The immunoexpression of p53 and Snail in endometrioid endometrial carcinomas.
Dragomirescu, Mihaela; Stepan, Alex Emilian; Mărgăritescu, Claudiu; Simionescu, Cristiana Eugenia
2018-01-01
Endometrial cancer is one of the most common tumors in women worldwide. P53 has a well-known function as tumor suppressor, but it can also regulate the tissues metabolism, differentiation and development. Snail is a zinc-finger transcription factor, involved in the cell differentiation and survival. We analyzed the immunoexpression of p53 and Snail in 55 cases of endometrioid endometrial carcinoma (EEC), in relation with the histopathological prognosis parameters and tumoral compartments, respectively intratumoral and advancing edge areas. For both markers, we found a statistically significant association with histological grade, in relation with tumoral compartments. P53 and Snail can be used in developing EEC targeted treatment.
Carrasco, V; Canfrán, S; Rodríguez-Franco, F; Benito, A; Sáinz, A; Rodríguez-Bertos, A
2011-01-01
Immunohistochemical staining for cell cycle proteins and heat shock proteins was performed on 17 canine gastric carcinomas. The immunoexpression of p53, p21, p16, Hsp27, and Hsp70 was investigated. A study was conducted to determine the histological type and parameters related to tumor malignancy. Possible associations and trends were assessed between the immunoexpression of each protein and tumor type as well as specific parameters of malignancy. High intratumor frequency of cellular p53 immunostaining was observed (61.96% average), but lower frequencies of p21 and p16 expression were present (34.65% and 10.41%, respectively). The p53 overexpression was associated with tumor infiltration (P = .0258). Expression of p21 was lower in undifferentiated carcinomas, and the loss of expression was associated with histopathological parameters characteristic of a poor prognosis such as lymphatic vessel invasion (P = .0258). The lack of p16 immunoreactivity was related to histopathological characteristics of malignancy such as the presence of evident and multiple nucleoli (P = .0475). In contrast, deep tumor infiltration was observed in those carcinomas with a high p16 index (P = .0475). Hsp70 appeared to be overexpressed in all gastric neoplasms included in this study. This is in contrast to Hsp27, because a group of tumors showed complete lack of Hsp27 immunoexpression, whereas the others displayed extensive Hsp27 immunostaining. The differences in Hsp27 did not correlate with any of the histopathological parameters, but Hsp27 immunoexpression was higher in the undifferentiated carcinoma. No significant differences in the expression of the proteins were found in canine gastric carcinomas according to their histological type. These findings may be useful for establishing a prognosis for canine gastric carcinoma.
Correlation between cell cycle proteins and hMSH2 in actinic cheilitis and lip cancer.
Lopes, Maria Luiza Diniz de Sousa; de Oliveira, Denise Hélen Imaculada Pereira; Sarmento, Dmitry José de Santana; Queiroz, Lélia Maria Guedes; Miguel, Márcia Cristina da Costa; da Silveira, Éricka Janine Dantas
2016-04-01
This study aims to evaluate and verify the relationship between the immunoexpression of hMSH2, p53 and p21 in actinic cheilitis (AC) and lower lip squamous cell carcinoma (SCC) cases. Forty AC and 40 SCC cases were submitted to immunoperoxidase method and quantitatively analyzed. Expression was compared by Mann-Whitney test, Student t test or one-way ANOVA. To correlate the variables, Pearson's correlation coefficient was calculated. The expression of p53 and p21 showed no significant differences between histopathological grades of AC or lower lip SCC (p > 0.05). Immunoexpression of p53 was higher in SCC than in AC (p < 0.001), while p21 expression was more observed in AC when compared to SCC group (p = 0.006). The AC group revealed an inverse correlation between p53 and hMSH2 expression (r = -0.30, p = 0.006). Alterations in p53 and p21 expression suggest that these proteins are involved in lower lip carcinogenesis. Moreover, p53 and hMSH2 seem to be interrelated in early events of this process.
Galvão, Hebel Cavalcanti; Gordón-Núñez, Manuel Antonio; de Amorim, Rivadavio Fernandes Batista; Freitas, Roseana de Almeida; de Souza, Lelia Batista
2013-01-01
Even though odontogenic cysts share a similar histogenesis, they show different growth and differentiation profile due to differences in the proliferative cellular activity. We perform an immunohistochemical assessment of protein 53 (p53), proliferating cell nuclear antigen (PCNA), B-cell lymphoma 2 (bcl-2), and murine double minute 2 (MDM2) expression in odontogenic cysts and keratocystic odontogenic tumor analyzing their correlation with the biological behavior of these lesions. By the streptavidin-biotin-peroxidase method with antibodies against p53, PCNA, bcl-2, and MDM2 proteins, 11 radicular cysts, 11 dentigerous cysts, and 11 keratocystic odontogenic tumor were analyzed. The non-parametric Mann-Whitney U-test and Kruskall-Wallis test (P ≤ 0.05) were used to analyze the data. Immunopositivity for PCNA was observed in all cases appraised, predominantly in the suprabasal layer of keratocystic odontogenic tumor epithelial lining (SD ± 19.44), but no significant differences were found among the groups of lesions. Bcl-2 immunoexpression was observed especially in the basal layer of keratocystic odontogenic tumor. PCNA LI was significantly higher than bcl-2 LI in keratocystic odontogenic tumor. MDM2 and p53 immunoexpression were not detected in the lesions studied. Among the evaluated lesions, the keratocystic odontogenic tumor showed different immunoexpression of the proliferation and apoptosis markers. The results of this study suggest that the keratocystic odontogenic tumor presents distinct biological behavior of the odontogenic cysts, as for the processes of proliferation, apoptosis, and differentiation, reinforcing the information in favor of the neoplastic nature of this lesion.
DNA damage, p53, Ki-67 and COX-2 expression in rat tongue cells exposed to nandrolone decanoate.
Pozzi, Renan; Fernandes, Kelly Rosseti; Foot Gomes de Moura, Carolina; Ferrari, Raquel Agnelli Mesquita; Fernandes, Kristianne Porta Santos; Chaves, Marcelo Donizeti; Renno, Ana Claudia Muniz; Ribeiro, Daniel Araki
2013-05-01
The objective of this article was to evaluate the impact potential of nandrolone decanoate on DNA damage, cellular regulatory proteins and cyclooxygenase (COX)-2 in oral mucosa cells of Wistar rats. A total of 40 rats were distributed into four groups. Two experimental groups were treated with nandrolone decanoate, at 5 mg/kg doses, subcutaneously, three times a week in two periods: 15 and 30 days. The remaining groups received only 0.9% saline subcutaneously, three times a week. To evaluate genetic damage, nandrolone decanoate at 15 mg/kg dose was exposed to 24 h. In the histopathological analysis, no remarkable morphological changes were observed in tongue tissue in all groups. Significant increase in immunoexpression of Ki-67, p53, COX-2 proteins was detected in the groups treated with nandrolone decanoate during 15 and 30 days, when compared to their respective controls. A positive correlation between immunoexpression of p53 and COX-2 protein was detected following nandrolone decanoate exposure. DNA damage was induced by nandrolone decanoate in oral mucosa cells at 15 mg/kg dose. Our results suggest that nandrolone decanoate was able to alter the expression of cell cycle-related proteins, as well as to induce genetic damage and COX-2 immunoexpression in tongue cells of Wistar rats.
Cambruzzi, Eduardo
2018-05-01
Medulloblastoma (MDB) is a small cell poorly differentiated embryonal tumor of the cerebellum, which more frequently compromises children. Overall prognosis is favorable, but dependent of stage, histopathological pattern and molecular group. Approximately 30% of the affected patients will die from the disease. WHO 2016 Classification of Tumors of the Central Nervous System (CNS) has been classified MDB into four principal groups: WNT-activated MDB, SHH-activated MDB, group 3 MDB, and group 4 MDB. WNT-activated MDB is associated to monosomy 6, CTNNB1, DDX3X and TP53 mutations, beta-catenin nuclear immunoexpression, and a better prognosis than SHH-activated MDB. WNT-activated tumors account approximately for 10% of cases of MDBs, and are thought to arise from cells in the dorsal brain stem/lower rhombic lip progenitor cells. SHH-activated MDB more frequently arises in the lateral hemispheres of the cerebellum, and clinical outcome in this group is variable. TP53-mutant SHHactivated MDB usually shows the large cell/anaplastic pattern, and can be related to MYCN amplification, GLI2 amplification and 17p loss. TP53-wildtype SHH-activated MDB is more commonly of desmoplastic/nodular morphology, and can be related to PTCH1 deletion and 10q loss. Gene expression and methylation profiling is the gold standard for defining molecular groups of MDB. In immunohistochemistry assays, anti-GAB1 antibody expression is positive in tumors showing SHH pathway activation or PTCH mutation, while positive immunoexpression for YAP1 antibody can be only found in WNT-activated and SHH-activated MDB.
Ocular squamous cell carcinoma in Holstein cows from the South of Brazil
Fornazari, Gabrielle A.; Kravetz, Juliana; Kiupel, Matti; Sledge, Dodd; Filho, Ivan Roque De Barros; Montiani-Ferreira, Fabiano
2017-01-01
Aim: The aim of this study was to investigate 10 cases of bovine ocular squamous cell carcinoma (OSCC) diagnosed in Holstein or Holstein-crosses cows. Materials and Methods: The investigation was performed exclusively in OSCC cases diagnosed in the State of Paraná and Santa Catarina. A combination of two previously existing histopathological classifications systems was used. The tissue samples were tested for immunoexpression of p53 and p16 and polymerase chain reaction (PCR) for bovine herpesvirus and papillomavirus. Results: A positive correlation between number of mitotic figures and tissue invasion was found. Anaplasia parameters did not correlate well with tumor invasion of deeper tissues and mitotic counts. Six of 10 OSCC cases were in animals with heavily pigmented eyes. Immunoexpression of p53 and p16 was observed in 3 cases each. Bovine herpesvirus and papillomavirus were not detected by PCR. Conclusions: Our results indicate that OSCC occurrence is most likely multifactorial with genetic, phenotypic, and environmental influences contributing to the pathogenesis of the disease. PMID:29391681
Ferreira, Andressa Orlandeli; Gollücke, Andréa Pittelli Boiago; Noguti, Juliana; da Silva, Victor Hugo Pereira; Yamamura, Elsa Tiemi Hojo; Ribeiro, Daniel Araki
2012-04-01
The goal of this study was to investigate whether subchronic treatment with grape juice concentrate is able to protect the liver from high fat diet injury in rats. The effects of grape juice concentrate treatment on histopathological changes, and immunohistochemistry for p53, p16 and p21 were evaluated. Male Wistar rats (n = 18) were distributed into three groups: group 1: negative control; group 2: cholesterol at 1% (w/w) in their diet, treated during 5 weeks; and group 3: cholesterol at 1% in their chow during 5 weeks, and grape juice concentrate at 222 mg per day in their drinking-water in the last week only. The results pointed out that treatment with grape juice concentrate did not show remarkable differences regarding liver tissue in the cholesterol-exposed group when compared to group 2. However, grape juice concentrate was able to modulate p16 immunoexpression when compared to high fat diet group. p53 and p21 did not show any significant statistical differences among groups. Taken together, our results suggest that subchronic grape juice concentrate administration was able to modulate cell cycle control by downregulation of p16 immunoexpression in high fat diet-induced liver steatosis in rats.
PAIS-COSTA, Sergio Renato; FARAH, José Francisco de Matos; ARTIGIANI-NETO, Ricardo; MARTINS, Sandro José; GOLDENBERG, Alberto
2014-01-01
Background Gallbladder carcinoma presents a dismal prognosis. Choice treatment is surgical resection that is associated a high levels of both morbidity and mortality. Best knowledgement of prognostic factors may result a better selection of patients either for surgical or multimodal treatment. Aim To evaluate tecidual immunoexpression of P53, E-cadherin, Cox-2, and EGFR proteins and to correlate these findings with resected gallbladder adenocarcinoma survival. Methods Clinical, laboratorial, surgical, and anatomopathological reports of a series of gallbladder adenocarcinoma patients were collected by individualized questionary. Total sample was 42 patients. Median of age was 72 years (35-87). There were seven men and 35 women. Lesion distribuition in according TNM state was the following: T1 (n=2), T2 (n=5), T3 (n=31), T4 (n=4). Twenty-three patients underwent radical resection (R0), while 19 palliative surgery (R1-R2). A block of tissue microarray with neoplasic tissue of each patient was confected. It was performed evaluation of P53, E-Caderine, COX-2, and EGFR proteins imunoexpression. These findings were correlated with overall survival. Results Five-year survival was 28%. The median of global survival was eight months. Only immunoexpression of EGFR protein was considered independent variable at multivariated analysis. Conclusion Final prognosis was influenced by over-expression of EGFR protein in tumoral tissue. PMID:25004291
Immunoexpression of P63 and SOX2 in triple-negative breast cancers, Indonesia
Kamarlis, Reno K; Lubis, Muhammad ND; Hernowo, Bethy S; Kar, Azmi S
2018-01-01
Background: Using immunohistochemical stains to target specific breast cancer markers has become indispensable for evaluation of small diagnostic tissue specimens, and therefore novel marker cocktails for specific breast cancers are required. This study was conducted to assess the immunoexpression of P63 and SOX2 in triple negative breast cancer (TNBC), and to evaluate the predictive diagnostic value of these markers for specific types of TNBC. Methods: Histological slides and paraffin blocks of TNBC cases were collected from Dr. Hasan Sadikin Hospital, Bandung, Indonesia from 5-years period (2011-2015). Each histological slide was subjected to immunohistochemical staining for P63 (nucleus and cytoplasm) and SOX2 (nucleus), with specific primer antibodies. Immunoexpression of P63 and SOX2 was evaluated using immunoreactivity scoring. Associations between P63 and SOX2 immunoexpression and TNBC types were assessed using Mann Whitney tests. In addition, the predictive diagnostic values of these markers were assessed. Results: Forty TNBC histological slides were included, and 23 (57.5%) were Basal-like type TNBC and 17 (42.5%) were Non basal-like type TNBC. Immunoexpression of P63 nucleus and SOX2 was not different between types of TNBC. However, immunoexpression of P63 in the cytoplasm in Basal-like type TNBC was significantly higher than in Non basal-like type TNBC ( p=0.021). Predictor diagnostic value analysis suggested that immunoexpression of P63 in cytoplasm had 56.5% sensitivity and 70.6% specificity for diagnosing Basal-like type TNBC, with area under curve of 0.64. Conclusions: Immunoexpression of P63 in the cytoplasm has a relatively weak diagnostic value to discriminate Basal-like and Non basal-like types of TNBC. PMID:29527291
Ciepliński, Klaudiusz; Jóźwik, Maciej; Semczuk-Sikora, Anna; Gogacz, Marek; Lewkowicz, Dorota; Ignatov, Atanas; Semczuk, Andrzej
2018-02-01
The expression of p53 has been studied not only in primary human ovarian carcinomas, but also in borderline ovarian tumors, however, the results were discordant. Expression patterns of proteins involved in cell proliferation and apoptosis have been investigated in various human neoplasms, including female genital tract neoplasms. The aim of this investigation was to assess the staining pattern and immunolocalization of p53 and selected proliferative markers (Ki-67, MCM3, PCNA, and topoisomerase IIα) in borderline ovarian tumors (BOTs). The study group consisted of 42 women who underwent pelvic surgery between 2006-2015. The median patients' age was 46 years. The immunoperoxidase technique was employed using antibodies against p53, Ki-67, MCM3, PCNA, and topoisomerase IIα. For p53, nuclear expression was observed in BOTs, however, cytoplasmatic immunoreactivity was also detected. Altogether, 25 (60%) tumors demonstrated positive p53 immunostaining, including overexpression found in 6 (14%). There were no significant differences in p53 expression between subgroups of clinicopathological variables. Immunoexpression of Ki-67, MCM3, PCNA, and topoisomerase IIα was nuclear. Ki-67 expression was positive in 12 (29%) cases and there was a trend towards a relationship between patients' age and Ki-67 staining (P=0.08). Interestingly, a significantly higher Ki-67 expression was found in tumors of ≥10 cm in diameter compared to smaller tumors (P=0.008). MCM3 expression was detected in 38 (90%) tumors, and PCNA expression in 28 (67%), yet none of clinicopathological factors was related to them. Topoisomerase IIα expression was present in 14 (33%) cases and, interestingly, its significantly higher expression was observed in BOTs of ≥10 cm in diameter compared to smaller tumors (P=0.008). Moreover, Spearman's correlation revealed highly significant positive associations between Ki-67 and topoisomerase IIα (R=0.403, P=0.008) and Ki-67 and MCM3 (R=0.469, P=0.001). We report a high positive immunostaining rate for p53, suggesting a role of TP53 alterations in the development of BOTs in humans. The new finding of higher topoisomerase IIα immunostaining positivity in BOTs of ≥10 cm may be clinically relevant and requires further studies on larger patient groups.
Ortiz, Rafael Carneiro; Lopes, Nathália Martins; Amôr, Nadia Ghinelli; Ponce, José Burgos; Schmerling, Cláudia Kliemann; Lara, Vanessa Soares; Moyses, Raquel Ajub; Rodini, Camila Oliveira
2018-05-23
Tumour metastasis has been associated with cancer stem cells, a small population with stem-like cells properties, higher rate of migration and metastatic potential compared to cells from the tumour bulk. Our aim was to evaluate the immunoexpression of the putative cancer stem cell biomarkers ALDH1 and CD44 in primary tumour and corresponding metastatic lymph nodes. Tumour tissue specimens (n=50) and corresponding metastatic lymph nodes (n=25) were surgically obtained from 50 patients with oral squamous cell carcinoma and submitted to immunohistochemistry. CD44 and ALDH1 were semi-quantitatively scored according to the proportion and intensity of positive cells within the invasive front and metastatic lymph nodes as a whole. A combined score was obtained by multiplying both parameters and later dichotomized into a final score classified as low (≤ 2) or high (> 2) immunoexpression. ALDH1 and CD44 immunoexpression was detected in both tumour sites, although the means of ALDH1 (P = 0.0985) and CD44 (P = 0.4220) cells were higher in metastasis compared to primary tumours. ALDH1 high was positively associated (P = 0.0184) with angiolymphatic invasion, while CD44 high was positively associated (P = 0.0181) with metastasis (N+). At multivariate analysis, CD44 significantly increased the odds of lymph node metastasis, regardless of T stage (OR=8,24; 1,64-65,64, p=0,0088). CD44 immunoexpression was a significant predictor of lymph node metastasis, while ALDH1 high immunostaining was associated with angiolymphatic invasion. Altogether, it suggests that immunoexpression of CD44 and ALDH1 links the cancer stem cell phenotype with oral squamous cell carcinoma invasion and metastasis. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
van der Post, Rachel S; Gullo, Irene; Oliveira, Carla; Tang, Laura H; Grabsch, Heike I; O'Donovan, Maria; Fitzgerald, Rebecca C; van Krieken, Han; Carneiro, Fátima
Familial clustering is seen in 10 % of gastric cancer cases and approximately 1-3 % of gastric cancer arises in the setting of hereditary diffuse gastric cancer (HDGC). In families with HDGC, gastric cancer presents at young age. HDGC is predominantly caused by germline mutations in CDH1 and in a minority by mutations in other genes, including CTNNA1. Early stage HDGC is characterized by a few, up to dozens of intramucosal foci of signet ring cell carcinoma and its precursor lesions. These include in situ signet ring cell carcinoma and pagetoid spread of signet ring cells. Advanced HDGC presents as poorly cohesive/diffuse type carcinoma, normally with very few typical signet ring cells, and has a poor prognosis. Currently, it is unknown which factors drive the progression towards aggressive disease, but it is clear that most intramucosal lesions will not have such progression.Immunohistochemical profile of early and advanced HDGC is often characterized by abnormal E-cadherin immunoexpression, including absent or reduced membranous expression, as well as "dotted" or cytoplasmic expression. However, membranous expression of E-cadherin does not exclude HDGC. Intramucosal HDGC (pT1a) presents with an "indolent" phenotype, characterized by typical signet ring cells without immunoexpression of Ki-67 and p53, while advanced carcinomas (pT > 1) display an "aggressive" phenotype with pleomorphic cells, that are immunoreactive for Ki-67 and p53. These features show that the IHC profile is different between intramucosal and more advanced HDGC, providing evidence of phenotypic heterogeneity, and may help to define predictive biomarkers of progression from indolent to aggressive, widely invasive carcinomas.
Andrade, Ana Luiza Dias Leite de; Nonaka, Cassiano Francisco Weege; Gordón-Núñez, Manuel Antonio; Freitas, Roseana de Almeida; Galvão, Hébel Cavalcanti
2013-08-01
Different cell types and cytokines have been identified as contributors to the formation of periapical lesions. In this perspective, this study aimed to evaluate the immunoexpression of interleukin (IL)-17, transforming growth factor (TGF)-β1, and the forkhead box P3 (FoxP3) in periapical lesions, correlating them with the type of lesion, the intensity of the inflammatory infiltrate, and the thickness of the cystic epithelial lining. Twenty periapical granulomas (PGs), 20 radicular cysts (RCs), and 20 residual radicular cysts (RRCs) were submitted to immunohistochemical analysis using anti-IL-17, anti-TGF-β1, and anti-FoxP3 antibodies. In comparison with PGs and RCs, RRCs exhibited a lower immunoexpression of IL-17 and TGF-β1 (P = .021 and P < .001, respectively). The number of FoxP3+ cells increased in this order: RRCs, RCs, and PGs (P < .001). In comparison with lesions with inflammatory infiltrates grades I and II, lesions with inflammatory infiltrate grade III exhibited a higher number of FoxP3+ cells (P = .002). Similarly, in comparison with lesions with inflammatory infiltrates grades II and III, lesions with inflammatory infiltrate grade I showed a tendency for a lower expression of IL-17 and TGF-β1 (P = .085 and P = .051, respectively). For all groups, there was a positive correlation between the immunoexpressions of IL-17 and TGF-β1 (P < .05). Positive correlations between the number of FoxP3+ cells and the immunoexpressions of IL-17 and TGF-β1 (P < .05) were found only in PGs. Th17 and Treg cells seem to interact at the site of injury, suggesting the involvement of proinflammatory and immunoregulatory cytokines in the pathogenesis of periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Núñez, Manuel Antonio Gordón; de Matos, Felipe Rodrigues; Freitas, Roseana de Almeida; Galvão, Hébel Cavalcanti
2013-07-01
The objective of this study was to compare the immunoexpression of integrin α₅β₁, fibronectin, and the Bcl-2 protein in normal oral mucosa (NOM), inflammatory fibroepithelial hyperplasia (IFH), oral epithelial dysplasia (OED), and oral squamous cell carcinoma (OSCC). Eleven cases of NOM, 16 IFH, 20 OED, and 27 OSCC were selected for analysis of the immunoexpression of integrin α₅β₁, fibronectin, and bcl-2 protein. There was an association between the intensity and location of the integrin α₅β₁ expression, especially in the OSCC, that 48.1% of cases showed weak immunoreactivity and 40.7% in the suprabasal layer (P < 0.05). There was an association between the pattern and distribution of fibronectin expression in basement membrane, where 90% of NOM showed a pattern of linear continuous and 80% of OED exhibited focal distribution (P < 0.05). The fibronectin expression in connective tissue was predominantly intense with an association of staining pattern among the different specimens, where 37% of OSCC showed a reticular pattern (P < 0.05). There was an association of bcl-2 protein among the types of specimens, especially in IFH and OSCC, where 100% of the cases exhibited scores 1 of staining (P < 0.05). Within this context, the interaction of integrin α₅β₁ with its main ligand in the extracellular matrix, fibronectin, is suggested to influence the survival of tumor cells and to favor their proliferation by modulating apoptosis through the upregulation of antiapoptotic proteins or the suppression of apoptotic mediators.
Onyangunga, Onankoy A; Moodley, Jagidesa; Merhar, Vesselina; Ofusori, David A; Naicker, Thajasvarie
2016-09-01
Lymphangiogenesis is the formation of new vessels from pre-existing lymphatic vessels. Data on lymphangiogenesis in the placenta of HIV-infected pre-eclamptics are sparse and the findings are conflicting. The aim of this novel study was to evaluate LYVE-1 immunoexpression in the placenta of HIV infected normotensive versus pre-eclamptic women. Placental tissue was obtained from normotensive and pre-eclamptic women stratified according to their HIV status. The pre-eclamptic group was divided into early (<34 weeks) and late (>34 weeks) onset. Immunohistochemistry utilized mouse anti-human LYVE-1 antibody and was morphometrically evaluated. LYVE-1 immunostaining was localized within endothelium of the arterial supply and venous drainage of both conducting and exchange villi as well as within medial cells of arteries. LYVE-1 immunostained macrophage-like cells were observed within the fetal and maternal circulation. LYVE-1 immunoexpression was higher (p=0.0001) in HIV positive cohort, regardless of pregnancy and villous type. Irrespective of HIV status and pregnancy type, LYVE-1 immunoexpression was significantly elevated in the conducting compared to the exchange villi (p=0.01). LYVE-1 immunoexpression was higher in N and LOPE compared to EOPE groups for both conducting and exchange villi types respectively (p=0.0001 and p=0.006). There is a decrease of LYVE-1 expression in EOPE+ (conducting villi) and EOPE- (exchange villi) compared to N and LOPE subgroups. This study provides a novel insight into an up-regulation of LYVE-1 expression in the fetal circulation of conducting and exchange villi of HIV-infected pre-eclamptics. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Comparative histological and immunohistochemical study of ameloblastomas and ameloblastic carcinomas
Mosqueda-Taylor, Adalberto; Carlos-Bregni, Román; Pires, Fabio-Ramoa; Delgado-Azañero, Wilson; Neves-Silva, Rodrigo; Aldape-Barrios, Beatriz; Paes-de Almeida, Oslei
2017-01-01
Background This study aimed to compare the histological and immunohistochemical characteristics of ameloblastomas (AM) and ameloblastic carcinomas (AC). Material and Methods Fifteen cases of AM and 9 AC were submitted to hematoxilin and eosin (H&E) and immunohistochemical analysis with the following antibodies: cytokeratins 5,7,8,14 and 19, Ki-67, p53, p63 and the cellular adhesion molecules CD138 (Syndecan-1), E-cadherin and β-catenin. The mean score of the expression of Ki-67 and p53 labelling index (LIs) were compared between the groups using the t test. A value of p<0.05 was considered to be statistically significant. Results All cases were positive for CKs 5, 14 and 19, but negative for CKs 7 and 8. CKs 5 and 19 were positive mainly in the central regions of the ameloblastic islands, while the expression in AC was variable in intensity and localization. CK14 was also variably expressed in both AM and AC. Ki-67 (P=.001) and p53 (P=.004) immunoexpression was higher in AC. All cases were positive for p63, but values were higher in AC. CD138 was mainly expressed in peripheral cells of AM, with a weak positivity in the central areas, while it was positive in most areas of ACs, except in less differentiated regions, where expression was decreased or lost. E-cadherin and β-catenin were weakly positive in both AM and AC. Conclusions These results shows that Ki-67, p53 and p63 expression was higher in AC as compared to AM, suggesting that these markers can be useful when considering diagnosis of malignancy, and perhaps could play a role in malignant transformation of AM. Pattern of expression of CKs 5 and 19 in AC were different to those found in AM, suggesting genetic alterations of these proteins in malignant cells. It was confirmed that CK19 is a good marker for benign odontogenic tumors, such as AM, but it is variably expressed in malignant cases. Key words:Ameloblastoma, ameloblastic carcinoma, immunohistochemistry, odontogenic tumors. PMID:28390135
Yamamoto, Fernanda-Paula; Corrêa Pontes, Flávia-Sirotheau; Cury, Sérgio-Elias; Fonseca, Felipe-Paiva; Rebelo-Pontes, Hélder; Pinto-Júnior, Décio-dos Santos
2012-01-01
Objectives: The aim of this study was to evaluate the immunoexpression of TWIST and p-Akt proteins in oral leukoplakia (OL) and oral squamous cell carcinoma (OSCC), correlating their expressions with the histological features of the lesions. Study design: Immunohistochemical studies were carried out on 10 normal oral epithelium, 30 OL and 20 OSCC formalin-fixed, paraffin-embedded tissue samples. Immunoperoxidase reactions for TWIST and p-Akt proteins were applied on the specimens and the positivity of the reactions was calculated for 1000 epithelial cells. Results: Kruskal-Wallis and Dunn’s post tests revealed a significant difference in TWIST and p-Akt immunoexpression among normal oral mucosa, OL and OSCC. In addition, a significant positive correlation was found between TWIST and p-Akt expressions according to the Pearson’s correlation test. Conclusions: The results obtained in the current study suggest that TWIST and p-Akt may participate of the multi-step process of oral carcinogenesis since its early stages. Key words: Oral cancer, oral leukoplakia, dysplasia, immunohistochemistry. PMID:21743395
Phenotypic Intratumoral Heterogeneity of Endometrial Carcinomas.
Silva, Cátia; Pires-Luís, Ana S; Rocha, Eduardo; Bartosch, Carla; Lopes, José M
2018-03-01
Intratumoral heterogeneity has been shown to play an important role in diagnostic accuracy, development of treatment resistance, and prognosis of cancer patients. Recent studies have proposed quantitative measurement of phenotypic intratumoral heterogeneity, but no study is yet available in endometrial carcinomas. In our study we evaluated the phenotypic intratumoral heterogeneity of a consecutive series of 10 endometrial carcinomas using measures of dispersion and diversity. Morphometric architectural (%tumor cells, %solid tumor, %differentiated tumor, and %lumens) and nuclear [volume-weighted mean nuclear volume ((Equation is included in full-text article.))] parameters, as well as estrogen receptor, progesterone receptor, p53, vimentin, and beta-catenin immunoexpression (H-score) were digitally analyzed in 20 microscopic fields per carcinoma. Quantitative measures of intratumoral heterogeneity included coefficient of variation (CV) and relative quadratic entropy (rQE). In each endometrial carcinoma there was slight variation of architecture from field to field, resulting in globally low levels of heterogeneity measures (mean CV %tumor cells: 0.10, %solid tumor: 0.73, %differentiated tumor: 0.19, %lumens: 0.61 and mean rQE %tumor cells: 18.5, %solid tumor: 20.3, %differentiated tumor: 25.6, %lumens: 21.8). Nuclear intratumoral heterogeneity was also globally low (mean (Equation is included in full-text article.)CV: 0.23 and rQE: 27.3), but significantly higher than the heterogeneity of architectural parameters within most carcinomas. In general, there was low to moderate variability of immunoexpression markers within each carcinoma, but estrogen receptor (mean CV: 0.56 and rQE: 46.2) and progesterone receptor (mean CV: 0.60 and rQE: 39.3) displayed the highest values of heterogeneity measures. Intratumoral heterogeneity of immunoexpression was significantly higher than that observed for morphometric parameters. In conclusion, our study indicates that endometrial carcinomas present a variable but predominantly low degree of phenotypic intratumoral heterogeneity.
