdown suppresses E6 and E7 from HPV integrants, but not from episomal HPVs. {yields} BAF53 knockdown decreases H3K9Ac and H4K12Ac on P105 promoter of integrated HPV 18. {yields} BAF53 knockdown restores the p53-dependent signaling pathway in HeLa and SiHa cells. -- Abstract: Deregulation of the expression of human papillomavirus (HPV) oncogenes E6 and E7 plays a pivotal role in cervical carcinogenesis because the E6 and E7 proteins neutralize p53 and Rb tumor suppressor pathways,more » respectively. In approximately 90% of all cervical carcinomas, HPVs are found to be integrated into the host genome. Following integration, the core-enhancer element and P105 promoter that control expression of E6 and E7 adopt a chromatin structure that is different from that of episomal HPV, and this has been proposed to contribute to activation of E6 and E7 expression. However, the molecular basis underlying this chromatin structural change remains unknown. Previously, BAF53 has been shown to be essential for the integrity of higher-order chromatin structure and interchromosomal interactions. Here, we examined whether BAF53 is required for activated expression of E6 and E7 genes. We found that BAF53 knockdown led to suppression of expression of E6 and E7 genes from HPV integrants in cervical carcinoma cell lines HeLa and SiHa. Conversely, expression of transiently transfected HPV18-LCR-Luciferase was not suppressed by BAF53 knockdown. The level of the active histone marks H3K9Ac and H4K12Ac on the P105 promoter of integrated HPV 18 was decreased in BAF53 knockdown cells. BAF53 knockdown restored the p53-dependent signaling pathway in HeLa and SiHa cells. These results suggest that activated expression of the E6 and E7 genes of integrated HPV is dependent on BAF53-dependent higher-order chromatin structure or nuclear motor activity.« less

Genomic alterations in spontaneous and carcinogen-induced murine melanoma cell lines.

PubMed

Melnikova, Vladislava O; Bolshakov, Svetlana V; Walker, Christopher; Ananthaswamy, Honnavara N

2004-03-25

We have conducted an analysis of genetic alterations in spontaneous murine melanoma cell line B16F0 and its two metastatic clones, B16F1 and B16F10 and the carcinogen-induced murine melanoma cell lines CM519, CM3205, and K1735. We found that unlike human melanomas, the murine melanoma cell lines did not have activating mutations in the Braf oncogene at exon 11 or 15. However, there were distinct patterns of alterations in the ras, Ink4a/Arf, and p53 genes in the two melanoma groups. In the spontaneous B16 melanoma cell lines, expression of p16Ink4a and p19Arf tumor suppressor proteins was lost as a consequence of a large deletion spanning Ink4a/Arf exons 1alpha, 1beta, and 2. In contrast, the carcinogen-induced melanoma cell lines expressed p16Ink4a but had inactivating mutations in either p19Arf (K1735) or p53 (CM519 and CM3205). Inactivation of p19Arf or p53 in carcinogen-induced melanomas was accompanied by constitutive activation of mitogen-activated protein kinases (MAPKs) and/or mutation-associated activation of N-ras. These results indicate that genetic alterations in p16Ink4a/p19Arf, p53 and ras-MAPK pathways can cooperate in the development of murine melanoma.

Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

PubMed

Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

2010-04-15

Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

Induction of apoptosis in hepatocellular carcinoma Smmc-7721 cells by vitamin K(2) is associated with p53 and independent of the intrinsic apoptotic pathway.

PubMed

Li, Lu; Qi, Zhiling; Qian, Jin; Bi, Fuyong; Lv, Jun; Xu, Lei; Zhang, Ling; Chen, Hongyu; Jia, Renbing

2010-09-01

Vitamin K(2) (VK(2)) can exert cell growth inhibitory effects in various human cancer cells. In this study, we investigated the cell growth inhibitory effects of VK(2) in hepatocellular carcinoma Smmc-7721 cells and the mechanisms involved. We found that VK(2)-inhibited cell proliferation in Smmc-7721 cells in a dose-dependent manner, and the IC50 of VK(2) in Smmc-7721 cells was 9.73 microM at 24 h. The data from flow cytometric analyses, DNA fragmentation assays, and caspase 3 activity assays revealed that apoptosis was the determining factor in VK(2) activity. Furthermore, a significant increase in p53 phosphorylation and protein level was exhibited in apoptotic cells treated with VK(2), although there were no changes in p53 mRNA expression. Bax expression was unaffected by VK(2) in Smmc-7721 cells. In addition, our study showed that caspase 3 was activated by caspase 8, not caspase 9, in Smmc-7721 cells treated with VK(2). In summary, these data suggested that VK(2) can inhibit the growth of Smmc-7721 cells by induction of apoptosis involving caspase 8 activation and p53. This apoptotic process was not mediated by the intrinsic apoptotic pathway.

Integrative Analysis Reveals an Outcome-associated and Targetable Pattern of p53 and Cell Cycle Deregulation in Diffuse Large B-cell Lymphoma

PubMed Central

Monti, Stefano; Chapuy, Bjoern; Takeyama, Kunihiko; Rodig, Scott J; Hao, Yangsheng; Yeda, Kelly T.; Inguilizian, Haig; Mermel, Craig; Curie, Treeve; Dogan, Ahmed; Kutok, Jeffery L; Beroukim, Rameen; Neuberg, Donna; Habermann, Thomas; Getz, Gad; Kung, Andrew L; Golub, Todd R; Shipp, Margaret A

2013-01-01

Summary Diffuse large B-cell lymphoma (DLBCL) is a clinically and biologically heterogeneous disease with a high proliferation rate. By integrating copy number data with transcriptional profiles and performing pathway analysis in primary DLBCLs, we identified a comprehensive set of copy number alterations (CNAs) that decreased p53 activity and perturbed cell cycle regulation. Primary tumors either had multiple complementary alterations of p53 and cell cycle components or largely lacked these lesions. DLBCLs with p53 and cell cycle pathway CNAs had decreased abundance of p53 target transcripts and increased expression of E2F target genes and the Ki67 proliferation marker. CNAs of the CDKN2A-TP53-RB-E2F axis provide a structural basis for increased proliferation in DLBCL, predict outcome with current therapy and suggest targeted treatment approaches. PMID:22975378

A Unifying Theory of Prostate Cancer

DTIC Science & Technology

2001-09-01

of cell cycle arrest or apoptosis, may lead to genomic instability and the development of cancer. 10 * One of our goals was to determine whether p53...and cell cycle arrest. Therefore, mechanisms responsible for upregulation and activation of p53 are intact in prostatic epithelial cells. We also...such as y-irradiation (Girinsky et al., 1995). The p53 protein is known to be a key regulator of cell cycle arrest and/or apoptosis (Wiman, 1997

Inhibition of the ERK phosphorylation plays a role in terbinafine-induced p21 up-regulation and DNA synthesis inhibition in human vascular endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, P.-Y.; Hsu, S.-P.; Liang, Y.-C.

2008-05-15

Previously, we showed that terbinafine (TB) induces cell-cycle arrest in cultured human umbilical vein endothelial cells (HUVEC) through an up-regulation of the p21 protein. The aim of this study is to delineate the molecular mechanisms underlying TB-induced increase of p21 protein. RT-PCR analysis demonstrated that the mRNA levels of p21 and p53 were increased in the TB-treated HUVEC. The p21 promoter activity was also increased by TB treatment. Transfection of HUVEC with p53 dominant negative (DN) abolished the TB-induced increases of p21 promoter activity and protein level, suggesting that the TB-induced increase of p21 is p53-dependent. Western blot analysis demonstratedmore » that TB decreased the levels of phosphorylated extracellular signal-regulated kinase (ERK). Over-expression of mitogen-activated protein kinase (MEK)-1, the immediate upstream activator kinase of ERK, abolished the TB-induced increases of p21 and p53 protein and decrease of thymidine incorporation. The ERK inhibitor (PD98059) enhanced the TB-induced inhibition of thymidine incorporation into HUVEC. Taken together, these data suggest that the decrease of ERK activity plays a role in the TB-induced up-regulation of p21 in HUVEC. On the other hand, pretreatment of the cells with geranylgeraniol (GGOH), farnesol (FOH), or Ras inhibitor peptide did not affect the TB-induced decrease of thymidine incorporation. Taken together, our results suggest that TB might cause a decrease of MEK, which in turn up-regulates p53 through the inhibition of ERK phosphorylation, and finally causes an increase of p21 expression and cell-cycle arrest.« less

p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

NASA Astrophysics Data System (ADS)

Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

1995-02-01

Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

PubMed

Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

1998-01-01

Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

Activation of Postnatal Neural Stem Cells Requires Nuclear Receptor TLX

PubMed Central

Niu, Wenze; Zou, Yuhua; Shen, ChengCheng; Zhang, Chun-Li

2011-01-01

Neural stem cells (NSCs) continually produce new neurons in postnatal brains. However, the majority of these cells stay in a non-dividing, inactive state. The molecular mechanism that is required for these cells to enter proliferation still remains largely unknown. Here, we show that nuclear receptor TLX (NR2E1) controls the activation status of postnatal NSCs in mice. Lineage tracing indicates that TLX-expressing cells give rise to both activated and inactive postnatal NSCs. Surprisingly, loss of TLX function does not result in spontaneous glial differentiation, but rather leads to a precipitous age-dependent increase of inactive cells with marker expression and radial morphology for NSCs. These inactive cells are mis-positioned throughout the granular cell layer of the dentate gyrus during development and can proliferate again after reintroducing ectopic TLX. RNA-seq analysis of sorted NSCs revealed a TLX-dependent global expression signature, which includes the p53 signaling pathway. TLX regulates p21 expression in a p53-dependent manner and acute removal of p53 can rescue the proliferation defect of TLX-null NSCs in culture. Together, these findings suggest that TLX acts as an essential regulator that ensures the proliferative ability of postnatal NSCs by controlling their activation through genetic interaction with p53 and other signaling pathways. PMID:21957244

Activation of postnatal neural stem cells requires nuclear receptor TLX.

PubMed

Niu, Wenze; Zou, Yuhua; Shen, Chengcheng; Zhang, Chun-Li

2011-09-28

Neural stem cells (NSCs) continually produce new neurons in postnatal brains. However, the majority of these cells stay in a nondividing, inactive state. The molecular mechanism that is required for these cells to enter proliferation still remains largely unknown. Here, we show that nuclear receptor TLX (NR2E1) controls the activation status of postnatal NSCs in mice. Lineage tracing indicates that TLX-expressing cells give rise to both activated and inactive postnatal NSCs. Surprisingly, loss of TLX function does not result in spontaneous glial differentiation, but rather leads to a precipitous age-dependent increase of inactive cells with marker expression and radial morphology for NSCs. These inactive cells are mispositioned throughout the granular cell layer of the dentate gyrus during development and can proliferate again after reintroduction of ectopic TLX. RNA-seq analysis of sorted NSCs revealed a TLX-dependent global expression signature, which includes the p53 signaling pathway. TLX regulates p21 expression in a p53-dependent manner, and acute removal of p53 can rescue the proliferation defect of TLX-null NSCs in culture. Together, these findings suggest that TLX acts as an essential regulator that ensures the proliferative ability of postnatal NSCs by controlling their activation through genetic interaction with p53 and other signaling pathways.

Proteasome inhibition mediates p53 reactivation and anti-cancer activity of 6-gingerol in cervical cancer cells.

PubMed

Rastogi, Namrata; Duggal, Shivali; Singh, Shailendra Kumar; Porwal, Konica; Srivastava, Vikas Kumar; Maurya, Rakesh; Bhatt, M L B; Mishra, Durga Prasad

2015-12-22

Human papilloma virus (HPV) expressing E6 and E7 oncoproteins, is known to inactivate the tumor suppressor p53 through proteasomal degradation in cervical cancers. Therefore, use of small molecules for inhibition of proteasome function and induction of p53 reactivation is a promising strategy for induction of apoptosis in cervical cancer cells. The polyphenolic alkanone, 6-Gingerol (6G), present in the pungent extracts of ginger (Zingiber officinale Roscoe) has shown potent anti-tumorigenic and pro-apoptotic activities against a variety of cancers. In this study we explored the molecular mechanism of action of 6G in human cervical cancer cells in vitro and in vivo. 6G potently inhibited proliferation of the HPV positive cervical cancer cells. 6G was found to: (i) inhibit the chymotrypsin activity of proteasomes, (ii) induce reactivation of p53, (iii) increase levels of p21, (iv) induce DNA damage and G2/M cell cycle arrest, (v) alter expression levels of p53-associated apoptotic markers like, cleaved caspase-3 and PARP, and (vi) potentiate the cytotoxicity of cisplatin. 6G treatment induced significant reduction of tumor volume, tumor weight, proteasome inhibition and p53 accumulation in HeLa xenograft tumor cells in vivo. The 6G treatment was devoid of toxic effects as it did not affect body weights, hematological and osteogenic parameters. Taken together, our data underscores the therapeutic and chemosensitizing effects of 6G in the management and treatment of cervical cancer.

Proteasome inhibition mediates p53 reactivation and anti-cancer activity of 6-Gingerol in cervical cancer cells

PubMed Central

Rastogi, Namrata; Duggal, Shivali; Singh, Shailendra Kumar; Porwal, Konica; Srivastava, Vikas Kumar; Maurya, Rakesh; Bhatt, Madan L.B.; Mishra, Durga Prasad

2015-01-01

Human papilloma virus (HPV) expressing E6 and E7 oncoproteins, is known to inactivate the tumor suppressor p53 through proteasomal degradation in cervical cancers. Therefore, use of small molecules for inhibition of proteasome function and induction of p53 reactivation is a promising strategy for induction of apoptosis in cervical cancer cells. The polyphenolic alkanone, 6-Gingerol (6G), present in the pungent extracts of ginger (Zingiber officinale Roscoe) has shown potent anti-tumorigenic and pro-apoptotic activities against a variety of cancers. In this study we explored the molecular mechanism of action of 6G in human cervical cancer cells in vitro and in vivo. 6G potently inhibited proliferation of the HPV positive cervical cancer cells. 6G was found to: (i) inhibit the chymotrypsin activity of proteasomes, (ii) induce reactivation of p53, (iii) increase levels of p21, (iv) induce DNA damage and G2/M cell cycle arrest, (v) alter expression levels of p53-associated apoptotic markers like, cleaved caspase-3 and PARP, and (vi) potentiate the cytotoxicity of cisplatin. 6G treatment induced significant reduction of tumor volume, tumor weight, proteasome inhibition and p53 accumulation in HeLa xenograft tumor cells in vivo. The 6G treatment was devoid of toxic effects as it did not affect body weights, hematological and osteogenic parameters. Taken together, our data underscores the therapeutic and chemosensitizing effects of 6G in the management and treatment of cervical cancer. PMID:26621832

[6]-Gingerol Induces Cell Cycle Arrest and Cell Death of Mutant p53-expressing Pancreatic Cancer Cells

PubMed Central

Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo

2006-01-01

[6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513

Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

PubMed Central

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

2011-01-01

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

PubMed

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

2011-09-23

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

Mechanisms of dihydrotestosterone action on resveratrol-induced anti-proliferation in breast cancer cells with different ERα status

PubMed Central

Chang, Tung-Cheng; Changou, Chun A.; Lai, Hsuan-Yu; Fu, Earl; HuangFu, Wei-Chun; Davis, Paul J.; Lin, Hung-Yun; Liu, Leroy F.

2015-01-01

Dihydrotestosterone (DHT) has been shown to promote breast cancer growth via different mechanisms. In addition to binding to ERα, the DHT membrane receptor exists on integrin αvβ3. Resveratrol induces p53-dependent apoptosis via plasma membrane integrin αvβ3. Resveratrol and DHT signals are both transduced by activated ERK1/2; however, DHT promotes cell proliferation in cancer cells, whereas resveratrol is pro-apoptotic. In this study, we examined the mechanism by which DHT inhibits resveratrol-induced apoptosis in human ERα positive (MCF-7) and negative (MDA-MB-231) breast cancer cells. DHT inhibited resveratrol-stimulated phosphorylation of Ser-15 of p53 in a concentration-dependent manner. These effects of DHT on resveratrol action were blocked by an ERα antagonist, ICI 182,780, in MCF-7 breast cancer cells. DHT inhibited resveratrol-induced nuclear complex of p53-COX-2 formation which is required p53-dependent apoptosis. ChIP studies of COX-2/p53 binding to DNA and expression of p53-responsive genes indicated that DHT inhibited resveratrol-induced p53-directed transcriptional activity. In addition, DHT did inhibit resveratrol-induced COX-2/p53-dependent gene expression. These results suggest that DHT inhibits p53-dependent apoptosis in breast cancer cells by interfering with nuclear COX-2 accumulation which is essential for stimulation of apoptotic pathways. Thus, the surface receptor sites for resveratrol and DHT are discrete and activate ERK1/2-dependent downstream effects on apoptosis that are distinctive. These studies provide new insights into the antagonizing effects of resveratrol versus DHT, an important step toward better understanding and eventually treating breast cancer. It also indicates the complex pathways by which apoptosis is induced by resveratrol in DHT-depleted and -repleted environments. PMID:26456774

Modulation of the poly (ADP-ribose) polymerase inhibitor response and DNA recombination in breast cancer cells by drugs affecting endogenous wild-type p53.

PubMed

Ireno, Ivanildce Cristiane; Wiehe, Rahel Stephanie; Stahl, Andreea Iulia; Hampp, Stephanie; Aydin, Sevtap; Troester, Melissa A; Selivanova, Galina; Wiesmüller, Lisa

2014-10-01

Synthetic lethal interactions between poly (ADP-ribose) polymerase (PARP) and homologous recombination (HR) repair pathways have been exploited for the development of novel mono- and combination cancer therapies. The tumor suppressor p53 was demonstrated to exhibit indirect and direct regulatory activities in DNA repair, particularly in DNA double-strand break (DSB)-induced and replication-associated HR. In this study, we tested a potential influence of the p53 status on the response to PARP inhibition, which is known to cause replication stress. Silencing endogenous or inducibly expressing p53 we found a protective effect of p53 on PARP inhibitor (PARPi)-mediated cytotoxicities. This effect was specific for wild-type versus mutant p53 and observed in cancer but not in non-transformed cell lines. Enhanced cytotoxicities after treatment with the p53-inhibitory drug Pifithrinα further supported p53-mediated resistance to PARP inhibition. Surprisingly, we equally observed increased PARPi sensitivity in the presence of the p53-activating compound Nutlin-3. As a common denominator, both drug responses correlated with decreased HR activities: Pifithrinα downregulated spontaneous HR resulting in damage accumulation. Nutlin-3 induced a decrease of DSB-induced HR, which was accompanied by a severe drop in RAD51 protein levels. Thus, we revealed a novel link between PARPi responsiveness and p53-controlled HR activities. These data expand the concept of cell and stress type-dependent healer and killer functions of wild-type p53 in response to cancer therapeutic treatment. Our findings have implications for the individualized design of cancer therapies using PARPi and the potentially combined use of p53-modulatory drugs. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Reverse chemomodulatory effects of the SIRT1 activators resveratrol and SRT1720 in Ewing's sarcoma cells: resveratrol suppresses and SRT1720 enhances etoposide- and vincristine-induced anticancer activity.

PubMed

Sonnemann, Jürgen; Kahl, Melanie; Siranjeevi, Priyanka M; Blumrich, Annelie; Blümel, Lisa; Becker, Sabine; Wittig, Susan; Winkler, René; Krämer, Oliver H; Beck, James F

2016-01-01

SIRT1-activating compounds (STACs) may have potential in the management of cancer. However, the best-studied STAC, the naturally occurring compound resveratrol, is reported to have contradictory effects in combination chemotherapy regimens: It has been shown both to increase and to decrease the action of anticancer agents. To shed more light on this issue, we comparatively investigated the impact of resveratrol and the synthetic STAC SRT1720 on the responsiveness of Ewing's sarcoma (ES) cells to the chemotherapeutic drugs etoposide and vincristine. Because the effects of STACs can depend on the functionality of the tumor suppressor protein p53, we used three ES cell lines differing in their p53 status, i.e., wild-type p53 WE-68 cells, mutant p53 SK-ES-1 cells and p53 null SK-N-MC cells. Single agent and combination therapy effects were assessed by flow cytometric analyses of propidium iodide uptake and mitochondrial depolarization, by measuring caspase 3/7 activity and by gene expression profiling. When applied as single agents, both STACs were effective in ES cells irrespective of their p53 status. Strikingly, however, when applied in conjunction with cytostatic agents, the STACs displayed reverse effects: SRT1720 largely enhanced etoposide- and vincristine-induced cell death, while resveratrol inhibited it. Combination index analyses validated the antipodal impact of the STACs on the effectiveness of the chemotherapeutics. These findings suggest that the synthetic STAC SRT1720 may be useful to enhance the efficacy of anticancer therapy in ES. But they also suggest that the dietary intake of the natural STAC resveratrol may be detrimental during chemotherapy of ES.

C2-streptavidin mediates the delivery of biotin-conjugated tumor suppressor protein p53 into tumor cells.

PubMed

Fahrer, Jörg; Schweitzer, Brigitte; Fiedler, Katja; Langer, Torben; Gierschik, Peter; Barth, Holger

2013-04-17

We have previously generated a recombinant C2-streptavidin fusion protein for the delivery of biotin-labeled molecules of low molecular weight into the cytosol of mammalian cells. A nontoxic moiety of Clostridium botulinum C2 toxin mediates the cellular uptake, whereas the streptavidin unit serves as a binding platform for biotin-labeled cargo molecules. In the present study, we used the C2-streptavidin transporter to introduce biotin-conjugated p53 protein into various mammalian cell lines. The p53 tumor suppressor protein is inactivated in many human cancers by multiple mechanisms and therefore the restoration of its activity in tumor cells is of great therapeutic interest. Recombinant p53 was expressed in insect cells and biotin-labeled. Biotin-p53 retained its specific high-affinity DNA-binding as revealed by gel-shift analysis. Successful conjugation of biotin-p53 to the C2-streptavidin transporter was monitored by an overlay blot technique and confirmed by real-time surface plasmon resonance, providing a KD-value in the low nM range. C2-streptavidin significantly enhanced the uptake of biotin-p53 into African Green Monkey (Vero) epithelial cells as shown by flow cytometry. Using cell fractionation, the cytosolic translocation of biotin-p53 was detected in Vero cells as well as in HeLa cervix carcinoma cells. In line with this finding, confocal microscopy displayed cytoplasmic staining of biotin-p53 in HeLa and HL60 leukemia cells. Internalized biotin-p53 partially colocalized with early endosomes, as confirmed by confocal microscopy. In conclusion, our results demonstrate the successful conjugation of biotin-p53 to C2-streptavidin and its subsequent receptor-mediated endocytosis into different human tumor cell lines.

B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang Xin; Xu Ke; Xu Yufang

The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report heremore » that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P{sub 2} promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research Highlights: > B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. > B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. > B1 induced significant increase of p53 binding to Bcl-2 P{sub 2} promoter TATA box.« less

Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

PubMed

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-02-11

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

PubMed Central

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

PubMed

Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

2016-11-04

Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

Novel action modality of the diterpenoid anisomelic acid causes depletion of E6 and E7 viral oncoproteins in HPV-transformed cervical carcinoma cells.

PubMed

Paul, Preethy; Rajendran, Senthil Kumar; Peuhu, Emilia; Alshatwi, Ali A; Akbarsha, Mohammad A; Hietanen, Sakari; Eriksson, John E

2014-05-15

Cervical cancer, the second most common malignancy among women, is mainly caused by human papilloma virus (HPV) infection. In HPV-positive cervical cancer cells, the activity of p53 and the induction of p21 are inhibited by the HPV oncoproteins E6 and E7. Therefore, blocking the activity of E6 and E7 would serve as an important therapeutic target in these cancer cells. In this study, anisomelic acid (AA), a natural compound belonging to the same diterpenoid family of bioactive compounds as taxol, was found to deplete the E6 and E7 proteins in HPV-positive cervical cancer cells. Consequently, p53 and the p53-responsive gene, p21, were dramatically induced, leading to G2/M-phase cell cycle arrest. AA-mediated cell cycle arrest and p21 expression were canceled when p53 was down-regulated by p53-shRNA. AA also induced p53-independent intrinsic apoptosis by depletion of the cellular inhibitor of apoptosis protein 2 (cIAP2) whose proteosomal degradation is inhibited by E6. The in ovo chick embryo chorioallantoic membrane (CAM) assay showed that anisomelic acid inhibited the tumor growth of the cervical cancer SiHa cells. AA is revealed to hold a novel action modality based on specific targeting of the HPV oncoproteins, which restores p53-mediated growth arrest and induces apoptosis by terminating E6-mediated cIAP2 stabilization. Copyright © 2014 Elsevier Inc. All rights reserved.

p53/PUMA expression in human pulmonary fibroblasts mediates cell activation and migration in silicosis.

PubMed

Wang, Wei; Liu, Haijun; Dai, Xiaoniu; Fang, Shencun; Wang, Xingang; Zhang, Yingming; Yao, Honghong; Zhang, Xilong; Chao, Jie

2015-11-18

Phagocytosis of SiO2 into the lung causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Clinical evidence has indicated that the activation of alveolar macrophages by SiO2 produces rapid and sustained inflammation characterized by the generation of monocyte chemotactic protein 1, which, in turn, induces fibrosis. However, the details of events downstream of monocyte chemotactic protein 1 activity in pulmonary fibroblasts remain unclear. Here, to elucidate the role of p53 in fibrosis induced by silica, both the upstream molecular mechanisms and the functional effects on cell proliferation and migration were investigated. Experiments using primary cultured adult human pulmonary fibroblasts led to the following results: 1) SiO2 treatment resulted in a rapid and sustained increase in p53 and PUMA protein levels; 2) the MAPK and PI3K pathways were involved in the SiO2-induced alteration of p53 and PUMA expression; and 3) RNA interference targeting p53 and PUMA prevented the SiO2-induced increases in fibroblast activation and migration. Our study elucidated a link between SiO2-induced p53/PUMA expression in fibroblasts and cell migration, thereby providing novel insight into the potential use of p53/PUMA in the development of novel therapeutic strategies for silicosis treatment.

Growth factor independence-1 antagonizes a p53-induced DNA damage response pathway in lymphoblastic leukemia

PubMed Central

Khandanpour, Cyrus; Phelan, James D.; Vassen, Lothar; Schütte, Judith; Chen, Riyan; Horman, Shane R.; Gaudreau, Marie-Claude; Krongold, Joseph; Zhu, Jinfang; Paul, William E.; Dührsen, Ulrich; Göttgens, Bertie; Grimes, H. Leighton; Möröy, Tarik

2013-01-01

Summary Most patients with acute lymphoblastic leukemia (ALL) fail current treatments highlighting the need for better therapies. Since oncogenic signaling activates a p53-dependent DNA-damage response and apoptosis, leukemic cells must devise appropriate countermeasures. We show here that growth factor independence 1 (Gfi1) can serve such a function, since Gfi1 ablation exacerbates p53 responses, and lowers the threshold for p53-induced cell death. Specifically, Gfi1 restricts p53 activity and expression of pro-apoptotic p53 targets such as Bax, Noxa (Pmaip1) and Puma (Bbc3). Subsequently, Gfi1 ablation cures mice from leukemia and limits the expansion of primary human T-ALL xenografts in mice. This suggests that targeting Gfi1 could improve the prognosis of patients with T-ALL or other lymphoid leukemias. PMID:23410974

Cellular Stress and p53-Associated Apoptosis by Juniperus communis L. Berry Extract Treatment in the Human SH-SY5Y Neuroblastoma Cells

PubMed Central

Lantto, Tiina A.; Laakso, Into; Dorman, H. J. Damien; Mauriala, Timo; Hiltunen, Raimo; Kõks, Sulev; Raasmaja, Atso

2016-01-01

Plant phenolics have shown to activate apoptotic cell death in different tumourigenic cell lines. In this study, we evaluated the effects of juniper berry extract (Juniperus communis L.) on p53 protein, gene expression and DNA fragmentation in human neuroblastoma SH-SY5Y cells. In addition, we analyzed the phenolic composition of the extract. We found that juniper berry extract activated cellular relocalization of p53 and DNA fragmentation-dependent cell death. Differentially expressed genes between treated and non-treated cells were evaluated with the cDNA-RDA (representational difference analysis) method at the early time point of apoptotic process when p53 started to be activated and no caspase activity was detected. Twenty one overexpressed genes related to cellular stress, protein synthesis, cell survival and death were detected. Interestingly, they included endoplasmic reticulum (ER) stress inducer and sensor HSPA5 and other ER stress-related genes CALM2 and YKT6 indicating that ER stress response was involved in juniper berry extract mediated cell death. In composition analysis, we identified and quantified low concentrations of fifteen phenolic compounds. The main groups of them were flavones, flavonols, phenolic acids, flavanol and biflavonoid including glycosides of quercetin, apigenin, isoscutellarein and hypolaetin. It is suggested that juniper berry extract induced the p53-associated apoptosis through the potentiation and synergism by several phenolic compounds. PMID:27420050

Dux4 induces cell cycle arrest at G1 phase through upregulation of p21 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Hongliang; Wang, Zhaoxia; Jin, Suqin

2014-03-28

Highlights: • Dux4 induced TE671 cell proliferation defect and G1 phase arrest. • Dux4 upregulated p21 expression without activating p53. • Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. • Sp1 binding site was required for Dux4-induced p21 promoter activation. - Abstract: It has been implicated that Dux4 plays crucial roles in development of facioscapulohumeral dystrophy. But the underlying myopathic mechanisms and related down-stream events of this retrogene were far from clear. Here, we reported that overexpression of Dux4 in a cell model TE671 reduced cell proliferation rate, and increased G1 phase accumulation. We also determined themore » impact of Dux4 on p53/p21 signal pathway, which controls the checkpoint in cell cycle progression. Overexpression of Dux4 increased p21 mRNA and protein level, while expression of p53, phospho-p53 remained unchanged. Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. Furthermore, we demonstrated that enhanced Dux4 expression increased p21 promoter activity and elevated expression of Sp1 transcription factor. Mutation of Sp1 binding site decreased dux4 induced p21 promoter activation. Chromatin immunoprecipitation (ChIP) assays confirmed the Dux4-induced binding of Sp1 to p21 promoter in vivo. These results suggest that Dux4 might induce proliferation inhibition and G1 phase arrest through upregulation of p21.« less

NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

PubMed

Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

2016-07-19

The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

Acentriolar mitosis activates a p53-dependent apoptosis pathway in the mouse embryo

PubMed Central

Bazzi, Hisham; Anderson, Kathryn V.

