Sample records for p53 cooperative integrators

  1. The regulation of p53 by phosphorylation: a model for how distinct signals integrate into the p53 pathway.


    Maclaine, Nicola J; Hupp, Ted R


    The tumour suppressor p53 is a transcription factor that has evolved the ability to integrate distinct environmental signals including DNA damage, virus infection, and cytokine signaling into a common biological outcome that maintains normal cellular control. Mutations in p53 switch the cellular transcription program resulting in deregulation of the stress responses that normally maintain cell and tissue integrity. Transgenic studies in mice have indicated that changes in the specific activity of p53 can have profound effects not only on cancer development, but also on organism aging. As the specific activity of p53 is regulated at a post-translational level by sets of enzymes that mediate phosphorylation, acetylation, methylation, and ubiquitin-like modifications, it is likely that physiological modifiers of the aging function of p53 would be enzymes that catalyze such covalent modifications. We demonstrate that distinct stress-activated kinases, including ataxia telangiectasia mutated (ATM), casein kinase 1 (CK1) and AMP-activated protein kinase (AMPK), mediate phosphorylation of a key phospho-acceptor site in the p53 transactivation domain in response to diverse stresses including ionizing radiation, DNA virus infection, and elevation in the intracellular AMP/ATP ratio. As diseases linked to aging can involve activation of p53-dependent changes in cellular protective pathways, the development of specific physiological models might further shed light on the role of p53 kinases in modifying age-related diseases. PMID:20157532

  2. ARF and ATM/ATR cooperate in p53-mediated apoptosis upon oncogenic stress

    SciTech Connect

    Pauklin, Siim . E-mail:; Kristjuhan, Arnold; Maimets, Toivo; Jaks, Viljar


    Induction of apoptosis is pivotal for eliminating cells with damaged DNA or deregulated proliferation. We show that tumor suppressor ARF and ATM/ATR kinase pathways cooperate in the induction of apoptosis in response to elevated expression of c-myc, {beta}-catenin or human papilloma virus E7 oncogenes. Overexpression of oncogenes leads to the formation of phosphorylated H2AX foci, induction of Rad51 protein levels and ATM/ATR-dependent phosphorylation of p53. Inhibition of ATM/ATR kinases abolishes both induction of Rad51 and phosphorylation of p53, and remarkably reduces the level of apoptosis induced by co-expression of oncogenes and ARF. However, the induction of apoptosis is downregulated in p53-/- cells and does not depend on activities of ATM/ATR kinases, indicating that efficient induction of apoptosis by oncogene activation depends on coordinated action of ARF and ATM/ATR pathways in the regulation of p53.

  3. Daxx cooperates with the Axin/HIPK2/p53 complex to induce cell death.


    Li, Qinxi; Wang, Xuan; Wu, Xiaoling; Rui, Yanning; Liu, Wei; Wang, Jifeng; Wang, Xinghao; Liou, Yih-Cherng; Ye, Zhiyun; Lin, Sheng-Cai


    Daxx, a death domain-associated protein, has been implicated in proapoptosis, antiapoptosis, and transcriptional regulation. Many factors known to play critically important roles in controlling apoptosis and gene transcription have been shown to associate with Daxx, including the Ser/Thr protein kinase HIPK2, promyelocytic leukemia protein, histone deacetylases, and the chromatin remodeling protein ATRX. Although it is clear that Daxx may exert multiple functions, the underlying mechanisms remain far from clear. Here, we show that Axin, originally identified for its scaffolding role to control beta-catenin levels in Wnt signaling, strongly associates with Daxx at endogenous levels. The Daxx/Axin complex formation is enhanced by UV irradiation. Axin tethers Daxx to the tumor suppressor p53, and cooperates with Daxx, but not DaxxDeltaAxin, which is unable to interact with Axin, to stimulate HIPK2-mediated Ser(46) phosphorylation and transcriptional activity of p53. Interestingly, Axin and Daxx seem to selectively activate p53 target genes, with strong activation of PUMA, but not p21 or Bax. Daxx-stimulated p53 transcriptional activity was significantly diminished by small interfering RNA against Axin; Daxx fails to inhibit colony formation in Axin(-/-) cells. Moreover, UV-induced cell death was attenuated by the knockdown of Axin and Daxx. All these results show that Daxx cooperates with Axin to stimulate p53, and implicate a direct role for Axin, HIPK2, and p53 in the proapoptotic function of Daxx. We have hence unraveled a novel aspect of p53 activation and shed new light on the ultimate understanding of the Daxx protein, perhaps most pertinently, in relation to stress-induced cell death. PMID:17210684

  4. Dicer Cooperates with p53 to Suppress DNA Damage and Skin Carcinogenesis in Mice

    PubMed Central

    Lyle, Stephen; Hoover, Kathleen; Colpan, Cansu; Zhu, Zhiqing; Matijasevic, Zdenka; Jones, Stephen N.


    Dicer is required for the maturation of microRNA, and loss of Dicer and miRNA processing has been found to alter numerous biological events during embryogenesis, including the development of mammalian skin and hair. We have previously examined the role of miRNA biogenesis in mouse embryonic fibroblasts and found that deletion of Dicer induces cell senescence regulated, in part, by the p53 tumor suppressor. Although Dicer and miRNA molecules are thought to have either oncogenic or tumor suppressing roles in various types of cancer, a role for Dicer and miRNAs in skin carcinogenesis has not been established. Here we show that perinatal ablation of Dicer in the skin of mice leads to loss of fur in adult mice, increased epidermal cell proliferation and apoptosis, and the accumulation of widespread DNA damage in epidermal cells. Co-ablation of Dicer and p53 did not alter the timing or extent of fur loss, but greatly reduced survival of Dicer-skin ablated mice, as these mice developed multiple and highly aggressive skin carcinomas. Our results describe a new mouse model for spontaneous basal and squamous cell tumorigenesis. Furthermore, our findings reveal that loss of Dicer in the epidermis induces extensive DNA damage, activation of the DNA damage response and p53-dependent apoptosis, and that Dicer and p53 cooperate to suppress mammalian skin carcinogenesis. PMID:24979267

  5. Cooperation between p53 Mutation and High Telomerase Transgenic Expression in Spontaneous Cancer Development

    PubMed Central

    González-Suárez, Eva; Flores, Juana M.; Blasco, María A.


    Telomerase reintroduction in adult somatic tissues is envisioned as a way to extend their proliferative capacity. It is still a question, however, whether constitutive telomerase expression in adult tissues impacts the normal aging and spontaneous cancer incidence of an organism. Here, we studied the aging and spontaneous cancer incidence of mice with transgenic telomerase expression in a wide range of adult tissues, K5-Tert mice. For this, we maintained large colonies of K5-Tert mice for more than 2 years. K5-Tert mice showed a decreased life span compared to wild-type cohorts associated with a higher incidence of preneoplastic and neoplastic lesions in various tissue types. Neoplasias in K5-Tert mice were coincident with transgene expression in the affected tissues. These observations suggest that high telomerase activity may cooperate with genetic alterations that occur with age to promote tumorigenesis. Indeed, we demonstrate here that increased cancer incidence and the reduced viability of K5-Tert mice are aggravated in a p53+/− genetic background, indicating that telomerase cooperates with loss of p53 function in inducing tumorigenesis. Altogether, these results demonstrate that constitutive high levels of telomerase activity result in a decreased life span associated with an increased incidence of neoplasias as the organism ages. PMID:12242304

  6. Cooperative Role of the RNA-Binding Proteins Hzf and HuR in p53 Activation ▿

    PubMed Central

    Nakamura, Hideaki; Kawagishi, Hiroyuki; Watanabe, Atsushi; Sugimoto, Kazushi; Maruyama, Mitsuo; Sugimoto, Masataka


    The RNA-binding protein Hzf (hematopoietic zinc finger) plays important roles in mRNA translation in cerebellar Purkinje cells and adipocytes. We along with others have reported that the expression of the Hzf gene is transcriptionally regulated by the p53 tumor suppressor protein. We show here that Hzf regulates p53 expression in cooperation with HuR. Hzf and HuR independently interact with the 3′ untranslated region (UTR) of p53 mRNA, which facilitates the cytoplasmic localization of p53 mRNA in the presence of the ARF tumor suppressor protein. In the absence of Hzf and HuR, p53 induction by p19ARF is significantly attenuated, and the cells consequently acquire resistance to p19ARF. Thus, these findings demonstrate that in addition to Mdm2 inhibition, p19ARF increases the concentration of p53 through posttranscriptional control of p53 mRNA and suggest critical roles for the RNA-binding proteins Hzf and HuR in p53 induction. PMID:21402775

  7. Endoplasmic Reticulum Stress Accelerates p53 Degradation by the Cooperative Actions of Hdm2 and Glycogen Synthase Kinase 3β

    PubMed Central

    Pluquet, Olivier; Qu, Li-Ke; Baltzis, Dionissios; Koromilas, Antonis E.


    Inactivation of the tumor suppressor p53 by degradation is a mechanism utilized by cells to adapt to endoplasmic reticulum (ER) stress. However, the mechanisms of p53 destabilization by ER stress are not known. We demonstrate here that the E3 ubiquitin-ligase Hdm2 is essential for the nucleocytoplasmic transport and proteasome-dependent degradation of p53 in ER-stressed cells. We also demonstrate that p53 phosphorylation at S315 and S376 is required for its nuclear export and degradation by Hdm2 without interfering with the ubiquitylation process. Furthermore, we show that p53 destabilization in unstressed cells utilizes the cooperative action of Hdm2 and glycogen synthase kinase 3β, a process that is enhanced in cells exposed to ER stress. In contrast to other stress pathways that stabilize p53, our findings further substantiate a negative role of ER stress in p53 activation with important implications for the function of the tumor suppressor in cells with a dysfunctional ER. PMID:16227590

  8. Integrated high-throughput analysis identifies Sp1 as a crucial determinant of p53-mediated apoptosis

    PubMed Central

    Li, H; Zhang, Y; Ströse, A; Tedesco, D; Gurova, K; Selivanova, G


    The restoration of p53 tumor suppressor function is a promising therapeutic strategy to combat cancer. However, the biological outcomes of p53 activation, ranging from the promotion of growth arrest to the induction of cell death, are hard to predict, which limits the clinical application of p53-based therapies. In the present study, we performed an integrated analysis of genome-wide short hairpin RNA screen and gene expression data and uncovered a previously unrecognized role of Sp1 as a central modulator of the transcriptional response induced by p53 that leads to robust induction of apoptosis. Sp1 is indispensable for the pro-apoptotic transcriptional repression by p53, but not for the induction of pro-apoptotic genes. Furthermore, the p53-dependent pro-apoptotic transcriptional repression required the co-binding of Sp1 to p53 target genes. Our results also highlight that Sp1 shares with p53 a common regulator, MDM2, which targets Sp1 for proteasomal degradation. This uncovers a new mechanism of the tight control of apoptosis in cells. Our study advances the understanding of the molecular basis of p53-mediated apoptosis and implicates Sp1 as one of its key modulators. We found that small molecules reactivating p53 can differentially modulate Sp1, thus providing insights into how to manipulate p53 response in a controlled way. PMID:24971482

  9. Fbw7 and p53 Cooperatively Suppress Advanced and Chromosomally Unstable Intestinal Cancer

    PubMed Central

    Grim, Jonathan E.; Knoblaugh, Sue E.; Guthrie, Katherine A.; Hagar, Amanda; Swanger, Jherek; Hespelt, Jessica; Delrow, Jeffrey J.; Small, Tom; Grady, William M.; Nakayama, Keiichi I.


    Colorectal cancer (CRC) remains a major cause of cancer mortality worldwide. Murine models have yielded critical insights into CRC pathogenesis, but they often fail to recapitulate advanced-disease phenotypes, notably metastasis and chromosomal instability (CIN). New models are thus needed to understand disease progression and to develop therapies. We sought to model advanced CRC by inactivating two tumor suppressors that are mutated in human CRCs, the Fbw7 ubiquitin ligase and p53. Here we report that Fbw7 deletion alters differentiation and proliferation in the gut epithelium and stabilizes oncogenic Fbw7 substrates, such as cyclin E and Myc. However, Fbw7 deletion does not cause tumorigenesis in the gut. In contrast, codeletion of both Fbw7 and p53 causes highly penetrant, aggressive, and metastatic adenocarcinomas, and allografts derived from these tumors form highly malignant adenocarcinomas. In vitro evidence indicates that Fbw7 ablation promotes genetic instability that is suppressed by p53, and we show that most Fbw7−/−; p53−/− carcinomas exhibit a CIN+ phenotype. We conclude that Fbw7 and p53 synergistically suppress adenocarcinomas that mimic advanced human CRC with respect to histopathology, metastasis, and CIN. This model thus represents a novel tool for studies of advanced CRC as well as carcinogenesis associated with ubiquitin pathway mutations. PMID:22473991

  10. p53 mutations cooperate with oncogenic Kras to promote adenocarcinoma from pancreatic ductal cells.


    Bailey, J M; Hendley, A M; Lafaro, K J; Pruski, M A; Jones, N C; Alsina, J; Younes, M; Maitra, A; McAllister, F; Iacobuzio-Donahue, C A; Leach, S D


    Pancreatic cancer is one of the most lethal malignancies, with virtually all patients eventually succumbing to their disease. Mutations in p53 have been documented in >50% of pancreatic cancers. Owing to the high incidence of p53 mutations in PanIN 3 lesions and pancreatic tumors, we interrogated the comparative ability of adult pancreatic acinar and ductal cells to respond to oncogenic Kras and mutant Tp53(R172H) using Hnf1b:CreER(T2) and Mist1:CreER(T2) mice. These studies involved co-activation of a membrane-tethered GFP lineage label, allowing for direct visualization and isolation of cells undergoing Kras and mutant p53 activation. Kras activation in Mist1(+) adult acinar cells resulted in brisk PanIN formation, whereas no evidence of pancreatic neoplasia was observed for up to 6 months following Kras activation in Hnf1beta(+) adult ductal cells. In contrast to the lack of response to oncogenic Kras alone, simultaneous activation of Kras and mutant p53 in adult ductal epithelium generated invasive PDAC in 75% of mice as early as 2.5 months after tamoxifen administration. These data demonstrate that pancreatic ductal cells, whereas exhibiting relative resistance to oncogenic Kras alone, can serve as an effective cell of origin for pancreatic ductal adenocarcinoma in the setting of gain-of-function mutations in p53. PMID:26592447

  11. Cooperative interactions between p53 and NFκB enhance cell plasticity

    PubMed Central

    Bisio, Alessandra; Zámborszky, Judit; Zaccara, Sara; Lion, Mattia; Tebaldi, Toma; Sharma, Vasundhara; Raimondi, Ivan; Alessandrini, Federica; Ciribilli, Yari; Inga, Alberto


    The p53 and NFκB sequence-specific transcription factors play crucial roles in cell proliferation and survival with critical, even if typically opposite, effects on cancer progression. To investigate a possible crosstalk between p53 and NFκB driven by chemotherapy-induced responses in the context of an inflammatory microenvironment, we performed a proof of concept study using MCF7 cells. Transcriptome analyses upon single or combined treatments with doxorubicin (Doxo, 1.5μM) and the NFκB inducer TNF-alpha (TNF⍺, 5ng/ml) revealed 432 up-regulated (log2 FC> 2), and 390 repressed genes (log2 FC< -2) for the Doxo+TNF⍺ treatment. 239 up-regulated and 161 repressed genes were synergistically regulated by the double treatment. Annotation and pathway analyses of Doxo+TNF⍺ selectively up-regulated genes indicated strong enrichment for cell migration terms. A panel of genes was examined by qPCR coupled to p53 activation by Doxo, 5-Fluoruracil and Nutlin-3a, or to p53 or NFκB inhibition. Transcriptome data were confirmed for 12 of 15 selected genes and seven (PLK3, LAMP3, ETV7, UNC5B, NTN1, DUSP5, SNAI1) were synergistically up-regulated after Doxo+TNF⍺ and dependent both on p53 and NFκB. Migration assays consistently showed an increase in motility for MCF7 cells upon Doxo+TNF⍺. A signature of 29 Doxo+TNF⍺ highly synergistic genes exhibited prognostic value for luminal breast cancer patients, with adverse outcome correlating with higher relative expression. We propose that the crosstalk between p53 and NFκB can lead to the activation of specific gene expression programs that may impact on cancer phenotypes and potentially modify the efficacy of cancer therapy. PMID:25401416

  12. Cooperative interactions between p53 and NFκB enhance cell plasticity.


    Bisio, Alessandra; Zámborszky, Judit; Zaccara, Sara; Lion, Mattia; Tebaldi, Toma; Sharma, Vasundhara; Raimondi, Ivan; Alessandrini, Federica; Ciribilli, Yari; Inga, Alberto


    The p53 and NFκB sequence-specific transcription factors play crucial roles in cell proliferation and survival with critical, even if typically opposite, effects on cancer progression. To investigate a possible crosstalk between p53 and NFκB driven by chemotherapy-induced responses in the context of an inflammatory microenvironment, we performed a proof of concept study using MCF7 cells. Transcriptome analyses upon single or combined treatments with doxorubicin (Doxo, 1.5μM) and the NFκB inducer TNF-alpha (TNFα, 5ng/ml) revealed 432 up-regulated (log2 FC> 2), and 390 repressed genes (log2 FC< -2) for the Doxo+TNFα treatment. 239 up-regulated and 161 repressed genes were synergistically regulated by the double treatment. Annotation and pathway analyses of Doxo+TNFα selectively up-regulated genes indicated strong enrichment for cell migration terms. A panel of genes was examined by qPCR coupled to p53 activation by Doxo, 5-Fluoruracil and Nutlin-3a, or to p53 or NFκB inhibition. Transcriptome data were confirmed for 12 of 15 selected genes and seven (PLK3, LAMP3, ETV7, UNC5B, NTN1, DUSP5, SNAI1) were synergistically up-regulated after Doxo+TNFα and dependent both on p53 and NFκB. Migration assays consistently showed an increase in motility for MCF7 cells upon Doxo+TNFα. A signature of 29 Doxo+TNFα highly synergistic genes exhibited prognostic value for luminal breast cancer patients, with adverse outcome correlating with higher relative expression. We propose that the crosstalk between p53 and NFκB can lead to the activation of specific gene expression programs that may impact on cancer phenotypes and potentially modify the efficacy of cancer therapy. PMID:25401416

  13. Zbtb1 Safeguards Genome Integrity and Prevents p53-Mediated Apoptosis in Proliferating Lymphoid Progenitors.


    Cao, Xin; Lu, Ying; Zhang, Xianyu; Kovalovsky, Damian


    Expression of the transcription factor Zbtb1 is required for normal lymphoid development. We report in the present study that Zbtb1 maintains genome integrity in immune progenitors, without which cells undergo increased DNA damage and p53-mediated apoptosis during replication and differentiation. Increased DNA damage in Zbtb1-mutant (ScanT) progenitors was due to increased sensitivity to replication stress, which was a consequence of inefficient activation of the S-phase checkpoint response. Increased p53-mediated apoptosis affected not only lymphoid but also myeloid development in competitive bone marrow chimeras, and prevention of apoptosis by transgenic Bcl2 expression and p53 deficiency rescued lymphoid as well as myeloid development from Zbtb1-mutant progenitors. Interestingly, however, protection from apoptosis rescued only the early stages of T cell development, and thymocytes remained arrested at the double-negative 3 developmental stage, indicating a strict requirement of Zbtb1 at later T cell developmental stages. Collectively, these results indicate that Zbtb1 prevents DNA damage in replicating immune progenitors, allowing the generation of B cells, T cells, and myeloid cells. PMID:27402700

  14. Mutant p53 cooperates with ETS2 to promote etoposide resistance

    PubMed Central

    Do, Phi M.; Varanasi, Lakshman; Fan, Songqing; Li, Chunyang; Kubacka, Iwona; Newman, Virginia; Chauhan, Krishna; Daniels, Silvano Rakeem; Boccetta, Maurizio; Garrett, Michael R.; Li, Runzhao; Martinez, Luis A.


    Mutant p53 (mtp53) promotes chemotherapy resistance through multiple mechanisms, including disabling proapoptotic proteins and regulating gene expression. Comparison of genome wide analysis of mtp53 binding revealed that the ETS-binding site motif (EBS) is prevalent within predicted mtp53-binding sites. We demonstrate that mtp53 regulates gene expression through EBS in promoters and that ETS2 mediates the interaction with this motif. Importantly, we identified TDP2, a 5′-tyrosyl DNA phosphodiesterase involved in the repair of DNA damage caused by etoposide, as a transcriptional target of mtp53. We demonstrate that suppression of TDP2 sensitizes mtp53-expressing cells to etoposide and that mtp53 and TDP2 are frequently overexpressed in human lung cancer; thus, our analysis identifies a potentially “druggable” component of mtp53's gain-of-function activity. PMID:22508727

  15. Mutant p53 cooperates with ETS2 to promote etoposide resistance.


    Do, Phi M; Varanasi, Lakshman; Fan, Songqing; Li, Chunyang; Kubacka, Iwona; Newman, Virginia; Chauhan, Krishna; Daniels, Silvano Rakeem; Boccetta, Maurizio; Garrett, Michael R; Li, Runzhao; Martinez, Luis A


    Mutant p53 (mtp53) promotes chemotherapy resistance through multiple mechanisms, including disabling proapoptotic proteins and regulating gene expression. Comparison of genome wide analysis of mtp53 binding revealed that the ETS-binding site motif (EBS) is prevalent within predicted mtp53-binding sites. We demonstrate that mtp53 regulates gene expression through EBS in promoters and that ETS2 mediates the interaction with this motif. Importantly, we identified TDP2, a 5'-tyrosyl DNA phosphodiesterase involved in the repair of DNA damage caused by etoposide, as a transcriptional target of mtp53. We demonstrate that suppression of TDP2 sensitizes mtp53-expressing cells to etoposide and that mtp53 and TDP2 are frequently overexpressed in human lung cancer; thus, our analysis identifies a potentially "druggable" component of mtp53's gain-of-function activity. PMID:22508727

  16. Mutant p53 cooperates with the SWI/SNF chromatin remodeling complex to regulate VEGFR2 in breast cancer cells

    PubMed Central

    Pfister, Neil T.; Fomin, Vitalay; Regunath, Kausik; Zhou, Jeffrey Y.; Zhou, Wen; Silwal-Pandit, Laxmi; Freed-Pastor, William A.; Laptenko, Oleg; Neo, Suat Peng; Bargonetti, Jill; Hoque, Mainul; Tian, Bin; Gunaratne, Jayantha; Engebraaten, Olav; Manley, James L.; Børresen-Dale, Anne-Lise; Neilsen, Paul M.; Prives, Carol


    Mutant p53 impacts the expression of numerous genes at the level of transcription to mediate oncogenesis. We identified vascular endothelial growth factor receptor 2 (VEGFR2), the primary functional VEGF receptor that mediates endothelial cell vascularization, as a mutant p53 transcriptional target in multiple breast cancer cell lines. Up-regulation of VEGFR2 mediates the role of mutant p53 in increasing cellular growth in two-dimensional (2D) and three-dimensional (3D) culture conditions. Mutant p53 binds near the VEGFR2 promoter transcriptional start site and plays a role in maintaining an open conformation at that location. Relatedly, mutant p53 interacts with the SWI/SNF complex, which is required for remodeling the VEGFR2 promoter. By both querying individual genes regulated by mutant p53 and performing RNA sequencing, the results indicate that >40% of all mutant p53-regulated gene expression is mediated by SWI/SNF. We surmise that mutant p53 impacts transcription of VEGFR2 as well as myriad other genes by promoter remodeling through interaction with and likely regulation of the SWI/SNF chromatin remodeling complex. Therefore, not only might mutant p53-expressing tumors be susceptible to anti VEGF therapies, impacting SWI/SNF tumor suppressor function in mutant p53 tumors may also have therapeutic potential. PMID:26080815

  17. Mutant p53 cooperates with ETS and selectively up-regulates human MDR1 not MRP1.


    Sampath, J; Sun, D; Kidd, V J; Grenet, J; Gandhi, A; Shapiro, L H; Wang, Q; Zambetti, G P; Schuetz, J D


    The most frequently expressed drug resistance genes, MDR1 and MRP1, occur in human tumors with mutant p53. However, it was unknown if mutant p53 transcriptionally regulated both MDR1 and MRP1. We demonstrated that mutant p53 did not activate either the MRP1 promoter or the endogenous gene. In contrast, mutant p53 strongly up-regulated the MDR1 promoter and expression of the endogenous MDR1 gene. Notably, cells that expressed either a transcriptionally inactive mutant p53 or the empty vector showed no endogenous MDR1 up-regulation. Transcriptional activation of the MDR1 promoter by mutant p53 required an Ets binding site, and mutant p53 and Ets-1 synergistically activated MDR1 transcription. Biochemical analysis revealed that Ets-1 interacted exclusively with mutant p53s in vivo but not with wild-type p53. These findings are the first to demonstrate the induction of endogenous MDR1 by mutant p53 and provide insight into the mechanism. PMID:11483599

  18. Affinities of organophosphate flame retardants to tumor suppressor gene p53: an integrated in vitro and in silico study.


    Li, Fei; Cao, Lulu; Li, Xuehua; Li, Na; Wang, Zijian; Wu, Huifeng


    Health concerns have been raised in regards to the environmental impact of the more frequently used organophosphate flame retardants (OPFRs). In this study, the effects of two typical OPFRs (TCPP and TPhP) on p53 gene expression in human embryo liver L02 cells were determined by quantitative real-time PCR. To better understand the relationship between molecular structural features of OPFRs and binding affinities for the tumor suppressor genes p53, an integrated experimental and in silico approach was used. The interaction of 9 OPFRs with p53 DNA fragment under simulated physiological conditions (phosphate buffer solution of pH 7.40), was explored by UV absorption spectroscopy, fluorescence spectroscopy and molecular modeling method. The binding constants of 9 OPFRs with p53 DNA fragment were determined respectively, using ethidium bromide (EB) as fluorescence probe of DNA. From docking analysis, hydrogen bonding and hydrophobic interactions were found to be the dominant interactions. Based on the observed interactions, appropriate molecular structural parameters were adopted to develop a quantitative structure-activity relationship (QSAR) model. The binding affinities of OPFRs to p53 DNA fragment were related with molecular electrostatic potential. The developed QSAR model had good robustness, predictive ability and mechanism interpretability. PMID:25510514

  19. Spatially- and temporally-controlled postnatal p53 knockdown cooperates with embryonic Schwann cell precursor Nf1 gene loss to promote malignant peripheral nerve sheath tumor formation

    PubMed Central

    Hirbe, Angela C.; Dahiya, Sonika; Friedmann-Morvinski, Dinorah; Verma, Inder M.; Clapp, D. Wade; Gutmann, David H.


    Malignant peripheral nerve sheath tumors (MPNSTs) are highly aggressive sarcomas that arise sporadically or in association with the Neurofibromatosis type 1 (NF1) cancer predisposition syndrome. In individuals with NF1, MPNSTs are hypothesized to arise from Nf1-deficient Schwann cell precursor cells following the somatic acquisition of secondary cooperating genetic mutations (e.g., p53 loss). To model this sequential genetic cooperativity, we coupled somatic lentivirus-mediated p53 knockdown in the adult right sciatic nerve with embryonic Schwann cell precursor Nf1 gene inactivation in two different Nf1 conditional knockout mouse strains. Using this approach, ∼60% of mice with Periostin-Cre-mediated Nf1 gene inactivation (Periostin-Cre; Nf1flox/flox mice) developed tumors classified as low-grade MPNSTs following p53 knockdown (mean, 6 months). Similarly, ∼70% of Nf1+/− mice with GFAP-Cre-mediated Nf1 gene inactivation (GFAP-Cre; Nf1flox/null mice) developed low-grade MPNSTs following p53 knockdown (mean, 3 months). In addition, wild-type and Nf1+/− mice with GFAP-Cre-mediated Nf1 loss develop MPNSTs following somatic p53 knockout with different latencies, suggesting potential influences of Nf1+/− stromal cells in MPNST pathogenesis. Collectively, this new MPNST model system permits the analysis of somatically-acquired events as well as tumor microenvironment signals that potentially cooperate with Nf1 loss in the development and progression of this deadly malignancy. PMID:26859681

  20. The cooperative effect of p53 and Rb in local nanotherapy in a rabbit VX2 model of hepatocellular carcinoma

    PubMed Central

    Dong, Shengli; Tang, Qibin; Long, Miaoyun; Guan, Jian; Ye, Lu; Li, Gaopeng


    Background/aim A local nanotherapy (LNT) combining the therapeutic efficacy of trans-arterial embolization, nanoparticles, and p53 gene therapy has been previously presented. The study presented here aimed to further improve the incomplete tumor eradication and limited survival enhancement and to elucidate the molecular mechanism of the LNT. Methods In a tumor-targeting manner, recombinant expressing plasmids harboring wild-type p53 and Rb were either co-transferred or transferred separately to rabbit hepatic VX2 tumors in a poly-L-lysine-modified hydroxyapatite nanoparticle nanoplex and Lipiodol® (Guerbet, Villepinte, France) emulsion via the hepatic artery. Subsequent co-expression of p53 and Rb proteins within the treated tumors was investigated by Western blotting and in situ analysis by laser-scanning confocal microscopy. The therapeutic effect was evaluated by the tumor growth velocity, apoptosis and necrosis rates, their sensitivity to Adriamycin® (ADM), mitomycin C, and fluorouracil, the microvessel density of tumor tissue, and the survival time of animals. Eventually, real-time polymerase chain reaction and enhanced chemiluminescence Western blotting were used to investigate the expressive changes of important genes related to the therapy. Results The administration procedure proved safe for the rabbits’ liver function, the p53 plus Rb LNT showed significantly better antitumoral effect and lower expression of malignant genes than the p53 or Rb LNT, although no significant difference was observed in animal survival when the p53 plus Rb LNT was compared with the p53 LNT. Conclusion Rb works synergistically with p53 in combined therapy mediated by a poly-L-lysine-modified hydroxyapatite nanoparticle nanoplex to augment the antitumoral effect through the downregulated expression of important genes related to apoptosis, necrosis, growth, differentiation and multidrug resistance of tumor cells. LNT with p53 and Rb is potentially an effective antitumor

  1. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies

    PubMed Central

    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O.; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E.; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C.; Orlowski, Robert; Sarbassov, Dos D.; Lorenzi, Philip L.; Huang, Xuelin; Neelapu, Sattva S.; McDonnell, Timothy; Miranda, Roberto N.; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R. Eric.; Andreeff, Michael


    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. PMID:26884599

  2. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies.


    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael


    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. PMID:26884599

  3. The p53 circuit board

    PubMed Central

    Sullivan, Kelly D.; Gallant-Behm, Corrie L.; Henry, Ryan E.; Fraikin, Jean-Luc; Espinosa, Joaquín M.


    The p53 tumor suppressor is embedded in a large gene network controlling diverse cellular and organismal phenotypes. Multiple signaling pathways converge onto p53 activation, mostly by relieving the inhibitory effects of its repressors, MDM2 and MDM4. In turn, signals originating from increased p53 activity diverge into distinct effector pathways to deliver a specific cellular response to the activating stimuli. Much attention has been devoted to dissecting how the various input pathways trigger p53 activation and how the activity of the p53 protein itself can be modulated by a plethora of co-factors and post-translational modifications. In this review we will focus instead on the multiple configurations of the effector pathways. We will discuss how p53-generated signals are transmitted, amplified, resisted and eventually integrated by downstream gene circuits operating at the transcriptional, post-transcriptional and post-translational level. We will also discuss how context-dependent variations in these gene circuits define the cellular response to p53 activation and how they may impact the clinical efficacy of p53-based targeted therapies. PMID:22333261

  4. Integrative Analysis Reveals an Outcome-associated and Targetable Pattern of p53 and Cell Cycle Deregulation in Diffuse Large B-cell Lymphoma

    PubMed Central

    Monti, Stefano; Chapuy, Bjoern; Takeyama, Kunihiko; Rodig, Scott J; Hao, Yangsheng; Yeda, Kelly T.; Inguilizian, Haig; Mermel, Craig; Curie, Treeve; Dogan, Ahmed; Kutok, Jeffery L; Beroukim, Rameen; Neuberg, Donna; Habermann, Thomas; Getz, Gad; Kung, Andrew L; Golub, Todd R; Shipp, Margaret A


    Summary Diffuse large B-cell lymphoma (DLBCL) is a clinically and biologically heterogeneous disease with a high proliferation rate. By integrating copy number data with transcriptional profiles and performing pathway analysis in primary DLBCLs, we identified a comprehensive set of copy number alterations (CNAs) that decreased p53 activity and perturbed cell cycle regulation. Primary tumors either had multiple complementary alterations of p53 and cell cycle components or largely lacked these lesions. DLBCLs with p53 and cell cycle pathway CNAs had decreased abundance of p53 target transcripts and increased expression of E2F target genes and the Ki67 proliferation marker. CNAs of the CDKN2A-TP53-RB-E2F axis provide a structural basis for increased proliferation in DLBCL, predict outcome with current therapy and suggest targeted treatment approaches. PMID:22975378

  5. Δ113p53/Δ133p53 converts P53 from a repressor to a promoter of DNA double-stand break repair

    PubMed Central

    Gong, Lu; Chen, Jun


    ABSTRACT In response to DNA damage, p53 (TP53, best known as p53) is quickly activated leading to cell cycle arrest or apoptosis to ensure genomic integrity; however, this represses DNA double-strand break (DSB) repair. Our recent work revealed that Δ113p53/Δ133p53 protein is accumulated at a later stage upon DNA DSB stress to switch p53 signaling from repression to promotion of DNA DSB repair. PMID:27308550

  6. Cooperative interactions between RB and p53 regulate cell proliferation, cell senescence, and apoptosis in human vascular smooth muscle cells from atherosclerotic plaques.


    Bennett, M R; Macdonald, K; Chan, S W; Boyle, J J; Weissberg, P L


    Compared with vascular smooth muscle cells (VSMCs) from normal vessels, VSMCs from human atherosclerotic plaques proliferate more slowly, undergo earlier senescence, and demonstrate higher levels of apoptosis in culture. The tumor suppressor genes p105RB (retinoblastoma, acting through the E2F transcription factor family) and p53 regulate cell proliferation, cell senescence, and apoptosis in many cell types. We have therefore determined whether these stable growth properties of plaque VSMCs reflect altered activity of RB and/or p53. VSMCs were derived from coronary atherectomies or from normal coronary arteries from transplant recipients. Compared with normal VSMCs, plaque VSMCs showed a higher ratio of the active (hypophosphorylated) to the inactive (phosphorylated) form of RB and a lower level of E2F transcriptional activity. Cells were stably transfected with retrovirus constructs that inhibited RB or p53 alone or in combination. Suppression of RB alone increased rates of cell proliferation and apoptosis and inhibited cell senescence in normal VSMCs. Suppression of p53 and RB together had similar effects but, additionally, resulted in immortalization of normal VSMC cultures. In contrast, inhibition of RB binding to E2F or ectopic expression of E2F-1 in plaque VSMCs induced massive apoptosis, which required suppression of p53 to rescue cells. Suppression of RB and p53 together increased cell proliferation and delayed senescence but failed to immortalize plaque VSMCs. Inhibition of p53 alone had minimal effects on plaque VSMCs but increased the lifespan of normal VSMCs. We conclude that human plaque VSMCs have slower rates of cell proliferation and earlier senescence than do cells from normal vessels because of a defect in phosphorylation of RB. Furthermore, both disruption of RB/E2F and inhibition of p53 are required for plaque VSMCs to proliferate without apoptosis. This observation may explain the relatively low level of cell proliferation and high level of

  7. Integrated Stochastic Model of DNA Damage Repair by Non-homologous End Joining and p53/p21- Mediated Early Senescence Signalling

    PubMed Central

    Nelson, Glyn; Hall, Philip; Miwa, Satomi; Kirkwood, Thomas B. L.; Shanley, Daryl P.


    Unrepaired or inaccurately repaired DNA damage can lead to a range of cell fates, such as apoptosis, cellular senescence or cancer, depending on the efficiency and accuracy of DNA damage repair and on the downstream DNA damage signalling. DNA damage repair and signalling have been studied and modelled in detail separately, but it is not yet clear how they integrate with one another to control cell fate. In this study, we have created an integrated stochastic model of DNA damage repair by non-homologous end joining and of gamma irradiation-induced cellular senescence in human cells that are not apoptosis-prone. The integrated model successfully explains the changes that occur in the dynamics of DNA damage repair after irradiation. Simulations of p53/p21 dynamics after irradiation agree well with previously published experimental studies, further validating the model. Additionally, the model predicts, and we offer some experimental support, that low-dose fractionated irradiation of cells leads to temporal patterns in p53/p21 that lead to significant cellular senescence. The integrated model is valuable for studying the processes of DNA damage induced cell fate and predicting the effectiveness of DNA damage related medical interventions at the cellular level. PMID:26020242

  8. Targeting the p53 pathway.


    Golubovskaya, Vita M; Cance, William G


    This article summarizes data on translational studies to target the p53 pathway in cancer. It describes the functions of the p53 and Mdm-2 signaling pathways, and discusses current therapeutic approaches to target p53 pathways, including reactivation of p53. In addition, direct interaction and colocalization of the p53 and focal adhesion kinase proteins in cancer cells have been demonstrated, and different approaches to target this interaction are reviewed. This is a broad review of p53 function as it relates to the diagnosis and treatment of a wide range of cancers. PMID:24012397

  9. p53 and Mitochondrial Function in Neurons

    PubMed Central

    Wang, David B.; Kinoshita, Chizuru; Kinoshita, Yoshito; Morrison, Richard S.


    The p53 tumor suppressor plays a central role in dictating cell survival and death as a cellular sensor for a myriad of stresses including DNA damage, oxidative and nutritional stress, ischemia and disruption of nucleolar function. Activation of p53-dependent apoptosis leads to mitochondrial apoptotic changes via the intrinsic and extrinsic pathways triggering cell death execution most notably by release of cytochrome c and activation of the caspase cascade. Although it was previously believed that p53 induces apoptotic mitochondrial changes exclusively through transcription-dependent mechanisms, recent studies suggest that p53 also regulates apoptosis via a transcription-independent action at the mitochondria. Recent evidence further suggests that p53 can regulate necrotic cell death and autophagic activity including mitophagy. An increasing number of cytosolic and mitochondrial proteins involved in mitochondrial metabolism and respiration are regulated by p53, which influences mitochondrial ROS production as well. Cellular redox homeostasis is also directly regulated by p53 through modified expression of pro- and anti-oxidant proteins. Proper regulation of mitochondrial size and shape through fission and fusion assures optimal mitochondrial bioenergetic function while enabling adequate mitochondrial transport to accommodate local energy demands unique to neuronal architecture. Abnormal regulation of mitochondrial dynamics has been increasingly implicated in neurodegeneration, where elevated levels of p53 may have a direct contribution as the expression of some fission/fusion proteins are directly regulated by p53. Thus, p53 may have a much wider influence on mitochondrial integrity and function than one would expect from its well-established ability to transcriptionally induce mitochondrial apoptosis. However, much of the evidence demonstrating that p53 can influence mitochondria through nuclear, cytosolic or intra-mitochondrial sites of action has yet to be

  10. The mitochondrial p53 pathway

    PubMed Central

    Vaseva, Angelina V.; Moll, Ute M.


    p53 is one of the most mutated tumor suppressors in human cancers and as such has been intensively studied for a long time. p53 is a major orchestrator of the cellular response to a broad array of stress types by regulating apoptosis, cell cycle arrest, senescence, DNA repair and genetic stability. For a long time it was thought that these functions of p53 solely rely on its function as a transcription factor, and numerous p53 target genes have been identified [1]. In the last 8 years however, a novel transcription-independent proapoptotic function mediated by the cytoplasmic pool of p53 has been revealed. p53 participates directly in the intrinsic apoptosis pathway by interacting with the multidomain members of the Bcl-2 family to induce mitochondrial outer membrane permeabilization. Our review will discuss these studies, focusing on recent advances in the field. PMID:19007744

  11. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses.


    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko


    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3'-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486-5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  12. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53

    PubMed Central

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar


    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1–393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using “hot-spot” p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  13. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53.


    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar


    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1-393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using "hot-spot" p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  14. Cellular adaptation to hypoxia and p53 transcription regulation.


    Zhao, Yang; Chen, Xue-qun; Du, Ji-zeng


    Tumor suppressor p53 is the most frequently mutated gene in human tumors. Meanwhile, under stress conditions, p53 also acts as a transcription factor, regulating the expression of a series of target genes to maintain the integrity of genome. The target genes of p53 can be classified into genes regulating cell cycle arrest, genes involved in apoptosis, and genes inhibiting angiogenesis. p53 protein contains a transactivation domain, a sequence-specific DNA binding domain, a tetramerization domain, a non-specific DNA binding domain that recognizes damaged DNA, and a later identified proline-rich domain. Under stress, p53 proteins accumulate and are activated through two mechanisms. One, involving ataxia telangiectasia-mutated protein (ATM), is that the interaction between p53 and its down-regulation factor murine double minute 2 (MDM2) decreases, leading to p53 phosphorylation on Ser15, as determined by the post-translational mechanism; the other holds that p53 increases and is activated through the binding of ribosomal protein L26 (RPL26) or nucleolin to p53 mRNA 5( untranslated region (UTR), regulating p53 translation. Under hypoxia, p53 decreases transactivation and increases transrepression. The mutations outside the DNA binding domain of p53 also contribute to tumor progress, so further studies on p53 should also be focused on this direction. The subterranean blind mole rat Spalax in Israel is a good model for hypoxia-adaptation. The p53 of Spalax mutated in residue 172 and residue 207 from arginine to lysine, conferring it the ability to survive hypoxic conditions. This model indicates that p53 acts as a master gene of diversity formation during evolution. PMID:19434769

  15. Regulation of p53 during senescence in normal human keratinocytes

    PubMed Central

    Kim, Reuben H; Kang, Mo K; Kim, Terresa; Yang, Paul; Bae, Susan; Williams, Drake W; Phung, Samantha; Shin, Ki-Hyuk; Hong, Christine; Park, No-Hee


    p53, the guardian of the genome, is a tumor suppressor protein and critical for the genomic integrity of the cells. Many studies have shown that intracellular level of p53 is enhanced during replicative senescence in normal fibroblasts, and the enhanced level of p53 is viewed as the cause of senescence. Here, we report that, unlike in normal fibroblasts, the level of intracellular p53 reduces during replicative senescence and oncogene-induced senescence (OIS) in normal human keratinocytes (NHKs). We found that the intracellular p53 level was also decreased in age-dependent manner in normal human epithelial tissues. Senescent NHKs exhibited an enhanced level of p16INK4A, induced G2 cell cycle arrest, and lowered the p53 expression and transactivation activity. We found that low level of p53 in senescent NHKs was due to reduced transcription of p53. The methylation status at the p53 promoter was not altered during senescence, but senescent NHKs exhibited notably lower level of acetylated histone 3 (H3) at the p53 promoter in comparison with rapidly proliferating cells. Moreover, p53 knockdown in rapidly proliferating NHKs resulted in the disruption of fidelity in repaired DNA. Taken together, our study demonstrates that p53 level is diminished during replicative senescence and OIS and that such diminution is associated with H3 deacetylation at the p53 promoter. The reduced intracellular p53 level in keratinocytes of the elderly could be a contributing factor for more frequent development of epithelial cancer in the elderly because of the loss of genomic integrity of cells. PMID:26138448

  16. p53: Guardian of Ploidy

    PubMed Central

    Aylon, Yael; Oren, Moshe


    Aneuploidy, often preceded by tetraploidy, is one of the hallmarks of solid tumors. Indeed, both aneuploidy and tetraploidy are oncogenic occurrences that are sufficient to drive neoplastic transformation and cancer progression. True to form, the tumor suppressor p53 obstructs propagation of these dangerous chromosomal events by either instigating irreversible cell cycle arrest or apoptosis. The tumor suppressor Lats2, along with other tumor inhibitory proteins such as BRCA1/2 and BubR1, are central to p53-dependent elimination of tetraploid cells. Not surprisingly, these proteins are frequently inactivated or downregulated in tumors, synergizing with p53 inactivation to establish an atmosphere of “tolerance” for a nondiploid state. PMID:21852209

  17. p53 regulation upon genotoxic stress: intricacies and complexities

    PubMed Central

    Kumari, Rajni; Kohli, Saishruti; Das, Sanjeev


    p53, the revered savior of genomic integrity, receives signals from diverse stress sensors and strategizes to maintain cellular homeostasis. However, the predominance of p53 overshadows the fact that this herculean task is no one-man show; rather, there is a huge army of regulators that reign over p53 at various levels to avoid an unnecessary surge in its levels and sculpt it dynamically to favor one cellular outcome over another. This governance starts right at the time of p53 translation, which is gated by proteins that bind to p53 mRNA and keep a stringent check on p53 protein levels. The same effect is also achieved by ubiquitylases and deubiquitylases that fine-tune p53 turnover and miRNAs that modulate p53 levels, adding precision to this entire scheme. In addition, extensive covalent modifications and differential protein interactions allow p53 to trigger a tailor-made response for a given circumstance. To magnify the marvel, these various tiers of regulation operate simultaneously and in various combinations. In this review, we have tried to provide a glimpse into this bewildering labyrinth. We believe that further studies will result in a better understanding of p53 regulation and that new insights will help unravel many aspects of cancer biology. PMID:27308356

  18. C-Abl as a modulator of p53

    SciTech Connect

    Levav-Cohen, Yaara; Goldberg, Zehavit; Zuckerman, Valentina; Grossman, Tamar; Haupt, Sue; Haupt, Ygal . E-mail:


    P53 is renowned as a cellular tumor suppressor poised to instigate remedial responses to various stress insults that threaten DNA integrity. P53 levels and activities are kept under tight regulation involving a complex network of activators and inhibitors, which determine the type and extent of p53 growth inhibitory signaling. Within this complexity, the p53-Mdm2 negative auto-regulatory loop serves as a major route through which intra- and extra-cellular stress signals are channeled to appropriate p53 responses. Mdm2 inhibits p53 transcriptional activities and through its E3 ligase activity promotes p53 proteasomal degradation either within the nucleus or following nuclear export. Upon exposure to stress signals these actions of Mdm2 have to be moderated, or even interrupted, in order to allow sufficient p53 to accumulate in an active form. Multiple mechanisms involving a variety of factors have been demonstrated to mediate this interruption. C-Abl is a critical factor that under physiological conditions is required for the maximal and efficient accumulation of active p53 in response to DNA damage. C-Abl protects p53 by antagonizing the inhibitory effect of Mdm2, an action that requires a direct interplay between c-Abl and Mdm2. In addition, c-Abl protects p53 from other inhibitors of p53, such as the HPV-E6/E6AP complex, that inhibits and degrades p53 in HPV-infected cells. Surprisingly, the oncogenic form of c-Abl, the Bcr-Abl fusion protein in CML cells, also promotes the accumulation of wt p53. However, in contrast to the activation of p53 by c-Abl, its oncogenic form, Bcr-Abl, counteracts the growth inhibitory activities of p53 by modulating the p53-Mdm2 loop. Thus, it appears that by modulating the p53-Mdm2 loop, c-Abl and its oncogenic forms critically determine the type and extent of the cellular response to DNA damage.

  19. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.



    undergoing phase I trials for the potential treatment of lung, breast, ovarian, bladder, liver and brain cancers. Introgen and Aventis Pharma had signed a Cooperative Research and Development Agreement (CRADA) with the National Cancer Institute (NCI). NCI will sponsor clinical trials to evaluate and develop RPR/INGN 201 as a potential anticancer agent for these cancer indications. The trials conducted under a NCI-sponsored IND will evaluate RPR/INGN 201 alone and in combination with other anticancer agents. This agreement was originally signed by Rhône-Poulenc Rorer's Gencell. Introgen has completed three phase I clinical trials with INGN 201 in patients with bronchioalveolar cell lung carcinoma, ovarian cancer and recurrent glioblastomas, respectively. Intratumoural injection of RPR/INGN 201 in patients with recurrent glioblastomas was well tolerated and resulted in expression of the p53 protein. Direct administration of RPR/INGN 201 to the lower airways of patients with bronchioalveolar cell lung carcinoma resulted in symptomatic improvement and improved lung function in some patients. In February 2003, Introgen announced that the US Patent and Trademark Office has issued to The Board of Regents of The University of Texas System, patent No. 6,511,847 entitled "Recombinant p53 Adenovirus Methods and Compositions". Introgen Therapeutics is the exclusive licensee of this patent. The patent covers any adenoviral DNA molecules that encode the p53 gene positioned under the control of a promoter. Such a DNA molecule forms the genetic core of Introgen's ADVEXIN cancer therapy. Introgen's ADVEXIN therapy is now covered by up to ten separate US patents relevant to the product including compositions, therapeutic methods of administering the product in virtually any form, alone and in conjunction with the most widely used chemotherapeutic and radiation treatments, as well as its production. Introgen has a number of US patents that relate to the clinical use of ADVEXIN in cancer as

  20. Crystal structure of a p53 core tetramer bound to DNA

    SciTech Connect

    Malecka, K.A.; Ho, W.C.; Marmorstein, R.


    The tumor suppressor p53 regulates downstream genes in response to many cellular stresses and is frequently mutated in human cancers. Here, we report the use of a crosslinking strategy to trap a tetrameric p53 DNA-binding domain (p53DBD) bound to DNA and the X-ray crystal structure of the protein/DNA complex. The structure reveals that two p53DBD dimers bind to B form DNA with no relative twist and that a p53 tetramer can bind to DNA without introducing significant DNA bending. The numerous dimer-dimer interactions involve several strictly conserved residues, thus suggesting a molecular basis for p53DBD-DNA binding cooperativity. Surface residue conservation of the p53DBD tetramer bound to DNA highlights possible regions of other p53 domain or p53 cofactor interactions.

  1. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi


    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  2. Pancreatic adenocarcinomas frequently show p53 gene mutations.

    PubMed Central

    Scarpa, A.; Capelli, P.; Mukai, K.; Zamboni, G.; Oda, T.; Iacono, C.; Hirohashi, S.


    Thirty-four pancreatic adenocarcinomas were studied for the presence of p53 gene mutations by the single-strand conformation polymorphism method and by direct sequencing of PCR-amplified fragments. p53 protein expression was immunohistochemically evaluated using monoclonal PAb1801 and polyclonal CM1 antibodies. Mutations were detected in 14 cases. The transitions were six G to A and two A to G; the transversions were one C to G and two A to C; the remaining three were frameshift mutations. Immunostaining results were identical with both antibodies. Nuclear immunohistochemical p53-positive cells were found in nine p53 mutated cases and in 12 cases in which no mutation was detected. In most of these latter cases only a minority of cancer cells showed immunohistochemical positivity. Twenty-nine cases, including all p53 mutated cancers, were known to contain codon 12 Ki-ras gene mutations. Also in the light of the demonstrated cooperation of ras and p53 gene alterations in the transformation of cultured cells, our data suggest that p53 mutation is one of the genetic defects that may have a role in the pathogenesis of a proportion of pancreatic cancers. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8494051

  3. Pathologies Associated with the p53 Response

    PubMed Central

    Gudkov, Andrei V.; Komarova, Elena A.


    Although p53 is a major cancer preventive factor, under certain extreme stress conditions it may induce severe pathologies. Analyses of animal models indicate that p53 is largely responsible for the toxicity of ionizing radiation or DNA damaging drugs contributing to hematopoietic component of acute radiation syndrome and largely determining severe adverse effects of cancer treatment. p53-mediated damage is strictly tissue specific and occurs in tissues prone to p53-dependent apoptosis (e.g., hematopoietic system and hair follicles); on the contrary, p53 can serve as a survival factor in tissues that respond to p53 activation by cell cycle arrest (e.g., endothelium of small intestine). There are multiple experimental indications that p53 contributes to pathogenicity of acute ischemic diseases. Temporary reversible suppression of p53 by small molecules can be an effective and safe approach to reduce severity of p53-associated pathologies. PMID:20595398

  4. Regulation of Mutant p53 Protein Expression

    PubMed Central

    Vijayakumaran, Reshma; Tan, Kah Hin; Miranda, Panimaya Jeffreena; Haupt, Sue; Haupt, Ygal


    For several decades, p53 has been detected in cancer biopsies by virtue of its high protein expression level which is considered indicative of mutation. Surprisingly, however, mouse genetic studies revealed that mutant p53 is inherently labile, similar to its wild type (wt) counterpart. Consistently, in response to stress conditions, both wt and mutant p53 accumulate in cells. While wt p53 returns to basal level following recovery from stress, mutant p53 remains stable. In part, this can be explained in mutant p53-expressing cells by the lack of an auto-regulatory loop with Mdm2 and other negative regulators, which are pivotal for wt p53 regulation. Further, additional protective mechanisms are acquired by mutant p53, largely mediated by the co-chaperones and their paralogs, the stress-induced heat shock proteins. Consequently, mutant p53 is accumulated in cancer cells in response to chronic stress and this accumulation is critical for its oncogenic gain of functions (GOF). Building on the extensive knowledge regarding wt p53, the regulation of mutant p53 is unraveling. In this review, we describe the current understanding on the major levels at which mutant p53 is regulated. These include the regulation of p53 protein levels by microRNA and by enzymes controlling p53 proteasomal degradation. PMID:26734569

  5. Energetic Landscape of MDM2-p53 Interactions by Computational Mutagenesis of the MDM2-p53 Interaction

    PubMed Central

    Thayer, Kelly M.; Beyer, George A.


    The ubiquitin ligase MDM2, a principle regulator of the tumor suppressor p53, plays an integral role in regulating cellular levels of p53 and thus a prominent role in current cancer research. Computational analysis used MUMBO to rotamerize the MDM2-p53 crystal structure 1YCR to obtain an exhaustive search of point mutations, resulting in the calculation of the ΔΔG comprehensive energy landscape for the p53-bound regulator. The results herein have revealed a set of residues R65-E69 on MDM2 proximal to the p53 hydrophobic binding pocket that exhibited an energetic profile deviating significantly from similar residues elsewhere in the protein. In light of the continued search for novel competitive inhibitors for MDM2, we discuss possible implications of our findings on the drug discovery field. PMID:26992014

  6. Energetic Landscape of MDM2-p53 Interactions by Computational Mutagenesis of the MDM2-p53 Interaction.


    Thayer, Kelly M; Beyer, George A


    The ubiquitin ligase MDM2, a principle regulator of the tumor suppressor p53, plays an integral role in regulating cellular levels of p53 and thus a prominent role in current cancer research. Computational analysis used MUMBO to rotamerize the MDM2-p53 crystal structure 1YCR to obtain an exhaustive search of point mutations, resulting in the calculation of the ΔΔG comprehensive energy landscape for the p53-bound regulator. The results herein have revealed a set of residues R65-E69 on MDM2 proximal to the p53 hydrophobic binding pocket that exhibited an energetic profile deviating significantly from similar residues elsewhere in the protein. In light of the continued search for novel competitive inhibitors for MDM2, we discuss possible implications of our findings on the drug discovery field. PMID:26992014

  7. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    PubMed Central

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan


    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  8. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture.


    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan


    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds 'structural' mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  9. Allele Specific p53 Mutant Reactivation

    PubMed Central

    Yu, Xin; Vazquez, Alexei; Levine, Arnold J.; Carpizo, Darren R.