Walter, R F H; Mairinger, F D; Ting, S; Vollbrecht, C; Mairinger, T; Theegarten, D; Christoph, D C; Schmid, K W; Wohlschlaeger, J
2015-03-03
Malignant pleural mesothelioma (MPM) is a highly aggressive tumour that is first-line treated with a combination of cisplatin and pemetrexed. Until now, predictive and prognostic biomarkers are lacking, making it a non-tailored therapy regimen with unknown outcome. P53 is frequently inactivated in MPM, but mutations are extremely rare. MDM2 and P14/ARF are upstream regulators of P53 that may contribute to P53 inactivation. A total of 72 MPM patients were investigated. MDM2 immunoexpression was assessed in 65 patients. MDM2 and P14/ARF mRNA expression was analysed in 48 patients of the overall collective. The expression results were correlated to overall survival (OS) and progression-free survival (PFS). OS and PFS correlated highly significantly with MDM2 mRNA and protein expression, showing a dismal prognosis for patients with elevated MDM2 expression (for OS: Score (logrank) test: P⩽0.002, and for PFS: Score (logrank) test; P<0.007). MDM2 was identified as robust prognostic and predictive biomarker for MPM on the mRNA and protein level. P14/ARF mRNA expression reached no statistical significance, but Kaplan-Meier curves distinguished patients with low P14/ARF expression and hence shorter survival from patients with higher expression and prolonged survival. MDM2 is a prognostic and predictive marker for a platin-pemetrexed therapy of patients with MPMs. Downregulation of P14/ARF expression seems to contribute to MDM2-overexpression-mediated P53 inactivation in MPM patients.
[Immunoexpression of c-erbB-2 in intraductal proliferative lesions of the female breast].
Oliveira, Agliberto Barbosa de; De Luca, Laurival Antônio; Carvalho, Grigna Teixeira; Arias, Victor Eduardo Arua; Carvalho, Lídia Raquel de; Assunção, Maria do Carmo
2004-01-01
Genetic modifications are related to genesis and development of cancer. Neoplasias in various organs express the c-erbB-2 oncogene. In intraductal proliferations of the breast it has been assessed as a risk factor for subsequent development of carcinoma. The c-erbB-2 immunoexpression in intraductal epithelial proliferations and the relationship with histopathological characteristics of ductal carcinoma in situ (DCIS) were evaluated. File material from 88 women, which were tissue samples formalin-fixed, paraffin-embedded blocks, was used. Of these 51 presented with DCIS and 37 with ductal hyperplasia without atypia. Ages of the women ranged from 35 to 76 years. All cases were reviewed and nuclear grade, presence of necrosis, preponderance of histological subtype and its extension were verified. Specimens were obtained for the c-erB-2 immunohistochemical study of 84 of the women in question. No expression of the oncogene was verified in the hyperplasias without atypias and in tissues adjacent to all tissue samples. Expression of c-erbB-2 was verified in 9 (19.1%) of the DCIS (p = 0.0001). Immunoexpression was not related to the extension of the lesions. The c-erbB-2 immunoexpression in DCIS was correlated to the histological subtype (p = 0.019), necrosis (p = 0.0066), nuclear grade (p = 0.0084) and Van Nuys Classification (p = 0.039). Expression of c-erbB-2 was significant in proliferative lesions with risk (DCIS) and was correlated to histopathological characteristics: high nuclear grade, presence of necrosis and comedy subtype. There was no expression in the hyperplasias without atypias and adjacent tissues.
Gundogdu, Ahmet Gokhan; Onder, Sevgen; Firat, Pinar; Dogan, Riza
2014-06-01
The impacts of epidermal growth factor receptor (EGFR) immunoexpression and RAS immunoexpression on the survival and prognosis of lung adenocarcinoma patients are debated in the literature. Twenty-six patients, who underwent pulmonary resections between 2002 and 2007 in our clinic, and whose pathologic examinations yielded adenocarcinoma, were included in the study. EGFR and RAS expression levels were examined by immunohistochemical methods. The results were compared with the survival, stage of the disease, nodal involvement, lymphovascular invasion, and pleural invasion. Nonparametric bivariate analyses were used for statistical analyses. A significant link between EGFR immunoexpression and survival has been identified while RAS immunoexpression and survival have been proven to be irrelevant. Neither EGFR, nor RAS has displayed a significant link with the stage of the disease, nodal involvement, lymphovascular invasion, or pleural invasion. Positive EGFR immunoexpression affects survival negatively, while RAS immunoexpression has no effect on survival in lung adenocarcinoma patients.
Ahmed, Ayesha; Al-Tamimi, Dalal M
2018-12-01
Her2-neu overexpression has a pathogenetic, therapeutic and a controversial prognostic role in gastric cancer. p-53 mutation status and Ki-67 proliferation index are established prognostic markers in many tumors. In this study we evaluated p-53 and Ki-67 in relation to Her2-neu positive and negative gastric adenocarcinoma (GA). This cross-sectional study was carried out at King Fahd Hospital of Imam Abdulrahman bin Faisal University. Fifty cases of GA were retrieved from pathology archives. Clinico-pathological parameters were evaluated. Immunohistochemical protein analysis for Her2-neu, Ki-67 and p-53 was carried out. Fluorescent in situ hybridization (FISH) analysis was done for Her2-neu positive cases showing 2+ immunoexpression. Frequency of Ki-67 and p-53 positivity in Her2-neu positive cases was calculated and compared with those in Her2-neu negative cases. Correlation of clinicopatological parameters with Her2 positive and negative cases, p-53 mutation status and Ki-67 proliferation index was carried out. Her2-neu overexpression was present in 12% (n = 6) cases. A high Ki-67 was seen predominantly in Her2-neu positive cases (83%, n = 5). Her2-neu negative cases (n = 44) showed moderate (31.88%, n = 14) to low (34%, n = 15) Ki-67. Diffuse p-53 positivity was seen predominantly in Her2-neu positive cases (33.33%, n = 2). Focal p-53 was seen mainly in Her2-neu negative cases 56.8% (n = 25). Negative p-53 was seen to be independent of Her2-neu status. Her2-neu positivity is strongly associated with diffuse p-53 mutation status and high Ki-67 proliferation. Her 2-neu negative status is associated with focal p-53 positivity and low to moderate Ki-67 proliferation index. Such stratifications in prognostic markers could not only be predictive in patient's prognostics but could also form a basis of molecular classification of gastric cancer.
Onder, Sevgen; Firat, Pinar; Dogan, Riza
2014-01-01
Background The impacts of epidermal growth factor receptor (EGFR) immunoexpression and RAS immunoexpression on the survival and prognosis of lung adenocarcinoma patients are debated in the literature. Methods Twenty-six patients, who underwent pulmonary resections between 2002 and 2007 in our clinic, and whose pathologic examinations yielded adenocarcinoma, were included in the study. EGFR and RAS expression levels were examined by immunohistochemical methods. The results were compared with the survival, stage of the disease, nodal involvement, lymphovascular invasion, and pleural invasion. Nonparametric bivariate analyses were used for statistical analyses. Results A significant link between EGFR immunoexpression and survival has been identified while RAS immunoexpression and survival have been proven to be irrelevant. Neither EGFR, nor RAS has displayed a significant link with the stage of the disease, nodal involvement, lymphovascular invasion, or pleural invasion. Conclusions Positive EGFR immunoexpression affects survival negatively, while RAS immunoexpression has no effect on survival in lung adenocarcinoma patients. PMID:24977003
Nonaka, Cassiano Francisco Weege; Maia, Alexandre Pinto; Nascimento, George João Ferreira do; de Almeida Freitas, Roseana; Batista de Souza, Lélia; Galvão, Hébel Cavalcanti
2008-12-01
Our aim was to assess and compare the immunoexpression of vascular endothelial growth factor (VEGF) in periapical granulomas (PGs), radicular cysts (RCs), and residual radicular cysts (RRCs), relating it to the angiogenic index and the intensity of the inflammatory infiltrate. Twenty PGs, 20 RCs, and 10 RRCs were evaluated by immunohistochemistry using anti-VEGF antibody. Angiogenic index was determined by microvessel count (MVC) using anti-von Willebrand factor antibody. The PGs and RCs showed higher expression of VEGF than the RRCs. Lesions presenting few inflammatory infiltrate revealed the lowest immunoexpression of VEGF (P < .05). Irrespective of the intensity of the inflammatory infiltrate, most of the RCs and RRCs showed moderate to strong epithelial expression of VEGF. Lesions showing dense inflammatory infiltrate presented higher MVC indices (P < .05). VEGF expression and MVC did not reveal a significant correlation (P > .05). VEGF is present in periapical inflammatory lesions but at a lower level in RRCs. The expression of this proangiogenic factor is closely related to the intensity of the inflammatory infiltrate in these lesions.
Leite, Ana Flávia Schueler de Assumpção; Bernardo, Vagner Gonçalves; Buexm, Luisa Aguirre; Fonseca, Eliene Carvalho da; Silva, Licínio Esmeraldo da; Barroso, Danielle Resende Camisasca; Lourenço, Simone de Queiroz Chaves
2016-01-01
This study aimed to evaluate apoptosis by assessing cleaved caspase-3 immunoexpression in hyperplastic, potentially malignant disorder (PMD), and malignant tumors in intraoral and lower lip sites. A retrospective study using paraffin blocks with tissues from patients with inflammatory fibrous hyperplasia (IFH), actinic cheilitis, oral leukoplakia, lower lip and intraoral squamous cell carcinoma (SCC) was performed. The tissues were evaluated by immunohistochemical analysis with anti-cleaved caspase-3 antibody. Apoptotic area index was then correlated with lesion type. From 120 lesions assessed, 55 (46%) were cleaved caspase-3-positive. The SCC samples (n=40) had the highest apoptotic area indices (n=35; 87.5%). Significant differences were detected between SCCs and PMDs (p=0.0003), as well as SCCs and IFHs (p=0.001), regarding caspase-3 immunopositivity. Carcinomas of the lower lip had lower apoptotic area indices than intraoral cancer (p=0.0015). Cleaved caspase-3 immunoexpression showed differences in oral SCCs and PMDs and demonstrated a distinct role of apoptosis in carcinogenesis of intraoral and lower lip cancer. In future, the expression of cleaved caspase-3 with other target molecules in oral cancer may be helpful in delineating the prognosis and treatment of these tumors.
Ryu, Hyang Joo; Kim, Eun Kyung; Heo, Su Jin; Cho, Byoung Chul; Kim, Hye Ryun; Yoon, Sun Och
2017-11-01
We evaluated the expression patterns of p16, which is used as a surrogate marker of HPV infection in head and neck squamous cell carcinoma (HNSCC), in regard to their biological and prognostic implications. p16 expression patterns and infiltrated immune cells were analyzed through immunohistochemistry of p16, CD3, CD8, PD-1, FOXP3, and CD163 on surgically resected HNSCCs (n = 393). Patterns of p16 immunoexpression were defined as STRONG (strong, diffuse expression in cytoplasm, and nucleus in >70% of tumor cells), MARGINAL (expression restricted to tumor margins), MOSAIC (ragged, discontinued expression), NUCLEAR (expression in nuclei only), and ABSENT (no expression). The STRONG pattern was more frequent in the oropharynx, and the MARGINAL pattern was noted only in the oral cavity. MOSAIC and NUCLEAR patterns were noted at variable sites. No two patterns of p16 expression showed the same immune cell composition of CD3+ T cells, CD8+ cytotoxic T cells, PD-1+ T cells, FOXP3+ regulatory T cells, and CD163+ macrophages. In overall and disease-free survival analyses, the STRONG pattern showed the most favorable prognosis, while the NUCLEAR pattern had the worst prognosis. HNSCC anatomical sites, tumor-related immune cell components, and patient outcomes were associated with p16 expression patterns. Each architectural pattern of p16 expression may be related to different biological and prognostic phenotypes. © 2017 APMIS. Published by John Wiley & Sons Ltd.
Immunoexpression of p16 in uterine leiomyomas with infarct-type necrosis: an analysis of 35 cases.
Ip, Philip P; Lim, Diana; Cheung, Annie N Y; Oliva, Esther
2017-11-01
Uterine leiomyosarcomas frequently show p16 immunoexpression. However, p16 may also be expressed in some benign leiomyoma variants such as leiomyomas with bizarre nuclei and cellular leiomyomas, limiting its utility as a biomarker to distinguish between benign and malignant neoplasms. We investigated p16 expression in leiomyomas with infarct-type necrosis, tumours which may sometimes be misinterpreted as smooth muscle tumours of uncertain malignant potential or even leiomyosarcoma on conventional light microscopy. p16 immunostaining was performed on 35 leiomyomas with infarct-type necrosis and the staining pattern was analysed. Staining was classified as absent, scattered/isolated, <33-, 33-66- or >66%-positive cells, and was assessed in the areas immediately surrounding and distant from the infarct. The median age of patients was 44 years. Seventeen had hormonal/non-hormonal drugs and three were pregnant. The median tumour size was 7.25 cm. The mean mitotic count was 0.9/10 high-power fields. Only one tumour had multifocal mild nuclear atypia. Positive p16 was noted in 34 of 35 (97.2%) tumours. It was typically patchy, and was concentrated in areas immediately surrounding the necrosis. Distant from the necrosis, p16 positivity was seen predominantly in scattered/isolated cells. One tumour without any worrisome microscopic features showed diffuse p16 positivity throughout. Median follow-up was 55 months, and none of the patients experienced any recurrence. p16 expression in benign uterine smooth muscle tumours with infarct-type necrosis is common. The staining is particularly concentrated adjacent to areas of necrosis. It is important to be aware of this potential pitfall when interpreting p16 expression. © 2017 John Wiley & Sons Ltd.
Ruiz-González, I; Sánchez, M A; García-Palencia, P; Sánchez, B; García-Fernández, R A; González-Bulnes, A; Flores, J M
2012-07-01
The aim of this work was to compare PR, ERα and OTR uterine expression between days 9 and 21 of pregnancy in ewes whose estrus had been synchronized with two different protocols. Sixty-four adult Manchega ewes were synchronized with either conventional progestagens (P) or prostaglandin analogues (PG), and mated. Uterine samples were obtained from pregnant animals (group P, n=24; group PG, n=25) on days 9 post coitus (pc), 13pc, 15pc, 17pc and 21pc. Immunohistochemical detection of progesterone receptor (PR), estrogen receptor-α (ERα) and oxytocin receptor (OTR) was assessed in different uterine cell compartments including luminal and glandular epithelium, stroma and myometrium. Interaction day × treatment was obtained when assessing PR expression in the caruncular stroma (P=0.027) and myometrium (P=0.000), as well as for ERα in the superficial stroma (P=0.05). Significant "day post coitus" effect was found regarding to PR (P<0.01, with the exception of the superficial stroma, deep stroma and myometrium), ERα (P<0.01), and OTR (P<0.05, except in the deep compartments). No significant "treatment" effect was found for PR, ERα or OTR protein immunoexpression. This study supports the implication of PR, ERα and OTR within days 9-21 of the ovine pregnancy. Moreover, different expression pattern of PR and ERα proteins has been found between treatments in various compartments studied. Collectively, these results indicate that PR, ERα and OTR expression during early pregnancy is similar between ewes treated with either progestagens or prostaglandin analogues-based protocols for estrus synchronization. Copyright © 2012 Elsevier B.V. All rights reserved.
LEITE, Ana Flávia Schueler de Assumpção; BERNARDO, Vagner Gonçalves; BUEXM, Luisa Aguirre; da FONSECA, Eliene Carvalho; da SILVA, Licínio Esmeraldo; BARROSO, Danielle Resende Camisasca; LOURENÇO, Simone de Queiroz Chaves
2016-01-01
ABSTRACT Objective This study aimed to evaluate apoptosis by assessing cleaved caspase-3 immunoexpression in hyperplastic, potentially malignant disorder (PMD), and malignant tumors in intraoral and lower lip sites. Material and Methods A retrospective study using paraffin blocks with tissues from patients with inflammatory fibrous hyperplasia (IFH), actinic cheilitis, oral leukoplakia, lower lip and intraoral squamous cell carcinoma (SCC) was performed. The tissues were evaluated by immunohistochemical analysis with anti-cleaved caspase-3 antibody. Apoptotic area index was then correlated with lesion type. Results From 120 lesions assessed, 55 (46%) were cleaved caspase-3-positive. The SCC samples (n=40) had the highest apoptotic area indices (n=35; 87.5%). Significant differences were detected between SCCs and PMDs (p=0.0003), as well as SCCs and IFHs (p=0.001), regarding caspase-3 immunopositivity. Carcinomas of the lower lip had lower apoptotic area indices than intraoral cancer (p=0.0015). Conclusions Cleaved caspase-3 immunoexpression showed differences in oral SCCs and PMDs and demonstrated a distinct role of apoptosis in carcinogenesis of intraoral and lower lip cancer. In future, the expression of cleaved caspase-3 with other target molecules in oral cancer may be helpful in delineating the prognosis and treatment of these tumors. PMID:27556207
Porto, Lia Pontes Arruda; dos Santos, Jean Nunes; Ramalho, Luciana Maria Pedreira; Figueiredo, Andreia Leal; Carneiro Júnior, Bráulio; Gurgel, Clarissa Araújo; Paiva, Katiúcia Batista Silva; Xavier, Flávia Caló Aquino
2016-04-01
The epithelial-mesenchymal transition (EMT) is the process where cells lose their epithelial features and acquire properties of typical mesenchymal cells. The dissociation of tumor cells due to changes in cell-cell adhesion is one of the key principles of tumor invasion and EMT. Thus, the knowledge of the molecular features of EMT in keratocyst odontogenic tumor (KOT) can provide useful markers to aid in the diagnosis and prognosis and perhaps contribute to an alternative therapeutic approach as it shows an aggressive clinical behavior and high recurrence rates. This study aimed to evaluate the EMT in KOT by the immunoexpression of E-cadherin, N-cadherin, Snail, and Slug and comparing to radicular cysts and dental follicles. Thirty-two KOTs, 15 radicular cysts, and 08 dental follicles were used for immunohistochemistry, evaluating the extent, intensity, labeling pattern, cellular compartment in the epithelium and stroma, and the presence of inflammation. E-cadherin was preserved in most cases of keratocystic odontogenic tumor. N-cadherin was increased in the tumor epithelium, a result that was positively correlated with the heterogeneous and nuclear immunoexpression of Slug in the epithelium; Slug also correlated with high Snail immunoexpression. N-cadherin was positively correlated with Slug in the stroma of keratocystic odontogenic tumors. The high immunoexpression of Snail and nuclear Slug in keratocystic odontogenic tumors suggests these proteins as transcription factors without necessarily participating in 'cadherin switching'. However, the knowledge of their induction of the epithelial-mesenchymal transition in odontogenic tumors is still limited. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Expression of mucins in the mucosal surface of small intestines in 1 week-old pigs.
Kim, Chung Hyun; Oh, Yeonsu; Ha, Yooncheol; Ahn, Qwein; Kim, Sung-Hoon; Cho, Kyung-Dong; Lee, Bog-Hieu; Chae, Chanhee
2010-02-01
The aim of this study was to determine the immunoexpression of mucins in jejunal and ileal villous epithelium using six antibodies against MUC1, MUC2, MUC4 MUC5AC, MUC5B and MUC6. The immunohistochemical score for MUC1 has significantly intense staining compared with MUC2 (P=0.008) and the immunohistochemical socre for MUC4 and MUC 6 has significantly intense staining compared with MUC2 (P=0.032) in ileal villous surface. The immunohistochemical score for MUC4 (P=0.008), MUC5AC (P=0.016) and MUC6 (P=0.016) in ileal villous surface has significantly intense staining compared with ileal cryptic surface. The results of this study demonstrated that six mucins gave distinctly different expression patterns throughout the 1 week-old porcine small intestinal tract.
Immunohistochemical study of Ki67, CD34 and p53 expression in human tooth buds.
Muica Nagy-Bota, Monica Cristina; Pap, Zsuzsanna; Denes, Lóránd; Ghizdavăţ, Alexandru; Brînzaniuc, Klara; Lup Coşarcă, Adina Simona; Chibelean Cireş-Mărginean, Manuela; Păcurar, Mariana; Pávai, Zoltán
2014-01-01
Establishment of Ki67, p53 and CD34 expression in human tooth buds of different stages of odontogenetic development. Tissue samples containing tooth buds were removed from the incisor areas of human fetuses in different stages of development (weeks 9-10, 12-13, 13-16, 21-24), and from the canine and molar areas of 21-24 weeks fetuses. The tissue fragments were fixed using formalin and were processed using common histological techniques with paraffin embedding. Immunostaining for Ki67, p53 and CD34 has been performed using the dextran method and moist heat antigen retrieval (except for CD34). The resulting slides were photographed and quantitatively evaluated. Ki67 immunoexpression decreases with advancement of the developmental stage of the tooth bud: in the inner enamel epithelium, between weeks 9 and 16 (IEE), in the preameloblasts (PB) between weeks 13 and 16, in the ameloblasts (AB) between weeks 21 and 24; outer enamel epithelium (OEE); stratum intermedium (SI); in the dental papilla: between weeks 9 and 10 in the dental papilla (DP), between weeks 13 and 16 in the outer layer of the dental papilla (DP1) and in the central layer of the dental papilla (DP2). Likewise, we noted Ki67 expression in the odontoblast layer (O) and pulp (P), between weeks 21 and 24. Concerning CD34 expression, we observed a decrease from weeks 9-10 until weeks 13-16, followed by an increase until weeks 21-24 of intrauterine life. From weeks 9-10, we observed a constant decrease of expression until weeks 13-16, followed by an increase during weeks 21-24. All Ki67, p53 and CD34 have been identified in the tooth bud. Ki67 expression gradually decreases with the embryonic development of the tooth, while p53 and CD34 expression decreases from weeks 9-10 to weeks 13-16 of intrauterine life, followed by an increase until weeks 21-24.
Barroca, H; Castedo, S; Vieira, J; Teixeira, M; Müller-Höcker, J
2009-01-01
Renal cell carcinoma (RCC) is a rare tumor in the pediatric population. Recently, a phenotypically and genetically distinct kidney carcinoma, mainly prevalent in children and associated with an Xp11.2 translocation or TFE3 gene fusion, has been described. It has been advanced that in this subtype of RCC, there is an accumulation of cyclin D1, cyclin D3, and p21 ((wafl/cip1)). The aim of the present study was to figure out in two pediatric RCC recently diagnosed in our department (one clear cell-type RCC and one TFE3-positive RCC) whether those features are indeed specific of the latter tumor or occur in pediatric RCC irrespective of the tumor type. The following immunostains were performed in both cases: Ki67, p16(ink4a), p21 ((wafl/cip1)), p27(kip1), p53, p63, mdm2, cyclin D1, cyclin D3, TFE3, CD10, vimentin, E-cadherin, and RCC-antigen. We observed in the TFE3-positive carcinoma an intense immunoreaction for p21 ((wafl/cip1)), cyclin D1, and cyclin D3, without expression for p53, p16, p27(kip1), and mdm2, whereas the immunoexpression profile observed in the classic RCC was similar to that of clear cell, adult-type RCC. Our study confirms that TFE3-positive RCC exhibits a deregulation of the cell cycle apparently unrelated to the young age of the patients.
Patrício, Patrícia; Ramalho-Carvalho, João; Costa-Pinheiro, Pedro; Almeida, Mafalda; Barros-Silva, João Diogo; Vieira, Joana; Dias, Paula Cristina; Lobo, Francisco; Oliveira, Jorge; Teixeira, Manuel R; Henrique, Rui; Jeronimo, Carmen
2013-01-01
Expression of PAX2 (Paired-box 2) is suppressed through promoter methylation at the later stages of embryonic development, but eventually reactivated during carcinogenesis. Pax-2 is commonly expressed in the most prevalent renal cell tumour (RCT) subtypes—clear cell RCC (ccRCC), papillary RCC (pRCC) and oncocytoma—but not in chromophobe RCC (chrRCC), which frequently displays chromosome 10 loss (to which PAX2 is mapped). Herein, we assessed the epigenetic and/or genetic alterations affecting PAX2 expression in RCTs and evaluated its potential as biomarker. We tested 120 RCTs (30 of each main subtype) and four normal kidney tissues. Pax-2 expression was assessed by immunohistochemistry and PAX2 mRNA expression levels were determined by quantitative RT-PCR. PAX2 promoter methylation status was assessed by methylation-specific PCR and bisulfite sequencing. Chromosome 10 and PAX2 copy number alterations were determined by FISH. Pax-2 immunoexpression was significantly lower in chrRCC compared to other RCT subtypes. Using a 10% immunoexpression cut-off, Pax-2 immunoreactivity discriminated chrRCC from oncocytoma with 67% sensitivity and 90% specificity. PAX2 mRNA expression was significantly lower in chrRCC, compared to ccRCC, pRCC and oncocytoma, and transcript levels correlated with immunoexpression. Whereas no promoter methylation was found in RCTs or normal kidney, 69% of chrRCC displayed chromosome 10 monosomy, correlating with Pax-2 immunoexpression. We concluded that Pax-2 expression might be used as an ancillary tool to discriminate chrRCC from oncocytomas with overlapping morphological features. The biological rationale lies on the causal relation between Pax-2 expression and chromosome 10 monosomy, but not PAX2 promoter methylation, in chrRCC. PMID:23890189
Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo
2017-12-01
Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Expression of cyclooxygenase-2 in the endometrium of gilts with different stages of endometritis.
Roongsitthichai, Atthaporn; Srisuwatanasagul, Sayamon; Koonjaenak, Seri; Tummaruk, Padet
2011-11-01
The present study determined the association among the expression of COX-2, stages of endometritis, and types and number of local immune cells infiltrating into the gilts' endometrium. The uterine tissues from 24 Landrace x Yorkshire gilts identified as acute endometritis (n = 7), chronic endometritis (n = 7), and normal endometrium (n = 10) were included. The tissues were prepared for both histological and immunohistochemical investigations. The immunoexpression of COX-2 in every layer of the gilts' endometria was appraised by avidin-biotin-peroxidase complex method via image analysis; and was reported as percentage of positive area and staining index. The results revealed that the immunoexpression of COX-2 was found only in the surface epithelial layer. The gilts with acute endometritis possessed higher both percentage of positive area (68.99% versus 4.50% and 3.43%, P < 0.001) and staining index (1.13 versus 0.05 and 0.04, P < 0.001) than those with chronic endometritis and normal endometrium, respectively. Positive correlations between the number of surface epithelial neutrophils and percentage of COX-2 positive area (r = 0.47, P = 0.022), as well as mean staining index (r = 0.44, P = 0.032) were observed. In conclusion, the immunoexpression of COX-2 was found strongest in the gilts with acute endometritis, meanwhile it was not different between those with chronic endometritis and normal endometrium. This suggested that the expression of COX-2 might be dependent not only on the infiltration of local immune cells in the endometrium, but also on the duration of exposure with inflammatory agents.
Sarmento, Dmitry José de Santana; Godoy, Gustavo Pina; Miguel, Márcia Cristina da Costa; da Silveira, Éricka Janine Dantas
2016-01-01
Background The studies found in the literature associate the immunoexpression of hMLH1 and hMSH2 proteins with histologic aspects, but do not correlate it with clinical and epidemiological data. Objective To evaluate the immunoexpression of hMLH1 and hMSH2 in actinic cheilitis, correlating it with clinical characteristics. Methods We analyzed 40 cases. Histological and immunohistochemical analyses were performed. The following clinical variables were evaluated: gender, age range, ethnicity, clinical aspect and occupational sunlight exposure. Statistical evaluation included the Student t-test, while the significance level was set at 5%. Results Greater immunoexpression of hMLH1 and hMSH2 was observed in females, individuals aged over 40, and mixed-race/black patients. Furthermore, the immunoexpression of these proteins was greater in actinic cheilitis with a white-colored appearance and in patients without occupational sunlight exposure. No statistical differences were observed for the variables studied. Conclusion This study uncovered variations of hMLH1 and hMSH2 protein expression upon evaluation of clinical aspects in actinic cheilitis. PMID:27579741
Sarmento, Dmitry José de Santana; Godoy, Gustavo Pina; Miguel, Márcia Cristina da Costa; Silveira, Éricka Janine Dantas da
2016-01-01
The studies found in the literature associate the immunoexpression of hMLH1 and hMSH2 proteins with histologic aspects, but do not correlate it with clinical and epidemiological data. To evaluate the immunoexpression of hMLH1 and hMSH2 in actinic cheilitis, correlating it with clinical characteristics. We analyzed 40 cases. Histological and immunohistochemical analyses were performed. The following clinical variables were evaluated: gender, age range, ethnicity, clinical aspect and occupational sunlight exposure. Statistical evaluation included the Student t-test, while the significance level was set at 5%. Greater immunoexpression of hMLH1 and hMSH2 was observed in females, individuals aged over 40, and mixed-race/black patients. Furthermore, the immunoexpression of these proteins was greater in actinic cheilitis with a white-colored appearance and in patients without occupational sunlight exposure. No statistical differences were observed for the variables studied. This study uncovered variations of hMLH1 and hMSH2 protein expression upon evaluation of clinical aspects in actinic cheilitis.
Fonseca-Alves, Carlos Eduardo; Kobayashi, Priscila Emiko; Rivera Calderón, Luis Gabriel; Felisbino, Sérgio Luis; Rinaldi, Jaqueline de Carvalho; Drigo, Sandra Aparecida; Rogatto, Silvia Regina; Laufer-Amorim, Renée
2018-01-01
An unusual variant of prostate adenocarcinoma (PC) expressing nuclear p63 in secretory cells instead of the typical basal expression has been reported in men. Nevertheless, the biological behavior and clinical significance of this phenomenon is unknown. In dogs, this unusual PC subtype has not been described. In this study, p63 immunoexpression was investigated in 90 canine PCs and 20 normal prostate tissues (NT). The p63 expression pattern in luminal or basal cells was confirmed in a selected group of 26 PCs and 20 NT by immunohistochemistry and/or Western blotting assays. Eleven canine PC samples aberrantly expressing p63 (p63+) in secretory cells were compared with 15 p63 negative (p63-) cases in the context of several molecular markers (high molecular weight cytokeratin-HMWC, CK8/18, CK5, AR, PSA, chromogranin, NKX3.1, PTEN, AKT and C-MYC). P63+ samples were positive for CK5, HMWC and CK8/18 and negative for PSA, NKX3.1, PTEN and chromogranin. Five p63+ PCs were negative for AR, and the remaining six samples had low AR expression. In contrast, p63- PC showed AR and PSA positive expression in all 15 samples. Only five p63- PCs were positive for CK5. Both p63+ and p63- PC samples showed higher cytoplasmic AKT expression and nuclear C-MYC staining in comparison with normal tissues. Metastatic (N = 12) and non-metastatic (N = 14) PCs showed similar immunoexpression for all markers tested. In contrast to human PC, canine PC aberrantly expressing p63 showed higher expression levels of HMWC and CK5 and lower levels of NKX3.1. Canine p63+ PC is a very rare PC group showing a distinct phenotype compared to typical canine PC, including AR and PSA negative expression. Although in a limited number of cases, p63 expression was not associated with metastasis in canine PC, and cytoplasmic p63 expression was observed in animals with shorter survival time, similar to human PC cases.