2014-01-01

Centrosomes are the microtubule-organizing centers of animal cells that organize interphase microtubules and mitotic spindles. Centrioles are the microtubule-based structures that organize centrosomes, and a defined set of proteins, including spindle assembly defective-4 (SAS4) (CPAP/CENPJ), is required for centriole biogenesis. The biological functions of centrioles and centrosomes vary among animals, and the functions of mammalian centrosomes have not been genetically defined. Here we use a null mutation in mouse Sas4 to define the cellular and developmental functions of mammalian centrioles in vivo. Sas4-null embryos lack centrosomes but survive until midgestation. As expected, Sas4−/− mutants lack primary cilia and therefore cannot respond to Hedgehog signals, but other developmental signaling pathways are normal in the mutants. Unlike mutants that lack cilia, Sas4−/− embryos show widespread apoptosis associated with global elevated expression of p53. Cell death is rescued in Sas4−/− p53−/− double-mutant embryos, demonstrating that mammalian centrioles prevent activation of a p53-dependent apoptotic pathway. Expression of p53 is not activated by abnormalities in bipolar spindle organization, chromosome segregation, cell-cycle profile, or DNA damage response, which are normal in Sas4−/− mutants. Instead, live imaging shows that the duration of prometaphase is prolonged in the mutants while two acentriolar spindle poles are assembled. Independent experiments show that prolonging spindle assembly is sufficient to trigger p53-dependent apoptosis. We conclude that a short delay in the prometaphase caused by the absence of centrioles activates a previously undescribed p53-dependent cell death pathway in the rapidly dividing cells of the mouse embryo. PMID:24706806

40 Years of Research Put p53 in Translation

PubMed Central

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

Dihydromyricetin promotes hepatocellular carcinoma regression via a p53 activation-dependent mechanism

NASA Astrophysics Data System (ADS)

Zhang, Qingyu; Liu, Jie; Liu, Bin; Xia, Juan; Chen, Nianping; Chen, Xiaofeng; Cao, Yi; Zhang, Chen; Lu, Caijie; Li, Mingyi; Zhu, Runzhi

2014-04-01

The development of antitumor chemotherapy drugs remains a key goal for oncologists, and natural products provide a vast resource for anti-cancer drug discovery. In the current study, we found that the flavonoid dihydromyricetin (DHM) exhibited antitumor activity against liver cancer cells, including primary cells obtained from hepatocellular carcinoma (HCC) patients. In contrast, DHM was not cytotoxic to immortalized normal liver cells. Furthermore, DHM treatment resulted in the growth inhibition and remission of xenotransplanted tumors in nude mice. Our results further demonstrated that this antitumor activity was caused by the activation of the p53-dependent apoptosis pathway via p53 phosphorylation at serine (15Ser). Moreover, our results showed that DHM plays a dual role in the induction of cell death when administered in combination with cisplatin, a common clinical drug that kills primary hepatoma cells but not normal liver cells.

Downregulation of LRRC8A protects human ovarian and alveolar carcinoma cells against Cisplatin-induced expression of p53, MDM2, p21Waf1/Cip1, and Caspase-9/-3 activation

PubMed Central

Sørensen, Belinda Halling; Nielsen, Dorthe; Thorsteinsdottir, Unnur Arna; Hoffmann, Else Kay

2016-01-01

The leucine-rich repeat containing 8A (LRRC8A) protein is an essential component of the volume-sensitive organic anion channel (VSOAC), and using pharmacological anion channel inhibitors (NS3728, DIDS) and LRRC8A siRNA we have investigated its role in development of Cisplatin resistance in human ovarian (A2780) and alveolar (A549) carcinoma cells. In Cisplatin-sensitive cells Cisplatin treatment increases p53-protein level as well as downstream signaling, e.g., expression of p21Waf1/Cip1, Bax, Noxa, MDM2, and activation of Caspase-9/-3. In contrast, Cisplatin-resistant cells do not enter apoptosis, i.e., their p53 and downstream signaling are reduced and caspase activity unaltered following Cisplatin exposure. Reduced LRRC8A expression and VSOAC activity are previously shown to correlate with Cisplatin resistance, and here we demonstrate that pharmacological inhibition and transient knockdown of LRRC8A reduce the protein level of p53, MDM2, and p21Waf1/Cip1 as well as Caspase-9/-3 activation in Cisplatin-sensitive cells. Cisplatin resistance is accompanied by reduction in total LRRC8A expression (A2780) or LRRC8A expression in the plasma membrane (A549). Activation of Caspase-3 dependent apoptosis by TNFα-exposure or hyperosmotic cell shrinkage is almost unaffected by pharmacological anion channel inhibition. Our data indicate 1) that expression/activity of LRRC8A is essential for Cisplatin-induced increase in p53 protein level and its downstream signaling, i.e., Caspase-9/-3 activation, expression of p21Waf1/Cip1 and MDM2; and 2) that downregulation of LRRC8A-dependent osmolyte transporters contributes to acquirement of Cisplatin resistance in ovarian and lung carcinoma cells. Activation of LRRC8A-containing channels is upstream to apoptotic volume decrease as hypertonic cell shrinkage induces apoptosis independent of the presence of LRRC8A. PMID:26984736

Negative feedback regulation of wild-type p53 biosynthesis.

PubMed Central

Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

1995-01-01

When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

Nutlin-3 induces HO-1 expression by activating JNK in a transcription-independent manner of p53.

PubMed

Choe, Yun-Jeong; Lee, Sun-Young; Ko, Kyung Won; Shin, Seok Joon; Kim, Ho-Shik

2014-03-01

A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1 in a transcription-independent manner of p53. Nutlin-3 induced HO-1 expression at the level of transcription in human cancer cells such as U2OS and RKO cells. This induction of HO-1 did not occur in SAOS cells in which p53 was mutated and was prevented by knocking down the p53 protein using p53 siRNA transfection, but not by PFT-α, an inhibitor of the transcriptional activity of p53. Accompanying HO-1 expression, nutlin-3 stimulated the accumulation of ROS and the phosphorylation of MAPKs such as JNK, p38 MAPK and ERK1/2. Nutlin-3-induced HO-1 expression was suppressed by TEMPO, a ROS scavenger, and chemical inhibitors of JNK and p38 MAPK but not ERK1/2. In addition, nutlin‑3-induced phosphorylation of JNK but not p38 MAPK was inhibited by TEMPO. Notably, the levels of nutlin-3-induced ROS were correlated with the mitochondrial translocation of p53 and this induction was prevented by PFT-μ, an inhibitor of the mitochondrial translocation of p53. Consistent with the effect of the ROS scavenger and MAPK inhibitors, PFT-μ reduced HO-1 expression and the phosphorylation of JNK induced by nutlin-3. In the experiments of analyzing cell death, the knockdown of HO-1 augmented nutlin-3-induced apoptosis. Collectively, these results suggest that nutlin-3 induces HO-1 expression via the activation of both JNK which is dependent on ROS generated by p53 translocated to the mitochondria and p38 MAPK which appears to be stimulated by a ROS-independent mechanism, and this HO-1 induction may inhibit nutlin-3-induced apoptosis, constituting a negative feedback loop of p53-induced apoptosis.

p53 as a retrovirus-induced oxidative stress modulator.

PubMed

Kim, Soo Jin; Wong, Paul K Y

2015-01-01

Infection of astrocytes by the neuropathogenic mutant of Moloney murine leukemia virus, ts1, exhibits increased levels of reactive oxygen species (ROS) and signs of oxidative stress compared with uninfected astrocytes. Previously, we have demonstrated that ts1 infection caused two separate events of ROS upregulation. The first upregulation occurs during early viral establishment in host cells and the second during the virus-mediated apoptotic process. In this study, we show that virus-mediated ROS upregulation activates the protein kinase, ataxia telangiectasia mutated, which in turn phosphorylates serine 15 on p53. This activation of p53 however, is unlikely associated with ts1-induced cell death. Rather p53 appears to be involved in suppressing intracellular ROS levels in astrocytes under oxidative stress. The activated p53 appears to delay retroviral gene expression by suppressing NADPH oxidase, a superoxide-producing enzyme. These results suggest that p53 plays a role as a retrovirus-mediated oxidative stress modulator. © 2015 The Authors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simoes, Maria L.; Hockley, Sarah L.; Schwerdtle, Tanja

Aristolochic acid (AA) is the causative agent of urothelial tumours associated with aristolochic acid nephropathy. These tumours contain TP53 mutations and over-express TP53. We compared transcriptional and translational responses of two isogenic HCT116 cell lines, one expressing TP53 (p53-WT) and the other with this gene knocked out (p53-null), to treatment with aristolochic acid I (AAI) (50-100 {mu}M) for 6-48 h. Modulation of 118 genes was observed in p53-WT cells and 123 genes in p53-null cells. Some genes, including INSIG1, EGR1, CAV1, LCN2 and CCNG1, were differentially expressed in the two cell lines. CDKN1A was selectively up-regulated in p53-WT cells, leadingmore » to accumulation of TP53 and CDKN1A. Apoptotic signalling, measured by caspase-3 and -7 activity, was TP53-dependent. Both cell types accumulated in S phase, suggesting that AAI-DNA adducts interfere with DNA replication, independently of TP53 status. The oncogene MYC, frequently over-expressed in urothelial tumours, was up-regulated by AAI, whereas FOS was down-regulated. Observed modulation of genes involved in endocytosis, e.g. RAB5A, may be relevant to the known inhibition of receptor-mediated endocytosis, an early sign of AA-mediated proximal tubule injury. AAI-DNA adduct formation was significantly greater in p53-WT cells than in p53-null cells. Collectively, phenotypic anchoring of the AAI-induced expression profiles to DNA adduct formation, cell-cycle parameters, TP53 expression and apoptosis identified several genes linked to these biological outcomes, some of which are TP53-dependent. These results strengthen the importance of TP53 in AA-induced cancer, and indicate that other alterations, e.g. to MYC oncogenic pathways, may also contribute.« less

Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk

2012-03-10

p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)-Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh-Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3-p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expressionmore » of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2-p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.« less

Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

PubMed

Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

2012-10-01

The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

Poly(beta-amino ester) nanoparticle-delivery of p53 has activity against small cell lung cancer in vitro and in vivo

PubMed Central

Kamat, Chandrashekhar D.; Shmueli, Ron B.; Connis, Nick; Rudin, Charles M.; Green, Jordan J.; Hann, Christine L.

2013-01-01

Small cell lung cancer (SCLC) is an aggressive disease with one of the highest case-fatality rates among cancer. The recommended therapy for SCLC has not changed significantly over the past 30 years; new therapeutic approaches are a critical need. TP53 is mutated in the majority of SCLC cases and its loss is required in transgenic mouse models of the disease. We synthesized an array of biodegradable poly(beta-amino ester) (PBAE) polymers which self-assemble with DNA and assayed for transfection efficiency in the p53-mutant H446 SCLC cell line using high-throughput methodologies. Two of the top candidates were selected for further characterization and TP53 delivery in vitro and in vivo. Nanoparticle delivery of TP53 resulted in expression of exogenous p53, induction of p21, induction of apoptosis and accumulation of cells in sub-G1 consistent with functional p53 activity. Intratumoral injection of subcutaneous H446 xenografts with polymers carrying TP53 caused marked tumor growth inhibition. This is the first demonstration of TP53 gene therapy in SCLC using non-viral polymeric nanoparticles. This technology may have general applicability as a novel anti-cancer strategy based on restoration of tumor suppressor gene function. PMID:23364678

β-Catenin C-terminal signals suppress p53 and are essential for artery formation

PubMed Central

Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

2016-01-01

Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

Chk2 mediates RITA-induced apoptosis.

PubMed

de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

2012-06-01

Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA.

Chk2 mediates RITA-induced apoptosis

PubMed Central

de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

2012-01-01

Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA. PMID:22158418

Concurrent acetylation of FoxO1/3a and p53 due to sirtuins inhibition elicit Bim/PUMA mediated mitochondrial dysfunction and apoptosis in berberine-treated HepG2 cells.

PubMed

Shukla, Shatrunajay; Sharma, Ankita; Pandey, Vivek Kumar; Raisuddin, Sheikh; Kakkar, Poonam

2016-01-15

Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD(+) dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P<0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increased the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P<0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD(+)/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1-10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P<0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria-mediated apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.

Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*

PubMed Central

Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi

2011-01-01

Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449

ATM phosphorylation of Mdm2 Ser394 regulates the amplitude and duration of the DNA damage response in mice

PubMed Central

Gannon, Hugh S.; Woda, Bruce A.; Jones, Stephen N.

2012-01-01

Summary DNA damage induced by ionizing radiation (IR) activates the ATM kinase, which subsequently stabilizes and activates the p53 tumor suppressor protein. Although phosphorylation of p53 by ATM was found previously to modulate p53 levels and transcriptional activities in vivo, it does not appear to be a major regulator of p53 stability. We have utilized mice bearing altered Mdm2 alleles to demonstrate that ATM phosphorylation of Mdm2 serine 394 is required for robust p53 stabilization and activation after DNA damage. In addition, we demonstrate that dephosphorylation of Mdm2 Ser394 regulates attenuation of the p53-mediated response to DNA damage. Therefore, the phosphorylation status of Mdm2 Ser394 governs p53 protein levels and functions in cells undergoing DNA damage. PMID:22624716

p53 is a major component of the transcriptional and apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling.

PubMed

Nayak, G; Cooper, G M

2012-10-11

The phosphatidylinositol (PI) 3-kinase/Akt signaling pathway has a prominent role in cell survival and proliferation, in part, by regulating gene expression at the transcriptional level. Previous work using global expression profiling identified FOXOs and the E-box-binding transcription factors MITF and USF1 as key targets of PI 3-kinase signaling that lead to the induction of proapoptotic and cell cycle arrest genes in response to inhibition of PI 3-kinase. In this study, we investigated the role of p53 downstream of PI 3-kinase signaling by analyzing the effects of inhibition of PI 3-kinase in Rat-1 cells, which have wild-type p53, compared with Rat-1 cells expressing a dominant-negative p53 mutant. Expression of dominant-negative p53 conferred partial resistance to apoptosis induced by inhibition of PI 3-kinase. Global gene expression profiling combined with computational and experimental analysis of transcription factor binding sites demonstrated that p53, along with FOXO, MITF and USF1, contributed to gene induction in response to PI 3-kinase inhibition. Activation of p53 was mediated by phosphorylation of the histone acetyltransferase Tip60 by glycogen synthase kinase (GSK) 3, leading to activation of p53 by acetylation. Many of the genes targeted by p53 were also targeted by FOXO and E-box-binding transcription factors, indicating that p53 functions coordinately with these factors to regulate gene expression downstream of PI 3-kinase/Akt/GSK3 signaling.

PML is a ROS sensor activating p53 upon oxidative stress

PubMed Central

Soilihi, Hassane

2017-01-01

Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625

PML is a ROS sensor activating p53 upon oxidative stress.

PubMed

Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues

2017-11-06

Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.

Local activation of p53 in the tumor microenvironment overcomes immune suppression and enhances antitumor immunity

PubMed Central

Guo, Gang; Yu, Miao; Xiao, Wei; Celis, Esteban; Cui, Yan

2017-01-01

Mutations in tumor suppressor p53 remain a vital mechanism of tumor escape from apoptosis and senescence. Emerging evidence suggests that p53 dysfunction also fuels inflammation and supports tumor immune evasion, thereby serving as an immunological driver of tumorigenesis. Therefore, targeting p53 in the tumor microenvironment (TME) also represents an immunologically desirable strategy for reversing immunosuppression and enhancing antitumor immunity. Using a pharmacological p53 activator nutlin-3a, we show that local p53 activation in TME comprising overt tumor infiltrating leukocytes (TILeus) induces systemic antitumor immunity and tumor regression, but not in TME with scarce TILeus, such as B16 melanoma. Maneuvers that recruit leukocytes to TME, such as TLR3 ligand in B16 tumors, greatly enhanced nutlin-induced antitumor immunity and tumor control. Mechanistically, nutlin-3a-induced antitumor immunity was contingent on two non-redundant but immunologically synergistic p53-dependent processes: reversal of immunosuppression in TME and induction of tumor immunogenic cell death (ICD), leading to activation and expansion of polyfunctional CD8 CTLs and tumor regression. Our study demonstrates that unlike conventional tumoricidal therapies, which rely on effective p53 targeting in each tumor cell and often associate with systemic toxicity, this immune-based strategy requires only limited local p53 activation to alter the immune landscape of TME and subsequently amplify immune response to systemic antitumor immunity. Hence, targeting the p53 pathway in TME can be exploited to reverse immunosuppression and augment therapeutic benefits beyond tumoricidal effects to harness tumor-specific, durable, and systemic antitumor immunity with minimal toxicity. PMID:28280037

MDM2 restrains estrogen-mediated AKT activation by promoting TBK1-dependent HPIP degradation

PubMed Central

Shostak, K; Patrascu, F; Göktuna, S I; Close, P; Borgs, L; Nguyen, L; Olivier, F; Rammal, A; Brinkhaus, H; Bentires-Alj, M; Marine, J-C; Chariot, A

2014-01-01

Restoration of p53 tumor suppressor function through inhibition of its interaction and/or enzymatic activity of its E3 ligase, MDM2, is a promising therapeutic approach to treat cancer. However, because the MDM2 targetome extends beyond p53, MDM2 inhibition may also cause unwanted activation of oncogenic pathways. Accordingly, we identified the microtubule-associated HPIP, a positive regulator of oncogenic AKT signaling, as a novel MDM2 substrate. MDM2-dependent HPIP degradation occurs in breast cancer cells on its phosphorylation by the estrogen-activated kinase TBK1. Importantly, decreasing Mdm2 gene dosage in mouse mammary epithelial cells potentiates estrogen-dependent AKT activation owing to HPIP stabilization. In addition, we identified HPIP as a novel p53 transcriptional target, and pharmacological inhibition of MDM2 causes p53-dependent increase in HPIP transcription and also prevents HPIP degradation by turning off TBK1 activity. Our data indicate that p53 reactivation through MDM2 inhibition may result in ectopic AKT oncogenic activity by maintaining HPIP protein levels. PMID:24488098

p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation

PubMed Central

Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.

2011-01-01

p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464

p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.

PubMed

Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina

2009-11-01

Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.

Mdm2 is required for survival of hematopoietic stem cells/progenitors via dampening of ROS-induced p53 activity

USDA-ARS?s Scientific Manuscript database

Mdm2 is an E3 ubiquitin ligase that targets p53 for degradation. p53(515C) (encoding p53R172P) is a hypomorphic allele of p53 that rescues the embryonic lethality of Mdm2(-/-) mice. Mdm2(-/-) p53(515C/515C) mice, however, die by postnatal day 13 resulting from hematopoietic failure. Hematopoietic st...

Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

PubMed

Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

2015-01-01

A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

DOE PAGES

Botcheva, Krassimira; McCorkle, Sean R.

2014-11-21

The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

Sulphur alters NFκB-p300 cross-talk in favour of p53-p300 to induce apoptosis in non-small cell lung carcinoma.

PubMed

Saha, Shilpi; Bhattacharjee, Pushpak; Guha, Deblina; Kajal, Kirti; Khan, Poulami; Chakraborty, Sreeparna; Mukherjee, Shravanti; Paul, Shrutarshi; Manchanda, Rajkumar; Khurana, Anil; Nayak, Debadatta; Chakrabarty, Rathin; Sa, Gaurisankar; Das, Tanya

2015-08-01

Adverse side effects of chemotherapy during cancer treatment have shifted considerable focus towards therapies that are not only targeted but are also devoid of toxic side effects. We evaluated the antitumorigenic activity of sulphur, and delineated the molecular mechanisms underlying sulphur-induced apoptosis in non-small cell lung carcinoma (NSCLC) cells. A search for the underlying mechanism revealed that the choice between the two cellular processes, NFκBp65-mediated survival and p53-mediated apoptosis, was decided by the competition for a limited pool of transcriptional coactivator protein p300 in NSCLC cells. In contrast, sulphur inhibited otherwise upregulated survival signaling in NSCLC cells by perturbing the nuclear translocation of p65NFκB, its association with p300 histone acetylase, and subsequent transcription of Bcl-2. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic mitochondrial death cascade. Overall, the findings of this preclinical study clearly delineated the molecular mechanism underlying the apoptogenic effect of the non-toxic homeopathic remedy, sulphur, in NSCLC cells.

Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

PubMed Central

1994-01-01

Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041

Concurrent acetylation of FoxO1/3a and p53 due to sirtuins inhibition elicit Bim/PUMA mediated mitochondrial dysfunction and apoptosis in berberine-treated HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shukla, Shatrunajay; Department of Medical Elementology and Toxicology, Jamia Hamdard; Sharma, Ankita

Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD{sup +} dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P < 0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increasedmore » the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P < 0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD{sup +}/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1–10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P < 0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria-mediated apoptosis. - Highlights: • Berberine inhibits sirtuins at transcriptional as well as at translational level. • Sirtuins inhibition leads to acetylation of non-histone proteins, FoxO1/3a and p53. • Acetylated FoxO and p53 transcriptionally upregulate BH3-only proteins Bim and PUMA respectively. • BH3-only proteins trigger mitochondrial dysfunction culminating into apoptosis. • SRT-1720 (SIRT-1 activator) partially restores Bax/Bcl-2 ratio and reduces berberine induced cytotoxicity in HepG2 cells.« less

Accumulation of p53 in infectious mononucleosis tissues.

PubMed

Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

2000-11-01

Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

An adaptive molecular timer in p53-meidated cell fate decision

NASA Astrophysics Data System (ADS)

Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

MicroRNA-214 Promotes Apoptosis in Canine Hemangiosarcoma by Targeting the COP1-p53 Axis.

PubMed

Heishima, Kazuki; Mori, Takashi; Sakai, Hiroki; Sugito, Nobuhiko; Murakami, Mami; Yamada, Nami; Akao, Yukihiro; Maruo, Kohji

2015-01-01

MicroRNA-214 regulates both angiogenic function in endothelial cells and apoptosis in various cancers. However, the regulation and function of miR-214 is unclear in canine hemangiosarcoma, which is a spontaneous model of human angiosarcoma. The expression and functional roles of miR-214 in canine hemangiosarcoma were presently explored by performing miRNA TaqMan qRT-PCR and transfecting cells with synthetic microRNA. Here, we report that miR-214 was significantly down-regulated in the cell lines used and in clinical samples of canine hemangiosarcoma. Restoration of miR-214 expression reduced cell growth and induced apoptosis in canine hemangiosarcoma cell lines through transcriptional activation of p53-regulated genes although miR-214 had a slight effect of growth inhibition on normal endothelial cells. We identified COP1, which is a critical negative regulator of p53, as a novel direct target of miR-214. COP1 was overexpressed and the specific COP1 knockdown induced apoptosis through transcriptional activation of p53-regulated genes as well as did miR-214-transfection in HSA cell lines. Furthermore, p53 knockdown abolished the miR-214-COP1-mediated apoptosis; thus, miR-214 and COP1 regulated apoptosis through controlling p53 in HSA. In conclusion, miR-214 functioned as a tumor suppressor in canine hemangiosarcoma by inducing apoptosis through recovering the function of p53. miR-214 down-regulation and COP1 overexpression is likely to contribute to tumorigenesis of HSA. Therefore, targeting miR-214-COP1-p53 axis would possibly be a novel effective strategy for treatment of canine hemangiosarcoma and capable of being applied to the development of novel therapeutics for human angiosarcoma.

p53-independent p21 induction by MELK inhibition.

PubMed

Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

2017-08-29

MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.

p53-independent p21 induction by MELK inhibition

PubMed Central

Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

2017-01-01

MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528

Undecylprodigiosin selectively induces apoptosis in human breast carcinoma cells independent of p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, T.-F.; Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan; Department of Medical Technology, Central Taiwan University of Science and Technology, Taichung 40605, Taiwan

2007-12-15

Undecylprodigiosin (UP) is a bacterial bioactive metabolite produced by Streptomyces and Serratia. In this study, we explored the anticancer effect of UP. Human breast carcinoma cell lines BT-20, MCF-7, MDA-MB-231 and T47D and one nonmalignant human breast epithelial cell line, MCF-10A, were tested in this study. We found that UP exerted a potent cytotoxicity against all breast carcinoma cell lines in a dose- and time-dependent manner. In contrast, UP showed limited toxicity to MCF-10A cells, indicating UP's cytotoxic effect is selective for malignant cells. UP's cytotoxic effect was due to apoptosis, as confirmed by positive TUNEL signals, annexin V-binding, caspasemore » 9 activation and PARP cleavage. Notably, UP-induced apoptosis was blocked by the pan-caspase inhibitor z-VAD.fmk, further indicating the involvement of caspase activity. Moreover, UP caused a marked decrease of the levels of antiapoptotic BCL-X{sub L}, Survivin and XIAP while enhancing the levels of proapoptotic BIK, BIM, MCL-1S and NOXA, consequently favoring induction of apoptosis. Additionally, we found that cells with functional p53 (MCF-7, T47D) or mutant p53 (BT-20, MDA-MB-231) were both susceptible to UP's cytotoxicity. Importantly, UP was able to induce apoptosis in MCF-7 cells with p53 knockdown by RNA interference, confirming the dispensability of p53 in UP-induced apoptosis. Overall, our results establish that UP induces p53-independent apoptosis in breast carcinoma cells with no marked toxicity to nonmalignant cells, raising the possibility of its use as a new chemotherapeutic drug for breast cancer irrespective of p53 status.« less

Pre-clinical efficacy and synergistic potential of the MDM2-p53 antagonists, Nutlin-3 and RG7388, as single agents and in combined treatment with cisplatin in ovarian cancer

PubMed Central

Zanjirband, Maryam; Edmondson, Richard J.; Lunec, John

2016-01-01

Ovarian cancer is the fifth leading cause of cancer-related female deaths. Due to serious side effects, relapse and resistance to standard chemotherapy, better and more targeted approaches are required. Mutation of the TP53 gene accounts for 50% of all human cancers. In the remaining malignancies, non-genotoxic activation of wild-type p53 by small molecule inhibition of the MDM2-p53 binding interaction is a promising therapeutic strategy. Proof of concept was established with the cis-imidazoline Nutlin-3, leading to the development of RG7388 and other compounds currently in early phase clinical trials. This preclinical study evaluated the effect of Nutlin-3 and RG7388 as single agents and in combination with cisplatin in a panel of ovarian cancer cell lines. Median-drug-effect analysis showed Nutlin-3 or RG7388 combination with cisplatin was additive to, or synergistic in a p53-dependent manner, resulting in increased p53 activation, cell cycle arrest and apoptosis, associated with increased p21WAF1 protein and/or caspase-3/7 activity compared to cisplatin alone. Although MDM2 inhibition activated the expression of p53-dependent DNA repair genes, the growth inhibitory and pro-apoptotic effects of p53 dominated the response. These data indicate that combination treatment with MDM2 inhibitors and cisplatin has synergistic potential for the treatment of ovarian cancer, dependent on cell genotype. PMID:27223080

Deletion of ribosomal protein genes is a common vulnerability in human cancer, especially in concert with TP53 mutations.

PubMed

Ajore, Ram; Raiser, David; McConkey, Marie; Jöud, Magnus; Boidol, Bernd; Mar, Brenton; Saksena, Gordon; Weinstock, David M; Armstrong, Scott; Ellis, Steven R; Ebert, Benjamin L; Nilsson, Björn

2017-04-01

Heterozygous inactivating mutations in ribosomal protein genes (RPGs) are associated with hematopoietic and developmental abnormalities, activation of p53, and altered risk of cancer in humans and model organisms. Here we performed a large-scale analysis of cancer genome data to examine the frequency and selective pressure of RPG lesions across human cancers. We found that hemizygous RPG deletions are common, occurring in about 43% of 10,744 cancer specimens and cell lines. Consistent with p53-dependent negative selection, such lesions are underrepresented in TP53 -intact tumors ( P  ≪ 10 -10 ), and shRNA-mediated knockdown of RPGs activated p53 in TP53 -wild-type cells. In contrast, we did not see negative selection of RPG deletions in TP53 -mutant tumors. RPGs are conserved with respect to homozygous deletions, and shRNA screening data from 174 cell lines demonstrate that further suppression of hemizygously deleted RPGs inhibits cell growth. Our results establish RPG haploinsufficiency as a strikingly common vulnerability of human cancers that associates with TP53 mutations and could be targetable therapeutically. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

p53 and c-myc activation by Pasteurella haemolytica leukotoxin is correlated with bovine mononuclear cells apoptosis.

PubMed

Marcatili, A; D'Isanto, M; Vitiello, M; Galdiero, R; Galdiero, M

2002-04-01

To analyse the role of Pasteurella haemolytica Leukotoxin (LKT) in the mechanism of apoptotic cell death of bovine lymphocytes, we evaluated DNA fragmentation and p53 and c-myc expression. P. haemolytica strain ATCC 14003 was cultivated for LKT production. DNA fragmentation was analysed by electrophoresis on Agarose gel. DNA strand breaks in individual apoptotic cells were also detected by an in situ Terminal deoxy nucleotidyl Transferase (TdT). The Polymerase Chain Reaction (PCR) procedure was used for verified p53 and c-myc activation by P. haemolytica LKT. LKT was able to induce DNA fragmentation in a dose and time-dependent fashion. The greatest apoptotic effect was obtained using LKT at a concentration of 0.25 U. The results show that p53 and c-myc activation by LKT is correlated with apoptosis of bovine lymphocytes and monocytes. Our data suggest that LKT may have an important role in the bacterial virulence of Pasteurella haemolytica.

Differential anti-tumor activity of coriolus versicolor (Yunzhi) extract through p53- and/or Bcl-2-dependent apoptotic pathway in human breast cancer cells.

PubMed

Ho, Cheong-Yip; Kim, Chi-Fai; Leung, Kwok-Nam; Fung, Kwok-Pui; Tse, Tak-Fu; Chan, Helen; Lau, Clara Bik-San

2005-06-01

Coriolus versicolor (CV), also called Yunzhi, has been demonstrated to exert anti-tumor effects on various types of cancer cells, but the underlying mechanism has not been fully elucidated. The present study aimed to evaluate the in vitro anti-tumor activity of a standardized aqueous ethanol extract prepared from CV on four breast cancer cell lines using MTT assay, and test whether the mechanism involves apoptosis induction and modulation of p53 and Bcl-2 protein expressions using cell death detection ELISA, p53 and Bcl-2 ELISAs respectively. Our results demonstrated that the CV extract dose-dependently suppressed the proliferation of three breast tumor cell lines, with ascending order of IC50 values: T-47D, MCF-7, MDA-MB-231, while BT-20 cells were not significantly affected. Tumoricidal activity of the CV extract was found to be comparable to a chemotherapeutic anti-cancer drug, mitomycin C. Nucleosome productions in apoptotic MDA-MB-231, MCF-7 and T-47D cells were significantly augmented in a time-dependent manner and paralleled the anti-proliferative activity of CV extract. Expression of p53 protein was significantly upregulated only in T-47D cells treated with the CV extract in a dose- and time-dependent fashion, but not in MCF-7 (except at 400 mug/ml after 16 h) and MDA-MB-231 cells. The CV extract significantly induced a dose-dependent downregulation of Bcl-2 protein expression in MCF-7 and T-47D cells, but not in MDA-MB-231 cells. These results suggested that apoptosis induction, differentially dependent of p53 and Bcl-2 expressions, might be the possible mechanism of CV extract-mediated cytotoxicity in human breast cancer cells in vitro.

Distinct downstream targets manifest p53-dependent pathologies in mice.