    Summary Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Using the NCI anticancer drug screen data, we identified two compounds from the thiosemicarbazone family that manifest increased growth inhibitory activity in mutant p53 cells, particularly for the p53R175 mutant. Mechanistic studies reveal that NSC319726 restores WT structure and function to the p53R175 mutant. This compound kills p53R172H knock-in mice with extensive apoptosis and inhibits xenograft tumor growth in a 175-allele specific mutant p53 dependent manner. This activity depends upon the zinc ion chelating properties of the compound as well as redox changes. These data identify NSC319726 as a p53R175 mutant reactivator and as a lead compound for p53 targeted drug development. PMID:22624712

  10. Prospective therapeutic applications of p53 inhibitors

    SciTech Connect

    Gudkov, Andrei V. . E-mail:; Komarova, Elena A.


    p53, in addition to being a key cancer preventive factor, is also a determinant of cancer treatment side effects causing excessive apoptotic death in several normal tissues during cancer therapy. p53 inhibitory strategy has been suggested to protect normal tissues from chemo- and radiotherapy, and to treat other pathologies associated with stress-mediated activation of p53. This strategy was validated by isolation and testing of small molecule p53 inhibitor pifithrin-{alpha} that demonstrated broad tissue protecting capacity. However, in some normal tissues and tumors p53 plays protective role by inducing growth arrest and preventing cells from premature entrance into mitosis and death from mitotic catastrophe. Inhibition of this function of p53 can sensitize tumor cells to chemo- and radiotherapy, thus opening new potential application of p53 inhibitors and justifying the need in pharmacological agents targeting specifically either pro-apoptotic or growth arrest functions of p53.

  11. mTORC1 and p53

    PubMed Central

    Hasty, Paul; Sharp, Zelton Dave; Curiel, Tyler J.; Campisi, Judith


    A balance must be struck between cell growth and stress responses to ensure that cells proliferate without accumulating damaged DNA. This balance means that optimal cell proliferation requires the integration of pro-growth and stress-response pathways. mTOR (mechanistic target of rapamycin) is a pleiotropic kinase found in complex 1 (mTORC1). The mTORC1 pathway governs a response to mitogenic signals with high energy levels to promote protein synthesis and cell growth. In contrast, the p53 DNA damage response pathway is the arbiter of cell proliferation, restraining mTORC1 under conditions of genotoxic stress. Recent studies suggest a complicated integration of these pathways to ensure successful cell growth and proliferation without compromising genome maintenance. Deciphering this integration could be key to understanding the potential clinical usefulness of mTORC1 inhibitors like rapamycin. Here we discuss how these p53-mTORC1 interactions might play a role in the suppression of cancer and perhaps the development of cellular senescence and organismal aging. PMID:23255104

  12. Role of cysteine residues in regulation of p53 function.


    Rainwater, R; Parks, D; Anderson, M E; Tegtmeyer, P; Mann, K


    Previous studies of p53 have implicated cysteine residues in site-specific DNA binding via zinc coordination and redox regulation (P. Hainaut and J. Milner, Cancer Res. 53:4469-4473, 1993; T. R. Hupp, D. W. Meek, C. A. Midgley, and D. P. Lane, Nucleic Acids Res. 21:3167-3174, 1993). We show here that zinc binding and redox regulation are, at least in part, distinct determinants of the binding of p53 to DNA. Moreover, by substituting serine for each cysteine in murine p53, we have investigated the roles of individual cysteines in the regulation of p53 function. Substitution of serine for cysteine at position 40, 179, 274, 293, or 308 had little or no effect on p53 function. In contrast, replacement of cysteine at position 173, 235, or 239 markedly reduced in vitro DNA binding, completely blocked transcriptional activation, and led to a striking enhancement rather than a suppression of transformation by p53. These three cysteines have been implicated in zinc binding by X-ray diffraction studies (Y. Cho, S. Gorina, P.D. Jeffrey, and N.P. Pavletich, Science 265:346-355, 1994); our studies demonstrate the functional consequences of the inability of the central DNA-binding domain of p53 to studies demonstrate the functional consequences of the inability of the central DNA-binding domain of p53 to bind zinc. Lastly, substitutions for cysteines at position 121, 132, 138, or 272 partially blocked both transactivation and the suppression of transformation by p53. These four cysteines are located in the loop-sheet-helix region of the site-specific DNA-binding domain of p53. Like the cysteines in the zinc-binding region, therefore, these cysteines may cooperate to modulate the structure of the DNA-binding domain. Our findings argue that p53 is subject to more than one level of conformational modulation through oxidation-reduction of cysteines at or near the p53-DNA interface. PMID:7791795

  13. The critical role of catalase in prooxidant and antioxidant function of p53

    PubMed Central

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J


    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  14. Posttranscriptional Regulation of p53 and Its Targets by RNA-Binding Proteins

    PubMed Central

    Zhang, Jin; Chen, Xinbin


    p53 tumor suppressor plays a pivotal role in maintaining genomic integrity and preventing cancer development. The importance of p53 in tumor suppression is illustrated by the observation that about 50% human tumor cells have a dysfunctional p53 pathway. Although it has been well accepted that the activity of p53 is mainly controlled through post-translational modifications, recent studies have revealed that posttranscriptional regulations of p53 by various RNA-binding proteins also play a crucial role in modulating p53 activity and its downstream targets. PMID:19075680

  15. Sodium orthovanadate inhibits p53-mediated apoptosis.


    Morita, Akinori; Yamamoto, Shinichi; Wang, Bing; Tanaka, Kaoru; Suzuki, Norio; Aoki, Shin; Ito, Azusa; Nanao, Tomohisa; Ohya, Soichiro; Yoshino, Minako; Zhu, Jin; Enomoto, Atsushi; Matsumoto, Yoshihisa; Funatsu, Osamu; Hosoi, Yoshio; Ikekita, Masahiko


    Sodium orthovanadate (vanadate) inhibits the DNA-binding activity of p53, but its precise effects on p53 function have not been examined. Here, we show that vanadate exerts a potent antiapoptotic activity through both transcription-dependent and transcription-independent mechanisms relative to other p53 inhibitors, including pifithrin (PFT) alpha. We compared the effects of vanadate to PFTalpha and PFTmicro, an inhibitor of transcription-independent apoptosis by p53. Vanadate suppressed p53-associated apoptotic events at the mitochondria, including the loss of mitochondrial membrane potential, the conformational change of Bax and Bak, the mitochondrial translocation of p53, and the interaction of p53 with Bcl-2. Similarly, vanadate suppressed the apoptosis-inducing activity of a mitochondrially targeted temperature-sensitive p53 in stable transfectants of SaOS-2 cells. In radioprotection assays, which rely on p53, vanadate completely protected mice from a sublethal dose of 8 Gy and partially from a lethal dose of 12 Gy. Together, our findings indicated that vanadate effectively suppresses p53-mediated apoptosis by both transcription-dependent and transcription-independent pathways, and suggested that both pathways must be inhibited to completely block p53-mediated apoptosis. PMID:20048077

  16. Restoring p53 function in cancer: novel therapeutic approaches for applying the brakes to tumorigenesis.


    Di Cintio, Alessandra; Di Gennaro, Elena; Budillon, Alfredo


    p53 tumor suppressor gene encodes for a critical cellular protein that regulate the integrity of the cell and can induce cell cycle arrest and/or apoptosis upon cellular stresses of several origins, including chemotherapeutics. Loss of p53 function occurs in an estimated 50% of all cancers by mutations and deletions while in the presence of wild-type p53 alleles other mechanisms may affect the expression and activity of p53. Alternate mechanisms include methylation of the promoter of p53, deletion or epigenetic inactivation of the p53-positive regulator p14/ARF, elevated expression of the p53 regulators murine double minute 2 (MDM2) and MDMX, or alteration of upstream regulators of p53 such as the kinase ATM. MDM2 is a p53 E3 ubiquitin ligase that mediates the ubiquitin-dependent degradation of p53 while p14/ARF is a small MDM2-binding protein that controls the activity of MDM2 by displacing p53 and preventing its degradation. MDMX antagonize p53-dependent transcriptional control by interfering with p53 transactivation function. The understanding of the key role of p53 inactivation in cancer development generated considerable interest in developing compounds that are capable of restoring the p53 functions. Several patents have been issued on such compounds. Adenovirus-based p53 gene therapy as well as small molecules such as PRIMA that can restore the transcriptional transactivation function to mutant p53, or NUTLIN and RITA that interfere with MDM2-directed p53 degradation, have tested in a preclinical setting and some of these approaches are currently in clinical development. PMID:19663772

  17. Transcriptional repressor NIR interacts with the p53-inhibiting ubiquitin ligase MDM2

    PubMed Central

    Heyne, Kristina; Förster, Juliane; Schüle, Roland; Roemer, Klaus


    NIR (novel INHAT repressor) can bind to p53 at promoters and inhibit p53-mediated gene transactivation by blocking histone acetylation carried out by p300/CBP. Like NIR, the E3 ubiquitin ligase MDM2 can also bind and inhibit p53 at promoters. Here, we present data indicating that NIR, which shuttles between the nucleolus and nucleoplasm, not only binds to p53 but also directly to MDM2, in part via the central acidic and zinc finger domain of MDM2 that is also contacted by several other nucleolus-based MDM2/p53-regulating proteins. Like some of these, NIR was able to inhibit the ubiquitination of MDM2 and stabilize MDM2; however, unlike these nucleolus-based MDM2 regulators, NIR did not inhibit MDM2 to activate p53. Rather, NIR cooperated with MDM2 to repress p53-induced transactivation. This cooperative repression may at least in part involve p300/CBP. We show that NIR can block the acetylation of p53 and MDM2. Non-acetylated p53 has been documented previously to more readily associate with inhibitory MDM2. NIR may thus help to sustain the inhibitory p53:MDM2 complex, and we present evidence suggesting that all three proteins can indeed form a ternary complex. In sum, our findings suggest that NIR can support MDM2 to suppress p53 as a transcriptional activator. PMID:24413661

  18. DNA-mediated oxidation of p53.


    Schaefer, Kathryn N; Barton, Jacqueline K


    Transcription factor p53 is the most commonly altered gene in human cancer. As a redox-active protein in direct contact with DNA, p53 can directly sense oxidative stress through DNA-mediated charge transport. Electron hole transport occurs over long distances through the π-stacked bases and leads to the oxidative dissociation of p53. The extent of protein dissociation depends upon the redox potential of the DNA in direct contact with each p53 monomer. The DNA sequence dependence of p53 oxidative dissociation was examined by electrophoretic mobility shift assays using oligonucleotides containing both synthetic and human p53 consensus sequences with an appended photooxidant, anthraquinone. Greater p53 dissociation is observed from sequences containing low-redox potential purine regions, particularly guanine triplets. Using denaturing polyacrylamide gel electrophoresis of irradiated anthraquinone-modified DNA, the DNA damage sites corresponding to sites of preferred electron hole localization were determined. The resulting DNA damage preferentially localizes to guanine doublets and triplets. Oxidative DNA damage is inhibited in the presence of p53, but only at sites in direct contact with p53. From these data, predictions about the sensitivity of human p53-binding sites to oxidative stress as well as possible biological implications have been made. On the basis of our data, the guanine pattern within the purine region of each p53-binding site determines the response of p53 to DNA oxidation, yielding for some sequences the oxidative dissociation of p53 from a distance and thereby providing another potential role for DNA charge transport chemistry within the cell. PMID:24853816

  19. p53 mutation heterogeneity in cancer

    SciTech Connect

    Soussi, T. . E-mail:; Lozano, G.


    The p53 gene is inactivated in about 50% of human cancers and the p53 protein is an essential component of the cell response induced by genotoxic stresses such as those generated by radiotherapy or chemotherapy. It is therefore highly likely that these alterations are an important component in tumor resistance to therapy. The particular characteristics of these alterations, 80% of which are missense mutations leading to functionally heterogeneous proteins, make p53 a unique gene in the class of tumor suppressor genes. A considerable number of mutant p53 proteins probably have an oncogenic activity per se and therefore actively participate in cell transformation. The fact that the apoptotic and antiproliferative functions of p53 can be dissociated in certain mutants also suggests another level of complexity in the relationships between p53 inactivation and neoplasia.

  20. Mutant p53: one name, many proteins

    PubMed Central

    Freed-Pastor, William A.; Prives, Carol


    There is now strong evidence that mutation not only abrogates p53 tumor-suppressive functions, but in some instances can also endow mutant proteins with novel activities. Such neomorphic p53 proteins are capable of dramatically altering tumor cell behavior, primarily through their interactions with other cellular proteins and regulation of cancer cell transcriptional programs. Different missense mutations in p53 may confer unique activities and thereby offer insight into the mutagenic events that drive tumor progression. Here we review mechanisms by which mutant p53 exerts its cellular effects, with a particular focus on the burgeoning mutant p53 transcriptome, and discuss the biological and clinical consequences of mutant p53 gain of function. PMID:22713868

  1. A p53 growth arrest protects fibroblasts from anticancer agents.


    McCormack, E S; Bruskin, A M; Borzillo, G V


    Reversible inhibitors of the cell cycle such as the TGF-betas have been exploited to protect dividing cells from exposure to anticancer drugs and radiation. Here, rat embryo fibroblast (REF) lines expressing different p53 mutations were used to test whether the p53 growth arrest could also chemoprotect cells from high doses of anticancer drugs. Whereas the doubling times of the different REF lines at 37 degrees C were similar, cells bearing temperature-sensitive mutations (mouse 135V or human 143A) were growth arrested at 31 degrees C. Temperature-dependent p53 activity was associated with increased levels of MDM2 and p21/WAF1, and the induction of an integrated p53-responsive luciferase gene. The REF lines exhibited similar sensitivities to common anticancer drugs when grown at 37 degrees C. However, when exposed to the same agents following transient incubation at 31 degrees C, the p53-arrested cells exhibited a marked survival advantage as shown by colony-forming assays. Chemoprotection was not universal, in that colony formation was not enhanced significantly after treatment with cisplatin or 5-fluorouracil, two drugs which can cause cellular damage throughout the cell cycle. Like other negative growth regulators, an activated p53 checkpoint may mediate the survival of cells exposed to drugs that target DNA synthesis or mitosis. PMID:9351895

  2. FAK and p53 protein interactions.


    Golubovskaya, Vita M; Cance, William G


    Focal Adhesion Kinase plays a major role in cell adhesion, motility, survival, proliferation, metastasis, angiogenesis and lymphangiogenesis. In 2004, we have cloned the promoter sequence of FAK and found that p53 inhibits its activity (BBA, v. 1678, 2004). In 2005, we were the first group to show that FAK and p53 proteins directly interact in the cells (JBC, v. 280, 2005). We have shown that FAK and p53 proteins interact in the cytoplasm and in the nucleus by immunoprecipitation, pull-down and confocal microscopy assays. We have shown that FAK inhibited activity of p53 with the transcriptional targets: p21, Bax and Mdm-2 through protein-protein interactions. We identified the 7 amino-acid site in p53 that is involved in interaction with FAK protein. The present review will discuss the interaction of FAK and p53 proteins and discuss the mechanism of FAK-p53 loop regulation: inhibition of FAK promoter activity by p53 protein and also inhibition of p53 transcriptional activity by FAK protein. PMID:21355845

  3. The E7 protein of the cottontail rabbit papillomavirus immortalizes normal rabbit keratinocytes and reduces pRb levels, while E6 cooperates in immortalization but neither degrades p53 nor binds E6AP

    SciTech Connect

    Ganzenmueller, Tina; Matthaei, Markus; Muench, Peter; Scheible, Michael; Iftner, Angelika; Hiller, Thomas; Leiprecht, Natalie; Probst, Sonja; Stubenrauch, Frank; Iftner, Thomas


    Human papillomaviruses (HPVs) cause cervical cancer and are associated with the development of non-melanoma skin cancer. A suitable animal model for papillomavirus-associated skin carcinogenesis is the infection of domestic rabbits with the cottontail rabbit papillomavirus (CRPV). As the immortalizing activity of CRPV genes in the natural target cells remains unknown, we investigated the properties of CRPV E6 and E7 in rabbit keratinocytes (RK) and their influence on the cell cycle. Interestingly, CRPV E7 immortalized RK after a cellular crisis but showed no such activity in human keratinocytes. Co-expressed CRPV E6 prevented cellular crisis. The HPV16 or CRPV E7 protein reduced rabbit pRb levels thereby causing rabbit p19{sup ARF} induction and accumulation of p53 without affecting cellular proliferation. Both CRPV E6 proteins failed to degrade rabbit p53 in vitro or to bind E6AP; however, p53 was still inducible by mitomycin C. In summary, CRPV E7 immortalizes rabbit keratinocytes in a species-specific manner and E6 contributes to immortalization without directly affecting p53.

  4. The p53-dependent radioadaptive response

    NASA Astrophysics Data System (ADS)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  5. Mitochondrial death functions of p53

    PubMed Central

    Marchenko, N D; Moll, U M


    The p53 tumor suppressor network plays a fundamental surveillance role in both homeostatic and adaptive cell biology. p53 is one of the most important barriers against malignant derailment of normal cells, orchestrating growth arrest, senescence, or cell death by linking many different pathways in response to genotoxic and non-genotoxic insults. p53 is the key broadband sensor for numerous cellular stresses such as DNA damage, hypoxia, oxidative stress, oncogenic signaling, and nucleolar stress. The crucial tumor suppressive and tissue homeostasis activity of p53 is its ability to activate cell death via multiple different pathways. A well-characterized biochemical function of p53 in the regulation of apoptosis is its role as a potent transcriptional regulator. p53 activates a panel of proapoptotic genes from the mitochondrial apoptotic and death receptor programs while repressing antiapoptotic Bcl2 family genes. In addition, over the last 10 y a growing body of evidence has also defined direct extranuclear non-transcriptional p53 activities within mitochondria-mediated cell death pathways that are based on p53 protein accumulation in cytosolic and mitochondrial compartments and protein-protein interactions. To date, transcription-independent p53-mediated cell death regulation has been described for apoptosis, necrosis, and autophagy. Because mitochondrial dysregulation is central to the development of a number of pathologic processes such as cancer and neurodegenerative and age-related diseases, understanding the direct roles of p53 protein in mitochondria has high translational impact and could facilitate the development of novel drug targets to combat these diseases. In this review we will mainly focus on mechanisms of p53-mediated transcription-independent cell death pathways at mitochondria. PMID:27308326

  6. The transcription factor CREBZF is a novel positive regulator of p53

    PubMed Central

    López-Mateo, Irene; Villaronga, M. Ángeles; Llanos, Susana; Belandia, Borja


    CREBZF is a member of the mammalian ATF/CREB family of transcription factors. Here, we describe a novel functional interaction between CREBZF and the tumor suppressor p53. CREBZF was identified in a yeast two-hybrid screen using HEY1, recently characterized as an indirect p53 activator, as bait. CREBZF interacts in vitro with both HEY1 and p53, and CREBZF expression stabilizes and activates p53. Moreover, CREBZF cooperates synergistically with HEY1 to enhance p53 transcriptional activity. On the other hand, partial depletion of endogenous CREBZF diminishes p53 protein levels and inhibits HEY1-mediated activation of p53. CREBZF-positive effects on p53 signaling may reflect, at least in part, an observed induction of posttranslational modifications in p53 known to prevent its degradation. CREBZF expression protects HCT116 cells from UV radiation-induced cell death. In addition, CREBZF expression confers sensitivity to 5-fluorouracil, a p53-activating chemotherapeutic drug. Our study suggests that CREBZF may participate in the modulation of p53 tumor suppressor function. PMID:22983008

  7. The transcription factor CREBZF is a novel positive regulator of p53.


    López-Mateo, Irene; Villaronga, M Ángeles; Llanos, Susana; Belandia, Borja


    CREBZF is a member of the mammalian ATF/CREB family of transcription factors. Here, we describe a novel functional interaction between CREBZF and the tumor suppressor p53. CREBZF was identified in a yeast two-hybrid screen using HEY1, recently characterized as an indirect p53 activator, as bait. CREBZF interacts in vitro with both HEY1 and p53, and CREBZF expression stabilizes and activates p53. Moreover, CREBZF cooperates synergistically with HEY1 to enhance p53 transcriptional activity. On the other hand, partial depletion of endogenous CREBZF diminishes p53 protein levels and inhibits HEY1-mediated activation of p53. CREBZF-positive effects on p53 signaling may reflect, at least in part, an observed induction of posttranslational modifications in p53 known to prevent its degradation. CREBZF expression protects HCT116 cells from UV radiation-induced cell death. In addition, CREBZF expression confers sensitivity to 5-fluorouracil, a p53-activating chemotherapeutic drug. Our study suggests that CREBZF may participate in the modulation of p53 tumor suppressor function. PMID:22983008

  8. Lysosomal destabilization in p53-induced apoptosis

    PubMed Central

    Yuan, Xi-Ming; Li, Wei; Dalen, Helge; Lotem, Joseph; Kama, Rachel; Sachs, Leo; Brunk, Ulf T.


    The tumor suppressor wild-type p53 can induce apoptosis. M1-t-p53 myeloid leukemic cells have a temperature-sensitive p53 protein that changes its conformation to wild-type p53 after transfer from 37°C to 32°C. We have now found that these cells showed an early lysosomal rupture after transfer to 32°C. Mitochondrial damage, including decreased membrane potential and release of cytochrome c, and the appearance of apoptotic cells occurred later. Lysosomal rupture, mitochondrial damage, and apoptosis were all inhibited by the cytokine IL-6. Some other compounds can also inhibit apoptosis induced by p53. The protease inhibitor N-tosyl-l-phenylalanine chloromethyl ketone inhibited the decrease in mitochondrial membrane potential and cytochrome c release, the Ca2+-ATPase inhibitor thapsigargin inhibited only cytochrome c release, and the antioxidant butylated hydroxyanisole inhibited only the decrease in mitochondrial membrane potential. In contrast to IL-6, these other compounds that inhibited some of the later occurring mitochondrial damage did not inhibit the earlier p53-induced lysosomal damage. The results indicate that apoptosis is induced by p53 through a lysosomal-mitochondrial pathway that is initiated by lysosomal destabilization, and that this pathway can be dissected by using different apoptosis inhibitors. These findings on the induction of p53-induced lysosomal destabilization can also help to formulate new therapies for diseases with apoptotic disorders. PMID:11959917

  9. Regulation of P53 stability in p53 mutated human and mouse hepatoma cells.


    Hailfinger, Stephan; Jaworski, Maike; Marx-Stoelting, Philip; Wanke, Ines; Schwarz, Michael


    The tumor suppressor p53 is frequently mutated in cancer. We have investigated the regulation of P53 in p53 wild type mouse hepatoma cells (line 55.1c), in p53 heterozygeously mutated cells (56.1b) and in p53 defective cells (lines 56.1d, 70.4 and HUH7) under various experimental settings. The basal levels of P53 were low in 55.1c cells, but nuclear accumulation occurred upon UV-irradiation. Similarly, UV-exposure induced stabilization of P53 in the heterozygeously p53 mutated 56.1b hepatoma cells. By contrast, the 3 hepatoma lines, which lack transcriptionally active P53, demonstrated high basal nuclear concentrations of P53 protein and, unexpectedly, showed loss of P53 upon UV-irradiation. Expression of p53 mRNA was also decreased in p53 defective cells after 24 hr post UV-irradiation, which may be linked to induction of apoptosis of the irradiated cells under these conditions. Other stressors like H2O2 also mediated a decrease in P53 concentration in p53 defective cells. This effect occurred at very low concentrations and was already detectable 1-2 hr after exposure of cells. There were no signs of apoptosis of H2O2-exposed cells at this time point and no significant changes in p53 mRNA or MDM2 level. These unexpected findings indicate a new aspect related to regulation of P53 stability in cells with a defect in the tumor suppressor protein. PMID:17205518

  10. Microbial Regulation of p53 Tumor Suppressor.


    Zaika, Alexander I; Wei, Jinxiong; Noto, Jennifer M; Peek, Richard M


    p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40). Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections. PMID:26379246

  11. Microbial Regulation of p53 Tumor Suppressor

    PubMed Central

    Zaika, Alexander I.; Wei, Jinxiong; Noto, Jennifer M.; Peek, Richard M.


    p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40). Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host–bacteria interactions and tumorigenesis associated with bacterial infections. PMID:26379246

  12. The heme-p53 interaction: Linking iron metabolism to p53 signaling and tumorigenesis.


    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Xie, Dong; Wang, Fudi; Hu, Ronggui


    Recently, we reported that heme binds to tumor suppressor p53 protein (TP53, best known as p53) and promotes its nuclear export and cytosolic degradation, whereas iron chelation stabilizes p53 protein and suppresses tumors in a p53-dependent manner. This not only provides mechanistic insights into tumorigenesis associated with iron excess, but also helps guide the administration of chemotherapy based on iron deprivation in the clinic. PMID:27308524

  13. The heme–p53 interaction: Linking iron metabolism to p53 signaling and tumorigenesis

    PubMed Central

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Xie, Dong; Wang, Fudi; Hu, Ronggui


    Recently, we reported that heme binds to tumor suppressor p53 protein (TP53, best known as p53) and promotes its nuclear export and cytosolic degradation, whereas iron chelation stabilizes p53 protein and suppresses tumors in a p53-dependent manner. This not only provides mechanistic insights into tumorigenesis associated with iron excess, but also helps guide the administration of chemotherapy based on iron deprivation in the clinic. PMID:27308524

  14. Expression of p53β and Δ133p53 isoforms in different gastric tissues

    PubMed Central

    Ji, Wansheng; Zhang, Na; Zhang, Hongmei; Ma, Jingrong; Zhong, Hua; Jiao, Jianxin; Gao, Zhixing


    This study aims to detect the mRNA of p53β and Δ133p53 isoforms in three gastric carcinoma cell lines and tissues of superficial gastritis, atrophic gastritis, gastric carcinoma, or paracancerous area. Nested reverse transcription PCR was used to detect the mRNA of p53β and Δ133p53 isoforms in tissues of superficial gastritis, chronic atrophic gastritis, gastric cancer cell lines (SGC-7901, MKN45, KATO III), gastric adenocarcinoma, and paracancerous lesion. The amplified products were shown by agarose gel electrophoresis. The expression difference among various tissues was analyzed by x2 tests. The positive rates of ∆133p53 mRNA were 73.3% (11/15) in gastric adenocarcinoma and 20% (3/15) in paracancerous tissue, whereas the positive rates of p53β mRNA were 20% (3/15) in gastric adenocarcinoma and 66.7% (10/15) in paracancerous tissue. The difference between adenocarcinoma and paracancerous tissues was significant (P<0.05). The positive rates of ∆133p53 mRNA were 25% (5/20), 50% (15/30), and 75% (15/20), respectively, in superficial gastritis, atrophic gastritis, and gastric adenocarcinoma; the positive rates of p53β mRNA were 65% (13/20), 33.3% (10/30), and 25% (5/20), respectively, in superficial gastritis, atrophic gastritis, and gastric adenocarcinoma. The difference between adenocarcinoma and superficial gastritis samples was significant (P<0.05). Both p53β and ∆133p53 mRNAs were positive in MKN45; only p53β mRNA was detected in SGC7901; neither p53β nor ∆133p53 mRNA was detected in KATO III. ∆133p53 and p53β, which are possible indicators for the diagnosis and biological therapy of gastric carcinoma, were expressed differentially in different gastric tissues. PMID:26617756

  15. Simian virus 40 T antigen can regulate p53-mediated transcription independent of binding p53.

    PubMed Central

    Rushton, J J; Jiang, D; Srinivasan, A; Pipas, J M; Robbins, P D


    A simian virus 40 (SV40) T-antigen mutant containing only the N-terminal 136 amino acids, able to bind to Rb and p300 but not p53, partially inhibited p53-mediated transcription without affecting the ability of p53 to bind DNA. These results suggest that SV40 T antigen can regulate p53-mediated transcription either directly through protein-protein association or indirectly through interaction with factors which may function to confer p53-mediated transcription. PMID:9188637

  16. Genome-wide analysis of the p53 gene regulatory network in the developing mouse kidney

    PubMed Central

    Li, Yuwen; Liu, Jiao; McLaughlin, Nathan; Bachvarov, Dimcho; El-Dahr, Samir S.


    Despite mounting evidence that p53 senses and responds to physiological cues in vivo, existing knowledge regarding p53 function and target genes is largely derived from studies in cancer or stressed cells. Herein we utilize p53 transcriptome and ChIP-Seq (chromatin immunoprecipitation-high throughput sequencing) analyses to identify p53 regulated pathways in the embryonic kidney, an organ that develops via mesenchymal-epithelial interactions. This integrated approach allowed identification of novel genes that are possible direct p53 targets during kidney development. We find the p53-regulated transcriptome in the embryonic kidney is largely composed of genes regulating developmental, morphogenesis, and metabolic pathways. Surprisingly, genes in cell cycle and apoptosis pathways account for <5% of differentially expressed transcripts. Of 7,893 p53-occupied genomic regions (peaks), the vast majority contain consensus p53 binding sites. Interestingly, 78% of p53 peaks in the developing kidney lie within proximal promoters of annotated genes compared with 7% in a representative cancer cell line; 25% of the differentially expressed p53-bound genes are present in nephron progenitors and nascent nephrons, including key transcriptional regulators, components of Fgf, Wnt, Bmp, and Notch pathways, and ciliogenesis genes. The results indicate widespread p53 binding to the genome in vivo and context-dependent differences in the p53 regulon between cancer, stress, and development. To our knowledge, this is the first comprehensive analysis of the p53 transcriptome and cistrome in a developing mammalian organ, substantiating the role of p53 as a bona fide developmental regulator. We conclude p53 targets transcriptional networks regulating nephrogenesis and cellular metabolism during kidney development. PMID:24003036

  17. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.


    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto


    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  18. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.


    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel


    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  19. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53

    PubMed Central

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Casanova, M. Llanos; Paramio, Jesús M.; Bravo, Ana; Ramirez, Angel


    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  20. Development of an adenoviral vector with robust expression driven by p53

    SciTech Connect

    Bajgelman, Marcio C.; Strauss, Bryan E.


    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG served as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.

  1. 2-Phenylethynesulfonamide (PES) uncovers a necrotic process regulated by oxidative stress and p53.


    Mattiolo, Paolo; Barbero-Farran, Ares; Yuste, Víctor J; Boix, Jacint; Ribas, Judit


    2-Phenylethynesulfonamide (PES) or pifithrin-μ is a promising anticancer agent with preferential toxicity for cancer cells. The type of cell death and the molecular cascades activated by this compound are controversial. Here, we demonstrate PES elicits a caspase- and BAX/BAK-independent non-necroptotic necrotic cell death, since it is not inhibited by necrostatin-1. This process is characterized by an early generation of reactive oxygen species (ROS) resulting in p53 up-regulation. Accordingly, thiolic antioxidants protect cells from PES-induced death. Furthermore, inhibiting the natural sources of glutathione with l-buthionine-sulfoximine (BSO) strongly cooperates with PES in triggering cytotoxicity. Genetically modified p53-null or p53 knocked-down cells show resistance to PES-driven necrosis. The predominant localization of p53 in chromatin-enriched fractions added to the up-regulation of the p53-responsive gene p21, strongly suggest the involvement of a transcription-dependent p53 program. On the other hand, we report an augmented production of ROS in p53-positive cells that, added to the increased p53 content in response to PES-elicited ROS, suggests that p53 and ROS are mutually regulated in response to PES. In sum, p53 up-regulation by ROS triggers a positive feedback loop responsible of further increasing ROS production and reinforcing PES-driven non-necroptotic necrosis. PMID:25139326

  2. p53 loss promotes acute myeloid leukemia by enabling aberrant self-renewal

    PubMed Central

    Zhao, Zhen; Zuber, Johannes; Diaz-Flores, Ernesto; Lintault, Laura; Kogan, Scott C.; Shannon, Kevin; Lowe, Scott W.


    The p53 tumor suppressor limits proliferation in response to cellular stress through several mechanisms. Here, we test whether the recently described ability of p53 to limit stem cell self-renewal suppresses tumorigenesis in acute myeloid leukemia (AML), an aggressive cancer in which p53 mutations are associated with drug resistance and adverse outcome. Our approach combined mosaic mouse models, Cre-lox technology, and in vivo RNAi to disable p53 and simultaneously activate endogenous KrasG12D—a common AML lesion that promotes proliferation but not self-renewal. We show that p53 inactivation strongly cooperates with oncogenic KrasG12D to induce aggressive AML, while both lesions on their own induce T-cell malignancies with long latency. This synergy is based on a pivotal role of p53 in limiting aberrant self-renewal of myeloid progenitor cells, such that loss of p53 counters the deleterious effects of oncogenic Kras on these cells and enables them to self-renew indefinitely. Consequently, myeloid progenitor cells expressing oncogenic Kras and lacking p53 become leukemia-initiating cells, resembling cancer stem cells capable of maintaining AML in vivo. Our results establish an efficient new strategy for interrogating oncogene cooperation, and provide strong evidence that the ability of p53 to limit aberrant self-renewal contributes to its tumor suppressor activity. PMID:20595231

  3. Expression of p53 in endometrial polyps with special reference to the p53 signature.


    Sho, Tomoko; Hachisuga, Toru; Kawagoe, Toshinori; Urabe, Rie; Kurita, Tomoko; Kagami, Seiji; Shimajiri, Shohei; Fujino, Yoshihisa


    We herein examined the significance of the p53 expression in endometrial polyps (EMPs). A total of 133 EMPs, including 62 premenopausal and 71 postmenopausal women with EMP, were immunohistochemically studied for the expression of estrogen receptor (ER)-alpha, Ki-67 and p53. Apoptotic cells were identified using a TUNEL assay. A DNA sequence analysis of TP53 exons 5 to 9 was performed. Among the premenopausal EMPs, a multivariate analysis showed the labeling index (LI) for Ki-67 to correlate significantly with that for p53 (P<0.001), but not that for apoptosis. On the contrary, among the postmenopausal EMPs, the LI for Ki-67 correlated significantly with that for apoptosis (P<0.001). The p53 signature (p53S) was defined by endometrial epithelial cells, which are morphologically benign in appearance but display 12 or more consecutive epithelial cell nuclei with strong p53 immunostaining. The p53S was found in nine (12.7%) postmenopausal EMPs (mean age: 70.2 years). The median Ki-67 index for the p53S was 7%, with no significant difference from that of the glands of the postmenopausal EMPs without the p53S (P=0.058). The median apoptotic index for the p53S was 0%, which was significantly lower than that of the postmenopausal EMPs without the p53S (P=0.002). Two of four p53Ss showed TP53 mutations according to the DNA sequence analysis. The presence of the p53S is not rare in postmenopausal EMPs with an advanced age. Among postmenopausal EMPs, the LI of Ki-67 significantly correlates with that of apoptosis. However, such a positive correlation between the LI of Ki-67 and apoptosis is not observed in p53S. PMID:26727623

  4. p53, Stem Cells, and Reprogramming

    PubMed Central

    Spike, Benjamin T.; Wahl, Geoffrey M.


    p53 is well recognized as a potent tumor suppressor. In its classic role, p53 responds to genotoxic insults by inducing cell cycle exit or programmed cell death to limit the propagation of cells with corrupted genomes. p53 is also implicated in a variety of other cellular processes in which its involvement is less well understood including self-renewal, differentiation, and reprogramming. These activities represent an emerging area of intense interest for cancer biologists, as they provide potential mechanistic links between p53 loss and the stem cell–like cellular plasticity that has been suggested to contribute to tumor cell heterogeneity and to drive tumor progression. Despite accumulating evidence linking p53 loss to stem-like phenotypes in cancer, it is not yet understood how p53 contributes to acquisition of “stemness” at the molecular level. Whether and how stem-like cells confer survival advantages to propagate the tumor also remain to be resolved. Furthermore, although it seems reasonable that the combination of p53 deficiency and the stem-like state could contribute to the genesis of cancers that are refractory to treatment, direct linkages and mechanistic underpinnings remain under investigation. Here, we discuss recent findings supporting the connection between p53 loss and the emergence of tumor cells bearing functional and molecular similarities to stem cells. We address several potential molecular and cellular mechanisms that may contribute to this link, and we discuss implications of these findings for the way we think about cancer progression. PMID:21779509

  5. Nucleolar stress with and without p53.


    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick


    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell's energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  6. Nucleolar stress with and without p53

    PubMed Central

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick


    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell’s energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  7. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui


    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  8. p53-directed translational control can shape and expand the universe of p53 target genes

    PubMed Central

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A


    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  9. p53-directed translational control can shape and expand the universe of p53 target genes.


    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A


    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  10. The role of p53 in ribosomopathies.


    Fumagalli, Stefano; Thomas, George


    Impaired ribosome biogenesis is the underlying cause of the pathological conditions collectively known as ribosomopathies. Several hypotheses have been advanced to explain the mechanisms by which deficiencies in ribosome biogenesis interfere with developmental processes leading eventually to the emergence of these diseases. In recent years it has become clear that perturbation of this process triggers a cell-cycle checkpoint that, through activation of the tumor-suppressor p53, leads to cell-cycle arrest and apoptosis. Indeed, evidence is accumulating from studies in animal models that the unscheduled activation of p53 is responsible for perturbations in tissue homeostasis that cause the development of ribosomopathies such as Treacher-Collins syndrome (TCS) and 5q(-) syndrome. These findings imply that inhibition of p53, or better, of mechanisms that specifically lead to p53 activation in response to inhibition of ribosome biogenesis, could be targeted in the treatment of ribosomopathies where activation of p53 is shown to play a pathogenic role. PMID:21435506

  11. TRIM32 is a novel negative regulator of p53.


    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui


    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  12. TRIM32 is a novel negative regulator of p53

    PubMed Central

    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui


    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  13. Developing Integrated Curricula: Academic and Vocational Cooperation.

    ERIC Educational Resources Information Center

    Barbieri, Marty J.; Wircenski, Jerry L.


    A University of North Texas project used a team approach to develop a curriculum integrating academic subjects into vocational curricula. Ten teachers cooperated on integrated junior high/middle school lesson plans and classroom support activities. (JOW)

  14. p53 and rapamycin are additive

    PubMed Central

    Campisi, Judith; Huang, Jing; Jones, Diane; Dodds, Sherry G.; Williams, Charnae; Hubbard, Gene; Livi, Carolina B.; Gao, Xiaoli; Weintraub, Susan; Curiel, Tyler; Sharp, Z. Dave; Hasty, Paul


    Mechanistic target of rapamycin (mTOR) is a kinase found in a complex (mTORC1) that enables macromolecular synthesis and cell growth and is implicated in cancer etiology. The rapamycin-FK506 binding protein 12 (FKBP12) complex allosterically inhibits mTORC1. In response to stress, p53 inhibits mTORC1 through a separate pathway involving cell signaling and amino acid sensing. Thus, these different mechanisms could be additive. Here we show that p53 improved the ability of rapamycin to: 1) extend mouse life span, 2) suppress ionizing radiation (IR)-induced senescence-associated secretory phenotype (SASP) and 3) increase the levels of amino acids and citric acid in mouse embryonic stem (ES) cells. This additive effect could have implications for cancer treatment since rapamycin and p53 are anti-oncogenic. PMID:26158292

  15. p53 Suppresses Tetraploid Development in Mice

    PubMed Central

    Horii, Takuro; Yamamoto, Masamichi; Morita, Sumiyo; Kimura, Mika; Nagao, Yasumitsu; Hatada, Izuho


    Mammalian tetraploid embryos die in early development because of defects in the epiblast. Experiments with diploid/tetraploid chimeric mice, obtained via the aggregation of embryonic stem cells, clarified that while tetraploid cells are excluded from epiblast derivatives, diploid embryos with tetraploid extraembryonic tissues can develop to term. Today, this method, known as tetraploid complementation, is usually used for rescuing extraembryonic defects or for obtaining completely embryonic stem (ES) cell-derived pups. However, it is still unknown why defects occur in the epiblast during mammalian development. Here, we demonstrated that downregulation of p53, a tumour suppressor protein, rescued tetraploid development in the mammalian epiblast. Tetraploidy in differentiating epiblast cells triggered p53-dependent cell-cycle arrest and apoptosis, suggesting the activation of a tetraploidy checkpoint during early development. Finally, we found that p53 downregulation rescued tetraploid embryos later in gestation. PMID:25752699

  16. EBNA3C regulates p53 through induction of Aurora kinase B.


    Jha, Hem C; Yang, Karren; El-Naccache, Darine W; Sun, Zhiguo; Robertson, Erle S


    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  17. A defect in the p53 response pathway induced by de novo purine synthesis inhibition.


    Bronder, Julie L; Moran, Richard G


    p53 is believed to sense cellular ribonucleotide depletion in the absence of DNA strand breaks and to respond by imposition of a p21-dependent G1 cell cycle arrest. We now report that the p53-dependent G1 checkpoint is blocked in human carcinoma cell lines after inhibition of de novo purine synthesis by folate analogs inhibitory to glycinamide ribonucleotide formyltransferase (GART). p53 accumulated in HCT116, MCF7, or A549 carcinoma cells upon GART inhibition, but, surprisingly, transcription of several p53 targets, including p21cip1/waf1, was impaired. The mechanism of this defect was examined. The p53 accumulating in these cells was nuclear but was not phosphorylated at serines 6, 15, and 20, nor was it acetylated at lysines 373 or 382. The DDATHF-stabilized p53 bound to the p21 promoter in vitro and in vivo but did not activate histone acetylation over the p53 binding sites in the p21 promoter that is an integral part of the transcriptional response mediated by the DNA damage pathway. We concluded that the robust initial response of the p53 pathway to GART inhibitors is not transcriptionally propagated to target genes due to a defect in p53 post-translational modifications and a failure to open chromatin structure despite promoter binding of this unmodified p53. PMID:14517211

  18. EBNA3C regulates p53 through induction of Aurora kinase B

    PubMed Central

    Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.


    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  19. Regulation of the p53 response and its relationship to cancer.


    Meek, David W


    p53 has been studied intensively as a major tumour suppressor that detects oncogenic events in cancer cells and eliminates them through senescence (a permanent non-proliferative state) or apoptosis. Consistent with this role, p53 activity is compromised in a high proportion of all cancer types, either through mutation of the TP53 gene (encoding p53) or changes in the status of p53 modulators. p53 has additional roles, which may overlap with its tumour-suppressive capacity, in processes including the DNA damage response, metabolism, aging, stem cell differentiation and fertility. Moreover, many mutant p53 proteins, termed 'gain-of-function' (GOF), acquire new activities that help drive cancer aggression. p53 is regulated mainly through protein turnover and operates within a negative-feedback loop with its transcriptional target, MDM2 (murine double minute 2), an E3 ubiquitin ligase which mediates the ubiquitylation and proteasomal degradation of p53. Induction of p53 is achieved largely through uncoupling the p53-MDM2 interaction, leading to elevated p53 levels. Various stress stimuli acting on p53 (such as hyperproliferation and DNA damage) use different, but overlapping, mechanisms to achieve this. Additionally, p53 activity is regulated through critical context-specific or fine-tuning events, mediated primarily through post-translational mechanisms, particularly multi-site phosphorylation and acetylation. In the present review, I broadly examine these events, highlighting their regulatory contributions, their ability to integrate signals from cellular events towards providing most appropriate response to stress conditions and their importance for tumour suppression. These are fascinating aspects of molecular oncology that hold the key to understanding the molecular pathology of cancer and the routes by which it may be tackled therapeutically. PMID:26205489

  20. Loss of P53 facilitates invasion and metastasis of prostate cancer cells.


    Wang, Yi; Zhang, Y X; Kong, C Z; Zhang, Z; Zhu, Y Y


    Prostate cancer is a lethal cancer for the invasion and metastasis in its earlier period. P53 is a tumor suppressor gene which plays a critical role on safeguarding the integrity of genome. However, loss of P53 facilitates or inhibits the invasion and metastasis of tumor is still suspended. In this study, we are going to explain whether loss of P53 affect the invasion and metastasis of prostate cancer cells. To explore whether loss of P53 influences the invasion and metastasis ability of prostate cancer cells, we first compared the invasion ability of si-P53 treated cells and control cells by wound healing, transwell assay, and adhesion assay. We next tested the activity of MMP-2, MMP-9, and MMP-14 by western blot and gelatin zymography. Moreover, we employed WB and IF to identify the EMT containing E-cad, N-cad, vimentin, etc. We also examined the expression of cortactin, cytoskeleton, and paxillin by immunofluorescence, and tested the expression of ERK and JNK by WB. Finally, we applied WB to detect the expression of FAK, Src, and the phosphorylation of them to elucidate the mechanism of si-P53 influencing invasion and metastasis. According to the inhibition rate of si-P53, we choose the optimized volume of si-P53. With the volume, we compare the invasion and metastasis ability of Du145 and si-P53 treated cells. We find si-P53 promotes the invasion and metastasis in prostate cancer cells, increases the expression and activity of MMP-2/9 and MMP-14. Also, si-P53 promotes EMT and cytoskeleton rearrangement. Further analyses explain that this effect is associated with FAK-Src signaling pathway. Loss of P53 promotes the invasion and metastasis ability of prostate cancer cells and the mechanism is correlated with FAK-Src signaling pathway. P53 is involved in the context of invasion and metastasis. PMID:23982184

  1. Autoantibody recognition mechanisms of p53 epitopes

    NASA Astrophysics Data System (ADS)

    Phillips, J. C.


    There is an urgent need for economical blood based, noninvasive molecular biomarkers to assist in the detection and diagnosis of cancers in a cost-effective manner at an early stage, when curative interventions are still possible. Serum autoantibodies are attractive biomarkers for early cancer detection, but their development has been hindered by the punctuated genetic nature of the ten million known cancer mutations. A landmark study of 50,000 patients (Pedersen et al., 2013) showed that a few p53 15-mer epitopes are much more sensitive colon cancer biomarkers than p53, which in turn is a more sensitive cancer biomarker than any other protein. The function of p53 as a nearly universal "tumor suppressor" is well established, because of its strong immunogenicity in terms of not only antibody recruitment, but also stimulation of autoantibodies. Here we examine dimensionally compressed bioinformatic fractal scaling analysis for identifying the few sensitive epitopes from the p53 amino acid sequence, and show how it could be used for early cancer detection (ECD). We trim 15-mers to 7-mers, and identify specific 7-mers from other species that could be more sensitive to aggressive human cancers, such as liver cancer. Our results could provide a roadmap for ECD.

  2. Repression of the antiapoptotic molecule galectin-3 by homeodomain-interacting protein kinase 2-activated p53 is required for p53-induced apoptosis.


    Cecchinelli, Barbara; Lavra, Luca; Rinaldo, Cinzia; Iacovelli, Stefano; Gurtner, Aymone; Gasbarri, Alessandra; Ulivieri, Alessandra; Del Prete, Fabrizio; Trovato, Maria; Piaggio, Giulia; Bartolazzi, Armando; Soddu, Silvia; Sciacchitano, Salvatore


    Galectin 3 (Gal-3), a member of the beta-galactoside binding lectin family, exhibits antiapoptotic functions, and its aberrant expression is involved in various aspects of tumor progression. Here we show that p53-induced apoptosis is associated with transcriptional repression of Gal-3. Previously, it has been reported that phosphorylation of p53 at Ser46 is important for transcription of proapoptotic genes and induction of apoptosis and that homeodomain-interacting protein kinase 2 (HIPK2) is specifically involved in these functions. We show that HIPK2 cooperates with p53 in Gal-3 repression and that this cooperation requires HIPK2 kinase activity. Gene-specific RNA interference demonstrates that HIPK2 is essential for repression of Gal-3 upon induction of p53-dependent apoptosis. Furthermore, expression of a nonrepressible Gal-3 prevents HIPK2- and p53-induced apoptosis. These results reveal a new apoptotic pathway induced by HIPK2-activated p53 and requiring repression of the antiapoptotic factor Gal-3. PMID:16738336

  3. Oncogenic Intra-p53 Family Member Interactions in Human Cancers

    PubMed Central

    Ferraiuolo, Maria; Di Agostino, Silvia; Blandino, Giovanni; Strano, Sabrina


    The p53 gene family members p53, p73, and p63 display several isoforms derived from the presence of internal promoters and alternative splicing events. They are structural homologs but hold peculiar functional properties. p53, p73, and p63 are tumor suppressor genes that promote differentiation, senescence, and apoptosis. p53, unlike p73 and p63, is frequently mutated in cancer often displaying oncogenic “gain of function” activities correlated with the induction of proliferation, invasion, chemoresistance, and genomic instability in cancer cells. These oncogenic functions are promoted either by the aberrant transcriptional cooperation of mutant p53 (mutp53) with transcription cofactors (e.g., NF-Y, E2F1, Vitamin D Receptor, Ets-1, NF-kB and YAP) or by the interaction with the p53 family members, p73 and p63, determining their functional inactivation. The instauration of these aberrant transcriptional networks leads to increased cell growth, low activation of DNA damage response pathways (DNA damage response and DNA double-strand breaks response), enhanced invasion, and high chemoresistance to different conventional chemotherapeutic treatments. Several studies have clearly shown that different cancers harboring mutant p53 proteins exhibit a poor prognosis when compared to those carrying wild-type p53 (wt-p53) protein. The interference of mutantp53/p73 and/or mutantp53/p63 interactions, thereby restoring p53, p73, and p63 tumor suppression functions, could be among the potential therapeutic strategies for the treatment of mutant p53 human cancers. PMID:27066457

  4. Genome-wide analysis of p53 transcriptional programs in B cells upon exposure to genotoxic stress in vivo

    PubMed Central

    Tonelli, Claudia; Morelli, Marco J.; Bianchi, Salvatore; Rotta, Luca; Capra, Thelma; Sabò, Arianna; Campaner, Stefano; Amati, Bruno


    The tumor suppressor p53 is a transcription factor that coordinates the cellular response to DNA damage. Here we provide an integrated analysis of p53 genomic occupancy and p53-dependent gene regulation in the splenic B and non-B cell compartments of mice exposed to whole-body ionizing radiation, providing insight into general principles of p53 activity in vivo. In unstressed conditions, p53 bound few genomic targets; induction of p53 by ionizing radiation increased the number of p53 bound sites, leading to highly overlapping profiles in the different cell types. Comparison of these profiles with chromatin features in unstressed B cells revealed that, upon activation, p53 localized at active promoters, distal enhancers, and a smaller set of unmarked distal regions. At promoters, recognition of the canonical p53 motif as well as binding strength were associated with p53-dependent transcriptional activation, but not repression, indicating that the latter was most likely indirect. p53-activated targets constituted the core of a cell type-independent response, superimposed onto a cell type-specific program. Core response genes included most of the known p53-regulated genes, as well as many new ones. Our data represent a unique characterization of the p53-regulated response to ionizing radiation in vivo. PMID:26372730

  5. Heavy-ion-induced mutations in the gpt delta transgenic mouse: effect of p53 gene knockout.


    Yatagai, Fumio; Kurobe, Toshihiro; Nohmi, Takehiko; Masumura, Ken-ichi; Tsukada, Teruyo; Yamaguchi, Hirotake; Kasai-Eguchi, Kiyomi; Fukunishi, Nobuhisa


    The influence of the loss of p53 gene on heavy-ion-induced mutations was examined by constructing a new line of transgenic mice, p53 knockout (p53(-/-)) gpt delta. In this mouse model, deletions in lambda DNA integrated into the mouse genome are preferentially selected as Spi(-) phages, which can then be subjected to molecular analysis. Mice were exposed to 10 Gy of whole-body carbon-ion irradiation. The carbon ions were accelerated to 135 MeV/u by the RIKEN Ring Cyclotron. The p53 defect markedly enhanced the Spi(-) mutant frequency (MF) in the kidneys of mice exposed to C-ion irradiation: the Spi(-) MF increased 4.4- and 2.8-fold over the background level after irradiation in p53(-/-) and p53(+/+) mice, respectively. There was no significant difference in the background Spi(-) MF between p53(-/-) and p53(+/+) mice. Sequence analysis of the Spi(-) mutants indicated that the enhancement of kidney Spi(-) MF in p53(-/-) mice was primarily due to an increase in complex or rearranged-type deletions. In contrast to the kidney, the p53 defect had no effect on the Spi(-) MF in liver: Spi(-) MF increased 3.0- and 2.7-fold after the irradiation in p53(-/-) and p53(+/+) mice, respectively. Our results suggest that p53 suppresses deletion mutations induced by heavy-ion irradiation in an organ-specific manner. PMID:12355556

  6. Mutant p53: Multiple Mechanisms Define Biologic Activity in Cancer

    PubMed Central

    Kim, Michael Paul; Zhang, Yun; Lozano, Guillermina


    The functional importance of p53 as a tumor suppressor gene is evident through its pervasiveness in cancer biology. The p53 gene is the most commonly altered gene in human cancer; however, not all genetic alterations are biologically equivalent. The majority of alterations involve p53 missense mutations that result in the production of mutant p53 proteins. Such mutant p53 proteins lack normal p53 function and may concomitantly gain novel functions, often with deleterious effects. Here, we review characterized mechanisms of mutant p53 gain of function in various model systems. In addition, we review mutant p53 addiction as emerging evidence suggests that tumors may depend on sustained mutant p53 activity for continued growth. We also discuss the role of p53 in stromal elements and their contribution to tumor initiation and progression. Lastly, current genetic mouse models of mutant p53 in various organ systems are reviewed and their limitations discussed. PMID:26618142

  7. Isolation, characterization and functional analysis of full length p53 cDNA from Bubalus bubalis.


    Singh, Minu; Aggarwal, Suruchi; Mohanty, Ashok K; Mukhopadhyay, Tapas


    p53 plays a pivotal role in maintaining the genomic integrity of the cell and has an important role in cellular transformation. We isolated and cloned a full length p53 cDNA (Bp53) from water buffalo in expression vectors designed to generate tagged proteins with FLAG or GFP. Bp53 was found to be 1161 nucleotide long and codes for 386 amino acid residues with 79% homology with human p53 containing 393 amino acids. Although Bp53 has some inherent differences in amino acid composition in different functional domains as compared to human p53 but the total electrostatic charge of amino acids has been maintained. Bp53 cDNA was transiently transfected in a p53 null human NSCLC cell line and as expected, it was predominantly localized in the nucleus. Besides, Bp53 effectively transactivates a number of target genes similar to human p53 and exerts most of its anti-tumorigenic potential in culture as observed in clonogenic and cell viability assays. Like human p53 mutants, core domain mutant version of Bp53 was found to be mis-localized to cytoplasm with diminished tumor suppressor activity. However, Bp53 appeared to be more sensitive to mdm2 mediated degradation and as a result, this protein was less stable as compared to human p53. For the first time we have characterized a functionally efficient wild-type p53 from buffalo having lower stability than human p53 and thus, buffalo p53 could be used as a model system for further insight to the molecular basis of wild-type p53 instability. PMID:26003295

  8. p53 protects against LPS-induced lung endothelial barrier dysfunction

    PubMed Central

    Dimitropoulou, Christiana; Birmpas, Charalampos; Joshi, Atul; Thangjam, Gagan; Catravas, John D.