Patrício, Patrícia; Ramalho-Carvalho, João; Costa-Pinheiro, Pedro; Almeida, Mafalda; Barros-Silva, João Diogo; Vieira, Joana; Dias, Paula Cristina; Lobo, Francisco; Oliveira, Jorge; Teixeira, Manuel R; Henrique, Rui; Jeronimo, Carmen
2013-08-01
Expression of PAX2 (Paired-box 2) is suppressed through promoter methylation at the later stages of embryonic development, but eventually reactivated during carcinogenesis. Pax-2 is commonly expressed in the most prevalent renal cell tumour (RCT) subtypes-clear cell RCC (ccRCC), papillary RCC (pRCC) and oncocytoma--but not in chromophobe RCC (chrRCC), which frequently displays chromosome 10 loss (to which PAX2 is mapped). Herein, we assessed the epigenetic and/or genetic alterations affecting PAX2 expression in RCTs and evaluated its potential as biomarker. We tested 120 RCTs (30 of each main subtype) and four normal kidney tissues. Pax-2 expression was assessed by immunohistochemistry and PAX2 mRNA expression levels were determined by quantitative RT-PCR. PAX2 promoter methylation status was assessed by methylation-specific PCR and bisulfite sequencing. Chromosome 10 and PAX2 copy number alterations were determined by FISH. Pax-2 immunoexpression was significantly lower in chrRCC compared to other RCT subtypes. Using a 10% immunoexpression cut-off, Pax-2 immunoreactivity discriminated chrRCC from oncocytoma with 67% sensitivity and 90% specificity. PAX2 mRNA expression was significantly lower in chrRCC, compared to ccRCC, pRCC and oncocytoma, and transcript levels correlated with immunoexpression. Whereas no promoter methylation was found in RCTs or normal kidney, 69% of chrRCC displayed chromosome 10 monosomy, correlating with Pax-2 immunoexpression. We concluded that Pax-2 expression might be used as an ancillary tool to discriminate chrRCC from oncocytomas with overlapping morphological features. The biological rationale lies on the causal relation between Pax-2 expression and chromosome 10 monosomy, but not PAX2 promoter methylation, in chrRCC. © 2013 The Authors. Journal of Cellular and Molecular Medicine Published by Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Chaudhari, Narendra T; Tupkari, Jagdish V; Joy, Tabita; Ahire, Manisha S
2016-01-01
Background: Mammalian mismatch repair system is responsible for maintaining genomic stability during repeated duplications, and human MutL homolog 1 (hMLH1) protein constitutes an important part of it. Various isolated studies have reported the altered expression of hMLH1 in oral leukoplakia (OL) and oral squamous cell carcinoma (OSCC). Research is lacking in the quantitative estimation and comparison of hMLH1 expression in OL and OSCC. Aims: To evaluate, quantify and compare hMLH1 immunoexpression in normal oral mucosa, OL and OSCC. Settings and Design: Thirty patients of OL and thirty patients of OSCC formed the study group and thirty patients were included in the control group (normal oral mucosa). Formalin-fixed paraffin wax blocks were prepared from the tissue samples. Materials and Methods: Immunohistochemistry for hMLH1 was performed, and the total number of positive cells was counted in high-power fields, and based on that percentage positivity of hMLH1 was calculated in all the cases. Statistical Analysis: Kruskal–Wallis and t-test were used. P < 0.05 was considered to be statistically significant. Results: The mean hMLH1 value in control group, leukoplakia and OSCC was 78.26, 54.33 and 40.97 respectively. hMLH1 immunoexpression showed decreasing indexes from control group to leukoplakia and then further to OSCC. hMLH1 expression was significantly lower in OSCC as compared to leukoplakia. There was no significant correlation of mean hMLH1 expression between different clinical and histopathological stages of leukoplakia and OSCC. Conclusions: hMLH1 immunoexpression was inversely related to the degree of dysplasia. These findings suggest that there is a progressive decrease in hMLH1 expression from control to leukoplakia and further to OSCC. Thus, it can be concluded that hMLH1 can be used as a reliable biomarker for malignant transformation. PMID:27721611
Profile of NF-κBp(65/NFκBp50) among prostate specific antigen sera levels in prostatic pathologies.
Bouraoui, Y; Ben Jemaa, A; Rodriguez, G; Ben Rais, N; Fraile, B; Paniagua, R; Sellemi, S; Royuela, M; Oueslati, R
2012-10-01
The aim of this work was to characterise the immunoexpression of NF-κB (p50/p65) in human prostatic pathologies and to study its profiles of activation among sera prostate specific antigen antigen (PSA) according the three groups: 0-4ng/mL, 4-20ng/mL and >20ng/mL. Twenty-four men with benign prostate hyperplasia (BPH); 19 men with prostate cancer (PC) and five men with normal prostates (NP). Immunohistochemical and western blot analysis was performed. Serum levels of PSA were assayed by immulite autoanalyser. In BPH and PC samples, immunoexpressions were observed for NF-κBp65 and NF-κBp50; while in NP samples, only were detected NF-κBp50. PC samples showed immunoreactions to NF-κBp65 and NF-κBp50 more intense (respectively 24.18±0.67 and 28.23±2.01) than that observed in BPH samples (respectively18.46±2.04 and 18.66±1.59) with special localisation in the nucleus. Different profiles of NF-κBp65 immunoexpressions were observed and BPH patients with sera PSA levels between 0-4ng/mL presented a significant weak percentage compared to BPH patients with sera PSA levels between 4-20ng/mL and >20ng/mL. No immunoreactions to NF-κBp65 were observed in PC patients with sera PSA levels between 4-20ng/mL. The sensibility of both NF-κB and PSA to inflammation allowed confirming the relationship between these two molecules and its involvement in prostatic diseases progression (inflammatory and neoplasic). Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Cele, S B; Odun-Ayo, F; Onyangunga, O A; Moodley, J; Naicker, T
2018-08-01
Hepatocyte Growth Factor (HGF) plays a role in the migration and morphogenesis of different cell types and tissues. Preeclampsia (PE) is associated with deficient trophoblast invasion and placental insufficiency; hence HGF production is expected to be compromised. This study therefore aimed to immunolocalize and morphometrically analyse placental HGF in normotensive versus PE pregnancies stratified by HIV status and gestational age. Normotensive (N; n = 40) and preeclamptic (PE; n = 80) women were stratified by HIV status (HIV- and HIV+), and gestational age i.e. early onset of PE (EOPE; <34 weeks) and late onset of PE (LOPE; ≥34 weeks). Placental tissues were stained using conventional immunohistochemistry, performed using mouse anti-human HGF antibody. Morphometric image analysis was performed using Zeiss Axio-Vision software. HGF was immuno-localized within the syncytiotrophoblast, cytotrophoblast, endothelial and fibroblast-like cell populations of both conducting and exchange villi. Based on pregnancy type, HGF immunoexpression within the conducting villi was significantly different between Nvs EOPE (p = 0.0372) and EOPE vs LOPE (p = 0.0006). Within the exchange villi, no significant difference of HGF immunostaining was noted between N vs EOPE and N vs LOPE. A down-regulation of HGF immuno-expression was observed in LOPE compared to other groups within both villi types, albeit non-significant. Based on HIV status, no significant difference in HGF immuno-expression was demonstrated between HIV- vs HIV + within the exchange and conducting villi. However, the expression of HGF in HIV- group was elevated in both villi types. Across the groups, a significant difference was found between N+ vs EOPE- (p = 0.0207), EOPE+ vs LOPE- (p = 0.0036) and EOPE- vs LOPE- (p = 0.0016) of the conducting villi while no significant difference was found within the exchange villi. This novel study demonstrates that HGF was two-fold higher in conducting compared to exchange villi irrespective of the pregnancy type. HIV infection does not influence HGF expression within the conducting and exchange villi. The HGF/c-MET receptor complex may modulate the ligand expression within the placenta. Copyright © 2018 Elsevier B.V. All rights reserved.
p16 protein is upregulated in a stepwise fashion in colorectal adenoma and colorectal carcinoma.
Al-Ahwal, Mahmoud; Gomaa, Wafaey; Emam, Eman; Qari, Yousif; Buhmeida, Abdelbaset; Radwi, Salman; Al-Maghrabi, Basim; Al-Qahtani, Mohammad; Al-Maghrabi, Jaudah
2016-11-01
p16 is tumor suppressor gene acting as a cell cycle regulator. The present study was conducted to compare p16 expression in normal, dysplastic, and malignant colonic mucosae, and to explore its relation to clinicopathological variables and follow-up data in colorectal carcinoma (CRC). Tissue microarrays were performed from 25 normal colonic mucosae, 41 colonic adenomas, and 191 CRC, with corresponding 50 nodal metastases. Immunohistochemistry was performed using anti-p16 antibody, sections were scored, and statistical analysis was performed. K-ras mutation detection was also performed. Immunoexpression of p16 was significantly higher in CRC than in adenomas (P = 0.033) and normal colonic mucosa (P = 0.005). There was no statistically significant difference between p16 expression in CRC and nodal metastasis. There was no significant association between p16 immunoexpression in CRC and all clinicopathological data and survival probability. K-ras mutations were detected in 34% of CRC. However, there was no correlation between K-ras status and p16 expression (P = 0.325). Absence of p16 expression is correlated to a benign course of CRC adenomas. p16 has a key role in CRC progression and can be used as a marker for colorectal adenoma. On the other hand, it has no role as a predictive and/or prognostic factor in CRC. Further extended studies are required to explore the role of p16 as indicator of premalignant lesions in the colon and to test its relation with CRC histological grade, as well as to test its value as a new therapeutic target.
Interactions between glioma and pregnancy: insight from a 52-case multicenter series.
Peeters, Sophie; Pagès, Mélanie; Gauchotte, Guillaume; Miquel, Catherine; Cartalat-Carel, Stéphanie; Guillamo, Jean-Sébastien; Capelle, Laurent; Delattre, Jean-Yves; Beauchesne, Patrick; Debouverie, Marc; Fontaine, Denys; Jouanneau, Emmanuel; Stecken, Jean; Menei, Philippe; De Witte, Olivier; Colin, Philippe; Frappaz, Didier; Lesimple, Thierry; Bauchet, Luc; Lopes, Manuel; Bozec, Laurence; Moyal, Elisabeth; Deroulers, Christophe; Varlet, Pascale; Zanello, Marc; Chretien, Fabrice; Oppenheim, Catherine; Duffau, Hugues; Taillandier, Luc; Pallud, Johan
2018-01-01
OBJECTIVE The goal of this study was to provide insight into the influence of gliomas on gestational outcomes, the impact of pregnancy on gliomas, and the identification of patients at risk. METHODS In this multiinstitutional retrospective study, the authors identified 52 pregnancies in 50 women diagnosed with a glioma. RESULTS For gliomas known prior to pregnancy (n = 24), we found the following: 1) An increase in the quantified imaging growth rates occurred during pregnancy in 87% of cases. 2) Clinical deterioration occurred in 38% of cases, with seizures alone resolving after delivery in 57.2% of cases. 3) Oncological treatments were immediately performed after delivery in 25% of cases. For gliomas diagnosed during pregnancy (n = 28), we demonstrated the following: 1) The tumor was discovered during the second and third trimesters in 29% and 54% of cases, respectively, with seizures being the presenting symptom in 68% of cases. 2) The quantified imaging growth rates did not significantly decrease after delivery and before oncological treatment. 3) Clinical deterioration resolved after delivery in 21.4% of cases. 4) Oncological treatments were immediately performed after delivery in 70% of cases. Gliomas with a high grade of malignancy, negative immunoexpression of alpha-internexin, or positive immunoexpression for p53 were more likely to be associated with tumor progression during pregnancy. Deliveries were all uneventful (cesarean section in 54.5% of cases and vaginal delivery in 45.5%), and the infants were developmentally normal. CONCLUSIONS When a woman harboring a glioma envisions a pregnancy, or when a glioma is discovered in a pregnant patient, the authors suggest informing her and her partner that pregnancy may impact the evolution of the glioma clinically and radiologically. They strongly advise a multidisciplinary approach to management. ■ CLASSIFICATION OF EVIDENCE Type of question: association; study design: case series; evidence: Class IV.
Carlson, J A; Amin, S; Malfetano, J; Tien, A T; Selkin, B; Hou, J; Goncharuk, V; Wilson, V L; Rohwedder, A; Ambros, R; Ross, J S
2001-06-01
To determine if carcinogenic events in vulvar skin precede the onset of morphologic atypia, the authors investigated for derangements in DNA content, cell proliferation, and cell death in vulvar carcinomas and surrounding skin in 140 samples of tumor and surrounding skin collected from 35 consecutive vulvectomy specimen for squamous cell carcinoma (SCC) or vulvar intraepithelial neoplasia (VIN) 3. Vulvar non-cancer excisions were used as controls. Investigations consisted of histologic classification and measurement of 9 variables--epidermal thickness (acanthosis and rete ridge length), immunolabeling index (LI) for 3 proteins (p53 protein, Ki-67, and mdm-2), pattern of p53 expression (dispersed vs. compact), DNA content index, and presence of aneuploidy by image analysis and apoptotic rate by Apotag labeling. Significant positive correlations were found for all nine variables studied versus increasing histologic severity in two proposed histologic stepwise models of vulvar carcinogenesis (lichen sclerosus (LS) and VIN 3 undifferentiated associated SCC groups). High p53 LI (>25) and the compact pattern of p53 expression (suspected oncoprotein) significantly correlated with LS and its associated vulvar samples compared with samples not associated with LS (P < or = 0.001). Furthermore, p53 LI, mdm-2 LI, and pattern of p53 expression were concordant between patient matched samples of LS and SCC. In addition, mdm-2 LI significantly correlated with dispersed pattern p53 LI suggesting a response to wild-type p53 protein accumulation. These findings support the hypothesis that neoplastic transformation occurs in sequential steps and compromises proteins involved in the cell cycle control. Concordance of p53 and mdm-2 protein expression in LS and adjacent SCC provides evidence that LS can act as a precursor lesion in the absence of morphologic atypia. Overexpression of mdm-2 with stabilization and inactivation of p53 protein may provide an alternate pathway for vulvar carcinogenesis.
Vuong, Linda; Brobst, Daniel E.; Saadi, Anisse; Ivanovic, Ivana; Al-Ubaidi, Muayyad R.
2012-01-01
Purpose. Because of its role in cell cycle regulation and apoptosis, p53 may be involved in maintaining the post-mitotic state of the adult eye. To shed light on the role of p53 in retinal development and maintenance, this study investigated the pattern of expression of p53, its family members, and its regulators during the development of the mouse eye. Methods. Relative quantitative real-time PCR (qRT-PCR) was used to determine the steady-state levels of target transcripts in RNA extracted from wild-type mouse whole eyes or retinas between embryonic day (E) 15 and post-natal day (P) 30. Immunoblotting was used to compare the steady-state levels of the protein to that of the transcript. Results. Transcript and protein levels for p53 in the eye were highest at E17 and E18, respectively. However, both p53 transcript and protein levels dropped precipitously thereafter, and no protein was detected on immunoblots after P3. Expression patterns of p63, p73, Mdm2, Mdm4, and Yy1 did not follow that of p53. Immunohistochemistry analysis of the developing eye showed that both p53 and Mdm2 are abundantly expressed at E18 in all layers of the retinal neuroblast. Conclusions. Downregulation of p53 in the post-mitotic retina suggests that, although p53 may be involved in ocular and retinal development, it may play a minimal role in healthy adult retinal function. PMID:22714890
Immunoexpression of Th17-related cytokines in oral lichen planus.
Monteiro, Bárbara Vanessa de Brito; Pereira, Joabe Dos Santos; Nonaka, Cassiano F W; Godoy, Gustavo P; da Silveira, Éricka J D; Miguel, Márcia Cristina da Costa
2015-07-01
A recently described lineage of lymphocytes, Th17 cells, has been associated with inflammatory and autoimmune diseases. The aim of this article was to assess the immunoexpression of cytokines related to this lineage, interleukin-17 (IL-17) and IL-23 and in reticular and erosive oral lichen planus (OLP). The sample included 41 cases of OLP (23 reticular and 18 erosive) and 10 cases of inflammatory fibrous hyperplasia (IFH). Lymphocytes exhibiting cytoplasmic immunostaining were counted. Epithelial immunostaining was also evaluated. There was no statistical differences in the number of IL-17 and IL-23 lymphocytes between the OLP (55.40 and 48.40, respectively) and IFH (39.30 and 44.40, respectively). A significantly higher number of IL-23 lymphocytes was found in erosive OLP group (63.80) when compared with reticular (41.40) and IFH lesions (44.40) (P=0.019). Furthermore, epithelial immunopositivity for IL-17 and IL-23 was higher in OLP lesions than in IFH (P=0.012 and P=0.011, respectively). A significantly higher number of IL-23 lymphocytes in erosive OLP and the strong epithelial immunopositivity for IL-23 and IL-17 in OLP group could suggest an important participation of TCD4 Th17 response in this disorder.
Medulloblastoma: histopathologic and molecular markers of anaplasia and biologic behavior.
Min, Hye Sook; Lee, You Jeong; Park, Kyeongmee; Cho, Byung-Kyu; Park, Sung-Hye
2006-07-01
Large cell/anaplastic (LC/A) medulloblastoma (MB) is a recently recognized variant of medulloblastoma known to be associated with an advanced stage and a poor prognosis. Although Eberhart et al. suggested histopathologic grading of medulloblastoma in 2002, no consensus has been reached in terms of determining the criteria of an LC/A variant, and its biological behavior continues to be the subject of debate. We retrospectively analyzed 74 cases (range 0.25-15 years) of MB clinicopathologically using the criteria established by Eberhart et al. The LC/A variant was identified in 16 cases (22% of MB cases), five of which showed a poor outcome. Most LC/A variant cases revealed synaptophysin immunoexpression (75%), but no epidermal growth factor receptor (EGFR) expression. Expression of synaptophysin, NeuN, GFAP, p53, c-erbB2, and EGFR did not differ in LC/A and non-LC/A variants. Seven of the 74 cases of medulloblastoma showed erbB2 amplification by FISH, four of which were LC/A variants. N-myc amplification was observed in only one LC/A variant, but no c-myc amplification was found. In patients younger than 10 years, the LC/A variant showed a significantly poorer outcome than the non-LC/A variant (P = 0.02), while no difference was found in older patients. Multivariate analysis revealed only metastasis on MRI and p53 expression, but not anaplasia as unfavorable prognostic factors. Our study suggests that prognostic implications of anaplasia in medulloblastoma are uncertain, and that the reproducibility of the histopathologic criteria of the LC/A variant should be reassessed before they can be applied in practical use.
Effect of low-level laser therapy (660 nm) on the healing of second-degree skin burns in rats.
Renno, Ana Claudia Muniz; Iwama, Angela May; Shima, Patricia; Fernandes, Kelly Rossetti; Carvalho, Juliana Gonçalves; De Oliveira, Poliani; Ribeiro, Daniel Araki
2011-10-01
The aim of this study was to investigate the effects of 660 nm laser on the healing of burn wounds made on the backs of rats. Thirty-two Wistar male rats were used. The animals were randomly distributed into 2 groups of 16 animals each: control group (burned rats without treatment) and laser-treated group (burned rats treated with laser therapy). Each group was divided into two different subgroups, euthanized in different periods (subgroup A: 7 days post-surgery and subgroup B: 14 days post-surgery). Histopathological analysis revealed a significant decrease in the necrotic area in the laser-treated group compared to the controls at days 7 and 14 post-injury. COX-2 positive cells were found in a strong pattern in the group submitted to laser therapy after 7 days. Regarding VEGF immunomarker, a significant VEGF immunoexpression was detected in the laser-exposed group after 14 days when compared to the negative control group. Taken together, our results demonstrate that laser therapy is able to promote skin repair of burned rats as a result of decreasing necrotic area and an up-regulation of COX-2 and VEGF immunoexpression.
Co-expression of COX-2 and 5-LO in primary glioblastoma is associated with poor prognosis.
Wang, Xingfu; Chen, Yupeng; Zhang, Sheng; Zhang, Lifeng; Liu, Xueyong; Zhang, Li; Li, Xiaoling; Chen, Dayang
2015-11-01
Cyclooxygenase-2 (COX-2) and 5-lipoxygenase (5-LO) are important factors in tumorigenesis and malignant progression; however, studies of their roles in glioblastoma have produced conflicting results. To define the frequencies of COX-2 and 5-LO expression and their correlation with clinicopathological features and prognosis, tumor tissues from 76 cases of newly diagnosed primary ordinary glioblastoma were examined for COX-2 and 5-LO expression by immunohistochemistry. The expression levels of COX-2 and 5-LO and the relationships between the co-expression of COX-2/5-LO and patient age and gender, edema index (EI), Karnofsky Performance Scale and overall survival (OS) were analyzed. COX-2 and 5-LO were expressed in 73.7 % (56/76) and 92.1 % (70/76) of the samples, respectively. Among the clinicopathological characteristics, only age (>60 years) exhibited a significant association with the high expression of COX-2. No statistically significant correlations were found in the 5-LO cohort. A significant positive correlation was revealed between the COX-2 and 5-LO scores (r = 0.374; p = 0.001). The elevated co-expression of COX-2 and 5-LO was observed primarily in the patients over the age of 60 years. Patients with a high expression of COX-2 had a significantly shorter OS (p < 0.01), whereas the immunoexpression of 5-LO was not associated with the OS of patients with glioblastoma. Survival analysis indicated that simultaneous high levels of COX-2 and 5-LO expression were significantly correlated with poor OS and, conversely, that a low/low expression pattern of these two proteins was significantly associated with better OS (p < 0.05). Moreover, the Cox multivariable proportional hazard model showed that a high expression of COX-2, high co-expression of COX-2 and 5-LO, and a high Ki-67 index were significant predictors of shorter OS in primary glioblastoma, independent of age, gender, EI, 5-LO expression and p53 status. The hazard ratios for OS were 2.347 (95 % CI 1.30-4.25, p = 0.005), 1.900 (95 % CI 1.30-2.78, p = 0.001), and 2.210 (95 % CI 1.19-4.09, p = 0.011), respectively. These results suggest that COX-2 and 5-LO play roles in tumorigenesis and the progression of primary glioblastoma and that the co-expression pattern of COX-2/5-LO may be used as an independent prognostic factor in this disease.
Guadagno, Elia; Del Basso De Caro, Marialaura; Pignatiello, Sara; Sciammarella, Concetta; Solari, Domenico; Cappabianca, Paolo; Maiuri, Francesco; Dones, Flavia
2016-09-01
According to the 2007 WHO (World Health Organization) Classification, meningiomas are divided into three grades of malignancy, with different recurrence rate, based exclusively on histopathological parameters. Loss/reduction of PgR (Progesterone Receptor) expression and increased Ki67 L.I. (Labeling Index) have been proven as possible prognostic factors able to predict the relapse of the disease. However, they sometimes result unreliable, especially when discordant. p40 is the short form of the p53 homologue gene p63, also named ∆Np63, and its antibody has recently been introduced as a highly specific diagnostic marker of the squamous cell carcinoma of the lung. Nevertheless its expression has been found in many other unconventional sites (e.g. placenta, urotheluim, etc). Herein we assessed the immuno-expression of p40 protein in a series of 72 meningiomas (35 grade I and 37 grade II) and analyzed its correlation with clinicopathological parameters, overall survival and recurrence free interval. We found that a high p40 score correlated with high histological grade, presence of recurrence, increased Ki67 L.I. and loss/reduction of PgR signal. Moreover, a higher expression of p40 was shown to be a significant prognostic factor for the development of recurrences and resulted a prognostic independent variable in multivariate analysis. Overall, for the first time, we investigated the expression of p40 protein in meningiomas and explored its usefulness as prognostic marker in addition to PgR and Ki67 L.I.
Wazir, Javed Fayyaz; Brahmi, Urmil Prabha; Fakhro, Abdul Rahman
2017-01-01
The role of estrogen and progesterone receptors in breast cancer biology is well established. In contrast, other steroid hormones are less well studied. Glucocorticoids (GCs) are known to play a role in mammary development and differentiation; thus, it is of interest to attempt to delineate their immunoexpression across a spectrum of mammary epithelia. Aim. To delineate the distribution pattern of glucocorticoid receptors (GRs) in malignant versus nonmalignant epithelium with particular emphasis on lactational epithelium. Materials and Methods. Immunohistochemistry (IHC) for GRs was performed on archival formalin-fixed paraffin-embedded tissue blocks of 96 cases comprising 52 invasive carcinomas, 21 cases with lactational change, and 23 cases showing normal mammary tissue histology. Results. Results reveal an overexpression of GRs in mammary malignant epithelium as compared to both normal and lactational groups individually and combined. GR overexpression is significantly more pronounced in HER-2-negative cancers. Discussion. This is the first study to compare GR expression in human lactating epithelium versus malignant and normal epithelium. The article discusses the literature related to the pathobiology of GCs in the breast with special emphasis on breast cancer. Conclusion. The lactational epithelium did not show overexpression of GR, while GR was overexpressed in mammary NST (ductal) carcinoma, particularly HER-2-negative cancers. PMID:29348941
Primordial odontogenic tumor: An immunohistochemical profile
Bologna-Molina, Ronell; Mikami, Toshinari; Pereira-Prado, Vanesa; Pires, Fabio-Ramoa; Carlos-Bregni, Roman
2017-01-01
Background Primordial Odontogenic Tumor (POT) is a recently described odontogenic tumor characterized by a variably cellular loose fibrous tissue with areas similar to the dental papilla, covered by cuboidal to columnar epithelium that resembles the internal epithelium of the enamel organ, surrounded at least partly by a delicate fibrous capsule. The purpose of this study was to investigate the possible histogenesis and biological behavior of this rare tumor by means of a wide immunohistochemical analysis of its epithelial and mesenchymal components. Material and Methods The immunoexpression of twenty-three different antibodies were evaluated in four cases of POT. Results The epithelial cells that cover the periphery of the tumor showed immunopositivity for Cytokeratins 14 and 19, while Amelogenin, Glut-1, MOC-31, Caveolin-1. Galectin-3, PITX2, p53, Bax, Bcl-2, Survivin and PTEN were variably expressed in focal areas. The mesenchymal component of the tumor was positive for Vimentin, Syndecan-1, PITX2, Endoglin (CD105), CD 34, Cyclin D1, Bax, Bcl-2, Survivin and p53. PTEN and CD 90 showed a moderate positivity. BRAF V600E and Calretinin were negative in all samples. Cell proliferation markers (Ki-67, MCM-7) were expressed in <5% of the tumor cells. Conclusions According to these immunohistochemical findings, we may conclude that POT is a benign odontogenic tumor in which there is both epithelial and mesenchymal activity during its histogenesis, as there is expression of certain components in particular zones in both tissues that suggests this tumor develops during the immature (primordial) stage of tooth development, leading to its inclusion within the group of benign mixed epithelial and mesenchymal odontogenic tumours in the current World Health Organization classification of these lesions. Key words:Immunohistochemistry, jaw tumors, odontogenic, primordial. PMID:28390134
Lopes, Maria Luiza Diniz de Sousa; Nonaka, Cassiano Francisco Weege; Queiroz, Lélia Maria Guedes; de Souza, Lélia Batista; Miguel, Márcia Cristina da Costa; da Silveira, Éricka Janine Dantas
2016-09-01
Actinic cheilitis (AC) is a chronic inflammatory lesion that in some situations can turn into squamous cell carcinoma of the lip. The molecular mechanisms involved in this process are not yet completely understood. This study aimed to investigate the expression pattern of galectins in actinic cheilitis according to the histopathological grading. Immunoexpression of galectin-1, galectin-3, galectin-7, and galectin-9 was semiquantitatively analyzed in 65 cases of actinic cheilitis graded as low risk (n = 40) or high risk (n = 25) of malignant transformation. Association between the location of the galectins in the cellular compartments and histopathological grading was analyzed. Galectin-1 was mainly observed in the cell cytoplasm, and was elevated (score 3) in 60% of cases, regardless of the histopathological grade (P > 0.05). Galectin-3 expression was higher in high-risk group than in the low-risk group (P < 0.05), with a predominant expression in the cytoplasm and nucleus of low-risk (67.5%), and only in the cytoplasm of high-risk cases (60%) (P < 0.05). Galectin-7 expression did not show significant differences between low-risk and high-risk groups (P > 0.05). With respect to galectin-9, 89.2% of cases were positive, showing decrease in median of scores as there was an increase in histological grade (P < 0.001), with predominant expression in the nucleus and cytoplasm. This study is the first indication of galectins involvement in the pathogenesis and morphologic progression of actinic cheilitis, particularly galectin-3 and galectin-9. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Immunoexpression of EGFR and EMMPRIN in a series of cases of head and neck squamous cell carcinoma.
de Andrade, Ana Luiza Dias Leite; Ferreira, Stefânia Jeronimo; Ferreira, Sonia Maria Soares; Ribeiro, Camila Maria Beder; Freitas, Roseana de Almeida; Galvão, Hébel Cavalcanti
2015-10-01
The epidermal growth factor receptor (EGFR) and the extracellular matrix metalloproteinase inducer (EMMPRIN) have been identified as oncologically important targets. This study aimed to evaluate the immunoexpression of EGFR and EMMPRIN in a series of cases of head and neck squamous cell carcinoma (HNSCC). Forty-five cases of HNSCC were selected for this study and evaluated with anti-EGFR and anti-EMMPRIN antibodies. The percentage of positive cells was determined assessing to the following categories: score 1 (staining in 0-50% of cells), score 2 (staining in 51-75% of cells), and score 3 (staining in >75% of cells). Immunostaining intensity was graded according to the following parameters: score 1 (absent/weak expression) and score 2 (strong expression). For EGFR, a predominance of high median scores was observed in cases of both histological grades of malignancy and in different clinical stages (p>0.05). For EMMPRIN, a statistically significant difference was observed between the histological grades of malignancy (p=0.030). Regarding the immunostaining intensity of EMMPRIN, it was observed a predominance of score 1 in cases with stages I/II, whereas most cases with stages III/IV presented score 2 (p=0.032). Considering the anatomical location, most cases of buccal floor presented higher median score of EMMPRIN in comparison with the other sites (p=0.015). These findings suggest that both proteins are potential targets for cancer therapy and EMMPRIN can be used as a prognostic marker of a more aggressive biological behavior in patients with HNSCC. Copyright © 2015 Elsevier GmbH. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mullinax, R.L.; Gross, E.A.; Amberg, J.R.