PubMed

Pant, V; Xiong, S; Chau, G; Tsai, K; Shetty, G; Lozano, G

2016-11-03

Mdm2, the principal negative regulator of p53, is critical for survival, a fact clearly demonstrated by the p53-dependent death of germline or conditional mice following deletion of Mdm2. On the other hand, Mdm2 hypomorphic (Mdm2 Puro/Δ7-12 ) or heterozygous (Mdm2 +/- ) mice that express either 30 or 50% of normal Mdm2 levels, respectively, are viable but present distinct phenotypes because of increased p53 activity. Mdm2 levels are also transcriptionally regulated by p53. We evaluated the significance of this reciprocal relationship in a new hypomorphic mouse model inheriting an aberrant Mdm2 allele with insertion of the neomycin cassette and deletion of 184-bp sequence in intron 3. These mice also carry mutations in the Mdm2 P2-promoter and thus express suboptimal levels of Mdm2 entirely encoded from the P1-promoter. Resulting mice exhibit abnormalities in skin pigmentation and reproductive tissue architecture, and are subfertile. Notably, all these phenotypes are rescued on a p53-null background. Furthermore, these phenotypes depend on distinct p53 downstream activities as genetic ablation of the pro-apoptotic gene Puma reverts the reproductive abnormalities but not skin hyperpigmentation, whereas deletion of cell cycle arrest gene p21 does not rescue either phenotype. Moreover, p53-mediated upregulation of Kitl influences skin pigmentation. Altogether, these data emphasize tissue-specific p53 activities that regulate cell fate.

Modulation of the cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by Zac1 through the antagonistic regulators p53 and histone deacetylase 1 in HeLa Cells.

PubMed

Liu, Pei-Yao; Chan, James Yi-Hsin; Lin, Hsiu-Chen; Wang, Sung-Ling; Liu, Shu-Ting; Ho, Ching-Liang; Chang, Li-Chien; Huang, Shih-Ming

2008-07-01

Zac1 is a novel seven-zinc finger protein which possesses the ability to bind specifically to GC-rich DNA elements. Zac1 not only promotes apoptosis and cell cycle arrest but also acts as a transcriptional cofactor for p53 and a number of nuclear receptors. Our previous study indicated that the enhancement of p53 activity by Zac1 is much more pronounced in HeLa cells compared with other cell lines tested. This phenomenon might be due to the coactivator effect of Zac1 on p53 and the ability of Zac1 to reverse E6 inhibition of p53. In the present study, we showed that Zac1 acted synergistically with either p53 or a histone deacetylase inhibitor, trichostatin A, to enhance p21(WAF1/Cip1) promoter activity. We showed that Zac1 physically interacted with some nuclear receptor corepressors such as histone deacetylase 1 (HDAC1) and mSin3a, and the induction of p21(WAF1/Cip1) gene and protein by Zac1 was suppressed by either overexpressing HDAC1 or its deacetylase-dead mutant. In addition, our data suggest that trichostatin A-induced p21(WAF1/Cip1) protein expression might be mediated through a p53-independent and HDAC deacetylase-independent pathway. Taken together, our data suggest that Zac1 might be involved in regulating the p21(WAF1/Cip1) gene and protein expression through its protein-protein interaction with p53 and HDAC1 in HeLa cells.

Growth hormone is a cellular senescence target in pituitary and nonpituitary cells

PubMed Central

Chesnokova, Vera; Zhou, Cuiqi; Ben-Shlomo, Anat; Zonis, Svetlana; Tani, Yuji; Ren, Song-Guang; Melmed, Shlomo

2013-01-01

Premature proliferative arrest in benign or early-stage tumors induced by oncoproteins, chromosomal instability, or DNA damage is associated with p53/p21 activation, culminating in either senescence or apoptosis, depending on cell context. Growth hormone (GH) elicits direct peripheral metabolic actions as well as growth effects mediated by insulin-like growth factor 1 (IGF1). Locally produced peripheral tissue GH, in contrast to circulating pituitary-derived endocrine GH, has been proposed to be both proapoptotic and prooncogenic. Pituitary adenomas expressing and secreting GH are invariably benign and exhibit DNA damage and a senescent phenotype. We therefore tested effects of nutlin-induced p53-mediated senescence in rat and human pituitary cells. We show that DNA damage senescence induced by nutlin triggers the p53/p21 senescent pathway, with subsequent marked induction of intracellular pituitary GH in vitro. In contrast, GH is not induced in cells devoid of p53. Furthermore we show that p53 binds specific GH promoter motifs and enhances GH transcription and secretion in senescent pituitary adenoma cells and also in nonpituitary (human breast and colon) cells. In vivo, treatment with nutlin results in up-regulation of both p53 and GH in the pituitary gland, as well as increased GH expression in nonpituitary tissues (lung and liver). Intracrine GH acts in pituitary cells as an apoptosis switch for p53-mediated senescence, likely protecting the pituitary adenoma from progression to malignancy. Unlike in the pituitary, in nonpituitary cells GH exerts antiapoptotic properties. Thus, the results show that GH is a direct p53 transcriptional target and fulfills criteria as a p53 target gene. Induced GH is a readily measurable cell marker for p53-mediated cellular senescence. PMID:23940366

Lebein, a snake venom disintegrin, suppresses human colon cancer cells proliferation and tumor-induced angiogenesis through cell cycle arrest, apoptosis induction and inhibition of VEGF expression.

PubMed

Zakraoui, Ons; Marcinkiewicz, Cezary; Aloui, Zohra; Othman, Houcemeddine; Grépin, Renaud; Haoues, Meriam; Essafi, Makram; Srairi-Abid, Najet; Gasmi, Ammar; Karoui, Habib; Pagès, Gilles; Essafi-Benkhadir, Khadija

2017-01-01

Lebein, is an heterodimeric disintegrin isolated from Macrovipera lebetina snake venom that was previously characterized as an inhibitor of ADP-induced platelet aggregation. In this study, we investigated the effect of Lebein on the p53-dependent growth of human colon adenocarcinoma cell lines. We found that Lebein significantly inhibited LS174 (p53wt), HCT116 (p53wt), and HT29 (p53mut) colon cancer cell viability by inducing cell cycle arrest through the modulation of expression levels of the tumor suppression factor p53, cell cycle regulating proteins cyclin D1, CDK2, CDK4, retinoblastoma (Rb), CDK1, and cyclin-dependent kinase inhibitors p21 and p27. Interestingly, Lebein-induced apoptosis of colon cancer cells was dependent on their p53 status. Thus, in LS174 cells, cell death was associated with PARP cleavage and the activation of caspases 3 and 8 while in HCT116 cells, Lebein induced caspase-independent apoptosis through increased expression of apoptosis inducing factor (AIF). In LS174 cells, Lebein triggers the activation of the MAPK ERK1/2 pathway through induction of reactive oxygen species (ROS). It also decreased cell adhesion and migration to fibronectin through down regulation of α5β1 integrin. Moreover, Lebein significantly reduced the expression of two angiogenesis stimulators, Vascular Endothelial Growth Factor (VEGF) and Neuropilin 1 (NRP1). It inhibited the VEGF-induced neovascularization process in the quail embryonic CAM system and blocked the development of human colon adenocarcinoma in nude mice. Overall, our work indicates that Lebein may be useful to design a new therapy against colon cancer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

MicroRNA501-5p induces p53 proteasome degradation through the activation of the mTOR/MDM2 pathway in ADPKD cells.

PubMed

de Stephanis, Lucia; Mangolini, Alessandra; Servello, Miriam; Harris, Peter C; Dell'Atti, Lucio; Pinton, Paolo; Aguiari, Gianluca

2018-09-01

Cell proliferation and apoptosis are typical hallmarks of autosomal dominant polycystic kidney disease (ADPKD) and cause the development of kidney cysts that lead to end-stage renal disease (ESRD). Many factors, impaired by polycystin complex loss of function, may promote these biological processes, including cAMP, mTOR, and EGFR signaling pathways. In addition, microRNAs (miRs) may also regulate the ADPKD related signaling network and their dysregulation contributes to disease progression. However, the role of miRs in ADPKD pathogenesis has not been fully understood, but also the function of p53 is quite obscure, especially its regulatory contribution on cell proliferation and apoptosis. Here, we describe for the first time that miR501-5p, upregulated in ADPKD cells and tissues, induces the activation of mTOR kinase by PTEN and TSC1 gene repression. The increased activity of mTOR kinase enhances the expression of E3 ubiquitin ligase MDM2 that in turn promotes p53 ubiquitination, leading to its degradation by proteasome machinery in a network involving p70S6K. Moreover, the overexpression of miR501-5p stimulates cell proliferation in kidney cells by the inhibition of p53 function in a mechanism driven by mTOR signaling. In fact, the downregulation of this miR as well as the pharmacological treatment with proteasome and mTOR inhibitors in ADPKD cells reduces cell growth by the activation of apoptosis. Consequently, the stimulation of cell death in ADPKD cells may occur through the inhibition of mTOR/MDM2 signaling and the restoring of p53 function. The data presented here confirm that the impaired mTOR signaling plays an important role in ADPKD. © 2018 Wiley Periodicals, Inc.

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

PubMed Central

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-01-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

PubMed

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-09-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

Differential expression of microRNA501-5p affects the aggressiveness of clear cell renal carcinoma

PubMed Central

Mangolini, Alessandra; Bonon, Anna; Volinia, Stefano; Lanza, Giovanni; Gambari, Roberto; Pinton, Paolo; Russo, Gian Rosario; del Senno, Laura; Dell’Atti, Lucio; Aguiari, Gianluca

2014-01-01

Renal cell carcinoma is a common neoplasia of the adult kidney that accounts for about 3% of adult malignancies. Clear cell renal carcinoma is the most frequent subtype of kidney cancer and 20–40% of patients develop metastases. The absence of appropriate biomarkers complicates diagnosis and prognosis of this disease. In this regard, small noncoding RNAs (microRNAs), which are mutated in several neoplastic diseases including kidney carcinoma, may be optimal candidates as biomarkers for diagnosis and prognosis of this kind of cancer. Here we show that patients with clear cell kidney carcinoma that express low levels of miR501-5p exhibited a good prognosis compared with patients with unchanged or high levels of this microRNA. Consistently, in kidney carcinoma cells the downregulation of miR501-5p induced an increased caspase-3 activity, p53 expression as well as decreased mTOR activation, leading to stimulation of the apoptotic pathway. Conversely, miR501-5p upregulation enhanced the activity of mTOR and promoted both cell proliferation and survival. These biological processes occurred through p53 inactivation by proteasome degradation in a mechanism involving MDM2-mediated p53 ubiquitination. Our results support a role for miR501-5p in balancing apoptosis and cell survival in clear cell renal carcinoma. In particular, the downregulation of microRNA501-5p promotes a good prognosis, while its upregulation contributes to a poor prognosis, in particular, if associated with p53 and MDM2 overexpression and mTOR activation. Thus, the expression of miR501-5p is a possible biomarker for the prognosis of clear cell renal carcinoma. PMID:25426415

Pokemon enhances proliferation, cell cycle progression and anti-apoptosis activity of colorectal cancer independently of p14ARF-MDM2-p53 pathway.

PubMed

Zhao, Yi; Yao, Yun-hong; Li, Li; An, Wei-fang; Chen, Hong-zen; Sun, Li-ping; Kang, Hai-xian; Wang, Sen; Hu, Xin-rong

2014-12-01

Pokemon has been showed to directly suppress p14(ARF) expression and also to overexpress in multiple cancers. However, p14(ARF)-MDM2-p53 pathway is usually aberrant in colorectal cancer (CRC). The aim is to confirm whether Pokemon plays a role in CRC and explore whether Pokemon works through p14(ARF)-MDM2-p53 pathway in CRC. Immunohistochemistry for Pokemon, p14(ARF) and Mtp53 protein was applied to 45 colorectal epitheliums (CREs), 42 colorectal adenomas (CRAs) and 66 CRCs. Pokemon was knocked down with RNAi technique in CRC cell line Lovo to detect mRNA expression of p14(ARF) with qRT-PCR, cell proliferation with CCK8 assay, and cell cycle and apoptosis with flowcytometry analysis. The protein expression rates were significantly higher in CRC (75.8%) than in CRE (22.2 %) or CRA (38.1%) for Pokemon and higher in CRC (53.0%) than in CRE (0) or CRA (4.8%) for Mtp53, but not significantly different in CRC (86.4 %) versus CRE (93.3%) or CRA (90.5 %) for p14(ARF). Higher expression rate of Pokemon was associated with lymph node metastasis and higher Duke's stage. After knockdown of Pokemon in Lovo cells, the mRNA level of p14(ARF) was not significantly changed, the cell proliferation ability was decreased by 20.6%, cell cycle was arrested by 55.7% in G0/G1 phase, and apoptosis rate was increased by 19.0%. Pokemon enhanced the oncogenesis of CRC by promoting proliferation, cell cycle progression and anti-apoptosis activity of CRC cells independently of p14(ARF)-MDM2-p53 pathway. This finding provided a novel idea for understanding and further studying the molecular mechanism of Pokemon on carcinogenesis of CRC.

Efficient synthesis of RITA and its analogues: derivation of analogues with improved antiproliferative activity via modulation of p53/miR-34a pathway.

PubMed

Lin, Jinshun; Jin, Xiuli; Bu, Yiwen; Cao, Deliang; Zhang, Nannan; Li, Shangfu; Sun, Qinsheng; Tan, Chunyan; Gao, Chunmei; Jiang, Yuyang

2012-12-28

A novel approach to synthesize RITA by practical palladium-catalyzed C-C bond-forming Suzuki reactions at room temperature was developed, which was used for deriving a series of substituted tricyclic α-heteroaryl (furan/thiophene) analogues of RITA under mild conditions. These novel analogues showed notable antiproliferative activity against cancer cell lines with wild-type p53 (i.e., HCT116, A549, MCF-7 and K562), but much less activity in HCT116/p53(-/-) cells. In particular, compound 1f demonstrated promising antiproliferative activity compared to RITA, with IC(50) = 28 nM in MCF-7 vs. 54 nM for RITA, and cancer cell selectivity. Compound 1f markedly activated p53 in HCT116 cells at 100 nM, triggering apoptosis. Importantly, we found that both RITA and compound 1f induced G(0)/G(1) cell cycle arrest by up-regulating miR-34a, which in turn down-regulated the expression of cell cycle-related proteins CDK4 and E2F1. In summary, this study reports an effective synthetic approach for RITA and its analogues, and elucidates a novel antiproliferative mechanism of these compounds.

RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.

PubMed

Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh

2011-07-01

The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.

Regulation of p53 Target Gene Expression by Peptidylarginine Deiminase 4 ▿ †

PubMed Central

Li, Pingxin; Yao, Hongjie; Zhang, Zhiqiang; Li, Ming; Luo, Yuan; Thompson, Paul R.; Gilmour, David S.; Wang, Yanming

2008-01-01

Histone Arg methylation has been correlated with transcriptional activation of p53 target genes. However, whether this modification is reversed to repress the expression of p53 target genes is unclear. Here, we report that peptidylarginine deiminase 4, a histone citrullination enzyme, is involved in the repression of p53 target genes. Inhibition or depletion of PAD4 elevated the expression of a subset of p53 target genes, including p21/CIP1/WAF1, leading to cell cycle arrest and apoptosis. Moreover, the induction of p21, cell cycle arrest, and apoptosis by PAD4 depletion is p53 dependent. Protein-protein interaction studies showed an interaction between p53 and PAD4. Chromatin immunoprecipitation assays showed that PAD4 is recruited to the p21 promoter in a p53-dependent manner. RNA polymerase II (Pol II) activities and the association of PAD4 are dynamically regulated at the p21 promoter during UV irradiation. Paused RNA Pol II and high levels of PAD4 were detected before UV treatment. At early time points after UV treatment, an increase of histone Arg methylation and a decrease of citrullination were correlated with a transient activation of p21. At later times after UV irradiation, a loss of RNA Pol II and an increase of PAD4 were detected at the p21 promoter. The dynamics of RNA Pol II activities after UV treatment were further corroborated by permanganate footprinting. Together, these results suggest a role of PAD4 in the regulation of p53 target gene expression. PMID:18505818

Expression screening using a Medaka cDNA library identifies evolutionarily conserved regulators of the p53/Mdm2 pathway.

PubMed

Zhang, Ping; Kratz, Anne Sophie; Salama, Mohammed; Elabd, Seham; Heinrich, Thorsten; Wittbrodt, Joachim; Blattner, Christine; Davidson, Gary

2015-10-08

The p53 tumor suppressor protein is mainly regulated by alterations in the half-life of the protein, resulting in significant differences in p53 protein levels in cells. The major regulator of this process is Mdm2, which ubiquitinates p53 and targets it for proteasomal degradation. This process can be enhanced or reduced by proteins that associate with p53 or Mdm2 and several proteins have been identified with such an activity. Furthermore, additional ubiquitin ligases for p53 have been identified in recent years. Nevertheless, our understanding of how p53 abundance and Mdm2 activity are regulated remains incomplete. Here we describe a cell culture based overexpression screen to identify evolutionarily conserved regulators of the p53/Mdm2 circuit. The results from this large-scale screening method will contribute to a better understanding of the regulation of these important proteins. Expression screening was based on co-transfection of H1299 cells with pools of cDNA's from a Medaka library together with p53, Mdm2 and, as internal control, Ror2. After cell lysis, SDS-PAGE/WB analysis was used to detect alterations in these proteins. More than one hundred hits that altered the abundance of either p53, Mdm2, or both were identified in the primary screen. Subscreening of the library pools that were identified in the primary screen identified several potential novel regulators of p53 and/or Mdm2. We also tested whether the human orthologues of the Medaka genes regulate p53 and/or Mdm2 abundance. All human orthologues regulated p53 and/or Mdm2 abundance in the same manner as the proteins from Medaka, which underscores the suitability of this screening methodology for the identification of new modifiers of p53 and Mdm2. Despite enormous efforts in the last two decades, many unknown regulators for p53 and Mdm2 abundance are predicted to exist. This cross-species approach to identify evolutionarily conserved regulators demonstrates that our Medaka unigene cDNA library represents a powerful tool to screen for these novel regulators of the p53/Mdm2 pathway.

Nicotine induces cell proliferation in association with cyclin D1 up-regulation and inhibits cell differentiation in association with p53 regulation in a murine pre-osteoblastic cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sato, Tsuyoshi; Abe, Takahiro; Nakamoto, Norimichi

Recent studies have suggested that nicotine critically affects bone metabolism. Many studies have examined the effects of nicotine on proliferation and differentiation, but the underlying molecular mechanisms remain unclear. We examined cell cycle regulators involved in the proliferation and differentiation of MC3T3-E1 cells. Nicotine induced cell proliferation in association with p53 down-regulation and cyclin D1 up-regulation. In differentiated cells, nicotine reduced alkaline phosphatase activity and mineralized nodule formation in dose-dependent manners. Furthermore, p53 expression was sustained in nicotine-treated cells during differentiation. These findings indicate that nicotine promotes the cell cycle and inhibits differentiation in association with p53 regulation in pre-osteoblasticmore » cells.« less

Suppression of Familial Adenomatous Polyposis by CP-31398, a TP53 modulator, in APCmin/+ Mice1

PubMed Central

Rao, Chinthalapally V.; Swamy, Malisetty V.; Patlolla, Jagan M.R.; Kopelovich, Levy

2008-01-01

p53 mutations occur in a large number of human malignancies. Mutant p53 is unable to affect downstream genes necessary for DNA repair, cell cycle regulation, and apoptosis. The styrylquinazoline CP-31398 can rescue destabilized mutant p53 expression and promote activity of wild-type p53. The present study examines chemopreventive effects of CP-31398 on intestinal adenoma development in an animal model of familial adenomatous polyposis (FAP). Effects were examined at both early and late stages of adenoma formation. Effects of CP-31398 on early-stage adenomas were determined by feeding 7-week-old female C57B/6J-APCmin (heterozygous) and wild-type C57BL/6J mice with American Institute of Nutrition (AIN)-76A diets containing 0, 100, or 200 ppm CP-31398 for 75 days. To examine activity toward late-stage adenomas, CP31398 administration was delayed until 15 weeks of age and continued for 50 days. During early-stage intervention, dietary CP-31398 suppressed development of intestinal tumors by 36% (p < 0.001) and 75% (p < 0.0001), at low and high dose, respectively. During late-stage intervention, CP-31398 also significantly suppressed intestinal polyp formation, albeit to a lesser extent than observed with early intervention. Adenomas in treated mice showed increased apoptotic cell death and decreased proliferation in conjunction with increased expression of p53, p21WAF1/CIP, cleaved caspase-3, and cleaved poly (ADP-ribose) polymerase (PARP). These observations demonstrate for the first time that the p53-modulating agent CP-31398 possesses significant chemopreventive activity in vivo against intestinal neoplastic lesions in genetically-predisposed APCmin/+ mice. Chemopreventive activity of other agents that restore tumor suppressor functions of mutant p53 in tumor cells is currently under investigation. PMID:18794156

Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy.

PubMed

Simon, Christian M; Dai, Ya; Van Alstyne, Meaghan; Koutsioumpa, Charalampia; Pagiazitis, John G; Chalif, Joshua I; Wang, Xiaojian; Rabinowitz, Joseph E; Henderson, Christopher E; Pellizzoni, Livio; Mentis, George Z

2017-12-26

The hallmark of spinal muscular atrophy (SMA), an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Mitoguazone induces apoptosis via a p53-independent mechanism.

PubMed

Davidson, K; Petit, T; Izbicka, E; Koester, S; Von Hoff, D D

1998-08-01

Mitoguazone (methylglyoxal bisguanylhydrazone, methyl-GAG or MGBG) is a synthetic polycarbonyl derivative with activity in patients with Hodgkin's and non-Hodgkin's lymphoma, head and neck cancer, prostate cancer, and esophageal cancer. Mitoguazone has also recently been documented to have activity in patients with AIDS-related lymphoma. Among anticancer drugs, mitoguazone has a unique mechanism of action via interference with the polyamine biosynthetic pathway. Polyamines stabilize DNA structure by non-covalent cross-bridging between phosphate groups on opposite strands. In addition, mitoguazone causes uncoupling of oxidative phosphorylation. In this study, the ability of mitoguazone to induce apoptosis by inhibiting the polyamine pathway was assessed in three Burkitt's lymphoma cell lines (Raji, Ramos and Daudi) and one prostate carcinoma cell line (MPC 3). Additional evaluations were performed in two human breast cancer cell lines (MCF7 with wild-type p53 and VM4K with mutated p53) to determine whether the p53 tumor suppressor gene was required for efficient apoptosis induction. The present study demonstrated that mitoguazone induces apoptosis in all the different human cancer cell lines tested in a concentration- and time-dependent way, and triggers a p53-independent programmed cell death in the human breast cancer MCF7 cell line.

p21 induction plays a dual role in anti-cancer activity of ursolic acid

PubMed Central

Zhang, Xudong; Song, Xinhua; Yin, Shutao; Zhao, Chong; Fan, Lihong

2015-01-01

Previous studies have shown that induction of G1 arrest and apoptosis by ursolic acid is associated with up-regulation of cyclin-dependent kinase inhibitor (CDKI) protein p21 in multiple types of cancer cells. However, the functional role of p21 induction in G1 cell cycle arrest and apoptosis, and the mechanisms of p21 induction by ursolic acid have not been critically addressed. In the current study, we demonstrated that p21 played a mediator role in G1 cell cycle arrest by ursolic acid, whereas p21-mediated up-regulation of Mcl-1 compromised apoptotic effect of ursolic acid. These results suggest that p21 induction plays a dual role in the anti-cancer activity of ursolic acid in terms of cell cycle and apoptosis regulation. p21 induction by ursolic acid was attributed to p53 transcriptional activation. Moreover, we found that ursolic acid was able to inhibit murine double minute-2 protein (MDM2) and T-LAK cell-originated protein kinase (TOPK), the two negative regulator of p53, which in turn contributed to ursolic acid-induced p53 activation. Our findings provided novel insights into understanding of the mechanisms involved in cell cycle arrest and apoptosis induction in response to ursolic acid exposure. PMID:26582056

Protection and sensitization of normal and malignant cells by a naturally occurring compound in a model of photochemical damage

NASA Astrophysics Data System (ADS)

Lee, Yuan-Hao; Kumar, Neeru; Glickman, Randolph D.

2012-03-01

Certain phytonutrients are known to confer protection and immunosuppression against radiation insults. Radiation-induced reactive oxygen species (ROS) can either lead to the destruction of normal tissue cells, or induce tumor radioresistance by activating ROS scavenging proteins. To identify whether the triterpene phytonutrient, ursolic acid, reduces radiation-induced damage in normal cells and promotes the apoptosis of malignant cells, we investigated the biologic mechanisms and effect of radiation-cell interaction with or without treatment with ursolic acid in human skin melanoma cells (ATCC CRL-11147TM) and transformed human retinal pigment epithelial (hTERT-RPE) cells. UV-VIS light was employed to investigate the efficacy of ursolic acid in altering cellular viability by modulations of p53 and NF-κB p65 signaling. Cell response was investigated by changes in proliferative activity and free radical generation assessed by 2',7'-dichlorofluorescin liquid chromatography. Ursolic acid pretreatment strongly increased the level of p53 and decreased the level of phosphorylated p65 leading to enhanced cell death of skin melanoma cells in response to UV-VIS exposure. In contrast, ursolic acid appeared to downregulate p53 levels without disturbing NF-κB activation along with an increase of oxidative stress in hTERT-RPE cells. These findings indicate that ursolic acid may beneficially increase the radiosensitivity of tumor cells while potentiating a photoprotective effect on benign cells through differential effects on the NF-κB and p53 signaling pathways.

Alpha-santalol, a chemopreventive agent against skin cancer, causes G2/M cell cycle arrest in both p53-mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells

PubMed Central

2010-01-01

Background α-Santalol, an active component of sandalwood oil, has shown chemopreventive effects on skin cancer in different murine models. However, effects of α-santalol on cell cycle have not been studied. Thus, the objective of this study was to investigate effects of α-santalol on cell cycle progression in both p53 mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells to elucidate the mechanism(s) of action. Methods MTT assay was used to determine cell viability in A431 cells and UACC-62; fluorescence-activated cell sorting (FACS) analysis of propidium iodide staining was used for determining cell cycle distribution in A431 cells and UACC-62 cells; immunoblotting was used for determining the expression of various proteins and protein complexes involved in the cell cycle progression; siRNA were used to knockdown of p21 or p53 in A431 and UACC-62 cells and immunofluorescence microscopy was used to investigate microtubules in UACC-62 cells. Results α-Santalol at 50-100 μM decreased cell viability from 24 h treatment and α-santalol at 50 μM-75 μM induced G2/M phase cell cycle arrest from 6 h treatment in both A431 and UACC-62 cells. α-Santalol altered expressions of cell cycle proteins such as cyclin A, cyclin B1, Cdc2, Cdc25c, p-Cdc25c and Cdk2. All of these proteins are critical for G2/M transition. α-Santalol treatment up-regulated the expression of p21 and suppressed expressions of mutated p53 in A431 cells; whereas, α-santalol treatment increased expressions of wild-type p53 in UACC-62 cells. Knockdown of p21 in A431 cells, knockdown of p21 and p53 in UACC-62 cells did not affect cell cycle arrest caused by α-santalol. Furthermore, α-santalol caused depolymerization of microtubules similar to vinblastine in UACC-62 cells. Conclusions This study for the first time identifies effects of α-santalol in G2/M phase arrest and describes detailed mechanisms of G2/M phase arrest by this agent, which might be contributing to its overall cancer preventive efficacy in various mouse skin cancer models. PMID:20682067

Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis

PubMed Central

2012-01-01

Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545

Interaction between the Cockayne syndrome B and p53 proteins: implications for aging.

PubMed

Frontini, Mattia; Proietti-De-Santis, Luca

2012-02-01

The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53’s levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis.

Epithelial PIK3R1 (p85) and TP53 Regulate Survivin Expression during Adaptation to Ileocecal Resection.

PubMed

Cohran, Valeria; Managlia, Elizabeth; Bradford, Emily M; Goretsky, Tatiana; Li, Ting; Katzman, Rebecca B; Cheresh, Paul; Brown, Jeffrey B; Hawkins, Jennifer; Liu, Shirley X L; De Plaen, Isabelle G; Weitkamp, Jörn-Hendrik; Helmrath, Michael; Zhang, Zheng; Barrett, Terrence A

2016-07-01

Intestinal adaptation to small-bowel resection (SBR) after necrotizing enterocolitis expands absorptive surface areas and promotes enteral autonomy. Survivin increases proliferation and blunts apoptosis. The current study examines survivin in intestinal epithelial cells after ileocecal resection. Wild-type and epithelial Pik3r1 (p85α)-deficient mice underwent sham surgery or 30% resection. RNA and protein were isolated from small bowel to determine levels of β-catenin target gene expression, activated caspase-3, survivin, p85α, and Trp53. Healthy and post-resection human infant small-bowel sections were analyzed for survivin, Ki-67, and TP53 by immunohistochemistry. Five days after ileocecal resection, epithelial levels of survivin increased relative to sham-operated on mice, which correlated with reduced cleaved caspase-3, p85α, and Trp53. At baseline, p85α-deficient intestinal epithelial cells had less Trp53 and more survivin, and relative responses to resection were blunted compared with wild-type. In infant small bowel, survivin in transit amplifying cells increased 71% after SBR. Resection increased proliferation and decreased numbers of TP53-positive epithelial cells. Data suggest that ileocecal resection reduces p85α, which lowers TP53 activation and releases survivin promoter repression. The subsequent increase in survivin among transit amplifying cells promotes epithelial cell proliferation and lengthens crypts. These findings suggest that SBR reduces p85α and TP53, which increases survivin and intestinal epithelial cell expansion during therapeutic adaptation in patients with short bowel syndrome. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner

DOE Office of Scientific and Technical Information (OSTI.GOV)

Panta, Sushil; Yamakuchi, Munekazu; Kagoshima University Hospital, Kagoshima

In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclearmore » localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β{sub 3}-integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β{sub 3}-integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β{sub 3}-integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β{sub 3}-integrin pathway in endothelial cells.« less

Ginsenoside metabolite compound K enhances the efficacy of cisplatin in lung cancer cells.

PubMed

Li, Yang; Zhou, Tong; Ma, Chengyuan; Song, Weiwei; Zhang, Jian; Yu, Zhenxiang

2015-03-01

To evaluate the potential of ginsenoside metabolite compound K (CK) in enhancing the anti-tumor effects of cisplatin against lung cancer cells, including cell proliferation and apoptosis, and the underlying mechanism. Western blotting and p53 reporter assay were used to assess p53 expression and activity. MTT assay and TUNEL staining were employed to investigate the drug effects on cell growth and apoptosis, respectively. Combination index (CI) was calculated to determine synergism. We found that CK could significantly enhance cisplatin-induced p53 expression and activity in two lung cancer cell lines, H460 and A549. Consequently, synergistic inhibition of cell growth was observed when the cells were co-treated with CK and cisplatin compared to single treatment. In addition, the ability of cisplatin in apoptosis induction was similarly synergized by CK. Furthermore, by using p53-null lung cancer cells, we demonstrate that the synergy was p53 dependent. Conventional chemotherapies are often accompanied by development of drug resistance and severe side effects. Novel discoveries of low toxicity compounds to improve the outcome or enhance the efficacy of chemotherapies are of great interest. In the present study, our data provide the first evidence that CK could be potentially used as an agent to synergize the efficacy of cisplatin in lung cancer.