    New therapies toward heart and blood vessel disorders may emerge from the development of Hsp90 inhibitors. Several independent studies suggest potent anti-inflammatory activities of those agents in human tissues. The molecular mechanisms responsible for their protective effects in the vasculature remain unclear. The present study demonstrates that the transcription factor p53, an Hsp90 client protein, is crucial for the maintenance of vascular integrity, protects again LPS-induced endothelial barrier dysfunction, and is involved in the mediation of the anti-inflammatory activity of Hsp90 inhibitors in lung tissues. p53 silencing by siRNA decreased transendothelial resistance (a measure of endothelial barrier function). A similar effect was induced by the p53 inhibitor pifithrin, which also potentiated the LPS-induced hyperpermeability in human lung microvascular endothelial cells (HLMVEC). On the other hand, p53 induction by nutlin suppressed the LPS-induced vascular barrier dysfunction. LPS decreased p53 expression in lung tissues and that effect was blocked by pretreatment with Hsp90 inhibitors both in vivo and in vitro. Furthermore, the Hsp90 inhibitor 17-allyl-amino-demethoxy-geldanamycin suppressed the LPS-induced overexpression of the p53 negative regulator MDMX as well as p53 and MDM2 (another p53 negative regulator) phosphorylation in HLMVEC. Both negative p53 regulators were downregulated by LPS in vivo. Chemically induced p53 overexpression resulted in the suppression of LPS-induced RhoA activation and MLC2 phosphorylation, whereas p53 suppression caused the opposite effects. These observations reveal new mechanisms for the anti-inflammatory actions of Hsp90 inhibitors, i.e., the induction of the transcription factor p53, which in turn can orchestrate robust vascular anti-inflammatory responses both in vivo and in vitro. PMID:25713322

  9. p53 Transactivation and the Impact of Mutations, Cofactors and Small Molecules Using a Simplified Yeast-Based Screening System

    PubMed Central

    Bisio, Alessandra; Lion, Mattia; Jordan, Jennifer; Fronza, Gilberto; Menichini, Paola; Resnick, Michael A.; Inga, Alberto


    Background The p53 tumor suppressor, which is altered in most cancers, is a sequence-specific transcription factor that is able to modulate the expression of many target genes and influence a variety of cellular pathways. Inactivation of the p53 pathway in cancer frequently occurs through the expression of mutant p53 protein. In tumors that retain wild type p53, the pathway can be altered by upstream modulators, particularly the p53 negative regulators MDM2 and MDM4. Methodology/Principal Findings Given the many factors that might influence p53 function, including expression levels, mutations, cofactor proteins and small molecules, we expanded our previously described yeast-based system to provide the opportunity for efficient investigation of their individual and combined impacts in a miniaturized format. The system integrates i) variable expression of p53 proteins under the finely tunable GAL1,10 promoter, ii) single copy, chromosomally located p53-responsive and control luminescence reporters, iii) enhanced chemical uptake using modified ABC-transporters, iv) small-volume formats for treatment and dual-luciferase assays, and v) opportunities to co-express p53 with other cofactor proteins. This robust system can distinguish different levels of expression of WT and mutant p53 as well as interactions with MDM2 or 53BP1. Conclusions/Significance We found that the small molecules Nutlin and RITA could both relieve the MDM2-dependent inhibition of WT p53 transactivation function, while only RITA could impact p53/53BP1 functional interactions. PRIMA-1 was ineffective in modifying the transactivation capacity of WT p53 and missense p53 mutations. This dual-luciferase assay can, therefore, provide a high-throughput assessment tool for investigating a matrix of factors that can influence the p53 network, including the effectiveness of newly developed small molecules, on WT and tumor-associated p53 mutants as well as interacting proteins. PMID:21674059

  10. Ferroptosis: A missing puzzle piece in the p53 blueprint?

    PubMed Central

    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei


    ABSTRACT Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  11. Pharmacological Activation of p53 in Cancer Cells

    PubMed Central

    Athar, Mohammad; Elmets, Craig A.; Kopelovich, Levy


    Tumor suppressor p53 is a transcription factor that regulates a large number of genes and guards against genomic instability. Under multiple cellular stress conditions, p53 functions to block cell cycle progression transiently unless proper DNA repair occurs. Failure of DNA repair mechanisms leads to p53-mediated induction of cell death programs. p53 also induces permanent cell cycle arrest known as cellular senescence. During neoplastic progression, p53 is often mutated and fails to efficiently perform these functions. It has been observed that cancers carrying a wild-type p53 may also have interrupted downstream p53 regulatory signaling leading to disruption in p53 functions. Therefore, strategies to reactivate p53 provide an attractive approach for blocking tumor pathogenesis and its progression. p53 activation may also lead to regression of existing early neoplastic lesions and therefore may be important in developing cancer chemoprevention protocols. A large number of small molecules capable of reactivating p53 have been developed and some are progressing through clinical trials for prospective human applications. However, several questions remain to be answered at this stage. For example, it is not certain if pharmacological activation of p53 will restore all of its multifaceted biological responses, assuming that the targeted cell is not killed following p53 activation. It remains to be demonstrated whether the distinct biological effects regulated by specific post-transnationally modified p53 can effectively be restored by refolding mutant p53. Mutant p53 can be classified as a loss of function or gain of function protein depending on the type of mutation. It is also unclear whether reactivation of mutant p53 has similar consequences in cells carrying gain-of-function and loss-of-function p53 mutants. This review provides a description of various pharmacological approaches tested to activate p53 (both wild-type and mutant) and to assess the effects of

  12. Ferroptosis: A missing puzzle piece in the p53 blueprint?


    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei


    Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  13. The combination of 5-fluorouracil plus p53 pathway restoration is associated with depletion of p53-deficient or mutant p53-expressing putative colon cancer stem cells.


    Huang, Catherine; Zhang, Xiang M; Tavaluc, Raluca T; Hart, Lori S; Dicker, David T; Wang, Wenge; El-Deiry, Wafik S


    The cancer stem cell hypothesis suggests that rare populations of tumor-initiating cells may be resistant to therapy, lead to tumor relapse and contribute to poor prognosis for cancer patients. We previously demonstrated the feasibility of p53 pathway restoration in p53-deficient tumor cell populations using small molecules including ellipticine or its derivatives. We now establish a single cell p53-regulated green fluorescent protein (EGFP)-reporter system in human DLD1 colon tumor cells expressing mutant p53 protein. We use these p53-EGFP reporter DLD1 cells to investigate the status of p53 transcriptional activity in putative colon cancer stem cell populations following exposure to p53 pathway-restoring drugs and/or classical chemotherapy. We demonstrate induction of p53-specific EGFP reporter fluorescence following overexpression of p53 family member p73 by an Adenovirus vector. We further show that p53-reporter activity is induced in DLD1 putative cancer stem cell side-populations analyzed by their Hoechst dye efflux properties following treatment with the p53 pathway restoring drug ellipticine. Combination of ellipticine with the cytotoxic agent 5-fluorouracil resulted in increased cytotoxicity as compared to either agent alone and this was associated with depletion of putative cancer stem cell populations as compared with 5-FU alone treatment. Our results support the feasibility of therapeutic targeting of mutant p53 in putative cancer stem cells as well as the potential to enhance cytotoxic chemotherapy. PMID:19923910

  14. Targeting Oncogenic Mutant p53 for Cancer Therapy

    PubMed Central

    Parrales, Alejandro; Iwakuma, Tomoo


    Among genetic alterations in human cancers, mutations in the tumor suppressor p53 gene are the most common, occurring in over 50% of human cancers. The majority of p53 mutations are missense mutations and result in the accumulation of dysfunctional p53 protein in tumors. These mutants frequently have oncogenic gain-of-function activities and exacerbate malignant properties of cancer cells, such as metastasis and drug resistance. Increasing evidence reveals that stabilization of mutant p53 in tumors is crucial for its oncogenic activities, while depletion of mutant p53 attenuates malignant properties of cancer cells. Thus, mutant p53 is an attractive druggable target for cancer therapy. Different approaches have been taken to develop small-molecule compounds that specifically target mutant p53. These include compounds that restore wild-type conformation and transcriptional activity of mutant p53, induce depletion of mutant p53, inhibit downstream pathways of oncogenic mutant p53, and induce synthetic lethality to mutant p53. In this review article, we comprehensively discuss the current strategies targeting oncogenic mutant p53 in cancers, with special focus on compounds that restore wild-type p53 transcriptional activity of mutant p53 and those reducing mutant p53 levels. PMID:26732534

  15. p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.


    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida


    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. PMID:25804735

  16. p53 enables metabolic fitness and self-renewal of nephron progenitor cells

    PubMed Central

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida


    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre+;p53fl/fl) induces progressive depletion of Cited1+/Six2+ self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre+;p53fl/fl cap has 30% fewer Six2(GFP+) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre+;p53fl/fl cells in the S and G2/M phases compared with Six2Cre+;p53+/+ cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP+) CM cells revealed that the top downregulated genes in Six2Cre+;p53fl/fl CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. PMID:25804735

  17. The p53 target Wig-1 regulates p53 mRNA stability through an AU-rich element

    PubMed Central

    Vilborg, Anna; Glahder, Jacob A.; Wilhelm, Margareta T.; Bersani, Cinzia; Corcoran, Martin; Mahmoudi, Salah; Rosenstierne, Maiken; Grandér, Dan; Farnebo, Marianne; Norrild, Bodil; Wiman, Klas G.


    The p53 target gene Wig-1 encodes a double-stranded-RNA-binding zinc finger protein. We show here that Wig-1 binds to p53 mRNA and stabilizes it through an AU-rich element (ARE) in the 3′ UTR of the p53 mRNA. This effect is mirrored by enhanced p53 protein levels in both unstressed cells and cells exposed to p53-activating stress agents. Thus, the p53 target Wig-1 is a previously undescribed ARE-regulating protein that acts as a positive feedback regulator of p53, with implications both for the steady-state levels of p53 and for the p53 stress response. Our data reveal a previously undescribed link between the tumor suppressor p53 and posttranscriptional gene regulation via AREs in mRNA. PMID:19805223

  18. Relevant Networks involving the p53 Signalling Pathway in Renal Cell Carcinoma

    PubMed Central

    Villaamil, V. Medina; Gallego, G. Aparicio; Caínzos, I. Santamarina; Ruvira, L. Valbuena; Valladares-Ayerbes, M.; Aparicio, L. M. Antón


    Introduction: Renal cell carcinoma is the most common type of kidney cancer. A better understanding of the critical pathways and interactions associated with alterations in renal function and renal tumour properties is required. Our final goal is to combine the knowledge provided by a regulatory network with experimental observations provided by the dataset. Methods: In this study, a systems biology approach was used, integrating immunohistochemistry protein expression profiles and protein interaction information with the STRING and MeV bioinformatics tools. A group consisting of 80 patients with renal cell carcinoma was studied. The expression of selected markers was assessed using tissue microarray technology on immunohistochemically stained slides. The immunohistochemical data of the molecular factors studied were analysed using a parametric statistical test, Pearson’s correlation coefficient test. Results: Bioinformatics analysis of tumour samples resulted in 2 protein networks. The first network consists of proteins involved in the angiogenesis pathway and the apoptosis suppressor, BCL2, and includes both positive and negative correlations. The second network shows a negative interaction between the p53 tumour suppressor protein and the glucose transporter type 4. Conclusion: The comprehensive pathway network will help us to realise the cooperative behaviours among pathways. Regulation of metabolic pathways is an important role of p53. The pathway involving the tumour suppressor gene p53 could regulate tumour angiogenesis. Further investigation of the proteins that interact with this pathway in this type of tumour may provide new strategies for cancer therapies to specifically inhibit the molecules that play crucial roles in tumour progression. PMID:23675247

  19. [Advances in the study of p53 in response to DNA damage].


    Wang, Ya-Jie; Sun, Hua; Liu, Geng-Tao; Chen, Xiao-Guang


    p53 (encoded by TP53) is undoubtedly one of the most extensively studied genes and proteins. It is a highly potent transcription factor which, under normal circumstances, is maintained at low level. Both genotoxic and non-genotoxic stresses can induce p53 stabilized leading to changes in the expression of p53-responsive genes. The biological outcome inducing this pathway can be either growth arrest and apoptosis or senescence to maintain the integrity of the genome or to delete the damaged cells. The biochemical activity of p53 itself and the cellular environment govern the choice between these outcomes in a cell type- and stress-specific manner. So, p53 is a pivotal tumour suppressor and a mainstay of our body's natural anticancer defence. This review could provide some useful information for further study on the mechanisms of tumorigenesis and its progression, and also could contribute to the discovery of antitumor agents. PMID:22375412

  20. Coordinate Transcriptional and Translational Repression of p53 by TGFβ1 Impairs the Stress Response

    PubMed Central

    López-Díaz, Fernando J.; Gascard, Philippe; Balakrishnan, Sri Kripa; Zhao, Jianxin; del Rincon, Sonia V.; Spruck, Charles; Tlsty, Thea D.; Emerson, Beverly M.


    Summary Cellular stress results in profound changes in RNA and protein synthesis. How cells integrate this intrinsic, p53-centered program with extracellular signals is largely unknown. We demonstrate that TGFβ1 signaling interferes with the stress response through coordinate transcriptional and translational repression of p53 levels, which reduces p53-activated transcription, and apoptosis in precancerous cells. Mechanistically, E2F4 binds constitutively to the TP53 gene and induces transcription. TGFβ1-activated Smads are recruited to a composite Smad/E2F4 element by an E2F4/p107 complex that switches to a Smad co-repressor, which represses TP53 transcription. TGFβ1 also causes dissociation of ribosomal protein RPL26 and elongation factor eEF1A from p53 mRNA, thereby reducing p53 mRNA association with polyribosomes and p53 translation. TGFβ1-signalling is dominant over stress-induced transcription and translation of p53 and prevents stress-imposed downregulation of Smad proteins. Thus, crosstalk between the TGFβ and p53 pathways defines a major node of regulation in the cellular stress response, enhancing drug resistance. PMID:23706820

  1. Maintenance of imaginal disc plasticity and regenerative potential in Drosophila by p53.


    Wells, Brent S; Johnston, Laura A


    Following irradiation (IR), the DNA damage response (DDR) activates p53, which triggers death of cells in which repair cannot be completed. Lost tissue is then replaced and re-patterned through regeneration. We have examined the role of p53 in co-regulation of the DDR and tissue regeneration following IR damage in Drosophila. We find that after IR, p53 is required for imaginal disc cells to repair DNA, and in its absence the damage marker, γ-H2AX is persistently expressed. p53 is also required for the compensatory proliferation and re-patterning of the damaged discs, and our results indicate that cell death is not required to trigger these processes. We identify an IR-induced delay in developmental patterning in wing discs that accompanies an animal-wide delay of the juvenile-adult transition, and demonstrate that both of these delays require p53. In p53 mutants, the lack of developmental delays and of damage resolution leads to anueploidy and tissue defects, and ultimately to morphological abnormalities and adult inviability. We propose that p53 maintains plasticity of imaginal discs by co-regulating the maintenance of genome integrity and disc regeneration, and coordinating these processes with the physiology of the animal. These findings place p53 in a role as master coordinator of DNA and tissue repair following IR. PMID:22036477

  2. Analytical Validation of AmpliChip p53 Research Test for Archival Human Ovarian FFPE Sections.


    Marton, Matthew J; McNamara, Andrew R; Nikoloff, D Michele; Nakao, Aki; Cheng, Jonathan


    The p53 tumor suppressor gene (TP53) is reported to be mutated in nearly half of all tumors and plays a central role in genome integrity. Detection of mutations in p53 can be accomplished by many assays, including the AmpliChip p53 Research Test. The AmpliChip p53 Research Test has been successfully used to determine p53 status in hematologic malignancies and fresh frozen solid tissues but there are few reports of using the assay with formalin fixed, paraffin-embedded (FFPE) tissue. The objective of this study was to describe analytical performance characterization of the AmpliChip p53 Research Test to detect p53 mutations in genomic DNA isolated from archival FFPE human ovarian tumor tissues. Method correlation with sequencing showed 96% mutation-wise agreement and 99% chip-wise agreement. We furthermore observed 100% agreement (113/113) of the most prevalent TP53 mutations. Workflow reproducibility was 96.8% across 8 samples, with 2 operators, 2 reagent lots and 2 instruments. Section-to-section reproducibility was 100% for each sample across a 60 μm region of the FFPE block from ovarian tumors. These data indicate that the AmpliChip p53 Research Test is an accurate and reproducible method for detecting mutations in TP53 from archival FFPE human ovarian specimens. PMID:26125596

  3. Iron Metabolism Regulates p53 Signaling through Direct Heme-p53 Interaction and Modulation of p53 Localization, Stability, and Function

    PubMed Central

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Wang, Sheng; Xuan, Zongliang; Li, Dan; Wu, Yalan; Shang, Yongjia; Kong, Xiangtao; Yu, Long; Li, Lin; Ruan, Kangchen; Hu, Hongyu; Huang, Ying; Hui, Lijian; Xie, Dong; Wang, Fudi; Hu, Ronggui


    SUMMARY Iron excess is closely associated with tumorigenesis in multiple types of human cancers, with underlying mechanisms yet unclear. Recently, iron deprivation has emerged as a major strategy for chemotherapy, but it exerts tumor suppression only on select human malignancies. Here, we report that the tumor suppressor protein p53 is downregulated during iron excess. Strikingly, the iron polyporphyrin heme binds to p53 protein, interferes with p53-DNA interactions, and triggers both nuclear export and cytosolic degradation of p53. Moreover, in a tumorigenicity assay, iron deprivation suppressed wild-type p53-dependent tumor growth, suggesting that upregulation of wild-type p53 signaling underlies the selective efficacy of iron deprivation. Our findings thus identify a direct link between iron/heme homeostasis and the regulation of p53 signaling, which not only provides mechanistic insights into iron-excess-associated tumorigenesis but may also help predict and improve outcomes in iron-deprivation-based chemotherapy. PMID:24685134

  4. The dichotomy of p53 regulation by noncoding RNAs.


    Deng, Qipan; Becker, Lindsey; Ma, Xiaodong; Zhong, Xiaoming; Young, Ken; Ramos, Kenneth; Li, Yong


    The p53 tumor suppressor gene is the most frequently mutated gene in cancer. Significant progress has been made to discern the importance of p53 in coordinating cellular responses to DNA damage, oncogene activation, and other stresses. Noncoding RNAs are RNA molecules functioning without being translated into proteins. In this work, we discuss the dichotomy of p53 regulation by noncoding RNAs with four unconventional questions. First, is overexpression of microRNAs responsible for p53 inactivation in the absence of p53 mutation? Second, are there somatic mutations in the noncoding regions of the p53 gene? Third, is there a germline mutant in the noncoding regions of the p53 gene that predisposes carriers to cancer? Fourth, can p53 activation mediated by a noncoding RNA mutation cause cancer? This work highlights the prominence of noncoding RNAs in p53 dysregulation and tumorigenesis. PMID:24706938

  5. P53 licensed to kill? Operating the assassin.


    Haupt, Susan; Louria-Hayon, Igal; Haupt, Ygal


    The p53 protein is a key player in the cellular response to stress. Proper regulation of p53 is imperative for the suppression of tumor development. This regulation is largely governed by its master inhibitor, Mdm2, which both blocks p53 activities and promotes its destabilization. This tight regulation of p53 by Mdm2 must be interrupted under stress conditions in order for p53 to be stabilized in an active form. A combined action of partner proteins and modifying enzymes is essential for the relief of p53 from Mdm2. The recent revelation of p53 association with the PML-nuclear bodies provides one explanation of how this regulatory network is coordinated within the nucleus in response to certain stress conditions. Thus, it is not only the nature of the p53 regulatory complex but also the spatial and temporal context of this association that governs the output inhibitory signals mediated by p53. PMID:12461776

  6. High levels of p53 protein expression do not correlate with p53 gene mutations in anaplastic large cell lymphoma.

    PubMed Central

    Cesarman, E.; Inghirami, G.; Chadburn, A.; Knowles, D. M.


    Strong immunohistochemical reactivity for p53 tumor suppressor gene product has been reported in a variety of different human malignancies including CD30- (Ki-1) positive anaplastic large cell lymphoma (ALCL). Although high levels of p53 protein have been interpreted as abnormal, rapidly proliferating benign and neoplastic lymphoid cells may have increased p53 expression in the absence of structural alterations. On the other hand, mutations in the p53 gene can lead to a lack of p53 protein production. Structural alterations of the p53 gene have not been documented in cases of ALCL and the mechanism for an abnormal pattern of p53 expression in these lymphomas has not been elucidated. Therefore, to determine whether an altered pattern of p53 expression correlates with mutations in the p53 locus in ALCL, we analyzed the expression of p53 protein immunohistochemically, compared it with the proliferation index using monoclonal antibody Ki-67, and assessed the presence of mutations in exons 5 though 9 of the p53 gene using a single-strand conformation polymorphism assay in a panel of 17 ALCLs. Furthermore, we studied the presence of allelic deletions of chromosome 17p by restriction fragment length polymorphism analysis. We found significant levels of p53 protein expression in 12 of the 15 cases studied, but identified mutations in only one of 17 cases. An allelic deletion in chromosome 17p was identified only in the one case containing a mutated p53 gene. Whereas the case containing structural alterations in the p53 gene did have strong p53 immunoreactivity, 11 cases that lacked p53 mutations in the regions examined also had significant levels of p53. Thus, our studies indicate that strong immunohistochemical reactivity for p53 is not a reliable indicator of the presence of structural alterations of p53 gene exons 5 through 9 in ALCL. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8103295

  7. Expression of TP53 Isoforms p53β or p53γ Enhances Chemosensitivity in TP53null Cell Lines

    PubMed Central

    Silden, Elisabeth; Hjelle, Sigrun M.; Wergeland, Line; Sulen, André; Andresen, Vibeke; Bourdon, Jean-Christophe; Micklem, David R.; McCormack, Emmet; Gjertsen, Bjørn Tore


    The carboxy-terminal truncated p53 alternative spliced isoforms, p53β and p53γ, are expressed at disparate levels in cancer and are suggested to influence treatment response and therapy outcome. However, their functional role in cancer remains to be elucidated. We investigated their individual functionality in the p53null background of cell lines H1299 and SAOS-2 by stable retroviral transduction or transient transfection. Expression status of p53β and p53γ protein was found to correlate with increased response to camptothecin and doxorubicin chemotherapy. Decreased DNA synthesis and clonogenicity in p53β and p53γ congenic H1299 was accompanied by increased p21(CIP1/WAF1), Bax and Mdm2 proteins. Chemotherapy induced p53 isoform degradation, most prominent for p53γ. The proteasome inhibitor bortezomib substantially increased basal p53γ protein level, while the level of p53β protein was unaffected. Treatment with dicoumarol, a putative blocker of the proteasome-related NAD(P)H quinone oxidoreductase NQO1, effectively attenuated basal p53γ protein level in spite of bortezomib treatment. Although in vitro proliferation and clonogenicity assays indicated a weak suppressive effect by p53β and p53γ expression, studies of in vivo subcutaneous H1299 tumor growth demonstrated a significantly increased growth by expression of either p53 isoforms. This study suggests that p53β and p53γ share functionality in chemosensitizing and tumor growth enhancement but comprise distinct regulation at the protein level. PMID:23409163

  8. Expression of TP53 isoforms p53β or p53γ enhances chemosensitivity in TP53(null) cell lines.


    Silden, Elisabeth; Hjelle, Sigrun M; Wergeland, Line; Sulen, André; Andresen, Vibeke; Bourdon, Jean-Christophe; Micklem, David R; McCormack, Emmet; Gjertsen, Bjørn Tore


    The carboxy-terminal truncated p53 alternative spliced isoforms, p53β and p53γ, are expressed at disparate levels in cancer and are suggested to influence treatment response and therapy outcome. However, their functional role in cancer remains to be elucidated. We investigated their individual functionality in the p53(null) background of cell lines H1299 and SAOS-2 by stable retroviral transduction or transient transfection. Expression status of p53β and p53γ protein was found to correlate with increased response to camptothecin and doxorubicin chemotherapy. Decreased DNA synthesis and clonogenicity in p53β and p53γ congenic H1299 was accompanied by increased p21((CIP1/WAF1)), Bax and Mdm2 proteins. Chemotherapy induced p53 isoform degradation, most prominent for p53γ. The proteasome inhibitor bortezomib substantially increased basal p53γ protein level, while the level of p53β protein was unaffected. Treatment with dicoumarol, a putative blocker of the proteasome-related NAD(P)H quinone oxidoreductase NQO1, effectively attenuated basal p53γ protein level in spite of bortezomib treatment. Although in vitro proliferation and clonogenicity assays indicated a weak suppressive effect by p53β and p53γ expression, studies of in vivo subcutaneous H1299 tumor growth demonstrated a significantly increased growth by expression of either p53 isoforms. This study suggests that p53β and p53γ share functionality in chemosensitizing and tumor growth enhancement but comprise distinct regulation at the protein level. PMID:23409163

  9. Quantitative evaluation of p53 as a new indicator of DNA damage in human spermatozoa

    PubMed Central

    Raimondo, Salvatore; Gentile, Tommaso; Cuomo, Felice; De Filippo, Stefania; Aprea, Gilda E.; Guida, John


    BACKGROUND: Sperm DNA integrity is considered an important parameter to assess seminal fluid quality and can be used as a predictive test of potential fertility. Amongst the various tests to determine sperm DNA integrity, one is the Acridine Orange test. Recent studies have demonstrated the importance of p53 in maintaining sperm DNA integrity. The aim of this study was to assess if a p53 ELISA assay could be a new indicator of DNA damage in human spermatozoa. MATERIALS AND METHODS: 103 human semen samples were evaluated using both Acridine Orange test and p53 ELISA and results were compared. RESULTS: A clear correlation between the values measured by two methods was obtained. CONCLUSIONS: If this hypothesis will be confirmed by further studies, the p53 ELISA assay could become a new and more precise indicator of DNA damage in human spermatozoa. PMID:25395748

  10. Activation and activities of the p53 tumour suppressor protein

    PubMed Central

    Bálint, É; Vousden, K H


    The p53 tumour suppressor protein inhibits malignant progression by mediating cell cycle arrest, apoptosis or repair following cellular stress. One of the major regulators of p53 function is the MDM2 protein, and multiple forms of cellular stress activate p53 by inhibiting the MDM2-mediated degradation of p53. Mutations in p53, or disruption of the pathways that allow activation of p53, seem to be a general feature of all cancers. Here we review recent advances in our understanding of the pathways that regulate p53 and the pathways that are induced by p53, as well as their implications for cancer therapy. © 2001 Cancer Research Campaign PMID:11747320

  11. Watching the watcher: regulation of p53 by mitochondria

    PubMed Central

    Holley, Aaron K; St Clair, Daret K


    p53 has been referred to as the ‘guardian of the genome’ because of its role in protecting the cell from DNA damage. p53 performs its duties by regulating cell-cycle progression and DNA repair and, in cases of irreparable DNA damage, by executing programmed cell death. Mitochondria are an important target of transcription-dependent and -independent actions of p53 to carry out the apoptotic function. However, increasing evidence suggests that p53 activity is regulated by mitochondria. Cellular insults that alter mitochondrial function can have important consequences on p53 activity. In light of these new findings, the following review focuses on p53/mitochondria connections, in particular how reactive oxygen species generated at mitochondria regulate p53 activity. A better understanding of the mechanisms by which mitochondria regulate p53 may have an impact on our understanding of the development and progression of many diseases, especially cancer. PMID:19243304

  12. Mutant p53: One, No One, and One Hundred Thousand

    PubMed Central

    Walerych, Dawid; Lisek, Kamil; Del Sal, Giannino


    Encoded by the mutated variants of the TP53 tumor suppressor gene, mutant p53 proteins are getting an increased experimental support as active oncoproteins promoting tumor growth and metastasis. p53 missense mutant proteins are losing their wild-type tumor suppressor activity and acquire oncogenic potential, possessing diverse transforming abilities in cell and mouse models. Whether various mutant p53s differ in their oncogenic potential has been a matter of debate. Recent discoveries are starting to uncover the existence of mutant p53 downstream programs that are common to different mutant p53 variants. In this review, we discuss a number of studies on mutant p53, underlining the advantages and disadvantages of alternative experimental approaches that have been used to describe the numerous mutant p53 gain-of-function activities. Therapeutic possibilities are also discussed, taking into account targeting either individual or multiple mutant p53 proteins in human cancer. PMID:26734571

  13. Wild type p53 reactivation: from lab bench to clinic.


    Selivanova, Galina


    The p53 tumor suppressor is the most frequently inactivated gene in cancer. Several mouse models have demonstrated that the reconstitution of the p53 function suppresses the growth of established tumors. These facts, taken together, promote the idea of p53 reactivation as a strategy to combat cancer. This review will focus on recent advances in the development of small molecules which restore the function of wild type p53 by blocking its inhibitors Mdm2 and MdmX or their upstream regulators and discuss the impact of different p53 functions for tumor prevention and tumor eradication. Finally, the recent progress in p53 research will be analyzed concerning the role of p53 cofactors and cellular environment in the biological response upon p53 reactivation and how this can be applied in clinic. PMID:24726725

  14. AKT-p53 axis protect cancer cells from autophagic cell death during nutrition deprivation.


    Sudhagar, S; Sathya, S; Gokulapriya, G; Lakshmi, B S


    An altered metabolism supports growth of tumor. AKT, a major signal integrator plays a key role in cell metabolism. We have shown that nutritional deprivation activates AKT as observed by increased phosphorylation of both Thr308 and Ser473. Pharmacological inhibition or silencing of AKT by siRNA affects cell viability during starvation. The tumor suppressor, p53 is also observed to be elevated during nutritional deprivation due to AKT. Silencing of AKT and p53 enhanced autophagy as evidenced by increased acidic vesicular organelles and LC3B II levels, suggesting AKT-p53 to play a significant role in cell survival through regulating autophagy during nutritional deprivation. PMID:26903300

  15. In vitro expression of human p53 cDNA clones and characterization of the cloned human p53 gene.


    Wolf, D; Laver-Rudich, Z; Rotter, V


    The human p53 gene was cloned and characterized by using a battery of p53 DNA clones. A series of human cDNA clones of various sizes and relative localizations to the mRNA molecule were isolated by using the human p53-H14 (2.35-kilobase) cDNA probe which we previously cloned. One such isolate, clone p53-H7 (2.65 kilobases), spans the entire human mature p53 mRNA molecule. Construction of the human cDNA clones in the pSP65 RNA transcription vector facilitated the generation of p53 transcripts by the SP6 bacteriophage RNA polymerase. The p53-specific RNA transcripts obtained without further processing were translated into p53 proteins in a cell-free system. By using this rapid in vitro transcription-translation assay, we found that whereas clone p53-H7 (2.65 kilobases) coded for a mature-sized p53 protein, a shorter cDNA clone, p53-H13 (1.8 kilobases), dictated the synthesis of a smaller-sized p53 protein (45 kilodaltons). The p53 proteins synthesized in vitro immunoprecipitated efficiently with human-specific anti-p53 antibodies. Genomic analysis of human DNA revealed the presence of a single p53 gene residing within two EcoRI fragments. Heteroduplex analysis between the full-length cDNA clone p53-H7 and the cloned p53 gene indicated the presence of seven major exons. PMID:3018534

  16. Hypoxia downregulates p53 but induces apoptosis and enhances expression of BAD in cultures of human syncytiotrophoblasts.


    Chen, Baosheng; Longtine, Mark S; Sadovsky, Yoel; Nelson, D Michael


    Hypoxia is commonly assigned a role in the placental dysfunction characteristic of preeclampsia and intrauterine growth restriction. We previously showed that hypoxia upregulates p53 and enhances apoptosis in primary cultures of human cytotrophoblasts. Here we tested the hypothesis that hypoxia also induces apoptosis in syncytiotrophoblasts by upregulation of p53. Primary cultures of human cytotrophoblasts that had differentiated into syncytiotrophoblasts by 52 h were exposed for ≤24 h to 20% or <1% oxygen in the presence or absence of staurosporine or the p53 modulators nutlin-3, pifithrin-α, and pifithrin-μ. Proteins were detected by Western blot analysis or immunofluorescence. Compared with 20% oxygen, exposure of syncytiotrophoblasts to <1% oxygen upregulated hypoxia-inducible factor (HIF)-1α and rapidly downregulated p53. Activity of p53 in hypoxic syncytiotrophoblasts was reduced by the higher expression of the negative p53 regulator MDMX and by the reduction of phosphorylation of p53 at Ser(392), which reduces p53 activity. Conversely, staurosporine, a kinase inhibitor, and nutlin-3, a drug that enhances p53 expression, both raised p53 levels and increased the rate of apoptosis in syncytiotrophoblasts compared with vehicle controls. Immunofluorescence staining showed p53 immunolocalized to both cytoplasm and nuclei of nutlin-3-exposed syncytiotrophoblasts. The hypoxia-induced apoptosis in syncytiotrophoblasts correlated with enhanced expression of the proapoptotic BAD and a reduced level of antiapoptotic BAD phosphorylated on Ser(112). We surmise that cell death induced by extreme hypoxia in syncytiotrophoblasts follows a non-p53-dependent pathway, unlike that of a nonhypoxic stimulus and unlike hypoxic cytotrophoblasts. We speculate that downregulation of p53 activity in response to hypoxia reduces or eliminates the apoptosis transduced by the p53 pathway in syncytiotrophoblasts, thereby limiting cell death and maintaining the integrity of this

  17. Hypoxia downregulates p53 but induces apoptosis and enhances expression of BAD in cultures of human syncytiotrophoblasts

    PubMed Central

    Chen, Baosheng; Longtine, Mark S.; Sadovsky, Yoel


    Hypoxia is commonly assigned a role in the placental dysfunction characteristic of preeclampsia and intrauterine growth restriction. We previously showed that hypoxia upregulates p53 and enhances apoptosis in primary cultures of human cytotrophoblasts. Here we tested the hypothesis that hypoxia also induces apoptosis in syncytiotrophoblasts by upregulation of p53. Primary cultures of human cytotrophoblasts that had differentiated into syncytiotrophoblasts by 52 h were exposed for ≤24 h to 20% or <1% oxygen in the presence or absence of staurosporine or the p53 modulators nutlin-3, pifithrin-α, and pifithrin-μ. Proteins were detected by Western blot analysis or immunofluorescence. Compared with 20% oxygen, exposure of syncytiotrophoblasts to <1% oxygen upregulated hypoxia-inducible factor (HIF)-1α and rapidly downregulated p53. Activity of p53 in hypoxic syncytiotrophoblasts was reduced by the higher expression of the negative p53 regulator MDMX and by the reduction of phosphorylation of p53 at Ser392, which reduces p53 activity. Conversely, staurosporine, a kinase inhibitor, and nutlin-3, a drug that enhances p53 expression, both raised p53 levels and increased the rate of apoptosis in syncytiotrophoblasts compared with vehicle controls. Immunofluorescence staining showed p53 immunolocalized to both cytoplasm and nuclei of nutlin-3-exposed syncytiotrophoblasts. The hypoxia-induced apoptosis in syncytiotrophoblasts correlated with enhanced expression of the proapoptotic BAD and a reduced level of antiapoptotic BAD phosphorylated on Ser112. We surmise that cell death induced by extreme hypoxia in syncytiotrophoblasts follows a non-p53-dependent pathway, unlike that of a nonhypoxic stimulus and unlike hypoxic cytotrophoblasts. We speculate that downregulation of p53 activity in response to hypoxia reduces or eliminates the apoptosis transduced by the p53 pathway in syncytiotrophoblasts, thereby limiting cell death and maintaining the integrity of this critical

  18. Identification of p53-target genes in Danio rerio

    PubMed Central

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M. Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia


    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  19. Identification of p53-target genes in Danio rerio.


    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia


    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  20. Suppression of Indued Pluripotent Stem Cell Generation by the p53-p21 Pathway

    PubMed Central

    Hong, Hyenjong; Takahashi, Kazutoshi; Ichisaka, Tomoko; Aoi, Takashi; Kanagawa, Osami; Nakagawa, Masato; Okita, Keisuke; Yamanaka, Shinya


    Induced pluripotent stem (iPS) cells can be generated from somatic cells by introduction of Oct3/4, Sox2, Klf4 and c-Myc, in mouse1-4 and human5-8. Efficiency of this process, however, is low9. Pluripotency can be induced without c-Myc, but with even lower efficiency10,11. A p53 siRNA was recently shown to promote human iPS cell generation12, but specificity and mechanisms remain to be determined. Here we report that up to 10% of transduced mouse embryonic fibroblasts (MEF) lacking p53 became iPS cells, even without the Myc retrovirus. The p53 deletion also promoted induction of integration-free mouse iPS cells with plasmid transfection. Furthermore, in the p53-null background, iPS cells were generated from terminally differentiated T lymphocytes. Suppression of p53 also increased the efficiency of human iPS cell generation. DNA microarray analyses identified 34 p53-regulated genes that are common in mouse and human fibroblasts. Functional analyses of these genes demonstrate that the p53-p21 pathway serves as a safeguard not only in tumorigenicity, but also in iPS cell generation. PMID:19668191

  1. High-level expression of human tumour suppressor P53 in the methylotrophic yeast: Pichia pastoris.


    Abdelmoula-Souissi, Salma; Rekik, Leila; Gargouri, Ali; Mokdad-Gargouri, Raja


    The human tumour suppressor P53 is a key protein involved in tumour suppression. P53 acts as a "guardian of genome" by regulating many target genes involved in cell cycle regulation, DNA repair and apoptosis. We report the P53 expression by the methylotrophic yeast Pichia pastoris using the methanol inducible AOX1 promoter. We have produced the rP53 in intracellular form as well as secreted using the Saccharomyces cerevisiae alpha-mating factor prepro-leader sequence in two genetic contexts of Pichia, Mut(s) and Mut(+). The intracellular P53 was successfully produced by Mut(s) (KM71) as well as Mut(+) (X33) strains, however, the secreted form was mainly observed in the Mut(s) strain, despite a higher number of p53 copies integrated in the Mut(+) strain. Interestingly, in Mut(s) phenotype, the medium pH influences markedly the rP53 production since it was higher at pH 7 than 6. PMID:17482479

  2. Neocarzinostatin induces an effective p53-dependent response in human papillomavirus-positive cervical cancer cells.


    Bañuelos, Adriana; Reyes, Elba; Ocadiz, Rodolfo; Alvarez, Elizabeth; Moreno, Martha; Monroy, Alberto; Gariglio, Patricio


    Human papillomavirus (HPV) E6 viral oncoprotein plays an important role during cervical carcinogenesis. This oncoprotein binds the tumor suppressor protein p53, leading to its degradation via the ubiquitin-proteasome pathway. Therefore, it is generally assumed that in HPV-positive cancer cells p53 function is completely abolished. Nevertheless, recent findings suggest that p53 activity can be recovered in cells expressing endogenous E6 protein. To investigate whether p53-dependent functions controlling genome integrity, cell proliferation, and apoptosis can be reactivated in cervical cancer cells, we examined the capacity of HeLa, INBL, CaSki, C33A, and ViBo cell lines to respond to neocarzinostatin (NCS), a natural product which induces single- and double-strand breaks in DNA. We found that NCS treatment inhibits cellular proliferation through G2 cell cycle arrest and apoptosis induction. This effect was preceded by nuclear accumulation of p53 protein and by an increase of p21 transcripts. Although apoptosis was blocked in ViBo cells (HPV-negative), nuclear accumulation of transcriptionally active p53 and inhibition of cell proliferation are observed after NCS treatment. These results suggest that HPV-positive cervical cancer cells are capable of responding efficiently to DNA damage provoked by NCS treatment through a p53-dependent pathway in spite of the presence of E6 protein. PMID:12750435

  3. Molecular cloning, characterization, and expression analysis of p53 from the oriental river prawn, Macrobrachium nipponense, in response to hypoxia.


    Sun, Shengming; Gu, Zhimin; Fu, Hongtuo; Zhu, Jian; Ge, Xianping; Xuan, Fujun


    The tumor suppressor gene p53 plays a critical role in safeguarding the integrity of the genome in mammalian cells. It acts as a sequence-specific transcription factor. Once p53 is activated by a variety of cellular stresses, it transactivates downstream target genes and regulates the cell cycle and apoptosis. However, little is known about the functions of the p53 pathway in prawns in response to hypoxia. In this study, the cDNA of p53 from the oriental river prawn, Macrobrachium nipponense, (Mnp53) was cloned using a combination of homology cloning and rapid amplification of cDNA ends. The full-length cDNA of Mnp53 has 2130 bp, including an open reading frame of 1125 bp that encodes a polypeptide of 374 amino acids with a predicted molecular weight of 41.9 kDa and a theoretical isoelectric point of 6.9. Quantitative real-time (qRT)-PCR assays revealed that Mnp53 was ubiquitously expressed in all examined tissues, but at high levels in the hepatopancreas. In addition, we studied respiratory bursts and reactive oxygen species (ROS) production in the hepatopancreas of M. nipponense. Our results suggest that oxidative stress occurred in prawns in response to hypoxia and that apoptosis was associated with an increase in caspase-3 mRNA expression. qRT-PCR and western blot results confirmed that hypoxic stress induced the upregulation of Mnp53 at mRNA and protein levels. Furthermore, immunohistochemistry showed remarkable changes in immunopositive staining after the same hypoxic treatment. These results suggest that hypoxia-induced oxidative stress may cause apoptosis and cooperatively stimulate the expression of Mnp53. PMID:27044329

  4. Transcriptional control of human p53-regulated genes.


    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold


    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  5. A p53-bound enhancer region controls a long intergenic noncoding RNA required for p53 stress response.


    Melo, C A; Léveillé, N; Rooijers, K; Wijchers, P J; Geeven, G; Tal, A; Melo, S A; de Laat, W; Agami, R


    Genome-wide chromatin studies identified the tumor suppressor p53 as both a promoter and an enhancer-binding transcription factor. As an enhancer factor, p53 can induce local production of enhancer RNAs, as well as transcriptional activation of distal neighboring genes. Beyond the regulation of protein-coding genes, p53 has the capacity to regulate long intergenic noncoding RNA molecules (lincRNAs); however, their importance to the p53 tumor suppressive function remains poorly characterized. Here, we identified and characterized a novel p53-bound intronic enhancer that controls the expression of its host, the lincRNA00475 (linc-475). We demonstrate the requirement of linc-475 for the proper induction of a p53-dependent cell cycle inhibitory response. We further confirm the functional importance of linc-475 in the maintenance of CDKN1A/p21 levels, a cell cycle inhibitor and a major p53 target gene, following p53 activation. Interestingly, loss of linc-475 reduced the binding of both p53 and RNA polymerase II (RNAPII) to the promoter of p21, attenuating its transcription rate following p53 activation. Altogether, our data suggest a direct role of p53-bound enhancer domains in the activation of lincRNAs required for an efficient p53 transcriptional response. PMID:26776159

  6. [Bcl-2 inhibits p53-induced apoptosis after genotoxic damage by inhibitors of nuclear import of p53].


    Beham, A; Schumacher, G; McDonnell, T J; Marin, M C; Jauch, K W


    The tumor suppressor gene p53 in overexpressed in 50% of colorectal carcinomas and is an interesting target for gene therapeutic approaches. Furthermore the protooncogen bcl-2 is known to inhibit p53 induced apoptosis and is expressed in some colorectal carcinomas. In this study mechanism of bcl-2 cell death inhibition after p53 induction were evaluated. The human colon carcinoma cell line RKO posses wild-type p53 and also expresses bcl-2 protein. RKO cells were treated with liposomal bcl-2 antisense oligonucleotides (AS), control oligonucleotides (CO) and empty liposomes (EL) resulting in decreased bcl-2 expression. After induction of p53 with gamma-irradiation p53 protein expression was induced in AS, CO and EL pretreated cells. Microscopy and immunoblotting was used to characterize subcellular localization of p53 protein. Further p53 subcellular localisation was examined after p53 transfer of wt p53 cDNA in three bcl-2 expressing cell lines. Most of the p53 protein remained localized in the cytosol and apoptosis was decreased in bcl-2 expressing cells assessed by flow cytometric analysis (Ao). Our data suggests that bcl-2 is able to modulate transmembrane trafficking of p53. This resulted in inhibition of cell death implicating that bcl-2 function is involved in regulation of transmembrane gradients. PMID:14518224

  7. Rb and p53 Liver Functions Are Essential for Xenobiotic Metabolism and Tumor Suppression

    PubMed Central

    Nantasanti, Sathidpak; Toussaint, Mathilda J. M.; Youssef, Sameh A.; Tooten, Peter C. J.; de Bruin, Alain


    The tumor suppressors Retinoblastoma (Rb) and p53 are frequently inactivated in liver diseases, such as hepatocellular carcinomas (HCC) or infections with Hepatitis B or C viruses. Here, we discovered a novel role for Rb and p53 in xenobiotic metabolism, which represent a key function of the liver for metabolizing therapeutic drugs or toxins. We demonstrate that Rb and p53 cooperate to metabolize the xenobiotic 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC). DDC is metabolized mainly by cytochrome P450 (Cyp)3a enzymes resulting in inhibition of heme synthesis and accumulation of protoporphyrin, an intermediate of heme pathway. Protoporphyrin accumulation causes bile injury and ductular reaction. We show that loss of Rb and p53 resulted in reduced Cyp3a expression decreased accumulation of protoporphyrin and consequently less ductular reaction in livers of mice fed with DDC for 3 weeks. These findings provide strong evidence that synergistic functions of Rb and p53 are essential for metabolism of DDC. Because Rb and p53 functions are frequently disabled in liver diseases, our results suggest that liver patients might have altered ability to remove toxins or properly metabolize therapeutic drugs. Strikingly the reduced biliary injury towards the oxidative stress inducer DCC was accompanied by enhanced hepatocellular injury and formation of HCCs in Rb and p53 deficient livers. The increase in hepatocellular injury might be related to reduce protoporphyrin accumulation, because protoporphrin is well known for its anti-oxidative activity. Furthermore our results indicate that Rb and p53 not only function as tumor suppressors in response to carcinogenic injury, but also in response to non-carcinogenic injury such as DDC. PMID:26967735

  8. Transcriptional Responses to Estrogen and Progesterone in Mammary Gland Identify Networks Regulating p53 Activity

    PubMed Central

    Lu, Shaolei; Becker, Klaus A.; Hagen, Mary J.; Yan, Haoheng; Roberts, Amy L.; Mathews, Lesley A.; Schneider, Sallie S.; Siegelmann, Hava T.; MacBeth, Kyle J.; Tirrell, Stephen M.; Blanchard, Jeffrey L.; Jerry, D. Joseph


    Estrogen and progestins are essential for mammary growth and differentiation but also enhance the activity of the p53 tumor suppressor protein in the mammary epithelium. However, the pathways by which these hormones regulate p53 activity are unknown. Microarrays were used to profile the transcriptional changes within the mammary gland after administration of either vehicle, 17β-estradiol (E), or progesterone (P) individually and combined (EP). Treatment with EP yielded 1182 unique genes that were differentially expressed compared to the vehicle-treated group. Although 30% of genes were responsive to either E or P individually, combined treatment with both EP had a synergistic effect accounting for 60% of the differentially regulated genes. Analysis of protein-protein interactions identified p53, RelA, Snw1, and Igfals as common targets of genes regulated by EP. RelA and p53 form hubs within a network connected by genes that are regulated by EP and that may coordinate the competing functions of RelA and p53 in proliferation and survival of cells. Induction of early growth response 1 (Egr1) and Stratifin (Sfn) (also known as 14–3-3σ) by EP was confirmed by reverse transcription-quantitative PCR and shown to be p53 independent. In luciferase reporter assays, Egr1 was shown to enhance transcriptional activation by p53 and inhibit nuclear factor κB activity. These results identify a gene expression network that provides redundant activation of RelA to support proliferation as well as sensitize p53 to ensure proper surveillance and integration of their competing functions through factors such as Egr1, which both enhance p53 and inhibit RelA. PMID:18556351

  9. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.


    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  10. p53 genes function to restrain mobile elements.


    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M


    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  11. Interaction between p53 and estradiol pathways in transcriptional responses to chemotherapeutics.


    Lion, Mattia; Bisio, Alessandra; Tebaldi, Toma; De Sanctis, Veronica; Menendez, Daniel; Resnick, Michael A; Ciribilli, Yari; Inga, Alberto


    Estrogen receptors (ERs) and p53 can interact via cis-elements to regulate the angiogenesis-related VEGFR-1 (FLT1) gene, as we reported previously. Here, we address cooperation between these transcription factors on a global scale. Human breast adenocarcinoma MCF7 cells were exposed to single or combinatorial treatments with the chemotherapeutic agent doxorubicin and the ER ligand 17β-estradiol (E2). Whole-genome transcriptome changes were measured by expression microarrays. Nearly 200 differentially expressed genes were identified that showed limited responsiveness to either doxorubicin treatment or ER ligand alone but were upregulated in a greater than additive manner following combined treatment. Based on exposure to 5-fuorouracil and nutlin-3a, the combined responses were treatment-specific. Among 16 genes chosen for validation using quantitative real-time PCR, seven (INPP5D, TLR5, KRT15, EPHA2, GDNF, NOTCH1, SOX9) were confirmed to be novel direct targets of p53, based on responses in MCF7 cells silenced for p53 or cooperative targets of p53 and ER. Promoter pattern searches and chromatin IP experiments for the INPP5D, TLR5, KRT15 genes supported direct, cis-mediated p53 and/or ER regulation through canonical and noncanonical p53 and ER response elements. Collectively, we establish that combinatorial activation of p53 and ER can induce novel gene expression programs that have implications for cell-cell communications, adhesion, cell differentiation, development and inflammatory responses as well as cancer treatments. PMID:23518503

  12. Interaction between p53 and estradiol pathways in transcriptional responses to chemotherapeutics

    PubMed Central

    Lion, Mattia; Bisio, Alessandra; Tebaldi, Toma; De Sanctis, Veronica; Menendez, Daniel; Resnick, Michael A.; Ciribilli, Yari; Inga, Alberto


    Estrogen receptors (ERs) and p53 can interact via cis-elements to regulate the angiogenesis-related VEGFR-1 (FLT1) gene, as we reported previously. Here, we address cooperation between these transcription factors on a global scale. Human breast adenocarcinoma MCF7 cells were exposed to single or combinatorial treatments with the chemotherapeutic agent doxorubicin and the ER ligand 17β-estradiol (E2). Whole-genome transcriptome changes were measured by expression microarrays. Nearly 200 differentially expressed genes were identified that showed limited responsiveness to either doxorubicin treatment or ER ligand alone but were upregulated in a greater than additive manner following combined treatment. Based on exposure to 5-fuorouracil and nutlin-3a, the combined responses were treatment-specific. Among 16 genes chosen for validation using quantitative real-time PCR, seven (INPP5D, TLR5, KRT15, EPHA2, GDNF, NOTCH1, SOX9) were confirmed to be novel direct targets of p53, based on responses in MCF7 cells silenced for p53 or cooperative targets of p53 and ER. Promoter pattern searches and chromatin IP experiments for the INPP5D, TLR5, KRT15 genes supported direct, cis-mediated p53 and/or ER regulation through canonical and noncanonical p53 and ER response elements. Collectively, we establish that combinatorial activation of p53 and ER can induce novel gene expression programs that have implications for cell-cell communications, adhesion, cell differentiation, development and inflammatory responses as well as cancer treatments. PMID:23518503

  13. A novel p53-binding domain in CUL7.


    Kasper, Jocelyn S; Arai, Takehiro; DeCaprio, James A


    CUL7 is a member of the cullin RING ligase family and forms an SCF-like complex with SKP1 and FBXW8. CUL7 is required for normal mouse embryonic development and cellular proliferation, and is highly homologous to PARC, a p53-associated, parkin-like cytoplasmic protein. We determined that CUL7, in a manner similar to PARC, can bind directly to p53 but does not affect p53 expression. We identified a discrete, co-linear domain in CUL7 that is conserved in PARC and HERC2, and is necessary and sufficient for p53-binding. The presence of p53 stabilized expression of this domain and we demonstrate that this p53-binding domain of CUL7 contributes to the cytoplasmic localization of CUL7. The results support the model that p53 plays a role in regulation of CUL7 activity. PMID:16875676

  14. Chemical Variations on the p53 Reactivation Theme

    PubMed Central

    Ribeiro, Carlos J. A.; Rodrigues, Cecília M. P.; Moreira, Rui; Santos, Maria M. M.


    Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX). Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented. PMID:27187415

  15. A novel p53-binding domain in CUL7

    SciTech Connect

    Kasper, Jocelyn S.; Arai, Takehiro; De Caprio, James A. . E-mail:


    CUL7 is a member of the cullin RING ligase family and forms an SCF-like complex with SKP1 and FBXW8. CUL7 is required for normal mouse embryonic development and cellular proliferation, and is highly homologous to PARC, a p53-associated, parkin-like cytoplasmic protein. We determined that CUL7, in a manner similar to PARC, can bind directly to p53 but does not affect p53 expression. We identified a discrete, co-linear domain in CUL7 that is conserved in PARC and HERC2, and is necessary and sufficient for p53-binding. The presence of p53 stabilized expression of this domain and we demonstrate that this p53-binding domain of CUL7 contributes to the cytoplasmic localization of CUL7. The results support the model that p53 plays a role in regulation of CUL7 activity.

  16. Transcriptional activation of cyclooxygenase-2 by tumor suppressor p53 requires nuclear factor-kappaB.


    Benoit, V; de Moraes, E; Dar, N A; Taranchon, E; Bours, V; Hautefeuille, A; Tanière, P; Chariot, A; Scoazec, J-Y; de Moura Gallo, C V; Merville, M-P; Hainaut, P


    Overexpression of cyclooxygenase-2 (Cox-2) is thought to exert antiapoptotic effects in cancer. Here we show that the tumor suppressor p53 upregulated Cox-2 in esophageal and colon cancer cell lines by inducing the binding of nuclear factor-kappaB (NF-kappaB) to its response element in the COX-2 promoter. Inhibition of NF-kappaB prevented p53 induction of Cox-2 expression. Cooperation between p53 and NF-kappaB was required for activation of COX-2 promoter in response to daunomycin, a DNA-damaging agent. Pharmacological inhibition of Cox-2 enhanced apoptosis in response to daunomycin, in particular in cells containing active p53. In esophageal cancer, there was a correlation between Cox-2 expression and wild-type TP53 in Barrett's esophagus (BE) and in adenocarcinoma, but not in squamous cell carcinoma (P<0.01). These results suggest that p53 and NF-kappaB cooperate in upregulating Cox-2 expression, promoting cell survival in inflammatory precursor lesions such as BE. PMID:16682957

  17. Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

    PubMed Central

    el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.


    We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

  18. p53 Loss Increases the Osteogenic Differentiation of BMSCs

    PubMed Central

    He, Yunlong; de Castro, Luis F; Shin, Min Hwa; Dubois, Wendy; Yang, Howard H.; Jiang, Shunlin; Mishra, Pravin J.; Ren, Ling; Gou, Hongfeng; Lal, Ashish; Khanna, Chand; Merlino, Glenn; Lee, Maxwell; Robey, Pamela G.; Huang, Jing


    The tumor suppressor, p53, plays a critical role in suppressing osteosarcoma. Bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) have been suggested to give rise to osteosarcomas. However, the role of p53 in BMSCs has not been extensively explored. Here, we report that p53 regulates the lineage choice of mouse BMSCs (mBMSCs). Compared to mBMSCs with wild type p53, mBMSCs deficient in p53 have enhanced osteogenic differentiation, but with similar adipogenic and chondrogenic differentiation. The role of p53 in inhibiting osteogenic lineage differentiation is mainly through the action of Runx2, a master transcription factor required for the osteogenic differentiation of mBMSCs. We find that p53 indirectly represses the expression of Runx2 by activating the microRNA-34 family, which suppresses the translation of Runx2. Since osteosarcoma may derive from BMSCs, we examined whether p53 has a role in the osteogenic differentiation of osteosarcoma cells and found that osteosarcoma cells with p53 deletion have higher levels of Runx2 and faster osteogenic differentiation than those with wild type p53. A systems biology approach reveals that p53-deficient mBMSCs are more closely related to human osteosarcoma while mBMSCs with wild type p53 are similar to normal human BMSCs. In summary, our results indicate that p53 activity can influence cell fate specification of mBMSCs, and provide molecular and cellular insights into the observation that p53 loss is associated with increased osteosarcoma incidence. PMID:25524638

  19. Loss of p53-regulatory protein IFI16 induces NBS1 leading to activation of p53-mediated checkpoint by phosphorylation of p53 SER37.