1990-10-01
The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less
de Souza, Lélia Batista; de Oliveira, Lucileide Castro; Nonaka, Cassiano Francisco Weege; Lopes, Maria Luiza Diniz de Sousa; Pinto, Leão Pereira; Queiroz, Lélia Maria Guedes
2017-06-01
This study aimed to evaluate and compare the immunoexpression of glucose transporter-1 (GLUT-1) and angiogenic index between pleomorphic adenomas (PAs), adenoid cystic carcinomas (ACCs), and mucoepidermoid carcinomas (MECs) of the salivary glands, and establish associations with the respective subtype/histological grade. Twenty PAs, 20 ACCs, and 10 MECs were submitted to morphological and immunohistochemical analysis. GLUT-1 expression was semi-quantitatively evaluated and angiogenic index was assessed by microvessel counts using anti-CD34 antibody. Higher GLUT-1 immunoexpression was observed in the MECs compared to PAs and ACCs (p = 0.022). Mean number of microvessels was 66.5 in MECs, 40.4 in PAs, and 21.2 in ACCs (p < 0.001). GLUT-1 expression and angiogenic index showed no significant correlation in the tumors studied. Results suggest that differences in biological behavior of the studied tumors are related to GLUT-1. Benign and malignant salivary gland tumors differ in the angiogenic index; however, angiogenesis may be independent of the tumor cell's metabolic demand.
Vassallo, J; Pinto, G A; Alvarenga, J M; Zeferino, L C; Chagas, C A; Metze, K
2004-06-01
The importance of in situ immunodetection of hormone receptors for therapy planning and prognostic evaluation in patients with breast carcinoma is well established. Sensitive detection methods are of utmost importance, especially in poorly fixed tissues, which are not uncommon in routine pathologic practice. The purpose of the present study is to compare immunoexpression of estrogen receptors in 20 cases of invasive ductal carcinoma using two antibodies, 1D5 and 6F11, and to verify the effect of different antigen retrieval solutions and detection systems. Immunoperoxidase was performed on paraffin sections using 1D5 and 6F11 as primary antibodies. Heat-induced antigen retrieval was performed using citrate buffer (pH 6.0) or Tris-EDTA buffer (pH 8.9). Detection was achieved using the following systems: EnVision, EnVision Plus, and labeled streptavidin-biotin peroxidase complex. Reaction was semiquantified from 0 to 4. There were no differences between the two markers, 1D5 and 6F11, except when 6F11 was used with EnVision and citrate buffer, in which case weaker reactivity was observed. Only in this combination (6F11/EnVision) was EDTA buffer significantly better than citrate. Labeled streptavidin-biotin peroxidase complex presented the best results, followed by EnVision Plus.
Saetta, Angelica A; Levidou, Georgia; El-Habr, Elias A; Panayotidis, Ioannis; Samaras, Vassilis; Thymara, Irene; Sakellariou, Stratigoula; Boviatsis, Efstathios; Patsouris, Efstratios; Korkolopoulou, Penelope
2011-06-01
Although pERK and pAKT are reportedly activated in various neoplasms, little information is available about their significance in astrocytomas. Paraffin-embedded tissue from 82 patients with diffuse infiltrating astrocytomas (grades II to IV) was investigated for the association of pERK and pAKT activation with clinicopathological features, vascular endothelial growth factor (VEGF), isocitrate dehydrogenase 1 and microvascular parameters. Nuclear pERK labelling index (LI) increased with increasing cytoplasmic pERK LI and nuclear and cytoplasmic pAKT LI (p = 0.0019, p = 0.0260 and p = 0.0012, respectively). Accordingly, cytoplasmic pERK increased with increasing levels of nuclear (p = 0.0001) and marginally with cytoplasmic pAKT LI (p = 0.0526). Nuclear and cytoplasmic pERK LI and nuclear pAKT LI were positively correlated with tumour histological grade (p = 0.0040, p = 0.0238 for pERK and p = 0.0004 for pAKT, respectively). VEGF expression was correlated with nuclear pERK (p = 0.0099) and nuclear pAKT LI (p = 0.0002). Interestingly, pERK cytoplasmic LI increased with microvessel calibre (p = 0.0287), whereas pAKT nuclear LI was marginally related to microvessel density (p = 0.0685). The presence of IDH1-R132H was related only to histological grade and lower microvessel calibre. Multivariate survival analysis in the entire cohort selected cytoplasmic pAKT LI (p = 0.045), histological grade, microvessel calibre (p = 0.028), patients' age, gender and surgical excision as independent predictors of survival. Moreover, in glioblastomas, pERK nuclear LI emerged as a favourable prognosticator in the presence of IDH1-R132H. pERK and pAKT in astrocytomas are interrelated and associated with tumour grade and angiogenesis. Moreover, the importance of cytoplasmic pAKT immunoexpression in patients' prognosis and nuclear pERK immunoexpression in glioblastomas is confirmed.
Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats
Botcheva, Krassimira; McCorkle, Sean R.
2014-11-21
The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877
p53 genes function to restrain mobile elements
Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.
2016-01-01
Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264
2000-08-01
Spodoptera frugiperda (Sf21) cells were infected with a recombinant baculovirus expressing the wild-type human p53. 3-4 and 10-1 cells were grown at 37 ’C in...for further use. Spodoptera fugiperda (Sf21) cells were grown at 27 0C in TC-100 medium (GIBCO), supplemented with 10% of heat inactivated Fetal
Sanaat, Zohreh; Halimi, Monireh; Ghojezadeh, Morteza; Pirovi, Amir Hossein; Gharamaleki, Jalil Vaez; Ziae, Ali Esfahani Jamal Eivazi; Kermani, Iraj Aswadi
2013-01-01
Introduction Gastric cancer remains the second most common cause of cancer-related deaths worldwide. In many malignancies like, lung and breast, multiple prognostic factors are known, such as mutations in Ki-67, HER-2/neu, p53. In this study, we evaluated immunohistochemical protein expression patterns of cell-cycle-regulators p53, proliferation marker Ki-67, surface expression of CD44, HER-2/neu oncogene proposed as useful prognostic factors. Methods In this descriptive-analytic study, we evaluate 100 patients with gastric cancer who were referred to Shahid Ghazi Hospital or other oncology clinics of Tabriz University of Medical Sciences in 2005-2010. Patients with pathologic confirmation of gastric cancer were selected. Expression of p53, ki-67, CD-44, HER-2/neu were detected by immunohistochemical staining. Results In this study, 100 patients with gastric cancer participated. 76(76%) were men and 24(24%) were women with mean age of 64.02(8.05) years. Seventy two samples were intestinal type and 28 were diffuse type. CD44 was positive in 27(27%) patients. P53 was positive in 35(35%) patients. Ki-67 was positive in 53(53%) patients. HER-2/neu was positive in 51(51%) patients. Conclusion The frequency of positive p53, Ki-67, CD44 and HER-2/neu varied in different studies. Positive Ki-67 and HER-2/neu were not associated with changes in survival but positive p53 and CD44 were significantly associated with improved survival. PMID:24505530
Palli, D; Caporaso, N E; Shiao, Y H; Saieva, C; Amorosi, A; Masala, G; Rice, J M; Fraumeni, J F
1997-12-01
A series of 105 gastric cancer (GC) cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. Overall, 33 of 105 cases had a mutation (p53+) identified by single-strand conformational polymorphism and confirmed by sequencing (Y-H. Shiao et al., submitted for publication). p53+ cases had a more traditional dietary pattern (i.e., corn meal mush, meat soup, and other homemade dishes) and reported less frequent consumption of raw vegetables (particularly lettuce and raw carrots). A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. In addition, p53+ cases tended to be located in the upper portion of the stomach and to be associated with advanced age and blood group A. No relation was found between the presence of p53 mutations and histologically defined Helicobacter pylori infection, smoking history, family history of gastric cancer, education, and social class. Of the 33 p53+ cases, 19 had G:C-->A:T transitions at CpG sites. These tumors tended to occur in females and in association with H. pylori infection but not other risk factors. The remaining 14 cases with a p53 mutation had mainly transversions but also two deletions and two transitions at non-CpG sites. These tumors showed a strong positive association with a traditional dietary pattern and with the estimated intake of selected nutrients (nitrite, protein, and fat, particularly from animal sources). The findings of this case-case analysis suggest that p53 mutations at non-CpG sites are related to exposure to alkylating compounds from diet, whereas p53 mutations at CpG sites might be related to H. pylori infection.
The Isoforms of the p53 Protein
Khoury, Marie P.; Bourdon, Jean-Christophe
2010-01-01
p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206
Paget, Vincent; Lechevrel, Mathilde; André, Véronique; Le Goff, Jérémie; Pottier, Didier; Billet, Sylvain; Garçon, Guillaume; Shirali, Pirouz; Sichel, François
2012-01-01
Mutations in the TP53 gene are the most common alterations in human tumours. TP53 mutational patterns have sometimes been linked to carcinogen exposure. In hepatocellular carcinoma, a specific G>T transversion on codon 249 is classically described as a fingerprint of aflatoxin B1 exposure. Likewise G>T transversions in codons 157 and 158 have been related to tobacco exposure in human lung cancers. However, controversies remain about the interpretation of TP53 mutational pattern in tumours as the fingerprint of genotoxin exposure. By using a functional assay, the Functional Analysis of Separated Alleles in Yeast (FASAY), the present study depicts the mutational pattern of TP53 in normal human fibroblasts after in vitro exposure to well-known carcinogens: benzo[a]pyrene, aflatoxin B1 and acetaldehyde. These in vitro patterns of mutations were then compared to those found in human tumours by using the IARC database of TP53 mutations. The results show that the TP53 mutational patterns found in human tumours can be only partly ascribed to genotoxin exposure. A complex interplay between the functional impact of the mutations on p53 phenotype and the cancer natural history may affect these patterns. However, our results strongly support that genotoxins exposure plays a major role in the aetiology of the considered cancers. PMID:22319594
Sundin, Andrew; Grzywacz, Bartosz J; Yohe, Sophia; Linden, Michael A; Courville, Elizabeth L
2017-03-01
In this retrospective study from one institution, we performed a clinicopathological study of a cohort of patients with posttransplant lymphoproliferative disorder (PTLD) confined to the central nervous system. We also identified a comparison cohort of patients with de novo primary diffuse large B-cell lymphoma of the central nervous system. We performed a detailed morphologic review, evaluated Epstein-Barr virus (EBV) by in situ hybridization, and interpreted a panel of immunohistochemical stains in a subset of cases including Hans classification markers (CD10, BCL6, MUM1), p53, CD30, Myc, and BCL2. All 17 of the posttransplant and none of 11 de novo cases were EBV positive (P < .005). Morphologic patterns identified in the PTLD cases were monomorphic diffuse large B-cell lymphoma pattern (10 patients) and "T-cell-rich" pattern (7 patients). The monomorphic posttransplant cases were more likely to be Myc negative (P = .015) and CD30 positive (P < .005) than the de novo cases, and showed a similarly low rate of p53 positivity by immunohistochemistry. No prognostic factors for overall survival were identified. Central nervous system PTLD is EBV positive, typically lacks p53 and Myc expression by immunohistochemistry, and can present with numerous background T lymphocytes. Copyright © 2016 Elsevier Inc. All rights reserved.
Hu, Juhua; Li, Qian; Wang, Yanqing; Li, Song
2015-06-01
This study aimed to detect the immunoexpression of interleukin-21 (IL-21) and receptor activator. of nuclear factor KB ligand (RANKL) in periapical granulomas (PGs) and radicular cysts (RCs). The interaction of IL-21 with RANKL and its role in periapical pathogenesis were also speculated. A total of 32 PGs and 23 RCs were selected as experimental samples. Lesion size and occurrence of tenderness were recorded. Up to 10 healthy gingival tissues were collected as normal control samples. All tissues were subjected to immunohistocheincal analysis with anti-human IL-21 and RANKL polyclonal antibodies. The correlations of IL-21 with RANKL, lesion size, and the occurrence of tenderness of the PGs and RCs were evaluated. IL-21-positive cells were detected in all periapical lesion tissues but not in normal tissues. In the cyst group and granuloma group, the corresponding expression levels of IL-21 were 59.92±6.57 and 36.80± 6.81, whereas those of RANKL were 68.81±18.59 and 36.12±14.87, respectively. Moreover, t-test revealed a significantly higher expression of IL-21 and RANKL in RCs than in PGs (P<0.05). IL-21 and RANKL were positively correlated in both PGs and RCs (P<0.05). Furthermore, IL-21 was correlated with lesion size (P<0.05). This study demonstrated that IL-21 is potentially involved in the pathogenesis of apical periodontitis lesions. A role in the exacerbation of chronic inflammation, as well as in bone resorption, is suspected. Further studies are required to elucidate the specific functions of IL-21 in periradicular inflammatory processes.
Sur, Monalisa; Sur, Ranjan K; Cooper, Kum; Bizos, Damon
2003-02-01
Pre-brachytherapy biopsies and post-brachytherapy oesophagectomy specimens of 10 patients with early squamous cell carcinoma of the middle third of the oesophagus were examined for the expression of p53, bcl-2 and apoptosis using immunohistochemical markers. There was no expression of p53 in one patient in both pre- and post-brachytherapy specimens. In 8 patients, p53 staining was strongly positive (3+) with approximately 50% or more cells, and with diffuse and no specific pattern in the pre-brachytherapy biopsies. The tumour areas of the post-brachytherapy specimens of this group showed strong 3+ positivity with p53 (10-50% positive cell count), with the pattern being focal and peripheral in the tumour islands. The centre of the tumour islands showed necrosis and/or keratinisation. In one patient, the pre-brachytherapy biopsy showed expression of p53 while the post-brachytherapy specimen was negative. bcl-2 expression in both pre- and post-brachytherapy was equivocal and inconclusive in both the pre- and post-brachytherapy specimens. Apoptosis was negative in all the pre- and post-brachytherapy tissue sections in the presence of positive controls. Brachytherapy does not cause cell death by apoptosis but by necrosis and maturation of the cells into better differentiated cells, which is caused by OH free radical, and induction of the keratin gene respectively. It is possible that brachytherapy may cause destruction of cells containing wild-type p53, while mutant p53 in cells located at the tumour periphery escape the effect of brachytherapy. This may be responsible for the high incidence of local recurrence and distant metastasis in oesophageal cancer treated with radiotherapy. There is no effect of brachytherapy on bcl-2 expression in oesophageal cancer.
Faraj, Sheila F; Gonzalez-Roibon, Nilda; Munari, Enrico; Sharma, Rajni; Burnett, Arthur L; Cubilla, Antonio L; Netto, George J; Chaux, Alcides
2017-06-01
Insulin-like growth factor-1 receptor (IGF1R) plays a key role in cell growth and transformation. It is overexpressed in several solid tumors. This study evaluates IGF1R immunoexpression in penile squamous cell carcinoma (SCC). Four tissue microarrays were built from formalin-fixed, paraffin-embedded blocks of 112 penile SCC from Paraguay. Membranous IGF1R expression was evaluated by immunohistochemistry using two different approaches. An H-score was calculated in each spot (stain intensity by extent), and a median score per tumor was obtained. The second approach consisted of a score similar to the scoring system that was used for evaluating HER2 immunoexpression. For each case, the highest category obtained at any spot was used for statistical analyses. IGF1R expression was compared by histologic subtype, grade, and human papillomavirus (HPV) status. Median H-score was 22.5. The distribution of IGF1R expression by HER2 approach was as follows: 0 in 33.0% cases, 1+ in 46.4%, 2+ in 14.3%, and 3+ in 6.2%. IGF1R H-scores were associated with basaloid and warty/basaloid subtypes (p = 0.0026) and higher grade (p = 0.00052). Although weaker when using the HER2 approach, the association of IGF1R expression with subtype (p = 0.015) and grade (p = 0.015) remained significant. Furthermore, there was an association between IGF1R expression by HER2 approach and HPV status (p = 0.012). IGF1R was expressed in about two thirds of penile SCC cases, showing a strong positive association with histologic grade, subtype, and HPV status. Considering that grade is a predictor of outcome IGF1R expression may have prognostic relevance and could point to a potential role for IGF1R inhibitors in treating penile SCC.
Nakae, Shunsuke; Kato, Takema; Murayama, Kazuhiro; Sasaki, Hikaru; Abe, Masato; Kumon, Masanobu; Kumai, Tadashi; Yamashiro, Kei; Inamasu, Joji; Hasegawa, Mitsuhiro; Kurahashi, Hiroki; Hirose, Yuichi
2017-01-01
Most IDH mutant gliomas harbor either 1p/19q co-deletions or TP53 mutation; 1p/19q co-deleted tumors have significantly better prognoses than tumors harboring TP53 mutations. To investigate the clinical factors that contribute to differences in tumor progression of IDH mutant gliomas, we classified recurrent tumor patterns based on MRI and correlated these patterns with their genomic characterization. Accordingly, in IDH mutant gliomas (N = 66), 1p/19 co-deleted gliomas only recurred locally, whereas TP53 mutant gliomas recurred both locally and in remote intracranial regions. In addition, diffuse tensor imaging suggested that remote intracranial recurrence in the astrocytomas, IDH-mutant with TP53 mutations may occur along major fiber bundles. Remotely recurrent tumors resulted in a higher mortality and significantly harbored an 8q gain; astrocytomas with an 8q gain resulted in significantly shorter overall survival than those without an 8q gain. OncoScan® arrays and next-generation sequencing revealed specific 8q regions (i.e., between 8q22 and 8q24) show a high copy number. In conclusion, only tumors with TP53 mutations showed patterns of remote recurrence in IDH mutant gliomas. Furthermore, an 8q gain was significantly associated with remote intracranial recurrence and can be considered a poor prognostic factor in astrocytomas, IDH-mutant. PMID:29156679
Szychlinska, Marta Anna; Trovato, Francesca Maria; Di Rosa, Michelino; Malaguarnera, Lucia; Puzzo, Lidia; Leonardi, Rosy; Castrogiovanni, Paola; Musumeci, Giuseppe
2016-01-01
Osteoarthritis is the most common human arthritis characterized by degeneration of articular cartilage. Several studies reported that levels of human cartilage glycoprotein chitinase 3-like-1 (CHI3L1) are known as a potential marker for the activation of chondrocytes and the progression of Osteoarthritis (OA), whereas lubricin appears to be chondroprotective. The aim of this study was to investigate the co-expression and co-localization of CHI3L1 and lubricin in normal and osteoarthritic rat articular cartilage to correlate their modified expression to a specific grade of OA. Samples of normal and osteoarthritic rat articular cartilage were analyzed by the Kellgren–Lawrence OA severity scores, the Kraus’ modified Mankin score and the Histopathology Osteoarthritis Research Society International (OARSI) system for histomorphometric evaluations, and through CHI3L1 and lubricin gene expression, immunohistochemistry and double immuno-staining analysis. The immunoexpression and the mRNA levels of lubricin increased in normal cartilage and decreased in OA cartilage (normal vs. OA, p < 0.01). By contrast, the immunoexpression and the mRNA levels of CHI3L1 increased in OA cartilage and decreased in normal cartilage (normal vs. OA, p < 0.01). Our findings are consistent with reports suggesting that these two glycoproteins are functionally associated with the development of OA and in particular with grade 2/3 of OA, suggesting that in the future they could be helpful to stage the severity and progression of the disease. PMID:26978347
The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.
Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang
2017-05-01
This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.
Monti, Stefano; Chapuy, Bjoern; Takeyama, Kunihiko; Rodig, Scott J; Hao, Yangsheng; Yeda, Kelly T.; Inguilizian, Haig; Mermel, Craig; Curie, Treeve; Dogan, Ahmed; Kutok, Jeffery L; Beroukim, Rameen; Neuberg, Donna; Habermann, Thomas; Getz, Gad; Kung, Andrew L; Golub, Todd R; Shipp, Margaret A
2013-01-01
Summary Diffuse large B-cell lymphoma (DLBCL) is a clinically and biologically heterogeneous disease with a high proliferation rate. By integrating copy number data with transcriptional profiles and performing pathway analysis in primary DLBCLs, we identified a comprehensive set of copy number alterations (CNAs) that decreased p53 activity and perturbed cell cycle regulation. Primary tumors either had multiple complementary alterations of p53 and cell cycle components or largely lacked these lesions. DLBCLs with p53 and cell cycle pathway CNAs had decreased abundance of p53 target transcripts and increased expression of E2F target genes and the Ki67 proliferation marker. CNAs of the CDKN2A-TP53-RB-E2F axis provide a structural basis for increased proliferation in DLBCL, predict outcome with current therapy and suggest targeted treatment approaches. PMID:22975378
Carr, N J
2000-12-01
The monoclonal antibody M30 recognizes a neoepitope of cytokeratin 18 produced during apoptosis. It is reactive in formalin-fixed, paraffin-embedded tissue and has great potential in the study of apoptosis in clinical and experimental material. To compare the results of M30 immunoexpression with a more established technique of demonstrating apoptosis in tissue sections, in situ end-labeling. A secondary objective was to compare the results with immunoexpression of the proliferation-associated antigen Ki-67. Retrospective analysis of adenomas and adenocarcinomas of the large intestine. Immunohistochemistry for M30 and Ki-67, and in situ end-labeling. Formalin-fixed, paraffin-embedded tissue was used. The number of cells positive for M30, Ki-67, and in situ end-labeling, expressed as a proportion of the total number of cells counted. A strong positive correlation was found between in situ end-labeling and expression of M30, although the counts were widely scattered around the regression line. Counts of Ki-67 were strongly correlated with both M30 expression and in situ end-labeling. Immunoexpression of M30 was generally easier to interpret than in situ end-labeling, and the procedures for M30 immunohistochemistry were technically less exacting. These findings support the application of M30 immunoreactivity in the study of apoptosis.
Pontes, Hélder Antônio Rebelo; Pontes, Flávia Sirotheau Corrêa; Fonseca, Felipe Paiva; de Carvalho, Pedro Luiz; Pereira, Erika Martins; de Abreu, Michelle Carvalho; de Freitas Silva, Brunno Santos; dos Santos Pinto, Décio
2013-02-01
Oral leukoplakia is the main potentially malignant oral lesion, and oral squamous cell carcinoma accounts for more than 95% of all malignant neoplasms in the oral cavity. Therefore, the aim of this study was to verify the immunoexpression of nuclear factor κB (NF-κB) and cyclooxygenase-2 (COX-2) proteins in dysplastic oral lesions and oral squamous cell carcinoma. Immunohistochemical reactions were performed on 6 inflammatory fibrous hyperplasia, 28 oral leukoplakia, and 15 oral squamous cell carcinoma paraffin-embedded samples. Immunoperoxidase reaction for NF-κB and COX-2 was applied on the specimens, and the positivity of the reactions was calculated for 1000 epithelial cells. Using the analysis of variance and the Tukey post hoc statistical analyses, a significantly increased immunoexpression for NF-κB was observed when oral squamous cell carcinoma samples were compared with the other groups studied. However, using the Kruskal-Wallis and the Dunn post hoc tests, a statistically significant result for COX-2 expression was obtained only when the moderate dysplasia group was compared with the inflammatory fibrous hyperplasia group. Nuclear factor κB may participate in the malignant phenotype acquisition process of the oral squamous cell carcinoma in its late stages, whereas COX-2 may be involved in the early stages of oral carcinogenesis process. Copyright © 2013 Elsevier Inc. All rights reserved.
The antidepressant-like effect of Ocimum basilicum in an animal model of depression.
Ali, S S; Abd El Wahab, M G; Ayuob, N N; Suliaman, M
2017-01-01
We investigated the efficacy of Ocimum basilicum (OB) essential oils for treating depression related behavioral, biochemical and histopathological changes caused by exposure to chronic unpredictable mild stress (CUMS) in mice and to explore the mechanism underlying the pathology. Male albino mice were divided into four groups: controls; CUMS; CUMS plus fluoxetine, the antidepressant administered for pharmacological validation of OB; and CUMS plus OB. Behavioral tests included the forced swim test (FST), elevated plus-maze (EPM) and the open field test (OFT); these tests were performed at the end of the experiment. We assessed serum corticosterone level, protein, gene and immunoexpression of brain-derived neurotropic factor (BDNF) and glucocorticoid receptors (GRs) as well as immunoexpression of glial fibrillary acidic protein (GFAP), Ki67, caspase-3 in the hippocampus. CUMS caused depression in the mice as evidenced by prolonged immobility in the FST, prolonged time spent in the open arms during the EPM test and reduction of open field activity in the OFT. OB ameliorated the CUMS induced depressive status. OB significantly reduced the corticosterone level and up-regulated protein and gene expressions of BDNF and GR. OB reduced CUMS induced hippocampal neuron atrophy and apoptosis, and increased the number of the astrocytes and new nerve cells. OB significantly increased GFAP-positive cells as well as BDNF and GR immunoexpression in the hippocampus.
Protein expression patterns of cell cycle regulators in operable breast cancer.
Zagouri, Flora; Kotoula, Vassiliki; Kouvatseas, George; Sotiropoulou, Maria; Koletsa, Triantafyllia; Gavressea, Theofani; Valavanis, Christos; Trihia, Helen; Bobos, Mattheos; Lazaridis, Georgios; Koutras, Angelos; Pentheroudakis, George; Skarlos, Pantelis; Bafaloukos, Dimitrios; Arnogiannaki, Niki; Chrisafi, Sofia; Christodoulou, Christos; Papakostas, Pavlos; Aravantinos, Gerasimos; Kosmidis, Paris; Karanikiotis, Charisios; Zografos, George; Papadimitriou, Christos; Fountzilas, George
2017-01-01
To evaluate the prognostic role of elaborate molecular clusters encompassing cyclin D1, cyclin E1, p21, p27 and p53 in the context of various breast cancer subtypes. Cyclin E1, cyclin D1, p53, p21 and p27 were evaluated with immunohistochemistry in 1077 formalin-fixed paraffin-embedded tissues from breast cancer patients who had been treated within clinical trials. Jaccard distances were computed for the markers and the resulted matrix was used for conducting unsupervised hierarchical clustering, in order to identify distinct groups correlating with prognosis. Luminal B and triple-negative (TNBC) tumors presented with the highest and lowest levels of cyclin D1 expression, respectively. By contrast, TNBC frequently expressed Cyclin E1, whereas ER-positive tumors did not. Absence of Cyclin D1 predicted for worse OS, while absence of Cyclin E1 for poorer DFS. The expression patterns of all examined proteins yielded 3 distinct clusters; (1) Cyclin D1 and/or E1 positive with moderate p21 expression; (2) Cyclin D1 and/or E1, and p27 positive, p53 protein negative; and, (3) Cyclin D1 or E1 positive, p53 positive, p21 and p27 negative or moderately positive. The 5-year DFS rates for clusters 1, 2 and 3 were 70.0%, 79.1%, 67.4% and OS 88.4%, 90.4%, 78.9%, respectively. It seems that the expression of cell cycle regulators in the absence of p53 protein is associated with favorable prognosis in operable breast cancer.
Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong
2007-01-01
Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291
Fernández-Vega, Iván; Santos-Juanes, Jorge; Camacho-Urkaray, Emma; Lorente-Gea, Laura; García, Beatriz; Gutiérrez-Corres, Francisco Borja; Quirós, Luis M; Guerra-Merino, Isabel; Aguirre, José Javier
2018-02-12
Hepatocellular carcinoma (HCC) is the most common type of primary malignant tumor in the liver. One of the main features of cancer survival is the generalized loss of growth control exhibited by cancer cells, and Miki is a protein related to the immunoglobulin superfamily that plays an important role in mitosis. We aim to study protein expression levels of Miki in non-tumoral liver and 20 HCCs recruited from a Pathology Department. Clinical information was also obtained. A tissue microarray was performed, and immunohistochemical techniques applied to study protein expression levels of Miki. In normal liver, Miki was weakly expressed, showing nuclear staining in the hepatocytes. Cirrhotic areas and HCCs showed a variety of staining patterns. Most HCC samples showed positive expression, with three different staining patterns being discernible: nuclear, cytoplasmic and mixed. Statistical analysis showed a significant association between grade of differentiation, Ki-67 proliferative index, survival rates and staining patterns. This study has revealed the positive expression of Miki in normal liver, cirrhotic areas and HCCs. Three different staining patterns of Miki expression with clinical relevance were noted in HCCs.
Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K
2017-10-01
Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (<5 cm) tumour) were recruited. The gene products of c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p < 0.0001) in the positivity rate of c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.
Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G
2016-01-01
Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. The results obtained were analyzed using Spearman's Co-relation. The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found.
Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen
2018-06-01
The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.
REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO
XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.
2015-01-01
The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern of the mitochondrial redox state in colon cancer and the first to indicate that at tissue level the mitochondrial redox state is p53 dependent. The findings should assist in our understanding on colon cancer pathology and developing new imaging biomarkers for clinical applications. PMID:26207147
β-catenin as a prognostic factor for prostate cancer (PCa)
Nowicki, Andrzej; Duda-Szymańska, Joanna
2012-01-01
Introduction The prostate cancer is difficult to predict, and treatment failure is associated with local infiltration, as well as distant metastases. Adhesion and migration abilities to of cancer cells play a major role in formation of metastasis. The participation of β-catenin in pathogene-sis of many types of cancer and benign processes has been an important discovery of recent years. Material and methods The studied material was obtained by transrectal, sextant core biopsy from 102 patients hospitalized in Department of Urology, Regional Hospital in Kalisz (2001-2004). The aim of our study was to determine the predictive value of β-catenin immunoexpression in prostate cancer, to analyze the prognostic aspect of some histopathological features and finally to assess the relationship between β-catenin immunoreactivity and the microscopic image of the tumor. Relationships between the investigated variables were analyzed using the Chi2 test of compatibility. We used the Kaplan-Meier curves to assess survival differences between groups of patients. Finally we established which of the studied factors significantly affect the patient outcome, using the method of Cox proportional hazard regression. Results In prostate cancer in comparison with the normal epithelium, both the location and the strength of β-catenin immunoexpression are impaired. Conclusions Our results indicate that the presence of disorders in β-catenin immunoexpression in prostate cancer cells indicates a high risk of death due to tumor progression and makes it imperative for immediate treatment procedures. PMID:24578946
γ-amino butyric acid (GABA) level as an overall survival risk factor in breast cancer.