C/EBPbeta represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19(Arf).

PubMed

Ewing, S J; Zhu, S; Zhu, F; House, J S; Smart, R C

2008-11-01

CCAAT/enhancer-binding protein-beta (C/EBPbeta) is a mediator of cell survival and tumorigenesis. When C/EBPbeta(-/-) mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19(Arf) and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19(Arf) is dramatically elevated in C/EBPbeta(-/-) epidermis and that C/EBPbeta represses a p19(Arf) promoter reporter. To determine whether p19(Arf) is responsible for the proapoptotic phenotype in C/EBPbeta(-/-) mice, C/EBPbeta(-/-);p19(Arf-/-) mice were generated. C/EBPbeta(-/-);p19(Arf-/-) mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19(Arf) is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPbeta(-/-) epidermis, we generated K14-ER:Ras;C/EBPbeta(-/-) mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPbeta(-/-) mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPbeta represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPbeta may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents.

C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

PubMed Central

Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC

2013-01-01

CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

Radiation-induced hyperproliferation of intestinal crypts results in elevated genome instability with inactive p53-related genomic surveillance.

PubMed

Zhou, Xin; Ma, Xiaofei; Wang, Zhenhua; Sun, Chao; Wang, Yupei; He, Yang; Zhang, Hong

2015-12-15

Radiation-induced hyperproliferation of intestinal crypts is well documented, but its potential tumorigenic effects remain elusive. Here we aim to determine the genomic surveillance process during crypt hyperproliferation, and its consequential outcome after ionizing radiation. Crypt regeneration in the intestine was induced by a single dose of 12Gy abdominal irradiation. γ-H2AX, 53BP1 and DNA-PKcs were used as DNA repair surrogates to investigate the inherent ability of intestinal crypt cells to recognize and repair double-strand breaks. Ki67 staining and the 5-bromo-2'-deoxyuridine incorporation assay were used to study patterns of cell proliferation in regenerating crypts. Staining for ATM, p53, Chk1 and Chk2 was performed to study checkpoint activation and release. Apoptosis was evaluated through H&E staining and terminal deoxynucleotidyl transferase (dUTP) nick-end labeling. The ATM-p53 pathway was immediately activated after irradiation. A second wave of DSBs in crypt cells was observed in regenerating crypts, accompanied with significantly increased chromosomal bridges. The p53-related genomic surveillance pathway was not active during the regeneration phase despite DSBs and chromosomal bridges in the cells of regenerating crypts. Non-homologous end joining (NHEJ) DSBs repair was involved in the DSBs repair process, as indicated by p-DNA-PKcs staining. Intestinal crypt cells retained hyperproliferation with inactive p53-related genomic surveillance system. NHEJ was involved in the resultant genomic instability during hyperproliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

SOX14 activates the p53 signaling pathway and induces apoptosis in a cervical carcinoma cell line

PubMed Central

Stanisavljevic, Danijela; Petrovic, Isidora; Vukovic, Vladanka; Schwirtlich, Marija; Gredic, Marija; Stevanovic, Milena

2017-01-01

SOX14 is a member of the SOX family of transcription factors mainly involved in the regulation of neural development. Recently, it became evident that SOX14 is one of four hypermethylated genes in cervical carcinoma, considered as a tumor suppressor candidate in this type of malignancy. In this paper we elucidated the role of SOX14 in the regulation of malignant properties of cervical carcinoma cells in vitro. Functional analysis performed in HeLa cells revealed that SOX14 overexpression decreased viability and promoted apoptosis through altering the expression of apoptosis related genes. Our results demonstrated that overexpression of SOX14 initiated accumulation of p53, demonstrating potential cross-talk between SOX14 and the p53 signaling pathway. Further analysis unambiguously showed that SOX14 triggered posttranslational modification of p53 protein, as detected by the significantly increased level of phospho-p53 (Ser-15) in SOX14-overexpressing HeLa cells. Moreover, the obtained results revealed that SOX14 activated p53 protein, which was confirmed by elevated p21Waf1/Cip1, a well known target gene of p53. This study advances our understanding about the role of SOX14 and might explain the molecular mechanism by which this transcription factor could exert tumor suppressor properties in cervical carcinoma. PMID:28926586

Enzastaurin inhibits ABCB1-mediated drug efflux independently of effects on protein kinase C signalling and the cellular p53 status.

PubMed

Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich

2015-07-10

The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

PubMed

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

PubMed

Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

2018-05-23

PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

Mechanical cell competition kills cells via induction of lethal p53 levels

PubMed Central

Wagstaff, Laura; Goschorska, Maja; Kozyrska, Kasia; Duclos, Guillaume; Kucinski, Iwo; Chessel, Anatole; Hampton-O'Neil, Lea; Bradshaw, Charles R.; Allen, George E.; Rawlins, Emma L.; Silberzan, Pascal; Carazo Salas, Rafael E.; Piddini, Eugenia

2016-01-01

Cell competition is a quality control mechanism that eliminates unfit cells. How cells compete is poorly understood, but it is generally accepted that molecular exchange between cells signals elimination of unfit cells. Here we report an orthogonal mechanism of cell competition, whereby cells compete through mechanical insults. We show that MDCK cells silenced for the polarity gene scribble (scribKD) are hypersensitive to compaction, that interaction with wild-type cells causes their compaction and that crowding is sufficient for scribKD cell elimination. Importantly, we show that elevation of the tumour suppressor p53 is necessary and sufficient for crowding hypersensitivity. Compaction, via activation of Rho-associated kinase (ROCK) and the stress kinase p38, leads to further p53 elevation, causing cell death. Thus, in addition to molecules, cells use mechanical means to compete. Given the involvement of p53, compaction hypersensitivity may be widespread among damaged cells and offers an additional route to eliminate unfit cells. PMID:27109213

MEK5/ERK5 signaling inhibition increases colon cancer cell sensitivity to 5-fluorouracil through a p53-dependent mechanism

PubMed Central

Pereira, Diane M.; Simões, André E. S.; Gomes, Sofia E.; Castro, Rui E.; Carvalho, Tânia; Rodrigues, Cecília M. P.; Borralho, Pedro M.

2016-01-01

The MEK5/ERK5 signaling pathway is emerging as an important contributor to colon cancer onset, progression and metastasis; however, its relevance to chemotherapy resistance remains unknown. Here, we evaluated the impact of the MEK5/ERK5 cascade in colon cancer cell sensitivity to 5-fluorouracil (5-FU). Increased ERK5 expression was correlated with poor overall survival in colon cancer patients. In colon cancer cells, 5-FU exposure impaired endogenous KRAS/MEK5/ERK5 expression and/or activation. In turn, MEK5 constitutive activation reduced 5-FU-induced cytotoxicity. Using genetic and pharmacological approaches, we showed that ERK5 inhibition increased caspase-3/7 activity and apoptosis following 5-FU exposure. Mechanistically, this was further associated with increased p53 transcriptional activation of p21 and PUMA. In addition, ERK5 inhibition increased the response of HCT116 p53+/+ cells to 5-FU, but failed to sensitize HCT116 p53−/− cells to the cytotoxic effects of this chemotherapeutic agent, suggesting a p53-dependent axis mediating 5-FU sensitization. Finally, ERK5 inhibition using XMD8-92 was shown to increase the antitumor effects of 5-FU in a murine subcutaneous xenograft model, enhancing apoptosis while markedly reducing tumor growth. Collectively, our results suggest that ERK5-targeted in hibition provides a promising therapeutic approach to overcome resistance to 5-FU-based chemotherapy and improve colon cancer treatment. PMID:27144434

Activation of miR-34a/SIRT1/p53 signaling contributes to cochlear hair cell apoptosis: implications for age-related hearing loss.

PubMed

Xiong, Hao; Pang, Jiaqi; Yang, Haidi; Dai, Min; Liu, Yimin; Ou, Yongkang; Huang, Qiuhong; Chen, Suijun; Zhang, Zhigang; Xu, Yaodong; Lai, Lan; Zheng, Yiqing

2015-04-01

The molecular mechanisms underlying age-related hearing loss are not fully understood, and currently, there is no treatment for this disorder. MicroRNAs have recently been reported to be increasingly associated with age-related diseases and are emerging as promising therapeutic targets. In this study, miR-34a/Sirtuin 1 (SIRT1)/p53 signaling was examined in cochlear hair cells during aging. MiR-34a, p53 acetylation, and apoptosis increased in the cochlea of C57BL/6 mice with aging, whereas an age-related decrease in SIRT1 was observed. In the inner ear HEI-OC1 cell line, miR-34a overexpression inhibited SIRT1, leading to an increase in p53 acetylation and apoptosis. Moreover, miR-34a knockdown increased SIRT1 expression and diminished p53 acetylation, and apoptosis. Additionally, resveratrol, an activator of SIRT1, significantly rescued miR-34a overexpression-induced HEI-OC1 cell death and significantly reduced hearing threshold shifts and hair cell loss in C57BL/6 mice after a 2-month administration. Our results support a link between age-related cochlear hair cell apoptosis and miR-34a/SIRT1/p53 signaling, which may serve as a potential target for age-related hearing loss treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

PubMed Central

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-01-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

PubMed

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-08-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

Depletion of hepatoma-derived growth factor-related protein-3 induces apoptotic sensitization of radioresistant A549 cells via reactive oxygen species-dependent p53 activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Hong Shik; Hong, Eun-Hee; Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791

2013-09-27

Highlights: •HRP-3 is a radiation- and anticancer drug-responsive protein in A549 cells. •Depletion of HRP-3 induces apoptosis of radio- and chemoresistant A549 cells. •Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. •Depletion of HRP-3 enhances ROS-dependent p53 activation and PUMA expression. -- Abstract: Biomarkers based on functional signaling have the potential to provide greater insight into the pathogenesis of cancer and may offer additional targets for anticancer therapeutics. Here, we identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistance-related gene and characterized the molecular mechanism by which its encoded protein regulates the radio- and chemoresistant phenotypemore » of lung cancer-derived A549 cells. Knockdown of HRP-3 promoted apoptosis of A549 cells and potentiated the apoptosis-inducing action of radio- and chemotherapy. This increase in apoptosis was associated with a substantial generation of reactive oxygen species (ROS) that was attributable to inhibition of the Nrf2/HO-1 antioxidant pathway and resulted in enhanced ROS-dependent p53 activation and p53-dependent expression of PUMA (p53 upregulated modulator of apoptosis). Therefore, the HRP-3/Nrf2/HO-1/ROS/p53/PUMA cascade is an essential feature of the A549 cell phenotype and a potential radiotherapy target, extending the range of targets in multimodal therapies against lung cancer.« less

Peroxisome proliferator-activated receptor-β/δ inhibits human neuroblastoma cell tumorigenesis by inducing p53- and SOX2-mediated cell differentiation.

PubMed

Yao, Pei-Li; Chen, Liping; Dobrzański, Tomasz P; Zhu, Bokai; Kang, Boo-Hyon; Müller, Rolf; Gonzalez, Frank J; Peters, Jeffrey M

2017-05-01

Neuroblastoma is a common childhood cancer typically treated by inducing differentiation with retinoic acid (RA). Peroxisome proliferator-activated receptor-β/δ, (PPARβ/δ) is known to promote terminal differentiation of many cell types. In the present study, PPARβ/δ was over-expressed in three human neuroblastoma cell lines, NGP, SK-N-BE(2), and IMR-32, that exhibit high, medium, and low sensitivity, respectively, to retinoic acid-induced differentiation to determine if PPARβ/δ and retinoic acid receptors (RARs) could be jointly targeted to increase the efficacy of treatment. All-trans-RA (atRA) decreased expression of SRY (sex determining region Y)-box 2 (SOX2), a stem cell regulator and marker of de-differentiation, in NGP and SK-N-BE(2) cells with inactive or mutant tumor suppressor p53, respectively. However, atRA did not suppress SOX2 expression in IMR-32 cells carrying wild-type p53. Over-expression and/or ligand activation of PPARβ/δ reduced the average volume and weight of ectopic tumor xenografts from NGP, SK-N-BE(2), or IMR-32 cells compared to controls. Compared with that found with atRA, PPARβ/δ suppressed SOX2 expression in NGP and SK-N-BE(2) cells and ectopic xenografts, and was also effective in suppressing SOX2 expression in IMR-32 cells that exhibit higher p53 expression compared to the former cell lines. Combined, these observations demonstrate that activating or over-expressing PPARβ/δ induces cell differentiation through p53- and SOX2-dependent signaling pathways in neuroblastoma cells and tumors. This suggests that combinatorial activation of both RARα and PPARβ/δ may be suitable as an alternative therapeutic approach for RA-resistant neuroblastoma patients. Published [2016]. This article is a U.S. Government work and is in the public domain in the USA.

A lentiviral vector that activates latent human immunodeficiency virus-1 proviruses by the overexpression of tat and that kills the infected cells.

PubMed

Macías, David; Oya, Ricardo; Saniger, Luisa; Martín, Francisco; Luque, Francisco

2009-11-01

Despite the efficient HIV-1 replication blockage achieved with current highly active antiretroviral therapy (HAART) therapies, HIV-1 persists in the body and survives in a latent state that can last for the entire life of the patient. A long-lived reservoir of latently infected CD4(+) memory T cells represents the most important sanctuary for the virus and the greatest obstacle for viral eradication. In this work, we present an initial step toward a gene therapy approach aimed at the activation of latent provirus to induce the death of latently infected T cells. Latent HIV-1 infection is characterized by the failure of viral gene expression as a consequence of uninitiated or aborted transcription. We have constructed an HIV-1-based lentiviral vector (p5p53RTAT3) that expresses the viral trans-activating protein Tat in a drug-regulated manner and p53 in a Rev-dependent manner. We have demonstrated that the Tat-expressed protein from p5p53RTAT3 vector reactivates latent HIV-1 proviruses in J1.1 and ACH-2 cell lines and promotes p53-induced apoptosis in the presence of Rev. Our system was able to trigger the trans-activation of the provirus 5' long terminal repeat (LTR), stimulate the expression of the Rev protein from a tat-defective provirus, and provoke apoptosis selectively in the cells transfected with a tat-defective HIV-1 provirus in contrast to those with no HIV-1 provirus. However, the Rev-dependent p53 killing of latently infected cells was not effective enough for complete elimination of the awakened HIV-1 viruses. In summary, we have developed a vector system that is efficient in activating latent HIV-1 proviruses but that needs further improvement to kill infected cells.

Selective FLT3 inhibitor FI-700 neutralizes Mcl-1 and enhances p53-mediated apoptosis in AML cells with activating mutations of FLT3 through Mcl-1/Noxa axis.

PubMed

Kojima, K; Konopleva, M; Tsao, T; Andreeff, M; Ishida, H; Shiotsu, Y; Jin, L; Tabe, Y; Nakakuma, H

2010-01-01

Treatment using Fms-like tyrosine kinase-3 (FLT3) inhibitors is a promising approach to overcome the dismal prognosis of acute myeloid leukemia (AML) with activating FLT3 mutations. Current trials are combining FLT3 inhibitors with p53-activating conventional chemotherapy. The mechanisms of cytotoxicity of FLT3 inhibitors are poorly understood. We investigated the interaction of FLT3 and p53 pathways after their simultaneous blockade using the selective FLT3 inhibitor FI-700 and the MDM2 inhibitor Nutlin-3 in AML. We found that FI-700 immediately reduced antiapoptotic Mcl-1 levels and enhanced Nutlin-induced p53-mediated mitochondrial apoptosis in FLT3/internal tandem duplication cells through the Mcl-1/Noxa axis. FI-700 induced proteasome-mediated degradation of Mcl-1, resulting in the reduced ability of Mcl-1 to sequester proapoptotic Bim. Nutlin-3 induced Noxa, which displaced Bim from Mcl-1. The FI-700/Nutlin-3 combination profoundly activated Bax and induced apoptosis. Our findings suggest that FI-700 actively enhances p53 signaling toward mitochondrial apoptosis and that a combination strategy aimed at inhibiting FLT3 and activating p53 signaling could potentially be effective in AML.

Drug Resistance to Inhibitors of the Human Double Minute-2 E3 Ligase is Mediated by Point Mutations of p53, but can be Overcome with the p53 Targeting Agent RITA

PubMed Central

Jones, Richard J.; Bjorklund, Chad C.; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J.; Orlowski, Robert Z.

2012-01-01

The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover, and has been validated pre-clinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, while Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA. HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor non-genotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G2/M arrest, up-regulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared to RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706

Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

PubMed Central

Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

2005-01-01

p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

p53 regulates cytoskeleton remodeling to suppress tumor progression.

PubMed

Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

2015-11-01

Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

PubMed

Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

2018-03-09

The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

β-Sitosterol targets Trx/Trx1 reductase to induce apoptosis in A549 cells via ROS mediated mitochondrial dysregulation and p53 activation.

PubMed

Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi

2018-02-01

β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.

β2-AR activation induces chemoresistance by modulating p53 acetylation through upregulating Sirt1 in cervical cancer cells.

PubMed

Chen, Hongyu; Zhang, Wei; Cheng, Xiang; Guo, Liang; Xie, Shuai; Ma, Yuanfang; Guo, Ning; Shi, Ming

2017-07-01

It has been suggested that β2-adrenergic receptor (β2-AR)-mediated signaling induced by catecholamines regulates the degradation of p53. However, the underlying molecular mechanisms were not known. In the present study, we demonstrated that catecholamines upregulated the expression of silent information regulator 1 (Sirt1) through activating β2-AR-mediated signaling pathway, since selective β2-AR antagonist ICI 118, 551 and non-selective β-blocker proprenolol effectively repressed isoproterenol (ISO)-induced Sirt1 expression. Catecholamines inhibited doxorubicin (DOX)-induced p53 acetylation and transcription-activation activities by inducing the expression of Sirt1. Knockdown of the Sirt1 expression by the specific siRNA remarkably blocked the inhibitory effects of ISO on DOX-induced p53 acetylation. In addition, we demonstrated that catecholamines induced resistance of cervical cancer cells to chemotherapeutics both in vitro and in vivo and that β2-AR was overexpressed in cervical cancer tissues. Our data suggest that the p53-dependent, chemotherapeutics-induced cytotoxicity in cervical cancer cells may be compromised by catecholamines-induced upregulation of the Sirt1 expression through activating the β2-AR signaling. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ginkel, Paul R. van; Yan, Michael B.; Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792

Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cellsmore » to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.« less

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

PubMed Central

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

PubMed

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Jing-Ping; Lin, Kai-Han; Liu, Chun-Yen

In this work, we demonstrated that the growth of human non-small-cell-lung-cancer cells H460 and A549 cells can be inhibited by low concentrations of an epoxide derivative, teroxirone, in both in vitro and in vivo models. The cytotoxicity was mediated by apoptotic cell death through DNA damage. The onset of ultimate apoptosis is dependent on the status of p53. Teroxirone caused transient elevation of p53 that activates downstream p21 and procaspase-3 cleavage. The presence of caspase-3 inhibitor reverted apoptotic phenotype. Furthermore, we showed the cytotoxicity of teroxirone in H1299 cells with stable ectopic expression of p53, but not those of mutantmore » p53. A siRNA-mediated knockdown of p53 expression attenuated drug sensitivity. The in vivo experiments demonstrated that teroxirone suppressed growth of xenograft tumors in nude mice. Being a potential therapeutic agent by restraining cell growth through apoptotic death at low concentrations, teroxirone provides a feasible perspective in reversing tumorigenic phenotype of human lung cancer cells. - Highlights: • Teroxirone repressed tumor cell growth in nude mice of human lung cancer cells. • The apoptotic cell death reverted by caspase-3 inhibitor is related to p53 status. • Teroxirone provides a good candidate for lung cancer treatment.« less

The Stress-responsive Gene ATF3 Mediates Dichotomous UV Responses by Regulating the Tip60 and p53 Proteins*

PubMed Central

Cui, Hongmei; Li, Xingyao; Han, Chunhua; Wang, Qi-En; Wang, Hongbo; Ding, Han-Fei; Zhang, Junran; Yan, Chunhong

2016-01-01

The response to UV irradiation is important for a cell to maintain its genetic integrity when challenged by environmental genotoxins. An immediate early response to UV irradiation is the rapid induction of activating transcription factor 3 (ATF3) expression. Although emerging evidence has linked ATF3 to stress pathways regulated by the tumor suppressor p53 and the histone acetyltransferase Tip60, the role of ATF3 in the UV response remains largely unclear. Here, we report that ATF3 mediated dichotomous UV responses. Although UV irradiation enhanced the binding of ATF3 to Tip60, knockdown of ATF3 expression decreased Tip60 stability, thereby impairing Tip60 induction by UV irradiation. In line with the role of Tip60 in mediating UV-induced apoptosis, ATF3 promoted the death of p53-defective cells in response to UV irradiation. However, ATF3 could also activate p53 and promote p53-mediated DNA repair, mainly through altering histone modifications that could facilitate recruitment of DNA repair proteins (such as DDB2) to damaged DNA sites. As a result, ATF3 rather protected the p53 wild-type cells from UV-induced apoptosis. Our results thus indicate that ATF3 regulates cell fates upon UV irradiation in a p53-dependent manner. PMID:26994140

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

PubMed

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its effective induction of apoptosis and tumor growth inhibition.

Down-regulation of MutS homolog 3 by hypoxia in human colorectal cancer

PubMed Central

Li, Jie; Koike, Junichi; Kugoh, Hiroyuki; Arita, Michitsune; Ohhira, Takahito; Kikuchi, Yoshinori; Funahashi, Kimihiko; Takamatsu, Ken; Boland, C. Richard; Koi, Minoru; Hemmi, Hiromichi

2013-01-01

Down-regulation of hMSH3 is associated with elevated microsatellite alterations at selected tetranucleotide repeats and low levels of microsatellite instability in colorectal cancer (CRC). However, the mechanism that down-regulates hMSH3 in CRC is not known. In this study, a significant association between over-expression of glucose transporter 1, a marker for hypoxia, and down-regulation of hMSH3 in CRC tissues was observed. Therefore, we examined the effect of hypoxia on the expression of hMSH3 in human cell lines. When cells with wild type p53 (wt-p53) were exposed to hypoxia, rapid down-regulation of both hMSH2 and hMSH3 occurred. In contrast, when null or mutated p53 (null/mut-p53) cells were exposed to hypoxia, only hMSH3 was down-regulated, and at slower rate than wt-p53 cells. Using a reporter assay, we found that disruption of the two putative hypoxia response elements (HREs) located within the promoter region of the hMSH3 abrogated the suppressive effect of hypoxia on reporter activity regardless of p53 status. In an EMSA, two different forms of HIF-1α complexes that specifically bind to these HREs were detected. A larger complex containing HIF-1α predominantly bound to the HREs in hypoxic null/mut-p53 cells whereas a smaller complex predominated in wt-p53 cells. Finally, HIF-1α knockdown by siRNA significantly inhibited down-regulation of hMSH3 by hypoxia in both wt-p53 and mut-p53 cells. Taken together, our results suggest that the binding of HIF-1α complexes to HRE sites is necessary for down-regulation of hMSH3 in both wt-p53 and mut-p53 cells. PMID:22343000

Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiran, Shashi; Oddi, Vineesha; Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com

2015-02-01

Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose ofmore » doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT7 attenuated p38/JNK activation and also p53 response. • Overall, SIRT7 promoted cellular survival in conditions of genomic stress.« less

Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

PubMed Central

Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

2016-01-01

Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

PubMed

Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

2008-07-01

To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

Aberrant AKT activation drives well-differentiated liposarcoma

PubMed Central

Gutierrez, Alejandro; Snyder, Eric L.; Marino-Enriquez, Adrian; Zhang, Yi-Xiang; Sioletic, Stefano; Kozakewich, Elena; Grebliunaite, Ruta; Ou, Wen-bin; Sicinska, Ewa; Raut, Chandrajit P.; Demetri, George D.; Perez-Atayde, Antonio R.; Wagner, Andrew J.; Fletcher, Jonathan A.; Fletcher, Christopher D. M.; Look, A. Thomas

2011-01-01

Well-differentiated liposarcoma (WDLPS), one of the most common human sarcomas, is poorly responsive to radiation and chemotherapy, and the lack of animal models suitable for experimental analysis has seriously impeded functional investigation of its pathobiology and development of effective targeted therapies. Here, we show that zebrafish expressing constitutively active Akt2 in mesenchymal progenitors develop WDLPS that closely resembles the human disease. Tumor incidence rates were 8% in p53 wild-type zebrafish, 6% in p53 heterozygotes, and 29% in p53-homozygous mutant zebrafish (P = 0.013), indicating that aberrant Akt activation collaborates with p53 mutation in WDLPS pathogenesis. Analysis of primary clinical specimens of WDLPS, and of the closely related dedifferentiated liposarcoma (DDLPS) subtype, revealed immunohistochemical evidence of AKT activation in 27% of cases. Western blot analysis of a panel of cell lines derived from patients with WDLPS or DDLPS revealed robust AKT phosphorylation in all cell lines examined, even when these cells were cultured in serum-free media. Moreover, BEZ235, a small molecule inhibitor of PI3K and mammalian target of rapamycin that effectively inhibits AKT activation in these cells, impaired viability at nanomolar concentrations. Our findings are unique in providing an animal model to decipher the molecular pathogenesis of WDLPS, and implicate AKT as a previously unexplored therapeutic target in this chemoresistant sarcoma. PMID:21930930

Hyperosmolarity induced by high glucose promotes senescence in human glomerular mesangial cells.

PubMed

del Nogal, Maria; Troyano, Nuria; Calleros, Laura; Griera, Mercedes; Rodriguez-Puyol, Manuel; Rodriguez-Puyol, Diego; Ruiz-Torres, María P

2014-09-01

Hyperglycemia is involved in the diabetic complication of different organs and can elevate serum osmolarity. Here, we tested whether hyperosmolarity promoted by high glucose levels induces cellular senescence in renal cells. We treated Wistar rats with streptozotocin to induce diabetes or with consecutive daily injections of mannitol to increase serum osmolarity and analyzed p53 and p16 genes in renal cortex by immunohistochemistry. Both diabetic and mannitol treated rats showed a significant increase in serum osmolarity, without significant signs of renal dysfunction, but associated with increased staining for p53 and p16 in the renal cortex. An increase in p53 and p16 expression was also found in renal cortex slices and glomeruli isolated from healthy rats, which were later treated with 30 mM glucose or mannitol. Intracellular mechanisms involved were analyzed in cultured human glomerular mesangial cells treated with 30 mM glucose or mannitol. After treatments, cells showed increased p53, p21 and p16 expression and elevated senescence-associated β-galactosidase activity. Senescence was prevented when myo-inositol was added before treatment. High glucose or mannitol induced constitutive activation of Ras and ERK pathways which, in turn, were activated by oxidative stress. In summary, hyperosmolarity induced renal senescence, particularly in glomerular mesangial cells, increasing oxidative stress, which constitutively activated Ras-ERK 1/2 pathway. Cellular senescence could contribute to the organ dysfunction associated with diabetes. Copyright © 2014 Elsevier Ltd. All rights reserved.

p53 mediates bcl-2 phosphorylation and apoptosis via activation of the Cdc42/JNK1 pathway.

PubMed

Thomas, A; Giesler, T; White, E

2000-11-02

A member of the small G protein family, cdc42, was isolated from a screen undertaken to identify p53-inducible genes during apoptosis in primary baby rat kidney (BRK) cells transformed with E1A and a temperature-sensitive mutant p53 using a PCR-based subtractive hybridization method. Cdc42 is a GTPase that belongs to the Rho/Rac subfamily of Ras-like GTPases. In response to external stimuli, Cdc42 is known to transduce signals to regulate the organization of the actin cytoskeleton, induce DNA synthesis in quiescent fibroblasts, and promote apoptosis in neuronal and immune cells. In this study, we have demonstrated that cdc42 mRNA and protein were up-regulated in the presence of wild-type p53 in BRK cells, followed by cytoplasmic to plasma membrane translocation of Cdc42. Overexpression of Cdc42 in the presence of a dominant-negative mutant p53 induced apoptosis rapidly, indicating that Cdc42 functions downstream of p53. Furthermore, stable expression of a dominant-negative mutant of Cdc42 partially inhibited p53-mediated apoptosis. The Bcl-2 family members Bcl-xL, and the adenovirus protein E1B 19K, inhibited Cdc42-mediated apoptosis, whereas Bcl-2 did not. We provide evidence that PAK1 and JNK1 may play a role downstream of Cdc42 to transduce its apoptotic signal. Cdc42/PAK1 activates JNK1-induced phosphorylation of Bcl-2, thereby inactivating its function, and that a phosphorylation resistant mutant (Bcl-2S70,87A,T56,74A) gains the ability to inhibit Cdc42- and p53-mediated apoptosis. Thus, one mechanism by which p53 promotes apoptosis is through activation of Cdc42 and inactivation of Bcl-2.

A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hwa-Ryeon; Roe, Jae-Seok; Lee, Ji-Eun

2012-02-24

Highlights: Black-Right-Pointing-Pointer p53 downregulates IMPDH. Black-Right-Pointing-Pointer p53-dependent miR-34a transactivation inhibits IMPDH transcription. Black-Right-Pointing-Pointer miR-34a-mediated inhibition of IMPDH downregulates GTP-dependent Ras signal. -- Abstract: p53 is a well-known transcription factor that controls cell cycle arrest and cell death in response to a wide range of stresses. Moreover, p53 regulates glucose metabolism and its mutation results in the metabolic switch to the Warburg effect found in cancer cells. Nucleotide biosynthesis is also critical for cell proliferation and the cell division cycle. Nonetheless, little is known about whether p53 regulates nucleotide biosynthesis. Here we demonstrated that p53-inducible microRNA-34a (miR-34a) repressed inosine 5 Primemore » -monophosphate dehydrogenase (IMPDH), a rate-limiting enzyme of de novo GTP biosynthesis. Treatment with anti-miR-34a inhibitor relieved the expression of IMPDH upon DNA damage. Ultimately, miR-34a-mediated inhibition of IMPDH resulted in repressed activation of the GTP-dependent Ras signaling pathway. In summary, we suggest that p53 has a novel function in regulating purine biosynthesis, aided by miR-34a-dependent IMPDH repression.« less

Agmatine Ameliorates High Glucose-Induced Neuronal Cell Senescence by Regulating the p21 and p53 Signaling.

PubMed

Song, Juhyun; Lee, Byeori; Kang, Somang; Oh, Yumi; Kim, Eosu; Kim, Chul-Hoon; Song, Ho-Taek; Lee, Jong Eun

2016-02-01

Neuronal senescence caused by diabetic neuropathy is considered a common complication of diabetes mellitus. Neuronal senescence leads to the secretion of pro-inflammatory cytokines, the production of reactive oxygen species, and the alteration of cellular homeostasis. Agmatine, which is biosynthesized by arginine decarboxylation, has been reported in previous in vitro to exert a protective effect against various stresses. In present study, agmatine attenuated the cell death and the expression of pro-inflammatory cytokines such as IL-6, TNF-alpha and CCL2 in high glucose in vitro conditions. Moreover, the senescence associated-β-galatosidase's activity in high glucose exposed neuronal cells was reduced by agmatine. Increased p21 and reduced p53 in high glucose conditioned cells were changed by agmatine. Ultimately, agmatine inhibits the neuronal cell senescence through the activation of p53 and the inhibition of p21. Here, we propose that agmatine may ameliorate neuronal cell senescence in hyperglycemia.

p53-mediated inhibition of angiogenesis through up-regulation of a collagen prolyl hydroxylase.