    Tawara, Hideyuki; Fujiuchi, Nobuko; Sironi, Juan; Martin, Sarah; Aglipay, Jason; Ouchi, Mutsuko; Taga, Makoto; Chen, Phang-Lang; Ouchi, Toru


    Our previous results that IFI16 is involved in p53 transcription activity under conditions of ionizing radiation (IR), and that the protein is frequently lost in human breast cancer cell lines and breast adenocarcinoma tissues suggesting that IFI16 plays a crucial role in controlling cell growth. Here, we show that loss of IFI16 by RNA interference in cell culture causes elevated phosphorylation of p53 Ser37 and accumulated NBS1 (nibrin) and p21WAF1, leading to growth retardation. Consistent with these observations, doxycyclin-induced NBS1 caused accumulation of p21WAF1 and increased phosphorylation of p53 Ser37, leading to cell cycle arrest in G1 phase. Wortmannin treatment was found to decrease p53 Ser37 phosphorylation in NBS-induced cells. These results suggest that loss of IFI16 activates p53 checkpoint through NBS1-DNA-PKcs pathway. PMID:17981542

  20. UV irradiation leads to transient changes in phosphorylation and stability of tumor suppressor protein p53.


    Scheidtmann, K; Landsberg, G


    Tumor suppressor protein p53 is thought to play a crucial role in maintaining the integrity of the genome. DNA damage caused by genotoxic drugs, UV or gamma-irradiation leads to accumulation of p53 and activation of its DNA binding and transcriptional activities and subsequently to cell cycle arrest or apoptosis. We investigated whether the apparent activation of p53 might be due to post-translational modification. The rat fibroblast cell lines REF52, 208F, and rat1 were irradiated with W-A and the synthesis, stability and phosphorylation state of p53 were investigated by pulse chase experiments, SDS-PAGE and two-dimensional phosphopeptide mapping. The three cell lines exhibited different sensitivities and biological responses to UV irradiation, REF52 cells responded with a growth arrest whereas 208F and rat1 cells underwent apoptosis. The fate of p53 was similar in all cases. Both the stability of p53 and its phosphorylation increased instantaneously but transiently. However, the amount of p53 that accumulated after UV treatment was much higher in 208F and rat1 than in REF52 cells. Interestingly, p53 that was synthesized early after irradiation was stable for more than 14 h whereas molecules synthesized 8 or more hours post irradiation were increasingly susceptible to degradation. Moreover, between 14 and 20 h after treatment, the rate of synthesis of p53 decreased to a level lower than in untreated cells suggesting negative feed back control. The expression of different p53-responsive genes, waf1/cip1, Gadd45, and bax was investigated by protein analyses. Surprisingly, p21(waf1) was expressed only in REF52 cells but not in the others. Furthermore, UV irradiation led only to a moderate increase of p21(waf1) expression. Expression of Gadd45 and box was detectable in both cell types but its expression did not change significantly upon UV treatment. Our results suggest i) that both cell types share a common pathway which upon UV irradiation results in enhanced

  1. NAT10 regulates p53 activation through acetylating p53 at K120 and ubiquitinating Mdm2.


    Liu, Xiaofeng; Tan, Yuqin; Zhang, Chunfeng; Zhang, Ying; Zhang, Liangliang; Ren, Pengwei; Deng, Hongkui; Luo, Jianyuan; Ke, Yang; Du, Xiaojuan


    As a genome guardian, p53 maintains genome stability by arresting cells for damage repair or inducing cell apoptosis to eliminate the damaged cells in stress response. Several nucleolar proteins stabilize p53 by interfering Mdm2-p53 interaction upon cellular stress, while other mechanisms by which nucleolar proteins activate p53 remain to be determined. Here, we identify NAT10 as a novel regulator for p53 activation. NAT10 acetylates p53 at K120 and stabilizes p53 by counteracting Mdm2 action. In addition, NAT10 promotes Mdm2 degradation with its intrinsic E3 ligase activity. After DNA damage, NAT10 translocates to nucleoplasm and activates p53-mediated cell cycle control and apoptosis. Finally, NAT10 inhibits cell proliferation and expression of NAT10 decreases in human colorectal carcinomas. Thus, our data demonstrate that NAT10 plays a critical role in p53 activation via acetylating p53 and counteracting Mdm2 action, providing a novel pathway by which nucleolar protein activates p53 as a cellular stress sensor. PMID:26882543

  2. Role of p53 isoforms and aggregations in cancer.


    Kim, SeJin; An, Seong Soo A


    p53 is a master regulatory protein that is involved in diverse cellular metabolic processes such as apoptosis, DNA repair, and cell cycle arrest. The protective function of p53 (in its homotetrameric form) as a tumor suppressor is lost in more than 50% of human cancers.Despite considerable experimental evidence suggesting the presence of multiple p53 states, it has been difficult to correlate the status of p53 with cancer response to treatments and clinical outcomes, which suggest the importance of complex but essential p53 regulatory pathways.Recent studies have indicated that the expression pattern of p53 isoforms may play a crucial role in regulating normal and cancer cell fates in response to diverse stresses. The human TP53 gene encodes at least 12 p53 isoforms, which are produced in normal tissue through alternative initiation of translation, usage of alternative promoters, and alternative splicing. Furthermore, some researchers have suggested that the formation of mutant p53 aggregates may be associated with cancer pathogenesis due to loss-of function (LoF), dominant-negative (DN), and gain-of function (GoF) effects.As different isoforms or the aggregation state of p53 may influence tumorigenesis, this review aims to examine the correlation of p53 isoforms and aggregation with cancer. PMID:27368003

  3. [Punish or cherish: p53, metabolism and tumor suppression].


    Albagli, Olivier


    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. PMID:26481026

  4. Role of p53 isoforms and aggregations in cancer

    PubMed Central

    Kim, SeJin; An, Seong Soo A.


    Abstract p53 is a master regulatory protein that is involved in diverse cellular metabolic processes such as apoptosis, DNA repair, and cell cycle arrest. The protective function of p53 (in its homotetrameric form) as a tumor suppressor is lost in more than 50% of human cancers. Despite considerable experimental evidence suggesting the presence of multiple p53 states, it has been difficult to correlate the status of p53 with cancer response to treatments and clinical outcomes, which suggest the importance of complex but essential p53 regulatory pathways. Recent studies have indicated that the expression pattern of p53 isoforms may play a crucial role in regulating normal and cancer cell fates in response to diverse stresses. The human TP53 gene encodes at least 12 p53 isoforms, which are produced in normal tissue through alternative initiation of translation, usage of alternative promoters, and alternative splicing. Furthermore, some researchers have suggested that the formation of mutant p53 aggregates may be associated with cancer pathogenesis due to loss-of function (LoF), dominant-negative (DN), and gain-of function (GoF) effects. As different isoforms or the aggregation state of p53 may influence tumorigenesis, this review aims to examine the correlation of p53 isoforms and aggregation with cancer. PMID:27368003

  5. p53: a molecular marker for the detection of cancer

    PubMed Central

    Boyd, Mark T; Vlatkovic, Nikolina


    Background The p53 gene is the most frequently mutated gene in cancer and accordingly has been the subject of intensive investigation for almost 30 years. Loss of p53 function due to mutations has been unequivocally demonstrated to promote cancer in both humans and in model systems. As a consequence, there exists an enormous body of information regarding the function of normal p53 in biology and the pathobiological consequences of p53 mutation. It has long been recognised that analysis of p53 has considerable potential as a tool for use in both diagnostic and, to a greater extent, prognostic settings and some significant progress has been made in both of these arenas. Objective To provide an overview of the biology of p53, particularly in the context of uses of p53 as a diagnostic tool. Methods A literature review focused upon the methods and uses of p53 analysis in the diagnosis of sporadic cancers, rare genetic disorders and in detection of residual disease. Conclusion p53 is currently an essential diagnostic for the rare inherited cancer prone syndrome (Li-Fraumeni) and is an important diagnostic in only a limited number of settings in sporadic disease. Research in specific cancers indicates that the uses of increasingly well informed p53 mutational analysis are likely to expand to other cancers. PMID:23495923

  6. p53 isoform profiling in glioblastoma and injured brain

    PubMed Central

    Takahashi, Rie; Giannini, Caterina; Sarkaria, Jann N.; Schroeder, Mark; Rogers, Joseph; Mastroeni, Diego; Scrable, Heidi


    The tumor suppressor p53 has been found to be the most commonly mutated gene in human cancers; however, the frequency of p53 mutations varies from 10–70% across different cancer types. This variability can partly be explained by inactivating mechanisms aside from direct genomic polymorphisms. The p53 gene encodes 12 isoforms, which have been shown to modulate full-length p53 activity in cancer. In this study, we characterized p53 isoform expression patterns in glioblastoma, gliosis, non-tumor brain, and neural progenitor cells by SDS-PAGE, immunoblot, mass spectrometry, and RT-PCR. At the protein level, we found that the most consistently expressed isoform in glioblastoma, Δ40p53, was uniquely expressed in regenerative processes, such as those involving neural progenitor cells and gliosis compared to tumor samples. Isoform profiling of glioblastoma tissues revealed the presence of both Δ40p53 and full-length p53, neither of which were detected in non-tumor cerebral cortex. Upon xenograft propagation of tumors, p53 levels increased. The variability of overall p53 expression and relative levels of isoforms suggest fluctuations in subpopulations of cells with greater or lesser capacity for proliferation, which can change as the tumor evolves under different growth conditions. PMID:22824800

  7. Senescence Regulation by the p53 Protein Family

    PubMed Central

    Qian, Yingjuan; Chen, Xinbin


    p53, a guardian of the genome, exerts its tumor suppression activity by regulating a large number of downstream targets involved in cell cycle arrest, DNA repair, apoptosis, and cellular senescence. Although p53-mediated apoptosis is able to kill cancer cells, a role for cellular senescence in p53-dependent tumor suppression is becoming clear. Mouse studies showed that activation of p53-induced premature senescence promotes tumor regression in vivo. However, p53-mediated cellular senescence also leads to aging-related phenotypes, such as tissue atrophy, stem cell depletion, and impaired wound healing. In addition, several p53 isoforms and two p53 homologs, p63 and p73, have been shown to play a role in cellular senescence and/or aging. Importantly, p53, p63, and p73 are necessary for the maintenance of adult stem cells. Therefore, understanding the dual role the p53 protein family in cancer and aging is critical to solve cancer and longevity in the future. In this chapter, we provide an overview on how p53, p63, p73, and their isoforms regulate cellular senescence and aging. PMID:23296650

  8. TRIM65 negatively regulates p53 through ubiquitination.


    Li, Yang; Ma, Chengyuan; Zhou, Tong; Liu, Ying; Sun, Luyao; Yu, Zhenxiang


    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. PMID:27012201

  9. Mitofusin-2 is a novel direct target of p53

    SciTech Connect

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen


    Research highlights: {yields} Mfn2 is a novel target gene of p53. {yields} Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. {yields} Mfn2 promoter activity can be elevated by the p53 protein. {yields} P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  10. Targeting the p53 Pathway in Ewing Sarcoma

    PubMed Central

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.


    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  11. Immunohistochemical Determination of p53 Protein Overexpression for Predicting p53 Gene Mutations in Hepatocellular Carcinoma: A Meta-Analysis

    PubMed Central

    Deng, Miao; Liu, Dechun; Ma, Qingyong; Feng, Xiaoshan


    Background Whether increased expression of the tumor suppressor protein p53 indicates a p53 gene mutation in hepatocellular carcinoma (HCC) remains unclear. We conducted a meta-analysis to determine whether p53 protein overexpression detected by immunohistochemistry (IHC) offers a diagnostic prediction for p53 gene mutations in HCC patients. Methods Systematic literature searches were conducted with an end date of December 2015. A meta-analysis was performed to estimate the diagnostic accuracy of IHC-determined p53 protein overexpression in the prediction of p53 gene mutations in HCC. Sensitivity, subgroup, and publication bias analyses were also conducted. Results Thirty-six studies were included in the meta-analysis. The results showed that the overall sensitivity and specificity for IHC-determined p53 overexpression in the diagnostic prediction of p53 mutations in HCC were 0.83 (95% CI: 0.80–0.86) and 0.74 (95% CI: 0.71–0.76), respectively. The summary positive likelihood ratio (PLR) and negative likelihood ratio (NLR) were 2.65 (95% CI: 2.21–3.18) and 0.36 (95% CI: 0.26–0.50), respectively. The diagnostic odds ratio (DOR) of IHC-determined p53 overexpression in predicting p53 mutations ranged from 0.56 to 105.00 (pooled, 9.77; 95% CI: 6.35–15.02), with significant heterogeneity between the included studies (I2 = 40.7%, P = 0.0067). Moreover, subgroup and sensitivity analyses did not alter the results of the meta-analysis. However, potential publication bias was present in the current meta-analysis. Conclusion The upregulation of the tumor suppressor protein p53 was indeed linked to p53 gene mutations. IHC determination of p53 overexpression can predict p53 gene mutations in HCC patients. PMID:27428001

  12. ASPP1 and ASPP2 bind active RAS, potentiate RAS signalling and enhance p53 activity in cancer cells

    PubMed Central

    Wang, Y; Godin-Heymann, N; Dan Wang, X; Bergamaschi, D; Llanos, S; Lu, X


    RAS mutations occur frequently in human cancer and activated RAS signalling contributes to tumour development and progression. Apart from its oncogenic effects on cell growth, active RAS has tumour-suppressive functions via its ability to induce cellular senescence and apoptosis. RAS is known to induce p53-dependent cell cycle arrest, yet its effect on p53-dependent apoptosis remains unclear. We report here that apoptosis-stimulating protein of p53 (ASPP) 1 and 2, two activators of p53, preferentially bind active RAS via their N-terminal RAS-association domains (RAD). Additionally, ASPP2 colocalises with and contributes to RAS cellular membrane localisation and potentiates RAS signalling. In cancer cells, ASPP1 and ASPP2 cooperate with oncogenic RAS to enhance the transcription and apoptotic function of p53. Thus, loss of ASPP1 and ASPP2 in human cancer cells may contribute to the full transforming property of RAS oncogene. PMID:23392125

  13. P53 protein expression in human leukemia and lymphoma cells.


    Koníková, E; Kusenda, J


    The purpose of this study was to determine the value of p53 protein overexpression in human leukemia and lymphoma cells. We examined PB and/or BM samples on a series of 111 patients with immunophenotypically defined hematological malignancies at diagnosis, in remission and in relapsed disease comparing to 20 control samples of healthy individuals. p53 protein has been studied by flow cytometry using three monoclonal antibodies specific for epitopes on N-terminus (Bp53-12, DO-1) and central region (DO-11) of p53 protein. Our findigs showed, that p53 expression may contribute to phenotype of leukemic cells and that overexpression of this protein is often associated with progression of disease. All samples of early B-ALL patients and samples of patients with immunophenotypically defined T- cell disorders examined at diagnosis of disease were p53 positive. Eleven of 19 patient samples from AML at diagnosis showed also increased expression of p53 protein. The cells of all patients who responded to therapy with complete immunophenotypically defined remission were p53 negative. Relapsed T-, B- ALL and AML develop p53 alteration. We reported positive p53 expression in cells of patients with advanced stages of CLL in comparison to them with initial stage of disease at examination. As well as in the group of B- cell lymphomas only samples of patients with generalized FCC lymphoma at diagnosis were p53 positive. We detected p53 positive cells in immunologically defined myeloid blast crisis of CML opposite to p53 negativity in chronic phase of disease. The finding of p53 positive BM cells without immunophenotypic blast markers in two of followed cases documented the contributing value of p53 detection in their characterization. On the basis of above findings we conclude, that cytofluorometric determination of p53 expression may contribute to the better definition of leukemic phenotype. Loss of the normal p53 function may be important in the genesis of some leukemias

  14. p53 attenuates AKT signaling by modulating membrane phospholipid composition

    PubMed Central

    Rueda-Rincon, Natalia; Bloch, Katarzyna; Derua, Rita; Vyas, Rajesh; Harms, Amy; Hankemeier, Thomas; Khan, Niamat Ali; Dehairs, Jonas; Bagadi, Muralidhararao; Binda, Maria Mercedes; Waelkens, Etienne; Marine, Jean-Christophe; Swinnen, Johannes V.


    The p53 tumor suppressor is the central component of a complex network of signaling pathways that protect organisms against the propagation of cells carrying oncogenic mutations. Here we report a previously unrecognized role of p53 in membrane phospholipids composition. By repressing the expression of stearoyl-CoA desaturase 1, SCD, the enzyme that converts saturated to mono-unsaturated fatty acids, p53 causes a shift in the content of phospholipids with mono-unsaturated acyl chains towards more saturated phospholipid species, particularly of the phosphatidylinositol headgroup class. This shift affects levels of phosphatidylinositol phosphates, attenuates the oncogenic AKT pathway, and contributes to the p53-mediated control of cell survival. These findings expand the p53 network to phospholipid metabolism and uncover a new molecular pathway connecting p53 to AKT signaling. PMID:26061814

  15. Mutant p53 in cell adhesion and motility.


    Yeudall, W Andrew; Wrighton, Katharine H; Deb, Sumitra


    Pro-oncogenic properties of mutant p53 were investigated with the aid of migration assays, adhesion assays, and soft agar growth assays using cells stably expressing gain-of-function p53 mutants. To determine cell migration, "wound-healing" (scratch) assays and haptotactic (chamber) assays were used. H1299 cells expressing mutant p53 were found to migrate more rapidly than cells transfected with empty vector alone. Results from both types of migration assay were broadly similar. Migratory ability differed for different p53 mutants, suggesting allele-specific effects. Cells expressing p53 mutants also showed enhanced adhesion to extracellular matrix compare to controls. Furthermore, stable transfection of mutant p53-H179L into NIH3T3 fibroblasts was sufficient to allow anchorage-independent growth in soft agar. PMID:23150443

  16. Crocetin exploits p53-induced death domain (PIDD) and FAS-associated death domain (FADD) proteins to induce apoptosis in colorectal cancer.


    Ray, Pallab; Guha, Deblina; Chakraborty, Juni; Banerjee, Shuvomoy; Adhikary, Arghya; Chakraborty, Samik; Das, Tanya; Sa, Gaurisankar


    Tumor suppressor p53 preserves the genomic integrity by restricting anomaly at the gene level. The hotspots for mutation in half of all colon cancers reside in p53. Hence, in a p53-mutated cellular milieu targeting cancer cells may be achievable by targeting the paralogue(s) of p53. Here we have shown the effectiveness of crocetin, a dietary component, in inducing apoptosis of colon cancer cells with varying p53 status. In wild-type p53-expressing cancer cells, p53 in one hand transactivates BAX and in parallel up-regulates p53-induced death domain protein (PIDD) that in turn cleaves and activates BID through caspase-2. Both BAX and t-BID converge at mitochondria to alter the transmembrane potential thereby leading to caspase-9 and caspase-3-mediated apoptosis. In contrast, in functional p53-impaired cells, this phytochemical exploits p53-paralogue p73, which up-regulates FAS to cleave BID through FAS-FADD-caspase-8-pathway. These findings not only underline the phenomenon of functional switch-over from p53 to p73 in p53-impaired condition, but also validate p73 as a promising and potential target for cancer therapy in absence of functional p53. PMID:27622714

  17. p53 isoforms regulate astrocyte-mediated neuroprotection and neurodegeneration.


    Turnquist, C; Horikawa, I; Foran, E; Major, E O; Vojtesek, B; Lane, D P; Lu, X; Harris, B T; Harris, C C


    Bidirectional interactions between astrocytes and neurons have physiological roles in the central nervous system and an altered state or dysfunction of such interactions may be associated with neurodegenerative diseases, such as Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS). Astrocytes exert structural, metabolic and functional effects on neurons, which can be either neurotoxic or neuroprotective. Their neurotoxic effect is mediated via the senescence-associated secretory phenotype (SASP) involving pro-inflammatory cytokines (e.g., IL-6), while their neuroprotective effect is attributed to neurotrophic growth factors (e.g., NGF). We here demonstrate that the p53 isoforms Δ133p53 and p53β are expressed in astrocytes and regulate their toxic and protective effects on neurons. Primary human astrocytes undergoing cellular senescence upon serial passaging in vitro showed diminished expression of Δ133p53 and increased p53β, which were attributed to the autophagic degradation and the SRSF3-mediated alternative RNA splicing, respectively. Early-passage astrocytes with Δ133p53 knockdown or p53β overexpression were induced to show SASP and to exert neurotoxicity in co-culture with neurons. Restored expression of Δ133p53 in near-senescent, otherwise neurotoxic astrocytes conferred them with neuroprotective activity through repression of SASP and induction of neurotrophic growth factors. Brain tissues from AD and ALS patients possessed increased numbers of senescent astrocytes and, like senescent astrocytes in vitro, showed decreased Δ133p53 and increased p53β expression, supporting that our in vitro findings recapitulate in vivo pathology of these neurodegenerative diseases. Our finding that Δ133p53 enhances the neuroprotective function of aged and senescent astrocytes suggests that the p53 isoforms and their regulatory mechanisms are potential targets for therapeutic intervention in neurodegenerative diseases. PMID:27104929

  18. Cytoplasmic Functions of the Tumor Suppressor p53

    PubMed Central

    Green, Douglas R.; Kroemer, Guido


    The principal tumor suppressor protein, p53, accumulates in cells in response to DNA damage, oncogene activation, and other stresses. It acts as a nuclear transcription factor that transactivates genes involved in apoptosis, cell cycle regulation, and numerous other processes. An emerging area of research unravels additional activities of p53 in the cytoplasm, where it triggers apoptosis and inhibits autophagy. These novel functions contribute to p53’s mission as a tumor suppressor. PMID:19407794

  19. Transcription factors that interact with p53 and Mdm2.


    Inoue, Kazushi; Fry, Elizabeth A; Frazier, Donna P


    The tumor suppressor p53 is activated upon cellular stresses such as DNA damage, oncogene activation, hypoxia, which transactivates sets of genes that induce DNA repair, cell cycle arrest, apoptosis, or autophagy, playing crucial roles in the prevention of tumor formation. The central regulator of the p53 pathway is Mdm2 which inhibits transcriptional activity, nuclear localization and protein stability. More than 30 cellular p53-binding proteins have been isolated and characterized including Mdm2, Mdm4, p300, BRCA1/2, ATM, ABL and 53BP-1/2. Most of them are nuclear proteins; however, not much is known about p53-binding transcription factors. In this review, we focus on transcription factors that directly interact with p53/Mdm2 through direct binding including Dmp1, E2F1, YB-1 and YY1. Dmp1 and YB-1 bind only to p53 while E2F1 and YY1 bind to both p53 and Mdm2. Dmp1 has been shown to bind to p53 and block all the known functions for Mdm2 on p53 inhibition, providing a secondary mechanism for tumor suppression in Arf-null cells. Although E2F1-p53 binding provides a checkpoint mechanism to silence hyperactive E2F1, YB-1 or YY1 interaction with p53 subverts the activity of p53, contributing to cell cycle progression and tumorigenesis. Thus, the modes and consequences for each protein-protein interaction vary from the viewpoint of tumor development and suppression. PMID:26132471

  20. Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53

    NASA Technical Reports Server (NTRS)

    Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.


    The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.

  1. A small molecule directly inhibits the p53 transactivation domain from binding to replication protein A

    PubMed Central

    Glanzer, Jason G.; Carnes, Katie A.; Soto, Patricia; Liu, Shengqin; Parkhurst, Lawrence J.; Oakley, Gregory G.


    Replication protein A (RPA), essential for DNA replication, repair and DNA damage signalling, possesses six ssDNA-binding domains (DBDs), including DBD-F on the N-terminus of the largest subunit, RPA70. This domain functions as a binding site for p53 and other DNA damage and repair proteins that contain amphipathic alpha helical domains. Here, we demonstrate direct binding of both ssDNA and the transactivation domain 2 of p53 (p53TAD2) to DBD-F, as well as DBD-F-directed dsDNA strand separation by RPA, all of which are inhibited by fumaropimaric acid (FPA). FPA binds directly to RPA, resulting in a conformational shift as determined through quenching of intrinsic tryptophan fluorescence in full length RPA. Structural analogues of FPA provide insight on chemical properties that are required for inhibition. Finally, we confirm the inability of RPA possessing R41E and R43E mutations to bind to p53, destabilize dsDNA and quench tryptophan fluorescence by FPA, suggesting that protein binding, DNA modulation and inhibitor binding all occur within the same site on DBD-F. The disruption of p53–RPA interactions by FPA may disturb the regulatory functions of p53 and RPA, thereby inhibiting cellular pathways that control the cell cycle and maintain the integrity of the human genome. PMID:23267009

  2. Regulation of iron homeostasis by the p53-ISCU pathway

    PubMed Central

    Funauchi, Yuki; Tanikawa, Chizu; Yi Lo, Paulisally Hau; Mori, Jinichi; Daigo, Yataro; Takano, Atsushi; Miyagi, Yohei; Okawa, Atsushi; Nakamura, Yusuke; Matsuda, Koichi


    Accumulation of iron in tissues increases the risk of cancer, but iron regulatory mechanisms in cancer tissues are largely unknown. Here, we report that p53 regulates iron metabolism through the transcriptional regulation of ISCU (iron-sulfur cluster assembly enzyme), which encodes a scaffold protein that plays a critical role in Fe-S cluster biogenesis. p53 activation induced ISCU expression through binding to an intronic p53-binding site. Knockdown of ISCU enhanced the binding of iron regulatory protein 1 (IRP1), a cytosolic Fe-S protein, to an iron-responsive element in the 5′ UTR of ferritin heavy polypeptide 1 (FTH1) mRNA and subsequently reduced the translation of FTH1, a major iron storage protein. In addition, in response to DNA damage, p53 induced FTH1 and suppressed transferrin receptor, which regulates iron entry into cells. HCT116 p53+/+ cells were resistant to iron accumulation, but HCT116 p53−/− cells accumulated intracellular iron after DNA damage. Moreover, excess dietary iron caused significant elevation of serum iron levels in p53−/− mice. ISCU expression was decreased in the majority of human liver cancer tissues, and its reduced expression was significantly associated with p53 mutation. Our finding revealed a novel role of the p53-ISCU pathway in the maintenance of iron homeostasis in hepatocellular carcinogenesis. PMID:26560363

  3. GATA-1 associates with and inhibits p53

    PubMed Central

    Mas, Caroline; Archambault, Patrick; Di Lello, Paola


    In addition to orchestrating the expression of all erythroid-specific genes, GATA-1 controls the growth, differentiation, and survival of the erythroid lineage through the regulation of genes that manipulate the cell cycle and apoptosis. The stages of mammalian erythropoiesis include global gene inactivation, nuclear condensation, and enucleation to yield circulating erythrocytes, and some of the genes whose expression are altered by GATA-1 during this process are members of the p53 pathway. In this study, we demonstrate a specific in vitro interaction between the transactivation domain of p53 (p53TAD) and a segment of the GATA-1 DNA-binding domain that includes the carboxyl-terminal zinc-finger domain. We also show by immunoprecipitation that the native GATA-1 and p53 interact in erythroid cells and that activation of p53-responsive promoters in an erythroid cell line can be inhibited by the overexpression of GATA-1. Mutational analysis reveals that GATA-1 inhibition of p53 minimally requires the segment of the GATA-1 DNA-binding domain that interacts with p53TAD. This inhibition is reciprocal, as the activation of a GATA-1–responsive promoter can be inhibited by p53. Based on these findings, we conclude that inhibition of the p53 pathway by GATA-1 may be essential for erythroid cell development and survival. PMID:19411634

  4. GATA-1 associates with and inhibits p53.


    Trainor, Cecelia D; Mas, Caroline; Archambault, Patrick; Di Lello, Paola; Omichinski, James G


    In addition to orchestrating the expression of all erythroid-specific genes, GATA-1 controls the growth, differentiation, and survival of the erythroid lineage through the regulation of genes that manipulate the cell cycle and apoptosis. The stages of mammalian erythropoiesis include global gene inactivation, nuclear condensation, and enucleation to yield circulating erythrocytes, and some of the genes whose expression are altered by GATA-1 during this process are members of the p53 pathway. In this study, we demonstrate a specific in vitro interaction between the transactivation domain of p53 (p53TAD) and a segment of the GATA-1 DNA-binding domain that includes the carboxyl-terminal zinc-finger domain. We also show by immunoprecipitation that the native GATA-1 and p53 interact in erythroid cells and that activation of p53-responsive promoters in an erythroid cell line can be inhibited by the overexpression of GATA-1. Mutational analysis reveals that GATA-1 inhibition of p53 minimally requires the segment of the GATA-1 DNA-binding domain that interacts with p53TAD. This inhibition is reciprocal, as the activation of a GATA-1-responsive promoter can be inhibited by p53. Based on these findings, we conclude that inhibition of the p53 pathway by GATA-1 may be essential for erythroid cell development and survival. PMID:19411634

  5. Multivalent binding of p53 to the STAGA complex mediates coactivator recruitment after UV damage.


    Gamper, Armin M; Roeder, Robert G


    The recruitment of transcriptional coactivators, including histone modifying enzymes, is an important step in transcription regulation. A typical activator is thought to interact with several cofactors, presumably in a sequential manner. The common use of several cofactors raises the question of how activators achieve both cofactor selectivity and diversity. Human STAGA is a multiprotein complex with the acetyltransferase GCN5L as the catalytic subunit. Here, we first show, through RNA interference-mediated knock-down and chromatin immunoprecipitation assays, that GCN5 plays a role in p53-dependent gene activation. We then employ p53 mutagenesis, in vitro binding, protein-protein cross-linking, and chromatin immunoprecipitation assays to establish a novel role for the second p53 activation subdomain (AD2) in STAGA recruitment and, further, to demonstrate that optimal binding of STAGA to p53 involves interactions of STAGA subunits TAF9, GCN5, and ADA2b, respectively, with AD1, AD2, and carboxy-terminal domains of p53. These results provide concrete evidence for mediation of transcription factor binding to coactivator complexes through multiple interactions. Based on our data, we propose a cooperative and modular binding mode for the recruitment of coactivator complexes to promoters. PMID:18250150

  6. PKR, a p53 target gene, plays a crucial role in the tumor-suppressor function of p53

    PubMed Central

    Yoon, Cheol-Hee; Lee, Eun-Soo; Lim, Dae-Seog; Bae, Yong-Soo


    Type I IFN-induced expression of dsRNA-activated protein kinase (PKR) during viral infection is a well-established antiviral mechanism. However, little is known about the expression of PKR in the context of p53 and about PKR involvement in p53-mediated tumor suppression. Here, we report that PKR is a p53 target gene and plays an important role in the tumor-suppressor function of p53. Activation of p53 by genotoxic stress induces a significant level of PKR expression by acting on the newly identified cis-acting element (ISRE), which is separated from the IFN-stimulated responsive element on the PKR promoter, resulting in translational inhibition and cell apoptosis. The genotoxin-mediated inhibition of translation is associated with the p53/PKR/elF2a (eukaryotic initiation factor-2α) pathway. To some extent, p53 activation induced by DNA damage facilitates cell apoptosis by activating PKR. PKR-knockdown human colon cancer cells grew rapidly in nude mice and proved resistant to anti-cancer drugs. These data indicate that p53-mediated tumor suppression can be attributed at least in part to the biological functions of PKR induced by p53 in genotoxic conditions. PMID:19416861

  7. Long Noncoding RNA MEG3 Interacts with p53 Protein and Regulates Partial p53 Target Genes in Hepatoma Cells

    PubMed Central

    Zhu, Juanjuan; Liu, Shanshan; Ye, Fuqiang; Shen, Yuan; Tie, Yi; Zhu, Jie; Wei, Lixin; Jin, Yinghua; Fu, Hanjiang; Wu, Yongge; Zheng, Xiaofei


    Maternally Expressed Gene 3 (MEG3) encodes a lncRNA which is suggested to function as a tumor suppressor. Previous studies suggested that MEG3 functioned through activation of p53, however, the functional properties of MEG3 remain obscure and their relevance to human diseases is under continuous investigation. Here, we try to illuminate the relationship of MEG3 and p53, and the consequence in hepatoma cells. We find that transfection of expression construct of MEG3 enhances stability and transcriptional activity of p53. Deletion analysis of MEG3 confirms that full length and intact structure of MEG3 are critical for it to activate p53-mediated transactivation. Interestingly, our results demonstrate for the first time that MEG3 can interact with p53 DNA binding domain and various p53 target genes are deregulated after overexpression of MEG3 in hepatoma cells. Furthermore, results of qRT-PCR have shown that MEG3 RNA is lost or reduced in the majority of HCC samples compared with adjacent non-tumorous samples. Ectopic expression of MEG3 in hepatoma cells significantly inhibits proliferation and induces apoptosis. In conclusion, our data demonstrates that MEG3 functions as a tumor suppressor in hepatoma cells through interacting with p53 protein to activate p53-mediated transcriptional activity and influence the expression of partial p53 target genes. PMID:26444285

  8. Post-thymic T cell lymphomas frequently overexpress p53 protein but infrequently exhibit p53 gene mutations.

    PubMed Central

    Matsushima, A. Y.; Cesarman, E.; Chadburn, A.; Knowles, D. M.


    We recently demonstrated that only one of 36 T-cell neoplasms contained p53 gene mutations. Although p53 gene mutations are known to result in overexpression of the p53 gene product, we also recently discovered that p53 protein overexpression does not correlate with p53 gene mutations, but does correlate with proliferation (r = 0.92), in anaplastic large cell lymphoma. In view of these findings, we investigated 34 non-human T-cell lymphotropic virus type I (HTLV-I) related postthymic T-cell lymphomas immunohistochemically for p53 protein, using monoclonal antibody 1801, and for proliferation, using monoclonal antibody Ki-67, and quantitated the results with the CAS-200 computerized image analysis system. We evaluated the presence of mutations in conserved exons 5 to 9 of the p53 gene using single-strand conformation polymorphism analysis and DNA sequencing. p53 mutations were detected in three of 34 cases, including two that contained deletions. p53 protein overexpression was detected in 17 of 34 cases, including the three mutated cases, with reactivities ranging from 10% to 48%. However, many cases in which a structural alteration could not be detected demonstrated levels of p53 protein expression comparable to those cases that were mutated. Correlation of p53 protein expression and proliferation, as assessed by Ki-67 expression, in this group of lymphomas was poor (r = 0.34). Whether alternative mechanisms of p53 protein inactivation are causing phenotypic overexpression of the p53 protein in these malignant lymphomas is unknown, although preliminary studies do not support a major role for such mechanisms. Therefore, the etiology and the significance of p53 protein overexpression in the cases that lack a demonstrable mutation is unclear. Nevertheless, as in anaplastic large cell lymphoma, overexpression of the p53 gene product is not a reliable predictor of the presence of mutations in conserved portions of the p53 gene in non-HTLV-I associated post-thymic T

  9. p53 Isoforms: Key Regulators of the Cell Fate Decision.


    Joruiz, Sebastien M; Bourdon, Jean-Christophe


    It is poorly understood how a single protein, p53, can be responsive to so many stress signals and orchestrates very diverse cell responses to maintain/restore cell/tissue functions. The uncovering that TP53 gene physiologically expresses, in a tissue-dependent manner, several p53 splice variants (isoforms) provides an explanation to its pleiotropic biological activities. Here, we summarize a decade of research on p53 isoforms. The clinical studies and the diverse cellular and animal models of p53 isoforms (zebrafish, Drosophila, and mouse) lead us to realize that a p53-mediated cell response is, in fact, the sum of the intrinsic activities of the coexpressed p53 isoforms and that unbalancing expression of different p53 isoforms leads to cancer, premature aging, (neuro)degenerative diseases, inflammation, embryo malformations, or defects in tissue regeneration. Cracking the p53 isoforms' code is, thus, a necessary step to improve cancer treatment. It also opens new exciting perspectives in tissue regeneration. PMID:26801896

  10. A role for Numb in p53 stabilization

    PubMed Central

    Carter, Stephanie; Vousden, Karen H


    The cell-fate determinant Numb has recently been shown to help activate the tumor suppressor protein p53. Loss of Numb in breast cancers would result, therefore, in both the activation of the potential oncogene Notch and the diminution of tumor suppression by p53. PMID:18492217

  11. Guilty as CHARGED: p53's expanding role in disease

    PubMed Central

    Van Nostrand, Jeanine L; Attardi, Laura D


    Unrestrained p53 activity during development, as occurs upon loss of the p53 negative regulators Mdm2 or Mdmx, causes early embryonic lethality. Surprisingly, co-expression of wild-type p53 and a transcriptionally-dead variant of p53, with mutations in both transactivation domains (p53L25Q,W26S,F53Q,F54S), also causes lethality, but later in gestation and in association with a host of very specific phenotypes reminiscent of a syndrome known as CHARGE. Molecular analyses revealed that wild-type p53 is inappropriately activated in p535,26,53,54/+ embryos, triggering cell-cycle arrest or apoptosis during development to cause CHARGE phenotypes. In addition, CHARGE syndrome is typically caused by mutations in the CHD7 chromatin remodeler, and we have shown that activated p53 contributes to phenotypes caused by CHD7-deficiency. Together, these studies provide new insight into CHARGE syndrome and expand our understanding of the role of p53 in diseases other than cancer. PMID:25483057

  12. Targeting p53 by small molecules in hematological malignancies.


    Saha, Manujendra N; Qiu, Lugui; Chang, Hong


    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their anti-tumor effects in different types of hematological malignancies. Importantly, nutlin and PRIMA-1 have successfully reached the stage of phase I/II clinical trials in at least one type of hematological cancer. Thus, the pharmacological activation of p53 by these small molecules has a major clinical impact on prognostic use and targeted drug design. In the current review, we present the recent achievements in p53 research using small molecules in hematological malignancies. Anticancer activity of different classes of compounds targeting the p53 signaling pathway and their mechanism of action are discussed. In addition, we discuss how p53 tumor suppressor protein holds promise as a drug target for recent and future novel therapies in these diseases. PMID:23531342

  13. p53 Regulates Period2 Expression and the Circadian Clock

    PubMed Central

    Miki, Takao; Matsumoto, Tomoko; Zhao, Zhaoyang; Lee, Cheng Chi


    The mechanistic interconnectivity between circadian regulation and the genotoxic stress response remains poorly understood. Here we show that the expression of Period 2 (Per2), a circadian regulator, is directly regulated by p53 binding to a response element in the Per2 promoter. This p53 response element is evolutionarily conserved and overlaps with the E-Box element critical for BMAL1/CLOCK binding and its transcriptional activation of Per2 expression. Our studies reveal that p53 blocks BMAL1/CLOCK binding to the Per2 promoter leading to repression of Per2 expression. In the suprachiasmatic nucleus (SCN), p53 expression and its binding to the Per2 promoter are under circadian control. Per2 expression in the SCN is altered by p53 deficiency or stabilization of p53 by Nutlin-3. Behaviorally, p53−/− mice have a shorter period length that lacks stability and they exhibit impaired photo-entrainment to a light pulse under a free-running state. Our studies demonstrate that p53 modulates mouse circadian behavior. PMID:24051492

  14. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck


    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  15. Functional Analysis of p53 Binding under Differential Stresses†

    PubMed Central

    Krieg, Adam J.; Hammond, Ester M.; Giaccia, Amato J.


    Hypoxia and DNA damage stabilize the p53 protein, but the subsequent effect that each stress has on transcriptional regulation of known p53 target genes is variable. We have used chromatin immunoprecipitation followed by CpG island (CGI) microarray hybridization to identify promoters bound by p53 under both DNA-damaging and non-DNA-damaging conditions in HCT116 cells. Using gene-specific PCR analysis, we have verified an association with CGIs of the highest enrichment (>2.5-fold) (REV3L, XPMC2H, HNRPUL1, TOR1AIP1, glutathione peroxidase 1, and SCFD2), with CGIs of intermediate enrichment (>2.2-fold) (COX7A2L, SYVN1, and JAG2), and with CGIs of low enrichment (>2.0-fold) (MYC and PCNA). We found little difference in promoter binding when p53 is stabilized by these two distinctly different stresses. However, expression of these genes varies a great deal: while a few genes exhibit classical induction with adriamycin, the majority of the genes are unchanged or are mildly repressed by either hypoxia or adriamycin. Further analysis using p53 mutated in the core DNA binding domain revealed that the interaction of p53 with CGIs may be occurring through both sequence-dependent and -independent mechanisms. Taken together, these experiments describe the identification of novel p53 target genes and the subsequent discovery of distinctly different expression phenomena for p53 target genes under different stress scenarios. PMID:16980608

  16. p53 as an intervention target for cancer and aging

    PubMed Central

    Hasty, Paul; Christy, Barbara A.


    p53 is well known for suppressing tumors but could also affect other aging processes not associated with tumor suppression. As a transcription factor, p53 responds to a variety of stresses to either induce apoptosis (cell death) or cell cycle arrest (cell preservation) to suppress tumor development. Yet, the effect p53 has on the non-cancer aspects of aging is complicated and not well understood. On one side, p53 could induce cellular senescence or apoptosis to suppress cancer but as an unintended consequence enhance the aging process especially if these responses diminish stem and progenitor cell populations. But on the flip side, p53 could reduce growth and growth-related stress to enable cell survival and ultimately delay the aging process. A better understanding of diverse functions of p53 is essential to elucidate its influences on the aging process and the possibility of targeting p53 or p53 transcriptional targets to treat cancer and ameliorate general aging. PMID:24124625

  17. p53 in the DNA-Damage-Repair Process.


    Williams, Ashley B; Schumacher, Björn


    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA-damage-response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA-repair systems. It thus appears as if p53 is multitasking in providing protection from cancer development by maintaining genome stability. PMID:27048304

  18. Low Levels of p53 Protein and Chromatin Silencing of p53 Target Genes Repress Apoptosis in Drosophila Endocycling Cells

    PubMed Central

    Zhang, Bingqing; Mehrotra, Sonam; Ng, Wei Lun; Calvi, Brian R.


    Apoptotic cell death is an important response to genotoxic stress that prevents oncogenesis. It is known that tissues can differ in their apoptotic response, but molecular mechanisms are little understood. Here, we show that Drosophila polyploid endocycling cells (G/S cycle) repress the apoptotic response to DNA damage through at least two mechanisms. First, the expression of all the Drosophila p53 protein isoforms is strongly repressed at a post-transcriptional step. Second, p53-regulated pro-apoptotic genes are epigenetically silenced in endocycling cells, preventing activation of a paused RNA Pol II by p53-dependent or p53-independent pathways. Over-expression of the p53A isoform did not activate this paused RNA Pol II complex in endocycling cells, but over-expression of the p53B isoform with a longer transactivation domain did, suggesting that dampened p53B protein levels are crucial for apoptotic repression. We also find that the p53A protein isoform is ubiquitinated and degraded by the proteasome in endocycling cells. In mitotic cycling cells, p53A was the only isoform expressed to detectable levels, and its mRNA and protein levels increased after irradiation, but there was no evidence for an increase in protein stability. However, our data suggest that p53A protein stability is regulated in unirradiated cells, which likely ensures that apoptosis does not occur in the absence of stress. Without irradiation, both p53A protein and a paused RNA pol II were pre-bound to the promoters of pro-apoptotic genes, preparing mitotic cycling cells for a rapid apoptotic response to genotoxic stress. Together, our results define molecular mechanisms by which different cells in development modulate their apoptotic response, with broader significance for the survival of normal and cancer polyploid cells in mammals. PMID:25211335

  19. Mitochondrial dysfunction impairs tumor suppressor p53 expression/function.


    Compton, Shannon; Kim, Chul; Griner, Nicholas B; Potluri, Prasanth; Scheffler, Immo E; Sen, Sabyasachi; Jerry, D Joseph; Schneider, Sallie; Yadava, Nagendra


    Recently, mitochondria have been suggested to act in tumor suppression. However, the underlying mechanisms by which mitochondria suppress tumorigenesis are far from being clear. In this study, we have investigated the link between mitochondrial dysfunction and the tumor suppressor protein p53 using a set of respiration-deficient (Res(-)) mammalian cell mutants with impaired assembly of the oxidative phosphorylation machinery. Our data suggest that normal mitochondrial function is required for γ-irradiation (γIR)-induced cell death, which is mainly a p53-dependent process. The Res(-) cells are protected against γIR-induced cell death due to impaired p53 expression/function. We find that the loss of complex I biogenesis in the absence of the MWFE subunit reduces the steady-state level of the p53 protein, although there is no effect on the p53 protein level in the absence of the ESSS subunit that is also essential for complex I assembly. The p53 protein level was also reduced to undetectable levels in Res(-) cells with severely impaired mitochondrial protein synthesis. This suggests that p53 protein expression is differentially regulated depending upon the type of electron transport chain/respiratory chain deficiency. Moreover, irrespective of the differences in the p53 protein expression profile, γIR-induced p53 activity is compromised in all Res(-) cells. Using two different conditional systems for complex I assembly, we also show that the effect of mitochondrial dysfunction on p53 expression/function is a reversible phenomenon. We believe that these findings will have major implications in the understanding of cancer development and therapy. PMID:21502317

  20. p53 regulates the transcription of its Delta133p53 isoform through specific response elements contained within the TP53 P2 internal promoter.


    Marcel, V; Vijayakumar, V; Fernández-Cuesta, L; Hafsi, H; Sagne, C; Hautefeuille, A; Olivier, M; Hainaut, P


    The tumor suppressor p53 protein is activated by genotoxic stress and regulates genes involved in senescence, apoptosis and cell-cycle arrest. Nine p53 isoforms have been described that may modulate suppressive functions of the canonical p53 protein. Among them, Delta133p53 lacks the 132 proximal residues and has been shown to modulate p53-induced apoptosis and cell-cycle arrest. Delta133p53 is expressed from a specific mRNA, p53I4, driven by an alternative promoter P2 located between intron 1 and exon 5 of TP53 gene. Here, we report that the P2 promoter is regulated in a p53-dependent manner. Delta133p53 expression is increased in response to DNA damage by doxorubicin in p53 wild-type cell lines, but not in p53-mutated cells. Chromatin immunoprecipitation and luciferase assays using P2 promoter deletion constructs indicate that p53 binds functional response elements located within the P2 promoter. We also show that Delta133p53 does not bind specifically to p53 consensus DNA sequence in vitro, but competes with wild-type p53 in specific DNA-binding assays. Finally, we report that Delta133p53 counteracts p53-dependent growth suppression in clonogenic assays. These observations indicate that Delta133p53 is a novel target of p53 that may participate in a negative feedback loop controlling p53 function. PMID:20190805

  1. Simulated solar light-induced p53 mutagenesis in SKH-1 mouse skin: a dose-response assessment.


    Verkler, Tracie L; Delongchamp, Robert R; Miller, Barbara J; Webb, Peggy J; Howard, Paul C; Parsons, Barbara L


    Sunlight and ultraviolet-induced mutation of the p53 gene is a frequent, possibly obligate step in skin cancer development, making quantitative measurement of p53 mutation an ideal biomarker for sunlight-induced skin carcinogenesis. To understand how the appearance of p53 mutation relates to skin tumor development, SKH-1 hairless mice were exposed 5 d per week to one of four different doses of simulated solar light (SSL; 0, 6.85, 13.70, 20.55 mJ x CIE/cm(2)) previously characterized for their tumorigenic potential. Allele-specific competitive blocker-PCR (ACB-PCR) was used to measure levels of p53 codon 270 CGT to TGT mutation within DNA isolated from dorsal skin of exposed mice. For each dose, p53 mutant fraction (MF) was measured after 4, 16, and 28 wk of exposure. Significant dose- and time-dependent increases in p53 MF were identified. All p53 MF measurements were integrated by relating the observed p53 MF to the cumulative dose of SSL. The increase in the logarithm of p53 MF was described by the linear function: log(10) MF = alpha + 0.0016 x d, where alpha is the spontaneous log(10) MF after a particular time point and d is the dose of SSL in mJ x CIE/cm(2). The p53 MF induced in nontumor bearing skin by 28 wk of exposure at the high dose of SSL was significantly lower than that found in skin tumors induced by approximately 32 wk of exposure to the same dose of SSL. p53 MF showed a strong negative correlation with tumor latency, suggesting this quantitative biomarker has the potential to predict tumorigenicity. PMID:18314877

  2. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis.


    Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang


    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H₂O₂ production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. PMID:25448048

  3. p53 mRNA and p53 Protein Structures Have Evolved Independently to Interact with MDM2.


    Karakostis, Konstantinos; Ponnuswamy, Anand; Fusée, Leïla T S; Bailly, Xavier; Laguerre, Laurent; Worall, Erin; Vojtesek, Borek; Nylander, Karin; Fåhraeus, Robin


    The p53 tumor suppressor and its key regulator MDM2 play essential roles in development, ageing, cancer, and cellular stress responses in mammals. Following DNA damage, MDM2 interacts with p53 mRNA in an ATM kinase-dependent fashion and stimulates p53 synthesis, whereas under normal conditions, MDM2 targets the p53 protein for degradation. The peptide- and RNA motifs that interact with MDM2 are encoded by the same conserved BOX-I sequence, but how these interactions have evolved is unknown. Here, we show that a temperature-sensitive structure in the invertebrate Ciona intestinalis (Ci) p53 mRNA controls its interaction with MDM2. We also show that a nonconserved flanking region of Ci-BOX-I domain prevents the p53-MDM2 protein-protein interaction. These results indicate that the temperature-regulated p53 mRNA-MDM2 interaction evolved to become kinase regulated in the mammalian DNA damage response. The data also suggest that the negative regulation of p53 by MDM2 via protein-protein interaction evolved in vertebrates following changes in the BOX-I flanking sequence. PMID:26823446

  4. Transcriptional Cross Talk between NF-κB and p53

    PubMed Central

    Webster, Gill A.; Perkins, Neil D.


    Many cellular stimuli result in the induction of both the tumor suppressor p53 and NF-κB. In contrast to activation of p53, which is associated with the induction of apoptosis, stimulation of NF-κB has been shown to promote resistance to programmed cell death. These observations suggest that a regulatory mechanism must exist to integrate these opposing outcomes and coordinate this critical cellular decision-making event. Here we show that both p53 and NF-κB inhibit each other’s ability to stimulate gene expression and that this process is controlled by the relative levels of each transcription factor. Expression of either wild-type p53 or the RelA(p65) NF-κB subunit suppresses stimulation of transcription by the other factor from a reporter plasmid in vivo. Moreover, endogenous, tumor necrosis factor alpha-activated NF-κB will inhibit endogenous wild-type p53 transactivation. Following exposure to UV light, however, the converse is observed, with p53 downregulating NF-κB-mediated transcriptional activation. Both p53 and RelA(p65) interact with the transcriptional coactivator proteins p300 and CREB-binding protein (CBP), and we demonstrate that these results are consistent with competition for a limiting pool of p300/CBP complexes in vivo. These observations have many implications for regulation of the transcriptional decision-making mechanisms that govern cellular processes such as apoptosis. Furthermore, they suggest a previously unrealized mechanism through which dysregulated NF-κB can contribute to tumorigenesis and disease. PMID:10207072

  5. p53MVA therapy in patients with refractory gastrointestinal malignancies elevates p53-specific CD8+ T cell responses

    PubMed Central

    Hardwick, Nicola R; Carrol, Mary; Kaltcheva, Teodora; Qian, Dajun; Lim, Dean; Leong, Lucille; Chu, Peiguo; Kim, Joseph; Chao, Joseph; Fakih, Marwan; Yen, Yun; Espenschied, Jonathan; Ellenhorn, Joshua D I; Diamond, Don J; Chung, Vincent


    PURPOSE: To conduct a Phase I trial of a Modified Vaccinia Ankara vaccine delivering wild type human p53 (p53MVA) in patients with refractory gastrointestinal cancers. EXPERIMENTAL DESIGN: Three patients were vaccinated with 1.0 × 108 pfu p53MVA followed by nine patients at 5.6 × 108 pfu. Toxicity was classified using the NCI Common Toxicity Criteria and clinical responses were assessed by CT scan. Peripheral blood samples were collected pre- and post-immunization for immunophenotyping, monitoring of p53MVA induced immune response and examination of PD-1 checkpoint inhibition in vitro. RESULTS: p53MVA immunization was well tolerated at both doses, with no adverse events above grade 2. CD4+ and CD8+ T cells showing enhanced recognition of a p53 overlapping peptide library were detectable after the first immunization, particularly in the CD8+ T cell compartment (p=0.03). However in most patients this did not expand further with the second and third immunization. The frequency of PD-1+ T cells detectable in patients PBMC was significantly higher than in healthy controls. Furthermore, the frequency of PD-1+ CD8+ T cells showed an inverse correlation with the peak CD8+ p53 response (p=0.02) and antibody blockade of PD-1 in vitro increased the p53 immune responses detected after the second or third immunizations. Induction of strong T cell and antibody responses to the MVA backbone were also apparent. CONCLUSION: p53MVA was well tolerated and induced robust CD8+ T cell responses. Combination of p53MVA with immune checkpoint inhibition could help sustain immune responses and lead to enhanced clinical benefit. PMID:24987057

  6. Caught in the cross fire: p53 in inflammation.


    Cooks, Tomer; Harris, Curtis C; Oren, Moshe


    The p53 transcription factor is a major tumor suppressor, whose diverse activities serve to ensure genome stability and inhibit neoplastic processes. In recent years, it is becoming increasingly clear that p53 also plays a broader role in maintaining cellular homeostasis, as well as contributing to tissue homeostasis in a non-cell-autonomous fashion. Chronic inflammation is a potential cancer-promoting condition, and as such is also within the radar of p53, which mounts a multifaceted attempt to prevent the escalation of chronic tissue imbalance into neoplasia. Recent understanding of the p53 pathway and other family members reveals a broad interaction with inflammatory elements such as reactive oxygen and nitrogen species, cytokines, infectious agents and major immune-regulatory pathways like nuclear factor-kappaB. This complex cross talk is highly dependent on p53 status, as different p53 isoforms and p53 mutants can mediate different responses and even promote chronic inflammation and associated cancer, acting in the tumor cells as well as in the stromal and immune compartments. PMID:24942866

  7. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M


    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  8. The p53 family and programmed cell death

    PubMed Central

    Pietsch, E. Christine; Sykes, Stephen M.; McMahon, Steven B.; Murphy, Maureen E.


    The p53 tumor suppressor continues to hold distinction as the most frequently mutated gene in human cancer. The ability of p53 to induce programmed cell death, or apoptosis, of cells exposed to environmental or oncogenic stress constitutes a major pathway whereby p53 exerts its tumor suppressor function. In the past decade we have discovered that p53 is not alone in its mission to destroy damaged or aberrantly proliferating cells: it has two homologues, p63 and p73, that in various cellular contexts and stresses contribute to this process. In this review, the mechanisms whereby p53, and in some cases p63 and p73, induce apoptosis are discussed. Whereas other reviews have focused more extensively on the contribution of individual p53-regulated genes to apoptosis induction by this protein, in this review we focus more on those factors that mediate the decision between growth arrest and apoptosis by p53, p63 and p73, and on the post-translational modifications and protein-protein interactions that influence this decision. PMID:18955976

  9. MDM2-p53 Pathway in Hepatocellular Carcinoma

    PubMed Central

    Meng, Xuan; Franklin, Derek A; Dong, Jiahong; Zhang, Yanping


    Abnormalities in the TP53 gene and overexpression of MDM2, a transcriptional target and negative regulator of p53, are commonly observed in cancers. The MDM2-p53 feedback loop plays an important role in tumor progression and thus, increased understanding of the pathway has the potential to improve clinical outcomes for cancer patients. Hepatocellular carcinoma (HCC) has emerged as one of the most commonly diagnosed forms of human cancer; yet, the current treatment for HCC is less effective than those used against other cancers. We review the current studies of the MDM2-p53 pathway in cancer with a focus on HCC, and specifically discuss the impact of p53 mutations along with other alterations of the MDM2-p53 feedback loop in HCC. We also discuss the potential diagnostic and prognostic applications of p53 and MDM2 in malignant tumors as well as therapeutic avenues that are being developed to target the MDM2-p53 pathway. PMID:25477334

  10. p53 and the pathogenesis of skin cancer

    SciTech Connect

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.


    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients.