Brzozowska, Anna; Burdan, Franciszek; Duma, Dariusz; Solski, Janusz; Mazurkiewicz, Maria
2017-09-21
The γ-amino butyric acid (GABA) plays important role in the proliferation and migration of cancer cells. The aim of the study was to evaluate the level of GABA in breast cancer, in relation to clinical and epidemiological data. The study was conducted on 89 patients with breast cancer in stage I-II. GABA level was assessed using spectrofluorometric method in tumour homogenates. Immunoexpression of E-cadherin was evaluated histologically on paraffin fixed specimens. Overall and disease-free survival was assessed for a 15-year interval period. Median overall survival was significantly longer (127.2 months) in patients with a high level of GABA (>89.3 μg/1), compared with a group with a low level of the amino acid (106.4 months). Disease-free survival was insignificantly different - 99 and 109 months, respectively. A significantly longer overall survival (131.2 months) was seen among patients with a high level of GABA and positive E-cadherin immunoexpression, compared with a group characterized by a low level of GABA and lack of E-cadherin immunorectivity (98.1 months). The co-existence of negative immunoexpression of E-cadherin and low GABA concentration resulted in a six-fold increase in the risk of death (HR=6.03). GABA has a significant prognostic value in breast cancer. Co-existence of a low level of GABA and loss of E-cadherin immune-expression seems to be a new, independent, and negative prognostic marker of the neoplasm.
Structure and Kinetic Stability of the p63 Tetramerization Domain
Natan, Eviatar; Joerger, Andreas C.
2012-01-01
The p53 family of transcription factors—comprising p53, p63 and p73—plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D2 symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. PMID:22100306
Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A
2002-08-22
A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.
NASA Technical Reports Server (NTRS)
2008-01-01
This image shows a small-scale polygonal pattern in the ground near NASA's Phoenix Mars Lander. This pattern is similar in appearance to polygonal structures in icy ground in the arctic regions of Earth. Phoenix touched down on the Red Planet at 4:53 p.m. Pacific Time (7:53 p.m. Eastern Time), May 25, 2008, in an arctic region called Vastitas Borealis, at 68 degrees north latitude, 234 degrees east longitude. This image was acquired by the Surface Stereo Imager shortly after landing. On the Phoenix mission calendar, landing day is known as Sol 0, the first Martian day of the mission. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.Li, Mingzhao; Yu, Meng; Liu, Chao; Zhu, Haijing; Hua, Jinlian
2013-06-01
Reproduction is required for the survival of all mammalian animals. Spermatogenesis is an essential and complex developmental process that ultimately results in production of haploid spermatozoa. Recent studies demonstrated that Boule and stimulated by retinoic acid 8 (Stra8) played important roles in initiation meiosis in male germ cells. miR-34c is indispensable in the late steps of spermatogenesis; remarkably, the main function of miR-34c is to reduce cell proliferation potentiality and promote cellular apoptosis. The objectives of this study were to investigate the expression patterns of Boule, Stra8, P53 and miR-34c in dairy goat testis and their relationship in male germ line stem cells (mGSCs). The results first revealed the expression patterns of Boule, Stra8, P53 and miR-34c in 30 dpp, 90 dpp and adult testes of dairy goats. The expression levels of Boule, Stra8, P53 and miR-34c in adult dairy goat testes were significantly higher than that of 30 dpp. Overexpression of Boule and Stra8 promoted the expression of miR-34c in dairy goat mGSCs. In our previous study, we showed that miR-34c was P53 dependent in mGSCs. These results have shown that the up-regulation of miR-34c was not due to P53 protein activation but which might be caused by the up-regulation of Boule and Stra8 promoting the advance of meiosis. In addition, we found retinoic acid would decrease the expression of P53 and miR-34c, however, did not change the expression of c-Myc greatly. It suggested that the function of driving differentiation of dairy goat mGSCs by retinoic acid might not be caused by P53. Copyright © 2013 John Wiley & Sons, Ltd.
Hassan, Sobia; Syed, Serajuddaula; Kehar, Shahnaz Imdad
2014-01-01
Objective: This study aims to determine expression of Glial Fibrillary Acidic Protein and of Alpha Smooth Muscle Actin (α-SMA) in hepatic stellate cells of CHC cases and their association with stage of fibrosis. Methods: The study was conducted at Ziauddin University, Clifton Campus during the year 2010-2012. Sixty Chronic Hepatitis C cases were immmunostained using anti α-SMA antibody and anti-GFAP antibody. Semi quantitative scoring in pericentral, periportal and perisinusoidal area of each case was done to assess immunoexpression of each marker. Results : Immunoexpression of GFAP showed significant association with α-SMA. GFAP expression was inversely correlated with progression of fibrosis. Conclusion : GFAP could represent a useful marker for early hepatic stellate cells activation. Follow up biopsies showing decline in GFAP levels may help identify the target group requiring aggressive therapy. PMID:25225520
Structure and kinetic stability of the p63 tetramerization domain.
Natan, Eviatar; Joerger, Andreas C
2012-01-20
The p53 family of transcription factors--comprising p53, p63 and p73--plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D₂ symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. Copyright © 2011 Elsevier Ltd. All rights reserved.
p21 controls patterning but not homologous recombination in RPE development.
Bishop, A J R; Kosaras, B; Hollander, M C; Fornace, A; Sidman, R L; Schiestl, R H
2006-01-05
p21/WAF1/CIP1/MDA6 is a key cell cycle regulator. Cell cycle regulation is an important part of development, differentiation, DNA repair and apoptosis. Following DNA damage, p53 dependent expression of p21 results in a rapid cell cycle arrest. p21 also appears to be important for the development of melanocytes, promoting their differentiation and melanogenesis. Here, we examine the effect of p21 deficiency on the development of another pigmented tissue, the retinal pigment epithelium. The murine mutation pink-eyed unstable (p(un)) spontaneously reverts to a wild-type allele by homologous recombination. In a retinal pigment epithelium cell this results in pigmentation, which can be observed in the adult eye. The clonal expansion of such cells during development has provided insight into the pattern of retinal pigment epithelium development. In contrast to previous results with Atm, p53 and Gadd45, p(un) reversion events in p21 deficient mice did not show any significant change. These results suggest that p21 does not play any role in maintaining overall genomic stability by regulating homologous recombination frequencies during development. However, the absence of p21 caused a distinct change in the positions of the reversion events within the retinal pigment epithelium. Those events that would normally arrest to produce single cell events continued to proliferate uncovering a cell cycle dysregulation phenotype. It is likely that p21 is involved in controlling the developmental pattern of the retinal pigment. We also found a C57BL/6J specific p21 dependent ocular defect in retinal folding, similar to those reported in the absence of p53.
Sánchez-Aguilera, Abel; Sánchez-Beato, Margarita; García, Juan F; Prieto, Ignacio; Pollan, Marina; Piris, Miguel A
2002-02-15
p14(ARF), the alternative product from the human INK4a/ARF locus, antagonizes Hdm2 and mediates p53 activation in response to oncogenic stimuli. An immunohistochemical study of p14(ARF) expression in 74 samples of aggressive B-cell lymphomas was performed, demonstrating an array of different abnormalities. A distinct nucleolar expression pattern was detected in nontumoral tissue and a subset of lymphomas (50/74). In contrast, a group of cases (8/74) showed absence of p14(ARF) expression, dependent either on promoter hypermethylation or gene loss. Additionally, 16 out of 74 cases displayed an abnormal nuclear p14(ARF) overexpression not confined to the nucleoli, as confirmed by confocal microscopy, and that was associated with high levels of p53 and Hdm2. A genetic study of these cases failed to show any alteration in the p14(ARF) gene, but revealed the presence of p53 mutations in over 50% of these cases. An increased growth fraction and a more aggressive clinical course, with a shortened survival time, also characterized the group of tumors with p14(ARF) nuclear overexpression. Moreover, this p14(ARF) expression pattern was more frequent in tumors displaying accumulated alterations in the p53, p16(INK4a), and p27(KIP1) tumor supressors. These observations, together with the consideration of the central role of p14(ARF) in cell cycle control, suggest that p14(ARF) abnormal nuclear overexpression is a sensor of malfunction of the major cell cycle regulatory pathways, and consequently a marker of a high tumor aggressivity.
Zhang, Jin; Chen, Xiangling; Kent, Michael S.; Rodriguez, Carlos O.; Chen, Xinbin
2009-01-01
Spontaneous tumors in the dog offer a unique opportunity as models to study human cancer etiology and therapy. p53, the most commonly mutated gene in human cancers, is found to be altered in dog cancers. However, little is known about the role of p53 in dog tumorigenesis. Here, we found that upon exposure to DNA damage agents or Mdm2 inhibitor nutlin-3, canine p53 is accumulated and capable of inducing its target genes, MDM2 and p21. We also found that upon DNA damage, canine p53 is accumulated in the nucleus, followed by MDM2 nuclear translocation and increased 53BP1 foci formation. In addition, we found that canine p63 and p73 are up-regulated by DNA damage agents. Furthermore, colony formation assay showed that canine tumor cells are sensitive to DNA damage agents and nutlin-3 in a p53-dependent manner. Surprisingly, canine p21 is expressed as two isoforms. Thus, we generated multiple canine p21 mutants and found that aa 129 to 142 is required, whereas aa 139 is one of the key determinants, for two p21 isoform expression. Finally, we showed that although the full-length human p21 cDNA expresses one polypeptide, aa 139 appears to play a similar role as that in canine p21 for various migration patterns. Taken together, our results indicate that canine p53 family proteins have biological activities similar to human counterparts. These similarities make the dog as an excellent out-bred spontaneous tumor model and the dog can serve as a translation model from bench-top to cage-side and then to bed-side. PMID:19147538
Maeda, Tetsuyo; Nakanishi, Yoko; Hirotani, Yukari; Fuchinoue, Fumi; Enomoto, Katsuhisa; Sakurai, Kenichi; Amano, Sadao; Nemoto, Norimichi
2016-03-01
Triple negative breast cancer (TNBC) is immunohistochemically characterised by the lack of expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor type 2 (HER2). TNBC is known for its poor prognosis and high recurrence probability. There is no effective targeted treatment for TNBC, but only adjuvant chemotherapies. There are two TNBC subtypes, basal-like and non-basal-like, which are defined based on positive cytokeratin (CK) 5/6 and/or epidermal growth factor receptor (EGFR) expression. In particular, CK5/6 expression is reported to correlate with TNBC recurrence. TNBC lacks ER-α expression, but some TNBCs are known to express the androgen receptor (AR). Moreover, although p53 accumulation is detected in various malignant tumors, its influence on adjuvant chemotherapy for patients with TNBC remains unclear. The aim of this study was to assess the combined immunohistochemical expression of CK 5/6, AR, and p53 as a potential prognostic marker of adjuvant chemotherapy for patients with TNBC. The expression of CK5/6, AR, and p53 in formalin-fixed and paraffin-embedded (FFPE) surgical sections from 52 patients with TNBC was analysed by immunohistochemistry (IHC) and the co-expression patterns in individual cells were investigated by immunofluorescent (IF) staining. Low AR expression was correlated with high clinical stage (P < 0.05) and low nuclear grade (P < 0.05). The expression of CK5/6 and p53 did not correlate with clinicopathological features. Patients who needed adjuvant chemotherapy presented the worst prognosis. In particular, when the IHC expression pattern was CK5/6 (-), AR (-), and p53 (+), the disease free survival (DFS) and overall survival (OS) were the worst. On the other hand, patients with AR (+) and p53 (-) TNBC presented a good prognosis. The analysis of the co-expression status of these three markers showed that no cells presented both AR and CK5/6 expression. Furthermore, TP53 mRNA expression was higher in patients with AR-negative TNBC (P < 0.05) and in patients with the worst prognosis (P < 0.05) than in the other patients. These results suggested that, in patients with CK5/6-negative TNBC, AR expression correlated with good prognosis, but p53 accumulation correlated with poor prognosis. The present IHC markers allowed us to predict the post-surgery prognosis of patients with TNBC. In conclusion, TNBCs are heterogeneous. Patients with the CK5/6 (-), AR (-), and p53 (+) TNBC subtype, evaluated by IHC, presented the worst prognosis. These IHC markers will be helpful to follow patients with TNBC.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
The p53 breast cancer tissue biomarker in Indian women
Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev
2011-01-01
Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177
Evaluation of the clinical significance of human papillomavirus (HPV) 53.
Padalko, Elizaveta; Ali-Risasi, Catherine; Van Renterghem, Lieve; Bamelis, Mieke; De Mey, Anja; Sturtewagen, Yolande; Vastenavond, Hilde; Vanden Broeck, Davy; Weyers, Steven; Praet, Marleen
2015-08-01
Human papillomaviruses (HPV) are classified according to their potential for the development of cervical neoplasia. However, the carcinogenicity of HPV types forms an evolving continuum based on the newly available data especially regarding the role of probable and possible high-risk HPV types (pHR-HPV). The objective of the present work was to evaluate clinical significance of the pHR-HPV53. An observational cohort study of potential aetiological association between infection with HPV53 and development of high-grade cervical cytology was performed. The study was conducted in two geographically remoted hospitals, in Belgium and Democratic Republic of Congo, as an attempt to collect data from regions with different geographical distribution of HPV genotypes. The samples were taken during routine gynaecological visit in outpatient clinics of both participating hospitals. A total of 2283 liquid-Pap samples were taken from 1465 women at Ghent University Hospital, Belgium, and from 660 women at General Hospital and Ngaliema Hospital of Kinshasa, DRC. "HPV53-only"-pattern as evaluated by full HPV genotyping was found in samples from only 34 (1.6%) samples. The initial cytology represented next to non-dysplastic, undetermined and low-grade lesions also high-grade lesions (12%). For 26 (76.5%) from the 34 women presented with "HPV53-only"-pattern follow-up results were available showing no progression to malignancy. Our findings support very low to lacking carcinogenic potential of HPV53. Recognising extreme rarity in cervical cancer next to high prevalence in general population of HPV53, further studies investigating progression to high-grade lesions are needed to elucidate the oncogenic potential of pHR-HPV53. Copyright © 2015. Published by Elsevier Ireland Ltd.
Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N
2016-05-01
To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.
M2 macrophages and inflammatory cells in oral lesions of chronic paracoccidioidomycosis.
de Carli, Marina Lara; Miyazawa, Marta; Nonogaki, Suely; Shirata, Neuza Kasumi; Oliveira, Denise Tostes; Pereira, Alessandro Antônio Costa; Hanemann, João Adolfo Costa
2016-02-01
Paracoccidioidomycosis (PCM) is a systemic fungal infection caused by Paracoccidioides brasiliensis (Pb) and associated with deficient cellular immune response, which is modulated by inflammatory cells, mainly macrophages, and cytokines. Recently, the comprehension of the macrophage polarization mediated by Th1 and Th2 cytokines has contributed to elucidate the immune response that takes part in some diseases. Thus, the aim of this study was to assess the presence of Th1- and Th2-immune response and also Pb counting in oral lesions of chronic PCM. Forty-eight cases of chronic PCM oral lesions were included. All cases were classified as loose or dense granulomas. S100 protein, IL-1β, IL-6, TNF-α, CD163 and CD68 immunoexpressions, and Pb localization were evaluated. The fungi present in the tissue were quantified by anti-Pb antibody. Most patients were white men with mean age of 47 years old and showed higher incidence of multiple lesions. Loose granulomas were predominant and exhibited a great amount of M2 macrophages, which were visualized with anti-CD163 antibody. The expression for CD163 and CD68 was similar (P = 0.05), highlighting the predominance of M2 macrophages in PCM. IL-1β, IL-6, and TNF-α immunoexpression did not significantly change with CD163, CD68, and S100 protein. The number of fungi was significantly higher in cases with intense IL-1β immunoexpression (P = 0.003). M2-activated macrophages were the majority among inflammatory cells in chronic PCM, characterizing the action of a Th2-immune response. Nevertheless, Th1 cytokines were also found; mainly IL-1β, which was associated with fungi counting in oral lesions. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Immunoexpression of tryptase-positive mast cells in periapical granulomas and radicular cysts.
Costa Neto, H; de Andrade, A L D L; Gordón-Núñez, M A; Freitas, R de A; Galvão, H C
2015-08-01
To evaluate and compare the immunoexpression of tryptase in samples of periapical granulomas (PGs) and radicular cysts (RCs) correlating it with the type of lesion, localization, intensity of the inflammatory infiltrate and thickness of the cystic epithelial lining, in order to gain insight into the phlogistic role of these cells in the lesions studied. Twenty-five PGs and twenty-five RCs obtained from human teeth without endodontic treatment were submitted to morphological and immunohistochemical analysis using anti-tryptase antibody. Mast cells were identified and counted in three regions: intra-epithelial, central/superficial and deep portions. The data were analysed using the Mann-Whitney U-test (P < 0.05). In comparison with RCs, PGs exhibited higher immunoexpression of tryptase-positive mast cells located in both central/superficial and deep regions (P < 0.001 and P < 0.001, respectively). When considering the total number of mast cells and disregarding the location, the number of tryptase-positive mast cells increased gradually from RCs to PGs (P < 0.001). Lesions with inflammatory infiltrate grade III had greater number of tryptase-positive mast cells located in both central/superficial and deep regions than lesions with inflammatory infiltrates grade II (P = 0.045 and P = 0.025). When the location was ignored, the lesions with inflammatory infiltrate grade III also exhibited higher immunostaining of tryptase-positive mast cells (P = 0.01). Tryptase-positive mast cells were present in chronic periapical lesions in a larger number in periapical granulomas than in radicular cysts, in both central/superficial and deep regions. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.
Pereira Faustino, Isabel Schausltz; Azevedo, Rebeca Souza; Takahama, Ademar
2016-04-01
The aim of this study was to evaluate the possible associations among the histopathological diagnosis, the inflammatory infiltrate profile, the presence of pain, and the immunoexpression of matrix metalloproteinases MMP-2 and MMP-9 in periapical lesions from primary endodontic infection. Fifty-one primary periapical lesions obtained from extracted teeth were selected for this study. Patients were previously evaluated for the presence of pain and sinus tract related to the tooth to be extracted. Tissues were processed for microscopic examination and MMP-2 and MMP-9 immunoexpression. Microscopically, samples were classified as periapical granulomas or periapical cysts and the inflammatory infiltrate as chronic or mixed. The percentage of immunopositive cells for MMP-2 and MMP-9 of each case was performed based on 10 consecutive microscopic fields. The Student t or chi-square tests were used in the statistical analysis. Of the total, 28 cases were classified as periapical granulomas (54.90%) and 23 cases as periapical cysts (45.10%). Seventeen patients (33.33%) reported pain associated with the extracted tooth, with 12 cases of periapical granulomas (70.58%) and 5 cases of periapical cysts (29.42%). All cases showed immunopositivity for MMP-2 and MMP-9 in a high percentage of cells, mainly in the cytoplasm of the leukocytes. MMP-2 was expressed more in periapical granulomas than periapical cysts (P < .05) and in symptomatic cases (P < .05). According to the results, we may conclude that MMP-2 and MMP-9 are highly expressed in periapical lesions from a primary endodontic infection. Moreover, we may suggest MMP-2 is expressed more in periapical granuloma and in cases associated with pain. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Comparative immunoexpression of ICAM-1, TGF-β1 and ki-67 in periapical and residual cysts.
Martins, R; Armada, L; Dos Santos, T-C; Pires, F-R
2017-01-01
This study compared the immunohistochemical expression of ki-67, transforming growth factor beta 1 (TGF-β1) and intercellular adhesion molecule-1 (ICAM-1) in inflammatory periapical cysts and residual cysts. The study sample was composed by 25 periapical cysts and 25 residual cysts and immunohistochemical reactions were carried out using antibodies directed against ICAM-1, TGF-β1 and ki-67. Clinical, radiological, gross, histological and immunohistochemical data were tabulated for descriptive and comparative analysis using the SPSS software and differences were considered statistically significant when p<0.05%. There were no differences between the expression of ICAM-1 (p=0.239) and TGF-β1 (p=0.258) when comparing both groups. Ki-67 labeling index was higher in residual cysts compared to periapical cysts (p=0.017). Results from the present study suggest that some specific inflammatory stimuli on residual cysts would modulate their mechanisms of etiopathogenesis, growing and repair.
Sada, Haruki; Shimomura, Manabu; Hinoi, Takao; Egi, Hiroyuki; Kawaguchi, Koji; Yano, Takuya; Niitsu, Hiroaki; Saitou, Yasufumi; Sawada, Hiroyuki; Miguchi, Masashi; Adachi, Tomohiro; Ohdan, Hideki
2015-03-26
The standard operation for colitic cancer in ulcerative colitis (UC) is restorative proctocolectomy; however, sporadic colorectal cancer (CRC) can coincidentally arise in patients with UC and the optimal procedure remains controversial. Therefore, it is crucial to preoperatively determine whether the CRC in UC is a sporadic or colitic cancer. We report a case of avoiding proctocolectomy for sporadic CRC in a patient with UC based on preoperative diagnosis involving p53 immunostaining. A 73-year-old man with CRC in UC had undergone sigmoid colectomy with lymphadenectomy because of the submucosal deep invasion pathologically after endoscopic mucosal resection. The cancer was diagnosed sporadic cancer preoperatively not only based on the endoscopic, clinical, and histological patterns but also that the colon epithelium was unlikely to develop dysplasia as the circumference and unaffected UC mucosa did not detect p53 protein overexpression. Recent reports have shown that the immunohistochemical detection of p53 protein overexpression can be useful for a differential diagnosis and as a predictor of dysplasia and colitic cancer. The analysis of p53 mutation status based on immunostaining of p53 protein expression in the unaffected UC mucosa can be useful for the decision regarding a surgical procedure for CRC in patients with UC.
Molecular Regulation of DNA Damage-Induced Apoptosis in Neurons of Cerebral Cortex
Liu, Zhiping; Pipino, Jacqueline; Chestnut, Barry; Landek, Melissa A.
2009-01-01
Cerebral cortical neuron degeneration occurs in brain disorders manifesting throughout life, but the mechanisms are understood poorly. We used cultured embryonic mouse cortical neurons and an in vivo mouse model to study mechanisms of DNA damaged-induced apoptosis in immature and differentiated neurons. p53 drives apoptosis of immature and differentiated cortical neurons through its rapid and prominent activation stimulated by DNA strand breaks induced by topoisomerase-I and -II inhibition. Blocking p53-DNA transactivation with α-pifithrin protects immature neurons; blocking p53-mitochondrial functions with μ-pifithrin protects differentiated neurons. Mitochondrial death proteins are upregulated in apoptotic immature and differentiated neurons and have nonredundant proapoptotic functions; Bak is more dominant than Bax in differentiated neurons. p53 phosphorylation is mediated by ataxia telangiectasia mutated (ATM) kinase. ATM inactivation is antiapoptotic, particularly in differentiated neurons, whereas inhibition of c-Abl protects immature neurons but not differentiated neurons. Cell death protein expression patterns in mouse forebrain are mostly similar to cultured neurons. DNA damage induces prominent p53 activation and apoptosis in cerebral cortex in vivo. Thus, DNA strand breaks in cortical neurons induce rapid p53-mediated apoptosis through actions of upstream ATM and c-Abl kinases and downstream mitochondrial death proteins. This molecular network operates through variations depending on neuron maturity. PMID:18820287
Detection of lymphovascular invasion by D2-40 (podoplanin) immunoexpression in endometrial cancer.
Weber, Sarah K; Sauerwald, Axel; Pölcher, Martin; Braun, Michael; Debald, Manuel; Serce, Nuran Bektas; Kuhn, Walther; Brunagel-Walgenbach, Giesela; Rudlowski, Christian
2012-10-01
Lymph node involvement is a major feature in tumor spread of endometrial cancer and predicts prognosis. Therefore, evaluation of lymph vessel invasion (LVI) in tumor tissue as a predictor for lymph node metastasis is of great importance. Immunostaining of D2-40 (podoplanin), a specific marker for lymphatic endothelial cells, might be able to increase the detection rate of LVI compared with conventional hematoxylin-eosin (H-E) staining. The aim of this retrospective study was to analyze the eligibility of D2-40-based LVI evaluation for the prediction of lymph node metastases and patients' outcome. Immunohistochemical staining with D2-40 monoclonal antibodies was performed on paraffin-embedded tissue sections of 182 patients with primary endometrioid adenocarcinoma treated in 1 gynecologic cancer center. Tumors were screened for the presence of LVI. Correlations with clinicopathological features and clinical outcome were assessed. Immunostaining of D2-40 significantly increased the frequency LVI detection compared with conventional H-E staining. Lymph vessel invasion was identified by D2-40 in 53 (29.1%) of 182 tumors compared with 34 (18.3%) of 182 carcinomas by routine H-E staining (P = 0.001). D2-40 LVI was detectable in 81.0% (17/21) of nodal-positive tumors and significantly predicted lymph node metastasis (P = 0.001). Furthermore, D2-40 LVI was an independent prognostic factor for patients overall survival considering tumor stage, lymph node involvement, and tumor differentiation (P < 0.01). D2-40-negative tumors confined to the inner half of the myometrium showed an excellent outcome (5-year overall survival, 97.8%). D2-40-based LVI assessment improves the histopathological detection of lymphovascular invasion in endometrial cancer. Furthermore, LVI is of prognostic value and predicts lymph node metastasis. D2-40 LVI detection might help to select endometrial cancer patients who will benefit from a lymphadenectomy.
González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E
1997-01-01
AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671
Markers of potential malignancy in chronic hyperplastic candidiasis.
Darling, Mark R; McCord, Christina; Jackson-Boeters, Linda; Copete, Maria
2012-08-01
To examine the presence of markers associated with malignancy, including p53, p21 cyclin-dependent kinase inhibitor 1A, murine double minutes-2, and others, in chronic hyperplastic candidiasis. Immunohistochemical methods were used to examine the expression of p53, murine double minutes-2, p21 cyclin-dependent kinase inhibitor 1A, metallothionein, and proliferating cell nuclear antigen in 42 chronic hyperplastic candidiasis lesions and 11 non-infected control tissues. Terminal deoxynucleotidyl transferase-mediated digoxigenin-dUTP nick-end labeling was used to examine apoptosis, which was correlated with p53 expression. These markers were measured in lesions of chronic hyperplastic candidiasis that did not show any epithelial dysplasia or histological signs of malignancy. p53 scores were higher in chronic hyperplastic candidiasis than in controls (P = 0.0046). Murine double-minutes 2 levels were not elevated. p21 cyclin-dependent kinase inhibitor 1A was increased in parabasal (P < 0.0001) and basal epithelial cells. Chronic hyperplastic candidiasis lesions showed a similar basal/parabasal metallothionein staining pattern to that seen in normal squamous epithelium. Proliferating cell nuclear antigen was increased (P = 0.0007), as was apoptosis (P = 0.0033). Increased p53 in oral chronic hyperplastic candidiasis suggests an increased potential for malignant change in the epithelium, above that of normal tissues. Further functional investigation is required, as well as clinical follow-up studies. © 2012 Blackwell Publishing Asia Pty Ltd.
Microcystic adnexal carcinoma with sebaceous differentiation: Three cases.
Fernandez-Flores, Angel; Llamas-Velasco, Mar; Saus, Carles; Patel, Anisha; Rutten, Arno
2018-04-01
Microcystic adnexal carcinoma (MAC) is a low-grade malignant tumor of the skin. Histologically, this tumor shows a biphasic pattern, with cords and nests of basaloid cells, as well as keratin horn cysts. This biphasic histological appearance has been interpreted by some authors as a sign of double eccrine and folliculosebaceous-apocrine differentiation, whereas some other authors defend a solely eccrine differentiation. In this context, sebaceous differentiation in MAC would support the first option. However, there are only 3 cases of MAC with sebaceous differentiation in the literature, and all of them were reported before adipophilin was available, which in the appropriate context (eg, testing clear cells for sebaceous vs eccrine differentiation) is very useful. In this study, we present 3 cases of MAC with focal sebaceous differentiation confirmed by immunoexpression of adipophilin in the sebaceous foci. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
BTK blocks the inhibitory effects of MDM2 on p53 activity
Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador
2017-01-01
p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977
The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines
2012-01-01
Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the induction of apoptosis in HCT116 p53 −/− cells. Considering the fact that most tumors show a functional p53 inactivation, further research is needed to elucidate the long-term effects of saffron in p53 −/− tumors. PMID:22640402
Nooij, Linda S; Ter Haar, Natalja T; Ruano, Dina; Rakislova, Natalia; van Wezel, Tom; Smit, Vincent T H B M; Trimbos, Baptist J B M Z; Ordi, Jaume; van Poelgeest, Mariette I E; Bosse, Tjalling
2017-11-15
Purpose: Vulvar cancer (VC) can be subclassified by human papillomavirus (HPV) status. HPV-negative VCs frequently harbor TP53 mutations; however, in-depth analysis of other potential molecular genetic alterations is lacking. We comprehensively assessed somatic mutations in a large series of vulvar (pre)cancers. Experimental Design: We performed targeted next-generation sequencing (17 genes), p53 immunohistochemistry and HPV testing on 36 VC and 82 precursors (sequencing cohort). Subsequently, the prognostic significance of the three subtypes identified in the sequencing cohort was assessed in a series of 236 VC patients (follow-up cohort). Results: Frequent recurrent mutations were identified in HPV-negative vulvar (pre)cancers in TP53 (42% and 68%), NOTCH1 (28% and 41%), and HRAS (20% and 31%). Mutation frequency in HPV-positive vulvar (pre)cancers was significantly lower ( P = 0.001). Furthermore, a substantial subset of the HPV-negative precursors (35/60, 58.3%) and VC (10/29, 34.5%) were TP53 wild-type (wt), suggesting a third, not-previously described, molecular subtype. Clinical outcomes in the three different subtypes (HPV + , HPV - /p53wt, HPV - /p53abn) were evaluated in a follow-up cohort consisting of 236 VC patients. Local recurrence rate was 5.3% for HPV + , 16.3% for HPV - /p53wt and 22.6% for HPV - /p53abn tumors ( P = 0.044). HPV positivity remained an independent prognostic factor for favorable outcome in the multivariable analysis ( P = 0.020). Conclusions: HPV - and HPV + vulvar (pre)cancers display striking differences in somatic mutation patterns. HPV - /p53wt VC appear to be a distinct clinicopathologic subgroup with frequent NOTCH1 mutations. HPV + VC have a significantly lower local recurrence rate, independent of clinicopathological variables, opening opportunities for reducing overtreatment in VC. Clin Cancer Res; 23(22); 6781-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Qian, Maoxiang; Cao, Xueyuan; Devidas, Meenakshi; Yang, Wenjian; Cheng, Cheng; Dai, Yunfeng; Carroll, Andrew; Heerema, Nyla A.; Zhang, Hui; Moriyama, Takaya; Gastier-Foster, Julie M.; Xu, Heng; Raetz, Elizabeth; Larsen, Eric; Winick, Naomi; Bowman, W. Paul; Martin, Paul L.; Mardis, Elaine R.; Fulton, Robert; Zambetti, Gerard; Borowitz, Michael; Wood, Brent; Nichols, Kim E.; Carroll, William L.; Pui, Ching-Hon; Mullighan, Charles G.; Evans, William E.; Hunger, Stephen P.; Relling, Mary V.; Loh, Mignon L.