PubMed

Teodoro, Jose G; Parker, Albert E; Zhu, Xiaochun; Green, Michael R

2006-08-18

Recent evidence suggests that antiangiogenic therapy is sensitive to p53 status in tumors, implicating a role for p53 in the regulation of angiogenesis. Here we show that p53 transcriptionally activates the alpha(II) collagen prolyl-4-hydroxylase [alpha(II)PH] gene, resulting in the extracellular release of antiangiogenic fragments of collagen type 4 and 18. Conditioned media from cells ectopically expressing either p53 or alpha(II)PH selectively inhibited growth of primary human endothelial cells. When expressed intracellularly or exogenously delivered, alpha(II)PH significantly inhibited tumor growth in mice. Our results reveal a genetic and biochemical linkage between the p53 tumor suppressor pathway and the synthesis of antiangiogenic collagen fragments.

p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis.

PubMed

Napoletano, Francesco; Gibert, Benjamin; Yacobi-Sharon, Keren; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Teil, Margaux; Chatelain, Gilles; Walter, Ludivine; Arama, Eli; Mollereau, Bertrand

2017-09-01

The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis.

PUMA promotes Bax translocation in FOXO3a-dependent pathway during STS-induced apoptosis

NASA Astrophysics Data System (ADS)

Zhang, Yingjie; Chen, Qun

2009-08-01

PUMA (p53 up-regulated modulator of apoptosis, also called Bbc3) was first identified as a BH3-only Bcl-2 family protein that is transcriptionally up-regulated by p53 and activated upon p53-dependent apoptotic stimuli, such as treatment with DNA-damaging drugs or UV irradiation. Recently studies have been shown that Puma is also up-regulated in response to certain p53-independent apoptotic stimuli, such as growth factor deprivation or treatment with glucocorticoids or STS (staurosporine). However, the molecular mechanisms of PUMA up-regulation and how PUMA functions in response to p53-independent apoptotic stimuli remain poorly understood. In this study, based on real-time single cell analysis, flow cytometry and western blotting technique, we investigated the function of PUMA in living human lung adenocarcinoma cells (ASTC-a-1) after STS treatment. Our results show that FOXO3a was activated by STS stimulation and then translocated from cytosol to nucleus. The expression of PUMA was up-regulated via a FOXO3a-dependent manner after STS treatment, while p53 had little function in this process. Moreover, cell apoptosis and Bax translocation induced by STS were not blocked by Pifithrin-α (p53 inhibitor), which suggested that p53 was not involved in this signaling pathway. Taken together, these results indicate that PUMA promoted Bax translocation in a FOXO3a-dependment pathway during STS-induced apoptosis, while p53 was dispensable in this process.

Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

PubMed

Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

2017-12-15

TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

Targeting MDM2 for Treatment of Adenoid Cystic Carcinoma

PubMed Central

Warner, Kristy A.; Nör, Felipe; Acasigua, Gerson A.; Martins, Manoela D.; Zhang, Zhaocheng; McLean, Scott A.; Spector, Matthew E.; Chepeha, Douglas B.; Helman, Joseph; Wick, Michael J.; Moskaluk, Christopher A.; Castilho, Rogerio M.; Pearson, Alexander T.; Wang, Shaomeng; Nör, Jacques E.

2016-01-01

Purpose There are no effective treatment options for patients with advanced adenoid cystic carcinoma (ACC). Here, we evaluated the effect of a new small molecule inhibitor of the MDM2-p53 interaction (MI-773) in preclinical models of ACC. Experimental Design To evaluate the anti-tumor effect of MI-773, we administered it to mice harboring 3 different patient-derived xenograft (PDX) models of ACC expressing functional p53. The effect of MI-773 on MDM2, p53, phospho-p53 and p21 was examined by Western blots in 5 low passage primary human ACC cell lines and in MI-773-treated PDX tumors. Results Single agent MI-773 caused tumor regression in the 3 PDX models of ACC studied here. For example, we observed a tumor growth inhibition (TGI) index of 127% in UM-PDX-HACC-5 tumors that was associated with an increase in the fraction of apoptotic cells (p=0.015). The number of p53-positive cells was increased in MI-773-treated PDX tumors (p<0.001), with a correspondent shift in p53 localization from the nucleus to the cytoplasm. Western blots demonstrated that MI-773 potently induced expression of p53 and its downstream targets p21, MDM2 and induced phosphorylation of p53 (serine 392) in low passage primary human ACC cells. Notably, MI-773 induced a dose-dependent increase in the fraction of apoptotic ACC cells and in the fraction of cells in the G1 phase of cell cycle (p<0.05). Conclusions Collectively, these data demonstrate that therapeutic inhibition of the MDM2-p53 interaction with MI-773 activates downstream effectors of apoptosis and causes robust tumor regression in preclinical models of adenoid cystic carcinoma. PMID:26936915

Co-expression of p53 and MDM2 in human atherosclerosis: implications for the regulation of cellularity of atherosclerotic lesions.

PubMed

Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M

1998-07-01

Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR. Thus, the fate of cells with p53 accumulation may depend on the interaction and the stoichiometry of the p53 and MDM2 proteins. Cells were indeed found with strong p53 accumulation and nuclear morphology typical for apoptosis and there were a few MIB1/Ki-67-positive cells with co-expression of MDM2, indicating a possible role for MDM2 in reversing the negative regulatory effects of p53 for cell cycle progression. The nuclear co-localization of p53 IR with MDM2 IR and the co-immunoprecipitation assay indicate the presence of p53-MDM2 complex formation in vivo in human atherosclerotic tissue. The destiny of individual p53 and MDM2-co-expressing cells either to undergo p53-dependent apoptosis or to re-enter the cycle of cell proliferation may depend on the relative ratios of the two proteins. p53 and MDM2 may therefore play an important role in regulating cellularity and inflammatory activity in human atherosclerotic plaques.

SMG-1 kinase attenuates mitochondrial ROS production but not cell respiration deficits during hyperoxia.

PubMed

Resseguie, Emily A; Brookes, Paul S; O'Reilly, Michael A

Supplemental oxygen (hyperoxia) used to treat individuals in respiratory distress causes cell injury by enhancing the production of toxic reactive oxygen species (ROS) and inhibiting mitochondrial respiration. The suppressor of morphogenesis of genitalia (SMG-1) kinase is activated during hyperoxia and promotes cell survival by phosphorylating the tumor suppressor p53 on serine 15. Here, we investigate whether SMG-1 and p53 blunt this vicious cycle of progressive ROS production and decline in mitochondrial respiration seen during hyperoxia. Human lung adenocarcinoma A549 and H1299 or colon carcinoma HCT116 cells were depleted of SMG-1, UPF-1, or p53 using RNA interference, and then exposed to room air (21% oxygen) or hyperoxia (95% oxygen). Immunoblotting was used to evaluate protein expression; a Seahorse Bioanalyzer was used to assess cellular respiration; and flow cytometry was used to evaluate fluorescence intensity of cells stained with mitochondrial or redox sensitive dyes. Hyperoxia increased mitochondrial and cytoplasmic ROS and suppressed mitochondrial respiration without changing mitochondrial mass or membrane potential. Depletion of SMG-1 or its cofactor, UPF1, significantly enhanced hyperoxia-induced mitochondrial but not cytosolic ROS abundance. They did not affect mitochondrial mass, membrane potential, or hyperoxia-induced deficits in mitochondrial respiration. Genetic depletion of p53 in A549 cells and ablation of the p53 gene in H1299 or HCT116 cells revealed that SMG-1 influences mitochondrial ROS through activation of p53. Our findings show that hyperoxia does not promote a vicious cycle of progressive mitochondrial ROS and dysfunction because SMG-1-p53 signaling attenuates production of mitochondrial ROS without preserving respiration. This suggests antioxidant therapies that blunt ROS production during hyperoxia may not suffice to restore cellular respiration.

The critical role of catalase in prooxidant and antioxidant function of p53

PubMed Central

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

DNA damage response in nephrotoxic and ischemic kidney injury

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Mingjuan; Tang, Chengyuan

DNA damage activates specific cell signaling cascades for DNA repair, cell cycle arrest, senescence, and/or cell death. Recent studies have demonstrated DNA damage response (DDR) in experimental models of acute kidney injury (AKI). In cisplatin-induced AKI or nephrotoxicity, the DDR pathway of ATR/Chk2/p53 is activated and contributes to renal tubular cell apoptosis. In ischemic AKI, DDR seems more complex and involves at least the ataxia telangiectasia mutated (ATM), a member of the phosphatidylinositol 3-kinase-related kinase (PIKK) family, and p53; however, while ATM may promote DNA repair, p53 may trigger cell death. Targeting DDR for kidney protection in AKI therefore reliesmore » on a thorough elucidation of the DDR pathways in various forms of AKI.« less

Differential protein expression, DNA binding and interaction with SV40 large tumour antigen implicate the p63-family of proteins in replicative senescence.

PubMed

Djelloul, Siham; Tarunina, Marina; Barnouin, Karin; Mackay, Alan; Jat, Parmjit S

2002-02-07

P53 activity plays a key role in mammalian cells when they undergo replicative senescence at their Hayflick limit. To determine whether p63 proteins, members of the family of p53-related genes, are also involved in this process, we examined their expression in serially passaged rat embryo fibroblasts. Upon senescence, two truncated DeltaNp63 proteins decreased in abundance whereas two TAp63 isoforms accumulated. 2-D gel analysis showed that the DeltaNp63 proteins underwent post-translational modifications in both proliferating and senescent cells. Direct binding of DeltaNp63 proteins to a p53 consensus motif was greater in proliferating cells than senescent cells. In contrast p63alpha isoforms bound to DNA in a p53 dependent manner and this was higher in senescent cells than proliferating cells. An interaction of p63alpha proteins with SV40 large tumour antigen was also detected and ectopic expression of DeltaNp63alpha can extend the lifespan of rat embryo fibroblasts. Taken together the results indicate that p63 proteins may play a role in replicative senescence either by competition for p53 DNA binding sites or by direct interaction with p53 protein bound to DNA.

Oncogenic HRAS activates epithelial-mesenchyme transition and confers stemness to p53-deficient urothelial cells to drive muscle invasion of basal subtype carcinomas

PubMed Central

He, Feng; Melamed, Jonathan; Tang, Moon-shong; Huang, Chuanshu; Wu, Xue-Ru

2015-01-01

Muscle-invasive urothelial carcinomas of the bladder (MIUCB) exhibit frequent receptor tyrosine kinase alterations but the precise nature of their contributions to tumor pathophysiology is unclear. Using mutant HRAS (HRAS*) as an oncogenic prototype, we obtained evidence in transgenic mice that RTK/RAS pathway activation in urothelial cells causes hyperplasia that neither progresses to frank carcinoma nor regresses to normal urothelium through a period of one year. This persistent hyperplastic state appeared to result from an equilibrium between pro-mitogenic factors and compensatory tumor barriers in the p19-MDM2-p53-p21 axis and a prolonged G2 arrest. Conditional inactivation of p53 in urothelial cells of transgenic mice expressing HRAS* resulted in carcinoma-in-situ and basal-subtype MIUCB with focal squamous differentiation resembling the human counterpart. The transcriptome of microdissected MIUCB was enriched in genes that drive epithelial-mesenchyme transition, the upregulation of which is associated with urothelial cells expressing multiple progenitor/stem cell markers. Taken together, our results provide evidence for RTK/RAS pathway activation and p53 deficiency as a combinatorial theranostic biomarker which may inform the progression and treatment of urothelial carcinoma. PMID:25795707

Identification of flubendazole as potential anti-neuroblastoma compound in a large cell line screen.

PubMed

Michaelis, Martin; Agha, Bishr; Rothweiler, Florian; Löschmann, Nadine; Voges, Yvonne; Mittelbronn, Michel; Starzetz, Tatjana; Harter, Patrick N; Abhari, Behnaz A; Fulda, Simone; Westermann, Frank; Riecken, Kristoffer; Spek, Silvia; Langer, Klaus; Wiese, Michael; Dirks, Wilhelm G; Zehner, Richard; Cinatl, Jaroslav; Wass, Mark N; Cinatl, Jindrich

2015-02-03

Flubendazole was shown to exert anti-leukaemia and anti-myeloma activity through inhibition of microtubule function. Here, flubendazole was tested for its effects on the viability of in total 461 cancer cell lines. Neuroblastoma was identified as highly flubendazole-sensitive cancer entity in a screen of 321 cell lines from 26 cancer entities. Flubendazole also reduced the viability of five primary neuroblastoma samples in nanomolar concentrations thought to be achievable in humans and inhibited vessel formation and neuroblastoma tumour growth in the chick chorioallantoic membrane assay. Resistance acquisition is a major problem in high-risk neuroblastoma. 119 cell lines from a panel of 140 neuroblastoma cell lines with acquired resistance to various anti-cancer drugs were sensitive to flubendazole in nanomolar concentrations. Tubulin-binding agent-resistant cell lines displayed the highest flubendazole IC50 and IC90 values but differences between drug classes did not reach statistical significance. Flubendazole induced p53-mediated apoptosis. The siRNA-mediated depletion of the p53 targets p21, BAX, or PUMA reduced the neuroblastoma cell sensitivity to flubendazole with PUMA depletion resulting in the most pronounced effects. The MDM2 inhibitor and p53 activator nutlin-3 increased flubendazole efficacy while RNAi-mediated p53-depletion reduced its activity. In conclusion, flubendazole represents a potential treatment option for neuroblastoma including therapy-refractory cells.

Identification of flubendazole as potential anti-neuroblastoma compound in a large cell line screen

PubMed Central

Michaelis, Martin; Agha, Bishr; Rothweiler, Florian; Löschmann, Nadine; Voges, Yvonne; Mittelbronn, Michel; Starzetz, Tatjana; Harter, Patrick N.; Abhari, Behnaz A.; Fulda, Simone; Westermann, Frank; Riecken, Kristoffer; Spek, Silvia; Langer, Klaus; Wiese, Michael; Dirks, Wilhelm G.; Zehner, Richard; Cinatl, Jaroslav; Wass, Mark N.; Cinatl, Jindrich

2015-01-01

Flubendazole was shown to exert anti-leukaemia and anti-myeloma activity through inhibition of microtubule function. Here, flubendazole was tested for its effects on the viability of in total 461 cancer cell lines. Neuroblastoma was identified as highly flubendazole-sensitive cancer entity in a screen of 321 cell lines from 26 cancer entities. Flubendazole also reduced the viability of five primary neuroblastoma samples in nanomolar concentrations thought to be achievable in humans and inhibited vessel formation and neuroblastoma tumour growth in the chick chorioallantoic membrane assay. Resistance acquisition is a major problem in high-risk neuroblastoma. 119 cell lines from a panel of 140 neuroblastoma cell lines with acquired resistance to various anti-cancer drugs were sensitive to flubendazole in nanomolar concentrations. Tubulin-binding agent-resistant cell lines displayed the highest flubendazole IC50 and IC90 values but differences between drug classes did not reach statistical significance. Flubendazole induced p53-mediated apoptosis. The siRNA-mediated depletion of the p53 targets p21, BAX, or PUMA reduced the neuroblastoma cell sensitivity to flubendazole with PUMA depletion resulting in the most pronounced effects. The MDM2 inhibitor and p53 activator nutlin-3 increased flubendazole efficacy while RNAi-mediated p53-depletion reduced its activity. In conclusion, flubendazole represents a potential treatment option for neuroblastoma including therapy-refractory cells. PMID:25644037

Interaction between the Cockayne syndrome B and p53 proteins: implications for aging

PubMed Central

Frontini, Mattia; Proietti-De-Santis, Luca

2012-01-01

The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53's levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis. PMID:22383384

Fusaric Acid Induces DNA Damage and Post-Translational Modifications of p53 in Human Hepatocellular Carcinoma (HepG2 ) Cells.

PubMed

Ghazi, Terisha; Nagiah, Savania; Tiloke, Charlette; Sheik Abdul, Naeem; Chuturgoon, Anil A

2017-11-01

Fusaric acid (FA), a common fungal contaminant of maize, is known to mediate toxicity in plants and animals; however, its mechanism of action is unclear. p53 is a tumor suppressor protein that is activated in response to cellular stress. The function of p53 is regulated by post-translational modifications-ubiquitination, phosphorylation, and acetylation. This study investigated a possible mechanism of FA induced toxicity in the human hepatocellular carcinoma (HepG 2 ) cell line. The effect of FA on DNA integrity and post-translational modifications of p53 were investigated. Methods included: (a) culture and treatment of HepG 2 cells with FA (IC 50 : 580.32 μM, 24 h); (b) comet assay (DNA damage); (c) Western blots (protein expression of p53, MDM2, p-Ser-15-p53, a-K382-p53, a-CBP (K1535)/p300 (K1499), HDAC1 and p-Ser-47-Sirt1); and (d) Hoechst 33342 assay (apoptosis analysis). FA caused DNA damage in HepG 2 cells relative to the control (P < 0.0001). FA decreased the protein expression of p53 (0.24-fold, P = 0.0004) and increased the expression of p-Ser-15-p53 (12.74-fold, P = 0.0126) and a-K382-p53 (2.24-fold, P = 0.0096). This occurred despite the significant decrease in the histone acetyltransferase, a-CBP (K1535)/p300 (K1499) (0.42-fold, P = 0.0023) and increase in the histone deacetylase, p-Ser-47-Sirt1 (1.22-fold, P = 0.0020). The expression of MDM2, a negative regulator of p53, was elevated in the FA treatment compared to the control (1.83-fold, P < 0.0001). FA also inhibited cell proliferation and induced apoptosis in HepG 2 cells as evidenced by the Hoechst assay. Together, these results indicate that FA is genotoxic and post-translationally modified p53 leading to HepG 2 cell death. J. Cell. Biochem. 118: 3866-3874, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Histone deacetylase inhibitors prevent p53-dependent and p53-independent Bax-mediated neuronal apoptosis through two distinct mechanisms.

PubMed

Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S

2009-03-04

Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.

p53 suppresses hyper-recombination by modulating BRCA1 function

PubMed Central

Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

2015-01-01

Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

Expression of matrix metalloproteinase 1, matrix metalloproteinase 2, and matrix metalloproteinase 9 in carcinoma of the head and neck.

PubMed

Franchi, Alessandro; Santucci, Marco; Masini, Emanuela; Sardi, Iacopo; Paglierani, Milena; Gallo, Oreste

2002-11-01

Numerous reports have documented a direct involvement of matrix metalloproteinase (MMP) overexpression in the development and progression of head and neck squamous cell carcinoma (HNSCC). In this study, the authors examined whether the expression of MMPs in HNSCC is correlated with other steps involved in tumor growth and metastasis, like angiogenesis, activation the nitric oxide (NO) pathway, and alteration of the p53 tumor suppressor gene. MMP-1, MMP-2, and MMP-9 expression levels were examined immunohistochemically in samples from 43 patients with HNSCC. Microvessel density (MVD) was determined by immunostaining of endothelial cells with anti-CD31 monoclonal antibody. Inducible nitric oxide synthase (iNOS) activity and cyclic guanosine monophosphatate (cGMP) levels were assessed in fresh tumor samples, whereas exons 5-9 of the p53 gene were analyzed by reverse transcriptase-polymerase chain reaction, single-strand conformation polymorphism analysis and were sequenced. MMP-1 overexpression (>10% of tumor cells) was identified in 32 tumors (74.5%), whereas elevated levels of MMP-2 and MMP-9 were detected in 17 tumors (39.5%) each. Tumors with MMP-9 overexpression were characterized by significantly higher MVD (P = 0.05) and significantly higher iNOS activity and cGMP levels (P = 0.005 and P = 0.02, respectively). Moreover, p53 mutation was associated strongly with MMP-9 overexpression (P = 0.004). Conversely, no correlation was found between MMP-1 and MMP-2 expression, angiogenesis, iNOS activity, cGMP levels, and p53 mutation in this series. This study documents the existence of a correlation between MMP-9 expression, activity of the iNOS pathway, p53 status, and angiogenesis in patients with HNSCC. This raises the possibility that p53 mutation, which frequently is present in HNSCC, may result in increased angiogenesis and invasiveness related to increased nitric oxide and MMP production by tumor cells, ultimately contributing to tumor progression. Copyright 2002 American Cancer Society.

Ginsenoside Rg3 Inhibits Melanoma Cell Proliferation through Down-Regulation of Histone Deacetylase 3 (HDAC3) and Increase of p53 Acetylation

PubMed Central

Shan, Xiu; Fu, Yuan-Shan; Aziz, Faisal; Wang, Xiao-Qi; Yan, Qiu; Liu, Ji-Wei

2014-01-01

Malignant melanoma is an aggressive and deadly form of skin cancer, and despite recent advances in available therapies, is still lacking in completely effective treatments. Rg3, a monomer extracted from ginseng roots, has been attempted for the treatment of many cancers. It is reported that the expressions of histone deacetylase 3 (HDAC3) and p53 acetylation correlate with tumor cell growth. However, the antitumor effect of Rg3 on melanoma and the mechanism by which it regulates HDAC3 expression and p53 acetylation remain unknown. We found high expression of HDAC3 in human melanoma tissues to be significantly correlated to lymph node metastasis and clinical stage of disease (p<0.05). In melanoma cells, Rg3 inhibited cell proliferation and induced G0/G1 cell cycle arrest. Rg3 also decreased the expression of HDAC3 and increased the acetylation of p53 on lysine (k373/k382). Moreover, suppression of HDAC3 by either siRNA or a potent HDAC3 inhibitor (MS-275) inhibited cell proliferation, increased p53 acetylation and transcription activity. In A375 melanoma xenograft studies, we demonstrated that Rg3 and HDAC3 short hairpin RNA (shHDAC3) inhibited the growth of xenograft tumors with down-regulation of HDAC3 expression and up-regulation of p53 acetylation. In conclusion, Rg3 has antiproliferative activity against melanoma by decreasing HDAC3 and increasing acetylation of p53 both in vitro and in vivo. Thus, Rg3 serves as a potential therapeutic agent for the treatment of melanoma. PMID:25521755

Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Duanmin; Su, Cunjin; Jiang, Min

There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs,more » siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.« less

Enhanced radiosensitization of p53 mutant cells by oleamide.

PubMed

Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil

2006-04-01

Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

p53, a New Master Regulator of Stem Cell Differentiation | Center for Cancer Research

Cancer.gov

When the genome is damaged, a key player in stabilizing and maintaining genomic integrity is a protein called p53.  This protein can activate or shut down gene activity in response to DNA damage.  But how exactly does p53 accomplish its task? This question has yet to be answered completely at the molecular level.   

A dual role of p53 in the control of autophagy.

PubMed

Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

2008-08-01

Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution.

PubMed

Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

2015-10-01

Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53(-/-) mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy.

E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution

PubMed Central

Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

2015-01-01

Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53−/− mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy. PMID:25656653

Immortal, telomerase-negative cell lines derived from a Li-Fraumeni syndrome patient exhibit telomere length variability and chromosomal and minisatellite instabilities.

PubMed

Tsutsui, Takeki; Kumakura, Shin-Ichi; Tamura, Yukiko; Tsutsui, Takeo W; Sekiguchi, Mizuki; Higuchi, Tokihiro; Barrett, J Carl

2003-05-01

Five immortal cell lines derived from a Li-Fraumeni syndrome patient (MDAH 087) with a germline mutant p53 allele were characterized with respect to telomere length and genomic instability. The remaining wild-type p53 allele is lost in the cell lines. Telomerase activity was undetectable in all immortal cell lines. Five subclones of each cell line and five re-subclones of each of the subclones also showed undetectable telomerase activity. All five immortal cell lines exhibited variability in the mean length of terminal restriction fragments (TRFs). Subclones of each cell line, and re-subclones of the subclones also showed TRF variability, indicating that the variability is owing to clonal heterogeneity. Chromosome aberrations were observed at high frequencies in these cell lines including the subclones and re-subclones, and the principal types of aberrations were breaks, double minute chromosomes and dicentric chromosomes. In addition, minisatellite instability detected by DNA fingerprints was observed in the immortal cell lines. However, all of the cell lines were negative for microsatellite instability. As minisatellite sequences are considered recombinogenic in mammalian cells, these results suggest that recombination rates can be increased in these cell lines. Tumor-derived human cell lines, HT1080 cells and HeLa cells that also lack p53 function, exhibited little genomic instability involving chromosomal and minisatellite instabilities, indicating that chromosomal and minisatellite instabilities observed in the immortal cell lines lacking telomerase activity could not result from loss of p53 function.

Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

PubMed

Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

2016-03-01

Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

SIAH1-induced p34SEI-1 polyubiquitination/degradation mediates p53 preferential vitamin C cytotoxicity.

PubMed

Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok

2015-03-01

Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.

p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

PubMed

Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

2018-05-28

p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

PubMed

Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

2010-05-01

Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

The ubiquitin ligase LIN41/TRIM71 targets p53 to antagonize cell death and differentiation pathways during stem cell differentiation

PubMed Central

Nguyen, Duong Thi Thuy; Richter, Daniel; Michel, Geert; Mitschka, Sibylle; Kolanus, Waldemar; Cuevas, Elisa; Gregory Wulczyn, F

2017-01-01

Rapidity and specificity are characteristic features of proteolysis mediated by the ubiquitin-proteasome system. Therefore, the UPS is ideally suited for the remodeling of the embryonic stem cell proteome during the transition from pluripotent to differentiated states and its inverse, the generation of inducible pluripotent stem cells. The Trim-NHL family member LIN41 is among the first E3 ubiquitin ligases to be linked to stem cell pluripotency and reprogramming. Initially discovered in C. elegans as a downstream target of the let-7 miRNA, LIN41 is now recognized as a critical regulator of stem cell fates as well as the timing of neurogenesis. Despite being indispensable for embryonic development and neural tube closure in mice, the underlying mechanisms for LIN41 function in these processes are poorly understood. To better understand the specific contributions of the E3 ligase activity for the stem cell functions of LIN41, we characterized global changes in ubiquitin or ubiquitin-like modifications using Lin41-inducible mouse embryonic stem cells. The tumor suppressor protein p53 was among the five most strongly affected proteins in cells undergoing neural differentiation in response to LIN41 induction. We show that LIN41 interacts with p53, controls its abundance by ubiquitination and antagonizes p53-dependent pro-apoptotic and pro-differentiation responses. In vivo, the lack of LIN41 is associated with upregulation of Grhl3 and widespread caspase-3 activation, two downstream effectors of p53 with essential roles in neural tube closure. As Lin41-deficient mice display neural tube closure defects, we conclude that LIN41 is critical for the regulation of p53 functions in cell fate specification and survival during early brain development. PMID:28430184

Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.

PubMed

Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana

2013-08-01

Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.

RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878

2013-11-01

Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less

Inhibition of Mdmx (Mdm4) in vivo induces anti-obesity effects.

PubMed

Kon, Ning; Wang, Donglai; Li, Tongyuan; Jiang, Le; Qiang, Li; Gu, Wei

2018-01-26

Although cell-cycle arrest, senescence and apoptosis remain as major canonical activities of p53 in tumor suppression, the emerging role of p53 in metabolism has been a topic of great interest. Nevertheless, it is not completely understood how p53-mediated metabolic activities are regulated in vivo and whether this part of the activities has an independent role beyond tumor suppression. Mdmx (also called Mdm4), like Mdm2, acts as a major suppressor of p53 but the embryonic lethality of mdmx-null mice creates difficulties to evaluate its physiological significance in metabolism. Here, we report that the embryonic lethality caused by the deficiency of mdmx , in contrast to the case for mdm2 , is fully rescued in the background of p53 3KR/3KR , an acetylation-defective mutant unable to induce cell-cycle arrest, senescence and apoptosis. p53 3KR/3KR /mdmx -/- mice are healthy but skinny without obvious developmental defects. p53 3KR/3KR /mdmx -/- mice are resistant to fat accumulation in adipose tissues upon high fat diet. Notably, the levels of p53 protein are only slightly increased and can be further induced upon DNA damage in p53 3KR/3KR /mdmx -/- mice, suggesting that Mdmx is only partially required for p53 degradation in vivo . Further analyses indicate that the anti-obesity phenotypes in p53 3KR/3KR /mdmx -/- mice are caused by activation of lipid oxidation and thermogenic programs in adipose tissues. These results demonstrate the specific effects of the p53/Mdmx axis in lipid metabolism and adipose tissue remodeling and reveal a surprising role of Mdmx inhibition in anti-obesity effects beyond, commonly expected, tumor suppression. Thus, our study has significant implications regarding Mdmx inhibitors in the treatment of obesity related diseases.

Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denamur, Sophie; Boland, Lidvine

Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasomemore » by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.« less

Ensemble-based virtual screening reveals dual-inhibitors for the p53-MDM2/MDMX interactions.

PubMed

Barakat, Khaled; Mane, Jonathan; Friesen, Douglas; Tuszynski, Jack

2010-02-26

The p53 protein, a guardian of the genome, is inactivated by mutations or deletions in approximately half of human tumors. While in the rest of human tumors, p53 is expressed in wild-type form, yet it is inhibited by over-expression of its cellular regulators MDM2 and MDMX proteins. Although the p53-binding sites within the MDMX and MDM2 proteins are closely related, known MDM2 small-molecule inhibitors have been shown experimentally not to bind to its homolog, MDMX. As a result, the activity of these inhibitors including Nutlin3 is compromised in tumor cells over-expressing MDMX, preventing these compounds from fully activating the p53 protein. Here, we applied the relaxed complex scheme (RCS) to allow for the full receptor flexibility in screening for dual-inhibitors that can mutually antagonize the two p53-regulator proteins. First, we filtered the NCI diversity set, DrugBank compounds and a derivative library for MDM2-inhibitors against 28 dominant MDM2-conformations. Then, we screened the MDM2 top hits against the binding site of p53 within the MDMX target. Results described herein identify a set of compounds that have been computationally predicted to ultimately activate the p53 pathway in tumor cells retaining the wild-type protein. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

PubMed

Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

2017-10-15

Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and DNA damage-mediated cellular stresses. This seems to be the first report that p53 activates a viral oncogene; therefore, the discovery would be interesting to a broad readership from the fields of oncology to virology. Copyright © 2017 American Society for Microbiology.

Mutant p53 protein localized in the cytoplasm inhibits autophagy.