  11. Long story short: p53 mediates innate immunity.


    Miciak, Jessica; Bunz, Fred


    The story of p53 and how we came to understand it is punctuated by fundamental insights into the essence of cancer. In the decades since its discovery, p53 has been shown to be centrally involved in most, if not all, of the cellular processes that maintain tissue homeostasis. Extensive functional analyses of p53 and its tumor-associated mutants have illuminated many of the common defects shared by most cancer cells. As the central character in a tale that continues to unfold, p53 has become increasingly familiar and yet remains surprisingly inscrutable. New relationships periodically come to light, and surprising, novel activities continue to emerge, thereby revealing new dimensions and aspects of its function. What lies at the very core of this complex protagonist? What is its prime motivation? As every avid reader knows, the elements of character are profoundly shaped by adversity--originating from within and without. And so it is with p53. This review will briefly recap the coordinated responses of p53 to viral infection, and outline a hypothetical model that would explain how an abundance of seemingly unrelated phenotypic attributes may in the end reflect a singular function. All stories eventually draw to a conclusion. This epic tale may eventually leave us with the realization that p53, most simply described, is a protein that evolved to mediate immune surveillance. PMID:26951863

  12. Caspase cleavage of iASPP potentiates its ability to inhibit p53 and NF-κB

    PubMed Central

    Hu, Ying; Ge, Wenjie; Wang, Xingwen; Sutendra, Gopinath; Zhao, Kunming; Dedeić, Zinaida; Slee, Elizabeth A.; Baer, Caroline; Lu, Xin


    An intriguing biological question relating to cell signaling is how the inflammatory mediator NF-kB and the tumour suppressor protein p53 can be induced by similar triggers, like DNA damage or infection, yet have seemingly opposing or sometimes cooperative biological functions. For example, the NF-κB subunit RelA/p65 has been shown to inhibit apoptosis, whereas p53 induces apoptosis. One potential explanation may be their co-regulation by common cellular factors: inhibitor of Apoptosis Stimulating p53 Protein (iASPP) is one such common regulator of both RelA/p65 and p53. Here we show that iASPP is a novel substrate of caspases in response to apoptotic stimuli. Caspase cleaves the N-terminal region of iASPP at SSLD294 resulting in a prominent 80kDa fragment of iASPP. This caspase cleavage site is conserved in various species from zebrafish to Homo sapiens. The 80kDa fragment of iASPP translocates from the cytoplasm to the nucleus via the RaDAR nuclear import pathway, independent of p53. The 80kDa iASPP fragment can bind and inhibit p53 or RelA/p65 more efficiently than full-length iASPP. Overall, these data reveal a potential novel regulation of p53 and RelA/p65 activities in response to apoptotic stimuli. PMID:26646590

  13. Proteasome machinery is instrumental in a common gain-of-function program of the p53 missense mutants in cancer.


    Walerych, Dawid; Lisek, Kamil; Sommaggio, Roberta; Piazza, Silvano; Ciani, Yari; Dalla, Emiliano; Rajkowska, Katarzyna; Gaweda-Walerych, Katarzyna; Ingallina, Eleonora; Tonelli, Claudia; Morelli, Marco J; Amato, Angela; Eterno, Vincenzo; Zambelli, Alberto; Rosato, Antonio; Amati, Bruno; Wiśniewski, Jacek R; Del Sal, Giannino


    In cancer, the tumour suppressor gene TP53 undergoes frequent missense mutations that endow mutant p53 proteins with oncogenic properties. Until now, a universal mutant p53 gain-of-function program has not been defined. By means of multi-omics: proteome, DNA interactome (chromatin immunoprecipitation followed by sequencing) and transcriptome (RNA sequencing/microarray) analyses, we identified the proteasome machinery as a common target of p53 missense mutants. The mutant p53-proteasome axis globally affects protein homeostasis, inhibiting multiple tumour-suppressive pathways, including the anti-oncogenic KSRP-microRNA pathway. In cancer cells, p53 missense mutants cooperate with Nrf2 (NFE2L2) to activate proteasome gene transcription, resulting in resistance to the proteasome inhibitor carfilzomib. Combining the mutant p53-inactivating agent APR-246 (PRIMA-1MET) with the proteasome inhibitor carfilzomib is effective in overcoming chemoresistance in triple-negative breast cancer cells, creating a therapeutic opportunity for treatment of solid tumours and metastasis with mutant p53. PMID:27347849

  14. Transcriptional Activation of p53 during Cold Induced Torpor in the 13-Lined Ground Squirrel Ictidomys tridecemlineatus

    PubMed Central

    Hefler, Joshua; Wu, Cheng-Wei; Storey, Kenneth B.


    The transcription factor p53 is located at the centre of multiple pathways relating the cellular response to stress. Commonly known as a tumor suppressor, it is responsible for initiating diverse actions to protect the integrity of the genome, ranging from cell cycle arrest to apoptosis. This study investigated the regulation of p53 protein in hibernating 13-lined ground squirrel Ictidomys tridecemlineatus during multiple stages of the torpor-arousal cycle. Transcript and protein levels of p53 were both elevated in the skeletal muscle during early and late torpor stages of the hibernation cycle. Nuclear localization of p53 was also increased during late torpor, and this is associated with an increase in its DNA binding activity and expression of p53 transcriptional targets p21CIP, gadd45α, and 14-3-3σ. The increase in p53 transcriptional activity appears to be independent of its phosphorylation at Ser-15, Ser-46, and Ser-392, consistent with an absence of checkpoint kinase activation during torpor. Sequence analysis revealed unique amino acid substitutions in the ground squirrel p53 protein, which may contribute to an increase in protein stability compared to nonhibernators. Overall, the study results provided evidences for a potential role of p53 in the protection of the skeletal muscle during torpor. PMID:26843984

  15. Transcriptional Activation of p53 during Cold Induced Torpor in the 13-Lined Ground Squirrel Ictidomys tridecemlineatus.


    Hefler, Joshua; Wu, Cheng-Wei; Storey, Kenneth B


    The transcription factor p53 is located at the centre of multiple pathways relating the cellular response to stress. Commonly known as a tumor suppressor, it is responsible for initiating diverse actions to protect the integrity of the genome, ranging from cell cycle arrest to apoptosis. This study investigated the regulation of p53 protein in hibernating 13-lined ground squirrel Ictidomys tridecemlineatus during multiple stages of the torpor-arousal cycle. Transcript and protein levels of p53 were both elevated in the skeletal muscle during early and late torpor stages of the hibernation cycle. Nuclear localization of p53 was also increased during late torpor, and this is associated with an increase in its DNA binding activity and expression of p53 transcriptional targets p21CIP, gadd45α, and 14-3-3σ. The increase in p53 transcriptional activity appears to be independent of its phosphorylation at Ser-15, Ser-46, and Ser-392, consistent with an absence of checkpoint kinase activation during torpor. Sequence analysis revealed unique amino acid substitutions in the ground squirrel p53 protein, which may contribute to an increase in protein stability compared to nonhibernators. Overall, the study results provided evidences for a potential role of p53 in the protection of the skeletal muscle during torpor. PMID:26843984

  16. Zinc deficiency induces apoptosis via mitochondrial p53- and caspase-dependent pathways in human neuronal precursor cells.


    Seth, Rohit; Corniola, Rikki S; Gower-Winter, Shannon D; Morgan, Thomas J; Bishop, Brian; Levenson, Cathy W


    Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent increases in the pro-apoptotic mitochondrial protein BAX leading to a loss of mitochondrial membrane potential as demonstrated by a 25% decrease in JC-1 red:green fluorescence ratio. Disruption of mitochondrial membrane integrity was accompanied by efflux of the apoptosis inducing factor (AIF) from the mitochondria and translocation to the nucleus with a significant increase in reactive oxygen species (ROS) after 24h of zinc deficiency. Measurement of caspase cleavage, mRNA, and treatment with caspase inhibitors revealed the involvement of caspases 2, 3, 6, and 7 in zinc deficiency-mediated apoptosis. Down-stream targets of caspase activation, including the nuclear structure protein lamin and polyADP ribose polymerase (PARP), which participates in DNA repair, were also cleaved. Transfection with a dominant-negative p53 construct and use of the p53 inhibitor, pifithrin-μ, established that these alterations were largely dependent on p53. Together these data identify a cascade of events involving mitochondrial p53 as well as p53-dependent caspase-mediated mechanisms leading to apoptosis during zinc deficiency. PMID:25467851

  17. The p53 status of cultured human premalignant oral keratinocytes.

    PubMed Central

    Burns, J. E.; Clark, L. J.; Yeudall, W. A.; Mitchell, R.; Mackenzie, K.; Chang, S. E.; Parkinson, E. K.


    Around 60% of oral squamous cell carcinomas (SCCs) have been shown to harbour p53 mutations, and other studies have demonstrated mutant p53 genes in normal and dysplastic squamous epithelium adjacent to these SCCs. In line with these earlier studies we show here that DOK, a keratinocyte cell line derived from a dysplasia, displays elevated levels of p53 protein and harbours a 12 bp in-frame deletion of the p53 gene spanning codons 188-191. In contrast, the coding region of the p53 gene was normal in a series of six benign recurrent laryngeal papillomas and a series of four premalignant oral erythroplakia biopsies and their cell cultures. All but one of these lesions were free of malignancy at the time of biopsy, in contrast to the premalignant lesions studied by previous investigators, but keratinocytes cultured from these lesions all displayed a partially transformed phenotype that was less pronounced than that of DOK. Since three out of four of the erythroplakia patients developed SCC within 1 year of biopsy, these lesions were by definition premalignant. The availability of strains of partially transformed keratinocytes from premalignant erythroplakias which possess normal p53 genes should enable us to test the role of mutant p53 in the progression of erythroplakia to SCC. The premalignant tissues and cultures were also tested for the presence of human papillomavirus (HPV), which is known to inactivate p53 function in some cases. Only the benign papillomas were shown to contain high levels of either HPV 6 or HPV 11 E6 DNA, but not both, and none of the samples contained detectable levels of HPV 16, HPV 18 or HPV 33 E6 DNA or L1 DNA of several other HPV types. There was therefore no evidence to suggest that p53 was being inactivated by a highly oncogenic HPV in these samples. Images Figure 1 Figure 2 Figure 3 PMID:7917902


    SciTech Connect



    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  19. Robustness of the p53 network and biological hackers.


    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G


    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses. PMID:15896791

  20. Oncogenomic Approaches in Exploring Gain of Function of Mutant p53

    PubMed Central

    Donzelli, Sara; Biagioni, Francesca; Fausti, Francesca; Strano, Sabrina; Fontemaggi, Giulia; Blandino, Giovanni


    Cancer is caused by the spatial and temporal accumulation of alterations in the genome of a given cell. This leads to the deregulation of key signalling pathways that play a pivotal role in the control of cell proliferation and cell fate. The p53 tumor suppressor gene is the most frequent target in genetic alterations in human cancers. The primary selective advantage of such mutations is the elimination of cellular wild type p53 activity. In addition, many evidences in vitro and in vivo have demonstrated that at least certain mutant forms of p53 may possess a gain of function, whereby they contribute positively to cancer progression. The fine mapping and deciphering of specific cancer phenotypes is taking advantage of molecular-profiling studies based on genome-wide approaches. Currently, high-throughput methods such as array-based comparative genomic hybridization (CGH array), single nucleotide polymorphism array (SNP array), expression arrays and ChIP-on-chip arrays are available to study mutant p53-associated alterations in human cancers. Here we will mainly focus on the integration of the results raised through oncogenomic platforms that aim to shed light on the molecular mechanisms underlying mutant p53 gain of function activities and to provide useful information on the molecular stratification of tumor patients. PMID:19440517

  1. KAP1 dictates p53 response induced by chemotherapeutic agents via Mdm2 interaction

    SciTech Connect

    Okamoto, Koji . E-mail:; Kitabayashi, Issay; Taya, Yoichi . E-mail:


    KAP1 recruits many proteins involved in gene silencing and functions as an integral part of co-repressor complex. KAP1 was identified as Mdm2-binding protein and shown to form a complex with Mdm2 and p53 in vivo. We examined the role of KAP1 in p53 activation after the treatment of cells with different types of external stresses. KAP1 reduction markedly enhanced the induction of p21, a product of the p53 target gene, after treatment with actinomycin D or {gamma}-irradiation, but not with camptothecin. Treatment with actinomycin D, but not with camptothecin, augmented the interaction of p53 with Mdm2 and KAP1. Further, KAP1 reduction in actinomycin D-treated cells facilitated cell cycle arrest and negatively affected clonal cell growth. Thus, the reduction of KAP1 levels promotes p53-dependent p21 induction and inhibits cell proliferation in actinomycin D-treated cells. KAP1 may serve as a therapeutic target against cancer in combination with actinomycin D.

  2. The emerging role of p53 in exercise metabolism.


    Bartlett, Jonathan D; Close, Graeme L; Drust, Barry; Morton, James P


    The major tumour suppressor protein, p53, is one of the most well-studied proteins in cell biology. Often referred to as the Guardian of the Genome, the list of known functions of p53 include regulatory roles in cell cycle arrest, apoptosis, angiogenesis, DNA repair and cell senescence. More recently, p53 has been implicated as a key molecular player regulating substrate metabolism and exercise-induced mitochondrial biogenesis in skeletal muscle. In this context, the study of p53 therefore has obvious implications for both human health and performance, given that impaired mitochondrial content and function is associated with the pathology of many metabolic disorders such as ageing, type 2 diabetes, obesity and cancer, as well as reduced exercise performance. Studies on p53 knockout (KO) mice collectively demonstrate that ablation of p53 content reduces intermyofibrillar (IMF) and subsarcolemmal (SS) mitochondrial yield, reduces cytochrome c oxidase (COX) activity and peroxisome proliferator-activated receptor gamma co-activator 1-α protein content whilst also reducing mitochondrial respiration and increasing reactive oxygen species production during state 3 respiration in IMF mitochondria. Additionally, p53 KO mice exhibit marked reductions in exercise capacity (in the magnitude of 50 %) during fatiguing swimming, treadmill running and electrical stimulation protocols. p53 may regulate contractile-induced increases in mitochondrial content via modulating mitochondrial transcription factor A (Tfam) content and/or activity, given that p53 KO mice display reduced skeletal muscle mitochondrial DNA, Tfam messenger RNA and protein levels. Furthermore, upon muscle contraction, p53 is phosphorylated on serine 15 and subsequently translocates to the mitochondria where it forms a complex with Tfam to modulate expression of mitochondrial-encoded subunits of the COX complex. In human skeletal muscle, the exercise-induced phosphorylation of p53(Ser15) is enhanced in conditions

  3. The transduction of His-TAT-p53 fusion protein into the human osteogenic sarcoma cell line (Saos-2) and its influence on cell cycle arrest and apoptosis.


    Jiang, Lei; Ma, Yushu; Wang, Jinzhi; Tao, Xinyi; Wei, Dongzhi


    The p53 gene is a tumor suppressor gene. It encodes a nuclear phosphoprotein p53 involved in the regulation of cell cycle arrest and apoptosis to maintain the genomic integrity of the cell. As mutations of p53 gene are found in most human cancers, p53 protein becomes a hot target in the research of anticancer therapy. In the present study, an 11-amino acid domain of TAT protein which has been demonstrated to be able to transduce across cell membranes was fused with p53. The result revealed that the fusion protein His-TAT-p53 accumulated in the nucleus and inhibited the growth of the Saos-2 cells. Besides apoptosis, an increased percentage of G2 phase suggested that the transduction of His-TAT-p53 into cells might be associated with a G2 arrest of cell cycle. PMID:17206471

  4. ERβ decreases the invasiveness of triple-negative breast cancer cells by regulating mutant p53 oncogenic function

    PubMed Central

    Bado, Igor; Nikolos, Fotis; Rajapaksa, Gayani; Gustafsson, Jan-Åke; Thomas, Christoforos


    Most (80%) of the triple-negative breast cancers (TNBCs) express mutant p53 proteins that acquire oncogenic activities including promoting metastasis. We previously showed that wild-type ERβ (ERβ1) impedes epithelial to mesenchymal transition (EMT) and decreases the invasiveness of TNBC cells. In the present study we searched for signaling pathways that ERβ1 uses to inhibit EMT and invasion in TNBC cells. We show that ERβ1 binds to and opposes the transcriptional activity of mutant p53 at the promoters of genes that regulate metastasis. p63 that transcriptionally cooperates with mutant p53 also binds to ERβ1. Downregulation of p63 represses the epithelial phenotype of ERβ1-expressing cells and alters the expression of mutant p53 target genes. These results describe a novel mechanism through which ERβ1 can disturb oncogenic signals to inhibit aggressiveness in TNBCs. PMID:26871946

  5. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika


    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  6. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis.


    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M; Kiricsi, Mónika


    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  7. Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

    SciTech Connect

    Okazaki, Ryuji; Ootsuyama, Akira; Kakihara, Hiroyo; Mabuchi, Yo; Matsuzaki, Yumi; Michikawa, Yuichi; Imai, Takashi; Norimura, Toshiyuki


    Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situ hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.

  8. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.


    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  9. Nitric oxide evoked p53-accumulation and apoptosis.


    Brüne, Bernhard; Schneiderhan, Nicole


    The tumor suppressor p53 accumulates under conditions of cellular stress and affects cell cycle progression and/or apoptosis. This has been exemplified for endogenously produced or exogenously supplied nitric oxide (NO) and thus accounts at least in part for cell destructive signaling qualities of this bioactive molecule and/or derived reactive nitrogen species. However, detailed mechanisms of toxicity and pathways of cell demise remain to be elucidated. Establishing that NO-treatment left the ubiquitination and the p53-Mdm2 interaction intact may point to an impaired nuclear-cytoplasmic shuttling to account for p53 stabilization. This was verified by heterokaryon analysis. We conclude that attenuated nuclear export contributes to stabilization and activation of p53 under the influence of NO. PMID:12628747

  10. Cerebellum Development and Tumorigenesis: A p53-Centric Perspective.


    Barthelery, Nicolas J; Manfredi, James J


    The p53 protein has been extensively studied for its role in suppressing tumorigenesis, in part through surveillance and maintenance of genomic stability. p53 has been associated with the induction of a variety of cellular outcomes including cell cycle arrest, senescence, and apoptosis. This occurs primarily, but not exclusively, through transcriptional activation of specific target genes. By contrast, the participation of p53 in normal developmental processes has been largely understudied. This review focuses on possible functions of p53 in cerebellar development. It can be argued that a better understanding of such mechanisms will provide needed insight into the genesis of certain embryonic cancers including medulloblastomas, and thus lead to more effective therapies. PMID:27085812

  11. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    SciTech Connect

    Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang


    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly

  12. TRIM24 Is a p53-Induced E3-Ubiquitin Ligase That Undergoes ATM-Mediated Phosphorylation and Autodegradation during DNA Damage

    PubMed Central

    Jain, Abhinav K.; Allton, Kendra; Duncan, Aundrietta D.


    Tumor suppressor p53 protects cells from genomic insults and is a target of mutation in more than 50% of human cancers. Stress-mediated modification and increased stability of p53 promote p53 interaction with chromatin, which results in transcription of target genes that are critical for the maintenance of genomic integrity. We recently discovered that TRIM24, an E3-ubiquitin ligase, ubiquitinates and promotes proteasome-mediated degradation of p53. Here, we show that TRIM24 is destabilized by ATM-mediated phosphorylation of TRIM24S768 in response to DNA damage, which disrupts TRIM24-p53 interactions and promotes the degradation of TRIM24. Transcription of TRIM24 is directly induced by damage-activated p53, which binds p53 response elements and activates expression of TRIM24. Newly synthesized TRIM24 interacts with phosphorylated p53 to target it for degradation and termination of the DNA damage response. These studies indicate that TRIM24, like MDM2, controls p53 levels in an autoregulatory feedback loop. However, unlike MDM2, TRIM24 also targets activated p53 to terminate p53-regulated response to DNA damage. PMID:24820418


    PubMed Central

    de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida


    Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia. PMID:19082401

  14. UHRF2, another E3 ubiquitin ligase for p53

    SciTech Connect

    Bai, Lu; Wang, Xiaohui; Jin, Fangmin; Yang, Yan; Qian, Guanhua; Duan, Changzhu


    Highlights: Black-Right-Pointing-Pointer UHRF2 associates with p53 in vivo and in vitro. Black-Right-Pointing-Pointer UHRF2 interacts with p53 through its SRA/YDG domain. Black-Right-Pointing-Pointer UHRF2 ubiquitinates p53 in vivo and in vitro. -- Abstract: UHRF2, ubiquitin-like with PHD and ring finger domains 2, is a nuclear E3 ubiquitin ligase, which is involved in cell cycle and epigenetic regulation. UHRF2 interacts with multiple cell cycle proteins, including cyclins (A2, B1, D1, and E1), CDK2, and pRb; moreover, UHRF2 could ubiquitinate cyclin D1 and cyclin E1. Also, UHRF2 has been shown to be implicated in epigenetic regulation by associating with DNMTs, G9a, HDAC1, H3K9me2/3 and hemi-methylated DNA. We found that UHRF2 associates with tumor suppressor protein p53, and p53 is ubiquitinated by UHRF2 in vivo and in vitro. Given that both UHRF2 and p53 are involved in cell cycle regulation, this study may suggest a novel signaling pathway on cell proliferation.

  15. Estradiol induces functional inactivation of p53 by intracellular redistribution.


    Molinari, A M; Bontempo, P; Schiavone, E M; Tortora, V; Verdicchio, M A; Napolitano, M; Nola, E; Moncharmont, B; Medici, N; Nigro, V; Armetta, I; Abbondanza, C; Puca, G A


    Estrogen treatment of MCF-7 cells grown in serum-free medium induced a modification of the intracellular distribution of p53 protein. Western blot analysis and immunofluorescence staining showed that p53 was localized in the nucleus of untreated cell and that after 48 h of hormone treatment, it was mostly localized in the cytoplasm. This effect was blocked by the antiestrogen ICI182,780. Intracellular redistribution of p53 was correlated to a reduced expression of the WAF1/CIP1 gene product and to the presence of degradation fragments of p53 in the cytosol. Estradiol treatment prevented the growth inhibition induced by oligonucleotide transfection, simulating DNA damage. This observation indicated that the wild-type p53 gene product present in the MCF-7 cell could be inactivated by estradiol through nuclear exclusion to permit the cyclin-dependent phosphorylation events leading to the G1-S transition. In addition, the estradiol-induced inactivation of p53 could be involved in the tumorigenesis of estrogen-dependent neoplasm. PMID:10825127

  16. Regulation of rheumatoid synoviocyte proliferation by endogenous p53 induction

    PubMed Central

    Migita, K; Tanaka, F; Yamasaki, S; Shibatomi, K; Ida, H; Kawakami, A; Aoyagi, T; Kawabe, Y; Eguchi, K


    The p53 tumour suppressor protein protects cells from tumorigenic alterations by inducing either cell growth arrest or apoptosis. In the present study, we investigated the role of endogenous p53 expressed in rheumatoid arthritis synovial fibroblasts which show transformed-appearing phenotypes. Type B synovial cells (fibroblast-like synovial cells) were exposed to a proteasome inhibitor, carbobenzoxyl-leucinyl-leucinyl-leucinal (MG-132). During this process, the expressions of p53 and p21 were examined by Western blot. Cell cycle analysis of the synovial cells was determined by DNA staining using propidium iodide (PI). Inhibition of proteasome resulted in the accumulation of p53 which was followed by an increase in the amount of a cyclin-dependent kinase (CDK)-inhibitor, p21. As a consequence, the retinoblastoma gene product, Rb, remained in the hypophosphorylated state, thus preventing PDGF-stimulated synovial cells from progressing into S-phase. This study shows that endogenous p53, which is inducible in rheumatoid synovial cells, is functionally active based on the findings that its expression blocks the G1/S transition by inhibiting the CDK-mediated phosphorylation of Rb via p21 induction. Thus the induction of p53 using proteasome inhibitor may provide a new approach in the treatment of RA. PMID:11703379

  17. Characterization of p53 expression in rainbow trout.


    Liu, Michelle; Tee, Catherine; Zeng, Fanxing; Sherry, James P; Dixon, Brian; Bols, Niels C; Duncker, Bernard P


    The tumour suppressor protein p53 is a critical component of cell cycle checkpoint responses. It upregulates the expression of cyclin-dependent kinase inhibitors in response to DNA damage and other cellular perturbations, and promotes apoptosis when DNA repair pathways are overwhelmed. Given the high incidence of p53 mutations in human cancers, it has been extensively studied, though only a small fraction of these investigations have been in non-mammalian systems. For the present study, an anti-rainbow trout p53 polyclonal antibody was generated. A variety of rainbow trout (Oncorhynchus mykiss) tissues and cell lines were examined through western blot analysis of cellular protein extracts, which revealed relatively high p53 levels in brain and gills. To evaluate the checkpoint response of rainbow trout p53, RTbrain-W1 and RTgill-W1 cell lines were exposed to varying concentrations of the DNA damaging agent bleomycin and ribonucleotide reductase inhibitor hydroxyurea. In contrast to mammals, these checkpoint-inducing agents provoked no apparent increase in rainbow trout p53 levels. These results infer the presence of alternate DNA damage checkpoint mechanisms in rainbow trout cells. PMID:21767662

  18. Xenogeneic human p53 DNA vaccination by electroporation breaks immune tolerance to control murine tumors expressing mouse p53.


    Soong, Ruey-Shyang; Trieu, Janson; Lee, Sung Yong; He, Liangmei; Tsai, Ya-Chea; Wu, T-C; Hung, Chien-Fu


    The pivotal role of p53 as a tumor suppressor protein is illustrated by the fact that this protein is found mutated in more than 50% of human cancers. In most cases, mutations in p53 greatly increase the otherwise short half-life of this protein in normal tissue and cause it to accumulate in the cytoplasm of tumors. The overexpression of mutated p53 in tumor cells makes p53 a potentially desirable target for the development of cancer immunotherapy. However, p53 protein represents an endogenous tumor-associated antigen (TAA). Immunization against a self-antigen is challenging because an antigen-specific immune response likely generates only low affinity antigen-specific CD8(+) T-cells. This represents a bottleneck of tumor immunotherapy when targeting endogenous TAAs expressed by tumors. The objective of the current study is to develop a safe cancer immunotherapy using a naked DNA vaccine. The vaccine employs a xenogeneic p53 gene to break immune tolerance resulting in a potent therapeutic antitumor effect against tumors expressing mutated p53. Our study assessed the therapeutic antitumor effect after immunization with DNA encoding human p53 (hp53) or mouse p53 (mp53). Mice immunized with xenogeneic full length hp53 DNA plasmid intramuscularly followed by electroporation were protected against challenge with murine colon cancer MC38 while those immunized with mp53 DNA were not. In a therapeutic model, established MC38 tumors were also well controlled by treatment with hp53 DNA therapy in tumor bearing mice compared to mp53 DNA. Mice vaccinated with hp53 DNA plasmid also exhibited an increase in mp53-specific CD8(+) T-cell precursors compared to vaccination with mp53 DNA. Antibody depletion experiments also demonstrated that CD8(+) T-cells play crucial roles in the antitumor effects. This study showed intramuscular vaccination with xenogeneic p53 DNA vaccine followed by electroporation is capable of inducing potent antitumor effects against tumors expressing mutated

  19. R248Q mutation--Beyond p53-DNA binding.


    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L


    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. PMID:26442703

  20. Gulf Cooperation Council: Arabia's model of integration

    SciTech Connect

    Etaibi, G.T.


    This study is an analysis of the foundations and emergence in 1981 of the Gulf Cooperation Council (GCC), which consists of six traditional Arab Gulf states (the United Arab Emirates, Bahrain, Saudi Arabia, Oman, Qatar, and Kuwait). It finds the GCC to be a unique case among twentieth-century integrative schemes. The study also identifies and analyzes relevant local, regional, and international forces. Among the local forces are traditional religio-political systems, economic dependence on a depletable resource, and the presence of a large number of foreign residents. On the regional level, this study takes into consideration such issues as the Arab League, Arab Nationalism, and the Islamic revolutionary movement in Iran. On the international level, the influence of the superpowers and the major industrialized nations on the emergence and future of the GCC Community are analyzed. Throughout the past decade there has been a growing scholarly interest in the Gulf region. In preparation for this study, the author relied heavily on the literature generated by this new research, as well as on documents and official publications, mostly in Arabic. A survey was conducted among a limited number of GCC graduate students during the summer of 1983. In addition, interviews with selected members of the GCC Secretariat-General and various member-state officials were conducted during a research trip in the region in the spring of 1984.

  1. Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response.


    Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C


    In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

  2. FAK and p53 Synergistically Decrease Neuroblastoma Cell Survival

    PubMed Central

    Gillory, Lauren A.; Stewart, Jerry E.; Megison, Michael L.; Waters, Alicia M.; Beierle, Elizabeth A.


    Neuroblastoma is the most common extracranial solid tumor of childhood and is responsible for over 15% of pediatric cancer deaths. Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase that is important in many facets of neuroblastoma tumor development and progression. The p53 oncogene, although wild type in most neuroblastomas, lacks significant function as a tumor suppressor in these tumors. Recent reports have found that FAK and p53 interact in some tumor types. We have hypothesized FAK and p53 coordinately control each other’s expression and also interact in neuroblastoma. In the current study, we showed that not only do FAK and p53 interact but each one controls the expression of the other. In addition, we also examined the effects of FAK inhibition combined with p53 activation in neuroblastoma and showed that these two, in combination, had a synergistic effect upon neuroblastoma cell survival. The findings from this current study help to further our understanding of the regulation of neuroblastoma tumorigenesis, and may provide novel therapeutic strategies and targets for neuroblastoma and other pediatric solid tumors. PMID:25862488

  3. The evolution of thymic lymphomas in p53 knockout mice.


    Dudgeon, Crissy; Chan, Chang; Kang, Wenfeng; Sun, Yvonne; Emerson, Ryan; Robins, Harlan; Levine, Arnold J


    Germline deletion of the p53 gene in mice gives rise to spontaneous thymic (T-cell) lymphomas. In this study, the p53 knockout mouse was employed as a model to study the mutational evolution of tumorigenesis. The clonality of the T-cell repertoire from p53 knockout and wild-type thymic cells was analyzed at various ages employing TCRβ sequencing. These data demonstrate that p53 knockout thymic lymphomas arose in an oligoclonal fashion, with tumors evolving dominant clones over time. Exon sequencing of tumor DNA revealed that all of the independently derived oligoclonal mouse tumors had a deletion in the Pten gene prior to the formation of the TCRβ rearrangement, produced early in development. This was followed in each independent clone of the thymic lymphoma by the amplification or overexpression of cyclin Ds and Cdk6. Alterations in the expression of Ikaros were common and blocked further development of CD-4/CD-8 T cells. While the frequency of point mutations in the genome of these lymphomas was one per megabase, there were a tremendous number of copy number variations producing the tumors' driver mutations. The initial inherited loss of p53 functions appeared to delineate an order of genetic alterations selected for during the evolution of these thymic lymphomas. PMID:25452272

  4. p53 Prevents Entry into Mitosis with Uncapped Telomeres

    PubMed Central

    Thanasoula, Maria; Escandell, Jose Miguel; Martinez, Paula; Badie, Sophie; Muñoz, Purificacion; Blasco, María A.; Tarsounas, Madalena


    Summary Telomeres are protected by capping structures consisting of core protein complexes that bind with sequence specificity to telomeric DNA (reviewed in [1]). In their absence, telomeres trigger a DNA damage response, materialized in accumulation at the telomere of damage response proteins, e.g., phosphorylated histone H2AX (γH2AX), into telomere-dysfunction-induced foci [2, 3]. Telomere uncapping occurs transiently in every cell cycle in G2 [4], following DNA replication, but little is known about how protective structures are reassembled or whether this process is controlled by the cell-cycle surveillance machinery. Here, we report that telomere capping is monitored at the G2/M transition by the p53/p21 damage response pathway. Unlike their wild-type counterparts, human and mouse cells lacking p53 or p21 progress into mitosis prematurely with persisting uncapped telomeres. Furthermore, artificially uncapped telomeres delay mitotic entry in a p53- and p21-dependent manner. Uncapped telomeres that persist in mitotic p53-deficient cells are shorter than average and religate to generate end-to-end fusions. These results suggest that a p53-dependent pathway monitors telomere capping after DNA replication and delays G2/M progression in the presence of unprotected telomeres. This mechanism maintains a cell-cycle stage conducive for capping reactions and prevents progression into stages during which uncapped telomeres are prone to deleterious end fusions. PMID:20226664

  5. The expanding regulatory universe of p53 in gastrointestinal cancer

    PubMed Central

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang


    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  6. The impact of p53 loss on murine plasmacytoma development.


    Mai, Sabine; Wiener, Francis


    Mouse plasmacytomas (PCTs) are characterized by c-myc-activating translocations that juxtapose c-myc on chromosome 15 onto one of the immunoglobulin loci (IgH on chromosome 12, IgK on chromosome 6, or IgA on chromosome 16). To assess the impact of p53 loss on PCT genesis, we induced PCTs in p53-deficient BALB/cRb6.15 mouse strains. We show that p53 loss accelerates tumor development and causes a shift in the typical translocation patterns. PCTs that carry variant T(6;15) translocations become as frequent as those with typical T(12;15) translocations (41.66%). In addition, in the absence of p53, the number of translocation-negative PCTs increases from less than 1% to 16.66%. It is noteworthy that neither the shortened latency periods nor the shift in translocation patterns had an impact on the incidence of PCT development. The 42.2% incidence in N3p53-/- mice is similar to the percentages recorded in groups of conventional BALB/cAn mice. The possible mechanisms underlying the accelerated tumorigenesis and the shift in translocation patterns are discussed. PMID:12067213

  7. Chk'ing p53-deficient breast cancers.


    Schoppy, David W; Brown, Eric J


    Loss or functional impairment of p53 occurs in many human cancers, and its absence is often associated with a poor response to conventional chemotherapy. Hence, much effort is currently devoted to developing novel treatments for p53-deficient malignancies. One approach is to target pathways that are selectively required for the survival of p53-deficient cancer cells, thus exploiting a synthetic lethal interaction. Previous studies have demonstrated that inhibition of the ataxia telangiectasia and Rad3-related (ATR) and checkpoint kinase 1 (Chk1) pathway in p53-deficient cells can induce such a synthetic lethal outcome. In this issue of the JCI, Ma et al. take these findings a step closer to the clinic by demonstrating that highly specific inhibitors of Chk1 synergize with chemotherapy to stem progression of p53-deficient triple-negative breast cancers in a xenotransplant model of this disease. Together with other recent studies, this report highlights the promise of ATR and Chk1 inhibitors in targeted cancer treatment. PMID:22446183

  8. Sequence-dependent sliding kinetics of p53

    NASA Astrophysics Data System (ADS)

    Leith, Jason; Tafvizi, Anahita; Huang, Fang; Uspal, William; Doyle, Patrick; Fersht, Alan; Mirny, Leonid; van Oijen, Antoine


    Theoretical work has long proposed that one-dimensional sliding along DNA while simultaneously reading its sequence can accelerate transcription factors' (TFs) search for their target sites. More recently, functional sliding has been shown to require TFs to possess at least two DNA-binding modes. The tumor suppressor p53 has been directly observed to slide on DNA, and structural and single-molecule studies have provided evidence for a two-mode model for the protein. If the model is in fact applicable to p53, then the requirement that TFs read while they slide implies that p53's mobility on DNA should be affected by non-cognate sites and thus that its diffusivity should be generally sequence-dependent. Here we confirm this prediction with single-molecule microscopy measurements of p53's local diffusivity on non-cognate DNA. We show how a two-mode model accurately predicts the variation in local diffusivity while a single-mode model does not. Our work provides evidence that p53's sliding is indeed functional and suggests that the timing and efficiency of its activating and repressing transcription can depend on its non-cognate binding properties and its ability to change between multiple modes of binding, in addition to the much better-studied effects of cognate-site binding.

  9. E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair

    PubMed Central

    Vélez-Cruz, Renier; Johnson, David G.


    Many of the biochemical details of nucleotide excision repair (NER) have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER. PMID:23202967

  10. p53 and ARF: Unexpected players in autophagy

    PubMed Central

    Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.


    p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino acids and subsequent survival. The mechanisms whereby p53 and ARF control autophagy are only now becoming elucidated. An emerging question is whether we can develop metabolic poisons that preferentially destroy tumor cells depending on their reliance on autophagy for survival, and on their p53 and ARF status. PMID:20303758

  11. Enhanced radiosensitization of p53 mutant cells by oleamide

    SciTech Connect

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil . E-mail:


    Purpose: Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. Methods and Materials: NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Results: Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Conclusions: Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  12. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress.


    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L J


    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  13. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    PubMed Central

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.


    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  14. Stress-dependent Daxx-CHIP interaction suppresses the p53 apoptotic program.


    McDonough, Holly; Charles, Peter C; Hilliard, Eleanor G; Qian, Shu-Bing; Min, Jin-Na; Portbury, Andrea; Cyr, Douglas M; Patterson, Cam


    Our previous studies have implicated CHIP (carboxyl terminus of Hsp70-interacting protein) as a co-chaperone/ubiquitin ligase whose activities yield protection against stress-induced apoptotic events. In this report, we demonstrate a stress-dependent interaction between CHIP and Daxx (death domain-associated protein). This interaction interferes with the stress-dependent association of HIPK2 with Daxx, blocking phosphorylation of serine 46 in p53 and inhibiting the p53-dependent apoptotic program. Microarray analysis confirmed suppression of the p53-dependent transcriptional portrait in CHIP(+/+) but not in CHIP(-/-) heat shocked mouse embryonic fibroblasts. The interaction between CHIP and Daxx results in ubiquitination of Daxx, which is then partitioned to an insoluble compartment of the cell. In vitro ubiquitination of Daxx by CHIP revealed that ubiquitin chain formation utilizes non-canonical lysine linkages associated with resistance to proteasomal degradation. The ubiquitination of Daxx by CHIP utilizes lysines 630 and 631 and competes with the sumoylation machinery of the cell at these residues. These studies implicate CHIP as a stress-dependent regulator of Daxx that counters the pro-apoptotic influence of Daxx in the cell. By abrogating p53-dependent apoptotic pathways and by ubiquitination competitive with Daxx sumoylation, CHIP integrates the proteotoxic stress response of the cell with cell cycle pathways that influence cell survival. PMID:19465479

  15. HZE particle radiation induces tissue-specific and p53-dependent mutagenesis in transgenic animals

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R.


    Transgenic animals, with the integrated target gene, provide a unique approach for measuring and characterizing mutations in any tissue of the animal. We are using the plasmid-based lacZ transgenic mice with different p53 genetic background to examine radiation-induced genetic damage resulting from exposure to heavy particle radiation. We measured lacZ mutation frequencies (MF) in the brain and spleen tissues at various times after exposing animals to an acute dose of 1 Gy of 1GeV/amu iron particles. MF in the spleen of p53+/+ animals increased up to 2.6-fold above spontaneous levels at 8 weeks post irradiation. In contrast, brain MF from the same animals increased 1.7-fold above controls in the same period. In the p53-/- animals, brain MF increased to 2.2-fold above spontaneous levels at 1 week after treatment, but returned to control levels thereafter. Radiation also induced alterations in the spectrum of mutants in both tissues, accompanied by changes in the frequency of mutants with deletions extending past the transgene into mouse genomic DNA. Our results indicate that the accumulation of transgene MF after radiation exposure is dependant on the tissue examined as well as the p53 genetic background of the animals.

  16. HZE particle radiation induces tissue-specific and p53-dependent mutagenesis in transgenic animals.


    Chang, P Y; Kanazawa, N; Lutze-Mann, L; Winegar, R


    Transgenic animals, with the integrated target gene, provide a unique approach for measuring and characterizing mutations in any tissue of the animal. We are using the plasmid-based lacZ transgenic mice with different p53 genetic background to examine radiation-induced genetic damage resulting from exposure to heavy particle radiation. We measured lacZ mutation frequencies (MF) in the brain and spleen tissues at various times after exposing animals to an acute dose of 1 Gy of 1GeV/amu iron particles. MF in the spleen of p53+/+ animals increased up to 2.6-fold above spontaneous levels at 8 weeks post irradiation. In contrast, brain MF from the same animals increased 1.7-fold above controls in the same period. In the p53-/- animals, brain MF increased to 2.2-fold above spontaneous levels at 1 week after treatment, but returned to control levels thereafter. Radiation also induced alterations in the spectrum of mutants in both tissues, accompanied by changes in the frequency of mutants with deletions extending past the transgene into mouse genomic DNA. Our results indicate that the accumulation of transgene MF after radiation exposure is dependant on the tissue examined as well as the p53 genetic background of the animals. PMID:11776257

  17. Oroxylin A modulates mitochondrial function and apoptosis in human colon cancer cells by inducing mitochondrial translocation of wild-type p53

    PubMed Central

    Zhou, Yuxin; Ni, Ting; Dai, Yuanyuan; Li, Zhiyu; Guo, Qinglong; Wei, Libin


    Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible for the mitochondrial apoptotic pathway triggered by oroxylin A. p53 regulates mitochondrial survival, mitochondrial DNA integrity, and protection from oxidative stress. We determined that oroxylin A induces p53 mitochondrial translocation and inhibits SOD2 activity. Additionally, our studies demonstrate that oroxylin A promotes the formation and mitochondrial translocation of the p53-Recql4 complex in HCT-116 cells. Finally, we showed that oroxylin A triggers cytosolic p53 activation, thereby promoting apoptosis. Mitochondrial translocation of p53 was also validated in vivo. Thus, oroxylin A induces mitochondrial translocation of p53 and leads to mitochondrial dysfunction in human colon cancer cells. PMID:26958937

  18. Oroxylin A modulates mitochondrial function and apoptosis in human colon cancer cells by inducing mitochondrial translocation of wild-type p53.


    Qiao, Chen; Lu, Na; Zhou, Yuxin; Ni, Ting; Dai, Yuanyuan; Li, Zhiyu; Guo, Qinglong; Wei, Libin


    Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible for the mitochondrial apoptotic pathway triggered by oroxylin A. p53 regulates mitochondrial survival, mitochondrial DNA integrity, and protection from oxidative stress. We determined that oroxylin A induces p53 mitochondrial translocation and inhibits SOD2 activity. Additionally, our studies demonstrate that oroxylin A promotes the formation and mitochondrial translocation of the p53-Recql4 complex in HCT-116 cells. Finally, we showed that oroxylin A triggers cytosolic p53 activation, thereby promoting apoptosis. Mitochondrial translocation of p53 was also validated in vivo. Thus, oroxylin A induces mitochondrial translocation of p53 and leads to mitochondrial dysfunction in human colon cancer cells. PMID:26958937

  19. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    SciTech Connect

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut


    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  20. NRF2 and p53: Januses in cancer?

    PubMed Central

    Rotblat, Barak; Melino, Gerry; Knight, Richard A.


    The transcription factor nuclear factor (erythroid-derived 2)-like 2, also known as NFE2L2 or NRF2, is a master regulator of the anti-oxidative stress response and positively controls the expression of a battery of anti-oxidative stress response proteins and enzymes implicated in detoxification and glutathione generation. Although its detoxifying activity is important in cancer prevention, it has recently been shown that cancer cells also exploit its protective functions to thrive and resist chemotherapy. NRF2 was also shown to the pentose phosphate pathway and glutaminolysis, which promotes purine synthesis for supporting rapid proliferation and glutathione for providing anti-oxidative stress protection. Evidence obtained from cancer patients and cell lines suggest that NRF2 is highly active in a variety of human cancers and is associated with aggressiveness. p53 is a tumor suppressor that also promotes an anti-oxidative stress metabolic program and glutaminolysis. Here we will discuss the similarities between NRF2 and p53 and review evidence that p53 might be exploited by cancer cells to gain protection against oxidative stress, as is the case for NRF2. We discuss findings of co-regulation between these transcription factors and propose possible therapeutic strategies that can be used for treatment of cancers that harbor WT p53 and express high levels of NRF2. PMID:23174755

  1. p53 at the crossroads between cancer and neurodegeneration.


    Lanni, Cristina; Racchi, Marco; Memo, Maurizio; Govoni, Stefano; Uberti, Daniela


    Aging, dementia, and cancer share a critical set of altered cellular functions in response to DNA damage, genotoxic stress, and other insults. Recent data suggest that the molecular machinery involved in maintaining neural function in neurodegenerative disease may be shared with oncogenic pathways. Cancer and neurodegenerative diseases may be influenced by common signaling pathways regulating the balance of cell survival versus death, a decision often governed by checkpoint proteins. This paper focuses on one such protein, p53, which represents one of the most extensively studied proteins because of its role in cancer prevention and which, furthermore, has been recently shown to be involved in aging and Alzheimer disease (AD). The contribution of a conformational change in p53 to aging and neurodegenerative processes has yet to be elucidated. In this review we discuss the multiple functions of p53 and how these correlate between cancer and neurodegeneration, focusing on various factors that may have a role in regulating p53 activity. The observation that aging and AD interfere with proteins controlling duplication and cell cycle may lead to the speculation that, in senescent neurons, aberrations in proteins generally dealing with cell cycle control and apoptosis could affect neuronal plasticity and functioning rather than cell duplication. PMID:22387179

  2. P53 expression in invasive pancreatic adenocarcinoma and precursor lesions.


    Norfadzilah, M Y; Pailoor, Jayalakshmi; Retneswari, M; Chinna, K; Noor, Laili M M


    Patients with pancreatic adenocarcinoma are known to have a high mortality rate. The 5-year survival rate still remains low even now compared to that of the 1960's despite new advances in management including surgery, chemotherapy, pathological classification and molecular diagnostic technologies. Precursors to invasive pancreatic adenocarcinoma have been identified in the last ten years that include mucinous cystic neoplasm, intraductal papillary mucinous neoplasm and pancreatic intraepithelial neoplasia. p53 protein accumulation in the nuclei is a common molecular event in most human neoplasms. Our objective is to investigate p53 expression in pancreatic adenocarcinoma and precursor lesions and their significance. The selected study material encompassed 31 invasive ductal adenocarcinoma, 15 mucinous cystic neoplasm and papillary mucinous neoplasm, and 27 cases of pancreatic intraepithelial neoplasia including grade 1, 2 and 3. Immunoscore was given for each case based on intensity of staining and percentage of cells positive and compared between precursor lesions and invasive adenocarcinoma. A score of 50 and above was considered significant. The results showed that p53 expression increased progressively and significantly with the grade of pancreatic intraepithelial neoplasia and adenocarcinoma (p-value < 0.001). These findings support the concept of multistep carcinogenesis in pancreatic adenocarcinoma and suggest that p53 inactivation occurs in the progression of precursors to pancreatic adenocarcinoma. PMID:22299208

  3. Immunohistochemical detection of P53 and Mdm2 in vitiligo

    PubMed Central

    Bakry, Ola A.; Hammam, Mostafa A.; Wahed, Moshira M. Abdel


    Background: Vitiligo is a common depigmented skin disorder that is caused by selective destruction of melanocytes. It is generally accepted that the main function of melanin resides in the protection of skin cells against the deleterious effect of ultraviolet rays (UVRs). Association of vitiligo and skin cancer has been a subject of controversy. Occurrence of skin cancer in long-lasting vitiligo is rare despite multiple evidences of DNA damage in vitiliginous skin. Aim: To detect the expression of P53 and Mdm2 proteins in both depigmented and normally pigmented skin of vitiligo patients and to compare it to control subjects suffering from nonmelanoma skin cancer (NMSC). Materials and Methods: Thirty-four patients with vitiligo and 30 age and sex-matched patients with nodulo-ulcerative basal cell carcinoma (BCC) as a control group were selected. Both patients and control subjects had outdoor occupations. Skin biopsies were taken from each case and control subjects. Histopathological examination of Hematoxylin and eosin-stained sections was done. Expression of P53 and Mdm2 proteins were examined immunohistochemically. Results: Both P53 and Mdm2 were strongly expressed in depigmented as well as normally pigmented skin of vitiligo patients. This expression involved the epidermis, skin adnexa and blood vessels with significant differences between cases and controls. Conclusions: The overexpression of P53 and Mdm2 proteins in both normally pigmented and depigmented skin of patients with vitiligo could contribute to the decreased occurrence of actinic damage and NMSC in these patients. PMID:23189248

  4. A role for p53 in selenium-induced senescence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The tumor suppressor p53 and the ataxia-telangiectasia mutated (ATM) kinase play important roles in the senescence response to oncogene activation and DNA damage. We have previously shown that selenium-containing compounds can activate an ATM-dependent senescence response in MRC-5 normal fibroblasts...

  5. Misfolding, Aggregation, and Disordered Segments in c-Abl and p53 in Human Cancer

    PubMed Central

    de Oliveira, Guilherme A. P.; Rangel, Luciana P.; Costa, Danielly C.; Silva, Jerson L.


    The current understanding of the molecular mechanisms that lead to cancer is not sufficient to explain the loss or gain of function in proteins related to tumorigenic processes. Among them, more than 100 oncogenes, 20–30 tumor-suppressor genes, and hundreds of genes participating in DNA repair and replication have been found to play a role in the origins of cancer over the last 25 years. The phosphorylation of serine, threonine, or tyrosine residues is a critical step in cellular growth and development and is achieved through the tight regulation of protein kinases. Phosphorylation plays a major role in eukaryotic signaling as kinase domains are found in 2% of our genes. The deregulation of kinase control mechanisms has disastrous consequences, often leading to gains of function, cell transformation, and cancer. The c-Abl kinase protein is one of the most studied targets in the fight against cancer and is a hotspot for drug development because it participates in several solid tumors and is the hallmark of chronic myelogenous leukemia. Tumor suppressors have the opposite effects. Their fundamental role in the maintenance of genomic integrity has awarded them a role as the guardians of DNA. Among the tumor suppressors, p53 is the most studied. The p53 protein has been shown to be a transcription factor that recognizes and binds to specific DNA response elements and activates gene transcription. Stress triggered by ionizing radiation or other mutagenic events leads to p53 phosphorylation and cell-cycle arrest, senescence, or programed cell death. The p53 gene is the most frequently mutated gene in cancer. Mutations in the DNA-binding domain are classified as class I or class II depending on whether substitutions occur in the DNA contact sites or in the protein core, respectively. Tumor-associated p53 mutations often lead to the loss of protein function, but recent investigations have also indicated gain-of-function mutations. The prion-like aggregation of mutant p

  6. p53 mutations and overexpression in locally advanced breast cancers.

    PubMed Central

    Faille, A.; De Cremoux, P.; Extra, J. M.; Linares, G.; Espie, M.; Bourstyn, E.; De Rocquancourt, A.; Giacchetti, S.; Marty, M.; Calvo, F.


    Alterations in the p53 gene were analysed in 39 patients with locally advanced breast cancers (LABCs) (stage III-IV) with inflammatory signs in most cases (UICC stage T4d = 32 patients) by molecular and immunohistochemical (IHC) approaches. All patients were included in the same therapy protocol. Using polymerase chain reaction (PCR) and a single-strand conformational polymorphism migration technique (SSCP), the presence of mutations in exons 2-11, covering the entire coding sequence of the p53 gene, was evaluated. Using the mouse specific anti-human p53 monoclonal antibody (PAb 1801), we also looked for overexpression of the p53 protein in tissue sections. In 16 cases shifted bands were reproducibly identified by PCR-SSCP, and all but one (localised to exon 10) were in exons 5-8, the usual mutational hotspots. Fifteen of these 16 samples were sequenced and 14 of the suspected mutations (36%) were confirmed. Most of them (12) were single nucleotide substitutions, and transitions were more frequent (eight cases) than transversions (four cases). Fourteen of the tumour samples were positively stained with the monoclonal antibody PAb 1801, 11 with nuclear staining only, two with mixed cytoplasmic and nuclear staining and one with cytoplasmic staining only. Staining patterns were very heterogeneous in terms of the percentage of positive cells (10-75%) and their distribution in the tissue section (isolated foci or dispersed cells). In 11 of the 14 mutated cases a positive immunostaining was observed. The presence of a p53 mutation was significantly associated with larger tumour diameter (chi 2 = 7.490, P = 0.0062) and the presence of clinical metastases (stage IV) (chi 2 = 10.113, P = 0.0015). A non-statistically significant trend of association was observed between p53 mutation, negative oestrogen receptors and lower response rate to therapy. Our results in this group of patients and the heterogeneity of the staining of tumour cells in tissue sections suggest that p53

  7. Overexpression of RAR{beta}4 and p53 in murine lung cancer

    SciTech Connect

    Landers, M.; Bradley, W.E.C.


    Lung cancer is the leading cause of cancer death in western societies. There are four major histological types: small cell, epidemoid carcinoma, adenocarcinoma and large cell carcinoma, the adenocarcinoma being the only type generally found in the mouse. Earlier studies have shown that the transgenes coding for isoform 4 of the retinoic acid receptor {beta} and a mutant form of the tumor suppressor p53 are involved in the development of lung cancer. These results led us to ask whether the two genes may contribute to lung carcinogenesis in a synergistic manner. Mice overexpressing a RAR{beta}4-like isoform transgene (which causes very marked hyperplasia of alveolar type II cells) and mutated p53 transgene were crossed and progeny were analyzed after treatment with the lung carcinogen urethane. The results to date suggest that in the double transgenic mice, lung tumor kinetics do not result from cooperation between those transgenes since the effect of the transgenes was additive rather than synergistic. We conclude that RAR{beta}4 and p53 are involved in different tumorigenic pathways.

  8. p53 suppresses type II endometrial carcinomas in mice and governs endometrial tumour aggressiveness in humans

    PubMed Central

    Wild, Peter J; Ikenberg, Kristian; Fuchs, Thomas J; Rechsteiner, Markus; Georgiev, Strahil; Fankhauser, Niklaus; Noske, Aurelia; Roessle, Matthias; Caduff, Rosmarie; Dellas, Athanassios; Fink, Daniel; Moch, Holger; Krek, Wilhelm; Frew, Ian J


    Type II endometrial carcinomas are a highly aggressive group of tumour subtypes that are frequently associated with inactivation of the TP53 tumour suppressor gene. We show that mice with endometrium-specific deletion of Trp53 initially exhibited histological changes that are identical to known precursor lesions of type II endometrial carcinomas in humans and later developed carcinomas representing all type II subtypes. The mTORC1 signalling pathway was frequently activated in these precursor lesions and tumours, suggesting a genetic cooperation between this pathway and Trp53 deficiency in tumour initiation. Consistent with this idea, analyses of 521 human endometrial carcinomas identified frequent mTORC1 pathway activation in type I as well as type II endometrial carcinoma subtypes. mTORC1 pathway activation and p53 expression or mutation status each independently predicted poor patient survival. We suggest that molecular alterations in p53 and the mTORC1 pathway play different roles in the initiation of the different endometrial cancer subtypes, but that combined p53 inactivation and mTORC1 pathway activation are unifying pathogenic features among histologically diverse subtypes of late stage aggressive endometrial tumours. PMID:22678923

  9. Depression of p53-independent Akt survival signals after high-LET radiation in mutated p53 cells

    NASA Astrophysics Data System (ADS)

    Ohnishi, Takeo; Takahashi, Akihisa; Nakagawa, Yosuke

    Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses the activities of serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signals were analyzed with Western blotting analysis 1 h, 2 h, 3 h and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis.Akt-related protein levels were decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G _{2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and depresses cell growth by suppressing Akt-related signals, even in the mp53 cells.

  10. Mdm2 inhibition confers protection of p53-proficient cells from the cytotoxic effects of Wee1 inhibitors

    PubMed Central

    Dobbelstein, Matthias


    Pharmacological inhibition of the cell cycle regulatory kinase Wee1 represents a promising strategy to eliminate cancer cells. Wee1 inhibitors cooperate with chemotherapeutics, e. g. nucleoside analogues, pushing malignant cells from S phase towards premature mitosis and death. However, considerable toxicities are observed in preclinical and clinical trials. A high proportion of tumor cells can be distinguished from all other cells of a patient's body by inactivating mutations in the tumor suppressor p53. Here we set out to develop an approach for the selective protection of p53-proficient cells against the cytotoxic effects of Wee1 inhibitors. We pretreated such cells with Nutlin-3a, a prototype inhibitor of the p53-antagonist Mdm2. The resulting transient cell cycle arrest effectively increased the survival of cells that were subsequently treated with combinations of the Wee1 inhibitor MK-1775 and/or the nucleoside analogue gemcitabine. In this constellation, Nutlin-3a reduced caspase activation and diminished the phosphorylation of Histone 2AX, an indicator of the DNA damage response. Both effects were strictly dependent on the presence of p53. Moreover, Nutlin pre-treatment reduced the fraction of cells that were undergoing premature mitosis in response to Wee1 inhibition. We conclude that the pre-activation of p53 through Mdm2 antagonists serves as a viable option to selectively protect p53-proficient cells against the cytotoxic effects of Wee1 inhibitors, especially when combined with a nucleoside analogue. Thus, Mdm2 antagonists might prove useful to avoid unwanted side effects of Wee1 inhibitors. On the other hand, when a tumor contains wild type p53, care should be taken not to induce its activity before applying Wee1 inhibitors. PMID:26431163

  11. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype

    PubMed Central

    Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko


    Background A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. Methods The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. Results p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. Conclusion In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways. PMID:26447864

  12. Cooperative Learning: Integrating Theory and Practice

    ERIC Educational Resources Information Center

    Gillies, Robyn M.