2018-01-01
Purpose Germline TP53 variation is the genetic basis of Li-Fraumeni syndrome, a highly penetrant cancer predisposition condition. Recent reports of germline TP53 variants in childhood hypodiploid acute lymphoblastic leukemia (ALL) suggest that this type of leukemia is another manifestation of Li-Fraumeni syndrome; however, the pattern, prevalence, and clinical relevance of TP53 variants in childhood ALL remain unknown. Patients and Methods Targeted sequencing of TP53 coding regions was performed in 3,801 children from the Children’s Oncology Group frontline ALL clinical trials, AALL0232 and P9900. TP53 variant pathogenicity was evaluated according to experimentally determined transcriptional activity, in silico prediction of damaging effects, and prevalence in non-ALL control populations. TP53 variants were analyzed for their association with ALL presenting features and treatment outcomes. Results We identified 49 unique nonsilent rare TP53 coding variants in 77 (2.0%) of 3,801 patients sequenced, of which 22 variants were classified as pathogenic. TP53 pathogenic variants were significantly over-represented in ALL compared with non-ALL controls (odds ratio, 5.2; P < .001). Children with TP53 pathogenic variants were significantly older at ALL diagnosis (median age, 15.5 years v 7.3 years; P < .001) and were more likely to have hypodiploid ALL (65.4% v 1.2%; P < .001). Carrying germline TP53 pathogenic variants was associated with inferior event-free survival and overall survival (hazard ratio, 4.2 and 3.9; P < .001 and .001, respectively). In particular, children with TP53 pathogenic variants were at a dramatically higher risk of second cancers than those without pathogenic variants, with 5-year cumulative incidence of 25.1% and 0.7% (P < .001), respectively. Conclusion Loss-of-function germline TP53 variants predispose children to ALL and to adverse treatment outcomes with ALL therapy, particularly the risk of second malignant neoplasms. PMID:29300620
Foster, K. Wade; Liu, Zhaoli; Nail, Clinton D.; Li, Xingnan; Fitzgerald, Thomas J.; Bailey, Sarah K.; Frost, Andra R.; Louro, Iuri D.; Townes, Tim M.; Paterson, Andrew J.; Kudlow, Jeffrey E.; Lobo-Ruppert, Susan M.; Ruppert, J. Michael
2006-01-01
KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions. PMID:15674344
Foster, K Wade; Liu, Zhaoli; Nail, Clinton D; Li, Xingnan; Fitzgerald, Thomas J; Bailey, Sarah K; Frost, Andra R; Louro, Iuri D; Townes, Tim M; Paterson, Andrew J; Kudlow, Jeffrey E; Lobo-Ruppert, Susan M; Ruppert, J Michael
2005-02-24
KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes, KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions.
Borrás, Elisa; Zaragozá, Rosa; Morante, María; García, Concha; Gimeno, Amparo; López-Rodas, Gerardo; Barber, Teresa; Miralles, Vicente J; Viña, Juan R; Torres, Luis
2003-04-01
Several clinical trials have revealed that individuals who were given beta-carotene and vitamin A did not have a reduced risk of cancer compared to those given placebo; rather, vitamin A could actually have caused an adverse effect in the lungs of smokers [Omenn, G.S., Goodman, G.E., Thornquist, M.D., Balmes, J., Cullen, M.R., Glass, A., Keogh, J.P., Meyskens, F.L., Valanis, B., Williams, J.H., Barnhart, S. & Hammar, S. N. Engl. J. Med (1996) 334, 1150-1155; Hennekens, C.H., Buring, J.E., Manson, J.E., Stampfer, M., Rosner, B., Cook, N.R., Belanger, C., LaMotte, F., Gaziano, J.M., Ridker, P.M., Willet, W. & Peto, R. (1996) N. Engl. J. Med. 334, 1145-1149]. Using differential display techniques, an initial survey using rats showed that liver RNA expression of c-H-Ras was decreased and p53 increased in rats with chronic vitamin A deficiency. These findings prompted us to evaluate the expression of c-Jun, p53 and p21WAF1/CIF1 (by RT-PCR) in liver and lung of rats. This study showed that c-Jun levels were lower and that p53 and p21WAF1/CIF1 levels were higher in chronic vitamin A deficiency. Vitamin A supplementation increased expression of c-Jun, while decreasing the expression of p53 and p21WAF1/CIF1. Western-blot analysis demonstrated that c-Jun and p53 showed a similar pattern to that found in the RT-PCR analyses. Binding of retinoic acid receptors (RAR) to the c-Jun promoter was decreased in chronic vitamin A deficiency when compared to control hepatocytes, but contrasting results were found with acute vitamin A supplementated cells. DNA fragmentation and cytochrome c release from mitochondria were analyzed and no changes were found. In lung, an increase in the expression of c-Jun produced a significant increase in cyclin D1 expression. These results may explain, at least in part, the conflicting results found in patients supplemented with vitamin A and illustrate that the changes are not restricted to lung. Furthermore, these results suggest that pharmacological vitamin A supplementation may increase the risk of adverse effects including the risk of oncogenesis.
Warren, Timothy A; Broit, Natasa; Simmons, Jacinta L; Pierce, Carly J; Chawla, Sharad; Lambie, Duncan L J; Quagliotto, Gary; Brown, Ian S; Parsons, Peter G; Panizza, Benedict J; Boyle, Glen M
2016-09-26
Squamous cell carcinoma (SCC) is the second most common cancer worldwide and accounts for approximately 30% of all keratinocyte cancers. The vast majority of cutaneous SCCs of the head and neck (cSCCHN) are readily curable with surgery and/or radiotherapy unless high-risk features are present. Perineural invasion (PNI) is recognized as one of these high-risk features. The molecular changes during clinical PNI in cSCCHN have not been previously investigated. In this study, we assessed the global gene expression differences between cSCCHN with or without incidental or clinical PNI. The results of the analysis showed signatures of gene expression representative of activation of p53 in tumors with PNI compared to tumors without, amongst other alterations. Immunohistochemical staining of p53 showed cSCCHN with clinical PNI to be more likely to exhibit a diffuse over-expression pattern, with no tumors showing normal p53 staining. DNA sequencing of cSCCHN samples with clinical PNI showed no difference in mutation number or position with samples without PNI, however a significant difference was observed in regulators of p53 degradation, stability and activity. Our results therefore suggest that cSCCHN with clinical PNI may be more likely to contain alterations in the p53 pathway, compared to cSCCHN without PNI.
Gandaglia, Giorgio; Karnes, R Jeffrey; Sivaraman, Arjun; Moschini, Marco; Fossati, Nicola; Zaffuto, Emanuele; DellʼOglio, Paolo; Cathelineau, Xavier; Montorsi, Francesco; Sanchez-Salas, Rafael; Briganti, Alberto
2017-07-01
According to the novel prostate cancer (PCa) grade grouping, men with Gleason score 8 should be included in the grade group 4 regardless of primary and secondary scores. We aimed at evaluating the effect of Gleason patterns on the risk of recurrence in men with grade group 4 PCa. Overall, 1,089 patients treated with radical prostatectomy with grade group 4 PCa at final pathology were identified. Biochemical recurrence (BCR) was defined as 2 consecutive prostate-specific antigen values≥0.2ng/ml and rising. Clinical recurrence (CR) was defined as positive imaging after BCR. Kaplan-Meier analyses assessed time to BCR and CR. Multivariable Cox regression analyses assessed the impact of Gleason patterns on the risk of BCR and CR. Overall, 295 (27.1%), 651 (59.8%), and 143 (13.1%) patients had pathologic Gleason pattern 3+5, 4+4, and 5+3. Overall, 435 (39.9%) patients had positive margins and 439 (30.2%), 300 (27.5%), 350 (32.1%), and 216 (19.8%) had pT2, pT3a, pT3b/4, and pN1 disease. Median follow-up was 83 months. Overall, 536 and 221 patients experienced BCR and CR. The 10-year BCR- and CR-free survival rates were 42.9% and 67.5% vs. 38.3% and 59.7% vs. 40.6% and 50.4% for patients with pathologic Gleason pattern 3+5 vs. 4+4 vs. 5+3, respectively (all P≤0.005). In multivariable analyses, patients with Gleason pattern 3+5 were at lower risk of BCR compared to those with 4+4 (P = 0.002). Men with Gleason pattern 3+5 were at lower risk of CR compared to those with 4+4 and 5+3 (all P≤ 0.01). Patients with a primary Gleason score 3 are at reduced risk of recurrence as compared to their counterparts with 4 or 5. Primary and secondary Gleason scores should be considered to stratify the risk of recurrence after surgery in patients with grade group 4 PCa. Copyright © 2017 Elsevier Inc. All rights reserved.
Vered, Marilena; Allon, Irit; Dayan, Dan
2009-03-01
The pattern of changes in the expression of mammary serine protease inhibitor (maspin) tumor suppressor protein in tongue epithelial lesions [hyperplasia (HP), mild dysplasia (MD), moderate-to-severe dysplasia (MSD) and squamous cell carcinoma (SCC)] was investigated and correlated to the expression of maspin-regulating factors p53 and p63, and the proliferation marker Ki-67. Cases of HP (n = 16), MD (n = 12), MSD (n = 11), and SCC (n = 22) were immunostained for maspin, p53, p63, and Ki-67. Maspin expression was scored separately for the basal, middle, and upper thirds of the epithelial width, and as the total sum of all 'thirds' (maspin-total). p53, p63, and Ki-67 were immuno-morphometrically assessed for the entire epithelial width. Maspin expression was differential and progressive extending to higher epithelial layers as dysplastic changes aggravated and culminated in carcinoma. Strong expression was related to MSD in the middle third and to carcinoma in the upper third. It was frequently lost at the invasion front, where the tumor was less differentiated. The changes in mean scores of maspin-total in the different study groups were positively correlated to the mean scores of p63 (r = 0.5, P < 0.001), p53 (r = 0.4, P = 0.004), and Ki-67 (r = 0.5, P < 0.001). Strong expression of maspin in the middle third of the epithelium may be considered a diagnostic sign of mild-to-moderate dysplasia and an indication of carcinoma in the upper third. The correlations between maspin and controlling factors (e.g. p63 and p53) may be events with key roles in the development of tongue carcinoma.
Synthesis and evaluation of modified chalcone based p53 stabilizing agents.
Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdel-Hamid; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib
2017-09-01
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (CAL-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI 50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI 50 of 0.473±0.043µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-h post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities. Copyright © 2017 Elsevier Ltd. All rights reserved.
Genomic instability--an evolving hallmark of cancer.
Negrini, Simona; Gorgoulis, Vassilis G; Halazonetis, Thanos D
2010-03-01
Genomic instability is a characteristic of most cancers. In hereditary cancers, genomic instability results from mutations in DNA repair genes and drives cancer development, as predicted by the mutator hypothesis. In sporadic (non-hereditary) cancers the molecular basis of genomic instability remains unclear, but recent high-throughput sequencing studies suggest that mutations in DNA repair genes are infrequent before therapy, arguing against the mutator hypothesis for these cancers. Instead, the mutation patterns of the tumour suppressor TP53 (which encodes p53), ataxia telangiectasia mutated (ATM) and cyclin-dependent kinase inhibitor 2A (CDKN2A; which encodes p16INK4A and p14ARF) support the oncogene-induced DNA replication stress model, which attributes genomic instability and TP53 and ATM mutations to oncogene-induced DNA damage.
Wanderley, Maria I; Saraiva, Karina L A; César Vieira, Juliany S B; Peixoto, Christina A; Udrisar, Daniel P
2013-06-01
The aim of this study was to examine the effect of maternal exposure to Panax ginseng extract (GE) on the prenatal dexamethasone (DEXA)-induced increase in testosterone production by isolated Leydig cells in adult rats. Pregnant rats were treated with (i) GE (200 mg/kg) or vehicle on days 10-21; (ii) DEXA (100 μg/kg) or vehicle on days 14-21; or (iii) a combination of GE plus DEXA at the same doses and with the same regimen. Testosterone production was induced either by the activator of protein kinase A (dbcAMP) or substrates of steroidogenesis [22(R)-hydroxycholesterol (22(R)-OH-C)] and pregnenolone. The capacity of rat Leydig cells exposed to DEXA to synthesize testosterone induced by dbcAMP, 22(R)-OH-C or pregnenolone was increased in comparison with the control group. Combined exposure to DEXA + GE prevented the effect of DEXA on the responsiveness of Leydig cells to all inductors of testosterone synthesis, whereas GE alone did not modify the response to inductors. No modifications in testosterone production were observed under basal conditions. StAR immunoexpression in Leydig cells was not modified by prenatal exposure to DEXA, GE or DEXA + GE. P450scc and glucocorticoid receptor immunoexpression was higher in offspring exposed to DEXA in comparison with the control group. This increased expression was prevented by combined treatment with DEXA + GE. The present findings demonstrate that GE is capable of reversing the effect of DEXA on testosterone synthesis by rat Leydig cells. © 2013 The Authors. International Journal of Experimental Pathology © 2013 International Journal of Experimental Pathology.
Paul, Catriona; Rhind, Stewart M.; Kyle, Carol E.; Scott, Hayley; McKinnell, Chris; Sharpe, Richard M.
2005-01-01
The purpose of this study was to evaluate whether experimental exposure of pregnant sheep to a mixture of environmental chemicals added to pasture as sewage sludge (n = 9 treated animals) exerted effects on fetal testis development or function; application of sewage sludge was undertaken so as to maximize exposure of the ewes to its contents. Control ewes (n = 9) were reared on pasture treated with an equivalent amount of inorganic nitrogenous fertilizer. Treatment had no effect on body weight of ewes, but it reduced body weight by 12–15% in male (n = 12) and female (n = 8) fetuses on gestation day 110. In treated male fetuses (n = 11), testis weight was significantly reduced (32%), as were the numbers of Sertoli cells (34% reduction), Leydig cells (37% reduction), and gonocytes (44% reduction), compared with control fetuses (n = 8). Fetal blood levels of testosterone and inhibin A were also reduced (36% and 38%, respectively) in treated compared with control fetuses, whereas blood levels of luteinizing hormone and follicle-stimulating hormone were unchanged. Based on immunoexpression of anti-Müllerian hormone, cytochrome P450 side chain cleavage enzyme, and Leydig cell cytoplasmic volume, we conclude that the hormone changes in treated male fetuses probably result from the reduction in somatic cell numbers. This reduction could result from fetal growth restriction in male fetuses and/or from the lowered testosterone action; reduced immunoexpression of α-smooth muscle actin in peritubular cells and of androgen receptor in testes of treated animals supports the latter possibility. These findings indicate that exposure of the developing male sheep fetus to real-world mixtures of environmental chemicals can result in major attenuation of testicular development and hormonal function, which may have consequences in adulthood. PMID:16263515
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
Zhou, Xin; Ma, Xiaofei; Wang, Zhenhua; Sun, Chao; Wang, Yupei; He, Yang; Zhang, Hong
2015-12-15
Radiation-induced hyperproliferation of intestinal crypts is well documented, but its potential tumorigenic effects remain elusive. Here we aim to determine the genomic surveillance process during crypt hyperproliferation, and its consequential outcome after ionizing radiation. Crypt regeneration in the intestine was induced by a single dose of 12Gy abdominal irradiation. γ-H2AX, 53BP1 and DNA-PKcs were used as DNA repair surrogates to investigate the inherent ability of intestinal crypt cells to recognize and repair double-strand breaks. Ki67 staining and the 5-bromo-2'-deoxyuridine incorporation assay were used to study patterns of cell proliferation in regenerating crypts. Staining for ATM, p53, Chk1 and Chk2 was performed to study checkpoint activation and release. Apoptosis was evaluated through H&E staining and terminal deoxynucleotidyl transferase (dUTP) nick-end labeling. The ATM-p53 pathway was immediately activated after irradiation. A second wave of DSBs in crypt cells was observed in regenerating crypts, accompanied with significantly increased chromosomal bridges. The p53-related genomic surveillance pathway was not active during the regeneration phase despite DSBs and chromosomal bridges in the cells of regenerating crypts. Non-homologous end joining (NHEJ) DSBs repair was involved in the DSBs repair process, as indicated by p-DNA-PKcs staining. Intestinal crypt cells retained hyperproliferation with inactive p53-related genomic surveillance system. NHEJ was involved in the resultant genomic instability during hyperproliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Kaminagakura, E; Bonan, P R F; Lopes, M A; Almeida, O P
2006-09-01
Paracoccidioidomycosis (PCMycosis) is a systemic mycosis frequently found in many regions of Latin America. Microscopically, it is characterised by granulomatous inflammation and pseudoepitheliomatous hyperplasia (PEH). This work describes the proliferation index and p53 expression by immunohistochemistry in PEH of PCMycosis, normal oral mucosa (NOM) and mild oral epithelial dysplasia (ED). Ki67 positive cells were present in the basal and parabasal layers in NOM and PEH, while in ED it was also observed in the spinous layer. Percentage of ki67 positive cells was 7.7, 28.2 and 46.0 in NOM, PEH and ED respectively. p53 was negative in NOM and in PEH it was expressed by few cells in the basal layer of only three cases. However, it was expressed in all cases of ED, in basal and parabasal layers. Although histologically PEH mimics well-differentiated squamous cell carcinoma, its proliferative pattern and p53 expression are more similar to NOM than to dysplasia. These findings, confirm PEH as a reactive process probably associated with the underlying chronic inflammation.
2010-01-01
Introduction Women with ductal hyperplasia including usual ductal hyperplasia (UDH) and atypical ductal hyperplasia (ADH) have an increased risk of developing invasive ductal carcinoma (IDC) of breast. The importance of several molecular markers in breast cancer has been of considerable interest during recent years such as p53 and estrogen receptor alpha (ERα). However, p53 nuclear accumulation and ERα expression have not been assessed in ductal hyperplasia co-existing with ductal carcinoma in situ (DCIS) or IDC versus pure ductal hyperplasia without DCIS or IDC. Materials and methods We investigated p53 nuclear accumulation and ERα expression in breast ductal hyperplasia in a cohort of 215 Chinese women by immunohistochemistry (IHC), which included 129 cases of pure ductal hyperplasia, 86 cases of ductal hyperplasia co-existing with DCIS (41 cases) or IDC (45 cases). Results Nuclear p53 accumulation was identified in 22.8% of ADH (31/136), 41.5% of DCIS (17/41) and 42.2% of IDC (19/45), and no case of UDH (0/79). No difference in nuclear p53 accumulation was observed between pure ADH and ADH co-existing with DCIS (ADH/DCIS) or IDC (ADH/IDC) (P > 0.05). The positive rate of ERα expression was lower in ADH (118/136, 86.8%) than that in UDH (79/79, 100%) (P < 0.001), but higher than that in DCIS (28/41, 68.3%) or IDC (26/45, 57.8%) respectively (P < 0.001). The frequency of ERα expression was lower in ADH/DCIS (23/29, 79.31%) and ADH/IDC (23/30, 76.67%) than that in pure ADH (72/77, 93.51%) respectively (P < 0.05). There was a negative weak correlation between p53 nuclear accumulation and ERα expression as for ADH (coefficient correlation -0.51; P < 0.001). Conclusions Different pathological types of ductal hyperplasia of breast are accompanied by diversity in patterns of nuclear p53 accumulation and ERα expression. At least some pure ADH is molecularly distinct from ADH/CIS or ADH/IDC which indicated the two types of ADH are molecularly distinct entities although they have the same morphological appearance. PMID:20712900
Khabaz, Mohamad Nidal; Abdelrahman, Amer Shafie; Butt, Nadeem Shafique; Al-Maghrabi, Basim; Al-Maghrabi, Jaudah
2017-10-01
Cyclin D1 overexpression has been described to have oncogenic role and association with diagnosis, prognosis and survival in various tumors. This study will describe the immunohistochemical phenotype of cyclin D1, and investigate the correlation between these patterns of expression and clinicopathological parameters of endometrial carcinomas, to conclude the clinical relevance of cyclin D1 expression in the evolution of endometrial neoplasms. This study employed 101 endometrial tissue samples which include 71 endometrial carcinomas and thirty normal and benign endometrium cases. All these tissue samples were used in the assembly of tissue microarrays which have been utilized afterward in immunohistochemistry staining to detect cyclin D1 expression. Forty (56.3%) cases of endometrial carcinomas showed brown nuclear expression of cyclin D1 including 36 (61%) cases of endometrioid carcinomas, and 3 (33.3%) cases of serous carcinomas. Twenty three (76.6%) cases of control group demonstrated nuclear expression. High score cyclin D1 immunohistochemical staining has been significantly linked with patient age (P=0.0001). Large proportion of high score cyclin D1 immunohistochemical staining was observed in females who are <40years of age while high proportions of negative staining were observed in older age groups. Histologic type of tissue was also significantly related to cyclin D1 immunohistochemical staining (P-value=0.0001), high staining is more common in normal proliferative and secretory endometrium while serous carcinoma is more prevalent with negative staining. Stage of tumor was significantly associated with cyclin D1 immunohistochemical staining (P-value=0.029), proportion of stage III and IV are higher in negative cyclin D1 immunostaining. Significantly higher proportion of high score cyclin D1 immunostaining is observed in controls while higher proportion of negative cyclin D1 immunostaining is observed among carcinoma cases (P-value=0.0001). No significant associations between cyclin D1 immunohistochemical staining and grade, recurrence and alive status were observed. Significant different survival distributions were observed (P-value=0.011) and poor survival behavior was correlated with negative cyclin D1 immunohistochemical staining. In conclusion, greater frequency of cyclin D1 expression was revealed in normal endometrial tissues in comparison with carcinomas. The distribution pattern of cyclin D1 immunoexpression suggests poor prognoses in endometrial carcinoma patients. Copyright © 2017 Elsevier Inc. All rights reserved.
Genomic alterations in spontaneous and carcinogen-induced murine melanoma cell lines.
Melnikova, Vladislava O; Bolshakov, Svetlana V; Walker, Christopher; Ananthaswamy, Honnavara N
2004-03-25
We have conducted an analysis of genetic alterations in spontaneous murine melanoma cell line B16F0 and its two metastatic clones, B16F1 and B16F10 and the carcinogen-induced murine melanoma cell lines CM519, CM3205, and K1735. We found that unlike human melanomas, the murine melanoma cell lines did not have activating mutations in the Braf oncogene at exon 11 or 15. However, there were distinct patterns of alterations in the ras, Ink4a/Arf, and p53 genes in the two melanoma groups. In the spontaneous B16 melanoma cell lines, expression of p16Ink4a and p19Arf tumor suppressor proteins was lost as a consequence of a large deletion spanning Ink4a/Arf exons 1alpha, 1beta, and 2. In contrast, the carcinogen-induced melanoma cell lines expressed p16Ink4a but had inactivating mutations in either p19Arf (K1735) or p53 (CM519 and CM3205). Inactivation of p19Arf or p53 in carcinogen-induced melanomas was accompanied by constitutive activation of mitogen-activated protein kinases (MAPKs) and/or mutation-associated activation of N-ras. These results indicate that genetic alterations in p16Ink4a/p19Arf, p53 and ras-MAPK pathways can cooperate in the development of murine melanoma.
Tamura, Koji; Ohtsuka, Takao; Date, Kenjiro; Fujimoto, Takaaki; Matsunaga, Taketo; Kimura, Hideyo; Watanabe, Yusuke; Miyazaki, Tetsuyuki; Ohuchida, Kenoki; Takahata, Shunichi; Ishigami, Kousei; Oda, Yoshinao; Mizumoto, Kazuhiro; Nakamura, Masafumi; Tanaka, Masao
2016-07-01
To clarify the usefulness of molecular biomarkers for distinguishing invasive carcinoma derived from intraductal papillary mucinous neoplasms (IPMNs [Inv-IPMN]) from concomitant pancreatic ductal adenocarcinoma (PDAC). Data from 19 patients with resected concomitant PDAC were retrospectively reviewed. KRAS/GNAS mutations and immunohistochemical (IHC) expression of p53 and p16/CDKN2A were assessed in both IPMN and distinct PDAC. As controls, KRAS/GNAS mutations and IHC labeling were assessed between invasive and noninvasive components in 1 lesion of 22 independent patients. KRAS/GNAS mutation status of invasive and noninvasive components in Inv-IPMN was consistent in 18 (86%) of 21 patients. Conversely, mutational patterns in IPMN and distinct PDAC in the same pancreas differed from each other in 17 (89%) of 19. There were 10 (53%) and 8 (42%) of 19 patients who showed the same p53 and p16/CDKN2A staining between concomitant PDAC and distinct IPMN. In the Inv-IPMN cohort, 19 (86%) of 22 patients showed the same IHC expression pattern between the noninvasive and invasive components. It may be possible to distinguish Inv-IPMN from concomitant PDAC by assessing these molecular biomarkers. More precise distinction of Inv-IPMN and concomitant PDAC will lead to adequate recognition of the natural history of IPMNs and hence optimal management.
Magliocco, Anthony; Zhang, Qiang; Wang, Dian; Klimowicz, Alex; Harris, Jonathan; Simko, Jeff; DeLaney, Thomas; Kraybill, William; Kirsch, David G.
2018-01-01
Background Sarcoma mortality remains high despite adjuvant chemotherapy. Biomarker predictors of treatment response and outcome could improve treatment selection. Methods Tissue microarrays (TMAs) were created using pre- and posttreatment tumor from two prospective trials (MGH pilot and RTOG 9514) of neoadjuvant/adjuvant MAID chemotherapy and preoperative radiation. Biomarkers were measured using automated computerized imaging (AQUA or ACIS). Expression was correlated with disease-free survival (DFS), distant disease-free survival (DDFS), and overall survival (OS). Results Specimens from 60 patients included 23 pretreatment (PRE), 40 posttreatment (POST), and 12 matched pairs (MPs). In the MP set, CAIX, GLUT1, and PARP1 expression significantly decreased following neoadjuvant therapy, but p53 nuclear/cytoplasmic (N/C) ratio increased. In the PRE set, no biomarker expression was associated with DFS, DDFS, or OS. In the POST set, increased p53 N/C ratio was associated with a significantly decreased DFS and DDFS (HR 4.13, p=0.017; HR 4.16, p=0.016), while increased ERCC1 and XPF expression were associated with an improved DFS and DDFS. No POST biomarkers were associated with OS. Conclusions PRE biomarker expression did not predict survival outcomes. Expression pattern changes after neoadjuvant chemoradiation supports the concepts of tumor reoxygenation, altered HIF-1α signaling, and a p53 nuclear accumulation DNA damage response. Clinical Trial Registration NRG Oncology RTOG 9514 is registered with ClinicalTrials.gov. The ClinicalTrials.gov Identifier is NCT00002791. PMID:29681762
Zhou, Zhihui; Yin, Yanlin; Chang, Qun; Sun, Guanqun; Lin, Jiahui; Dai, Yalei
2017-04-01
To reveal whether B-myb is involved in preventing senescence of vascular endothelial cells, and if so, to identify possible mechanisms for it. C57/BL6 male mice and primary human aortic endothelial cells (HAECs) were used. Bleomycin was applied to induce stress-related premature senescence. B-myb knockdown was achieved using an siRNA technique and cell senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) assay. Intracellular reactive oxygen species (ROS) production was analysed using an ROS assay kit and cell proliferation was evaluated using KFluor488 EdU kit. Capillary tube network formation was determined by Matrigel assay. Expressions of mRNA and protein levels were detected by real-time PCR and western blotting. B-myb expression significantly decreased, while p53 and p21 expressions increased in the aortas of aged mice. This expression pattern was also found in replicative senescent HAECs and senescent HAECs induced by bleomycin. B-myb knockdown resulted in upregulation of p22 phox , ROS accumulation and cell senescence of HAECs. Downregulation of B-myb significantly inhibited cell proliferation and capillary tube network formation and activated the p53/p21 signalling pathway. Blocking ROS production or inhibiting p53 activation remarkably attenuated SA-β-gal activity and delayed cell senescence induced by B-myb-silencing. Downregulation of B-myb induced senescence by upregulation of p22 phox and activation of the ROS/p53/p21 pathway, in our vascular endothelial cells, suggesting that B-myb may be a novel candidate for regulating cell senescence to protect against endothelial senescence-related cardiovascular diseases. © 2016 John Wiley & Sons Ltd.
Influence of parameter values on the oscillation sensitivities of two p53-Mdm2 models.
Cuba, Christian E; Valle, Alexander R; Ayala-Charca, Giancarlo; Villota, Elizabeth R; Coronado, Alberto M
2015-09-01
Biomolecular networks that present oscillatory behavior are ubiquitous in nature. While some design principles for robust oscillations have been identified, it is not well understood how these oscillations are affected when the kinetic parameters are constantly changing or are not precisely known, as often occurs in cellular environments. Many models of diverse complexity level, for systems such as circadian rhythms, cell cycle or the p53 network, have been proposed. Here we assess the influence of hundreds of different parameter sets on the sensitivities of two configurations of a well-known oscillatory system, the p53 core network. We show that, for both models and all parameter sets, the parameter related to the p53 positive feedback, i.e. self-promotion, is the only one that presents sizeable sensitivities on extrema, periods and delay. Moreover, varying the parameter set values to change the dynamical characteristics of the response is more restricted in the simple model, whereas the complex model shows greater tunability. These results highlight the importance of the presence of specific network patterns, in addition to the role of parameter values, when we want to characterize oscillatory biochemical systems.
MiR-300 regulate the malignancy of breast cancer by targeting p53.
Xu, Xiao-Heng; Li, Da-Wei; Feng, Hui; Chen, Hong-Mei; Song, Yan-Qiu
2015-01-01
In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of breast cancer (BC) cells. MicroRNA and protein expression patterns were compared between breast cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in MCF-7 breast cancer cells. We observed that miR-300 expression was frequently and dramatically up-regulated in human breast cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote breast cancer cell proliferation and invasion by regulating p53 expression. Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in breast cancer cell proliferation during breast tumorigenesis.