PubMed

Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

2008-10-01

The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

Human rpL3 induces G₁/S arrest or apoptosis by modulating p21waf1/cip1 levels in a p53-independent manner

PubMed Central

Russo, Annapina; Esposito, Davide; Catillo, Morena; Pietropaolo, Concetta; Crescenzi, Elvira; Russo, Giulia

2013-01-01

It is now largely accepted that ribosomal proteins may be implicated in a variety of biological functions besides that of components of the translation machinery. Many evidences show that a subset of ribosomal proteins are involved in the regulation of the cell cycle and apoptosis through modulation of p53 activity. In addition, p53-independent mechanisms of cell cycle arrest in response to alterations of ribosomal proteins availability have been described. Here, we identify human rpL3 as a new regulator of cell cycle and apoptosis through positive regulation of p21 expression in a p53-independent system. We demonstrate that the rpL3-mediated p21 upregulation requires the specific interaction between rpL3 and Sp1. Furthermore, in our experimental system, p21 overexpression leads to a dual outcome, activating the G₁/S arrest of the cell cycle or the apoptotic pathway through mitochondria, depending on its intracellular levels. It is noteworthy that depletion of p21 abrogates both effects. Taken together, our findings unravel a novel extraribosomal function of rpL3 and reinforce the proapoptotic role of p21 in addition to its widely reported ability as an inhibitor of cell proliferation. PMID:23255119

Synthesis and Biological Evaluation of Neopeltolide and Analogs

PubMed Central

Cui, Yubo; Balachandran, Raghavan

2012-01-01

The synthesis of neopeltolide analogs that contain variations in the oxazole-containing side chain and in the macrolide core are reported along with the GI50 values for these compounds against MCF7, HCT-116, and p53 knockout HCT-116 cell lines. Although biological activity is sensitive to changes in the macrocycle and the side chain, several analogs displayed GI50 values of <25 nM. Neopeltolide and several of the more potent analogs were significantly less potent against p53 knockout cells, suggesting that p53 plays an auxiliary role in the activity of these compounds. PMID:22329423

HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

PubMed

Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

2006-02-01

HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

Rosiglitazone enhances the radiosensitivity of p53-mutant HT-29 human colorectal cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiu, Shu-Jun, E-mail: chiusj@mail.tcu.edu.tw; Institute of Radiation Sciences, Tzu Chi Technology College, Hualien, Taiwan; Hsaio, Ching-Hui

2010-04-09

Combined-modality treatment has improved the outcome in cases of various solid tumors, and radiosensitizers are used to enhance the radiotherapeutic efficiency. Rosiglitazone, a synthetic ligand of peroxisome proliferator-activated receptors {gamma} used in the treatment of type-2 diabetes, has been shown to reduce tumor growth and metastasis in human cancer cells, and may have the potential to be used as a radiosensitizer in radiotherapy for human colorectal cancer cells. In this study, rosiglitazone treatment significantly reduced the cell viability of p53-wild type HCT116 cells but not p53-mutant HT-29 cells. Interestingly, rosiglitazone pretreatment enhanced radiosensitivity in p53-mutant HT-29 cells but not HCT116more » cells, and prolonged radiation-induced G{sub 2}/M arrest and enhanced radiation-induced cell growth inhibition in HT-29 cells. Pretreatment with rosiglitazone also suppressed radiation-induced H2AX phosphorylation in response to DNA damage and AKT activation for cell survival; on the contrary, rosiglitazone pretreatment enhanced radiation-induced caspase-8, -9, and -3 activation and PARP cleavage in HT-29 cells. In addition, pretreatment with a pan-caspase inhibitor, zVAD-fmk, attenuated the levels of caspase-3 activation and PARP cleavage in radiation-exposed cancer cells in combination with rosiglitazone pretreatment. Our results provide proof for the first time that rosiglitazone suppresses radiation-induced survival signals and DNA damage response, and enhances the radiation-induced apoptosis signaling cascade. These findings can assist in the development of rosiglitazone as a novel radiosensitizer.« less

Gene Expression in Mammalian Cells After Exposure to 95 MeV Argon Ions

NASA Astrophysics Data System (ADS)

Arenz, A.; Hellweg, C. E.; Baumstark-Khan, C.

Cell response to genotoxic agents is complex and involves the participation of different classes of genes (DNA repair, cell cycle control, signal transduction, apoptosis and oncogenesis). The unique feature of the space radiation environment is the dominance of high-energy charged particles (HZE or high LET radiation) which present a significant hazard to space flight crews, and accelerator-based experiments are underway to quantify the health risks due to unavoidable radiation exposure. High linear energy transfer (LET) radiation has an increased relative biological effectiveness (RBE) as compared to X-rays for cell death induction, gene mutation, genomic instability, and carcinogenesis. The tumour suppressor gene p53 plays a crucial role in maintaining the integrity of the genome. The p53 protein acts as a transcription factor that mediates cell cycle arrest and apoptosis by binding to DNA and activating transcription of specific genes. It is also though to be involved in damage repair by transcriptional activation of the newly identified p53 dependent ribonuclease subunit R2 (p53R2) that is directly involved in the p53 cell cycle checkpoint for repair of damaged DNA. In that case it is responsible for nucleotide delivery for DNA repair synthesis. DNA damages of cultured human cells (e.g. MCF-7, AGS, A549) exposed to accelerated argon ions at the French heavy ion facility GANIL were analysed for expression levels of certain damage- and apoptosis-relevant genes. RNA was extracted from cells exposed to different particle fluences after various recovery times. A real-time QRT-PCR assay was applied, which employs both relative and absolute quantification of a candidate mRNA biomarker. The expressions of different DNA damage inducible genes (e.g. p53R2, GADD45, p21) were analysed. A reproducible up-regulation representing a twofold to fourfold change in p53R2 gene expression level was confirmed for X-irradiated and Ar-ion exposed cells dependent on dose. Kinetics of p53R2 gene expression modulations shows a response lasting up to 24 hours after irradiation.

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

Reversible p53 inhibition prevents cisplatin ototoxicity without blocking chemotherapeutic efficacy.

PubMed

Benkafadar, Nesrine; Menardo, Julien; Bourien, Jérôme; Nouvian, Régis; François, Florence; Decaudin, Didier; Maiorano, Domenico; Puel, Jean-Luc; Wang, Jing

2017-01-01

Cisplatin is a widely used chemotherapy drug, despite its significant ototoxic side effects. To date, the mechanism of cisplatin-induced ototoxicity remains unclear, and hearing preservation during cisplatin-based chemotherapy in patients is lacking. We found activation of the ATM-Chk2-p53 pathway to be a major determinant of cisplatin ototoxicity. However, prevention of cisplatin-induced ototoxicity is hampered by opposite effects of ATM activation upon sensory hair cells: promoting both outer hair cell death and inner hair cell survival. Encouragingly, however, genetic or pharmacological ablation of p53 substantially attenuated cochlear cell apoptosis, thus preserving hearing. Importantly, systemic administration of a p53 inhibitor in mice bearing patient-derived triple-negative breast cancer protected auditory function, without compromising the anti-tumor efficacy of cisplatin. Altogether, these findings highlight a novel and effective strategy for hearing protection in cisplatin-based chemotherapy. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

Inhibitory effect of PDGF-BB and serum-stimulated responses in vascular smooth muscle cell proliferation by hinokitiol via up-regulation of p21 and p53.

PubMed

Li, Jiun-Yi; Liu, Chun-Ping; Shiao, Wei-Cheng; Jayakumar, Thanasekaran; Li, Yi-Shin; Chang, Nen-Chung; Huang, Shih-Yi; Hsieh, Cheng-Ying

2018-04-01

Vascular smooth muscle cell (VSMC) proliferation plays a major role in the progression of vascular diseases. In the present study, we established the efficacy and the mechanisms of action of hinokitiol, a tropolone derivative found in Chamaecyparis taiwanensis , Cupressaceae, in relation to platelet-derived growth factor-BB (PDGF-BB) and serum-dependent VSMC proliferation. Primary cultured rat VSMCs were pre-treated with hinokitiol and then stimulated by PDGF-BB (10 ng/ml) or serum (10% fetal bovine serum). Cell proliferation and cytotoxicity were determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and lactose dehydrogenase assay, respectively. The degree of DNA synthesis was evaluated by BrdU-incorporation measurements and observed using confocal microscopy. Immunoblotting was utilized to determine the protein level of p-extracellular signal-regulated kinase (ERK) 1/2, p-Akt, p-phosphoinositide 3-kinase (PI3K), p-Janus kinase 2 (JAK2), p-p53, and p21 Cip1 . The promoter activity of p21 and p53 activity were measured by dual luciferase reporter assay. Treatment with hinokitiol (1-10 μM) inhibited PDGF-BB and serum-induced VSMC proliferation and DNA synthesis in a concentration-dependent manner. Cytotoxicity was not observed in hinokitiol-treated VSMCs at the studied concentrations. Pre-incubation of VSMCs with hinokitiol did not alter PDGF-BB-induced phosphorylation of ERK1/2, Akt, PI3K or JAK2. Interestingly, hinokitiol induced promoter activity of p21 and p21 protein expression in VSMCs. Furthermore, hinokitiol augmented p53 protein phosphorylation and subsequently led to enhanced p53 activity. These data suggest that the anti-proliferative effects of hinokitiol in VSMCs may be mediated by activation of p21 and p53 signaling pathways, and it may contribute to the prevention of vascular diseases associated with VSMC proliferation.

Inhibitory effect of PDGF-BB and serum-stimulated responses in vascular smooth muscle cell proliferation by hinokitiol via up-regulation of p21 and p53

PubMed Central

Li, Jiun-Yi; Liu, Chun-Ping; Shiao, Wei-Cheng; Jayakumar, Thanasekaran; Li, Yi-Shin; Chang, Nen-Chung

2018-01-01

Introduction Vascular smooth muscle cell (VSMC) proliferation plays a major role in the progression of vascular diseases. In the present study, we established the efficacy and the mechanisms of action of hinokitiol, a tropolone derivative found in Chamaecyparis taiwanensis, Cupressaceae, in relation to platelet-derived growth factor-BB (PDGF-BB) and serum-dependent VSMC proliferation. Material and methods Primary cultured rat VSMCs were pre-treated with hinokitiol and then stimulated by PDGF-BB (10 ng/ml) or serum (10% fetal bovine serum). Cell proliferation and cytotoxicity were determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and lactose dehydrogenase assay, respectively. The degree of DNA synthesis was evaluated by BrdU-incorporation measurements and observed using confocal microscopy. Immunoblotting was utilized to determine the protein level of p-extracellular signal-regulated kinase (ERK) 1/2, p-Akt, p-phosphoinositide 3-kinase (PI3K), p-Janus kinase 2 (JAK2), p-p53, and p21Cip1. The promoter activity of p21 and p53 activity were measured by dual luciferase reporter assay. Results Treatment with hinokitiol (1–10 μM) inhibited PDGF-BB and serum-induced VSMC proliferation and DNA synthesis in a concentration-dependent manner. Cytotoxicity was not observed in hinokitiol-treated VSMCs at the studied concentrations. Pre-incubation of VSMCs with hinokitiol did not alter PDGF-BB-induced phosphorylation of ERK1/2, Akt, PI3K or JAK2. Interestingly, hinokitiol induced promoter activity of p21 and p21 protein expression in VSMCs. Furthermore, hinokitiol augmented p53 protein phosphorylation and subsequently led to enhanced p53 activity. Conclusions These data suggest that the anti-proliferative effects of hinokitiol in VSMCs may be mediated by activation of p21 and p53 signaling pathways, and it may contribute to the prevention of vascular diseases associated with VSMC proliferation. PMID:29765446

5-ASA affects cell cycle progression in colorectal cells by reversibly activating a replication checkpoint.

PubMed

Luciani, M Gloria; Campregher, Christoph; Fortune, John M; Kunkel, Thomas A; Gasche, Christoph

2007-01-01

Individuals with inflammatory bowel disease are at risk of developing colorectal cancer (CRC). Epidemiologic, animal, and laboratory studies suggest that 5-amino-salicylic acid (5-ASA) protects from the development of CRC by altering cell cycle progression and by inducing apoptosis. Our previous results indicate that 5-ASA improves replication fidelity in colorectal cells, an effect that is active in reducing mutations. In this study, we hypothesized that 5-ASA restrains cell cycle progression by activating checkpoint pathways in colorectal cell lines, which would prevent tumor development and improve genomic stability. CRC cells with different genetic backgrounds such as HT29, HCT116, HCT116(p53-/-), HCT116+chr3, and LoVo were treated with 5-ASA for 2-96 hours. Cell cycle progression, phosphorylation, and DNA binding of cell cycle checkpoint proteins were analyzed. We found that 5-ASA at concentrations between 10 and 40 mmol/L affects cell cycle progression by inducing cells to accumulate in the S phase. This effect was independent of the hMLH1, hMSH2, and p53 status because it was observed to a similar extent in all cell lines under investigation. Moreover, wash-out experiments demonstrated reversibility within 48 hours. Although p53 did not have a causative role, p53 Ser15 was strongly phosphorylated. Proteins involved in the ATM-and-Rad3-related kinase (ATR)-dependent S-phase checkpoint response (Chk1 and Rad17) were also phosphorylated but not ataxia telengectasia mutated kinase. Our data demonstrate that 5-ASA causes cells to reversibly accumulate in S phase and activate an ATR-dependent checkpoint. The activation of replication checkpoint may slow down DNA replication and improve DNA replication fidelity, which increases the maintenance of genomic stability and counteracts carcinogenesis.

Depletion of pro-oncogenic RUNX2 enhances gemcitabine (GEM) sensitivity of p53-mutated pancreatic cancer Panc-1 cells through the induction of pro-apoptotic TAp63.

PubMed

Ozaki, Toshinori; Nakamura, Mizuyo; Ogata, Takehiro; Sang, Meijie; Yoda, Hiroyuki; Hiraoka, Kiriko; Sang, Meixiang; Shimozato, Osamu

2016-11-01

Recently, we have described that siRNA-mediated silencing of runt-related transcription factor 2 (RUNX2) improves anti-cancer drug gemcitabine (GEM) sensitivity of p53-deficient human pancreatic cancer AsPC-1 cells through the augmentation of p53 family TAp63-dependent cell death pathway. In this manuscript, we have extended our study to p53-mutated human pancreatic cancer Panc-1 cells. According to our present results, knockdown of mutant p53 alone had a marginal effect on GEM-mediated cell death of Panc-1 cells. We then sought to deplete RUNX2 using siRNA in Panc-1 cells and examined its effect on GEM sensitivity. Under our experimental conditions, RUNX2 knockdown caused a significant enhancement of GEM sensitivity of Panc-1 cells. Notably, GEM-mediated induction of TAp63 but not of TAp73 was further stimulated in RUNX2-depleted Panc-1 cells, indicating that, like AsPC-1 cells, TAp63 might play a pivotal role in the regulation of GEM sensitivity of Panc-1 cells. Consistent with this notion, forced expression of TAp63α in Panc-1 cells promoted cell cycle arrest and/or cell death, and massively increased luciferase activities driven by TAp63-target gene promoters such as p21WAF1 and NOXA. In addition, immunoprecipitation experiments indicated that RUNX2 forms a complex with TAp63 in Panc-1 cells. Taken together, our current observations strongly suggest that depletion of RUNX2 enhances the cytotoxic effect of GEM on p53-mutated Panc-1 cells through the stimulation of TAp63-dependent cell death pathway even in the presence of a large amount of pro-oncogenic mutant p53, and might provide an attractive strategy to treat pancreatic cancer patients with p53 mutations.

Depletion of pro-oncogenic RUNX2 enhances gemcitabine (GEM) sensitivity of p53-mutated pancreatic cancer Panc-1 cells through the induction of pro-apoptotic TAp63

PubMed Central

Ozaki, Toshinori; Nakamura, Mizuyo; Ogata, Takehiro; Sang, Meijie; Yoda, Hiroyuki; Hiraoka, Kiriko; Sang, Meixiang; Shimozato, Osamu

2016-01-01

Recently, we have described that siRNA-mediated silencing of runt-related transcription factor 2 (RUNX2) improves anti-cancer drug gemcitabine (GEM) sensitivity of p53-deficient human pancreatic cancer AsPC-1 cells through the augmentation of p53 family TAp63-dependent cell death pathway. In this manuscript, we have extended our study to p53-mutated human pancreatic cancer Panc-1 cells. According to our present results, knockdown of mutant p53 alone had a marginal effect on GEM-mediated cell death of Panc-1 cells. We then sought to deplete RUNX2 using siRNA in Panc-1 cells and examined its effect on GEM sensitivity. Under our experimental conditions, RUNX2 knockdown caused a significant enhancement of GEM sensitivity of Panc-1 cells. Notably, GEM-mediated induction of TAp63 but not of TAp73 was further stimulated in RUNX2-depleted Panc-1 cells, indicating that, like AsPC-1 cells, TAp63 might play a pivotal role in the regulation of GEM sensitivity of Panc-1 cells. Consistent with this notion, forced expression of TAp63α in Panc-1 cells promoted cell cycle arrest and/or cell death, and massively increased luciferase activities driven by TAp63-target gene promoters such as p21WAF1 and NOXA. In addition, immunoprecipitation experiments indicated that RUNX2 forms a complex with TAp63 in Panc-1 cells. Taken together, our current observations strongly suggest that depletion of RUNX2 enhances the cytotoxic effect of GEM on p53-mutated Panc-1 cells through the stimulation of TAp63-dependent cell death pathway even in the presence of a large amount of pro-oncogenic mutant p53, and might provide an attractive strategy to treat pancreatic cancer patients with p53 mutations. PMID:27713122

Telomerase activation by the E6 gene product of human papillomavirus type 16.

PubMed

Klingelhutz, A J; Foster, S A; McDougall, J K

1996-03-07

Activation of telomerase, a ribonucleoprotein complex that synthesizes telomere repeat sequences, is linked to cell immortalization and is characteristic of most cell lines and tumours. Here we show that expression of the human papillomavirus type 16 (HPV-16) E6 protein activates telomerase in early-passage human keratinocytes and mammary epithelial cells. This activation was observed in cells pre-crisis, that is, before they became immortal, and occurred within one passage of retroviral infection with vectors expressing HPV-16 E6. Studies using HPV-16 E6 mutants showed that there was no correlation between the ability of the mutants to activate telomerase and their ability to target p53 for degradation, suggesting that telomerase activation by HPV-16 E6 is p53 independent. Keratinocytes expressing wild-type HPV-16 E6 have an extended lifespan, but do not become immortal, indicating that telomerase activation and E6-mediate degradation of p53 are insufficient for their immortalization. These results show that telomerase activation is an intrinsic, but insufficient, component of transformation by HPV.

p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

PubMed

Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

2018-03-06

Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

PubMed

De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

2017-05-01

Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Inositol pyrophosphates mediate the DNA-PK/ATM-p53 cell death pathway by regulating CK2 phosphorylation of Tti1/Tel2

PubMed Central

Rao, Feng; Cha, Jiyoung; Xu, Jing; Xu, Risheng; Vandiver, M. Scott; Tyagi, Richa; Tokhunts, Robert; Koldobskiy, Michael A.; Fu, Chenglai; Barrow, Roxanne; Wu, Mingxuan; Fiedler, Dorothea; Barrow, James C.; Snyder, Solomon H.

2014-01-01

The apoptotic actions of p53 require its phosphorylation by a family of phosphoinositide-3-kinase-related-kinases (PIKKs), which include DNA-PKcs and ATM. These kinases are stabilized by the TTT (Tel2, Tti1, Tti2) co-chaperone family, whose actions are mediated by CK2 phosphorylation. The inositol pyrophosphates, such as 5-diphosphoinositol pentakisphosphate (IP7), are generated by a family of inositol hexakisphosphate kinases (IP6Ks) of which IP6K2 has been implicated in p53-associated cell death. In the present study we report a novel apoptotic signaling cascade linking CK2, TTT, the PIKKs, and p53. We demonstrate that IP7, formed by IP6K2, binds CK2 to enhance its phosphorylation of the TTT complex thereby stabilizing DNA-PKcs and ATM. This process stimulates p53 phosphorylation at serine-15 to activate the cell death program in human cancer cells and in murine B cells. PMID:24657168

Various stress stimuli rewire the profile of liver secretome in a p53-dependent manner.

PubMed

Charni-Natan, Meital; Solomon, Hilla; Molchadsky, Alina; Jacob-Berger, Adi; Goldfinger, Naomi; Rotter, Varda

2018-05-29

Liver is an important secretory organ that consistently manages various insults in order to retain whole-body homeostasis. Importantly, it was suggested that the tumor-suppressor p53 plays a role in a variety of liver physiological processes and thus it is being regarded as a systemic homeostasis regulator. Using high-throughput mass spectrometric analysis, we identified various p53-dependent liver secretome profiles. This allowed a global view on the role of p53 in maintaining the harmony of liver and whole-body homeostasis. We found that p53 altered the liver secretome differently under various conditions. Under physiological conditions, p53 controls factors that are related mainly to lipid metabolism and injury response. Upon exposure to various types of cancer therapy agents, the hepatic p53 is activated and induces the secretion of proteins related to additional pathways, such as hemostasis, immune response, and cell adhesion. Interestingly, we identified a possible relationship between p53-dependent liver functions and lung tumors. The latter modify differently liver secretome profile toward the secretion of proteins mainly related to cell migration and immune response. The notion that p53 may rewire the liver secretome profile suggests a new non-cell autonomous role of p53 that affect different liver functions and whole organism homeostasis.

CITED2 silencing sensitizes cancer cells to cisplatin by inhibiting p53 trans-activation and chromatin relaxation on the ERCC1 DNA repair gene

PubMed Central

Liu, Yu-Chin; Chang, Pu-Yuan; Chao, Chuck C.-K.

2015-01-01

In this study, we show that silencing of CITED2 using small-hairpin RNA (shCITED2) induced DNA damage and reduction of ERCC1 gene expression in HEK293, HeLa and H1299 cells, even in the absence of cisplatin. In contrast, ectopic expression of ERCC1 significantly reduced intrinsic and induced DNA damage levels, and rescued the effects of CITED2 silencing on cell viability. The effects of CITED2 silencing on DNA repair and cell death were associated with p53 activity. Furthermore, CITED2 silencing caused severe elimination of the p300 protein and markers of relaxed chromatin (acetylated H3 and H4, i.e. H3K9Ac and H3K14Ac) in HEK293 cells. Chromatin immunoprecipitation assays further revealed that DNA damage induced binding of p53 along with H3K9Ac or H3K14Ac at the ERCC1 promoter, an effect which was almost entirely abrogated by silencing of CITED2 or p300. Moreover, lentivirus-based CITED2 silencing sensitized HeLa cell line-derived tumor xenografts to cisplatin in immune-deficient mice. These results demonstrate that CITED2/p300 can be recruited by p53 at the promoter of the repair gene ERCC1 in response to cisplatin-induced DNA damage. The CITED2/p300/p53/ERCC1 pathway is thus involved in the cell response to cisplatin and represents a potential target for cancer therapy. PMID:26384430

HIPK2 modulates p53 activity towards pro-apoptotic transcription.

PubMed

Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

2009-10-14

Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.

WIP1 deficiency inhibits HTLV-1 Tax oncogenesis: novel therapeutic prospects for treatment of ATL?

PubMed Central

2012-01-01

Attenuation of p53 activity appears to be a major step in Human T-lymphotropic virus type 1 (HTLV-1) Tax transformation. However, p53 genomic mutations are late and rather infrequent events in HTLV-1 induced Adult T cell leukemia (ATL). The paper by Zane et al. shows that a mediator of p53 activity, Wild-type p53-induced phosphatase 1 (Wip1), contributes to Tax-induced oncogenesis in a mouse model. Wip1 may therefore be a novel target for therapeutic approaches. PMID:23256570

p53 and Ca(2+) signaling from the endoplasmic reticulum: partners in anti-cancer therapies.

PubMed

Bittremieux, Mart; Bultynck, Geert

2015-01-01

Ca(2+) transfer from the endoplasmic reticulum (ER) to the mitochondria critically controls cell survival and cell death decisions. Different oncogenes and deregulation of tumor suppressors exploit this mechanism to favor the survival of altered, malignant cells. Two recent studies of the Pinton team revealed a novel, non-transcriptional function of cytosolic p53 in cell death. During cell stress, p53 is recruited to the ER and the ER-mitochondrial contact sites. This results in augmented ER Ca(2+) levels by enhancing sarco/endoplasmic reticulum Ca(2+) ATPase (SERCA) activity, ultimately promoting mitochondrial Ca(2+) overload. The boosting of "toxic" Ca(2+) signaling by p53 appears to be a critical component of the cell death-inducing properties of chemotherapeutic agents and anti-cancer treatments, like photodynamic stress. Strikingly, the resistance of p53-deficient cancer cells to these treatments could be overcome by facilitating Ca(2+) transfer between the ER and the mitochondria via overexpression of SERCA or of the mitochondrial Ca(2+) uniporter (MCU). Importantly, these concepts have also been supported by in vivo Ca(2+) measurements in tumor masses in mice. Collectively, these studies link for the first time the major tumor suppressor, p53, to Ca(2+) signaling in dictating cell-death outcomes and by the success of anti-cancer treatments.

Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.

PubMed

Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C

2017-12-01

Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Quercetin Enhances the Antitumor Activity of Trichostatin A through Upregulation of p53 Protein Expression In Vitro and In Vivo

PubMed Central

Chan, Shu-Ting; Yang, Nae-Cherng; Huang, Chin-Shiu; Liao, Jiunn-Wang; Yeh, Shu-Lan

2013-01-01

This study investigated the effects of quercetin on the anti-tumor effect of trichostatin A (TSA), a novel anticancer drug, in vitro and in vivo and the possible mechanisms of these effects in human lung cancer cells. We first showed that quercetin (5 µM) significantly increased the growth arrest and apoptosis in A549 cells (expressing wild-type p53) induced by 25 ng/mL of (82.5 nM) TSA at 48 h by about 25% and 101%, respectively. However, such enhancing effects of quercetin (5 µM) were not significant in TSA-exposed H1299 cells (a p53 null mutant) or were much lower than in A549 cells. In addition, quercetin significantly increased TSA-induced p53 expression in A549 cells. Transfection of p53 siRNA into A549 cells significantly but not completely diminished the enhancing effects of quercetin on TSA-induced apoptosis. Furthermore, we demonstrated that quercetin enhanced TSA-induced apoptosis through the mitochondrial pathway. Transfection of p53 siRNA abolished such enhancing effects of quercetin. However, quercetin increased the acetylation of histones H3 and H4 induced by TSA in A549 cells, even with p53 siRNA transfection as well as in H1299 cells. In a xenograft mouse model of lung cancer, quercetin enhanced the antitumor effect of TSA. Tumors from mice treated with TSA in combination with quercetin had higher p53 and apoptosis levels than did those from control and TSA-treated mice. These data indicate that regulation of the expression of p53 by quercetin plays an important role in enhancing TSA-induced apoptosis in A549 cells. However, p53-independent mechanisms may also contribute to the enhancing effect of quercetin. PMID:23342112

PARP1 expression, activity and ex vivo sensitivity to the PARP inhibitor, talazoparib (BMN 673), in chronic lymphocytic leukaemia

PubMed Central

Herriott, Ashleigh; Tudhope, Susan J.; Junge, Gesa; Rodrigues, Natalie; Patterson, Miranda J.; Woodhouse, Laura; Lunec, John; Hunter, Jill E.; Mulligan, Evan A.; Cole, Michael; Allinson, Lisa M.; Wallis, Jonathan P.; Marshall, Scott; Wang, Evelyn; Curtin, Nicola J.; Willmore, Elaine

2015-01-01

In chronic lymphocytic leukemia (CLL), mutation and loss of p53 and ATM abrogate DNA damage signalling and predict poorer response and shorter survival. We hypothesised that poly (ADP-ribose) polymerase (PARP) activity, which is crucial for repair of DNA breaks induced by oxidative stress or chemotherapy, may be an additional predictive biomarker and a target for therapy with PARP inhibitors. We measured PARP activity in 109 patient-derived CLL samples, which varied widely (192 – 190052 pmol PAR/106 cells) compared to that seen in healthy volunteer lymphocytes (2451 – 7519 pmol PAR/106 cells). PARP activity was associated with PARP1 protein expression and endogenous PAR levels. PARP activity was not associated with p53 or ATM loss, Binet stage, IGHV mutational status or survival, but correlated with Bcl-2 and Rel A (an NF-kB subunit). Levels of 8-hydroxy-2′-deoxyguanosine in DNA (a marker of oxidative damage) were not associated with PAR levels or PARP activity. The potent PARP inhibitor, talazoparib (BMN 673), inhibited CD40L-stimulated proliferation of CLL cells at nM concentrations, independently of Binet stage or p53/ATM function. PARP activity is highly variable in CLL and correlates with stress-induced proteins. Proliferating CLL cells (including those with p53 or ATM loss) are highly sensitive to the PARP inhibitor talazoparib. PMID:26539646

Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

PubMed

Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

2017-04-01

Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 <3.0 μmol/l) were identified within established (4/9) and primary patient-derived (2/5) CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or oxaliplatin to enhance the antiproliferative response to both chemotherapeutic agents. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

PubMed

Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

2017-05-09

Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

Janus face-like effects of Aurora B inhibition: antitumoral mode of action versus induction of aneuploid progeny.

PubMed

Wiedemuth, Ralf; Klink, Barbara; Fujiwara, Mamoru; Schröck, Evelin; Tatsuka, Masaaki; Schackert, Gabriele; Temme, Achim

2016-10-01

The mitotic Aurora B kinase is overexpressed in tumors and various inhibitors for Aurora B are currently under clinical assessments. However, when considering Aurora B kinase inhibitors as anticancer drugs, their mode of action and the role of p53 status as a possible predictive factor for response still needs to be investigated. In this study, we analyzed the effects of selective Aurora B inhibition using AZD1152-HQPA/Barasertib (AZD1152) on HCT116 cells, U87-MG, corresponding isogenic p53-deficient cells and a primary glioblastoma cell line. AZD1152 treatment caused polyploidy and non-apoptotic cell death in all cell lines irrespective of p53 status and was accompanied by poly-merotelic kinetochore-microtubule attachments and DNA damage. In p53 wild-type cells a DNA damage response induced an inefficient pseudo-G1 cell cycle arrest, which was not able to halt ongoing endoreplication of cells. Of note, release of tumor cells from AZD1152 resulted in recovery of aneuploid progenies bearing numerical and structural chromosomal aberrations. Yet, AZD1152 treatment enhanced death receptor TRAIL-R2 levels in all tumor cell lines investigated. A concomitant increase of the activating natural killer (NK) cell ligand MIC A/B in p53-deficient cells and an induction of FAS/CD95 in cells containing p53 rendered AZD1152-treated cells more susceptible for NK-cell-mediated lysis. Our study mechanistically explains a p53-independent mode of action of a chemical Aurora B inhibitor and suggests a potential triggering of antitumoral immune responses, following polyploidization of tumor cells, which might constrain recovery of aneuploid tumor cells. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Genetic inactivation of the transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis.