    Although cooperative learning is widely endorsed as a pedagogical practice that promotes learning and socialization among students, teachers still struggle with how to introduce it into their classrooms. This text highlights the strategies teachers can use to challenge student thinking and scaffold their learning as well as the strategies students…

  13. Cooperation, Integration, and Caring in Public Education.

    ERIC Educational Resources Information Center

    Cogar, Paul N.; Raebeck, Barry S.


    For our students to become truly free, we must share with them our perceptions concerning freedom. Educators must stop "motivating" and begin inspiring students to use education as a means toward self-realization. Teachers and administrators should stop isolating themselves and experience the benefits of cooperation and collegiality. Includes two…

  14. Stabilization of p53 in Influenza A Virus-infected Cells Is Associated with Compromised MDM2-mediated Ubiquitination of p53*

    PubMed Central

    Wang, Xiaodu; Deng, Xufang; Yan, Wenjun; Zhu, Zixiang; Shen, Yang; Qiu, Yafeng; Shi, Zixue; Shao, Donghua; Wei, Jianchao; Xia, Xianzhu; Ma, Zhiyong


    Influenza A virus (IAV) induces apoptosis of infected cells. In response to IAV infection, p53, a tumor suppressor involved in regulating apoptosis and host antiviral defense, accumulates and becomes activated. This study was undertaken to examine the mechanism of p53 accumulation in IAV-infected cells. Here we show that p53 accumulation in IAV-infected cells results from protein stabilization, which was associated with compromised Mdm2-mediated ubiquitination of p53. In IAV-infected cells, p53 was stabilized and its half-life was remarkably extended. The ladders of polyubiquitinated p53 were not detectable in the presence of the proteasome inhibitor MG132 and were less sensitive to proteasome-mediated degradation. IAV infection did not affect the abundance of Mdm2, a major ubiquitin E3 ligase responsible for regulating p53 ubiquitination and degradation, but weakened the interaction between p53 and Mdm2. Viral nucleoprotein (NP) was able to increase the transcriptional activity and stability of p53. Furthermore, NP was found to associate with p53 and to impair the p53-Mdm2 interaction and Mdm2-mediated p53 ubiquitination, demonstrating its role in inhibiting Mdm2-mediated p53 ubiquitination and degradation. PMID:22474335

  15. Deregulation of Internal Ribosome Entry Site-Mediated p53 Translation in Cancer Cells with Defective p53 Response to DNA Damage

    PubMed Central

    Halaby, Marie-Jo; Harris, Benjamin R. E.; Miskimins, W. Keith; Cleary, Margot P.


    Synthesis of the p53 tumor suppressor and its subsequent activation following DNA damage are critical for its protection against tumorigenesis. We previously discovered an internal ribosome entry site (IRES) at the 5′ untranslated region of the p53 mRNA. However, the connection between IRES-mediated p53 translation and p53's tumor suppressive function is unknown. In this study, we identified two p53 IRES trans-acting factors, translational control protein 80 (TCP80), and RNA helicase A (RHA), which positively regulate p53 IRES activity. Overexpression of TCP80 and RHA also leads to increased expression and synthesis of p53. Furthermore, we discovered two breast cancer cell lines that retain wild-type p53 but exhibit defective p53 induction and synthesis following DNA damage. The levels of TCP80 and RHA are extremely low in both cell lines, and expression of both proteins is required to significantly increase the p53 IRES activity in these cells. Moreover, we found cancer cells transfected with a shRNA against TCP80 not only exhibit decreased expression of TCP80 and RHA but also display defective p53 induction and diminished ability to induce senescence following DNA damage. Therefore, our findings reveal a novel mechanism of p53 inactivation that links deregulation of IRES-mediated p53 translation with tumorigenesis. PMID:26391949

  16. Reactivating p53 functions by suppressing its novel inhibitor iASPP: a potential therapeutic opportunity in p53 wild-type tumors

    PubMed Central

    Dong, Peixin; Ihira, Kei; Hamada, Junichi; Watari, Hidemichi; Yamada, Takahiro; Hosaka, Masayoshi; Hanley, Sharon J.B.; Kudo, Masataka; Sakuragi, Noriaki


    Although mutational inactivation of p53 is found in 50% of all human tumors, a subset of tumors display defective p53 function, but retain wild-type (WT) p53. Here, direct and indirect mechanisms leading to the loss of WT p53 activities are discussed. We summarize the oncogenic roles of iASPP, an inhibitor of WT p53, in promoting proliferation, invasion, drug or radiation-resistance and metastasis. From the therapeutic view, we highlight promising perspectives of microRNA-124, peptide and small molecules that reduce or block iASPP for the treatment of cancer. High iASPP expression enhances proliferation, aggressive behavior, the resistance to radiation/chemotherapy and correlates with poor prognosis in a range of human tumors. Overexpression of iASPP accelerates tumorigenesis and invasion through p53-dependent and p53-independent mechanisms. MicroRNA-124 directly targets iASPP and represses the growth and invasiveness of cancer cells. The disruption of iASPP-p53 interaction by a p53-derived peptide A34 restores p53 function in cancer cells. The inhibition of iASPP phosphorylation with small molecules induces p53-dependent apoptosis and growth suppression. The mechanisms underlying aberrant expression of iASPP in human tumors should be further investigated. Reactivating WT p53 functions by targeting its novel inhibitor iASPP holds promise for potential therapeutic interventions in the treatment of WT p53-containing tumors. PMID:26343523

  17. The BM2 protein of influenza B virus interacts with p53 and inhibits its transcriptional and apoptotic activities.


    Zhang, H; Yu, H; Wang, J; Zhang, M; Wang, X; Ahmad, W; Duan, M; Guan, Z


    The influenza virus integral membrane proteins BM2 (M2 of influenza B virus) and A/M2 (M2 of influenza A virus) functions as an ion channel, important for virus uncoating in endosomes of virus-infected cells and essential for viral replication. M2 ion channel activity is also required to stimulate NLRP3 inflammasome activation by perturbing ionic concentrations in the Golgi. In the present study, we have investigated further the interaction between BM2 and p53 to confirm our previous studies using yeast two-hybrid assays. The interaction between BM2 and p53 was confirmed by GST pull-down, co-immunoprecipitation assays, and confocal microscopy. Expression of BM2 results in down-regulation of p53 mRNA and protein expression in a dose-dependent manner. In addition, we demonstrated that exogenous expression of BM2 functionally blocked p53-mediated transcriptional activity and apoptosis by luciferase reporter assay and TUNEL assay, respectively. Together, the present results indicate that BM2 is able to functionally interact with p53, and provide valuable insights into the modulation of p53 functions by influenza virus. PMID:25670017

  18. Che-1/AATF: A Critical Cofactor for Both Wild-Type- and Mutant-p53 Proteins

    PubMed Central

    Bruno, Tiziana; Iezzi, Simona; Fanciulli, Maurizio


    The p53 protein is a key player in a wide range of protein networks that allow the state of “good health” of the cell. Not surprisingly, mutations of the TP53 gene are one of the most common alterations associated to cancer cells. Mutated forms of p53 (mtp53) not only lose the ability to protect the integrity of the genetic heritage of the cell but also acquire pro-oncogenic functions, behaving like dangerous accelerators of transformation and tumor progression. In recent years, many studies focused on investigating possible strategies aiming to counteract this mutant p53 “gain of function” but the results have not always been satisfactory. Che-1/AATF is a nuclear protein that binds to RNA polymerase II and plays a role in multiple fundamental processes, including control of transcription, cell cycle regulation, DNA damage response, and apoptosis. Several studies showed Che-1/AATF as an important endogenous regulator of p53 expression and activity in a variety of biological processes. Notably, this same regulation was more recently observed also on mtp53. The depletion of Che-1/AATF strongly reduces the expression of mutant p53 in several tumors in vitro and in vivo, making the cells an easier target for chemotherapy treatments. In this mini review, we report an overview of Che-1/AATF functions and discuss a possible role of Che-1/AATF in cancer therapy, with particular regard to its action on p53/mtp53. PMID:26913241

  19. Identification of antipsychotic drug fluspirilene as a potential p53-MDM2 inhibitor: a combined computational and experimental study.


    Patil, Sachin P; Pacitti, Michael F; Gilroy, Kevin S; Ruggiero, John C; Griffin, Jonathan D; Butera, Joseph J; Notarfrancesco, Joseph M; Tran, Shawn; Stoddart, John W


    The inhibition of tumor suppressor p53 protein due to its direct interaction with oncogenic murine double minute 2 (MDM2) protein, plays a central role in almost 50 % of all human tumor cells. Therefore, pharmacological inhibition of the p53-binding pocket on MDM2, leading to p53 activation, presents an important therapeutic target against these cancers expressing wild-type p53. In this context, the present study utilized an integrated virtual and experimental screening approach to screen a database of approved drugs for potential p53-MDM2 interaction inhibitors. Specifically, using an ensemble rigid-receptor docking approach with four MDM2 protein crystal structures, six drug molecules were identified as possible p53-MDM2 inhibitors. These drug molecules were then subjected to further molecular modeling investigation through flexible-receptor docking followed by Prime/MM-GBSA binding energy analysis. These studies identified fluspirilene, an approved antipsychotic drug, as a top hit with MDM2 binding mode and energy similar to that of a native MDM2 crystal ligand. The molecular dynamics simulations suggested stable binding of fluspirilene to the p53-binding pocket on MDM2 protein. The experimental testing of fluspirilene showed significant growth inhibition of human colon tumor cells in a p53-dependent manner. Fluspirilene also inhibited growth of several other human tumor cell lines in the NCI60 cell line panel. Taken together, these computational and experimental data suggest a potentially novel role of fluspirilene in inhibiting the p53-MDM2 interaction. It is noteworthy here that fluspirilene has a long history of safe human use, thus presenting immediate clinical potential as a cancer therapeutic. Furthermore, fluspirilene could also serve as a structurally-novel lead molecule for the development of more potent, small-molecule p53-MDM2 inhibitors against several types of cancer. Importantly, the combined computational and experimental screening protocol

  20. p53 mutation, but not p53 overexpression, correlates with survival in head and neck squamous cell carcinoma.

    PubMed Central

    Mineta, H.; Borg, A.; Dictor, M.; Wahlberg, P.; Akervall, J.; Wennerberg, J.


    Survival in squamous cell carcinoma of the head and neck (HNSCC) was compared with overexpression and mutation of the p53 gene. Archival tissue from 77 tumours was analysed for protein expression using immunohistochemistry (IHC) with the monoclonal antibody Do-7, and for the presence of mutation in exons 5-8 using single-stranded conformation polymorphism (SSCP), followed by DNA sequencing in SSCP-positive cases. p53 expression was scored as high (>70% nuclei stained) in 25 (32%) tumours, as intermediate (10-70% nuclei stained) in 19 (25%) tumours and as low (<10% nuclei stained) in 33 (43%) tumours. Twelve (18%) tumours exhibited gene mutation (ten missense and two nonsense mutations) and an additional five tumours contained changes that could not result in amino acid substitution or protein truncation. There was no correlation between gene expression and mutation, mutations being equally frequent in tumours with either high (4/25), intermediate (4/19) or low protein expression (4/33). Fifty-eight patients were eligible for survival analysis. There was a strong correlation between p53 mutation and cause-specific survival; median survival among mutated cases was 12.5 months compared with >160 months among non-mutated patients (P < 0.005). There was no correlation between p53 overexpression and survival. The results suggest that p53 mutation status is an important prognostic factor in HNSCC, and that IHC analysis of protein overexpression is an inadequate measure of gene mutation in these tumours. Images Figure 1 PMID:9792155

  1. Activation of p53 in Down Syndrome and in the Ts65Dn Mouse Brain is Associated with a Pro-Apoptotic Phenotype.


    Tramutola, Antonella; Pupo, Gilda; Di Domenico, Fabio; Barone, Eugenio; Arena, Andrea; Lanzillotta, Chiara; Broekaart, Diede; Blarzino, Carla; Head, Elizabeth; Butterfield, D Allan; Perluigi, Marzia


    Down syndrome (DS) is the most common genetic cause of intellectual disability, resulting from trisomy of chromosome 21. The main feature of DS neuropathology includes early onset of Alzheimer's disease (AD), with deposition of senile plaques and tangles. We hypothesized that apoptosis may be activated in the presence of AD neuropathology in DS, thus we measured proteins associated with upstream and downstream pathways of p53 in the frontal cortex from DS cases with and without AD pathology and from Ts65Dn mice, at different ages. We observed increased acetylation and phosphorylation of p53, coupled to reduced MDM2/p53 complex level and lower levels of SIRT1. Activation of p53 was associated with a number of targets (BAX, PARP1, caspase-3, p21, heat shock proteins, and PGC1α) that were modulated in both DS and DS/AD compared with age-matched controls. In particular, the most relevant changes (increased p-p53 and acetyl-p53 and reduced formation of MDM2/p53 complex) were found to be modified only in the presence of AD pathology in DS. In addition, a similar pattern of alterations in the p53 pathway was found in Ts65Dn mice. These results suggest that p53 may integrate different signals, which can result in a pro-apoptotic-phenotype contributing to AD neuropathology in people with DS. PMID:26967221

  2. Identification of Two Reactive Cysteine Residues in the Tumor Suppressor Protein p53 Using Top-Down FTICR Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Scotcher, Jenna; Clarke, David J.; Weidt, Stefan K.; Mackay, C. Logan; Hupp, Ted R.; Sadler, Peter J.; Langridge-Smith, Pat R. R.


    The tumor suppressor p53 is a redox-regulated transcription factor involved in cell cycle arrest, apoptosis and senescence in response to multiple forms of stress, as well as many other cellular processes such as DNA repair, glycolysis, autophagy, oxidative stress and differentiation. The discovery of cysteine-targeting compounds that cause re-activation of mutant p53 and the death of tumor cells in vivo has emphasized the functional importance of p53 thiols. Using a combination of top-down and middle-down FTICR mass spectrometry, we show that of the 10 Cys residues in the core domain of wild-type p53, Cys182 and Cys277 exhibit a remarkable preference for modification by the alkylating reagent N-ethylmaleimide. The assignment of Cys182 and Cys277 as the two reactive Cys residues was confirmed by site-directed mutagenesis. Further alkylation of p53 beyond Cys182 and Cys277 was found to trigger co-operative modification of the remaining seven Cys residues and protein unfolding. This study highlights the power of top-down FTICR mass spectrometry for analysis of the cysteine reactivity and redox chemistry in multiple cysteine-containing proteins.

  3. RGS16, a novel p53 and pRb cross-talk candidate inhibits migration and invasion of pancreatic cancer cells

    PubMed Central

    Carper, Miranda B.; Denvir, James; Boskovic, Goran; Primerano, Donald A.; Claudio, Pier Paolo


    Data collected since the discovery of p53 and pRb/RB1 suggests these tumor suppressors cooperate to inhibit tumor progression. Patients who have mutations in both p53 and RB1 genes have increased tumor reoccurrence and decreased survival compared to patients with only one tumor suppressor gene inactivated. It remains unclear how p53 and pRb cooperate toward inhibiting tumorigenesis. Using RNA expression profiling we identified 179 p53 and pRb cross-talk candidates in normal lung fibroblasts (WI38) cells exogenously coexpressing p53 and pRb. Regulator of G protein signaling 16 (RGS16) was among the p53 and pRb cross-talk candidates and has been implicated in inhibiting activation of several oncogenic pathways associated with proliferation, migration, and invasion of cancer cells. RGS16 has been found to be downregulated in pancreatic cancer patients with metastases compared to patients without metastasis. Expression of RGS16 mRNA was decreased in the pancreatic cancer cell lines tested compared to control. Expression of RGS16 inhibited migration of the BxPC-3 and AsPC-1 but not PANC-1 cells and inhibited invasion of BxPC-3 and AsPC-1 cells with no impact on cell viability. We have identified for the first time p53 and pRb cross-talk candidates and a role for RGS16 to inhibit pancreatic cancer migration and invasion. PMID:25568667

  4. Small-Molecule NSC59984 Restores p53 Pathway Signaling and Antitumor Effects against Colorectal Cancer via p73 Activation and Degradation of Mutant p53.


    Zhang, Shengliang; Zhou, Lanlan; Hong, Bo; van den Heuvel, A Pieter J; Prabhu, Varun V; Warfel, Noel A; Kline, Christina Leah B; Dicker, David T; Kopelovich, Levy; El-Deiry, Wafik S


    The tumor-suppressor p53 prevents cancer development via initiating cell-cycle arrest, cell death, repair, or antiangiogenesis processes. Over 50% of human cancers harbor cancer-causing mutant p53. p53 mutations not only abrogate its tumor-suppressor function, but also endow mutant p53 with a gain of function (GOF), creating a proto-oncogene that contributes to tumorigenesis, tumor progression, and chemo- or radiotherapy resistance. Thus, targeting mutant p53 to restore a wild-type p53 signaling pathway provides an attractive strategy for cancer therapy. We demonstrate that small-molecule NSC59984 not only restores wild-type p53 signaling, but also depletes mutant p53 GOF. NSC59984 induces mutant p53 protein degradation via MDM2 and the ubiquitin-proteasome pathway. NSC59984 restores wild-type p53 signaling via p73 activation, specifically in mutant p53-expressing colorectal cancer cells. At therapeutic doses, NSC59984 induces p73-dependent cell death in cancer cells with minimal genotoxicity and without evident toxicity toward normal cells. NSC59984 synergizes with CPT11 to induce cell death in mutant p53-expressing colorectal cancer cells and inhibits mutant p53-associated colon tumor xenograft growth in a p73-dependent manner in vivo. We hypothesize that specific targeting of mutant p53 may be essential for anticancer strategies that involve the stimulation of p73 in order to efficiently restore tumor suppression. Taken together, our data identify NSC59984 as a promising lead compound for anticancer therapy that acts by targeting GOF-mutant p53 and stimulates p73 to restore the p53 pathway signaling. PMID:26294215

  5. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    PubMed Central


    Background Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. Methods We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. Results By different assays in isogenic HCT116p53+/+ and HCT116 p53-/- cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53+/+ but not in HCT116 p53-/- xenografts in vivo. In addition, R2 sensitized HCT116p53+/+ cells to doxorubicin and 5-fluorouracil. Conclusions Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches. PMID:23841915

  6. Low doses of arsenic, via perturbing p53, promotes tumorigenesis.


    Ganapathy, Suthakar; Li, Ping; Fagman, Johan; Yu, Tianqi; Lafontant, Jean; Zhang, Guojun; Chen, Changyan


    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure. PMID:27425828

  7. p53 protects against genome instability following centriole duplication failure

    PubMed Central

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield


    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  8. Mutation of p53 Tumor Suppressor Gene in Hepatocellular Carcinoma.


    Tullo, A; Sbisà, E


    In recent years, the most commonly observed genetic alteration in hepatocellular carcinoma (HCC), as in many other tumors affecting man, has been reported to be the mutation of the p53 coding gene (1,2). This gene has the features of a recessive oncosuppressor in its wild-type form and can be a dominant oncogene in its mutated form. The gene (20 kb) is located in a single copy on the short arm of chromosome 17 and contains 11 exons interrupted by 10 introns. The mRNA (2.8 kb) codes for a protein of 393 amino acids, which is expressed at relatively low levels in all tissues. p53 product is a 53-kDa phosphoprotein involved in the regulation of cell cycle, in DNA synthesis and repair, and in cell differentiation and apoptosis (see refs. 3-6, for reviews). PMID:21341051

  9. Roles of p53 in Various Biological Aspects of Hematopoietic Stem Cells

    PubMed Central

    Nii, Takenobu; Marumoto, Tomotoshi; Tani, Kenzaburo


    Hematopoietic stem cells (HSCs) have the capacity to self-renew as well as to differentiate into all blood cell types, and they can reconstitute hematopoiesis in recipients with bone marrow ablation. In addition, transplantation therapy using HSCs is widely performed for the treatment of various incurable diseases such as hematopoietic malignancies and congenital immunodeficiency disorders. For the safe and successful transplantation of HSCs, their genetic and epigenetic integrities need to be maintained properly. Therefore, understanding the molecular mechanisms that respond to various cellular stresses in HSCs is important. The tumor suppressor protein, p53, has been shown to play critical roles in maintenance of “cell integrity” under stress conditions by controlling its target genes that regulate cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. In this paper, we summarize recent reports that describe various biological functions of HSCs and discuss the roles of p53 associated with them. PMID:22778557

  10. HPV-p53-miR-34a axis in HPV-associated cancers

    PubMed Central


    Human papillomaviruses (HPVs) are known to cause many cancers by altering multiple signalling pathways through their oncogene integration into host genome and expression. Studies have shown that many microRNAs (miRs) may function as oncogenes (called as oncomiRs) to promote an oncogenic effect. MiR-34a among the reported oncomiRs is a key player in the carcinogenesis caused by infection with HPVs. In this mini-review, we summarise the roles of miR-34a in HPV-caused cancers. MiR-34a is transcriptionally regulated by tumour suppressor p53. HPV oncogene E6 inhibits expression of p53 to decrease the levels of miR-34a, leading to the increased expression of multiple genes which are targeted by miR-34a. The upregulation of these genes increases cancer cell proliferation, survival and migration in HPV-associated cancers. PMID:26734641

  11. [Quality control of recombinant oncolytic adenovirus/p53].


    Gao, Kai; Bi, Hua; Ding, You-Xue; Li, Yong-Hong; Han, Chun-Mei; Guo, Ying; Rao, Chun-Ming


    To establish a detection method of oncolytic adenovirus/p53 and standard of quality control, human telomerase reverse transcriptase (hTERT) promoter, CMV fusion promoter containing hypoxia reaction element (HRE) and p53 gene were identified by vector DNA restriction enzyme digestion and PCR analysis. The result conformed that all modified regions were in consistent with theoretical ones. Particle number was 2.0 x 10(11) mL(-1) determined by UV (A260). Infectious titer was 5.0 x 10(10) IU mL(-1) analyzed by TCID50. In vitro p53 gene expression in human lung cancer cell H1299 was determined by ELISA, and A450 ratio of nucleoprotein in virus infection group to control group was 5.2. Antitumor potency was evaluated by cytotoxicity assay using human lung cancer cell A549, and the MOI(IC50) of this gene therapy preparation was 1.0. The tumor cells targeted replication ability of recombinant virus was determined by TCID50 titer ratio of filial generation virus between human lung cancer cell A549 and human diploid epidermal fibrolast BJ cells after infected by virus with same MOI. TCID50 titer ratio of tumor cell infection group to normal cell infection control group was 398. The IE-HPLC purity of virus was 99.5%. There was less than 1 copy of wild type adenovirus within 1 x 10(7) VP recombinant virus. Other quality control items were complied with corresponding requirements in the guidance for human somatic cell therapy and gene therapy and Chinese pharmacopeia volume III. The detection method of oncolytic adenovirus/p53 was successfully established for quality control standard. The study also provided reference for quality control of other oncolytic viral vector products. PMID:22375422

  12. p53 protein oxidation in cultured cells in response to pyrrolidine dithiocarbamate: a novel method for relating the amount of p53 oxidation in vivo to the regulation of p53-responsive genes.

    PubMed Central

    Wu, H H; Thomas, J A; Momand, J


    A novel method was developed to determine the oxidation status of proteins in cultured cells. Methoxy-polyethylene glycol-maleimide MW 2000 (MAL-PEG) was used to covalently tag p53 protein that was oxidized at cysteine residues in cultured cells. Treatment of MCF7 breast cancer cells with pyrrolidine dithiocarbamate (PDTC), a metal chelator, resulted in a minimum of 25% oxidation of p53. The oxidized p53 had an average of one cysteine residue oxidized per p53 protein molecule. The effect of PDTC treatment on downstream components of the p53 signal-transduction pathway was tested. PDTC treatment prevented actinomycin D-mediated up-regulation of two p53 effector gene products, murine double minute clone 2 oncoprotein and p21(WAF1/CIP1) (where WAF1 corresponds to wild-type p53-activated fragment 1 and CIP1 corresponds to cyclin-dependent kinase-interacting protein 1). Actinomycin D treatment led to accumulation of p53 protein in the nucleus. However, when cells were simultaneously treated with PDTC and actinomycin D, p53 accumulated in both the nucleus and the cytoplasm. The data indicate that an average of one cysteine residue per p53 protein molecule is highly sensitive to oxidation and that p53 can be efficiently oxidized by PDTC in cultured cells. PDTC-mediated oxidation of p53 correlates with altered p53 subcellular localization and reduced activation of p53 downstream effector genes. The novel method for detecting protein oxidation detailed in the present study may be used to determine the oxidation status of specific proteins in cells. PMID:10998350

  13. Yin Yang 1 Promotes Thymocyte Survival by Downregulating p53.


    Chen, Liang; Foreman, Daniel P; Sant'Angelo, Derek B; Krangel, Michael S


    Yin Yang 1 (YY1) is a zinc finger protein that functions as a transcriptional activator or repressor and participates in multiple biological processes, including development and tumorigenesis. To investigate the role of YY1 in developing T cells, we used mouse models that depleted YY1 at two distinct stages of thymocyte development. When YY1 was depleted in CD4(-)CD8(-) double-negative thymocytes, development to the CD4(+)CD8(+) double-positive stage was impaired, due to increased apoptosis that prevented expansion of post-β-selection thymocytes. When YY1 was depleted in double-positive thymocytes, they underwent increased cell-autonomous apoptosis in vitro and displayed a shorter lifespan in vivo, as judged by their ability to undergo secondary Vα-to-Jα recombination. Mechanistically, we found that the increased apoptosis in YY1-deficient thymocytes was attributed to overexpression of p53, because concurrent loss of p53 completely rescued the developmental defects of YY1-deficient thymocytes. These results indicated that YY1 functions as a critical regulator of thymocyte survival and that it does so by suppressing the expression of p53. PMID:26843327

  14. v-Src Generates a p53-Independent Apoptotic Signal

    PubMed Central

    Webb, Brian L.; Jimenez, Elsa; Martin, G. Steven


    Evasion of apoptosis appears to be a necessary event in tumor progression. Some oncogenes, such as c-myc and E1A, induce apoptosis in the absence of survival factors. However, others, such as bcl-2 and v-src, activate antiapoptotic pathways. For v-Src, these antiapoptotic pathways are dependent on the function of Ras, phosphatidylinositol (PI) 3-kinase, and Stat3. Here we asked whether v-Src can activate a proapoptotic signal when survival signaling is inhibited. We show that when the functions of Ras and PI 3-kinase are inhibited, v-src-transformed Rat-2 fibroblasts undergo apoptosis, evidenced by loss of adherence, nuclear fragmentation, and chromosomal DNA degradation. The apoptotic response is dependent on activation of caspase 3. Under similar conditions nontransformed Rat-2 cells undergo considerably lower levels of apoptosis. Apoptosis induced by v-Src is accompanied by a loss of mitochondrial membrane potential and release of cytochrome c and is blocked by overexpression of bcl-2, indicating that it is mediated by the mitochondrial pathway. However apoptosis induced by v-Src is not accompanied by an increase in the level of p53 and is not dependent on p53 function. Thus v-Src generates a p53-independent proapoptotic signal. PMID:11094078

  15. Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction

    EPA Science Inventory

    Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protei...


    EPA Science Inventory

    p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...

  17. Cooperative Integrated Reading and Composition (CIRC): A Brief Overview.

    ERIC Educational Resources Information Center

    Slavin, Robert E.; And Others

    This pamphlet describes the Cooperative Integrated Reading and Composition (CIRC) program, a comprehensive approach to reading and writing instruction for grades 2 through 8. The pamphlet addresses the three principal elements of the program: story-related activities, direct instruction in reading comprehension, and integrated writing/language…

  18. Limiting the power of p53 through the ubiquitin proteasome pathway

    PubMed Central

    Pant, Vinod


    The ubiquitin proteasome pathway is critical in restraining the activities of the p53 tumor suppressor. Numerous E3 and E4 ligases regulate p53 levels. Additionally, deubquitinating enzymes that modify p53 directly or indirectly also impact p53 function. When alterations of these proteins result in increased p53 activity, cells arrest in the cell cycle, senesce, or apoptose. On the other hand, alterations that result in decreased p53 levels yield tumor-prone phenotypes. This review focuses on the physiological relevance of these important regulators of p53 and their therapeutic implications. PMID:25128494

  19. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide

    SciTech Connect

    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschella, Giuseppe


    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53.

  20. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide.


    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschellà, Giuseppe


    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53. PMID:18230339

  1. Novel Implications of DNA Damage Response in Drug Resistance of Malignant Cancers Obtained from the Functional Interaction between p53 Family and RUNX2

    PubMed Central

    Ozaki, Toshinori; Nakamura, Mizuyo; Shimozato, Osamu


    During the lifespan of cells, their genomic DNA is continuously exposed to the endogenous and exogenous DNA insults. Thus, the appropriate cellular response to DNA damage plays a pivotal role in maintaining genomic integrity and also acts as a molecular barrier towards DNA legion-mediated carcinogenesis. The tumor suppressor p53 participates in an integral part of proper regulation of DNA damage response (DDR). p53 is frequently mutated in a variety of human cancers. Since mutant p53 displays a dominant-negative behavior against wild-type p53, cancers expressing mutant p53 sometimes acquire drug-resistant phenotype, suggesting that mutant p53 prohibits the p53-dependent cell death pathway following DNA damage, and thereby contributing to the acquisition and/or maintenance of drug resistance of malignant cancers. Intriguingly, we have recently found that silencing of pro-oncogenic RUNX2 enhances drug sensitivity of aggressive cancer cells regardless of p53 status. Meanwhile, cancer stem cells (CSCs) have stem cell properties such as drug resistance. Therefore, the precise understanding of the biology of CSCs is quite important to overcome their drug resistance. In this review, we focus on molecular mechanisms behind DDR as well as the serious drug resistance of malignant cancers and discuss some attractive approaches to improving the outcomes of patients bearing drug-resistant cancers. PMID:26512706

  2. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation

    PubMed Central

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M.; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge


    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  3. E3 ubiquitin ligase TRIM32 negatively regulates tumor suppressor p53 to promote tumorigenesis.


    Liu, Ju; Zhang, C; Wang, X L; Ly, P; Belyi, V; Xu-Monette, Z Y; Young, K H; Hu, W; Feng, Z


    Tumor suppressor p53 has a key role in maintaining genomic stability and preventing tumorigenesis through its regulation of cellular stress responses, including apoptosis, cell cycle arrest and senescence. To ensure its proper levels and functions in cells, p53 is tightly regulated mainly through post-translational modifications, such as ubiquitination. Here, we identified E3 ubiquitin ligase TRIM32 as a novel p53 target gene and negative regulator to regulate p53-mediated stress responses. In response to stress, such as DNA damage, p53 binds to the p53 responsive element in the promoter of the TRIM32 gene and transcriptionally induces the expression of TRIM32 in cells. In turn, TRIM32 interacts with p53 and promotes p53 degradation through ubiquitination. Thus, TRIM32 negatively regulates p53-mediated apoptosis, cell cycle arrest and senescence in response to stress. TRIM32 is frequently overexpressed in different types of human tumors. TRIM32 overexpression promotes cell oncogenic transformation and tumorigenesis in mice in a largely p53-dependent manner. Taken together, our results demonstrated that as a novel p53 target and a novel negative regulator for p53, TRIM32 has an important role in regulation of p53 and p53-mediated cellular stress responses. Furthermore, our results also revealed that impairing p53 function is a novel mechanism for TRIM32 in tumorigenesis. PMID:25146927

  4. The ribosomal protein S26 regulates p53 activity in response to DNA damage.


    Cui, D; Li, L; Lou, H; Sun, H; Ngai, S-M; Shao, G; Tang, J


    Ribosomal proteins have emerged as novel regulators of the Mdm2-p53 feedback loop, especially in the context of ribosomal stress. RPS26 is a recently identified Diamond-Blackfan Anemia-related ribosomal protein and its role in p53 activation has not been previously explored. In this study we found knockdown of RPS26 induced p53 stabilization and activation via a RPL11-dependent mechanism, resulting in p53-dependent cell growth inhibition. Moreover, RPS26 has the ability to interact with Mdm2 and inhibits Mdm2-mediated p53 ubiquitination that leads to p53 stabilization upon overexpression. Importantly, we discovered that RPS26 knockdown impaired p53's ability to transcriptionally activate its target genes in response to DNA damage, without affecting its stability. Accordingly, the cells lost the ability to induce G2/M cell cycle arrest. We further found that upon RPS26 knockdown, the DNA damage induced recruitment of p53 to the promoters of its target genes and p53 acetylation were both greatly reduced. In addition, RPS26 can interact with p53 independent of Mdm2 and coexist in a complex with p53 and p300. These data establish a role of RPS26 in DNA damage response by directly influencing p53 transcriptional activity, and suggest that RPS26 acts distinctively in different scenarios of p53 activation. Our finding also implicates p53 transcriptional activity control as an important mechanism of p53 regulation by ribosomal proteins. PMID:23728348

  5. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation.


    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge


    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  6. TRIM25 has a dual function in the p53/Mdm2 circuit.


    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C


    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context. PMID:25728675

  7. Mutant p53 (p53-R248Q) functions as an oncogene in promoting endometrial cancer by up-regulating REGγ.


    Wang, Huihui; Bao, Wei; Jiang, Feizhou; Che, Qi; Chen, Zheng; Wang, Fangyuan; Tong, Huan; Dai, Chenyun; He, Xiaoying; Liao, Yun; Liu, Binya; Sun, Jing; Wan, Xiaoping


    P53 mutation plays a pivotal role in tumorigenesis of endometrial cancer (EC), here we report that the gain-of-function mutant p53-R248Q targets the proteasome activator REGγ to promote EC progression. Increased p53 expression significantly correlated with high pathological grade and lymph node metastasis in EC specimens. Manipulation of p53-R248Q in EC cells caused coincident changes in REGγ expression, and chromatin immunoprecipitation coupled with PCR further indicated that p53-R248Q bound to the REGγ gene promoter at a p53 responsive element. Silencing of REGγ in EC cells attenuated the cell proliferation, migration and invasion abilities, whereas overexpression of p53-R248Q rescued these activities. Overexpression of REGγ also induced an epithelial-mesenchymal transition phenotype. Moreover, a mouse xenograft tumor model showed that REGγ promoted tumor growth, further demonstrating a p53-R248Q-REGγ oncogenic pathway. Finally, examination of EC and normal endometrium specimens confirmed the oncogenic role of REGγ, in that REGγ was more highly overexpressed in p53-positive specimens than in p53-negative specimens. Our data suggest that REGγ is a promising therapeutic target for EC with the p53-R248Q mutation. PMID:25697482

  8. Akt phosphorylates myc-associated zinc finger protein (MAZ), releases P-MAZ from the p53 promoter, and activates p53 transcription.


    Lee, Wei-Ping; Lan, Keng-Hsin; Li, Chung-Pin; Chao, Yee; Lin, Han-Chieh; Lee, Shou-Dong


    The p53 protein is a cell cycle regulator. When the cell cycle progresses, p53 plays an important role in putting a brake on the G1 phase to prevent unwanted errors during cell division. Akt is a downstream kinase of receptor tyrosine kinase. Upon activation, Akt phorphorylates IKK that then phosphorylates IκB and releases NF-κB, leading to transcriptional activation of Dmp1. Dmp1 is a transcriptional activator of Arf. It has been known that oncogene activation stabilizes p53 through transcriptional activation of Arf, which then binds and inhibits Mdm2. In the current study, we show that myc-associated zinc finger protein (MAZ) is a transcriptional repressor of the p53 promoter. Akt phosphorylates MAZ at Thr385, and the phosphorylated MAZ is released from the p53 promoter, leading to transcriptional activation of p53, a new mechanism that contributes to increased p53 protein pool during oncogene activation. PMID:26902421

  9. Escape from p53-mediated tumor surveillance in neuroblastoma: switching off the p14(ARF)-MDM2-p53 axis.


    Van Maerken, T; Vandesompele, J; Rihani, A; De Paepe, A; Speleman, F


    A primary failsafe program against unrestrained proliferation and oncogenesis is provided by the p53 tumor suppressor protein, inactivation of which is considered as a hallmark of cancer. Intriguingly, mutations of the TP53 gene are rarely encountered in neuroblastoma tumors, suggesting that alternative p53-inactivating lesions account for escape from p53 control in this childhood malignancy. Several recent studies have shed light on the mechanisms by which neuroblastoma cells circumvent the p53-driven antitumor barrier. We review here these mechanisms for evasion of p53-mediated growth control and conclude that deregulation of the p14(ARF)-MDM2-p53 axis seems to be the principal mode of p53 inactivation in neuroblastoma, opening new perspectives for targeted therapeutic intervention. PMID:19779493

  10. ZASP Interacts with the Mechanosensing Protein Ankrd2 and p53 in the Signalling Network of Striated Muscle

    PubMed Central

    Martinelli, Valentina C.; Kyle, W. Buck; Kojic, Snezana; Vitulo, Nicola; Li, Zhaohui; Belgrano, Anna; Maiuri, Paolo; Banks, Lawrence; Vatta, Matteo; Valle, Giorgio; Faulkner, Georgine


    ZASP is a cytoskeletal PDZ-LIM protein predominantly expressed in striated muscle. It forms multiprotein complexes and plays a pivotal role in the structural integrity of sarcomeres. Mutations in the ZASP protein are associated with myofibrillar myopathy, left ventricular non-compaction and dilated cardiomyopathy. The ablation of its murine homologue Cypher results in neonatal lethality. ZASP has several alternatively spliced isoforms, in this paper we clarify the nomenclature of its human isoforms as well as their dynamics and expression pattern in striated muscle. Interaction is demonstrated between ZASP and two new binding partners both of which have roles in signalling, regulation of gene expression and muscle differentiation; the mechanosensing protein Ankrd2 and the tumour suppressor protein p53. These proteins and ZASP form a triple complex that appears to facilitate poly-SUMOylation of p53. We also show the importance of two of its functional domains, the ZM-motif and the PDZ domain. The PDZ domain can bind directly to both Ankrd2 and p53 indicating that there is no competition between it and p53 for the same binding site on Ankrd2. However there is competition for this binding site between p53 and a region of the ZASP protein lacking the PDZ domain, but containing the ZM-motif. ZASP is negative regulator of p53 in transactivation experiments with the p53-responsive promoters, MDM2 and BAX. Mutations in the ZASP ZM-motif induce modification in protein turnover. In fact, two mutants, A165V and A171T, were not able to bind Ankrd2 and bound only poorly to alpha-actinin2. This is important since the A165V mutation is responsible for zaspopathy, a well characterized autosomal dominant distal myopathy. Although the mechanism by which this mutant causes disease is still unknown, this is the first indication of how a ZASP disease associated mutant protein differs from that of the wild type ZASP protein. PMID:24647531

  11. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

    PubMed Central

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia


    Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

  12. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53.


    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Vande Pol, Scott; Podjarny, Alberto; Travé, Gilles; Zanier, Katia


    The p53 pro-apoptotic tumour suppressor is mutated or functionally altered in most cancers. In epithelial tumours induced by 'high-risk' mucosal human papilloma viruses, including human cervical carcinoma and a growing number of head-and-neck cancers, p53 is degraded by the viral oncoprotein E6 (ref. 2). In this process, E6 binds to a short leucine (L)-rich LxxLL consensus sequence within the cellular ubiquitin ligase E6AP. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 (ref. 4). Neither E6 nor E6AP are separately able to recruit p53 (refs 3, 5), and the precise mode of assembly of E6, E6AP and p53 is unknown. Here we solve the crystal structure of a ternary complex comprising full-length human papilloma virus type 16 (HPV-16) E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumour suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against oncogenesis mediated by human papilloma virus. PMID:26789255

  13. p53 alteration in morphologically normal/benign breast tissue in patients with triple-negative high-grade breast carcinomas: breast p53 signature?


    Wang, Xi; Stolla, Moritz; Ring, Brian Z; Yang, Qi; Laughlin, Todd S; Rothberg, Paul G; Skinner, Kristin; Hicks, David G


    p53 alterations have been identified in approximately 23% of breast carcinomas, particularly in hormone receptor-negative high-grade carcinomas. It is considered to be an early event in breast carcinogenesis. Nevertheless, the putative precursor lesion of high-grade breast carcinoma remains elusive. Breast excision specimens from 93 triple-negative high-grade invasive ductal carcinomas, 48 estrogen receptor (ER)-positive/progesterone receptor-positive/Her2-negative non-high-grade invasive ductal carcinomas, and 50 mammoplasty breasts were selected. At least 2 tissue blocks with tumor and adjacent benign tissue were sectioned and subjected to immunohistochemistry staining for p53. TP53 gene sequencing was performed on select tumors. Further immunohistochemistry staining for ER and Ki-67 was performed on consecutive sections of tissue with p53-positive normal/benign cells. Of the 93 high-grade carcinomas, 51 (55%) were positive for p53 alteration, whereas only 3 (6.25%) of the 48 non-high-grade carcinomas were p53 altered. Focal p53 positivity in adjacent normal/benign breast tissue was identified in 19 cases, and 18 of them also had p53 alteration in their carcinomas. Only 1 case had focal p53 staining in normal/benign tissue, but the tumor was negative for p53 alteration. No p53 staining positivity was identified in the mammoplasty specimens. The p53-stained normal/benign cells were ER negative and did not show an increase in the Ki-67 labeling index. These findings indicate that the p53 staining positivity in normal/benign breast tissue is not a random event. It could be considered as the "p53 signature" in breast and serve as an indicator for future potential risk of p53-positive high-grade breast carcinoma. PMID:27246177

  14. A dynamic p53-mdm2 model with distributed delay

    NASA Astrophysics Data System (ADS)

    Horhat, Raluca; Horhat, Raul Florin


    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcripion factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. In this paper, the dynamic P53-Mdm2 interaction model with distributed delays is investigated. Both weak and Dirac kernels are taken into consideration. For Dirac case, the Hopf bifurcation is investigated. Some numerical examples are finally given for justifying the theoretical results.

  15. Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion.


    Chen, Yongheng; Zhang, Xiaojun; Dantas Machado, Ana Carolina; Ding, Yuan; Chen, Zhuchu; Qin, Peter Z; Rohs, Remo; Chen, Lin


    The p53 core domain binds to response elements (REs) that contain two continuous half-sites as a cooperative tetramer, but how p53 recognizes discontinuous REs is not well understood. Here we describe the crystal structure of the p53 core domain bound to a naturally occurring RE located at the promoter of the Bcl-2-associated X protein (BAX) gene, which contains a one base-pair insertion between the two half-sites. Surprisingly, p53 forms a tetramer on the BAX-RE that is nearly identical to what has been reported on other REs with a 0-bp spacer. Each p53 dimer of the tetramer binds in register to a half-site and maintains the same protein-DNA interactions as previously observed, and the two dimers retain all the protein-protein contacts without undergoing rotation or translation. To accommodate the additional base pair, the DNA is deformed and partially disordered around the spacer region, resulting in an apparent unwinding and compression, such that the interactions between the dimers are maintained. Furthermore, DNA deformation within the p53-bound BAX-RE is confirmed in solution by site-directed spin labeling measurements. Our results provide a structural insight into the mechanism by which p53 binds to discontinuous sites with one base-pair spacer. PMID:23836939


    PubMed Central

    Di Domenico, Fabio; Barone, Eugenio; Arena, Andrea; Lanzillotta, Chiara; Brokeaart, Diede; Blarzino, Carla; Head, Elizabeth; Butterfield, D Allan; Perluigi, Marzia


    Down Syndrome (DS) is the most common genetic cause of intellectual disability resulting from trisomy of chromosome 21. The main feature of DS neuropathology includes early onset of Alzheimer's disease, with deposition of senile plaques and tangles. We hypothesized that apoptosis may be activated in the presence of AD neuropathology in DS, thus we measured proteins associated with upstream and downstream pathways of p53 in the frontal cortex from DS cases with and without AD pathology and from Ts65Dn mice, at different ages. We observed increased acetylation and phosphorylation of p53, coupled to reduced MDM2-mediated ubiquitination and lower levels of SIRT1. Activation of p53 was associated with a number of down-stream targets (bax, PARP1, caspase-3, heat shock proteins and PGC1α) that were modulated in both DS and DS/AD compared with age-matched controls. In particular, the most relevant changes (increased p-p53, acetyl-p53 and reduced formation of MDM2/p53 complex) were found to be modified only in the presence of AD pathology in DS. In addition, a similar pattern of alterations in the p53 pathway were found in Ts65Dn mice. These results suggest that p53 may integrate different signals, which can result in a pro-apoptotic-phenotype contributing to AD neuropathology in people with DS. PMID:26967221

  17. A Novel Function for p53: Regulation of Growth Cone Motility through Interaction with Rho Kinase

    PubMed Central

    Qin, Qingyu; Baudry, Michel; Liao, Guanghong; Noniyev, Albert; Galeano, James; Bi, Xiaoning


    The transcription factor p53 suppresses tumorgenesis by regulating cell proliferation and migration. We investigated whether p53 could also control cell motility in postmitotic neurons. P53 isoforms recognized by phospho-p53-specific (at Ser15) or “mutant” conformation specific antibodies were highly and specifically expressed in axons and axonal growth cones in primary hippocampal neurons. Inhibition of p53 function by inhibitors, siRNAs, or by dominant negative forms, induced axonal growth cone collapse, whereas p53 over-expression led to larger growth cones. Furthermore, deletion of the p53 nuclear export signal blocked its axonal distribution and induced growth cone collapse. P53 inhibition-induced axonal growth cone collapse was significantly reduced by the Rho kinase (ROCK) inhibitor, Y27632. Our results reveal a new function for p53 as a critical regulator of axonal growth cone behavior by suppressing ROCK activity. PMID:19386914

  18. Tetramerization-defects of p53 result in aberrant ubiquitylation and transcriptional activity.


    Lang, Valérie; Pallara, Chiara; Zabala, Amaia; Lobato-Gil, Sofia; Lopitz-Otsoa, Fernando; Farrás, Rosa; Hjerpe, Roland; Torres-Ramos, Monica; Zabaleta, Lorea; Blattner, Christine; Hay, Ronald T; Barrio, Rosa; Carracedo, Arkaitz; Fernandez-Recio, Juan; Rodríguez, Manuel S; Aillet, Fabienne


    The tumor suppressor p53 regulates the expression of genes involved in cell cycle progression, senescence and apoptosis. Here, we investigated the effect of single point mutations in the oligomerization domain (OD) on tetramerization, transcription, ubiquitylation and stability of p53. As predicted by docking and molecular dynamics simulations, p53 OD mutants show functional defects on transcription, Mdm2-dependent ubiquitylation and 26S proteasome-mediated degradation. However, mutants unable to form tetramers are well degraded by the 20S proteasome. Unexpectedly, despite the lower structural stability compared to WT p53, p53 OD mutants form heterotetramers with WT p53 when expressed transiently or stably in cells wild type or null for p53. In consequence, p53 OD mutants interfere with the capacity of WT p53 tetramers to be properly ubiquitylated and result in changes of p53-dependent protein expression patterns, including the pro-apoptotic proteins Bax and PUMA under basal and adriamycin-induced conditions. Importantly, the patient derived p53 OD mutant L330R (OD1) showed the more severe changes in p53-dependent gene expression. Thus, in addition to the well-known effects on p53 stability, ubiquitylation defects promote changes in p53-dependent gene expression with implications on some of its functions. PMID:24816189

  19. Pla2g16 phospholipase mediates gain-of-function activities of mutant p53.


    Xiong, Shunbin; Tu, Huolin; Kollareddy, Madhusudhan; Pant, Vinod; Li, Qin; Zhang, Yun; Jackson, James G; Suh, Young-Ah; Elizondo-Fraire, Ana C; Yang, Peirong; Chau, Gilda; Tashakori, Mehrnoosh; Wasylishen, Amanda R; Ju, Zhenlin; Solomon, Hilla; Rotter, Varda; Liu, Bin; El-Naggar, Adel K; Donehower, Lawrence A; Martinez, Luis Alfonso; Lozano, Guillermina


    p53(R172H/+) mice inherit a p53 mutation found in Li-Fraumeni syndrome and develop metastatic tumors at much higher frequency than p53(+/-) mice. To explore the mutant p53 metastatic phenotype, we used expression arrays to compare primary osteosarcomas from p53(R172H/+) mice with metastasis to osteosarcomas from p53(+/-) mice lacking metastasis. For this study, 213 genes were differentially expressed with a P value <0.05. Of particular interest, Pla2g16, which encodes a phospholipase that catalyzes phosphatidic acid into lysophosphatidic acid and free fatty acid (both implicated in metastasis), was increased in p53(R172H/+) osteosarcomas. Functional analyses showed that Pla2g16 knockdown decreased migration and invasion in mutant p53-expressing cells, and vice versa: overexpression of Pla2g16 increased the invasion of p53-null cells. Furthermore, Pla2g16 levels were increased upon expression of mutant p53 in both mouse and human osteosarcoma cell lines, indicating that Pla2g16 is a downstream target of the mutant p53 protein. ChIP analysis revealed that several mutant p53 proteins bind the Pla2g16 promoter at E26 transformation-specific (ETS) binding motifs and knockdown of ETS2 suppressed mutant p53 induction of Pla2g16. Thus, our study identifies a phospholipase as a transcriptional target of mutant p53 that is required for metastasis. PMID:25024203

  20. Functional analysis of the p53 codon 72 polymorphism in black South Africans with rheumatoid arthritis--a pilot study.


    Moodley, Devapregasan; Mody, Girish M; Chuturgoon, Anil A


    The p53 tumor-suppressor protein plays an integral role in apoptosis. Perturbations in peripheral lymphocyte (PL) apoptosis may be associated with rheumatoid arthritis (RA). Polymorphisms at codon 72 of p53 (arginine (Arg72) to proline transition) confers differences in mitochondrial translocation and apoptosis inducing capabilities of p53 in vitro. We examined associations of this polymorphism with PL apoptosis, mitochondrial depolarization, and clinical markers of disease activity in a cohort of black South African RA patients. Genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism. PL apoptosis was measured using the annexin-V assay and mitochondrial membrane potential with the JC-1 assay. Clinical and laboratory parameters were recorded for all patients. Statistical differences in these parameters were investigated according to genotype. Genotype distribution did not differ significantly between RA patients and controls (Arg/Arg, Arg/Pro, Pro/Pro: 12%, 46%, and 42% versus 3%, 34%, and 63%), despite significantly higher frequency of the Arg72 allele in patients (p = 0.0406). There was no significant difference in PL apoptosis and mitochondrial depolarization based on p53 codon 72 genotype. In addition, clinical markers of disease activity were not significantly different between genotypes. We conclude that p53 codon 72 genotype does not influence PL apoptosis or mitochondrial depolarization and is not associated with clinical markers of disease in RA. PMID:20532936

  1. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    SciTech Connect

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer


    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  2. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.


    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong


    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  3. Shifting p53-induced senescence to cell death by TIS21(/BTG2/Pc3) gene through posttranslational modification of p53 protein.


    Choi, Ok Ran; Ryu, Min Sook; Lim, In Kyoung


    Cellular senescence and apoptosis can be regulated by p53 activity, although the underlying mechanism of the switch between the two events remains largely unknown. Cells exposed to cancer chemotherapy can escape to senescence phenotype rather than undergoing apoptosis. By employing adenoviral transduction of p53 or TIS21 genes, we observed shifting of p53 induced-senescence to apoptosis in EJ bladder cancer cells, which express H-RasV12 and mutant p53; transduction of p53 increased H-RasV12 expression along with senescence phenotypes, whereas coexpression with TIS21 (p53+TIS21) induced cell death rather than senescence. The TIS21-mediated switch of senescence to apoptosis was accompanied by nuclear translocation of p53 protein and its modifications on Ser-15 and Ser-46 phosphorylation and acetylations on Lys-120, -320, -373 and -382 residues. Mechanistically, TIS21(/BTG2) regulated posttranslational modification of p53 via enhancing miR34a and Bax expressions as opposed to inhibiting SIRT1 and Bcl2 expression. At the same time, TIS21 increased APAF-1 and p53AIP1 expressions, but inhibited the interaction of p53 with iASPP. In vitro tumorigenicity was significantly reduced in the p53+TIS21 expresser through inhibiting micro-colony proliferation by TIS21. Effect of TIS21 on the regulation of p53 activity was confirmed by knockdown of TIS21 expression by RNA interference. Therefore, we suggest TIS21 expression as an endogenous cell death inducer at the downstream of p53 gene, which might be useful for intractable cancer chemotherapy. PMID:27208501

  4. Phosphorylation of p53: a Novel Pathway for p53 Inactivation in Human T-Cell Lymphotropic Virus Type 1-Transformed Cells

    PubMed Central

    Pise-Masison, Cynthia A.; Radonovich, Michael; Sakaguchi, Kazuyasu; Appella, Ettore; Brady, John N.