PubMed

Yuan, Xuejun; Zhou, Yonggang; Casanova, Emilio; Chai, Minqiang; Kiss, Eva; Gröne, Hermann-Josef; Schütz, Günter; Grummt, Ingrid

2005-07-01

Growth-dependent regulation of rRNA synthesis is mediated by TIF-IA, a basal transcription initiation factor for RNA polymerase I. We inactivated the murine TIF-IA gene by homologous recombination in mice and embryonic fibroblasts (MEFs). TIF-IA-/- embryos die before or at embryonic day 9.5 (E9.5), displaying retardation of growth and development. In MEFs, Cre-mediated depletion of TIF-IA leads to disruption of nucleoli, cell cycle arrest, upregulation of p53, and induction of apoptosis. Elevated levels of p53 after TIF-IA depletion are due to increased binding of ribosomal proteins, such as L11, to MDM2 and decreased interaction of MDM2 with p53 and p19(ARF). RNAi-induced loss of p53 overcomes proliferation arrest and apoptosis in response to TIF-IA ablation. The striking correlation between perturbation of nucleolar function, elevated levels of p53, and induction of cell suicide supports the view that the nucleolus is a stress sensor that regulates p53 activity.

Magnolol inhibits growth of gallbladder cancer cells through the p53 pathway

PubMed Central

Li, Maolan; Zhang, Fei; Wang, Xu’an; Wu, Xiangsong; Zhang, Bingtai; Zhang, Ning; Wu, Wenguang; Wang, Zheng; Weng, Hao; Liu, Shibo; Gao, Guofeng; Mu, Jiasheng; Shu, Yijun; Bao, Runfa; Cao, Yang; Lu, Jianhua; Gu, Jun; Zhu, Jian; Liu, Yingbin

2015-01-01

Magnolol, the major active compound found in Magnolia officinalis has a wide range of clinical applications due to its anti-inflammation and anti-oxidation effects. This study investigated the effects of magnolol on the growth of human gallbladder carcinoma (GBC) cell lines. The results indicated that magnolol could significantly inhibit the growth of GBC cell lines in a dose- and time-dependent manner. Magnolol also blocked cell cycle progression at G0/G1 phase and induced mitochondrial-related apoptosis by upregulating p53 and p21 protein levels and by downregulating cyclin D1, CDC25A, and Cdk2 protein levels. When cells were pretreated with a p53 inhibitor (pifithrin-a), followed by magnolol treatment, pifithrin-a blocked magnolol-induced apoptosis and G0/G1 arrest. In vivo, magnolol suppressed tumor growth and activated the same mechanisms as were activated in vitro. In conclusion, our study is the first to report that magnolol has an inhibitory effect on the growth of GBC cells and that this compound may have potential as a novel therapeutic agent for the treatment of GBC. PMID:26250568

IKK is a therapeutic target in KRAS-Induced lung cancer with disrupted p53 activity.

PubMed

Bassères, Daniela S; Ebbs, Aaron; Cogswell, Patricia C; Baldwin, Albert S

2014-04-01

Activating mutations in KRAS are prevalent in cancer, but therapies targeted to oncogenic RAS have been ineffective to date. These results argue that targeting downstream effectors of RAS will be an alternative route for blocking RAS-driven oncogenic pathways. We and others have shown that oncogenic RAS activates the NF-κB transcription factor pathway and that KRAS-induced lung tumorigenesis is suppressed by expression of a degradation-resistant form of the IκBα inhibitor or by genetic deletion of IKKβ or the RELA/p65 subunit of NF-κB. Here, genetic and pharmacological approaches were utilized to inactivate IKK in human primary lung epithelial cells transformed by KRAS, as well as KRAS mutant lung cancer cell lines. Administration of the highly specific IKKβ inhibitor Compound A (CmpdA) led to NF-κB inhibition in different KRAS mutant lung cells and siRNA-mediated knockdown of IKKα or IKKβ reduced activity of the NF-κB canonical pathway. Next, we determined that both IKKα and IKKβ contribute to oncogenic properties of KRAS mutant lung cells, particularly when p53 activity is disrupted. Based on these results, CmpdA was tested for potential therapeutic intervention in the Kras-induced lung cancer mouse model (LSL-Kras (G12D)) combined with loss of p53 (LSL-Kras (G12D)/p53 (fl/fl)). CmpdA treatment was well tolerated and mice treated with this IKKβ inhibitor presented smaller and lower grade tumors than mice treated with placebo. Additionally, IKKβ inhibition reduced inflammation and angiogenesis. These results support the concept of targeting IKK as a therapeutic approach for oncogenic RAS-driven tumors with altered p53 activity.

Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

PubMed

Stępiński, Dariusz

2016-08-01

Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hongling; Huang, Yong; Du, Qian

Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells inmore » a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.« less

PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu Dehua; Fan, Wufang; Liu, Guohong

2006-04-01

HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showedmore » that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties.« less

Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity

PubMed Central

Kaller, Markus; Götz, Ursula; Hermeking, Heiko

2017-01-01

We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524

Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

PubMed Central

Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

2014-01-01

Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

Vernolide-A, a sesquiterpene lactone from Vernonia cinerea, induces apoptosis in B16F-10 melanoma cells by modulating p53 and caspase-3 gene expressions and regulating NF-κB-mediated bcl-2 activation.

PubMed

Pratheeshkumar, Poyil; Kuttan, Girija

2011-07-01

In this study, we investigated the effect of vernolide-A on the induction of apoptosis as well as its regulatory effect on the activation of transcription factors in B16F-10 melanoma cells. Treatment of B16F-10 cells with nontoxic concentrations of vernolide-A showed the presence of apoptotic bodies and induced DNA fragmentation in a dose-dependent manner. Cell-cycle analysis and TUNEL assays also confirmed the observation. The proapoptotic genes, p53, Bax, caspase-9, and caspase-3, were upregulated in vernolide-A-treated cells, whereas the antiapoptotic gene, Bcl-2, was downregulated. vernolide-A treatment also showed a downregulation of cyclin D1 expression and upregulated p21 and p27 gene expression in B16F-10 melanoma cells. The study also reveals that vernolide-A treatment could alter the production and expression of proinflammatory cytokines and could inhibit the activation and nuclear translocation of p65, p50, and c-Rel subunits of nuclear factor-κB and other transcription factors, such as c-fos, activated transcription factor-2, and cyclic adenosine monophosphate response-element-binding protein in B16F-10 melanoma cells. These results suggest that vernolide-A induces apoptosis via activation of p53-induced, caspase-3-mediated proapoptotic signaling and suppression of NF-κB-induced, bcl-2-mediated survival signaling.

A tryptophanol-derived oxazolopiperidone lactam is cytotoxic against tumors via inhibition of p53 interaction with murine double minute proteins.

PubMed

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A L; dos Santos, Daniel J V A; Pérez, Maria; Queiroz, Glória; Leão, Mariana; Santos, Maria M M; Saraiva, Lucília

2015-01-01

Inactivation of the p53 tumor suppressor protein by interaction with murine double minute (MDM) proteins, MDM2 and MDMX, is a common event in human tumors expressing wild-type p53. In these tumors, the simultaneous inhibition of these interactions with MDMs, for a full p53 reactivation, represents a promising anticancer strategy. Herein, we report the identification of a dual inhibitor of the p53 interaction with MDM2 and MDMX, the (S)-tryptophanol derivative OXAZ-1, from the screening of a small library of enantiopure tryptophanol-derived oxazolopiperidone lactams, using a yeast-based assay. With human colon adenocarcinoma HCT116 cell lines expressing wild-type p53 (HCT116 p53(+/+)) and its p53-null isogenic derivative (HCT116 p53(-/-)), it was shown that OXAZ-1 induced a p53-dependent tumor growth-inhibitory effect. In fact, OXAZ-1 induced p53 stabilization, up-regulated p53 transcription targets, such as MDM2, MDMX, p21, Puma and Bax, and led to PARP cleavage, in p53(+/+), but not in p53(-/-), HCT116 cells. In addition, similar tumor cytotoxic effects were observed for OXAZ-1 against MDMX-overexpressing breast adenocarcinoma MCF-7 tumor cells, commonly described as highly resistant to MDM2-only inhibitors. In HCT116 p53(+/+) cells, the disruption of the p53 interaction with MDMs by OXAZ-1 was further confirmed by co-immunoprecipitation. It was also shown that OXAZ-1 potently triggered a p53-dependent mitochondria-mediated apoptosis, characterized by reactive oxygen species generation, mitochondrial membrane potential dissipation, Bax translocation to mitochondria, and cytochrome c release, and exhibited a p53-dependent synergistic effect with conventional chemotherapeutic drugs. Collectively, in this work, a novel selective activator of the p53 pathway is reported with promising antitumor properties to be explored either alone or combined with conventional chemotherapeutic drugs. Moreover, OXAZ-1 may represent a promising starting scaffold to search for new dual inhibitors of the p53-MDMs interaction. Copyright © 2015 Elsevier Ltd. All rights reserved.

Bax/Bak activation in the absence of Bid, Bim, Puma, and p53

PubMed Central

Zhang, J; Huang, K; O'Neill, K L; Pang, X; Luo, X

2016-01-01

How BH3-only proteins activate Bax/Bak, the two gateway proteins of the mitochondria-dependent apoptotic pathway, remains incompletely understood. Although all pro-apoptotic BH3-only proteins are known to bind/neutralize the anti-apoptotic Bcl-2 proteins, the three most potent ones, Bid (tBid), Bim, and Puma, possess an additional activity of directly activating Bax/Bak in vitro. This latter activity has been proposed to be responsible for triggering Bax/Bak activation following apoptotic stimulation. To test this hypothesis, we generated Bid−/−Bim−/−Puma−/− (TKO), TKO/Bax−/−/Bak−/− (PentaKO), and PentaKO/Mcl-1−/− (HexaKO) HCT116 cells through gene editing. Surprisingly, although the TKO cells were resistant to several apoptotic stimuli, robust apoptosis was induced upon the simultaneous inactivation of Bcl-xL and Mcl-1, two anti-apoptotic Bcl-2 proteins known to suppress Bax/Bak activation and activity. Importantly, such apoptotic activity was completely abolished in the PentaKO cells. In addition, ABT-737, a BH3 mimetic that inhibits Bcl-xL/Bcl-w/Bcl-2, induced Bax activation in HexaKO cells reconstituted with endogenous level of GFP-Bax. Further, by generating TKO/p53−/− (QKO) cells, we demonstrated that p53, a tumor suppressor postulated to directly activate Bax, is not required for Bid/Bim/Puma-independent Bax/Bak activation. Together, these results strongly suggest that the direct activation activities of Bid (tBid), Bim, Puma, and p53 are not essential for activating Bax/Bak once the anti-apoptotic Bcl-2 proteins are neutralized. PMID:27310874

Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer

PubMed Central

Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel

2016-01-01

Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766

Non-Thermal Atmospheric Pressure Plasma Preferentially Induces Apoptosis in p53-Mutated Cancer Cells by Activating ROS Stress-Response Pathways

PubMed Central

Ma, Yonghao; Ha, Chang Seung; Hwang, Seok Won; Lee, Hae June; Kim, Gyoo Cheon; Lee, Kyo-Won; Song, Kiwon

2014-01-01

Non-thermal atmospheric pressure plasma (NTAPP) is an ionized gas at room temperature and has potential as a new apoptosis-promoting cancer therapy that acts by generating reactive oxygen species (ROS). However, it is imperative to determine its selectivity and standardize the components and composition of NTAPP. Here, we designed an NTAPP-generating apparatus combined with a He gas feeding system and demonstrated its high selectivity toward p53-mutated cancer cells. We first determined the proper conditions for NTAPP exposure to selectively induce apoptosis in cancer cells. The apoptotic effect of NTAPP was greater for p53-mutated cancer cells; artificial p53 expression in p53-negative HT29 cells decreased the pro-apoptotic effect of NTAPP. We also examined extra- and intracellular ROS levels in NTAPP-treated cells to deduce the mechanism of NTAPP action. While NTAPP-mediated increases in extracellular nitric oxide (NO) did not affect cell viability, intracellular ROS increased under NTAPP exposure and induced apoptotic cell death. This effect was dose-dependently reduced following treatment with ROS scavengers. NTAPP induced apoptosis even in doxorubicin-resistant cancer cell lines, demonstrating the feasibility of NTAPP as a potent cancer therapy. Collectively, these results strongly support the potential of NTAPP as a selective anticancer treatment, especially for p53-mutated cancer cells. PMID:24759730

Gamma rays induce a p53-independent mitochondrial biogenesis that is counter-regulated by HIF1α

PubMed Central

Bartoletti-Stella, A; Mariani, E; Kurelac, I; Maresca, A; Caratozzolo, M F; Iommarini, L; Carelli, V; Eusebi, L H; Guido, A; Cenacchi, G; Fuccio, L; Rugolo, M; Tullo, A; Porcelli, A M; Gasparre, G

2013-01-01

Mitochondrial biogenesis is an orchestrated process that presides to the regulation of the organelles homeostasis within a cell. We show that γ-rays, at doses commonly used in the radiation therapy for cancer treatment, induce an increase in mitochondrial mass and function, in response to a genotoxic stress that pushes cells into senescence, in the presence of a functional p53. Although the main effector of the response to γ-rays is the p53-p21 axis, we demonstrated that mitochondrial biogenesis is only indirectly regulated by p53, whose activation triggers a murine double minute 2 (MDM2)-mediated hypoxia-inducible factor 1α (HIF1α) degradation, leading to the release of peroxisome-proliferator activated receptor gamma co-activator 1β inhibition by HIF1α, thus promoting mitochondrial biogenesis. Mimicking hypoxia by HIF1α stabilization, in fact, blunts the mitochondrial response to γ-rays as well as the induction of p21-mediated cell senescence, indicating prevalence of the hypoxic over the genotoxic response. Finally, we also show in vivo that post-radiotherapy mitochondrial DNA copy number increase well correlates with lack of HIF1α increase in the tissue, concluding this may be a useful molecular tool to infer the trigger of a hypoxic response during radiotherapy, which may lead to failure of activation of cell senescence. PMID:23764844

Transactivation of bad by vorinostat-induced acetylated p53 enhances doxorubicin-induced cytotoxicity in cervical cancer cells.

PubMed

Lee, Sook-Jeong; Hwang, Sung-Ook; Noh, Eun Joo; Kim, Dong-Uk; Nam, Miyoung; Kim, Jong Hyeok; Nam, Joo Hyun; Hoe, Kwang-Lae

2014-02-14

Vorinostat (VOR) has been reported to enhance the cytotoxic effects of doxorubicin (DOX) with fewer side effects because of the lower DOX dosage in breast cancer cells. In this study, we investigated the novel mechanism underlying the synergistic cytotoxic effects of VOR and DOX co-treatment in cervical cancer cells HeLa, CaSki and SiHa cells. Co-treatment with VOR and DOX at marginal doses led to the induction of apoptosis through caspase-3 activation, poly (ADP-ribose) polymerase cleavage and DNA micronuclei. Notably, the synergistic growth inhibition induced by the co-treatment was attributed to the upregulation of the pro-apoptotic protein Bad, as the silencing of Bad expression using small interfering RNA (siRNA) abolished the phenomenon. As siRNA against p53 did not result in an increase in acetylated p53 and the consequent upregulation of Bad, the observed Bad upregulation was mediated by acetylated p53. Moreover, a chromatin immunoprecipitation analysis showed that the co-treatment of HeLa cells with VOR and DOX increased the recruitment of acetylated p53 to the bad promoter, with consequent bad transactivation. Conversely, C33A cervical cancer cells containing mutant p53 co-treated with VOR and DOX did not exhibit Bad upregulation, acetylated p53 induction or consequent synergistic growth inhibition. Together, the synergistic growth inhibition of cervical cancer cell lines induced by co-treatment with VOR and DOX can be attributed to the upregulation of Bad, which is induced by acetylated p53. These results show for the first time that the acetylation of p53, rather than histones, is a mechanism for the synergistic growth inhibition induced by VOR and DOX co-treatments.

Somatotropinomas, but not nonfunctioning pituitary adenomas, maintain a functional apoptotic RET/Pit1/ARF/p53 pathway that is blocked by excess GDNF.

PubMed

Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V

2014-11-01

Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in acromegaly.

Strategy to enhance efficacy of doxorubicin in solid tumor cells by methyl-β-cyclodextrin: Involvement of p53 and Fas receptor ligand complex

PubMed Central

Mohammad, Naoshad; Vikram Singh, Shivendra; Malvi, Parmanand; Chaube, Balkrishna; Athavale, Dipti; Vanuopadath, Muralidharan; Nair, Sudarslal Sadasivan; Nair, Bipin; Bhat, Manoj Kumar

2015-01-01

Doxorubicin (DOX) is one of the preferred drugs for treating breast and liver cancers. However, its clinical application is limited due to severe side effects and the accompanying drug resistance. In this context, we investigated the effect on therapeutic efficacy of DOX by cholesterol depleting agent methyl-β-cyclodextrin (MCD), and explored the involvement of p53. MCD sensitizes MCF-7 and Hepa1–6 cells to DOX, Combination of MCD and marginal dose of DOX reduces the cell viability, and promoted apoptosis through induction of pro-apoptotic protein, Bax, activation of caspase-8 and caspase-7, down regulation of anti-apoptotic protein Bcl-2 and finally promoting PARP cleavage. Mechanistically, sensitization to DOX by MCD was due to the induction of FasR/FasL pathway through p53 activation. Furthermore, inhibition of p53 by pharmacological inhibitor pifithrin-α (PFT-α) or its specific siRNA attenuated p53 function and down-regulated FasR/FasL, thereby preventing cell death. Animal experiments were performed using C57BL/6J mouse isografted with Hepa1–6 cells. Tumor growth was retarded and survival increased in mice administered MCD together with DOX to as compared to either agent alone. Collectively, these results suggest that MCD enhances the sensitivity to DOX for which wild type p53 is an important determinant. PMID:26149967

Lithocholic acid is an endogenous inhibitor of MDM4 and MDM2

PubMed Central

Vogel, Simon M.; Bauer, Matthias R.; Joerger, Andreas C.; Wilcken, Rainer; Brandt, Tobias; Veprintsev, Dmitry B.; Rutherford, Trevor J.; Fersht, Alan R.; Boeckler, Frank M.

2012-01-01

The proteins MDM2 and MDM4 are key negative regulators of the tumor suppressor protein p53, which are frequently upregulated in cancer cells. They inhibit the transactivation activity of p53 by binding separately or in concert to its transactivation domain. MDM2 is also a ubiquitin ligase that leads to the degradation of p53. Accordingly, MDM2 and MDM4 are important targets for drugs to inhibit their binding to p53. We found from in silico screening and confirmed by experiment that lithocholic acid (LCA) binds to the p53 binding sites of both MDM2 and MDM4 with a fivefold preference for MDM4. LCA is an endogenous steroidal bile acid, variously reported to have both carcinogenic and apoptotic activities. The comparison of LCA effects on apoptosis in HCT116 p53+/+ vs. p53-/- cells shows a predominantly p53-mediated induction of caspase-3/7. The dissociation constants are in the μM region, but only modest inhibition of binding of MDM2 and MDM4 is required to negate their upregulation because they have to compete with transcriptional coactivator p300 for binding to p53. Binding was weakened by structural changes in LCA, and so it may be a natural ligand of MDM2 and MDM4, raising the possibility that MDM proteins may be sensors for specific steroids. PMID:23035244

Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

PubMed

Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

2014-12-01

Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

The depletion of ATM inhibits colon cancer proliferation and migration via B56γ2-mediated Chk1/p53/CD44 cascades.

PubMed

Liu, Rui; Tang, Jiajia; Ding, Chaodong; Liang, Weicheng; Zhang, Li; Chen, Tianke; Xiong, Yan; Dai, Xiaowei; Li, Wenfeng; Xu, Yunsheng; Hu, Jin; Lu, Liting; Liao, Wanqin; Lu, Xincheng

2017-04-01

Ataxia-telangiectasia mutated (ATM) protein kinase is a major guardian of genomic stability, and its well-established function in cancer is tumor suppression. Here, we report an oncogenic role of ATM. Using two isogenic sets of human colon cancer cell lines that differed only in their ATM status, we demonstrated that ATM deficiency significantly inhibits cancer cell proliferation, migration, and invasion. The tumor-suppressive function of ATM depletion is not modulated by the compensatory activation of ATR, but it is associated with B56γ2-mediated Chk1/p53/CD44 signaling pathways. Under normal growth conditions, the depletion of ATM prevents B56γ2 ubiquitination and degradation, which activates PP2A-mediated Chk1/p53/p21 signaling pathways, leading to senescence and cell cycle arrest. CD44 was validated as a novel ATM target based on its ability to rescue cell migration and invasion defects in ATM-depleted cells. The activation of p53 induced by ATM depletion suppresses CD44 transcription, thus resulting in epithelial-mesenchymal transition (EMT) and cell migration suppression. Our study suggests that ATM has tumorigenic potential in post-formed colon neoplasia, and it supports ATM as an appealing target for improving cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

p63 and p73 coordinate p53 function to determine the balance between survival, cell death, and senescence in adult neural precursor cells

PubMed Central

Fatt, M P; Cancino, G I; Miller, F D; Kaplan, D R

2014-01-01

The p53 family members p73 and p63 have been implicated in various aspects of stem cell regulation. Here, we have asked whether they work together to regulate stem cell biology, focusing upon neural precursor cells (NPCs) in the adult murine brain. By studying mice that are haploinsufficient for p63 and/or p73, we show that these two proteins cooperate to ensure appropriate NPC self-renewal and long-term maintenance in the hippocampus and forebrain, and that when both are haploinsufficient, the NPC deficits are significantly greater than haploinsufficiency for either alone. We show that, in the case of p63+/− mice, this decrease in adult NPCs is caused by enhanced apoptosis. However, when p73 is coincidently haploinsufficient, this rescues the enhanced apoptosis of p63+/− NPCs under both basal conditions and following genotoxic stress, instead causing increased cellular senescence. This increase in cellular senescence is likely due, at least in part, to increased levels of basal DNA damage and p53 activation, as genetic ablation of p53 completely rescues the senescence phenotype observed in p63+/−; p73+/− mice. Thus, the presence of p73 determines whether p63+/− NPCs exhibit increased p53-dependent apoptosis or senescence. Together, these studies demonstrate that p63 and p73 cooperate to maintain adult NPC pools through regulation of p53 function; p63 antagonizes p53 to promote cellular survival, whereas p73 regulates self-renewal and p53-mediated apoptosis versus senescence. PMID:24809925

Honokiol induces autophagic cell death in malignant glioma through reactive oxygen species-mediated regulation of the p53/PI3K/Akt/mTOR signaling pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Chien-Ju

Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- andmore » time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS participates in honokiol-induced cell death through the p53-mediated signaling pathway. • Honokiol induces ROS-mediated autophagic cell death via the p53/PI3K/Akt/mTOR mechanism.« less

Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

2013-01-01

Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

New Treatment Options for Osteosarcoma - Inactivation of Osteosarcoma Cells by Cold Atmospheric Plasma.

PubMed

Gümbel, Denis; Gelbrich, Nadine; Weiss, Martin; Napp, Matthias; Daeschlein, Georg; Sckell, Axel; Ender, Stephan A; Kramer, Axel; Burchardt, Martin; Ekkernkamp, Axel; Stope, Matthias B

2016-11-01

Cold atmospheric plasma has been shown to inhibit tumor cell growth and induce tumor cell death. The aim of the study was to investigate the effects of cold atmospheric plasma treatment on proliferation of human osteosarcoma cells and to characterize the underlying cellular mechanisms. Human osteosarcoma cells (U2-OS and MNNG/HOS) were treated with cold atmospheric plasma and seeded in culture plates. Cell proliferation, p53 and phospho-p53 protein expression and nuclear morphology were assessed. The treated human osteosarcoma cell lines exhibited attenuated proliferation rates by up to 66%. The cells revealed an induction of p53, as well as phospho-p53 expression, by 2.3-fold and 4.5-fold, respectively, compared to controls. 4',6-diamidino-2-phenylindole staining demonstrated apoptotic nuclear condensation following cold atmospheric plasma treatment. Cold atmospheric plasma treatment significantly attenuated cell proliferation in a preclinical in vitro osteosarcoma model. The resulting increase in p53 expression and phospho-activation in combination with characteristic nuclear changes indicate this was through induction of apoptosis. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Therapeutic inhibition of the MDM2-p53 interaction prevents recurrence of adenoid cystic carcinomas

PubMed Central

Nör, Felipe; Warner, Kristy A.; Zhang, Zhaocheng; Acasigua, Gerson A.; Pearson, Alexander T.; Kerk, Samuel A.; Helman, Joseph; Filho, Manoel Sant’Ana; Wang, Shaomeng; Nör, Jacques E.

2016-01-01

Purpose Conventional chemotherapy has modest efficacy in advanced adenoid cystic carcinomas (ACC). Tumor recurrence is a major challenge in the management of ACC patients. Here, we evaluated the anti-tumor effect of a novel small molecule inhibitor of the MDM2-p53 interaction (MI-773) combined with Cisplatin in patient-derived xenograft (PDX) ACC tumors. Experimental design Therapeutic strategies with MI-773 and/or Cisplatin were evaluated in SCID mice harboring PDX ACC tumors (UM-PDX-HACC-5) and in low passage primary human ACC cells (UM-HACC-2A, -2B, -5, -6) in vitro. The effect of therapy on the fraction of cancer stem cells was determined by flow cytometry for ALDH activity and CD44 expression. Results Combined therapy with MI-773 with Cisplatin caused p53 activation, induction of apoptosis, and regression of ACC PDX tumors. Western blots revealed induction of MDM2, p53 and downstream p21 expression, and regulation of apoptosis-related proteins PUMA, BAX, Bcl-2, Bcl-xL and active Caspase-9 upon MI-773 treatment. Both, single-agent MI-773, and MI-773 combined with Cisplatin, decreased the fraction of cancer stem cells in PDX ACC tumors. Notably, neoadjuvant MI-773 and surgery eliminated tumor recurrences during a post-surgical follow-up of more than 300 days. In contrast, 62.5% of mice that received vehicle control presented with palpable tumor recurrences within this time period (p=0.0097). Conclusions Collectively, these data demonstrate that therapeutic inhibition of MDM2-p53 interaction by MI-773 decreased the cancer stem cell fraction, sensitized ACC xenograft tumors to Cisplatin, and eliminated tumor recurrence. These results suggest that patients with ACC might benefit from the therapeutic inhibition of the MDM2-p53 interaction. PMID:27550999

p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis

PubMed Central

Napoletano, Francesco; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Chatelain, Gilles; Walter, Ludivine; Arama, Eli

2017-01-01

The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis. PMID:28945745

Cnidium officinale Makino extract induces apoptosis through activation of caspase-3 and p53 in human liver cancer HepG2 cells

PubMed Central

Hong, Heeok; An, Jeong Cheol; de La Cruz, Joseph F.; Hwang, Seong-Gu

2017-01-01

A number of diverse studies have reported the anticancer properties of Cnidium officinale Makino (CO). However, the apoptotic effect of this traditional medicinal herb in human hepatocellular carcinoma cells (HepG2) remains to be elucidated. Therefore, the present study investigated the ability of CO to reduce cell viability through apoptotic pathways. Cell viability was determined using the 2,3-bis [2-methyloxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide assay. CO extract-induced apoptosis in HepG2 cells was assessed by Hoechst 33258 staining. The cell cycle was monitored using fluorescence-activated cell sorting analysis with propidium iodide staining. Furthermore, the present study explored whether various signaling molecules associated with HepG2 cell death were affected by CO treatment, including caspase-3, B-cell lymphoma 2 (Bcl-2), tumor protein p53 (p53), cyclin-dependent kinase 4 (CDK4) and cyclin D. The expression levels of these genes were examined by reverse-transcription polymerase chain reaction and western blotting. The expression levels of caspase-3 and p53 were upregulated with CO extract treatment, whereas those of Bcl-2, CDK4 and cyclin D were significantly downregulated. Cleaved caspase-3 expression was upregulated following treatment with CO extract in a dose-dependent manner. Collectively, the data suggest that CO extract has the potential to induce apoptosis of HepG2 cells and may act by suppressing the cell cycle, which leads to caspase-3 cleavage and p53 signaling. PMID:28966688

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Antineoplastic Effects of α-Santalol on Estrogen Receptor-Positive and Estrogen Receptor-Negative Breast Cancer Cells through Cell Cycle Arrest at G2/M Phase and Induction of Apoptosis

PubMed Central

Santha, Sreevidya; Bommareddy, Ajay; Rule, Brittny; Guillermo, Ruth; Kaushik, Radhey S.; Young, Alan; Dwivedi, Chandradhar

2013-01-01

Anticancer efficacy and the mechanism of action of α-santalol, a terpenoid isolated from sandalwood oil, were investigated in human breast cancer cells by using p53 wild-type MCF-7 cells as a model for estrogen receptor(ER)-positive and p53 mutated MDA-MB-231 cells as a model for ER-negative breast cancer. α-Santalol inhibited cell viability and proliferation in a concentration and time-dependent manner in both cells regardless of their ER and/or p53 status. However, α-santalol produced relatively less toxic effect on normal breast epithelial cell line, MCF-10A. It induced G2/M cell cycle arrest and apoptosis in both MCF-7 and MDA-MB-231 cells. Cell cycle arrest induced by α-santalol was associated with changes in the protein levels of BRCA1, Chk1, G2/M regulatory cyclins, Cyclin dependent kinases (CDKs), Cell division cycle 25B (Cdc25B), Cdc25C and Ser-216 phosphorylation of Cdc25C. An up-regulated expression of CDK inhibitor p21 along with suppressed expression of mutated p53 was observed in MDA-MB-231 cells treated with α-santalol. On the contrary, α-santalol did not increase the expression of wild-type p53 and p21 in MCF-7 cells. In addition, α-santalol induced extrinsic and intrinsic pathways of apoptosis in both cells with activation of caspase-8 and caspase-9. It led to the activation of the executioner caspase-6 and caspase-7 in α-santalol-treated MCF-7 cells and caspase-3 and caspase-6 in MDA-MB-231 cells along with strong cleavage of poly(ADP-ribose) polymerase (PARP) in both cells. Taken together, this study for the first time identified strong anti-neoplastic effects of α-santalol against both ER-positive and ER-negative breast cancer cells. PMID:23451128

Benzo[a]pyrene-7,8-dihydrodiol promotes checkpoint activation and G2/M arrest in human bronchoalveolar carcinoma H358 cells.

PubMed

Caino, M Cecilia; Oliva, Jose L; Jiang, Hao; Penning, Trevor M; Kazanietz, Marcelo G

2007-03-01

Polycyclic aromatic hydrocarbons (PAHs) are potent carcinogens that require metabolic activation inside cells. The proximate carcinogens PAH-diols can be converted to o-quinones by aldo-keto reductases (AKRs) or to diol-epoxides by cytochrome P450 (P450) enzymes. We assessed the effect of benzo[a]pyrene-7,8-dihydrodiol (BPD) on proliferation in p53-null bronchoalveolar carcinoma H358 cells. BPD treatment led to a significant inhibition of proliferation and arrest in G2/M in H358 cells. The relative contribution of the AKR and P450 pathways to cell cycle arrest was assessed. Overexpression of AKR1A1 did not affect cell proliferation or cell cycle progression, and benzo[a]pyrene-7,8-dione did not cause any noticeable effect on cell growth, suggesting that AKR1A1 metabolic products were not involved in the antiproliferative effect of BPD. On the other hand, blockade of P450 induction or inhibition of P450 activity greatly impaired the effect of BPD. Moreover, P450 induction by 2,3,7,8-tetrachlorodibenzo-p-dioxin significantly enhanced the antiproliferative effect of BPD. Mechanistic studies revealed that BPD caused a DNA damage response, Chk1 activation, and accumulation of phospho-Cdc2 (Tyr15) in H358 cells, effects that were impaired by an ataxia-telangectasia mutated (ATM)/ATM-related (ATR) inhibitor. Similar results were observed in human bronchoepithelial BEAS-2B cells, arguing for analogous mechanisms in tumorigenic and immortalized nontumorigenic cells lacking functional p53. Our data suggest that a p53-independent pathway operates in lung epithelial cells in response to BPD that involves P450 induction and subsequent activation of the ATR/ATM/Chk1 damage check-point pathway and cell cycle arrest in G2/M.