    Inhibition of p53 function, through either mutation or interaction with viral or cellular transforming proteins, correlates strongly with the oncogenic potential. Only a small percentage of human T-cell lymphotropic virus type 1 (HTLV-1)-transformed cells carry p53 mutations, and mutated p53 genes have been found in only one-fourth of adult T-cell leukemia cases. In previous studies, we demonstrated that wild-type p53 is stabilized and transcriptionally inactive in HTLV-1-transformed cells. Further, the viral transcriptional activator Tax plays a role in both the stabilization and inactivation of p53 through a mechanism involving the first 52 amino acids of p53. Here we show for the first time that phosphorylation of p53 inactivates p53 by blocking its interaction with basal transcription factors. Using two-dimensional peptide mapping, we demonstrate that peptides corresponding to amino acids 1 to 19 and 387 to 393 are hyperphosphorylated in HTLV-1-transformed cells. Moreover, using antibodies specific for phosphorylated Ser15 and Ser392, we demonstrate increased phosphorylation of these amino acids. Since HTLV-1 p53 binds DNA in a sequence-specific manner but fails to interact with TFIID, we tested whether phosphorylation of the N terminus of p53 affected p53-TFIID interaction. Using biotinylated peptides, we show that phosphorylation of Ser15 alone inhibits p53-TFIID interaction. In contrast, phosphorylation at Ser15 and -37 restores TFIID binding and blocks MDM2 binding. Our studies provide evidence that HTLV-1 utilizes the posttranslational modification of p53 in vivo to inactivate function of the tumor suppressor protein. PMID:9658074

  5. Heterogeneous Hydration of p53/MDM2 Complex

    PubMed Central


    Water-mediated interactions play critical roles in biomolecular recognition processes. Explicit solvent molecular dynamics (MD) simulations and the variational implicit-solvent model (VISM) are used to study those hydration properties during binding for the biologically important p53/MDM2 complex. Unlike simple model solutes, in such a realistic and heterogeneous solute–solvent system with both geometrical and chemical complexity, the local water distribution sensitively depends on nearby amino acid properties and the geometric shape of the protein. We show that the VISM can accurately describe the locations of high and low density solvation shells identified by the MD simulations and can explain them by a local coupling balance of solvent–solute interaction potentials and curvature. In particular, capillary transitions between local dry and wet hydration states in the binding pocket are captured for interdomain distance between 4 to 6 Å, right at the onset of binding. The underlying physical connection between geometry and polarity is illustrated and quantified. Our study offers a microscopic and physical insight into the heterogeneous hydration behavior of the biologically highly relevant p53/MDM2 system and demonstrates the fundamental importance of hydrophobic effects for biological binding processes. We hope our study can help to establish new design rules for drugs and medical substances. PMID:24803860

  6. Mutant p53 and ETS2, a Tale of Reciprocity

    PubMed Central

    Martinez, Luis Alfonso


    TP53 is one of the most frequently inactivated tumor suppressor genes in human cancer. However, unlike other tumor suppressor genes whose expression is lost, TP53 is usually inactivated as a result of a single nucleotide change within the coding region. Typically, these single nucleotide mutations result in a codon change that creates an amino acid substitution. Thus, unlike other tumor suppressor genes whose expression is lost due to genetic or epigenetic changes, the p53 gene primarily suffers missense mutations, and therefore, the cells retain and express a mutant form of the p53 protein (mtp53). It is now well established that mtp53 contributes to tumor development through its gain-of-function (GOF) activities. These GOF activities can arise from novel protein–protein interactions that can either disable other tumor suppressors (e.g., p63 and p73) or enable oncogenes such as ETS2, an ETS family member. In this review, I will focus on the identification of the mtp53/ETS2 complex and outline the diverse activities that this transcriptional regulatory complex controls to promote cancer. PMID:26925389

  7. Mutant p53 and ETS2, a Tale of Reciprocity.


    Martinez, Luis Alfonso


    TP53 is one of the most frequently inactivated tumor suppressor genes in human cancer. However, unlike other tumor suppressor genes whose expression is lost, TP53 is usually inactivated as a result of a single nucleotide change within the coding region. Typically, these single nucleotide mutations result in a codon change that creates an amino acid substitution. Thus, unlike other tumor suppressor genes whose expression is lost due to genetic or epigenetic changes, the p53 gene primarily suffers missense mutations, and therefore, the cells retain and express a mutant form of the p53 protein (mtp53). It is now well established that mtp53 contributes to tumor development through its gain-of-function (GOF) activities. These GOF activities can arise from novel protein-protein interactions that can either disable other tumor suppressors (e.g., p63 and p73) or enable oncogenes such as ETS2, an ETS family member. In this review, I will focus on the identification of the mtp53/ETS2 complex and outline the diverse activities that this transcriptional regulatory complex controls to promote cancer. PMID:26925389

  8. Constitutive p53 heightens mitochondrial apoptotic priming and favors cell death induction by BH3 mimetic inhibitors of BCL-xL.


    Le Pen, J; Laurent, M; Sarosiek, K; Vuillier, C; Gautier, F; Montessuit, S; Martinou, J C; Letaï, A; Braun, F; Juin, P P


    Proapoptotic molecules directly targeting the BCL-2 family network are promising anticancer therapeutics, but an understanding of the cellular stress signals that render them effective is still elusive. We show here that the tumor suppressor p53, at least in part by transcription independent mechanisms, contributes to cell death induction and full activation of BAX by BH3 mimetic inhibitors of BCL-xL. In addition to mildly facilitating the ability of compounds to derepress BAX from BCL-xL, p53 also provides a death signal downstream of anti-apoptotic proteins inhibition. This death signal cooperates with BH3-induced activation of BAX and it is independent from PUMA, as enhanced p53 can substitute for PUMA to promote BAX activation in response to BH3 mimetics. The acute sensitivity of mitochondrial priming to p53 revealed here is likely to be critical for the clinical use of BH3 mimetics. PMID:26844698

  9. Design of p53-derived peptides with cytotoxicity on breast cancer.


    Fang, Yi; Jin, Rongzhong; Gao, Yinqi; Gao, Jidong; Wang, Jing


    The tumor suppressor p53 plays essential role in conserving stability by preventing genome mutation, which is inactivated naturally by its negative regulator MDM2. Thus, targeting p53-MDM2 protein-protein interaction has been raised as a new cancer therapy in the medicinal community. In the current study, we report a successful application of an integrative protocol to design novel p53-derived peptides with cytotoxicity on human breast cancer cells. A quantitative structure-activity relationship-improved statistical potential was used to evaluate the binding potency of totally 24,054 single- and dual-point mutants of p53 peptide to MDM2 in a high-throughput manner, from which 46 peptide mutants with high predicted affinity and typical helical feature were involved in a rigorous modeling procedure that employed molecular dynamics simulations and post-binding energy analysis to systematically investigate the structural, energetic and dynamic aspects of peptide interactions with MDM2. Subsequently, a biological analysis was performed on a number of promising peptide candidates to determine their cytotoxic effects on human breast cancer cell line MDF-7. Six dual-point mutants were found to have moderate or high activities with their IC50 values ranging from 16.3 to 137.0 μM, which are better than that of wild-type p53 peptide (IC50 = 182.6 μM) and close to that of classical anticancer agent cis-platin (IC50 = 4.3 μM). Further, the most active peptide ETFSDWWKLLAE was selected as parent to further derive new mutants on the basis of the structural and energetic profile of its complex with MDM2. Consequently, three triple-point mutants (LTFSDWWKLLAE, ESFSDWWKLLAE and ETFADWWKLLAE) were obtained, and their biological activities (IC50 = 15.1, 27.0 and 8.7 μM, respectively) were determined to be comparable or better than the parent (IC50 = 16.3 μM). PMID:24830845

  10. Cellular Oxidative Stress and the Control of Apoptosis by Wild-Type p53, Cytotoxic Compounds, and Cytokines

    NASA Astrophysics Data System (ADS)

    Lotem, Joseph; Peled-Kamar, Mira; Groner, Yoram; Sachs, Leo


    Apoptosis induced by wild-type p53 or cytotoxic compounds in myeloid leukemic cells can be inhibited by the cytokines interleukin 6, interleukin 3, granulocyte-macrophage colony-stimulating factor, and interferon γ and by antioxidants. The antioxidants and cytokines showed a cooperative protective effect against induction of apoptosis. Cells with a higher sensitivity to induction of apoptosis and required a higher cytokine concentration to inhibit apoptosis. Decreasing the intrinsic oxidative stress in cells by antioxidants thus inhibited apoptosis, whereas increasing this intrinsic stress by adding H2O2 enhanced apoptosis. Induction of apoptosis by wild-type p53 was not preceded by increased peroxide production or lipid peroxidation and the protective effect of cytokines was not associated with a decrease in these properties. The results indicate that the intrinsic degree of oxidative stress can regulate cell susceptibility to wild-type p53-dependent and p53-independent induction of apoptosis and the ability of cytokines to protect cells against apoptosis.

  11. p53-repressed miRNAs are involved with E2F in a feed-forward loop promoting proliferation

    PubMed Central

    Brosh, Ran; Shalgi, Reut; Liran, Atar; Landan, Gilad; Korotayev, Katya; Nguyen, Giang Huong; Enerly, Espen; Johnsen, Hilde; Buganim, Yosef; Solomon, Hilla; Goldstein, Ido; Madar, Shalom; Goldfinger, Naomi; Børresen-Dale, Anne-Lise; Ginsberg, Doron; Harris, Curtis C; Pilpel, Yitzhak; Oren, Moshe; Rotter, Varda


    Normal cell growth is governed by a complicated biological system, featuring multiple levels of control, often deregulated in cancers. The role of microRNAs (miRNAs) in the control of gene expression is now increasingly appreciated, yet their involvement in controlling cell proliferation is still not well understood. Here we investigated the mammalian cell proliferation control network consisting of transcriptional regulators, E2F and p53, their targets and a family of 15 miRNAs. Indicative of their significance, expression of these miRNAs is downregulated in senescent cells and in breast cancers harboring wild-type p53. These miRNAs are repressed by p53 in an E2F1-mediated manner. Furthermore, we show that these miRNAs silence antiproliferative genes, which themselves are E2F1 targets. Thus, miRNAs and transcriptional regulators appear to cooperate in the framework of a multi-gene transcriptional and post-transcriptional feed-forward loop. Finally, we show that, similarly to p53 inactivation, overexpression of representative miRNAs promotes proliferation and delays senescence, manifesting the detrimental phenotypic consequence of perturbations in this circuit. Taken together, these findings position miRNAs as novel key players in the mammalian cellular proliferation network. PMID:19034270

  12. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    SciTech Connect

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei


    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  13. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    SciTech Connect

    Abdelalim, Essam Mohamed; Tooyama, Ikuo


    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  14. UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation.


    Du, Cheng; Wu, Hong; Leng, Roger P


    Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

  15. Coordination of the Nuclear and Cytoplasmic Activities of p53 in Response to DNA Damage

    PubMed Central

    Pu, Tian; Zhang, Xiao-Peng; Liu, Feng; Wang, Wei


    The tumor suppressor p53 plays a key role in the cellular response to various stresses. Most previous studies have focused on either the nuclear or cytoplasmic proapoptotic functions of p53, ignoring the combination of both functions. To explore how the two functions of p53 are coordinated in the DNA damage response via computer simulation, we construct a model for the p53 network comprising coupled positive and negative feedback loops involving p53, Mdm2, and Akt, as well as PUMA and Bax. In our model p53 is stabilized and accumulates in the nucleus and cytoplasm upon DNA damage. Nuclear p53 induces expression of Mdm2, PTEN, PUMA, and Bax. Cytoplasmic p53 is then released from the p53·Bcl-xL complex by PUMA to activate Bax directly. We find that the switching between low and high protein levels underlies the decision between cell survival and death. Moreover, a balance between the nuclear and cytoplasmic p53 levels and appropriate levels of Akt and PUMA are required for reliable cell fate decision. Our results indicate that coordination of the transcription-dependent and -independent activities of p53 is important in determining cellular outcomes. These findings advance our understanding of the mechanism for p53-mediated cellular responses and provide clues to p53-based cancer therapy. PMID:20858413

  16. STAT5A is regulated by DNA damage via the tumor suppressor p53.


    Mukhopadhyay, Utpal K; Cass, Jamaica; Raptis, Leda; Craig, Andrew W; Bourdeau, Véronique; Varma, Sonal; SenGupta, Sandip; Elliott, Bruce E; Ferbeyre, Gerardo


    Here we report that the STAT5A transcription factor is a direct p53 transcriptional target gene. STAT5A is well expressed in p53 wild type cells but not in p53-null cells. Inhibition of p53 reduces STAT5A expression. DNA damaging agents such as doxorubicin also induced STAT5A expression in a p53 dependent manner. Two p53 binding sites were mapped in the STAT5A gene and named PBS1 and PBS2; these sites were sufficient to confer p53 responsiveness in a luciferase reporter gene. Chromatin immunoprecipitation experiments revealed that PBS2 has constitutive p53 bound to it, while p53 binding to PBS1 required DNA damage. In normal human breast lobules, weak p53 staining correlated with regions of intense STAT5A staining. Interestingly, in a cohort of triple negative breast tumor tissues there was little correlation between regions of p53 and STAT5A staining, likely reflecting a high frequency of p53 mutations that stabilize the protein in these tumors. We thus reveal an unexpected connection between cytokine signaling and p53. PMID:26876578

  17. Exogenous p53 and ASPP2 expression enhances rAdV-TK/GCV-induced death in hepatocellular carcinoma cells lacking functional p53

    PubMed Central

    Guo, Xianghua; Wei, Feili; Yin, Jiming; Zang, Yunjin; Li, Ning; Chen, Dexi


    Suicide gene therapy using herpes simplex virus-1 thymidine kinase (HSV-TK) in combination with ganciclovir (GCV) has emerged as a potential new method for treating cancer. We hypothesize that the efficacy of HSV-TK/GCV therapy is at least partially dependent on p53 status in hepatocellular carcinoma (HCC) patients. Using recombinant adenoviral vectors (rAdV), TK, p53, and ASPP2 were overexpressed individually and in combination in Hep3B (p53 null) and HepG2 (p53 wild-type) cell lines and in primary HCC tumor cells. p53 overexpression induced death in Hep3B cells, but not HepG2 cells. ASPP2 overexpression increased rAdV-TK/GCV-induced HepG2 cell death by interacting with endogenous p53. Similarly, ASPP2 reduced survival in rAdV-TK/GCV-treated primary HCC cells expressing p53 wild-type but not a p53 R249S mutant. Mutated p53 was unable to bind to ASPP2, suggesting that the increase in rAdV-TK/GCV-induced cell death resulting from ASPP2 overexpression was dependent on its interaction with p53. Additionally, γ-H2AX foci, ATM phosphorylation, Bax, and p21 expression increased in rAdV-TK/GCV-treated HepG2 cells as compared to Hep3B cells. This suggests that the combined use of HSV-TK, GCV, rAdV-p53 and rAdV-ASPP2 may improve therapeutic efficacy in HCC patients lacking functional p53. PMID:26934443

  18. Gene expression profiling analysis reveals arsenic-induced cell cycle arrest and apoptosis in p53-proficient and p53-deficient cells through differential gene pathways

    SciTech Connect

    Yu Xiaozhong Robinson, Joshua F.; Gribble, Elizabeth; Hong, Sung Woo; Sidhu, Jaspreet S.; Faustman, Elaine M.


    Arsenic (As) is a well-known environmental toxicant and carcinogen as well as an effective chemotherapeutic agent. The underlying mechanism of this dual capability, however, is not fully understood. Tumor suppressor gene p53, a pivotal cell cycle checkpoint signaling protein, has been hypothesized to play a possible role in mediating As-induced toxicity and therapeutic efficiency. In this study, we found that arsenite (As{sup 3+}) induced apoptosis and cell cycle arrest in a dose-dependent manner in both p53{sup +/+} and p53{sup -/-} mouse embryonic fibroblasts (MEFs). There was, however, a distinction between genotypes in the apoptotic response, with a more prominent induction of caspase-3 in the p53{sup -/-} cells than in the p53{sup +/+} cells. To examine this difference further, a systems-based genomic analysis was conducted comparing the critical molecular mechanisms between the p53 genotypes in response to As{sup 3+}. A significant alteration in the Nrf2-mediated oxidative stress response pathway was found in both genotypes. In p53{sup +/+} MEFs, As{sup 3+} induced p53-dependent gene expression alterations in DNA damage and cell cycle regulation genes. However, in the p53{sup -/-} MEFs, As{sup 3+} induced a significant up-regulation of pro-apoptotic genes (Noxa) and down-regulation of genes in immune modulation. Our findings demonstrate that As-induced cell death occurs through a p53-independent pathway in p53 deficient cells while apoptosis induction occurs through p53-dependent pathway in normal tissue. This difference in the mechanism of apoptotic responses between the genotypes provides important information regarding the apparent dichotomy of arsenic's dual mechanisms, and potentially leads to further advancement of its utility as a chemotherapeutic agent.

  19. Gene expression profiling analysis reveals arsenic-induced cell cycle arrest and apoptosis in p53-proficient and p53-deficient cells through differential gene pathways

    PubMed Central

    Yu, Xiaozhong; Robinson, Joshua F.; Gribble, Elizabeth; Hong, Sung Woo; Sidhu, Jaspreet S; Faustman, Elaine M


    Arsenic (As) is a well-known environmental toxicant and carcinogen as well as an effective chemotherapeutic agent. The underlying mechanism of this dual capability, however, is not fully understood. Tumor suppressor gene p53, a pivotal cell cycle checkpoint signaling protein, has been hypothesized to play a possible role in mediating As-induced toxicity and therapeutic efficiency. In this study, we found that arsenite (As3+) induced apoptosis and cell cycle arrest in a dose-dependent manner in both p53+/+ and p53−/− mouse embryonic fibroblasts (MEFs). There was, however, a distinction between genotypes in the apoptotic response, with a more prominent induction of caspase-3 in the p53−/− cells than in the p53+/+ cells. To examine this difference further, a systems-based genomic analysis was conducted comparing the critical molecular mechanisms between the p53 genotypes in response to As3+. A significant alteration in the Nrf2-mediated oxidative stress response pathway were found in both genotypes. In p53+/+ MEFs, As3+ induced p53-dependent gene expression alterations in DNA damage and cell cycle regulation genes. However, in the p53−/− MEFs, As3+ induced a significant up-regulation of pro-apoptotic genes (Noxa) and down-regulation of genes in immune modulation. Our findings demonstrate that As-induced cell death occurs through a p53-independent pathway in p53 deficient cells while apoptosis induction occurs through p53-dependent pathway in normal tissue. This difference in the mechanism of apoptotic responses between the genotypes provides important information regarding the apparent dichotomy of arsenic’s dual mechanisms, and potentially leads to further advancement of its utility as a chemotherapeutic agent. PMID:18929588

  20. The therapeutic potential of p53 reactivation by nutlin-3a in ALK+ anaplastic large cell lymphoma with wild-type or mutated p53.


    Drakos, E; Atsaves, V; Schlette, E; Li, J; Papanastasi, I; Rassidakis, G Z; Medeiros, L J


    p53 is expressed frequently, but is rarely mutated in anaplastic lymphoma kinase (ALK)-positive anaplastic large cell lymphoma (ALCL) tumours. Nutlin-3a is a recently developed small molecule that targets Mdm2, a critical negative regulator of p53, and disrupts the p53-Mdm2 interaction resulting in p53 stabilization and activation. We show that nutlin-3a activates p53 in ALK+ ALCL cells carrying a wild type (wt) or mutated but partially functional p53 gene resulting in p53-dependent cell-cycle arrest and apoptosis. Cell-cycle arrest was associated with upregulation of the cyclin-dependent kinase inhibitor p21. Nutlin-3a-induced apoptotic cell death was accompanied by Bax and Puma upregulation, downregulation of Bcl-xl, survivin, and caspase-3 cleavage, and this was reduced when p53-dependent transactivation activity was inhibited by pifithrin-alpha, or when pifithrin-mu was used to inhibit direct p53 targeting of mitochondria. Nutlin-3a sensitized the activation of the extrinsic apoptotic pathway in wt-p53 ALK+ ALCL cells, in part, through upregulation of DR-5 and downregulation of c-Flip(S/L), and was synergistic with TRAIL in cell death induction. In addition, nutlin-3a treatment enhanced doxorubicin cytotoxicity against ALK+ ALCL cells harbouring mt p53, and this was associated with p73 upregulation. These data suggest that disruption of the p53-mdm2 interaction by nutlin-3a offers a novel therapeutic approach for ALK+ ALCL patients. PMID:19741726

  1. Pontin, a new mutant p53-binding protein, promotes gain-of-function of mutant p53.


    Zhao, Y; Zhang, C; Yue, X; Li, X; Liu, J; Yu, H; Belyi, V A; Yang, Q; Feng, Z; Hu, W


    Tumor-suppressor p53 is frequently mutated in human cancers. Many tumor-associated mutant p53 (mutp53) proteins gain new functions in promoting tumorigenesis, defined as gain-of-function (GOF). The mechanisms for mutp53 GOF are not well understood. Here, we report Pontin, a highly conserved AAA+ ATPase important for various cellular functions, as a new mutp53-binding protein. This Pontin-mutp53 interaction promotes mutp53 GOF in invasion, migration and anchorage-independent growth of tumor cells. The ATPase domain of Pontin is crucial for its promoting effect on mutp53 GOF; blocking the ATPase activity of Pontin by a Pontin-specific ATPase inhibitor or an ATPase-deficient dominant-negative Pontin expression vector greatly diminished mutp53 GOF. Pontin promotes mutp53 GOF through regulation of mutp53 transcriptional activity; knockdown of Pontin abolished the transcriptional regulation of mutp53 toward a group of genes. Furthermore, overexpression of Pontin in tumors is associated with the poor survival in cancer patients, especially those containing mutp53. Our results highlight an important role and mechanism for Pontin, a new mutp53 partner, in promoting mutp53 GOF in tumorigenesis. PMID:25857266

  2. Structure of the Tfb1/p53 complex: Insights into the interaction between the p62/Tfb1 subunit of TFIIH and the activation domain of p53.


    Di Lello, Paola; Jenkins, Lisa M Miller; Jones, Tamara N; Nguyen, Bao D; Hara, Toshiaki; Yamaguchi, Hiroshi; Dikeakos, Jimmy D; Appella, Ettore; Legault, Pascale; Omichinski, James G


    The interaction between the amino-terminal transactivation domain (TAD) of p53 and TFIIH is directly correlated with the ability of p53 to activate both transcription initiation and elongation. We have identified a region within the p53 TAD that specifically interacts with the pleckstrin homology (PH) domain of the p62 and Tfb1 subunits of human and yeast TFIIH. We have solved the 3D structure of a complex between the p53 TAD and the PH domain of Tfb1 by NMR spectroscopy. Our structure reveals that p53 forms a nine residue amphipathic alpha helix (residues 47-55) upon binding to Tfb1. In addition, we demonstrate that diphosphorylation of p53 at Ser46 and Thr55 leads to a significant enhancement in p53 binding to p62 and Tfb1. These results indicate that a phosphorylation cascade involving Ser46 and Thr55 of p53 could play an important role in the regulation of select p53 target genes. PMID:16793543

  3. Mutations in p53 change phosphatidylinositol acyl chain composition

    PubMed Central

    Naguib, Adam; Bencze, Gyula; Engle, Dannielle; Chio, Iok I. C.; Herzka, Tali; Watrud, Kaitlin; Bencze, Szilvia; Tuveson, David A.; Pappin, Darryl J; Trotman, Lloyd C.


    Phosphatidylinositol phosphate (PIP) second messengers relay extracellular growth cues through the phosphorylation status of the inositol sugar, a signal transduction system that is deregulated in cancer. In stark contrast to PIP inositol head group phosphorylation, changes in phosphatidylinositol (PI) lipid acyl chains in cancer have remained ill-defined. Here, we apply a mass spectrometry-based method capable of unbiased high-throughput identification and quantification of cellular PI acyl chain composition. Using this approach we find that PI lipid chains represent a cell-specific fingerprint and are unperturbed by serum-mediated signaling in contrast to the inositol head group. We find that mutation of Trp53 results in PIs containing reduced-length fatty acid moieties. Our results suggest that the anchoring tails of lipid second messengers form an additional layer of PIP signaling in cancer that operates independently of PTEN/PI3-Kinase activity, but is instead linked somehow to p53. PMID:25543136

  4. Mitochondrial localization of the low level p53 protein in proliferative cells

    SciTech Connect

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc


    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  5. The tissue dependent interactions between p53 and Bcl-2 in vivo

    PubMed Central

    Wang, Hongshen; Xu, Zhixiang; Li, Bin


    To further investigate the role of p53 in apoptosis in vivo and the interaction between p53 and Bcl-2 in the regulation of cellular apoptosis in vivo, we depleted p53 in Bcl-2-null mice. We found that the interaction between p53 and Bcl-2 are tissue dependent. Specifically, loss of p53 in Bcl-2−/− mice inhibits apoptotic induction in spleen and subsequently inhibits the Bcl-2-null-induced spleen atrophy. Furthermore, p53 deficiency overcomes loss of melanocyte stem cell (MSC)-induced apoptosis and subsequently prevents hair graying in Bcl-2- null mice. In addition, p53 deletion partly inhibits apoptosis in hair follicle keratinocytes, leading to the alleviation of hair growth delay in Bcl-2-null mice. However, p53 absence in Bcl-2-null mice cannot restore other defects in Bcl-2-null mice, including retardation of growth, short ears and polycystic kidney disease. PMID:26452131

  6. Intracellular delivery of p53 fused to the basic domain of HIV-1 Tat.


    Ryu, Jiyoon; Lee, Hak Joo; Kim, Kyeong-Ae; Lee, Jae Yong; Lee, Kil Soo; Park, Jinseu; Choi, Soo Young


    p53 is a potent tumor suppressor inactivated in many cancers. In this study, the membrane permeability of the HIV-1 Tat basic domain was exploited to introduce functional p53 into cancer cells. We expressed and purified a p53 fusion protein with the HIV-1 Tat basic domain at its N terminus (Tat-p53), and examined its transduction profile and biological activity in cancer cells. Tat-p53 was efficiently delivered to both the cytoplasm and nucleus of cells, and was transcriptionally active, as judged by the level of p21/WAF1 protein and of p21 promoter activity. Transduction of cells with Tat-p53 resulted in apoptotic cell death in both p53 positive and negative human tumor cell lines. These results suggest that Tat-p53 could be useful in cancer therapy. PMID:15179054

  7. Nerve growth factor receptor negates the tumor suppressor p53 as a feedback regulator

    PubMed Central

    Zhou, Xiang; Hao, Qian; Liao, Peng; Luo, Shiwen; Zhang, Minhong; Hu, Guohui; Liu, Hongbing; Zhang, Yiwei; Cao, Bo; Baddoo, Melody; Flemington, Erik K; Zeng, Shelya X; Lu, Hua


    Cancer develops and progresses often by inactivating p53. Here, we unveil nerve growth factor receptor (NGFR, p75NTR or CD271) as a novel p53 inactivator. p53 activates NGFR transcription, whereas NGFR inactivates p53 by promoting its MDM2-mediated ubiquitin-dependent proteolysis and by directly binding to its central DNA binding domain and preventing its DNA-binding activity. Inversely, NGFR ablation activates p53, consequently inducing apoptosis, attenuating survival, and reducing clonogenic capability of cancer cells, as well as sensitizing human cancer cells to chemotherapeutic agents that induce p53 and suppressing mouse xenograft tumor growth. NGFR is highly expressed in human glioblastomas, and its gene is often amplified in breast cancers with wild type p53. Altogether, our results demonstrate that cancers hijack NGFR as an oncogenic inhibitor of p53. DOI: PMID:27282385

  8. Reactivating mutant p53 using small molecules as zinc metallochaperones: awakening a sleeping giant in cancer

    PubMed Central

    Blanden, Adam R.; Yu, Xin; Loh, Stewart N.; Levine, Arnold J.; Carpizo, Darren R.


    Tumor protein p53 (TP53) is the most commonly mutated gene in human cancer. The majority of mutations are missense, and generate a defective protein that is druggable. Yet, for decades, the small-molecule restoration of wild-type (WT) p53 function in mutant p53 tumors (so-called p53 mutant ‘reactivation’) has been elusive to researchers. The p53 protein requires the binding of a single zinc ion for proper folding, and impairing zinc binding is a major mechanism for loss of function in missense mutant p53. Here, we describe recent work defining a new class of drugs termed zinc metallochaperones that restore WT p53 structure and function by restoring Zn2+ to Zn2+-deficient mutant p53. PMID:26205328

  9. p53 modulates homologous recombination by transcriptional regulation of the RAD51 gene

    PubMed Central

    Arias-Lopez, Carmen; Lazaro-Trueba, Iciar; Kerr, Peter; Lord, Christopher J; Dexter, Tim; Iravani, Marjan; Ashworth, Alan; Silva, Augusto


    DNA repair by homologous recombination is involved in maintaining genome stability. Previous data report that wild-type p53 suppresses homologous recombination and physically interacts with Rad51. Here, we show the in vivo binding of wild-type p53 to a p53 response element in the promoter of Rad51 and the downregulation of Rad51 messenger RNA and protein by wild-type p53, favoured by DNA damage. Moreover, wild-type p53 inhibits Rad51 foci formation in response to double-strand breaks, whereas p53 contact mutant R280K fails to repress Rad51 mRNA and protein expression and Rad51 foci formation. We propose that transcriptional repression of Rad51 by p53 participates in regulating homologous recombination, and impaired Rad51 repression by p53 mutants may contribute to malignant transformation. PMID:16322760

  10. Regulation of p53-dependent apoptosis, transcriptional repression, and cell transformation by phosphorylation of the 55-kilodalton E1B protein of human adenovirus type 5.

    PubMed Central

    Teodoro, J G; Branton, P E


    The adenovirus type 5 55-kDa E1B protein (E1B-55kDa) cooperates with E1A gene products to induce cell transformation. E1A proteins stimulate DNA synthesis and cell proliferation; however, they also cause rapid cell death by p53-dependent and p53-independent apoptosis. It is believed that the role of the E1B-55kDa protein in transformation is to protect against p53-dependent apoptosis by binding to and inactivating p53. It has been shown previously that the 55-kDa polypeptide abrogates p53-mediated transactivation and that mutants defective in p53 binding are unable to cooperate with E1A in transformation. We have previously mapped phosphorylation sites near the carboxy terminus of the E1B-55kDa protein at Ser-490 and Ser-491, which lie within casein kinase II consensus sequences. Conversion of these sites to alanine residues greatly reduced transforming activity, and although the mutant 55-kDa protein was found to interact with p53 at normal levels, it was somewhat defective for suppression of p53 transactivation activity. We now report that a nearby residue, Thr-495, also appears to be phosphorylated. We demonstrate directly that the wild-type 55-kDa protein is able to block E1A-induced p53-dependent apoptosis, whereas cells infected by mutant pm490/1/5A, which contains alanine residues at all three phosphorylation sites, exhibited extensive DNA fragmentation and classic apoptotic cell death. The E1B-55kDa product has been shown to exhibit intrinsic transcriptional repression activity when localized to promoters, such as by fusion with the GAL4 DNA-binding domain, even in the absence of p53. Such repression activity was totally absent with mutant pm490/1/5A. These data suggested that inhibition of p53-dependent apoptosis may depend on the transcriptional repression function of the 55-kDa protein, which appears to be regulated be phosphorylation at the carboxy terminus. PMID:9094635

  11. Cooperative integration of stereopsis and optic flow computation

    NASA Astrophysics Data System (ADS)

    Sudhir, G.; Banerjee, Subhashis; Biswas, K. K.; Bahl, R.


    A cooperative integration of stereopsis and optic flow computation is presented. Central to our approach is the modeling of the visual processes as a sequence of coupled Markov random fields by definition of suitable interprocess interactions based on some natural constraints. The integration makes each of the individual processes better constrained and more reliable. Further, as a result of the integration, it becomes possible to obtain accurately the discontinuities in both the flow and the disparity fields along with the regions of stereo occlusion. Results on both noisy synthetic image data and real images are presented. Copyright (c) 1995 Optical Society of America

  12. PACT is a negative regulator of p53 and essential for cell growth and embryonic development.


    Li, Li; Deng, Binwei; Xing, Guichun; Teng, Yan; Tian, Chunyan; Cheng, Xuan; Yin, Xiushan; Yang, Juntao; Gao, Xue; Zhu, Yunping; Sun, Qihong; Zhang, Lingqiang; Yang, Xiao; He, Fuchu


    The tumor suppressor p53 regulates cell cycle progression and apoptosis in response to various types of stress, whereas excess p53 activity creates unwanted effects. Tight regulation of p53 is essential for maintaining normal cell growth. p53-associated cellular protein-testes derived (PACT, also known as P2P-R, RBBP6) is a 250-kDa Ring finger-containing protein that can directly bind to p53. PACT is highly up-regulated in esophageal cancer and may be a promising target for immunotherapy. However, the physiological role of the PACT-p53 interaction remains largely unclear. Here, we demonstrate that the disruption of PACT in mice leads to early embryonic lethality before embryonic day 7.5 (E7.5), accompanied by an accumulation of p53 and widespread apoptosis. p53-null mutation partially rescues the lethality phenotype and prolonged survival to E11.5. Endogenous PACT can interact with Hdm2 and enhance Hdm2-mediated ubiquitination and degradation of p53 as a result of the increase of the p53-Hdm2 affinity. Consequently, PACT represses p53-dependent gene transcription. Knockdown of PACT significantly attenuates the p53-Hdm2 interaction, reduces p53 polyubiquitination, and enhances p53 accumulation, leading to both apoptosis and cell growth retardation. Taken together, our data demonstrate that the PACT-p53 interaction plays a critical role in embryonic development and tumorigenesis and identify PACT as a member of negative regulators of p53. PMID:17470788

  13. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.


    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  14. p53 negatively regulates Aurora A via both transcriptional and posttranslational regulation

    PubMed Central

    Wu, Chun-Chi; Yang, Tsung-Ying; Yu, Chang-Tze Ricky; Phan, Liem; Ivan, Cristina; Sood, Anil K.; Hsu, Shih-Lan; Lee, Mong-Hong


    p53 plays an important role in mitotic checkpoint, but what its role is remains enigmatic. Aurora A is a Ser/Thr kinase involved in correcting progression of mitosis. Here, we show that p53 is a negative regulator for Aurora A. We found that p53 deficiency leads to Aurora A elevation. Ectopic expression of p53 or DNA damage-induced expression of p53 can suppress the expression of Aurora A. Mechanistic studies show that p53 is a negative regulator for Aurora A expression through both transcriptional and posttranslational regulation. p53 knockdown in cancer cells reduces the level of p21, which, in turn, increases the activity of CDK2 followed by induction of Rb1 hyperphosphorylation and its dissociation with transcriptional factor E2F3. E2F3 can bind to Aurora A gene promoter, potentiating Aurora A gene expression and p53 deficiency, enhancing the binding of E2F3 on Aurora A promoter. Also, p53 deficiency leads to decelerating Aurora A’s turnover rate, due to the fact that p53 deficiency causes the downregulation of Fbw7α, a component of E3 ligase of Aurora A. Consistently, p53 knockdown-mediated Aurora A elevation is mitigated when Fbw7α is ectopically expressed. Thus, p53-mediated Aurora A degradation requires Fbw7α expression. Significantly, inverse correlation between p53 and Aurora A elevation is translated into the deregulation of centrosome amplification. p53 knockdown leads to high percentages of cells with abnormal amplification of centrosome. These data suggest that p53 is an important negative regulator of Aurora A, and that loss of p53 in many types of cancer could lead to abnormal elevation of Aurora A and dysregulated mitosis, which provides a growth advantage for cancer cells. PMID:22894933

  15. p53-Dependent DNA damage response sensitive to editing-defective tRNA synthetase in zebrafish.


    Song, Youngzee; Shi, Yi; Carland, Tristan M; Lian, Shanshan; Sasaki, Tomoyuki; Schork, Nicholas J; Head, Steven R; Kishi, Shuji; Schimmel, Paul


    Brain and heart pathologies are caused by editing defects of transfer RNA (tRNA) synthetases, which preserve genetic code fidelity by removing incorrect amino acids misattached to tRNAs. To extend understanding of the broader impact of synthetase editing reactions on organismal homeostasis, and based on effects in bacteria ostensibly from small amounts of mistranslation of components of the replication apparatus, we investigated the sensitivity to editing of the vertebrate genome. We show here that in zebrafish embryos, transient overexpression of editing-defective valyl-tRNA synthetase (ValRS(ED)) activated DNA break-responsive H2AX and p53-responsive downstream proteins, such as cyclin-dependent kinase (CDK) inhibitor p21, which promotes cell-cycle arrest at DNA damage checkpoints, and Gadd45 and p53R2, with pivotal roles in DNA repair. In contrast, the response of these proteins to expression of ValRS(ED) was abolished in p53-deficient fish. The p53-activated downstream signaling events correlated with suppression of abnormal morphological changes caused by the editing defect and, in adults, reversed a shortened life span (followed for 2 y). Conversely, with normal editing activities, p53-deficient fish have a normal life span and few morphological changes. Whole-fish deep sequencing showed genomic mutations associated with the editing defect. We suggest that the sensitivity of p53 to expression of an editing-defective tRNA synthetase has a critical role in promoting genome integrity and organismal homeostasis. PMID:27402763

  16. Treating cancer when pRb and p53 cannot be reactivated

    PubMed Central

    Zhu, Liang


    Activation of oncoproteins and inactivation of tumor suppressors induces tumorigenesis. When these events happen upstream of pRb and p53, cancer therapies may initially succeed and then fail when pRb and p53 are activated and then re-inactivated. Therapies might succeed if they remain effective when pRb and p53 are genetically inactivated. PMID:27308498

  17. MDM2 Inhibits Axin-Induced p53 Activation Independently of its E3 Ligase Activity.


    He, Ying; Lian, Guili; Lin, Shuyong; Ye, Zhiyun; Li, Qinxi


    MDM2 plays a crucial role in negatively regulating the functions of tumor suppressor p53. Here we show that MDM2 can inhibit Axin-stimulated p53-dependent apoptosis by suppressing p53 phosphorylation at Ser 46 and apoptosis-related p53 transactivational activity. Interestingly, the ubiquitin E3 ligase activity of MDM2 is not required for this inhibitory effect. Mechanically, either wildtype MDM2 or its E3-dead mutant, disrupts the Axin-based HIPK2/p53 complex formation by blocking the binding of p53 and HIPK2 to Axin. MDM2Δp53, a deletion mutant that lacks p53 binding domain fails to exert the inhibitory effect, demonstrating that the interaction of MDM2 and p53, but not its E3 ligase activity toward p53 plays key role in suppressing Axin-stimulated p53 activation. Our results thus have revealed a novel aspect of the mechanism by which MDM2 regulates p53 activities. PMID:23826318

  18. Accumulation of soluble and nucleolar-associated p53 proteins following cellular stress.


    Klibanov, S A; O'Hagan, H M; Ljungman, M


    The tumor suppressor p53 is a nucleocytoplasmic shuttling protein that accumulates in the nucleus of cells exposed to various cellular stresses. One important role of nuclear p53 is to mobilize a stress response by transactivating target genes such as the p21(Waf1) gene. In this study, we investigated more closely the localization of p53 in cells following various stresses. Immunocytochemistry of fixed human fibroblasts treated with either UV light, the kinase and transcription inhibitor DRB or the proteasome inhibitor MG132 revealed abundant p53 localized to the nucleus. When cells treated with UV or DRB were permeabilized prior to fixation to allow soluble proteins to diffuse, the nuclear p53 signal was abolished. However, in cells treated with MG132, residual p53 localized to distinct large foci. Furthermore, nucleolin co-localized with p53 to these foci, suggesting that these foci were nucleolar structures. Interestingly, the MDM2 protein was found to co-localize with p53 to nucleolar structures following proteasome inhibition. Our results suggest that the p53 proteins accumulating in the nucleus following UV-irradiation or blockage of transcription are freely soluble and, thus, should be able to roam the nucleus to ensure high occupancy of p53 binding sites. However, inhibition of proteasome activity may be a unique stress in that it leads to the sequestering of p53 proteins to the nucleolus, thereby blunting the p53-mediated transactivation of target genes. PMID:11329373

  19. p53 Promotes Cell Survival Due to the Reversibility of its Cell Cycle Checkpoints

    PubMed Central

    Lukin, Dana J.; Carvajal, Luis A.; Liu, Wen-jun; Resnick-Silverman, Lois; Manfredi, James J.


    The tumor suppressor p53 (TP53) has a well-studied role in triggering cell cycle checkpoint in response to DNA damage. Previous studies have suggested that functional p53 enhances chemosensitivity. In contrast, data are presented to show that p53 can be required for cell survival following DNA damage due to activation of reversible cell cycle checkpoints. The cellular outcome to DNA damage is determined by the duration and extent of the stimulus in a p53-dependent manner. In response to transient or low levels of DNA damage, p53 triggers a reversible G2 arrest whereas a sustained p53-dependent cell cycle arrest and senescence follows prolonged or high levels of DNA damage. Regardless of the length of treatment, p53-null cells arrest in G2, but ultimately adapt and proceed into mitosis. Interestingly, they fail to undergo cytokinesis, become multinucleated, and then die from apoptosis. Upon transient treatment with DNA damaging agents, wild-type p53 cells reversibly arrest and repair the damage, whereas p53-null cells fail to do so and die. These data indicate that p53 can promote cell survival by inducing reversible cell cycle arrest, thereby allowing for DNA repair. Thus, transient treatments may exploit differences between wild-type p53 and p53-null cells. PMID:25158956

  20. SnoN activates p53 directly to regulate aging and tumorigenesis.


    Pan, Deng; Zhu, Qingwei; Conboy, Michael J; Conboy, Irina M; Luo, Kunxin


    We have identified SnoN as a direct activator of p53 to accelerate aging and inhibit tumorigenesis. SnoN has been shown previously to promote proliferation and transformation by antagonizing TGFβ signaling. We show that elimination of this TGFβ antagonistic activity of SnoN in vivo results in accelerated aging and resistance to tumorigenesis. The SnoN knockin mice display a shortened lifespan, decreased reproductivity, osteoporosis, reduced regenerative capacity, and other aging phenotypes, similar to that found in mice expressing an active p53. These activities of SnoN rely on the ability of SnoN to activate p53. SnoN can bind directly to p53 and compete with Mdm2 for binding to p53, preventing p53 ubiquitination and degradation and additionally facilitating p53 acetylation and phosphorylation. SnoN also binds to p53 on the promoter of p53 responsive genes to promote transcription activation. This activation of p53 by SnoN is necessary for its antitumorigenic and progeria activities in vivo because elimination of one copy of p53 reverses the aging phenotypes and accelerates tumorigenesis. Thus, we have revealed a novel function of SnoN in regulating aging and tumorigenesis by directly activating p53. PMID:22805162

  1. Divergence between the high rate of p53 mutations in skin carcinomas and the low prevalence of anti-p53 antibodies

    PubMed Central

    Moch, C; Moysan, A; Lubin, R; Salmonière, P de La; Soufir, N; Galisson, F; Vilmer, C; Venutolo, E; Pelletier, F Le; Janin, A; Basset-Séguin, N


    Circulating anti-p53 antibodies have been described and used as tumoural markers in patients with various cancers and strongly correlate with the p53 mutated status of the tumours. No study has yet looked at the prevalence of such antibodies in skin carcinoma patients although these tumours have been shown to be frequently p53 mutated. Most skin carcinoma can be diagnosed by examination or biopsy, but aggressive, recurrent and/or non-surgical cases' follow up would be helped by a biological marker of residual disease. We performed a prospective study looking at the prevalence of anti-p53 antibodies using an ELISA technique in a series of 105 skin carcinoma patients in comparison with a sex- and age-matched control skin carcinoma-free group (n = 130). Additionally, p53 accumulation was studied by immunohistochemistry to confirm p53 protein altered expression in a sample of tumours. Anti-p53 antibodies were detected in 2.9% of the cases, with a higher prevalence in patients suffering from the more aggressive squamous cell type (SCC) of skin carcinoma (8%) than for the more common and slowly growing basal cell carcinoma type or BCC (1.5%). p53 protein stabilization could be confirmed in 80% of tumours studied by IHC. This low level of anti-p53 antibody detection contrasts with the high rate of p53 mutations reported in these tumours. This observation shows that the anti-p53 humoral response is a complex and tissue-specific mechanism. © 2001 Cancer Research Campaign PMID:11747330

  2. cIAP2 represses IKKα/β-mediated activation of MDM2 to prevent p53 degradation.


    Lau, Rosanna; Niu, Min Ying; Pratt, M A Christine


    Cellular inhibitor of apoptosis proteins (cIAP1 and cIAP2) function to prevent apoptosis and are often overexpressed in various cancers. However, mutations in cIAP1/2 can activate the alternative NFκB pathway through IκBα-kinase-α (IKKα) and are associated with hematopoetic malignancies. In the current study, we found that knockdown of cIAP2 in human mammary epithelial cells resulted in activation of MDM2 through increased SUMOylation and profound reduction of the pool of MDM2 not phosphorylated at Ser166. cIAP2 siRNA markedly decreased p53 levels, which were rescued by addition of the MDM2 inhibitor, Nutlin3a. An IAP antagonist, which induces cIAP degradation, transiently increased MDM2 mRNA. Simultaneous transfection of siRNA for cIAP2 and IKKα reduced MDM2 protein, while expression of a kinase-dead IKKβ strongly increased non-Ser166 P-MDM2. Inhibition of either IKKα or -β partially rescued p53 levels, while concomitant IKKα/β inhibition fully rescued p53 after cIAP2 knockdown. Surprisingly, IKKα knockdown alone increased SUMO-MDM2, suggesting that in the absence of activation, IKKα can prevent MDM2 SUMOylation. cIAP2 knockdown disrupted the interaction between the MDM2 SUMO ligase, PIAS1 and IKKα. Partial knockdown of cIAP2 cooperated with (V12) H-ras-transfected mammary epithelial cells to enhance colony formation. In summary, our data identify a novel role for cIAP2 in maintaining wild-type p53 levels by preventing both an NFκB-mediated increase and IKKα/-β-dependent transcriptional and post-translational modifications of MDM2. Thus, mutations or reductions in cIAP2 could contribute to cancer promotion, in part, through downregulation of p53. PMID:23032264

  3. Hepatic IGFBP1 is a prosurvival factor that binds to BAK, protects the liver from apoptosis, and antagonizes the proapoptotic actions of p53 at mitochondria

    PubMed Central

    Leu, J. I-Ju; George, Donna L.


    Liver is generally refractory to apoptosis induced by the p53 tumor suppressor protein, but the molecular basis remains poorly understood. Here we show that p53 transcriptional activation leads to enhanced expression of hepatic IGFBP1 (insulin-like growth factor-binding protein-1). Exhibiting a previously unanticipated role, a portion of intracellular IGFBP1 protein localizes to mitochondria where it binds to the proapoptotic protein BAK and hinders BAK activation and apoptosis induction. Interestingly, in many cells and tissues p53 also has a direct apoptotic function at mitochondria that includes BAK binding and activation. When IGFBP1 is in a complex with BAK, formation of a proapoptotic p53/BAK complex and apoptosis induction are impaired, both in cultured cells and in liver. In contrast, livers of IGFBP1-deficient mice exhibit spontaneous apoptosis that is accompanied by p53 mitochondrial accumulation and evidence of BAK oligomerization. These data support the importance of BAK as a mediator of p53’s mitochondrial function. The results also identify IGFBP1 as a negative regulator of the BAK-dependent pathway of apoptosis, whose expression integrates the transcriptional and mitochondrial functions of the p53 tumor suppressor protein. PMID:18056423

  4. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein.


    Bromley, Dennis; Bauer, Matthias R; Fersht, Alan R; Daggett, Valerie


    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be 'rescued' and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

  5. Immunohistochemical detection of p53 in Wilms' tumors correlates with unfavorable outcome.

    PubMed Central

    Lahoti, C.; Thorner, P.; Malkin, D.; Yeger, H.


    The role of p53 in the pathogenesis and progression of Wilms' tumors is only partly understood. Although p53 mutations were initially reported only in anaplastic Wilms' tumors, we had reported that, of two of twenty-one cases that had a p53 mutation, one tumor showed no evidence of anaplasia. To determine the significance of p53 expression in all clinical stages of Wilms' tumor, twenty-eight cases were analyzed for p53 immunoreactivity. Paraffin sections were immunolabeled with two different monoclonal antibodies, recognizing both mutant and wild-type p53. Fifteen of sixteen tumors in the recurrent/metastatic group and three of twelve tumors in the nonmetastatic/nonrecurrent group showed p53 immunopositivity. Only one of three positive tumors in the latter group showed moderate to strong positivity, whereas twelve of sixteen metastatic/recurrent tumors revealed a similar degree of p53 positivity. The positivity was stronger in the metastasis/recurrences as compared with the corresponding primary tumor. Western blot analysis revealed p53 expression in all of the Wilms' tumors tested, suggesting its involvement in the development of Wilms' tumors. Single-strand conformation polymorphism analysis performed on twenty-three of these tumors revealed p53 mutations in four of fourteen recurrent/metastatic tumors and none in the nonmetastatic/nonrecurrent group. Our results show that, whereas 60% of cases were immunopositive for p53 protein, mutations were detected in only 16% of tumors, indicating that wild-type p53 protein is retained in the other tumors. We conclude that p53 immunopositivity strongly correlates with recurrence/metastasis in Wilms' tumors. Furthermore, the accumulation of p53 in these tumors is not only due to mutations but may also involve stabilization of normal p53 with other proteins. Images Figure 1 Figure 2 Figure 3 PMID:8623926

  6. Cardiac glycosides inhibit p53 synthesis by a mechanism relieved by Src or MAPK inhibition

    PubMed Central

    Wang, Zhen; Zheng, Min; Li, Zhichuan; Li, Ruiguo; Jia, Lijun; Xiong, Xiufang; Southall, Noel; Wang, Shaomeng; Xia, Menghang; Austin, Christopher P.; Zheng, Wei; Xie, Zijian; Sun, Yi


    p53 is regulated at the multiple levels. We report here that p53 in multiple lines of human cancer cells is down-regulated by cardiac glycoside drugs, digoxin or ouabain, the potent inhibitors of Na+/K+-ATPase. These drugs reduced the basal levels of p53 protein at nanomolar concentrations in a dose-, time- and cancer cell line-dependent manner, but independent of p53 status of wild type (wt) or mutant. The drugs also reduced the levels of p53 induced by its activators as well as p53 transfected into human cancer cells, regardless of its status. Interestingly, the drugs had no effect on endogenous p53 in two immortalized human cell lines. Mechanistically, p53 reduction did not occur at the mRNA levels, but at the protein levels, as a result of reduced protein synthesis rather than enhanced degradation. The cellular sensitivity to drug-induced p53 reduction was not associated with the levels of α subunits of Na+/K+-ATPase in different cell lines. While lowering extracellular K+ did not reduce p53 as did ouabain and digoxin, it did potentiate both digoxin and ouabain-induced p53 reduction in sensitive lines. Finally, p53 reduction appears to be triggered by activation of Src/MAPK signaling pathways upon drug binding to the Na+/K+-ATPase and can be completely blocked by the inhibitors of Src or MEK. This is the first report that cardiac glycoside drugs, by initiating the Src/MAPK signaling pathways, reduce the p53 levels via inhibition of p53 protein synthesis. The drugs may be useful in the treatment of human cancers with a gain-of-function p53 mutation. PMID:19679550

  7. Reversible induction of translational isoforms of p53 in glucose deprivation

    PubMed Central

    Khan, D; Katoch, A; Das, A; Sharathchandra, A; Lal, R; Roy, P; Das, S; Chattopadhyay, S; Das, S


    Tumor suppressor protein p53 is a master transcription regulator, indispensable for controlling several cellular pathways. Earlier work in our laboratory led to the identification of dual internal ribosome entry site (IRES) structure of p53 mRNA that regulates translation of full-length p53 and Δ40p53. IRES-mediated translation of both isoforms is enhanced under different stress conditions that induce DNA damage, ionizing radiation and endoplasmic reticulum stress, oncogene-induced senescence and cancer. In this study, we addressed nutrient-mediated translational regulation of p53 mRNA using glucose depletion. In cell lines, this nutrient-depletion stress relatively induced p53 IRES activities from bicistronic reporter constructs with concomitant increase in levels of p53 isoforms. Surprisingly, we found scaffold/matrix attachment region-binding protein 1 (SMAR1), a predominantly nuclear protein is abundant in the cytoplasm under glucose deprivation. Importantly under these conditions polypyrimidine-tract-binding protein, an established p53 ITAF did not show nuclear-cytoplasmic relocalization highlighting the novelty of SMAR1-mediated control in stress. In vivo studies in mice revealed starvation-induced increase in SMAR1, p53 and Δ40p53 levels that was reversible on dietary replenishment. SMAR1 associated with p53 IRES sequences ex vivo, with an increase in interaction on glucose starvation. RNAi-mediated-transient SMAR1 knockdown decreased p53 IRES activities in normal conditions and under glucose deprivation, this being reflected in changes in mRNAs in the p53 and Δ40p53 target genes involved in cell-cycle arrest, metabolism and apoptosis such as p21, TIGAR and Bax. This study provides a new physiological insight into the regulation of this critical tumor suppressor in nutrient starvation, also suggesting important functions of the p53 isoforms in these conditions as evident from the downstream transcriptional target activation. PMID:25721046

  8. PPM1D phosphatase, a target of p53 and RBM38 RNA-binding protein, inhibits p53 mRNA translation via dephosphorylation of RBM38

    PubMed Central

    Zhang, Min; Xu, Enshun; Zhang, Jin; Chen, Xinbin


    PPM1D phosphatase, also called wild-type p53-induced phosphatase 1 (Wip1), promotes tumor development by inactivating the p53 tumor suppressor pathway. RBM38 RNA-binding protein, also called RNPC1 and a target of p53, inhibits p53 mRNA translation, which can be reversed by GSK3 protein kinase via phosphorylation of RBM38 at serine 195. Here we showed that ectopic expression of RBM38 increases, whereas knockdown of RBM38 inhibits, PPM1D mRNA translation. Consistent with this, we found that RBM38 directly binds to PPM1D 3' untranslated region (3’UTR) and promotes expression of a heterologous reporter gene that carries PPM1D 3’UTR in a dose-dependent manner. Interestingly, we showed that PPM1D directly interacts with and dephosphorylates RBM38 at serine 195. Furthermore, we showed that PPM1D modulates p53 mRNA translation and p53-dependent growth suppression through dephosphorylation of RBM38. These findings provide evidence that the crosstalk between PPM1D and RBM38, both of which are targets and modulators of p53, plays a critical role in p53 expression and activity. PMID:25823026

  9. Aspirin acetylates wild type and mutant p53 in colon cancer cells: identification of aspirin acetylated sites on recombinant p53.


    Ai, Guoqiang; Dachineni, Rakesh; Kumar, D Ramesh; Marimuthu, Srinivasan; Alfonso, Lloyd F; Bhat, G Jayarama


    Aspirin's ability to inhibit cell proliferation and induce apoptosis in cancer cell lines is considered to be an important mechanism for its anti-cancer effects. We previously demonstrated that aspirin acetylated the tumor suppressor protein p53 at lysine 382 in MDA-MB-231 human breast cancer cells. Here, we extended these observations to human colon cancer cells, HCT 116 harboring wild type p53, and HT-29 containing mutant p53. We demonstrate that aspirin induced acetylation of p53 in both cell lines in a concentration-dependent manner. Aspirin-acetylated p53 was localized to the nucleus. In both cell lines, aspirin induced p21(CIP1). Aspirin also acetylated recombinant p53 (rp53) in vitro suggesting that it occurs through a non-enzymatic chemical reaction. Mass spectrometry analysis and immunoblotting identified 10 acetylated lysines on rp53, and molecular modeling showed that all lysines targeted by aspirin are surface exposed. Five of these lysines are localized to the DNA-binding domain, four to the nuclear localization signal domain, and one to the C-terminal regulatory domain. Our results suggest that aspirin's anti-cancer effect may involve acetylation and activation of wild type and mutant p53 and induction of target gene expression. This is the first report attempting to characterize p53 acetylation sites targeted by aspirin. PMID:26596838

  10. p53MutaGene: an online tool to estimate the effect of p53 mutational status on gene regulation in cancer

    PubMed Central

    Amelio, I; Knight, R A; Lisitsa, A; Melino, G; Antonov, A V


    p53MutaGene is the first online tool for statistical validation of hypotheses regarding the effect of p53 mutational status on gene regulation in cancer. This tool is based on several large-scale clinical gene expression data sets and currently covers breast, colon and lung cancers. The tool detects differential co-expression patterns in expression data between p53 mutated versus p53 normal samples for the user-specified genes. Statistically significant differential co-expression for a gene pair is indicative that regulation of two genes is sensitive to the presence of p53 mutations. p53MutaGene can be used in ‘single mode' where the user can test a specific pair of genes or in ‘discovery mode' designed for analysis of several genes. Using several examples, we demonstrate that p53MutaGene is a useful tool for fast statistical validation in clinical data of p53-dependent gene regulation patterns. The tool is freely available at PMID:26986515

  11. Genome-scale functional analysis of the human genes modulating p53 activity by regulating MDM2 expression in a p53-independent manner.


    Kim, Dong Min; Choi, Seung-Hyun; Yeom, Young Il; Min, Sang-Hyun; Kim, Il-Chul


    MDM2, a critical negative regulator of p53, is often overexpressed in leukemia, but few p53 mutations are found, suggesting that p53-independent MDM2 expression occurs due to alterations in MDM2 upstream regulators. In this study, a high MDM2 transcription level was observed (41.17%) regardless of p53 expression in patient with acute myeloid leukemia (AML). Therefore, we performed genome-scale functional screening of the human genes modulating MDM2 expression in a p53-independent manner. We searched co-expression profiles of genes showing a positive or negative pattern with MDM2 expression in a DNA microarray database, selected1089 links, and composed a screening library of 368 genes. Using MDM2 P1 and P2 promoter-reporter systems, we screened clones regulating MDM2 transcriptions in a p53-independent manner by overexpression. Nine clones from the screening library showed enhanced MDM2 promoter activity and MDM2 expression in p53-deficient HCT116 cells. Among them, six clones, including NTRK2, GNA15, SFRS2, EIF5A, ELAVL1, and YWHAB mediated MAPK signaling for expressing MDM2. These results indicate that p53-independent upregulation of MDM2 by increasing selected clones may lead to oncogenesis in AML and that MDM2-modulating genes are novel potential targets for AML treatment. PMID:27524244

  12. The novel partnership of L-GILZ and p53: a new affair in cancer?

    PubMed Central

    Ayroldi, Emira; Marchetti, Cristina; Riccardi, Carlo


    A recent report from our laboratory reveals how long glucocorticoid-induced leucine zipper (L-Gilz) protein binds to p53 and mouse double minute 2 homolog (Mdm2), thus dissociating the p53/Mdm2 complex and activating p53 with subsequent activation of downstream genes p21 and p53 upregulated modulator of apoptosis (Puma). p53 activation appears to be the mechanism by which both basal and glucocorticoid (GC)-induced L-Gilz inhibits proliferation and induces antioncogenic activity in human cancer. PMID:27308427

  13. The anti-leukemic activity of sodium dichloroacetate in p53mutated/null cells is mediated by a p53-independent ILF3/p21 pathway

    PubMed Central

    Agnoletto, Chiara; Brunelli, Laura; Melloni, Elisabetta; Pastorelli, Roberta; Casciano, Fabio; Rimondi, Erika; Rigolin, Gian Matteo; Cuneo, Antonio; Secchiero, Paola; Zauli, Giorgio


    B-chronic lymphocytic leukemia (B-CLL) patients harboring p53 mutations are invariably refractory to therapies based on purine analogues and have limited treatment options and poor survival. Having recently demonstrated that the mitochondria-targeting small molecule sodium dichloroacetate (DCA) exhibits anti-leukemic activity in p53wild-type B-CLL cells, the aim of this study was to evaluate the effect of DCA in p53mutated B-CLL cells and in p53mutated/null leukemic cell lines. DCA exhibited comparable cytotoxicity in p53wild-type and p53mutated B-CLL patient cell cultures, as well as in p53mutated B leukemic cell lines (MAVER, MEC-1, MEC-2). At the molecular level, DCA promoted the transcriptional induction of p21 in all leukemic cell types investigated, including p53null HL-60. By using a proteomic approach, we demonstrated that DCA up-regulated the ILF3 transcription factor, which is a known regulator of p21 expression. The role of the ILF3/p21 axis in mediating the DCA anti-leukemic activity was underscored by knocking-down experiments. Indeed, transfection with ILF3 and p21 siRNAs significantly decreased both the DCA-induced p21 expression and the DCA-mediated cytotoxicity. Taken together, our results emphasize that DCA is a small molecule that merits further evaluation as a therapeutic agent also for p53mutated leukemic cells, by acting through the induction of a p53-independent pathway. PMID:25544776

  14. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.


    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R


    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells. PMID:27551077

  15. Regulation of myo-inositol biosynthesis by p53-ISYNA1 pathway.


    Koguchi, Tomoyuki; Tanikawa, Chizu; Mori, Jinichi; Kojima, Yoshiyuki; Matsuda, Koichi


    In response to various cellular stresses, p53 exerts its tumor suppressive effects such as apoptosis, cell cycle arrest, and senescence through the induction of its target genes. Recently, p53 was shown to control cellular homeostasis by regulating energy metabolism, glycolysis, antioxidant effect, and autophagy. However, its function in inositol synthesis was not reported. Through a microarray screening, we found that five genes related with myo-inositol metabolism were induced by p53. DNA damage enhanced intracellular myo-inositol content in HCT116 p53+/+ cells, but not in HCT116 p53-/- cells. We also indicated that inositol 3-phosphate synthase (ISYNA1) which encodes an enzyme essential for myo-inositol biosynthesis as a direct target of p53. Activated p53 regulated ISYNA1 expression through p53 response element in the seventh exon. Ectopic ISYNA1 expression increased myo-inositol levels in the cells and suppressed tumor cell growth. Knockdown of ISYNA1 caused resistance to adriamycin treatment, demonstrating the role of ISYNA1 in p53-mediated growth suppression. Furthermore, ISYNA1 expression was significantly associated with p53 mutation in bladder, breast cancer, head and neck squamous cell carcinoma, lung squamous cell carcinoma, and pancreatic adenocarcinoma. Our findings revealed a novel role of p53 in myo-inositol biosynthesis which could be a potential therapeutic target. PMID:27035231

  16. Negative Regulation of Tumor Suppressor p53 by microRNA miR-504

    PubMed Central

    Hu, Wenwei; Chan, Chang S.; Wu, Rui; Zhang, Cen; Sun, Yvonne; Song, Jun S.; Tang, Laura H.; Levine, Arnold J.; Feng, Zhaohui


    Summary Tumor suppressor p53 plays a central role in tumor prevention. p53 protein levels and activity are under a tight and complex regulation in cells to maintain the proper function of p53. microRNAs play a key role in the regulation of gene expression. Here we report the regulation of p53 through microRNA miR-504. miR-504 acts as a negative regulator of human p53 through its direct binding to two sites in p53 3′-UTR. Overexpression of miR-504 decreases p53 protein levels and functions in cells, including p53 transcriptional activity, p53-mediated apoptosis and cell cycle arrest in response to stress, and furthermore, promotes tumorigenecity of cells in vivo. These results demonstrate the direct negative regulation of p53 by miR-504 as a mechanism for p53 regulation in cells, which highlights the importance of microRNAs in tumorigenesis. PMID:20542001

  17. 9-Hydroxyellipticine alters the conformation and DNA binding characteristics of mutated p53 protein.


    Sugikawa, E; Tsunoda, S; Nakanishi, N; Ohashi, M


    The tumor suppressor protein p53 is a phosphoprotein which shows growth and transformation suppression functions. Mutational loss of p53 function is the most frequently detected genetic event in human cancers. We examined whether 9-hydroxyellipticine (9HE), a cytotoxic agent, affected the tertiary structure of mutant p53 and DNA binding characteristics. Although several types of p53 mutants were resistant to degradation by calpain, the p53 mutants treated with 9HE were markedly sensitive to calpain as well as wild-type p53. Furthermore, mutant p53 proteins isolated from 9HE-treated cells regained the ability to bind a wild-type-specific p53 DNA consensus sequence. Wild-type p53 proteins prepared from both untreated and 9HE-treated cells bound the p53 consensus sequence and were degradaded by calpain equally well. These results suggest that 9HE affects the tertiary structure of mutated p53, which results in the restoration of DNA binding characteristics. PMID:11724337

  18. Altered p53 in microdissected, metachronous, premalignant and malignant oral lesions from the same patients

    PubMed Central

    Li, Y-Q; Pavelic, Z P; Wang, L-J; McDonald, J S; Gleich, L; Munck-Wikland, E; Dacic, S; Danilovic, Z; Pavelic, L J; Wilson, K M; Gluckman, J L; Stambrook, P J


    Aims—To determine whether mutant p53 alleles harboured by malignant tumours of the oral cavity were also present in previous premalignant lesions at the same site. Methods—Paraffin embedded tumour specimens along with their premalignant counterparts were analysed for p53 alterations using immunohistochemistry, microdissection, polymerase chain reaction amplification, and DNA sequencing. Results—Malignant lesions from five of eight patients showed overexpression of p53 protein by immunohistochemistry. Upon DNA sequencing, two of these five specimens had p53 mutations. Of the five patients whose cancers showed p53 overexpression by immunohistochemistry, three had previous premalignant lesions that also had immunohistochemically detectable p53 protein. However, DNA sequencing showed that none of these three had mutations in the p53 gene. The remaining five premalignant lesions had no immunohistochemically detectable p53 protein. Conclusions—Some premalignant lesions have increased p53 protein which can be detected by staining with antibody to p53. This staining is not caused by mutations in p53 that are found in subsequent tumours at the same site. Images PMID:16696020

  19. Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.


    Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi


    Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality. PMID:26334721

  20. Microarray and ChIP-seq data analysis revealed changes in p53-mediated transcriptional regulation in Nutlin-3-treated U2OS cells

    PubMed Central



    Integrative analysis of chromatin immunoprecipitation-sequencing (ChIP-seq) data and microarray data was performed to illustrate the effect of Nutlin-3 on promoter selectivity and transcriptional regulation by the tumor suppressor p53 in U2OS human osteosarcoma cells. Raw data (accession number, GSE46642) were downloaded from Gene Expression Omnibus. Differential analyses were performed using package limma of R software. Gene ontology enrichment and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed for the differentially expressed genes (DEGs) using the Database for Annotation, Visualization and Integration Discovery. Integrative analysis of ChIP-seq data and microarray data were confirmed with ChIP-Array. A total of 565 DEGs were identified, including 373 upregulated genes and 192 downregulated genes. Genes involved in the p53 signaling pathway, cell cycle, DNA replication, cytokine-cytokine receptor interaction and melanoma were markedly over-represented in the DEGs. A total of 39 DEGs were directly regulated by p53 and two were the transcription factors (TFs), E2F2 and HOXA1. E2F2 regulated 25 DEGs, while HOXA1 regulated one DEG. The cell cycle, p53 signaling pathway, melanoma and pathways involved in cancer were enriched in the direct and indirect target genes. Changes in the p53-binding pattern induced by Nutlin-3 were described in the present study, which may advance the understanding of the regulatory network of p53 in osteosarcoma and aid in the development of novel therapies. PMID:26080812

  1. Stress-dependent nucleolin mobilization mediated by p53-nucleolin complex formation.


    Daniely, Yaron; Dimitrova, Diana D; Borowiec, James A


    We recently discovered that heat shock causes nucleolin to relocalize from the nucleolus to the nucleoplasm, whereupon it binds replication protein A and inhibits DNA replication initiation. We report that nucleolin mobilization also occurs following exposure to ionizing radiation (IR) and treatment with camptothecin. Mobilization was selective in that another nucleolar marker, upstream binding factor, did not relocalize in response to IR. Nucleolin relocalization was dependent on p53 and stress, the latter initially stimulating nucleolin-p53 complex formation. Nucleolin relocalization and complex formation in vivo were independent of p53 transactivation but required the p53 C-terminal regulatory domain. Nucleolin and p53 also interact directly in vitro, with a similar requirement for p53 domains. These data indicate a novel p53-dependent mechanism in which cell stress mobilizes nucleolin for transient replication inhibition and DNA repair. PMID:12138209

  2. Crosstalk between tumor suppressors p53 and PKCδ: Execution of the intrinsic apoptotic pathways.


    Dashzeveg, Nurmaa; Yoshida, Kiyotsugu


    p53 and PKCδ are tumor suppressors that execute apoptotic mechanisms in response to various cellular stresses. p53 is a transcription factor that is frequently mutated in human cancers; it regulates apoptosis in transcription-dependent and -independent ways in response to genotoxic stresses. PKCδ is a serine/threonine protein kinase and mutated in human cancers. Available evidence shows that PKCδ activates p53 by direct and/or indirect mechanisms. Moreover, PKCδ is also implicated in the transcriptional regulation of p53 in response to DNA damage. Recent findings demonstrated that p53, in turn, binds onto the PKCδ promoter and induces its expression upon DNA damage to facilitate apoptosis. Both p53 and PKCδ are associated with the apoptotic mechanisms in the mitochondria by regulating Bcl-2 family proteins to provide mitochondrial outer membrane permeabilization. This review discusses the crosstalk between p53 and PKCδ in the context of apoptotic cell death and cancer therapy. PMID:27130668

  3. PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence

    PubMed Central

    Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues


    Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773

  4. [p53 activation by PI-3K family kinases after DNA double-strand breaks].


    Pernin, D; Uhrhammer, N; Verrelle, P; Bignon, Y J; Bay, J O


    p53 plays a central role in the cellular response to DNA double-strand breaks (DSBs), and to DNA damage in general. The protein kinases ATM, ATR and DNA-PK detect DSBs and transmit this information to p53 by phosphorylation. This phosphorylation dissociates p53 from its negative regulator, mdm2. p53 then undergoes further modification and activates transcription of the genes responsible for cell cycle arrest. In certain circumstances, p53 also activates transcription of the genes responsible for apoptosis. The dysfunction of this cascade of events is oncogenic, with P53 itself being the most commonly mutated gene in malignant cells, although mutations in both the DNA damage sensors and cell cycle checkpoint and apoptosis effectors are frequent. A more complete understanding of p53 and the proteins it interacts with may allow the development of new cancer treatments. PMID:11038413

  5. p53 and Cell Cycle Effects After DNA Damage

    PubMed Central

    Senturk, Emir; Manfredi, James J.


    Flow cytometry, a valuable technique that employs the principles of light scattering, light excitation, and emission of fluorochrome molecules, can be used to assess the cell cycle position of individual cells based on DNA content. After the permeabilization of cells, the DNA can be stained with a fluorescent dye. Cells which have a 2N amount of DNA can be distinguished from cells with a 4N amount of DNA, making flow cytometry a very useful tool for the analysis of cell cycle checkpoints following DNA damage. A critical feature of the cellular response to DNA damage is the ability to pause and repair the damage so that consequential mutations are not passed along to daughter generations of cells. If cells arrest prior to DNA replication, they will contain a 2N amount of DNA, whereas arrest after replication but before mitosis will result in a 4N amount of DNA. Using this technique, the role that p53 plays in cell cycle checkpoints following DNA damage can be evaluated based on changes in the profile of the G1, S, and G2/M phases of the cell cycle. PMID:23150436

  6. The tumor suppressor, p53 regulates the γA-crystallin gene during mouse lens development.


    Hu, X-H; Nie, Q; Yi, M; Li, T-T; Wang, Z-F; Huang, Z-X; Gong, X-D; Zhou, L; Ji, W-K; Hu, W-F; Liu, J-F; Wang, L; Woodward, Z; Zhu, J; Liu, W-B; Nguyen, Q D; Li, D W-C


    The tumor suppressor, p53 regulates a large number of target genes to control cell proliferation and apoptosis. In addition, it is also implicated in the regulation of cell differentiation in muscle, the circulatory system and various carcinoma tissues. We have recently shown that p53 also controls lens differentiation. Regarding the mechanism, we reveal that p53 directly regulates several genes including c-Maf and Prox1, two important transcription factors for lens differentiation, and αA and βA3/A1, the lens differentiation markers. In the present study, we present evidence to show that the γA-crystallin gene distal promoter and the first intron also contain p53 binding sites and are capable of mediating p53 control during mouse lens development. First, gel mobility shifting assays revealed that the p53 protein in nuclear extracts from human lens epithelial cells (HLE) directly binds to the p53 binding sites present in the γA-crystallin gene. Second, the exogenous wild type p53 induces the dose-dependent expression of the luciferase reporter gene driven by the basic promoter containing the γA-crystallin gene p53 binding site. In contrast, the exogenous dominant negative mutant p53 causes a dose-dependent inhibition of the same promoter. Third, ChIP assays revealed that p53 binds to the γA-crystallin gene promoter in vivo. Finally, in the p53 knockout mouse lenses, the expression level of the γAcrystallin gene was found attenuated in comparison with that in the wild type mouse lenses. Together, our results reveal that p53 regulates γA-crystallin gene expression during mouse lens development. Thus, p53 directly regulates all 3 types of crystallin genes to control lens differentiation. PMID:25336329

  7. BAC transgenic mice provide evidence that p53 expression is highly regulated in vivo

    PubMed Central

    Chen, L; Zhang, G X; Zhou, Y; Zhang, C X; Xie, Y Y; Xiang, C; He, X Y; Zhang, Q; Liu, G


    p53 is an important tumor suppressor and stress response mediator. Proper control of p53 level and activity is tightly associated with its function. Posttranslational modifications and the interactions with Mdm2 and Mdm4 are major mechanisms controlling p53 activity and stability. As p53 protein is short-lived and hardly detectable in unstressed situations, less is known on its basal level expression and the corresponding controlling mechanisms in vivo. In addition, it also remains obscure how p53 expression might contribute to its functional regulation. In this study, we established bacterial artificial chromosome transgenic E.coli β-galactosidase Z gene reporter mice to monitor p53 expression in mouse tissues and identify important regulatory elements critical for the expression in vivo. We revealed preferentially high level of p53 reporter expressions in the proliferating, but not the differentiated compartments of the majority of tissues during development and tissue homeostasis. In addition, tumors as well as regenerating tissues in the p53 reporter mice also expressed high level of β-gal. Furthermore, both the enhancer box sequence (CANNTG) in the p53 promoter and the 3′ terminal untranslated region element were critical in mediating the high-level expression of the reporter. We also provided evidence that cellular myelocytomatosis oncogene was a critical player regulating p53 mRNA expression in proliferating cells and tissues. Finally, we found robust p53 activation preferentially in the proliferating compartment of mouse tissues upon DNA damage and the proliferating cells exhibited an enhanced p53 response as compared with cells in a quiescent state. Together, these results suggested a highly regulated expression pattern of p53 in the proliferating compartment controlled by both transcriptional and posttranscriptional mechanisms, and such regulated p53 expression may impose functional significance upon stress by setting up a precautionary mode in

  8. Characterization of p53 mutations in colorectal liver metastases and correlation with clinical parameters.


    Tullo, A; D'Erchia, A M; Honda, K; Mitry, R R; Kelly, M D; Habib, N A; Saccone, C; Sbisà, E


    The presence and type of mutations of the p53 tumor suppressor gene were determined in 40 patients undergoing curative hepatic resection for metastatic colorectal carcinoma. This represents the largest series in the literature on the screening of p53 mutations for liver metastases. The analysis was performed in exons 5-9 by denaturing gradient gel electrophoresis followed by direct sequencing. Forty-five percent of tumors showed mutation in p53, and this was observed only in exons 5-8. Mutations at codon positions 167, 196, 204, 213, 245, 281, 282, 286, and 306; deletion of codon 251 and of the first nucleotide of codon 252; and Leu residue (CTC) insertion downstream codon 252 are reported for the first time in colorectal liver metastasis. Mutations at codon positions 163, 248, and 273 have been reported previously. Correlation of p53 status with clinical parameters showed that patients with mutated p53 had a statistically higher number of lesions when compared with patients with wild-type p53 (P<0.050). In particular, of patients with mutated p53, 41% had three or more metastases compared with 14% of patients with wild-type p53. Synchronous metastases were present in 70% of the patients with p53 mutations and in only 29% of patients with wild-type p53 (P<0.025). In addition, patients with p53 mutations are more likely to develop recurrence (73%) compared with patients with wild-type p53 (33%; P<0.001). Other factors considered, including preoperative carcinoembryonic antigen level, bilobar distribution, and size of the lesion(s), did not show significant correlation with p53 status. These results suggest that p53 status might be an important prognostic indicator to predict the pattern and likelihood of treatment failure after hepatic resection. PMID:10589767

  9. Controlled Access of p53 to the Nucleus Regulates its Proteasomal Degradation by MDM2

    PubMed Central

    Davis, James R.; Mossalam, Mohanad; Lim, Carol S.


    The tumor suppressor p53 can be sent to the proteasome for degradation by placing its nucleo-cytoplasmic shuttling under ligand control. Endogenous p53 is ubiquitinated by MDM2 in the nucleus, and controlling the access of p53 to the nuclear compartment regulates its ubiquitination and proteasomal degradation. This was accomplished by the use of a “protein switch” that places nuclear translocation under the control of externally applied dexamethasone. Fluorescence microscopy revealed that sending protein switch p53 (PS-p53) to the nucleus produces a distinct punctate distribution in both the cytoplasm and nucleus. The nuclear role in accessing the proteasome was investigated by inhibiting classical nuclear export with leptomycin B. Trapping PS-p53 in the nucleus only allows this punctate staining in that compartment, suggesting that PS-p53 must translocate first to the nuclear compartment for cytoplasmic punctate staining to occur. The role of MDM2 binding was explored by inhibiting MDM2/p53 binding with nutlin-3. Inhibition of this interaction blocked both nuclear export and cytoplasmic and nuclear punctate staining, providing evidence that any change in localization after nuclear translocation is due to MDM2 binding. Further, blocking the proteolytic activity of the proteasome maintained the nuclear localization of the construct. Truncations of p53 were made to determine smaller constructs still capable of interacting with MDM2, and their subcellular localization and degradation potential was observed. PS-p53 and a smaller construct, construct containing the two MDM2 binding regions of p53 (Box I+V) were indeed degraded by the proteasome as measured by loss of enhanced green fluorescent protein that was also fused to the construct. The influence of these constructs on p53 gene transactivation function was assessed, and revealed that PS-p53 decreased gene transactivation, while PS-p53(BoxI+V) did not significantly change baseline gene transactivation. PMID

  10. Combined loss of PUMA and p21 accelerates c-MYC-driven lymphoma development considerably less than loss of one allele of p53.


    Valente, L J; Grabow, S; Vandenberg, C J; Strasser, A; Janic, A


    The tumor suppressor p53 is mutated in ~50% of human cancers. P53 is activated by a range of stimuli and regulates several cellular processes, including apoptotic cell death, cell cycle arrest, senescence and DNA repair. P53 induces apoptosis via transcriptional induction of the BH3-only proteins PUMA (p53-upregulated modulator of apoptosis) and NOXA, and cell cycle arrest via p21. Induction of these processes was proposed to be critical for p53-mediated tumor suppression. It is therefore surprising that mice lacking PUMA, NOXA and p21, as well as mice bearing mutations in p53 that impair the transcriptional activation of these genes, are not tumor prone, unlike mice lacking p53 function, which spontaneously develop tumors with 100% incidence. These p53 target genes and the processes they regulate may, however, impact differently on tumor development depending on the oncogenic drivers. For example, loss of PUMA enhances c-MYC-driven lymphoma development in mice, but, interestingly, the acceleration was less impressive compared with that caused by the loss of even a single p53 allele. Different studies have reported that loss of p21 can accelerate, delay or have no impact on tumorigenesis. In an attempt to resolve this controversy, we examined whether loss of p21-mediated cell cycle arrest cooperates with PUMA deficiency in accelerating lymphoma development in Eμ-Myc mice (overexpressing c-MYC in B-lymphoid cells). We found that Eμ-Myc mice lacking both p21 and PUMA (Eμ-Myc;Puma(-/-);p21(-/-)) developed lymphoma at a rate comparable to Eμ-Myc;Puma(-/-) animals, notably with considerably longer latency than Eμ-Myc;p53(+/-)mice. Loss of p21 had no impact on the numbers, cycling or survival of pre-leukemic Eμ-Myc B-lymphoid cells, even when PUMA was lost concomitantly. These results demonstrate that even in the context of deregulated c-MYC expression, p53 must suppress tumor development by activating processes apart from, or in addition to, PUMA

  11. Hyperactivation of ATM upon DNA-PKcs inhibition modulates p53 dynamics and cell fate in response to DNA damage.


    Finzel, Ana; Grybowski, Andrea; Strasen, Jette; Cristiano, Elena; Loewer, Alexander


    A functional DNA damage response is essential for maintaining genome integrity in the presence of DNA double-strand breaks. It is mainly coordinated by the kinases ATM, ATR, and DNA-PKcs, which control the repair of broken DNA strands and relay the damage signal to the tumor suppressor p53 to induce cell cycle arrest, apoptosis, or senescence. Although many functions of the individual kinases have been identified, it remains unclear how they act in concert to ensure faithful processing of the damage signal. Using specific inhibitors and quantitative analysis at the single-cell level, we systematically characterize the contribution of each kinase for regulating p53 activity. Our results reveal a new regulatory interplay in which loss of DNA-PKcs function leads to hyperactivation of ATM and amplification of the p53 response, sensitizing cells for damage-induced senescence. This interplay determines the outcome of treatment regimens combining irradiation with DNA-PKcs inhibitors in a p53-dependent manner. PMID:27280387

  12. Chk2 and p53 Are Haploinsufficient with Dependent and Independent Functions to Eliminate Cells after Telomere Loss

    PubMed Central

    Xie, Heng B.; Golic, Kent G.


    The mechanisms that cells use to monitor telomere integrity, and the array of responses that may be induced, are not fully defined. To date there have been no studies in animals describing the ability of cells to survive and contribute to adult organs following telomere loss. We developed assays to monitor the ability of somatic cells to proliferate and differentiate after telomere loss. Here we show that p53 and Chk2 limit the growth and differentiation of cells that lose a telomere. Furthermore, our results show that two copies of the genes encoding p53 and Chk2 are required for the cell to mount a rapid wildtype response to a missing telomere. Finally, our results show that, while Chk2 functions by activating the p53-dependent apoptotic cascade, Chk2 also functions independently of p53 to limit survival. In spite of these mechanisms to eliminate cells that have lost a telomere, we find that such cells can make a substantial contribution to differentiated adult tissues. PMID:21655087

  13. The homeoprotein DLX3 and tumor suppressor p53 co-regulate cell cycle progression and squamous tumor growth.


    Palazzo, E; Kellett, M; Cataisson, C; Gormley, A; Bible, P W; Pietroni, V; Radoja, N; Hwang, J; Blumenberg, M; Yuspa, S H; Morasso, M I


    Epidermal homeostasis depends on the coordinated control of keratinocyte cell cycle. Differentiation and the alteration of this balance can result in neoplastic development. Here we report on a novel DLX3-dependent network that constrains epidermal hyperplasia and squamous tumorigenesis. By integrating genetic and transcriptomic approaches, we demonstrate that DLX3 operates through a p53-regulated network. DLX3 and p53 physically interact on the p21 promoter to enhance p21 expression. Elevating DLX3 in keratinocytes produces a G1-S blockade associated with p53 signature transcriptional profiles. In contrast, DLX3 loss promotes a mitogenic phenotype associated with constitutive activation of ERK. DLX3 expression is lost in human skin cancers and is extinguished during progression of experimentally induced mouse squamous cell carcinoma (SCC). Reinstatement of DLX3 function is sufficient to attenuate the migration of SCC cells, leading to decreased wound closure. Our data establish the DLX3-p53 interplay as a major regulatory axis in epidermal differentiation and suggest that DLX3 is a modulator of skin carcinogenesis. PMID:26522723

  14. Adenoviral-E2F-1 radiosensitizes p53{sup wild-type} and p53{sup null} human prostate cancer cells

    SciTech Connect

    Nguyen, Khanh H.; Hachem, Paul; Khor, L.-Y.; Salem, Naji; Hunt, Kelly K.; Calkins, Peter R.; Pollack, Alan . E-mail:


    Purpose: E2F-1 is a transcription factor that enhances the radiosensitivity of various cell lines by inducing apoptosis. However, there are conflicting data concerning whether this enhancement is mediated via p53 dependent pathways. Additionally, the role of E2F-1 in the response of human prostate cancer to radiation has not been well characterized. In this study, we investigated the effect of Adenoviral-E2F-1 (Ad-E2F-1) on the radiosensitivity of p53{sup wild-type} (LNCaP) and p53{sup null} (PC3) prostate cancer cell lines. Methods and Materials: LNCaP and PC3 cells were transduced with Ad-E2F-1, Adenoviral-Luciferase (Ad-Luc) control vector, or Adenoviral-p53 (Ad-p53). Expression of E2F-1 and p53 was examined by Western blot analysis. Annexin V and caspase 3 + 7 assays were performed to estimate the levels of apoptosis. Clonogenic survival assays were used to determine overall cell death. Statistical significance was determined by analysis of variance, using the Bonferroni method to correct for multiple comparisons. Results: Western blot analysis confirmed the efficacy of transductions with Ad-E2F-1 and Ad-p53. Ad-E2F-1 transduction significantly enhanced apoptosis and decreased clonogenic survival in both cell lines. These effects were compounded by the addition of RT. Although E2F-1-mediated radiosensitization was independent of p53 status, this effect was more pronounced in p53{sup wild-type} LNCaP cells. When PC3 cells were treated with Ad-p53 in combination with RT and Ad-E2F-1, there was at least an additive reduction in clonogenic survival. Conclusions: Our results suggest that Ad-E2F-1 significantly enhances the response of p53{sup wild-type} and p53{sup null} prostate cancer cells to radiation therapy, although radiosensitization is more pronounced in the presence of p53. Ad-E2F-1 may be a useful adjunct to radiation therapy in the treatment of prostate cancer.

  15. INMAP Overexpression Inhibits Cell Proliferation, Induces Genomic Instability and Functions through p53/p21 Pathways

    PubMed Central

    Zhu, Yan; Lei, Yan; Du, Baochen; Zheng, Yanbo; Lu, Xiangfeng; Tan, Tan; Kang, Jingting; Sun, Le; Liang, Qianjin


    INMAP is a spindle protein that plays essential role for mitosis, by ensuring spindle and centromere integrality. The aim of this study was to investigate the relevant functions of INMAP for genomic stability and its functional pathway. We overexpressed INMAP in HeLa cells, resulting in growth inhibition in monolayer cell cultures, anchorage-independent growth in soft agar and xenograft growth in nude mice. In this system caused micronuclei (MNi) formation, chromosome distortion and γH2AX expression upregulation, suggesting DNA damage induction and genomic stability impairment. As a tumour biochemical marker, lactate dehydrogenase (LDH) isoenzymes were detected to evaluate cell metabolic activity, the results confirming that total activity of LDH, as well as that of its LDH5 isoform, is significantly decreased in INMAP-overexpressing HeLa cells. The levels of p53 and p21 were upregulated, and however, that of PCNA and Bcl-2, downregulated. Indirect immunofluorescence (IIF) and coimmunoprecipitation (CoIP) analyses revealed the interaction between INMAP and p21. These results suggest that INMAP might function through p53/p21 pathways. PMID:25635878

  16. DNA repair and aging: the impact of the p53 family

    PubMed Central

    Nicolai, Sara; Rossi, Antonello; Di Daniele, Nicola; Melino, Gerry; Annicchiarico-Petruzzelli, Margherita; Raschellà, Giuseppe


    Cells are constantly exposed to endogenous and exogenous factors that threaten the integrity of their DNA. The maintenance of genome stability is of paramount importance in the prevention of both cancer and aging processes. To deal with DNA damage, cells put into operation a sophisticated and coordinated mechanism, collectively known as DNA damage response (DDR). The DDR orchestrates different cellular processes, such as DNA repair, senescence and apoptosis. Among the key factors of the DDR, the related proteins p53, p63 and p73, all belonging to the same family of transcription factors, play multiple relevant roles. Indeed, the members of this family are directly involved in the induction of cell cycle arrest that is necessary to allow the cells to repair. Alternatively, they can promote cell death in case of prolonged or irreparable DNA damage. They also take part in a more direct task by modulating the expression of core factors involved in the process of DNA repair or by directly interacting with them. In this review we will analyze the fundamental roles of the p53 family in the aging process through their multifaceted function in DDR. PMID:26668111

  17. Cisplatin modulates B-cell translocation gene 2 to attenuate cell proliferation of prostate carcinoma cells in both p53-dependent and p53-independent pathways.


    Chiang, Kun-Chun; Tsui, Ke-Hung; Chung, Li-Chuan; Yeh, Chun-Nan; Feng, Tsui-Hsia; Chen, Wen-Tsung; Chang, Phei-Lang; Chiang, Hou-Yu; Juang, Horng-Heng


    Cisplatin is a widely used anti-cancer drug. The B-cell translocation gene 2 (BTG2) is involved in the cell cycle transition regulation. We evaluated the cisplatin effects on prostate cancer cell proliferation and the expressions of BTG2, p53, androgen receptor (AR) and prostate specific antigen (PSA) in prostate carcinoma, p53 wild-type LNCaP or p53-null PC-3, cells. Cisplatin treatments attenuated cell prostate cancer cell growth through inducing Go/G1 cell cycle arrest in lower concentration and apoptosis at higher dosage. Cisplatin treatments enhanced p53 and BTG2 expression, repressed AR and PSA expression, and blocked the activation of androgen on the PSA secretion in LNCaP cells. BTG2 knockdown in LNCaP cells attenuated cisplatin-mediated growth inhibition. Cisplatin enhanced BTG2 gene expression dependent on the DNA fragment located within -173 to -82 upstream of BTG2 translation initiation site in prostate cancer cells. Mutation of the p53 response element from GGGCAGAGCCC to GGGCACC or mutation of the NFκB response element from GGAAAGTCC to GGAAAGGAA by site-directed mutagenesis abolished the stimulation of cisplatin on the BTG2 promoter activity in LNCaP or PC-3 cells, respectively. Our results indicated that cisplatin attenuates prostate cancer cell proliferation partly mediated by upregulation of BTG2 through the p53-dependent pathway or p53-independent NFκB pathway. PMID:24981574

  18. Cisplatin modulates B-cell translocation gene 2 to attenuate cell proliferation of prostate carcinoma cells in both p53-dependent and p53-independent pathways

    PubMed Central

    Chiang, Kun-Chun; Tsui, Ke-Hung; Chung, Li-Chuan; Yeh, Chun-Nan; Feng, Tsui-Hsia; Chen, Wen-Tsung; Chang, Phei-Lang; Chiang, Hou-Yu; Juang, Horng-Heng


    Cisplatin is a widely used anti-cancer drug. The B-cell translocation gene 2 (BTG2) is involved in the cell cycle transition regulation. We evaluated the cisplatin effects on prostate cancer cell proliferation and the expressions of BTG2, p53, androgen receptor (AR) and prostate specific antigen (PSA) in prostate carcinoma, p53 wild-type LNCaP or p53-null PC-3, cells. Cisplatin treatments attenuated cell prostate cancer cell growth through inducing Go/G1 cell cycle arrest in lower concentration and apoptosis at higher dosage. Cisplatin treatments enhanced p53 and BTG2 expression, repressed AR and PSA expression, and blocked the activation of androgen on the PSA secretion in LNCaP cells. BTG2 knockdown in LNCaP cells attenuated cisplatin-mediated growth inhibition. Cisplatin enhanced BTG2 gene expression dependent on the DNA fragment located within -173 to -82 upstream of BTG2 translation initiation site in prostate cancer cells. Mutation of the p53 response element from GGGCAGAGCCC to GGGCACC or mutation of the NFκB response element from GGAAAGTCC to GGAAAGGAA by site-directed mutagenesis abolished the stimulation of cisplatin on the BTG2 promoter activity in LNCaP or PC-3 cells, respectively. Our results indicated that cisplatin attenuates prostate cancer cell proliferation partly mediated by upregulation of BTG2 through the p53-dependent pathway or p53-independent NFκB pathway. PMID:24981574

  19. Nitric oxide-induced p53 accumulation and regulation of inducible nitric oxide synthase expression by wild-type p53.

    PubMed Central

    Forrester, K; Ambs, S; Lupold, S E; Kapust, R B; Spillare, E A; Weinberg, W C; Felley-Bosco, E; Wang, X W; Geller, D A; Tzeng, E; Billiar, T R; Harris, C C


    The tumor suppressor gene product p53 plays an important role in the cellular response to DNA damage from exogenous chemical and physical mutagens. Therefore, we hypothesized that p53 performs a similar role in response to putative endogenous mutagens, such as nitric oxide (NO). We report here that exposure of human cells to NO generated from an NO donor or from overexpression of inducible nitric oxide synthase (NOS2) results in p53 protein accumulation. In addition, expression of wild-type (WT) p53 in a variety of human tumor cell lines, as well as murine fibroblasts, results in down-regulation of NOS2 expression through inhibition of the NOS2 promoter. These data are consistent with the hypothesis of a negative feedback loop in which endogenous NO-induced DNA damage results in WT p53 accumulation and provides a novel mechanism by which p53 safeguards against DNA damage through p53-mediated transrepression of NOS2 gene expression, thus reducing the potential for NO-induced DNA damage. Images Fig. 1 Fig. 2 Fig. 3 PMID:8637893

  20. Lack of p53 Affects the Expression of Several Brain Mitochondrial Proteins: Insights from Proteomics into Important Pathways Regulated by p53

    PubMed Central

    Fiorini, Ada; Sultana, Rukhsana; Barone, Eugenio; Cenini, Giovanna; Perluigi, Marzia; Mancuso, Cesare; Cai, Jian; Klein, Jon B.; St. Clair, Daret; Butterfield, D. Allan


    The tumor suppressor protein p53 has been described “as the guardian of the genome” for its crucial role in regulating the transcription of numerous genes responsible for cells cycle arrest, senescence, or apoptosis in response to various stress signals. Although p53 promotes longevity by decreasing the risk of cancer through activation of apoptosis or cellular senescence, several findings suggest that an increase of its activity may have deleterious effects leading to selected aspects of the aging phenotype and neurodegenerative diseases. There is the link between p53 and oxidative stress, the latter a crucial factor that contributes to neurodegenerative processes like Alzheimer disease (AD). In the present study, using a proteomics approach, we analyzed the impact of lack of p53 on the expression of several brain mitochondrial proteins involved in different pathways, and how lack of p53 may present a target to restore neuronal impairments. Our investigation on isolated brain mitochondria from p53(−/−) mice also provides a better understanding of the p53-mitochondria relationship and its involvement in the development of many diseases. PMID:23209608

  1. Frameshift and nonsense p53 mutations in squamous-cell carcinoma of head and neck - non-reactivity with 3 anti-p53 monoclonal-antibodies.


    Chen, Y; Xu, L; Massey, L; Zlotolow, I; Huvos, A; Garinchesa, P; Old, L


    p53 mutations in human tumors are often associated with overexpression of p53, and immunohistochemical detection of p53 has frequently been chosen as a simpler method than genetic analysis to access p53 mutations. In this study, we analyzed the p53 gene by single-strand conformational polymorphism (SSCP) and DNA sequencing, and correlated findings to Ab staining results. In a series of 58 squamous cell carcinoma, 15 showed mutations in exons 5, 6, 7, 8 and 9 by SSCP. Of these 15 cases, 11 were positive by antibody staining, and DNA sequencing showed missense mutations but no frameshift or nonsense mutations. In contrast, the antibody-negative cases had frameshift or nonsense mutations, but no missense mutations. SSCP analysis of these 4 cases showed mutations in exon 6 (2 cases), exon 7 (1), and exon 8 (1), respectively. In case 1, sequencing data revealed a single-base addition in exon 6, leading to a truncated gene product of 207 amino acids (aa), in contrast to 393 aa in wild-type p53. Similar frameshift mutations were shown in case 2 and case 3. Case 4, instead of a frameshift mutation, carried a nonsense mutation, and a truncated peptide of 235 aa. All these mutations thus shared the feature of producing truncated p53 products nonreactive with antibodies. We conclude that frameshift mutations as well as nonsense mutations can lead to altered p53 undetectable by available monoclonal antibodies. Our finding indicates that the absence of Ab reactivity does not rule out genetic alterations of the p53 gene in human tumors. PMID:21566966

  2. Experimentally guided structural modeling and dynamics analysis of Hsp90-p53 interactions: allosteric regulation of the Hsp90 chaperone by a client protein.


    Blacklock, Kristin; Verkhivker, Gennady M


    A fundamental role of the Hsp90 chaperone system in mediating maturation of protein clients is essential for the integrity of signaling pathways involved in cell cycle control and organism development. Molecular characterization of Hsp90 interactions with client proteins is fundamental to understanding the activity of many tumor-inducing signaling proteins and presents an active area of structural and biochemical studies. In this work, we have probed mechanistic aspects of allosteric regulation of Hsp90 by client proteins via a detailed computational study of Hsp90 interactions with the tumor suppressor protein p53. Experimentally guided protein docking and molecular dynamics structural refinement have reconstructed the recognition-competent states of the Hsp90-p53 complexes that are consistent with the NMR studies. Protein structure network analysis has identified critical interacting networks and specific residues responsible for structural integrity and stability of the Hsp90-p53 complexes. Coarse-grained modeling was used to characterize the global dynamics of the regulatory complexes and map p53-induced changes in the conformational equilibrium of Hsp90. The variations in the functional dynamics profiles of the Hsp90-p53 complexes are consistent with the NMR studies and could explain differences in the functional role of the alternative binding sites. Despite the overall similarity of the collective movements and the same global interaction footprint, p53 binding at the C-terminal interaction site of Hsp90 may have a more significant impact on the chaperone dynamics, which is consistent with the stronger allosteric effect of these interactions revealed by the experimental studies. The results suggest that p53-induced modulation of the global dynamics and structurally stable interaction networks can target the regulatory hinge regions and facilitate stabilization of the closed Hsp90 dimer that underlies the fundamental stimulatory effect of the p53 client. PMID

  3. P53 functional abnormality in mesenchymal stem cells promotes osteosarcoma development

    PubMed Central

    Velletri, T; Xie, N; Wang, Y; Huang, Y; Yang, Q; Chen, X; Chen, Q; Shou, P; Gan, Y; Cao, G; Melino, G; Shi, Y


    It has been shown that p53 has a critical role in the differentiation and functionality of various multipotent progenitor cells. P53 mutations can lead to genome instability and subsequent functional alterations and aberrant transformation of mesenchymal stem cells (MSCs). The significance of p53 in safeguarding our body from developing osteosarcoma (OS) is well recognized. During bone remodeling, p53 has a key role in negatively regulating key factors orchestrating the early stages of osteogenic differentiation of MSCs. Interestingly, changes in the p53 status can compromise bone homeostasis and affect the tumor microenvironment. This review aims to provide a unique opportunity to study the p53 function in MSCs and OS. In the context of loss of function of p53, we provide a model for two sources of OS: MSCs as progenitor cells of osteoblasts and bone tumor microenvironment components. Standing at the bone remodeling point of view, in this review we will first explain the determinant function of p53 in OS development. We will then summarize the role of p53 in monitoring MSC fidelity and in regulating MSC differentiation programs during osteogenesis. Finally, we will discuss the importance of loss of p53 function in tissue microenvironment. We expect that the information provided herein could lead to better understanding and treatment of OS. PMID:26775693

  4. Lysines in the tetramerization domain of p53 selectively modulate G1 arrest.


    Beckerman, Rachel; Yoh, Kathryn; Mattia-Sansobrino, Melissa; Zupnick, Andrew; Laptenko, Oleg; Karni-Schmidt, Orit; Ahn, Jinwoo; Byeon, In-Ja; Keezer, Susan; Prives, Carol


    Functional in a tetrameric state, the protein product of the p53 tumor suppressor gene confers its tumor-suppressive activity by transactivating genes which promote cell-cycle arrest, senescence, or programmed cell death. How p53 distinguishes between these divergent outcomes is still a matter of considerable interest. Here we discuss the impact of 2 mutations in the tetramerization domain that confer unique properties onto p53. By changing lysines 351 and 357 to arginine, thereby blocking all post-translational modifications of these residues, DNA binding and transcriptional regulation by p53 remain virtually unchanged. On the other hand, by changing these lysines to glutamine (2KQ-p53), thereby neutralizing their positive charge and potentially mimicking acetylation, p53 is impaired in the induction of cell cycle arrest and yet can still effectively induce cell death. Surprisingly, when 2KQ-p53 is expressed at high levels in H1299 cells, it can bind to and transactivate numerous p53 target genes including p21, but not others such as miR-34a and cyclin G1 to the same extent as wild-type p53. Our findings show that strong induction of p21 is not sufficient to block H1299 cells in G1, and imply that modification of one or both of the lysines within the tetramerization domain may serve as a mechanism to shunt p53 from inducing cell cycle arrest. PMID:27210019

  5. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds

    PubMed Central

    Cino, Elio A.; Soares, Iaci N.; Pedrote, Murilo M.; de Oliveira, Guilherme A. P.; Silva, Jerson L.


    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  6. β-Catenin C-terminal signals suppress p53 and are essential for artery formation.


    Riascos-Bernal, Dario F; Chinnasamy, Prameladevi; Cao, Longyue Lily; Dunaway, Charlene M; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E S


    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  7. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides

    PubMed Central

    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda


    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  8. p53 directly regulates the glycosidase FUCA1 to promote chemotherapy-induced cell death

    PubMed Central

    Baudot, Alice D.; Crighton, Diane; O'Prey, Jim; Somers, Joanna; Sierra Gonzalez, Pablo; Ryan, Kevin M.


    ABSTRACT p53 is a central factor in tumor suppression as exemplified by its frequent loss in human cancer. p53 exerts its tumor suppressive effects in multiple ways, but the ability to invoke the eradication of damaged cells by programmed cell death is considered a key factor. The ways in which p53 promotes cell death can involve direct activation or engagement of the cell death machinery, or can be via indirect mechanisms, for example though regulation of ER stress and autophagy. We present here another level of control in p53-mediated tumor suppression by showing that p53 activates the glycosidase, FUCA1, a modulator of N-linked glycosylation. We show that p53 transcriptionally activates FUCA1 and that p53 modulates fucosidase activity via FUCA1 up-regulation. Importantly, we also report that chemotherapeutic drugs induce FUCA1 and fucosidase activity in a p53-dependent manner. In this context, while we found that over-expression of FUCA1 does not induce cell death, RNAi-mediated knockdown of endogenous FUCA1 significantly attenuates p53-dependent, chemotherapy-induced apoptotic death. In summary, these findings add an additional component to p53s tumor suppressive response and highlight another mechanism by which the tumor suppressor controls programmed cell death that could potentially be exploited for cancer therapy. PMID:27315169

  9. Cytoplasmic CUL9/PARC ubiquitin ligase is a tumor suppressor and promotes p53-dependent apoptosis

    PubMed Central

    Pei, Xin-Hai; Bai, Feng; Li, Zhijun; Smith, Matthew D.; Whitewolf, Gabrielle; Jin, Ran; Xiong, Yue


    A wide range of cell stresses, including DNA damage, signal to p53 through post-translational modification of p53. The cytoplasmic functions of p53 are emerging as an important constituent of p53’s role in tumor suppression. Here we report that deletion of the Cul9 (formerly Parc) gene, which encodes an E3 ubiquitin ligase that binds to p53 and localizes in the cytoplasm, resulted in spontaneous tumor development, accelerated Eμ-Myc-induced lymphomagenesis and rendered mice susceptible to carcinogenesis. Cul9-p53 double mutant mice exhibited indistinguishable tumor phenotypes as p53 single mutant mice, indicating that the function of Cul9 in tumor suppression is largely mediated by p53. Deletion of Cul9 had no significant effect on cell cycle progression, but attenuated DNA damage-induced apoptosis. Ectopic expression of wild-type CUL9, but not a point mutant CUL9 deficient in p53 binding, promotes apoptosis. These results demonstrate CUL9 as a potential p53 activating E3 ligase in the cytoplasm. PMID:21487039

  10. Renal cell carcinoma escapes death by p53 depletion through transglutaminase 2-chaperoned autophagy

    PubMed Central

    Kang, J H; Lee, J-S; Hong, D; Lee, S-H; Kim, N; Lee, W-K; Sung, T-W; Gong, Y-D; Kim, S-Y


    In renal cell carcinoma, transglutaminase 2 (TGase 2) crosslinks p53 in autophagosomes, resulting in p53 depletion and the tumor's evasion of apoptosis. Inhibition of TGase 2 stabilizes p53 and induces tumor cells to enter apoptosis. This study explored the mechanism of TGase 2-dependent p53 degradation. We found that TGase 2 competes with human double minute 2 homolog (HDM2) for binding to p53; promotes autophagy-dependent p53 degradation in renal cell carcinoma (RCC) cell lines under starvation; and binds to p53 and p62 simultaneously without ubiquitin-dependent recognition of p62. The bound complex does not have crosslinking activity. A binding assay using a series of deletion mutants of p62, p53 and TGase 2 revealed that the PB1 (Phox and Bem1p-1) domain of p62 (residues 85–110) directly interacts with the β-barrel domains of TGase 2 (residues 592–687), whereas the HDM2-binding domain (transactivation domain, residues 15–26) of p53 interacts with the N terminus of TGase 2 (residues 1–139). In addition to the increase in p53 stability due to TGase 2 inhibition, the administration of a DNA-damaging anti-cancer drug such as doxorubicin-induced apoptosis in RCC cell lines and synergistically reduced tumor volume in a xenograft model. Combination therapy with a TGase 2 inhibitor and a DNA-damaging agent may represent an effective therapeutic approach for treating RCC. PMID:27031960

  11. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides.


    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda


    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  12. The C-terminus of p53 binds the N-terminal domain of MDM2

    PubMed Central

    Poyurovsky, Masha V.; Katz, Chen; Laptenko, Oleg; Beckerman, Rachel; Lokshin, Maria; Ahn, Jinwoo; Byeon, In-Ja L.; Gabizon, Ronen; Mattia, Melissa; Zupnick, Andrew; Brown, Lewis M.; Friedler, Assaf; Prives, Carol


    The p53 tumor suppressor interacts with its negative regulator Mdm2 via the former’s N-terminal region and core domain. Yet the extreme p53 C-terminal region contains lysine residues ubiquitinated by Mdm2 and can bear post-translational modifications that inhibit Mdm2–p53 association. We show that, the Mdm2–p53 interaction is decreased upon deletion, mutation or acetylation of the p53 C-terminus. Mdm2 decreases the association of full-length but not C-terminally deleted p53 with a DNA target sequence in vitro and in cells. Further, using multiple approaches we demonstrate that a peptide from p53 C-terminus directly binds Mdm2 N-terminus in vitro. We also show that p300-acetylated p53 binds inefficiently to Mdm2 in vitro, and Nutlin-3 treatment induces C-terminal modification(s) of p53 in cells, explaining the low efficiency of Nutlin-3 in dissociating p53-MDM2 in vitro. PMID:20639885

  13. p53 directly regulates the glycosidase FUCA1 to promote chemotherapy-induced cell death.


    Baudot, Alice D; Crighton, Diane; O'Prey, Jim; Somers, Joanna; Sierra Gonzalez, Pablo; Ryan, Kevin M


    p53 is a central factor in tumor suppression as exemplified by its frequent loss in human cancer. p53 exerts its tumor suppressive effects in multiple ways, but the ability to invoke the eradication of damaged cells by programmed cell death is considered a key factor. The ways in which p53 promotes cell death can involve direct activation or engagement of the cell death machinery, or can be via indirect mechanisms, for example though regulation of ER stress and autophagy. We present here another level of control in p53-mediated tumor suppression by showing that p53 activates the glycosidase, FUCA1, a modulator of N-linked glycosylation. We show that p53 transcriptionally activates FUCA1 and that p53 modulates fucosidase activity via FUCA1 up-regulation. Importantly, we also report that chemotherapeutic drugs induce FUCA1 and fucosidase activity in a p53-dependent manner. In this context, while we found that over-expression of FUCA1 does not induce cell death, RNAi-mediated knockdown of endogenous FUCA1 significantly attenuates p53-dependent, chemotherapy-induced apoptotic death. In summary, these findings add an additional component to p53s tumor suppressive response and highlight another mechanism by which the tumor suppressor controls programmed cell death that could potentially be exploited for cancer therapy. PMID:27315169

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  15. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds.


    Cino, Elio A; Soares, Iaci N; Pedrote, Murilo M; de Oliveira, Guilherme A P; Silva, Jerson L


    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  16. Change in oligomerization specificity of the p53 tetramerization domain by hydrophobic amino acid substitutions.

    PubMed Central

    Stavridi, E. S.; Chehab, N. H.; Caruso, L. C.; Halazonetis, T. D.


    The tumor suppressor function of the wild-type p53 protein is transdominantly inhibited by tumor-derived mutant p53 proteins. Such transdominant inhibition limits the prospects for gene therapy approaches that aim to introduce wild-type p53 into cancer cells. The molecular mechanism for transdominant inhibition involves sequestration of wild-type p53 subunits into inactive wild-type/mutant hetero-tetramers. Thus, p53 proteins, whose oligomerization specificity is altered so they cannot interact with tumor-derived mutant p53, would escape transdominant inhibition. Aided by the known three-dimensional structure of the p53 tetramerization domain and by trial and error we designed a novel domain with seven amino acid substitutions in the hydrophobic core. A full-length p53 protein bearing this novel domain formed homo-tetramers and had tumor suppressor function, but did not hetero-oligomerize with tumor-derived mutant p53 and resisted transdominant inhibition. Thus, hydrophobic core residues influence the oligomerization specificity of the p53 tetramerization domain. PMID:10493578

  17. Identification of a Sequence Element from p53 That Signals for Mdm2-Targeted Degradation

    PubMed Central

    Gu, Jijie; Chen, Dongli; Rosenblum, Jamie; Rubin, Rachel M.; Yuan, Zhi-Min


    The binding of Mdm2 to p53 is required for targeting p53 for degradation. p73, however, binds to Mdm2 but is refractory to Mdm2-mediated degradation, indicating that binding to Mdm2 is not sufficient for degradation. By utilizing the structural homology between p53 and p73, we generated p53-p73 chimeras to determine the sequence element unique to p53 essential for regulation of its stability. We found that replacing an element consisting of amino acids 92 to 112 of p53 with the corresponding region of p73 results in a protein that is not degradable by Mdm2. Removal of amino acids 92 to 112 of p53 by deletion also results in a non-Mdm2-degradable protein. Significantly, the finding that swapping this fragment converts p73 from refractory to sensitive to Mdm2-mediated degradation supports the conclusion that the amino acids 92 to 112 of p53 function as a degradation signal. We propose that the presence of an additional protein recognizes the degradation signal and coordinates with Mdm2 to target p53 for degradation. Our finding opens the possibility of searching for the additional protein, which most likely plays a critical role in the regulation of p53 stability and therefore function. PMID:10648610

  18. Nucleolar protein GLTSCR2 stabilizes p53 in response to ribosomal stresses

    PubMed Central

    Lee, S; Kim, J-Y; Kim, Y-J; Seok, K-O; Kim, J-H; Chang, Y-J; Kang, H-Y; Park, J-H


    p53 is a key regulator of cell growth and death by controlling cell cycle progression and apoptosis under conditions of stress such as DNA damage or oncogenic stimulation. As these processes are critical for cell function and inhibition of tumor development, p53 regulatory pathways are strictly monitored in cells. Recently, it was recognized that nucleolar proteins, including nucleophosmin/B23, ribosomal protein L11, and alternate reading frame (ARF), form the nucleolus-ARF-murine double minute 2 (MDM2) axis in p53 regulatory pathways, which increases p53 stability by suppressing the activity of MDM2. In this work, we show that nucleolar protein glioma tumor-suppressor candidate region gene 2 (GLTSCR2) translocates to the nucleoplasm under ribosomal stress, where it interacts with and stabilizes p53 and inhibits cell cycle progression without the involvement of the major upstream p53 regulator, ARF. Furthermore, ectopic expression of GLTSCR2 significantly suppressed growth of cancer cells in a xenograft animal model via p53-dependent pathway. Our data identify GLTSCR2 as a new member of the nucleolus–nucleoplasmic axis for p53 regulation. ARF-independent direct regulation of p53 by GLTSCR2 may be a key mechanism and therapeutic target for cell death or growth inhibition when nucleolus-ARF-p53 pathways are inactivated by genetic or epigenetic modifications of ARF, which are the second most common types of genetic change observed in human cancers. PMID:22522597

  19. Decrease of mitochondrial p53 during late apoptosis is linked to its dephosphorylation on serine 20

    PubMed Central

    Castrogiovanni, Cédric; Vandaudenard, Marie; Waterschoot, Béranger; De Backer, Olivier; Dumont, Patrick


    Following a genotoxic stress, the tumor suppressor p53 translocates to mitochondria to take part in direct induction of apoptosis, via interaction with BCL-2 family members such as BAK and BAX. We determined the kinetics of the mitochondrial translocation of p53 in HCT-116 and PA-1 cells exposed to different genotoxic stresses (doxorubicin, camptothecin, UVB). This analysis revealed an early escalation in the amount of mitochondrial p53, followed by a peak amount and a decrease of mitochondrial p53 at later time points. We show that the serine 20 phosphorylated form of p53 is present at the mitochondria and that the decrease of p53 mitochondrial level during late apoptosis correlates with a decrease of Ser-20 phosphorylation. Moreover, the S20A p53 mutant translocates well to mitochondria after a genotoxic stress but its mitochondrial localization is very low during late apoptosis when compared to wt p