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

PubMed

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

PubMed

Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

2016-04-01

P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression.

PubMed

Cathcart, Jillian M; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

2016-09-20

Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype.

The effect of Zhangfei/CREBZF on cell growth, differentiation, apoptosis, migration, and the unfolded protein response in several canine osteosarcoma cell lines.

PubMed

Zhang, Rui; Thamm, Douglas H; Misra, Vikram

2015-02-07

We had previously shown that the bLZip domain-containing transcription factor, Zhangfei/CREBZF inhibits the growth and the unfolded protein response (UPR) in cells of the D-17 canine osteosarcoma (OS) line and that the effects of Zhangfei are mediated by it stabilizing the tumour suppressor protein p53. To determine if our observations with D-17 cells applied more universally to canine OS, we examined three other independently isolated canine OS cell lines--Abrams, McKinley and Gracie. Like D-17, the three cell lines expressed p53 proteins that were capable of activating promoters with p53 response elements on their own, and synergistically with Zhangfei. Furthermore, as with D-17 cells, Zhangfei suppressed the growth and UPR-related transcripts in the OS cell lines. Zhangfei also induced the activation of osteocalcin expression, a marker of osteoblast differentiation and triggered programmed cell death. Osteosarcomas are common malignancies in large breeds of dogs. Although there has been dramatic progress in their treatment, these therapies often fail, leading to recurrence of the tumour and metastatic spread. Our results indicate that induction of the expression of Zhangfei in OS, where p53 is functional, may be an effective modality for the treatment of OS.

Nitroxoline shows antimyeloma activity by targeting the TRIM25/p53 axle.

PubMed

Mao, Hongwu; Du, Yanyun; Zhang, Zubin; Cao, Biyin; Zhao, Jun; Zhou, Haibin; Mao, Xinliang

2017-04-01

The aim of this study was to identify the most potent quinoline-based anti-infectives for the treatment of multiple myeloma (MM) and to understand the molecular mechanisms. A small-scale screen against a panel of marketed quinoline-based drugs was performed in MM cell lines. Cell apoptosis was examined by flow cytometry. Anti-MM activity was also evaluated in nude mice. Western blotting was performed to investigate mechanisms. Nitroxoline (NXQ) was the most effective in suppressing MM cell proliferation. NXQ induced more than 40% MM cell apoptosis within 24 h and potentiated anti-MM activities of current major drugs including doxorubicin and lenalidomide. This finding was shown by activation of caspase-3, a major executive apoptotic enzyme, and by inactivation of PARP, a major enzyme in DNA damage repair. NXQ also suppressed prosurvival proteins Bcl-xL and Mcl-1. Moreover, NXQ suppressed the growth of myeloma xenografts in nude mice models. In the mechanistic study, NXQ was found to downregulate TRIM25, a highly expressed ubiquitin ligase in MM. Notably, NXQ upregulated tumor suppressor p53, but not PTEN. Furthermore, overexpression of TRIM25 decreased p53 protein. This study indicated that the long-term use of anti-infective NXQ has potential for MM treatment by targeting the TRIM25/p53 axle.

Blockade of TLR3 protects mice from lethal radiation-induced gastrointestinal syndrome

PubMed Central

Takemura, Naoki; Kawasaki, Takumi; Kunisawa, Jun; Sato, Shintaro; Lamichhane, Aayam; Kobiyama, Kouji; Aoshi, Taiki; Ito, Junichi; Mizuguchi, Kenji; Karuppuchamy, Thangaraj; Matsunaga, Kouta; Miyatake, Shoichiro; Mori, Nobuko; Tsujimura, Tohru; Satoh, Takashi; Kumagai, Yutaro; Kawai, Taro; Standley, Daron M.; Ishii, Ken J.; Kiyono, Hiroshi; Akira, Shizuo; Uematsu, Satoshi

2014-01-01

High-dose ionizing radiation induces severe DNA damage in the epithelial stem cells in small intestinal crypts and causes gastrointestinal syndrome (GIS). Although the tumour suppressor p53 is a primary factor inducing death of crypt cells with DNA damage, its essential role in maintaining genome stability means inhibiting p53 to prevent GIS is not a viable strategy. Here we show that the innate immune receptor Toll-like receptor 3 (TLR3) is critical for the pathogenesis of GIS. Tlr3−/− mice show substantial resistance to GIS owing to significantly reduced radiation-induced crypt cell death. Despite showing reduced crypt cell death, p53-dependent crypt cell death is not impaired in Tlr3−/− mice. p53-dependent crypt cell death causes leakage of cellular RNA, which induces extensive cell death via TLR3. An inhibitor of TLR3–RNA binding ameliorates GIS by reducing crypt cell death. Thus, we propose blocking TLR3 activation as a novel approach to treat GIS. PMID:24637670

Histone Deacetylase Inhibitor Trichostatin a Promotes the Apoptosis of Osteosarcoma Cells through p53 Signaling Pathway Activation

PubMed Central

Deng, Zhantao; Liu, Xiaozhou; Jin, Jiewen; Xu, Haidong; Gao, Qian; Wang, Yong; Zhao, Jianning

2016-01-01

Purpose: The purpose of this study was to investigate the profile of histone deacetylase (HDAC) activity and expression in osteosarcoma cells and tissues from osteosarcoma patients and to examine the mechanism by which a histone deacetylase (HDAC) inhibitor, Trichostatin A (TSA), promotes the apoptosis of osteosarcoma cells. Methods: HDAC activity and histone acetyltransferase (HAT) activity were determined in nuclear extracts of MG63 cells, hFOB 1.19 cells and tissues from 6 patients with primary osteosarcoma. The protein expression of Class I HDACs (1, 2, 3 and 8) and the activation of the p53 signaling pathway were examined by Western blot. Cell growth and apoptosis were determined by 3-(4, 5-dimethyl-2-thiazolyl)-2H-tetrazolium bromide (MTT) assay and flow cytometry, respectively. Results: Nuclear HDAC activity and class I HDAC expression were significantly higher in MG63 cells than in hFOB 1.19 cells, and a similar trend was observed in the human osteosarcoma tissues compared with the paired adjacent non-cancerous tissues. TSA significantly inhibited the growth of MG63 cells and promoted apoptosis in a dose-dependent manner through p53 signaling pathway activation. Conclusion: Class I HDACs play a central role in the pathogenesis of osteosarcoma, and HDAC inhibitors may thus have promise as new therapeutic agents against osteosarcoma. PMID:27877082

Molecular Dynamic Simulation Insights into the Normal State and Restoration of p53 Function

PubMed Central

Fu, Ting; Min, Hanyi; Xu, Yong; Chen, Jianzhong; Li, Guohui

2012-01-01

As a tumor suppressor protein, p53 plays a crucial role in the cell cycle and in cancer prevention. Almost 50 percent of all human malignant tumors are closely related to a deletion or mutation in p53. The activity of p53 is inhibited by over-active celluar antagonists, especially by the over-expression of the negative regulators MDM2 and MDMX. Protein-protein interactions, or post-translational modifications of the C-terminal negative regulatory domain of p53, also regulate its tumor suppressor activity. Restoration of p53 function through peptide and small molecular inhibitors has become a promising strategy for novel anti-cancer drug design and development. Molecular dynamics simulations have been extensively applied to investigate the conformation changes of p53 induced by protein-protein interactions and protein-ligand interactions, including peptide and small molecular inhibitors. This review focuses on the latest MD simulation research, to provide an overview of the current understanding of interactions between p53 and its partners at an atomic level. PMID:22949826

p53-Independent Roles of MDM2 in NF-κB Signaling: Implications for Cancer Therapy, Wound Healing, and Autoimmune Diseases1

PubMed Central

Thomasova, Dana; Mulay, Shrikant R; Bruns, Hauke; Anders, Hans-Joachim

2012-01-01

Murine double minute-2 (MDM2) is an intracellular molecule with multiple biologic functions. It serves as a negative regulator of p53 and thereby limits cell cycle arrest and apoptosis. Because MDM2 blockade suppresses tumor cell growth in vitro and in vivo, respective MDM2 inhibition is currently evaluated as anti-cancer therapy in clinical trials. However, the anti-proliferative effects of MDM2 inhibition also impair regenerative cell growth upon tissue injury. This was so far documented for tubular repair upon postischemic acute kidney injury and might apply to wound healing responses in general. Furthermore, MDM2 has numerous p53-independent effects. As a new entry, MDM2 was identified to act as a co-transcription factor for nuclear factor-kappa-light-enhancer of activated B cells (NF-κB) at cytokine promoters. This explains the potent anti-inflammatory effects of MDM2 inhibitors in vitro and in vivo. For example, the NF-κB-antagonistic and p53-agonistic activities of MDM2 inhibitors elicit potent therapeutic effects on experimental lymphoproliferative autoimmune disorders such as systemic lupus erythematosus. In this review, we discuss the classic p53-dependent, the recently discovered p53-independent, and the NF-κB-agonistic biologic functions of MDM2. We describe its complex regulatory role on p53 and NF-κB signaling and name areas of research that may help to foresee previously unexpected effects or potential alternative indications of therapeutic MDM2 blockade. PMID:23308042

Synergy between Prkdc and Trp53 regulates stem cell proliferation and GI-ARS after irradiation.

PubMed

Gurley, Kay E; Ashley, Amanda K; Moser, Russell D; Kemp, Christopher J

2017-11-01

Ionizing radiation (IR) is one of the most widely used treatments for cancer. However, acute damage to the gastrointestinal tract or gastrointestinal acute radiation syndrome (GI-ARS) is a major dose-limiting side effect, and the mechanisms that underlie this remain unclear. Here we use mouse models to explore the relative roles of DNA repair, apoptosis, and cell cycle arrest in radiation response. IR induces DNA double strand breaks and DNA-PK mutant Prkdc scid/scid mice are sensitive to GI-ARS due to an inability to repair these breaks. IR also activates the tumor suppressor p53 to trigger apoptotic cell death within intestinal crypt cells and p53 deficient mice are resistant to apoptosis. To determine if DNA-PK and p53 interact to govern radiosensitivity, we compared the response of single and compound mutant mice to 8 Gy IR. Compound mutant Prkdc scid/scid /Trp53 -/- mice died earliest due to severe GI-ARS. While both Prkdc scid/scid and Prkdc scid/scid /Trp53 -/- mutant mice had higher levels of IR-induced DNA damage, particularly within the stem cell compartment of the intestinal crypt, in Prkdc scid/scid /Trp53 -/- mice these damaged cells abnormally progressed through the cell cycle resulting in mitotic cell death. This led to a loss of Paneth cells and a failure to regenerate the differentiated epithelial cells required for intestinal function. IR-induced apoptosis did not correlate with radiosensitivity. Overall, these data reveal that DNA repair, mediated by DNA-PK, and cell cycle arrest, mediated by p53, cooperate to protect the stem cell niche after DNA damage, suggesting combination approaches to modulate both pathways may be beneficial to reduce GI-ARS. As many cancers harbor p53 mutations, this also suggests targeting DNA-PK may be effective to enhance sensitivity of p53 mutant tumors to radiation.

Minnelide/Triptolide Impairs Mitochondrial Function by Regulating SIRT3 in P53-Dependent Manner in Non-Small Cell Lung Cancer.

PubMed

Kumar, Ajay; Corey, Catherine; Scott, Iain; Shiva, Sruti; D'Cunha, Jonathan

2016-01-01

Minnelide/Triptolide (TL) has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC). However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS). Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2), along with diminished cellular glutathione (GSH) content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC). TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y), restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.

Aflatoxin B1-induced DNA adduct formation and p53 mutations in CYP450-expressing human liver cell lines.

PubMed

Macé, K; Aguilar, F; Wang, J S; Vautravers, P; Gómez-Lechón, M; Gonzalez, F J; Groopman, J; Harris, C C; Pfeifer, A M

1997-07-01

Epidemiological evidence has been supporting a relationship between dietary aflatoxin B1 (AFB1) exposure, development of human primary hepatocellular carcinoma (HCC) and mutations in the p53 tumor suppressor gene. However, the correlation between the observed p53 mutations, the AFB1 DNA adducts and their activation pathways has not been elucidated. Development of relevant cellular in vitro models, taking into account species and tissue specificity, could significantly contribute to the knowledge of cytotoxicity and genotoxicity mechanisms of chemical procarcinogens, such as AFB1, in humans. For this purpose a non-tumorigenic SV40-immortalized human liver epithelial cell line (THLE cells) which retained most of the phase II enzymes, but had markedly reduced phase I activities was used for stable expression of the human CYP1A2, CYP2A6, CYP2B6 and CYP3A4 cDNA. The four genetically engineered cell lines (T5-1A2, T5-2A6, T5-2B6 and T5-3A4) produced high levels of the specific CYP450 proteins and showed comparable or higher catalytic activities related to the CYP450 expression when compared to human hepatocytes. The T5-1A2, T5-2A6, T5-2B6 and T5-3A4 cell lines exhibited a very high sensitivity to the cytotoxic effects of AFB1 and were approximately 125-, 2-, 2- and 15-fold, respectively, more sensitive than the control T5-neo cells, transfected with an expressing vector which does not contain CYP450 cDNA. In the CYP450-expressing cells, nanomolar doses of AFB1-induced DNA adduct formation including AFB1-N7-guanine, -pyrimidyl and -diol adducts. In addition, the T5-1A2 cells showed AFM1-DNA adducts. At similar levels of total DNA adducts, both the T5-1A2 and T5-3A4 cells showed, at codon 249 of the p53 gene, AGG to AGT transversions at a relative frequency of 15x10(-6). In contrast, only the T5-3A4 cells showed CCC to ACC transversion at codon 250 at a high frequency, whereas the second most frequent mutations found in the T5-1A2 cells were C to T transitions at the first and second position of the codon 250. No significant AFB1-induced p53 mutations could be detected in the T5-2A6 cells. Therefore, the differential expression of specific CYP450 genes in human hepatocytes can modulate the cytotoxicity, DNA adduct levels and frequency of p53 mutations produced by AFB1.

The UbL-UBA Ubiquilin4 protein functions as a tumor suppressor in gastric cancer by p53-dependent and p53-independent regulation of p21.

PubMed

Huang, Shengkai; Li, Yan; Yuan, Xinghua; Zhao, Mei; Wang, Jia; Li, You; Li, Yuan; Lin, Hong; Zhang, Qiao; Wang, Wenjie; Li, Dongdong; Dong, Xin; Li, Lanfen; Liu, Min; Huang, Weiyan; Huang, Changzhi

2018-06-13

Ubiquilin4 (Ubqln4), a member of the UbL-UBA protein family, serves as an adaptor in the degradation of specific substrates via the proteasomal pathway. However, the biological function of Ubqln4 remains largely unknown, especially in cancer. Here, we reported that Ubqln4 was downregulated in gastric cancer tissues and functioned as a tumor suppressor by inhibiting gastric cancer cell proliferation in vivo and in vitro. Overexpression of Ubqln4-induced cellular senescence and G1-S cell cycle arrest in gastric cancer cells and activated the p53/p21 axis. Moreover, Ubqln4 regulated p21 through both p53-dependent and p53-independent manners. Ubqln4 interacted with RNF114, an E3 ubiquitin ligase of p21, and negatively regulated its expression level, which in turn stabilized p21 by attenuating proteasomal degradation of p21. These effects of Ubqln4 were partly abrogated in gastric cancer cells upon silencing of p21. Our findings not only establish the anti-tumor potential of Ubqln4 in gastric cancer but also reveal a role for Ubqln4 in regulation of the cell cycle and cellular senescence via stabilizing p21.

Histone Deacetylase Inhibitors Prevent p53-dependent and Independent Bax-Mediated Neuronal Apoptosis Through Two Distinct Mechanisms

PubMed Central

Uo, Takuma; Veenstra, Timothy D.; Morrison, Richard S.

2009-01-01

Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and —independent intrinsic apoptotic programs require the pro-apoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing post-mitochondrial events including cleavage of caspase-9 and -3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions. PMID:19261878

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

PubMed

Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

2002-08-22

A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

Human papillomavirus oncogenic E6 protein regulates human β-defensin 3 (hBD3) expression via the tumor suppressor protein p53

PubMed Central

Yue, Hong; Wang, Liming; Jin, Jessica; Ghosh, Santosh K.; Kawsar, Hameem I.; Zender, Chad; Androphy, Elliot J.; Weinberg, Aaron; McCormick, Thomas S.; Jin, Ge

2016-01-01

Human β-defensin-3 (hBD3) is an epithelial cell-derived innate immune regulatory molecule overexpressed in oral dysplastic lesions and fosters a tumor-promoting microenvironment. Expression of hBD3 is induced by the epidermal growth factor receptor signaling pathway. Here we describe a novel pathway through which the high-risk human papillomavirus type-16 (HPV-16) oncoprotein E6 induces hBD3 expression in mucosal keratinocytes. Ablation of E6 by siRNA induces the tumor suppressor p53 and diminishes hBD3 in HPV-16 positive CaSki cervical cancer cells and UM-SCC-104 head and neck cancer cells. Malignant cells in HPV-16-associated oropharyngeal cancer overexpress hBD3. HPV-16 E6 induces hBD3 mRNA expression, peptide production and gene promoter activity in mucosal keratinocytes. Reduction of cellular levels of p53 stimulates hBD3 expression, while activation of p53 by doxorubicin inhibits its expression in primary oral keratinocytes and CaSki cells, suggesting that p53 represses hBD3 expression. A p53 binding site in the hBD3 gene promoter has been identified by using electrophoretic mobility shift assays and chromatin immunoprecipitation (ChIP). In addition, the p63 protein isoform ΔNp63α, but not TAp63, stimulated transactivation of the hBD3 gene and was co-expressed with hBD3 in head and neck cancer specimens. Therefore, high-risk HPV E6 oncoproteins may stimulate hBD3 expression in tumor cells to facilitate tumorigenesis of HPV-associated head and neck cancer. PMID:27034006

Dehydroandrographolide, an iNOS inhibitor, extracted from Andrographis paniculata (Burm.f.) Nees, induces autophagy in human oral cancer cells.

PubMed

Hsieh, Ming-Ju; Lin, Chiao-Wen; Chiou, Hui-Ling; Yang, Shun-Fa; Chen, Mu-Kuan

2015-10-13

Autophagy, which is constitutively executed at the basal level in all cells, promotes cellular homeostasis by regulating the turnover of organelles and proteins. Andrographolide and dehydroandrographolide (DA) are the two principle components of Andrographis paniculata (Burm.f.) Nees. and are the main contributors to its therapeutic properties. However, the pharmacological activities of dehydroandrographolide (DA) remain unclear. In this study, DA induces oral cancer cell death by activating autophagy. Treatment with autophagy inhibitors inhibited DA-induced human oral cancer cell death. In addition, DA increased LC3-II expression and reduced p53 expression in a time- and concentration-dependent manner. Furthermore, DA induced autophagy and decreased cell viability through modulation of p53 expression. DA-induced autophagy was triggered by an activation of JNK1/2 and an inhibition of Akt and p38. In conclusion, this study demonstrated that DA induced autophagy in human oral cancer cells by modulating p53 expression, activating JNK1/2, and inhibiting Akt and p38. Finally, an administration of DA effectively suppressed the tumor formation in the oral carcinoma xenograft model in vivo. This is the first study to reveal the novel function of DA in activating autophagy, suggesting that DA could serve as a new and potential chemopreventive agent for treating human oral cancer.

Dehydroandrographolide, an iNOS inhibitor, extracted from from Andrographis paniculata (Burm.f.) Nees, induces autophagy in human oral cancer cells

PubMed Central

Hsieh, Ming-Ju; Lin, Chiao-Wen; Chiou, Hui-Ling; Yang, Shun-Fa; Chen, Mu-Kuan

2015-01-01

Autophagy, which is constitutively executed at the basal level in all cells, promotes cellular homeostasis by regulating the turnover of organelles and proteins. Andrographolide and dehydroandrographolide (DA) are the two principle components of Andrographis paniculata (Burm.f.) Nees. and are the main contributors to its therapeutic properties. However, the pharmacological activities of dehydroandrographolide (DA) remain unclear. In this study, DA induces oral cancer cell death by activating autophagy. Treatment with autophagy inhibitors inhibited DA-induced human oral cancer cell death. In addition, DA increased LC3-II expression and reduced p53 expression in a time- and concentration-dependent manner. Furthermore, DA induced autophagy and decreased cell viability through modulation of p53 expression. DA-induced autophagy was triggered by an activation of JNK1/2 and an inhibition of Akt and p38. In conclusion, this study demonstrated that DA induced autophagy in human oral cancer cells by modulating p53 expression, activating JNK1/2, and inhibiting Akt and p38. Finally, an administration of DA effectively suppressed the tumor formation in the oral carcinoma xenograft model in vivo. This is the first study to reveal the novel function of DA in activating autophagy, suggesting that DA could serve as a new and potential chemopreventive agent for treating human oral cancer. PMID:26356821

p53 Reactivation by PRIMA-1(Met) (APR-246) sensitises (V600E/K)BRAF melanoma to vemurafenib.

PubMed

Krayem, Mohammad; Journe, Fabrice; Wiedig, Murielle; Morandini, Renato; Najem, Ahmad; Salès, François; van Kempen, Leon C; Sibille, Catherine; Awada, Ahmad; Marine, Jean-Christophe; Ghanem, Ghanem

2016-03-01

Intrinsic and acquired resistance of metastatic melanoma to (V600E/K)BRAF and/or MEK inhibitors, which is often caused by activation of the PI3K/AKT survival pathway, represents a major clinical challenge. Given that p53 is capable of antagonising PI3K/AKT activation we hypothesised that pharmacological restoration of p53 activity may increase the sensitivity of BRAF-mutant melanoma to MAPK-targeted therapy and eventually delay and/or prevent acquisition of drug resistance. To test this possibility we exposed a panel of vemurafenib-sensitive and resistant (innate and acquired) (V600E/K)BRAF melanomas to a (V600E/K)BRAF inhibitor (vemurafenib) alone or in combination with a direct p53 activator (PRIMA-1(Met)/APR-246). Strikingly, PRIMA-1(Met) synergised with vemurafenib to induce apoptosis and suppress proliferation of (V600E/K)BRAF melanoma cells in vitro and to inhibit tumour growth in vivo. Importantly, this drug combination decreased the viability of both vemurafenib-sensitive and resistant melanoma cells irrespectively of the TP53 status. Notably, p53 reactivation was invariably accompanied by PI3K/AKT pathway inhibition, the activity of which was found as a dominant resistance mechanism to BRAF inhibition in our lines. From all various combinatorial modalities tested, targeting the MAPK and PI3K signalling pathways through p53 reactivation or not, the PRIMA-1(Met)/vemurafenib combination was the most cytotoxic. We conclude that PRIMA-1(Met) through its ability to directly reactivate p53 regardless of the mechanism causing its deactivation, and thereby dampen PI3K signalling, sensitises (V600E/K)BRAF-positive melanoma to BRAF inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

Dihydroptychantol A, a macrocyclic bisbibenzyl derivative, induces autophagy and following apoptosis associated with p53 pathway in human osteosarcoma U2OS cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Xia; School of Ocean, Shandong University, Weihai 264209; Wu, William K.K.

2011-03-01

Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G{sub 2}/M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine,more » suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21{sup Waf1/Cip1}. In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B{sub 1}, a cyclin required for progression through the G{sub 2}/M phase. Taken together, DHA induces G{sub 2}/M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.« less

Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

PubMed

Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

2012-04-01

Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

Phloretin induces apoptosis in H-Ras MCF10A human breast tumor cells through the activation of p53 via JNK and p38 mitogen-activated protein kinase signaling.

PubMed

Kim, Mi-Sung; Kwon, Jung Yeon; Kang, Nam Joo; Lee, Ki Won; Lee, Hyong Joo

2009-08-01

Mutations in Ras play a critical role in the development of human cancers, including breast cancer. We investigated the possible antiproliferative effects of the naturally occurring dihydrochalcone phloretin [2',4',6'-trihydroxy-3-(4-hydroxyphenyl)-propiophenone] on H-Ras-transformed MCF10A human breast epithelial (H-Ras MCF10A) cells. Phloretin suppressed H-Ras MCF10A cell proliferation in a dose-dependent manner and induced nuclear condensation in the cells, indicating that phloretin-induced cell death occurs mainly via the induction of apoptosis. Prominent upregulation of p53 and Bax and cleavage of poly (ADP)-ribose polymerase were also detected in the phloretin-treated cells. Finally, phloretin markedly increased caspase-3 activity as well as JNK and p38 mitogen-activated protein kinase signaling. Our findings suggest that the phloretin-induced apoptosis of breast tumor cells contributes to the chemopreventive potential of phloretin against breast cancer.

Silibinin induces hepatic stellate cell cycle arrest via enhancing p53/p27 and inhibiting Akt downstream signaling protein expression.

PubMed

Ezhilarasan, Devaraj; Evraerts, Jonathan; Sid, Brice; Calderon, Pedro Buc; Karthikeyan, Sivanesan; Sokal, Etienne; Najimi, Mustapha

2017-02-01

Proliferation of hepatic stellate cells (HSCs) plays a pivotal role in the progression of liver fibrosis consequent to chronic liver injury. Silibinin, a flavonoid compound, has been shown to possess anti-fibrogenic effects in animal models of liver fibrosis. This was attributed to an inhibition of cell proliferation of activated HSCs. The present study was to gain insight into the molecular pathways involved in silibinin anti-fibrogenic effect. The study was conducted on LX-2 human stellate cells treated with three concentrations of silibinin (10, 50 and 100 μmol/L) for 24 and 96 hours. At the end of the treatment cell viability and proliferation were evaluated. Protein expression of p27, p21, p53, Akt and phosphorylated-Akt was evaluated by Western blotting analysis and Ki-67 protein expression was by immunocytochemistry. Sirtuin activity was evaluated by chemiluminescence based assay. Silibinin inhibits LX-2 cell proliferation in dose- and time-dependent manner; we showed that silibinin upregulated the protein expressions of p27 and p53. Such regulation was correlated to an inhibition of both downstream Akt and phosphorylated-Akt protein signaling and Ki-67 protein expression. Sirtuin activity also was correlated to silibinin-inhibited proliferation of LX-2 cells. The anti-proliferative effect of silibinin on LX-2 human stellate cells is via the inhibition of the expressions of various cell cycle targets including p27, Akt and sirtuin signaling.

The homeoprotein DLX3 and tumor suppressor p53 co-regulate cell cycle progression and squamous tumor growth.

PubMed

Palazzo, E; Kellett, M; Cataisson, C; Gormley, A; Bible, P W; Pietroni, V; Radoja, N; Hwang, J; Blumenberg, M; Yuspa, S H; Morasso, M I

2016-06-16

Epidermal homeostasis depends on the coordinated control of keratinocyte cell cycle. Differentiation and the alteration of this balance can result in neoplastic development. Here we report on a novel DLX3-dependent network that constrains epidermal hyperplasia and squamous tumorigenesis. By integrating genetic and transcriptomic approaches, we demonstrate that DLX3 operates through a p53-regulated network. DLX3 and p53 physically interact on the p21 promoter to enhance p21 expression. Elevating DLX3 in keratinocytes produces a G1-S blockade associated with p53 signature transcriptional profiles. In contrast, DLX3 loss promotes a mitogenic phenotype associated with constitutive activation of ERK. DLX3 expression is lost in human skin cancers and is extinguished during progression of experimentally induced mouse squamous cell carcinoma (SCC). Reinstatement of DLX3 function is sufficient to attenuate the migration of SCC cells, leading to decreased wound closure. Our data establish the DLX3-p53 interplay as a major regulatory axis in epidermal differentiation and suggest that DLX3 is a modulator of skin carcinogenesis.

The homeoprotein DLX3 and tumor suppressor p53 co-regulate cell cycle progression and squamous tumor growth

PubMed Central

Palazzo, Elisabetta; Kellett, Meghan; Cataisson, Christophe; Gormley, Anna; Bible, Paul W.; Pietroni, Valentina; Radoja, Nadezda; Hwang, Joonsung; Blumenberg, Miroslav; Yuspa, Stuart H.; Morasso, Maria

2015-01-01

Epidermal homeostasis depends on the coordinated control of keratinocyte cell cycle. Differentiation and the alteration of this balance can result in neoplastic development. Here we report on a novel DLX3-dependent network that constrains epidermal hyperplasia and squamous tumorigenesis. By integrating genetic and transcriptomic approaches, we demonstrate that DLX3 operates through a p53-regulated network. DLX3 and p53 physically interact on the p21 promoter to enhance p21 expression. Elevating DLX3 in keratinocytes produces a G1-S blockade associated with p53 signature transcriptional profiles. In contrast, DLX3 loss promotes a mitogenic phenotype associated with constitutive activation of ERK. DLX3 expression is lost in human skin cancers and is extinquished during progression of experimentally induced mouse squamous cell carcinoma (SCC). Reinstatement of DLX3 function is sufficient to attenuate the migration of SCC cells, leading to decreased wound closure. Our data establish the DLX3-p53 interplay as a major regulatory axis in epidermal differentiation and suggest that DLX3 is a modulator of skin carcinogenesis. PMID:26522723

Methionine sulfoxide reductase A regulates cell growth through the p53-p21 pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Seung Hee; Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr

2011-12-09

Highlights: Black-Right-Pointing-Pointer Down-regulation of MsrA inhibits normal cell proliferation. Black-Right-Pointing-Pointer MsrA deficiency leads to an increase in p21 by enhanced p53 acetylation. Black-Right-Pointing-Pointer Down-regulation of MsrA causes cell cycle arrest at the G{sub 2}/M stage. Black-Right-Pointing-Pointer MsrA is a regulator of cell growth that mediates the p53-p21 pathway. -- Abstract: MsrA is an oxidoreductase that catalyzes the stereospecific reduction of methionine-S-sulfoxide to methionine. Although MsrA is well-characterized as an antioxidant and has been implicated in the aging process and cellular senescence, its roles in cell proliferation are poorly understood. Here, we report a critical role of MsrA in normal cellmore » proliferation and describe the regulation mechanism of cell growth by this protein. Down-regulation of MsrA inhibited cell proliferation, but MsrA overexpression did not promote it. MsrA deficiency led to an increase in p21, a major cyclin-dependent kinase inhibitor, thereby causing cell cycle arrest at the G{sub 2}/M stage. While protein levels of p53 were not altered upon MsrA deficiency, its acetylation level was significantly elevated, which subsequently activated p21 transcription. The data suggest that MsrA is a regulator of cell growth that mediates the p53-p21 pathway.« less