MiR-300 regulate the malignancy of breast cancer by targeting p53
Xu, Xiao-Heng; Li, Da-Wei; Feng, Hui; Chen, Hong-Mei; Song, Yan-Qiu
2015-01-01
Objective: In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of breast cancer (BC) cells. Methods: MicroRNA and protein expression patterns were compared between breast cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in MCF-7 breast cancer cells. Results: We observed that miR-300 expression was frequently and dramatically up-regulated in human breast cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote breast cancer cell proliferation and invasion by regulating p53 expression. Conclusion: Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in breast cancer cell proliferation during breast tumorigenesis. PMID:26221232
Daniel, Filipe I; Alves, Soraia R; Vieira, Daniella S C; Biz, Michelle T; Daniel, Inah W B S; Modolo, Filipe
2016-11-01
Epigenetic modifications, including DNA methylation of tumor suppressor genes carried out by DNA methyltransferases (DNMTs), are important events in carcinogenesis. Although there are studies concerning to its expression in several cancer types, DNMTs expression pattern is not known in photoinduced lip carcinogenesis. The aim of this study was to investigate the immunoexpression of DNMTs 1, 3a, and 3b in lip precancerous lesion (actinic cheilitis) and cancer. Thirty cases of actinic cheilitis (AC), thirty cases of lip squamous cell carcinoma (LSCC), and twenty cases of non-neoplastic tissue (NNT) were selected for immunohistochemical investigation of DNMTs 1, 3a, and 3b. Nuclear DNMT 1 immunoreactivity was significantly higher in the LSCC group (68.6%) compared with NNT (47%), and nuclear DNMT 3b was higher in LSCC (70.9%) than in NNT (37.9%) and in AC (44%). Only DNMT 3a showed both higher nuclear and cytoplasmic expression in AC (35.9% and 35.5%, respectively) than in NNT (4.4% and 16.1%, respectively) and LSCC (8.8% and 13.2%, respectively) (P < 0.05). The results suggested that DNMT 3a could play a key role in the methylation process of initial steps of UV carcinogenesis present in AC while DNMT 3b could be responsible for de novo methylation in already established lip cancer. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Vetterlein, Malte W; Roschinski, Julia; Gild, Philipp; Marks, Phillip; Soave, Armin; Doh, Ousman; Isbarn, Hendrik; Höppner, Wolfgang; Wagner, Walter; Shariat, Shahrokh F; Brausi, Maurizio; Büscheck, Franziska; Sauter, Guido; Fisch, Margit; Rink, Michael
2017-12-01
The identification of protein biomarkers to guide treatment decisions regarding adjuvant therapies for high-risk non-muscle-invasive bladder cancer (NMIBC) has been of increasing interest. Evidence of the impact of tumor suppressor gene product p53 and cell proliferation marker Ki-67 on oncologic outcomes in bladder cancer patients at highest risk of recurrence and progression is partially contradictory. We sought to mirror contemporary expression patterns of p53 and Ki-67 in a select cohort of patients with pT1 bladder cancer. Patients from four Northern German institutions with a primary diagnosis of pT1 bladder cancer between 2009 and 2016 and complete data regarding p53 or Ki-67 expression status were included for final analyses. Baseline patient characteristics (age, gender, age-adjusted Charlson comorbidity index) and tumor characteristics [diagnostic sequence, tumor focality, concomitant carcinoma in situ, 1973 World Health Organization (WHO) grading, lymphovascular invasion, adjuvant instillation therapy] were abstracted by retrospective chart review. Immunohistochemistry for detection of p53 and Ki-67 expression was performed according to standardized protocols. Microscopic analyses were performed by central pathologic review. First, we compared patients with positive vs. negative p53 expression and Ki-67 labeling index [>40% vs. ≤40%; cutoffs based on best discriminative ability in univariable Cox regression analysis with disease-free survival (DFS) as endpoint] with regard to baseline and tumor characteristics. Second, we evaluated the effect of biomarker positivity on DFS by plotting univariable Kaplan-Meier curves and performing uni- and multivariable Cox regression analyses. Of 102 patients with complete information on p53 status, 44 (43.1%) were p53 positive, and they more often harbored concomitant carcinoma in situ (50.0% vs. 27.6%; P=0.032) and 1973 WHO grade 3 (97.7% vs. 69.0%; P=0.001) compared to their p53 negative counterparts. Of 79 patients with complete information on Ki-67 expression status, 30 (38.0%) had a labeling index >40%. Mean Ki-67 labeling index was higher in WHO grade 3 vs. grade 2 tumors (45.8 vs. 29.7; P=0.004). At a median follow-up of 51.0 months, 31/91 patients with complete follow-up information (34.1%) suffered from disease recurrence or progression. In univariable Kaplan-Meier analyses, no difference regarding DFS was found in p53 positive vs. negative (P=0.8) or Ki-67 labeling index >40% vs. ≤40% (P=0.078) patients. In multivariable analyses, Ki-67 labeling index >40% remained an independent predictor of DFS [hazard ratio (HR), 2.66; 95% confidence interval (CI), 1.02-6.95; P=0.046], after adjusting for p53 expression and lymphovascular invasion. However, p53 status was not associated with our endpoint (P=0.8). While we found an association of a Ki-67 labeling index >40% and shorter DFS in pT1 bladder cancer patients, this did not hold true for p53 positivity. Future research is needed to identify additional microscopic and molecular risk factors and biomarker panels to improve risk stratification and guide adjuvant therapies in those patients.
Carvalho, Maria Isabel; Pires, Isabel; Dias, Marlene; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina
2015-01-01
In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.039) between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups), presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF), and presence of lymph node metastasis (P < 0.0001 for all groups). Tumors with high CD3/VEGF (P = 0.006), c-kit/VEGF (P < 0.0001), and CD3/c-kit (P = 0.002) were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor. PMID:26346272
Comparative immunoexpression of ICAM-1, TGF-β1 and ki-67 in periapical and residual cysts
Armada, Luciana; dos Santos, Teresa-Cristina; Pires, Fabio-Ramoa
2017-01-01
Background This study compared the immunohistochemical expression of ki-67, transforming growth factor beta 1 (TGF-β1) and intercellular adhesion molecule-1 (ICAM-1) in inflammatory periapical cysts and residual cysts. Material and Methods The study sample was composed by 25 periapical cysts and 25 residual cysts and immunohistochemical reactions were carried out using antibodies directed against ICAM-1, TGF-β1 and ki-67. Clinical, radiological, gross, histological and immunohistochemical data were tabulated for descriptive and comparative analysis using the SPSS software and differences were considered statistically significant when p<0.05%. Results There were no differences between the expression of ICAM-1 (p=0.239) and TGF-β1 (p=0.258) when comparing both groups. Ki-67 labeling index was higher in residual cysts compared to periapical cysts (p=0.017). Conclusions Results from the present study suggest that some specific inflammatory stimuli on residual cysts would modulate their mechanisms of etiopathogenesis, growing and repair. Key words:Periapical cyst, radicular cyst, residual cyst, transforming growth factor beta 1 (TGF-β1), intercellular adhesion molecule 1 (ICAM-1), ki-67. PMID:27918735
Regulators of apoptosis in cholangiocarcinoma.
Jhala, Nirag C; Vickers, Selwyn M; Argani, Pedram; McDonald, Jay M
2005-04-01
Dysregulation of mediators of apoptosis is associated with carcinogenesis. For biliary duct cancers, p53 gene mutation is an important contributor to carcinogenesis. Mutations in the p53 gene affect transcription of the Fas gene, resulting in lack of Fas expression on cell membrane. It has been previously shown that cloned Fas-negative but not Fas-positive human cholangiocarcinoma cells are resistant to anti-Fas-mediated apoptosis and develop tumors in nude mice. In addition, interferon gamma induces Fas expression in Fas-negative cholangiocarcinoma cells and makes them susceptible to apoptosis. Therefore, it becomes important to characterize immunophenotypic expression of p53 and Fas in normal and neoplastic human tissues of the biliary tract to further understand the pathogenesis of the disease. To date, human studies to characterize differences in immunophenotypic expression of the Fas protein between intrahepatic and extrahepatic biliary duct cancers and in their precursor lesions have not been performed. To report the immunophenotypic expression of p53 and Fas expression in various stages in the development of bile duct cancers (intrahepatic and extrahepatic tumor location) and their association with tumor differentiation. Thirty bile duct cancer samples (13 intrahepatic and 17 extrahepatic) from 18 men and 12 women who ranged in age from 44 to 77 years (mean age, 65.6 years) were retrieved from the surgical pathology files. Hematoxylin-eosin-stained slides were evaluated for the type and grade of tumor and dysplastic changes in the biliary tract epithelium. Additional slides were immunohistochemically stained with p53 and anti-Fas mouse monoclonal antibody. The pattern of Fas distribution and percentage of cells positive for p53 and Fas expression were determined. The percentage of Fas-expressing cells is significantly (P = .01) more frequently noted in extrahepatic tumors compared with intrahepatic tumors. Furthermore, Fas expression decreased from dysplastic epithelium to cholangiocarcinoma (P = .01), and this decreasing trend continued from well to poorly differentiated tumors. Nuclear p53 expression was not identified in normal and dysplastic epithelium but was noted in 30% of carcinomas (P = .02). Fas expression is an early event in pathogenesis of bile duct cancers. Immunophenotypic expression of Fas is associated with well to moderately differentiated tumors but not with poor tumor differentiation.
Amaral, Cátia Lira Do; Bueno, Rafaela de Barros E Lima; Burim, Regislaine Valéria; Queiroz, Regina Helena Costa; Bianchi, Maria de Lourdes Pires; Antunes, Lusânia Maria Greggi
2011-05-18
Methionine is a component of one-carbon metabolism and a precursor of S-adenosylmethionine (SAM), the methyl donor for DNA methylation. When methionine intake is high, an increase of S-adenosylmethionine (SAM) is expected. DNA methyltransferases convert SAM to S-adenosylhomocysteine (SAH). A high intracellular SAH concentration could inhibit the activity of DNA methyltransferases. Therefore, high methionine ingestion could induce DNA damage and change the methylation pattern of tumor suppressor genes. This study investigated the genotoxicity of a methionine-supplemented diet. It also investigated the diet's effects on glutathione levels, SAM and SAH concentrations and the gene methylation pattern of p53. Wistar rats received either a methionine-supplemented diet (2% methionine) or a control diet (0.3% methionine) for six weeks. The methionine-supplemented diet was neither genotoxic nor antigenotoxic to kidney cells, as assessed by the comet assay. However, the methionine-supplemented diet restored the renal glutathione depletion induced by doxorubicin. This fact may be explained by the transsulfuration pathway, which converts methionine to glutathione in the kidney. Methionine supplementation increased the renal concentration of SAH without changing the SAM/SAH ratio. This unchanged profile was also observed for DNA methylation at the promoter region of the p53 gene. Further studies are necessary to elucidate this diet's effects on genomic stability and DNA methylation. 2011 Elsevier B.V. All rights reserved.
Mechanisms of spinal motoneurons survival in rats under simulated hypogravity on earth
NASA Astrophysics Data System (ADS)
Islamov, R. R.; Mishagina, E. A.; Tyapkina, O. V.; Shajmardanova, G. F.; Eremeev, A. A.; Kozlovskaya, I. B.; Nikolskij, E. E.; Grigorjev, A. I.
2011-05-01
It was previously shown that different cell types in vivo and in vitro may die via apoptosis under weightlessness conditions in space as well as in simulated hypogravity on the Earth. We assessed survivability of spinal motoneurons of rats after 35-day antiorthostatic hind limb suspension. Following weight bearing, unloading the total protein content in lumbar spinal cord is dropped by 21%. The electrophysiological studies of m. gastrocnemius revealed an elevated motoneurons' reflex excitability and conduction disturbances in the sciatic nerve axons. The number of myelinated fibers in the ventral root of experimental animals was insignificantly increased by 35-day of antiorthostatic hind limb suspension, although the retrograde axonal transport was significantly decreased during the first week of simulated hypogravity. The results of the immunohistochemical assay with antibodies against proapoptotic protein caspase 9 and cytotoxicity marker neuron specific nitric oxide synthase (nNOS) and the TUNEL staining did not reveal any signs of apoptosis in motoneurons of suspended and control animals. To examine the possible adaptation mechanisms activated in motoneurons in response to simulated hypogravity we investigated immunoexpression of Hsp25 and Hsp70 in lumbar spinal cord of the rats after 35-day antiorthostatic hind limb suspension. Comparative analysis of the immunohistochemical reaction with anti-Hsp25 antibodies revealed differential staining of motoneurons in intact and experimental animals. The density of immunoprecipitate with anti-Hsp25 antibodies was substantially higher in motoneurons of the 35-day suspended than control rats and the more intensive precipitate in this reaction was observed in motoneuron neuritis. Quantitative analysis of Hsp25 expression demonstrated an increase in the Hsp25 level by 95% in experimental rats compared to the control. The immunoexpression of Hsp70 found no qualitative and quantitative differences in control and experimental lumbar spinal cords. Taken together our results show that (1) rat motoneurons survived after 35-day antiorthostatic hind limb suspension and the changes in neurons had a mostly functional character, and (2) the increased immunoexpression of Hsp25 can be considered as the anti-apoptotic factor.
Evans, Juanita J; Crist, Henry S; Durvesh, Saima; Bruggeman, Richard D; Goldenberg, David
2012-07-01
Anaplastic thyroid carcinoma (ATC) is an extremely aggressive and rapidly fatal neoplasm. The aim of this study was to identify a limited cell cycle associated protein expression pattern unique to ATC and to correlate that pattern with clinical outcome. This represents one of the largest tissue micro-array projects comparing the cell cycle protein expression data of ATC to other well-differentiated tumors in the literature. Tissue microarrays were created from 21 patients with ATC and an age and gender matched cohort of patients with papillary thyroid carcinoma (PTC). Expression of epidermal growth factor receptor, cyclin D1, cyclin E, p53, p21, p16, aurora kinase A, opioid growth factor (OGF), OGF-receptor, thyroglobulin and Ki-67 was evaluated in a semi-quantitative fashion. Differences in protein expression between the cohorts were evaluated using chi-square tests with Bonferroni adjustments. Survival time and presence of metastasis at presentation were collected. The ATC cohort showed a statistically significant decrease (p < 0.05) in thyroglobulin expression and statistically significant increases (p < 0.05) in Ki-67 and p53 expression as compared with the PTC cohort. A trend toward loss of p16 and p21 expression was noted in the ATC cohort. A trend toward decreased survival was noted with p21 expression. These data indicate disruption of the normal cell cycle with aberrant expression of multiple protein markers suggesting increased proliferative activity and loss of control of cell cycle progression to G₁ phase. These findings support the assertion that ATC may represent the furthest end of a continuum of thyroid carcinoma dedifferentiation.
Mokrowiecka, Anna; Veits, Lothar; Falkeis, Christina; Musial, Jacek; Kordek, Radzislaw; Lochowski, Mariusz; Kozak, Jozef; Wierzchniewska-Lawska, Agnieszka; Vieth, Michael; Malecka-Panas, Ewa
2017-03-01
Barrett's esophagus (BE), which develops as a result of gastroesophageal reflux disease, is a preneoplastic condition for esophageal adenocarcinoma (EAC). A new hypothesis suggests that cancer is a disease of stem cells, however, their expression and pathways in BE - EAC sequence are not fully elucidated yet. We used a panel of putative cancer stem cells markers to identify stem cells in consecutive steps of BE-related cancer progression. Immunohistochemistry was performed on formalin-fixed, paraffin-embedded blocks from 58 patients with normal cardiac mucosa (n=5), BE (n=14), early EAC (pT1) from mucosal resection (n=17) and advanced EAC (pT1-T4) from postoperative specimens (n=22). Expression of the CD133, CD44, Musashi-1 and EpCAM was analyzed using respective monoclonal antibodies. All markers showed a heterogeneous expression pattern, mainly at the base of the crypts of Barrett's epithelium and EAC, with positive stromal cells in metaplastic and dysplastic lesions. Immuno-expression of EpCAM, CD44 and CD133 in cardiac mucosa was significantly lower (mean immunoreactivity score (IRS)=1.2; 0.0; 0.4; respectively) compared to their expression in Barrett's metaplasia (mean IRS=4.3; 0.14; 0.7; respectively), in early adenocarcinoma (mean IRS=4.4; 0.29; 1.3; respectively) and in advanced adenocarcinoma (mean IRS=6.6; 0.7; 2.7; respectively) (p<0.05). On the contrary, Musashi-1 expression was higher in BE and early ADC compared to GM and advanced ADC (NS). Our results suggest that the stem cells could be present in premalignant lesions. EpCAM, CD44 and CD133 expression could be candidate markers for BE progression, whereas Musashi-1 may be a marker of the small intestinal features of Barrett's mucosa. Copyright © 2016 Elsevier GmbH. All rights reserved.
p53 Mutagenesis by Benzo[a]pyrene derived Radical Cations
Sen, Sushmita; Bhojnagarwala, Pratik; Francey, Lauren; Lu, Ding; Jeffrey Field, Trevor M. Penning
2013-01-01
Benzo[a]pyrene (B[a]P), a major human carcinogen in combustion products such as cigarette smoke and diesel exhaust, is metabolically activated into DNA-reactive metabolites via three different enzymatic pathways. The pathways are the anti-(+)-benzo[a]pyrene 7,8-diol 9, 10-epoxide pathway (P450/ epoxide hydrolase catalyzed) (B[a]PDE), the benzo[a]pyrene o-quinone pathway (aldo ketose reductase (AKR) catalyzed) and the B[a]P radical cation pathway (P450 peroxidase catalyzed). We used a yeast p53 mutagenesis system to assess mutagenesis by B[a]P radical cations. Because radical cations are short-lived, they were generated in situ by reacting B[a]P with cumene hydroperoxide (CuOOH) and horse radish peroxidase (HRP) and then monitoring the generation of the more stable downstream products, B[a]P-1,6-dione and B[a]P-3,6-dione. Based on the B[a]P-1,6 and 3,6-dione formation, approximately 4µM of radical cation was generated. In the mutagenesis assays, the radical cations produced in situ showed a dose-dependent increase in mutagenicity from 0.25 µM to 10 µM B[a]P with no significant increase seen with further escalation to 50 µM B[a]P. However, mutagenesis was 200-fold less than with the AKR pathway derived B[a]P, 7–8 dione. Mutant p53 plasmids, which yield red colonies, were recovered from the yeast to study the pattern and spectrum of mutations. The mutation pattern observed was G to T (31%) > G to C (29%) > G to A (14%). The frequency of codons mutated by the B[a]P radical cations was essentially random and not enriched at known cancer hotspots. The quinone products of radical cations, B[a]P-1,6-dione and B[a]P-3,6-dione were more mutagenic than the radical cation reactions, but still less mutagenic than AKR derived B[a]P-7,8-dione. We conclude that B[a]P radical cations and their quinone products are weakly mutagenic in this yeast-based system compared to redox cycling PAH o-quinones. PMID:22768918
Immunophenotype of nipple adenoma in a male patient.
Fernandez-Flores, Angel; Suarez-Peñaranda, Jose-Manuel
2011-03-01
Adenoma of the nipple is rare in men. It must be distinguished from a breast carcinoma and from Paget disease. In this sense, immunohistochemistry can be of some help. In women, for instance, immunoexpression of c-erbB-2 favors a diagnosis of Paget disease, according to some studies. Nevertheless, we have not found any studies on HER2/neu status, estrogen receptors, or progesterone receptors in nipple adenoma of male patients. We present a case of an adenoma of the nipple in a 21-year-old man in which we carried out a wide immunohistochemical study. The lesion did not express estrogen receptors, progesterone receptors, or androgen receptors. The HercepTest was negative. Smooth muscle Actin and p63 were remarked in the basal layer of the tumoral tubules, supporting the benignancy of the lesion. This case of adenoma of the nipple in a male shows an immunophenotype that is similar to the ones reported in female patients.
Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J
1998-01-01
A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.
Gurgul, Edyta; Kasprzak, Aldona; Blaszczyk, Agata; Biczysko, Maciej; Surdyk-Zasada, Joanna; Seraszek-Jaros, Agnieszka; Ruchala, Marek
2015-01-01
Previous studies analyzing ghrelin and obestatin expression in thyroid gland tissue are not unanimous and are mostly related to ghrelin. The role of ghrelin and obestatin in the thyroid gland appears very interesting due to their probable involvement in cell proliferation. Furthermore, since the thyroid gland is associated with the maintenance of energy balance, the relationship between ghrelin, obestatin and thyroid function is worthy of consideration. The aim of the study was to assess ghrelin and obestatin immunocytochemical expression in nodular goiter (NG), papillary cancer (PTC) and medullary cancer (MTC). Analyzed samples included 9 cases of NG, 8 cases of PTC and 11 cases of MTC. The analysis of ghrelin and obestatin expression was performed by use of the immunohistochemical (IHC) EnVision system and evaluated with filter HSV software (quantitative morphometric analysis). Quantitative ghrelin expression in MTC cells was higher than in NG (p = 0.013) and correlated negatively with the size of the tumor (r= -0.829, p < 0.05). We did not observe any differences in ghrelin expression neither between MTC and PTC nor between NG and PTC. Obestatin immunoexpression pattern in all analyzed specimens was irregular and poorly accented. The strongest immunoreactivity for obestatin was demonstrated in NG. In MTC obestatin expression was significantly weaker than in NG and PTC (p < 0.05 in both cases). In NG the intensity of obestatin immunostaining was significantly higher than that of ghrelin (p = 0.03). Conversely, ghrelin expression in MTC was definitely more evident than obestatin immunoreactivity (p < 0.01). There was no statistically significant difference between ghrelin and obestatin expression in PTC. No correlations were detected between reciprocal tissue expressions of ghrelin and obestatin in the analyzed specimens of NG, PTC or MTC. The differences between ghrelin expression in NG and MTC suggest that ghrelin may be involved in thyroid cell proliferation. The differences between ghrelin and obestatin immunoreactivity in benign and malignant thyroid tumors could support the theory of alternative transcription of the preproghrelin gene and independent production of ghrelin and obestatin.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Das, Amitabh, E-mail: amitabhdas.kn@gmail.com; Chai, Jin Choul, E-mail: jincchai@gmail.com; Jung, Kyoung Hwa, E-mail: khjung2@gmail.com
JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuationmore » significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup −/−} NE4C cells. • Finding JMJD2A-based molecular targets and crucial pathways in p53{sup −/−} NE4C cells.« less
Sahm, Felix; Reuss, David; Koelsche, Christian; Capper, David; Schittenhelm, Jens; Heim, Stephanie; Jones, David T W; Pfister, Stefan M; Herold-Mende, Christel; Wick, Wolfgang; Mueller, Wolf; Hartmann, Christian; Paulus, Werner; von Deimling, Andreas
2014-10-01
Astrocytoma and oligodendroglioma are histologically and genetically well-defined entities. The majority of astrocytomas harbor concurrent TP53 and ATRX mutations, while most oligodendrogliomas carry the 1p/19q co-deletion. Both entities share high frequencies of IDH mutations. In contrast, oligoastrocytomas (OA) appear less clearly defined and, therefore, there is an ongoing debate whether these tumors indeed constitute an entity or whether they represent a mixed bag containing both astrocytomas and oligodendrogliomas. We investigated 43 OA diagnosed in different institutions employing histology, immunohistochemistry and in situ hybridization addressing surrogates for the molecular genetic markers IDH1R132H, TP53, ATRX and 1p/19q loss. In all but one OA the combination of nuclear p53 accumulation and ATRX loss was mutually exclusive with 1p/19q co-deletion. In 31/43 OA, only alterations typical for oligodendroglioma were observed, while in 11/43 OA, only indicators for mutations typical for astrocytomas were detected. A single case exhibited a distinct pattern, nuclear expression of p53, ATRX loss, IDH1 mutation and partial 1p/19q loss. However, this was the only patient undergoing radiotherapy prior to surgery, possibly contributing to the acquisition of this uncommon combination. In OA with oligodendroglioma typical alterations, the portions corresponding to astrocytic part were determined as reactive, while in OA with astrocytoma typical alterations the portions corresponding to oligodendroglial differentiation were neoplastic. These data provide strong evidence against the existence of an independent OA entity.
A Survey of Korean Physicians' Prescription Patterns for Allergic Rhinitis.
Seo, Min Young; Kim, Dong-Kyu; Jee, Hye Mi; Ahn, Young Min; Kim, Yong Min; Hong, Sang Duk
2017-12-01
The aim of this study was to compare the prescription patterns according to characteristics of physicians using a survey distributed amongst physicians in Korea. We surveyed the prescription patterns for allergic rhinitis (AR) of the members of the Korean Academy of Asthma, Allergy and Clinical Immunology (KAAACI) and the Korean Association of Otorhinolaryngologists (KAO). Questionnaire contained 4 categories with 28 queries. 448 physicians including 98 internal medicine (IM), 113 pediatrics (PED), and 237 otorhinolaryngology (ENT) were responded. Although the Allergic Rhinitis and its Impact on Asthma (ARIA) guidelines are most frequently used in all specialties, seasonal or perennial AR is the most frequent classification system. For the definitive diagnosis of AR, ENT physicians reported using multiple allergen simultaneous test (MAST)/radio allergy sorbent test (RAST) more than others (IM, 10.9%; PED, 20.6%; ENT, 44.2%; P<0.001). In treatment, most physicians reported that antihistamine medication is the initial treatment for AR. PED physicians prescribed fewer intranasal steroid to combinations with an antihistamine than other specialists (IM, 65.3%; PED, 42.5%; ENT, 63.3%), but preferred leukotriene antagonists (IM, 4.1%; PED, 23.0%; ENT, 3.9%; P=0.041). Overall, 53% (235/448) of the physicians performed allergen immunotherapy (AIT), and IM administers the most AIT (IM, 71.6%; PED, 42.0%; ENT, 39.5%; P=0.019). Furthermore, university and general hospital physicians prescribed more AIT than doctors at other hospital types (university hospital, 76.4%; general hospital, 64.3%; local hospital, 21.4%; private clinic, 20.2%; P<0.001). The prescription patterns for AR were different according to the physicians' characteristics and general rate of prescribing AIT is just about 53% in Korea. Thus, the development of complementary Korean-specific guidelines is needed and proper clinical instruction of AIT would be necessary.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Kwon, Oh Sang; Pyo, Hyun Keol; Oh, Youn Jin; Han, Ji Hyun; Lee, Se Rah; Chung, Jin Ho; Eun, Hee Chul
2007-01-01
Minoxidil induces hair growth in male pattern baldness and prolongs the anagen phase. All-trans retinoic acid (ATRA) has been reported to act synergistically with minoxidil in vivo: they can enhance more dense hair regrowth than either compound alone. We evaluated the effect of minoxidil combined with ATRA on hair growth in vitro. The effect of co-treatment of minoxidil and ATRA on hair growth was studied in hair follicle organ culture. In cultured human dermal papilla cells (DPCs) and normal human epidermal keratinocytes, the expressions of Erk, Akt, Bcl-2, Bax, P53 and P21 were evaluated by immunoblot analysis. Minoxidil plus ATRA additively promoted hair growth in vitro, compared with minoxidil alone. In addition, minoxidil plus ATRA elevated phosphorylated Erk, phosphorylated Akt and the ratio of Bcl-2/Bax, but decreased the expressions of P53 and P21 more effectively than by minoxidil alone. Our results suggest that minoxidil plus ATRA would additively enhance hair growth by mediating dual functions: 1) the prolongation of cell survival by activating the Erk and Akt signaling pathways, and 2) the prevention of apoptosis of DPCs and epithelial cells by increasing the ratio of Bcl-2/Bax and downregulating the expressions of P53 and P21. PMID:17449938
NASA Technical Reports Server (NTRS)
2008-01-01
This image, one of the first captured by NASA's Phoenix Mars Lander, shows flat ground strewn with tiny pebbles and marked by small-scale polygonal cracking, a pattern seen widely in Martian high latitudes and also observed in permafrost terrains on Earth. The polygonal cracking is believed to have resulted from seasonal contraction and expansion of surface ice. Phoenix touched down on the Red Planet at 4:53 p.m. Pacific Time (7:53 p.m. Eastern Time), May 25, 2008, in an arctic region called Vastitas Borealis, at 68 degrees north latitude, 234 degrees east longitude. This image was acquired at the Phoenix landing site by the Surface Stereo Imager on day 1 of the mission on the surface of Mars, or Sol 0, after the May 25, 2008, landing. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C
2014-01-01
In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616
Hidradenocarcinoma: a histological and immunohistochemical study.
Ko, Christine J; Cochran, Alistair J; Eng, William; Binder, Scott W
2006-11-01
The diagnosis of hidradenocarcinoma is difficult due to a combination of factors including inconsistent nomenclature/ classification, rarity of the neoplasm, and variable morphology of cells composing the neoplasm. Immunohistochemistry has not been previously performed on a series of hidradenocarcinomas. We evaluated six cases of hidradenocarcinoma histologically and immunohistochemically using antibodies to gross cystic disease fluid protein-15 (GCDFP-15), carcino-embryonic antigen (CEA), epithelial membrane antigen (EMA), S-100 protein, keratin AE1/3, cytokeratin 5/6, p53, bcl-1, bcl-2, and Ki67. Histology suggested concurrent eccrine and apocrine differentiation of the cases. Ki67 and p53 staining was strongly positive in five of six tumors. The neoplasms stained with antibodies to CEA, S-100 protein, GCDFP-15, EMA, bcl-1, and bcl-2 in no consistent pattern. All tumors studied stained positively for keratin AE1/3 and cytokeratin 5/6. In making the diagnosis of hidradenocarcinoma, it may be unnecessary to separate hidradenocarcinoma into eccrine and apocrine categories, and although Ki67 and p53 may be helpful, histological parameters remain paramount.
Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo
2011-01-01
Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less
Ma, Ting; Fan, Bo-Yi; Zhang, Chao; Zhao, Hui-Jun; Han, Chao; Gao, Cai-Yun; Luo, Jian-Guang; Kong, Ling-Yi
2016-01-01
Metabolomics can be used to identify potential markers and discover new targets for future therapeutic interventions. Here, we developed a novel application of the metabonomics method based on gas chromatography-mass spectrometry (GC/MS) analysis and principal component analysis (PCA) for rapidly exploring the anticancer mechanism of physapubenolide (PB), a cytotoxic withanolide isolated from Physalis species. PB inhibited the proliferation of hepatocellular carcinoma cells in vitro and in vivo, accompanied by apoptosis-related biochemical events, including the cleavage of caspase-3/7/9 and PARP. Metabolic profiling analysis revealed that PB disturbed the metabolic pattern and significantly decreased lactate production. This suggests that the suppression of glycolysis plays an important role in the anti-tumour effects induced by PB, which is further supported by the decreased expression of glycolysis-related genes and proteins. Furthermore, the increased level of p53 and decreased expression of p-Akt were observed, and the attenuated glycolysis and enhanced apoptosis were reversed in the presence of Akt cDNA or p53 siRNA. These results confirm that PB exhibits anti-cancer activities through the Akt-p53 pathway. Our study not only reports for the first time the anti-tumour mechanism of PB, but also suggests that PB is a promising therapeutic agent for use in cancer treatments and that metabolomic approaches provide a new strategy to effectively explore the molecular mechanisms of promising anticancer compounds. PMID:27416811
Ma, Ting; Fan, Bo-Yi; Zhang, Chao; Zhao, Hui-Jun; Han, Chao; Gao, Cai-Yun; Luo, Jian-Guang; Kong, Ling-Yi
2016-07-15
Metabolomics can be used to identify potential markers and discover new targets for future therapeutic interventions. Here, we developed a novel application of the metabonomics method based on gas chromatography-mass spectrometry (GC/MS) analysis and principal component analysis (PCA) for rapidly exploring the anticancer mechanism of physapubenolide (PB), a cytotoxic withanolide isolated from Physalis species. PB inhibited the proliferation of hepatocellular carcinoma cells in vitro and in vivo, accompanied by apoptosis-related biochemical events, including the cleavage of caspase-3/7/9 and PARP. Metabolic profiling analysis revealed that PB disturbed the metabolic pattern and significantly decreased lactate production. This suggests that the suppression of glycolysis plays an important role in the anti-tumour effects induced by PB, which is further supported by the decreased expression of glycolysis-related genes and proteins. Furthermore, the increased level of p53 and decreased expression of p-Akt were observed, and the attenuated glycolysis and enhanced apoptosis were reversed in the presence of Akt cDNA or p53 siRNA. These results confirm that PB exhibits anti-cancer activities through the Akt-p53 pathway. Our study not only reports for the first time the anti-tumour mechanism of PB, but also suggests that PB is a promising therapeutic agent for use in cancer treatments and that metabolomic approaches provide a new strategy to effectively explore the molecular mechanisms of promising anticancer compounds.
Differentiated intraepithelial neoplasia of the vulva.
Mulvany, Nicholas J; Allen, David G
2008-01-01
We present the clinical and pathological findings of 6 women with intraepithelial neoplasia of differentiated or simplex type (DVIN). The mean age was 68 years (range 55-82). One lesion was still in situ, whereas 5 were associated with squamous carcinoma, 4 of well-differentiated keratinizing type and 1 of poorly differentiated spindle-cell type. The invasive depth of the squamous carcinomas ranged from 0.6 to 8 mm and the surgical margins of all of the resection specimens were uninvolved by neoplastic cells. In contrast, DVIN involved the surgical margins in 5 specimens while the remaining specimen had normal surgical margins. In all 6 vulvar specimens, DVIN showed intense immunoreactivity for Ki-67 in the basal and parabasal cells while only 4 specimens showed reactivity for p53. In 5 surgical specimens with DVIN the number of CD1a cells was increased but little if any immunoreactivity could be found amongst the corresponding invasive neoplastic cells. Four squamous carcinomas also showed diffuse p53 reactivity. There was little difference in the pattern of Ki-67 expression between DVIN and squamous carcinoma. For a number of reasons, DVIN present diagnostic difficulty and considerable interobserver variation also exists. Our study suggests that Ki-67 and p16 are useful for distinguishing DVIN and classical VIN 3, whereas p53 and CD1a are useful for distinguishing DVIN and invasive squamous carcinoma. Furthermore, p53 appears to have higher specificity than sensitivity for distinguishing DVIN from normal squamous epithelium.
Oh, Il Hwan; Park, Jung Hwan; Lee, Chang Hwa; Park, Joon-Sung
2015-01-01
Glycated hemoglobin (HbA1c) is an important diagnostic indicator of diabetes mellitus, and some authors have argued that it is related to impaired lung function in the diabetic population. However, there was rare study for association between lung function and HbA1c in the non-diabetic population. We investigated whether HbA1c below the diagnostic threshold is related to deficits in lung function. We analyzed biochemical and spirometry data from a nation-wide, population-based, case-control study (the KNHANES IV and V). Eligible as cases were all native Koreans aged 40 years or more with no medical illness. A total of 3670 participants were divided into 4 groups according to HbA1c (%) as follows: Group I (n = 842), ≥ 4.0 and ≤ 5.3; Group II (n = 833), > 5.3 and ≤ 5.5; Group III (n = 898), > 5.5 and ≤ 5.7; and Group IV (n = 1097), > 5.7 and ≤ 6.4. Group I had the greatest forced vital capacity (FVC, 96.3 ± 0.5% pred, P < 0.0001), forced expiratory volume per second (FEV1, 93.8 ± 0.5% pred, P < 0.0001) and FEV1/FVC (0.792 ± 0.003, P < 0.0001) compared with the other groups. Linear regression showed that HbA1c was closely related to FVC (β = -6.972154, P < 0.0001) and FEV1 (β = -5.591589, P < 0.0001), but not to FEV1/FVC. Logistic regression analysis revealed a significant association between HbA1c and a restrictive spirometric pattern (FVC < 80% pred., FEV1/FVC ≥ 0.70; OR = 3.772, 95% CI = 1.234-11.53), indicating that elevated HbA1c is closely associated with lung impairment in the non-diabetic population. In the healthy population, relatively high HbA1c level is associated with decrements of FVC and FEV1 and may be a reliable predictor of poor lung function, especially the restrictive pattern. PMID:25658743
Gleber-Netto, Frederico O; Zhao, Mei; Trivedi, Sanchit; Wang, Jiping; Jasser, Samar; McDowell, Christina; Kadara, Humam; Zhang, Jiexin; Wang, Jing; William, William N; Lee, J Jack; Nguyen, Minh Ly; Pai, Sara I; Walline, Heather M; Shin, Dong M; Ferris, Robert L; Carey, Thomas E; Myers, Jeffrey N; Pickering, Curtis R
2018-01-01
Human immunodeficiency virus-infected individuals (HIVIIs) have a higher incidence of head and neck squamous cell carcinoma (HNSCC), and clinical and histopathological differences have been observed in their tumors in comparison with those of HNSCC patients without a human immunodeficiency virus (HIV) infection. The reasons for these differences are not clear, and molecular differences between HIV-related HNSCC and non-HIV-related HNSCC may exist. This study compared the mutational patterns of HIV-related HNSCC and non-HIV-related HNSCC. The DNA of 20 samples of HIV-related HNSCCs and 32 samples of non-HIV-related HNSCCs was sequenced. DNA libraries covering exons of 18 genes frequently mutated in HNSCC (AJUBA, CASP8, CCND1, CDKN2A, EGFR, FAT1, FBXW7, HLA-A, HRAS, KEAP1, NFE2L2, NOTCH1, NOTCH2, NSD1, PIK3CA, TGFBR2, TP53, and TP63) were prepared and sequenced on an Ion Personal Genome Machine sequencer. DNA sequencing data were analyzed with Ion Reporter software. The human papillomavirus (HPV) status of the tumor samples was assessed with in situ hybridization, the MassARRAY HPV multiplex polymerase chain reaction assay, and p16 immunostaining. Mutation calls were compared among the studied groups. HIV-related HNSCC revealed a distinct pattern of mutations in comparison with non-HIV-related HNSCC. TP53 mutation frequencies were significantly lower in HIV-related HNSCC. Mutations in HIV+ patients tended to be TpC>T nucleotide changes for all mutated genes but especially for TP53. HNSCC in HIVIIs presents a distinct pattern of genetic mutations, particularly in the TP53 gene. HIV-related HNSCC may have a distinct biology, and an effect of the HIV virus on the pathogenesis of these tumors should not be ruled out. Cancer 2018;124:84-94. © 2017 American Cancer Society. © 2017 American Cancer Society.
Mechanism of p53-Dependent Apoptosis and its Role in Breast Cancer Therapy
1999-07-01
inducibly express p53 as previously described (Chen et a!., 1996). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A62-91)-l, -5, and -6 cells...1994) was used as template, ( a ) Levels of p53, p21 and actin in p53-3 and p53(gln22-ser23/A62-91)-2 and -14 cells were assayed by Western blot...CGG TAC CCC TGT CAT CTT CTG TC; and reverse primer C393 as used for generating p53(A62-91). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A74
Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R
2014-01-01
The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.
Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília
2016-01-01
Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173
Kim, Ju-Ang; Lim, Jiwon; Naren, Raja; Yun, Hui-Suk; Park, Eui Kyun
2016-10-15
Similar to calcium phosphates, magnesium phosphate (MgP) ceramics have been shown to be biocompatible and support favorable conditions for bone cells. Micropores below 25μm (MgP25), between 25 and 53μm (MgP53), or no micropores (MgP0) were introduced into MgP scaffolds using different sizes of an NaCl template. The porosities of MgP25 and MgP53 were found to be higher than that of MgP0 because of their micro-sized pores. Both in vitro and in vivo analysis showed that MgP scaffolds with high porosity promoted rapid biodegradation. Implantation of the MgP0, MgP25, and MgP53 scaffolds into rabbit calvarial defects (with 4- and 6-mm diameters) was assessed at two times points (4 and 8weeks), followed by analysis of bone regeneration. The micro-CT and histologic analyses of the 4-mm defect showed that the MgP25 and MgP53 scaffolds were degraded completely at 4weeks with simultaneous bone and marrow-like structure regeneration. For the 6-mm defect, a similar pattern of regeneration was observed. These results indicate that the rate of degradation is associated with bone regeneration. The MgP25 and MgP53 scaffold-implanted bone showed a better lamellar structure and enhanced calcification compared to the MgP0 scaffold because of their porosity and degradation rate. Tartrate-resistant acid phosphatase (TRAP) staining indicated that the newly formed bone was undergoing maturation and remodeling. Overall, these data suggest that the pore architecture of MgP ceramic scaffolds greatly influence bone formation and remodeling activities and thus should be considered in the design of new scaffolds for long-term bone tissue regeneration. The pore structural conditions of scaffold, including porosity, pore size, pore morphology, and pore interconnectivity affect cell ingrowth, mechanical properties and biodegradabilities, which are key components of scaffold in bone tissue regeneration. In this study, we designed hierarchical pore structure of the magnesium phosphate (MgP) scaffold by combination of the 3D printing process, self-setting reaction and salt-leaching technique, and first studied the effect of pore structures of bioceramic scaffolds on bone tissue regeneration through both in vitro and in vivo studies (rabbit calvarial model). The MgP scaffolds with higher porosity promoted more rapid biodegradation and enhanced new bone formation and remodeling activities at the same time. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.
He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu
2015-02-10
Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.
Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J
2005-12-08
TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.
Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin
2014-03-18
Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.
Role of Nuclear Matrix in Estrogen Regulated Gene Expression in Human Breast Cancer Cells
1998-08-01
reticular pattern evenly distributed throughout the nucleus, excluding the nucleolus (Figure 4A). This is not so for T47D cells where a composite pattern...acetylation is required to maintain the unfolded nucleosome structure associated with transcribing DNA. Journal of Biological Chemistry 273:14516...nuclear matrix include ER, YY1, AML-1, Spl, Oct1, mutant p53, and Rb [25,28,31,34-40]. Appendix A, part 4 reviews alterations in nuclear matrix composition
Yachida, Shinichi; Vakiani, Efsevia; White, Catherine M; Zhong, Yi; Saunders, Tyler; Morgan, Richard; de Wilde, Roeland F; Maitra, Anirban; Hicks, Jessica; Demarzo, Angelo M; Shi, Chanjuan; Sharma, Rajni; Laheru, Daniel; Edil, Barish H; Wolfgang, Christopher L; Schulick, Richard D; Hruban, Ralph H; Tang, Laura H; Klimstra, David S; Iacobuzio-Donahue, Christine A
2012-02-01
Poorly differentiated neuroendocrine carcinomas (NECs) of the pancreas are rare malignant neoplasms with a poor prognosis. The aim of this study was to determine the clinicopathologic and genetic features of poorly differentiated NECs and compare them with other types of pancreatic neoplasms. We investigated alterations of KRAS, CDKN2A/p16, TP53, SMAD4/DPC4, DAXX, ATRX, PTEN, Bcl2, and RB1 by immunohistochemistry and/or targeted exomic sequencing in surgically resected specimens of 9 small cell NECs, 10 large cell NECs, and 11 well-differentiated neuroendocrine tumors (PanNETs) of the pancreas. Abnormal immunolabeling patterns of p53 and Rb were frequent (p53, 18 of 19, 95%; Rb, 14 of 19, 74%) in both small cell and large cell NECs, whereas Smad4/Dpc4, DAXX, and ATRX labeling was intact in virtually all of these same carcinomas. Abnormal immunolabeling of p53 and Rb proteins correlated with intragenic mutations in the TP53 and RB1 genes. In contrast, DAXX and ATRX labeling was lost in 45% of PanNETs, whereas p53 and Rb immunolabeling was intact in these same cases. Overexpression of Bcl-2 protein was observed in all 9 small cell NECs (100%) and in 5 of 10 (50%) large cell NECs compared with only 2 of 11 (18%) PanNETs. Bcl-2 overexpression was significantly correlated with higher mitotic rate and Ki67 labeling index in neoplasms in which it was present. Small cell NECs are genetically similar to large cell NECs, and these genetic changes are distinct from those reported in PanNETs. The finding of Bcl-2 overexpression in poorly differentiated NECs, particularly small cell NEC, suggests that Bcl-2 antagonists/inhibitors may be a viable treatment option for these patients.
Dynamics of buckbrush populations under simulated forest restoration alternatives (P-53)
David W. Huffman; Margaret M. Moore
2008-01-01
Plant population models are valuable tools for assessing ecological tradeoffs between forest management approaches. In addition, these models can provide insight on plant life history patterns and processes important for persistence and recovery of populations in changing environments. In this study, we evaluated a set of ecological restoration alternatives for their...
Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.
2014-01-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269
Tongtawee, Taweesak; Dechsukhum, Chavaboon; Leeanansaksiri, Wilairat; Kaewpitoon, Soraya; Kaewpitoon, Natthawut; Loyd, Ryan A; Matrakool, Likit; Panpimanmas, Sukij
2016-01-01
The tumor suppressor p53 is as a regulator of cell proliferation, apoptosis and many other biological processes as well as external and internal stress responses. Mdm2 SNIP309 is a negative regulator of 53. Therefore, this study aimed to determine the role of the Mdm2 SNIP 309 polymorphism in the gastric mucosal morphological patterns in patients with Helicobacter pylori associated gastritis. A prospective cross-sectional study was carried out from November 2014 through November 2015. Biopsy specimens were obtained from patients and infection was proven by positive histology. Gastric mucosa specimens were sent to the Molecular Genetics Unit, Institute of Medicine, Suranaree University of Technology where they were tested by molecular methods to detect the patterns of Mdm2 SNIP 309 polymorphism using the real-time PCR hybridization probe method. The results were analyzed and correlated with gastric mucosal morphological patterns by using C-NBI endoscopy. A total of 300 infected patients were enrolled and gastric mucosa specimens were collected. In this study the percentage of Mdm2 SNIP 309 T/T homozygous and Mdm2 SNIP309 G/T heterozygous was 78% and 19 % respectively whereas Mdm2 SNIP309 G/G homozygous was 3%. Mdm2 SNIP 309 T/T homozygous and Mdm2 SNIP309 G/T heterozygosity correlated with type 1 to type 3 gastric mucosal morphological patterns (P<0.01) whereas Mdm2 SNIP309 G/G homozygous correlated with type 4 and type 5 (P<0.01). Our study finds the frequency of Mdm2 SNIP309 G/G in a Thai population is very low, and suggests that this can explain ae Thailand enigma. Types 1 to type 3 are the most common gastric mucosal morphological patterns according to the unique genetic polymorphism of MDM2 SNIP 309 in the Thai population.
Liu, Ruixue; Jia, Wei; Zou, Hong; Wang, Xinhua; Ren, Yan; Zhao, Jin; Wang, Lianghai; Li, Man; Qi, Yan; Shen, Yaoyuan; Liang, Weihua; Jiang, Jinfang; Sun, Zhenzhu; Pang, Lijuan; Li, Feng
2015-01-01
Perivascular epithelioid cell tumor (PEComa) is a rare mesenchymal tumor composed of histologically and immunohistochemically distinctive perivascular epithelioid cells. The perivascular epithelioid cell (PEC) co-expresses melanocytic and muscle markers. Since no normal counterpart to the PEC has ever been identified in any normal tissue, the cell origin of these tumors is still uncertain. Although, several hypotheses have recently been advanced to explain the histogenesis of PEComa, it remains unclear. The aim of this study was to discuss whether differential expression of stem cell-associated proteins could be used to aid in determining the histogenesis of PEComa. For this purpose, we detected the immunoexpression of 5 kinds of stem cell markers on PEComas, including CD29, CD44, CD133, ALDH1, and nestin. In addition to observed histopathologic morphology, we also performed PEComa relevant clinical diagnostic markers (HMB-45, SMA, melan-A, Desmin, Ki-67, S-100 and TFE3) to identify whether they belonged to PEComas. Our study included 13 PEComa samples, and we obtained positive immunoexpression results as follows: CD29 (13/13), CD44 (8/13), ALDH1 (10/13), nestin (1/13), and CD133 (0/13). Since CD44 and CD29 are surface proteins associated with MSCs, these results suggest that PEComa might arise from MSCs. However, whether MSCs are the origin of PEComa needs to be further explored in the future.
Elmas, Onur; Erbas, Oytun; Yigitturk, Gurkan
2016-10-01
Cytokines, such as transforming growth factor (TGF)-ß1, and increased oxidative stress are considered to be responsible for the development of diabetic nephropathy. We hypothesized that Aesculus hippocastanum (AH) seeds may have preventive effects on oxidative stress and TGF-β-related diabetic nephropathy in streptozotocin (STZ)-induced diabetic nephropathy in rats. Twenty-one male Sprague-Dawley albino rats were divided into three groups (n=7). Except for the control group, they all had diabetic nephropathy induced by an intraperitoneal injection of STZ. While the diabetes group did not receive any medication, the diabetes+AH group was given the medication for 4 weeks. After the experiment, analyses were performed to evaluate the glomerular area, severity of sclerosis, and fibronectin immunoexpression, as well as levels of malondialdehyde (MDA), TGF-β, blood urea nitrogen (BUN), blood glucose, creatinine, and proteinuria. It was found that glomerular area, severity of sclerosis, fibronectin immunoexpression, and levels of MDA, TGF-β, BUN, creatinine, and proteinuria were decreased in the diabetes+AH group. It is known that diabetic nephropathy is induced, to a large extent, by hyperglycemia. In the present study, AH extract ameliorated diabetic nephropathy without decrease in blood glucose levels. In the study, AH seeds showed beneficial effects on the functional properties of the kidney and microscopic improvements in diabetic nephropathy. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Kolodziejczyk, L; Laszczyńska, M; Masiuk, M; Grabowska, M; Skrzydlewska, E
2015-01-01
We investigated the immunoexpression of the intermediate filament proteins, cytokeratin and desmin, and the morphological changes in the liver of rats during experimental fasciolosis at 4, 7 and 10 weeks post-infection. Rats were infected with 30 Fasciola hepatica metacercariae. Paraffin sections of the liver were stained using H & E, PAS and azan stains. Immunohistochemical reactions were performed using antibodies against cytokeratin and desmin. The experimental F. hepatica infection led to fibrosis and cirrhosis of the liver, and to inflammation of the common bile ducts. The expression of cytokeratin was increased in the epithelial cells of both the liver bile ductules at 4, 7 and 10 weeks post-infection and in the common bile ducts at 7 and 10 weeks post-infection compared to uninfected rats; expression in the common bile ducts was more intense. The myofibroblasts of the liver and smooth myocytes of the interlobular bile ducts and common bile ducts, showed a slight increase in desmin expression compared to the uninfected rats. The increased expression of cytokeratins in the hyperplastic rat common bile duct epithelium during the biliary phase of fasciolosis at 7 and 10 weeks post-infection may be explained by mechanical irritation by the parasite and an inflammatory reaction in the bile duct epithelium and in periductal fibrous tissue.
Rodrigues, Janderson Teixeira; Dos Santos Antunes, Henrique; Armada, Luciana; Pires, Fábio Ramôa
2017-12-01
The biologic effects of surgical decompression on the epithelium and connective tissues of periapical cysts are not fully understood. The aim of this study was to evaluate the expression of tissue repair and inflammatory biomarkers in periapical cysts before and after surgical decompression. Nine specimens of periapical cysts treated with decompression before undergoing complete enucleation were immunohistochemically analyzed to investigate the expression of interleukin-1β, tumor necrosis factor-α, transforming growth factor-β1, matrix metalloproteinase-9, Ki-67, and epidermal growth factor receptor. Expression of the biomarkers was classified as positive, focal, or negative. Ki-67 immunoexpression was calculated as a cell proliferation index. The expression of the biomarkers was compared in the specimens from decompression and from the final surgical procedure. Computed tomography demonstrated that volume was reduced in all cysts after decompression. There were no differences in the immunoexpression of the proinflammatory and tissue repair biomarkers when comparing the specimens obtained before and after the decompression. Surgical decompression was efficient in reducing the volume of periapical cysts before complete enucleation. When comparing the specimens obtained from surgical decompression and from complete surgical removal, the immunohistochemical analysis did not show a decrease in proinflammatory biomarkers; neither did it show an increase in tissue repair biomarkers. Copyright © 2017 Elsevier Inc. All rights reserved.
Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W
2010-11-01
Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.
Dietary Patterns and Body Mass Index in Children with Autism and Typically Developing Children
Evans, E. Whitney; Must, Aviva; Anderson, Sarah E.; Curtin, Carol; Scampini, Renee; Maslin, Melissa; Bandini, Linda
2012-01-01
To determine whether dietary patterns (juice and sweetened non-dairy beverages, fruits, vegetables, fruits & vegetables, snack foods, and kid’s meals) and associations between dietary patterns and body mass index (BMI) differed between 53 children with autism spectrum disorders (ASD) and 58 typically developing children, ages 3 to 11, multivariate regression models including interaction terms were used. Children with ASD were found to consume significantly more daily servings of sweetened beverages (2.6 versus 1.7, p=0.03) and snack foods (4.0 versus 3.0, p=0.01) and significantly fewer daily servings of fruits and vegetables (3.1 versus 4.4, p=0.006) than typically developing children. There was no evidence of statistical interaction between any of the dietary patterns and BMI z-score with autism status. Among all children, fruits and vegetables (p=0.004) and fruits alone (p=0.005) were positively associated with BMI z-score in our multivariate models. Children with ASD consume more energy-dense foods than typically developing children; however, in our sample, only fruits and vegetables were positively associated with BMI z-score. PMID:22936951
Mechanisms for ribotoxin-induced ribosomal RNA cleavage
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Kaiyu; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Zhou, Hui-Ren
The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activatedmore » kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via activation of p53, caspases and cathepsins. ► DON- and anisomycin-triggered rRNA cleavage is p38-dependent. ► SG- and ricin-induced rRNA cleavage is p38-independent.« less
Kingsbury, K. J.; Kay, L.; Hjelm, M.
1998-01-01
AIM: There is little information on the plasma free amino acid patterns of elite athletes against which fatigue and nutrition can be considered. Therefore the aim was to include analysis of this pattern in the medical screening of elite athletes during both especially intense and light training periods. METHODS: Plasma amino acid analysis was undertaken in three situations. (1) A medical screening service was offered to elite athletes during an intense training period before the 1992 Olympics. Screening included a blood haematological/biochemical profile and a microbial screen in athletes who presented with infection. The athletes were divided into three groups who differed in training fatigue and were considered separately. Group A (21 track and field athletes) had no lasting fatigue; group B (12 judo competitors) reported heavy fatigue at night but recovered overnight to continue training; group C (18 track and field athletes, one rower) had chronic fatigue and had been unable to train normally for at least several weeks. (2) Athletes from each group were further screened during a post- Olympic light training period. (3) Athletes who still had low amino acid levels during the light training period were reanalysed after three weeks of additional protein intake. RESULTS: (1) The pre-Olympics amino acid patterns were as follows. Group A had a normal amino acid pattern (glutamine 554 (25.2) micromol/l, histidine 79 (6.1) micromol/l, total amino acids 2839 (92.1) micromol/l); all results are means (SEM). By comparison, both groups B and C had decreased plasma glutamine (average 33%; p<0.001) with, especially in group B, decreased histidine, glucogenic, ketogenic, and branched chain amino acids (p<0.05 to p<0.001). None in group A, one in group B, but ten athletes in group C presented with infection: all 11 athletes had plasma glutamine levels of less than 450 micromol/l. No intergroup differences in haematological or other blood biochemical parameters, apart from a lower plasma creatine kinase activity in group C than in group B (p<0.05) and a low neutrophil to lymphocyte ratio in the athletes with viral infections (1.2 (0.17)), were found. (2) During post-Olympic light training, group A showed no significant amino acid changes. In contrast, group B recovered normal amino acid levels (glutamine 528 (41.4) micromol/l, histidine 76 (5.3) micromol/l, and total amino acids 2772 (165) micromol/l) (p<0.05 to p<0.001) to give a pattern comparable with that of group A, whereas, in group C, valine and threonine had increased (p<0.05), but glutamine (441 (24.5) micromol/l) and histidine (58 (5.3) micromol/l) remained low. Thus none in group A, two in group B, but ten (53%) in group C still had plasma glutamine levels below 450 micromol/l, including eight of the 11 athletes who had presented with infection. (3) With the additional protein intake, virtually all persisting low glutamine levels increased to above 500 micromol/l. Plasma glutamine rose to 592 (35.1) micromol/l and histidine to 86 (6.0) micromol/l. Total amino acids increased to 2761 (128) micromol/l (p<0.05 to p<0.001) and the amino acid pattern normalised. Six of the ten athletes on this protein intake returned to increased training within the three weeks. CONCLUSION: Analysis of these results provided contrasting plasma amino acid patterns: (a) a normal pattern in those without lasting fatigue; (b) marked but temporary changes in those with acute fatigue; (c) a persistent decrease in plasma amino acids, mainly glutamine, in those with chronic fatigue and infection, for which an inadequate protein intake appeared to be a factor. PMID:9562160
Septin 7 immunoexpression in papillary thyroid carcinoma: a preliminary study.
Igci, Yusuf Ziya; Erkilic, Suna; Arslan, Ahmet
2014-07-01
Papillary thyroid carcinoma (PTC) is the most common type among thyroid cancers. The diagnosis of PTC may be challenging when follicular variant (FVPTC) of this disease is present due to the resemblance of nuclear properties of the classical type (CVPTC). However, making use of ancillary molecular markers in the diagnosis of PTC may help. In our study, we aimed to evaluate the SEPT7 protein expression in PTC. A total of 55 paraffin block tissue samples comprising encapsulated FVPTC (FVPTC(e), n=25), and CVPTC (n=15), and benign hyperfunctioning thyroid nodules (HypN, n=15) were used in this study. Nuclear, cytoplasmic, and overall (total) SEPT7 protein expression levels were determined by using immunohistochemistry. Nuclear, cytoplasmic, and overall SEPT7 expressions (p=0.02, p=0.001, p=0.002, respectively) were significantly lower in FVPTC(e) tissues when compared to HypN. In CVPTC group, nuclear expression was significantly lower (p=0.004) while overall and cytoplasmic expressions were not changed (p>0.05). In HypN group, highest nuclear (mean=2.73), cytoplasmic (mean=2.86), and overall (mean=2.86) expression scores were detected. Significantly lower SEPT7 expression in all expressional categories in FVPTC(e) group may be a sign of different molecular signature in this type of tissue. Copyright © 2014 Elsevier GmbH. All rights reserved.
Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status
Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L
2000-01-01
p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365
[Interaction between p53 and MDM2 in human lung cancer cells].
Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J
2014-01-01
The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) - mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.
Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I
2013-04-16
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy
Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.
2013-01-01
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378
Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E
2014-07-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-01-01
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K
2001-07-20
Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.
TRIM25 has a dual function in the p53/Mdm2 circuit.
Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C
2015-11-12
P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.
Serum p53 antibody as a potential tumor marker in extrahepatic cholangiocarcinoma.
Okada, Rei; Shimada, Hideaki; Otsuka, Yuichiro; Tsuchiya, Masaru; Ishii, Jun; Katagiri, Toshio; Maeda, Tetsuya; Kubota, Yoshihisa; Nemoto, Tetsuo; Kaneko, Hironori
2017-12-01
Only a few studies have evaluated the clinicopathological significance of the p53 protein expression and s-p53-Abs level in patients with cholangiocarcinoma. We therefore analyzed the clinicopathological and prognostic significance of s-p53-Abs in patients with extrahepatic cholangiocarcinoma. We prospectively evaluated s-p53-Abs levels before and after surgery in 61 patients with extrahepatic cholangiocarcinoma to determine the relationship between clinicopathological factors and the prognostic significance of s-p53-Abs. Among a total of 61 primary extrahepatic cholangiocarcinoma cases, 23% were positive for s-p53-Abs. Combination of s-p53-Abs with the conventional serum markers carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) significantly increased the rate of positive extrahepatic cholangiocarcinoma cases (57% for CEA and/or CA19-9 vs. 75% for CEA and/or CA19-9 and/or s-p53-Abs, P = 0.035). There were no significant differences in clinicopathological factors between the p53-seropositive and p53-seronegative patients. An immunohistochemical analysis showed the presence of significant associations between the intensity (P = 0.003) and extent (P = 0.001) of p53 immunoreactivity and p53-seropositivitly. Although s-p53-Abs was not a significant prognostic factor for the survival in either univariate or multivariate analyses, p53 immunoreactivity was independently associated with a poor survival. Among patients positive for s-p53-Abs before surgery, the s-p53-Abs levels were reduced after surgery in most. These findings suggested that s-p53-Abs might be associated with p53 immunoreactivity. In addition, s-p53-Abs may be useful for a diagnosis, but was not useful for predicting tumor recurrence or the survival. This study was registered as UMIN000014530.
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
2010-01-01
Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557
Derksen, Patrick W B; Braumuller, Tanya M; van der Burg, Eline; Hornsveld, Marten; Mesman, Elly; Wesseling, Jelle; Krimpenfort, Paul; Jonkers, Jos
2011-05-01
Breast cancer is the most common malignancy in women of the Western world. Even though a large percentage of breast cancer patients show pathological complete remission after standard treatment regimes, approximately 30-40% are non-responsive and ultimately develop metastatic disease. To generate a good preclinical model of invasive breast cancer, we have taken a tissue-specific approach to somatically inactivate p53 and E-cadherin, the cardinal cell-cell adhesion receptor that is strongly associated with tumor invasiveness. In breast cancer, E-cadherin is found mutated or otherwise functionally silenced in invasive lobular carcinoma (ILC), which accounts for 10-15% of all breast cancers. We show that mammary-specific stochastic inactivation of conditional E-cadherin and p53 results in impaired mammary gland function during pregnancy through the induction of anoikis resistance of mammary epithelium, resulting in loss of epithelial organization and a dysfunctional mammary gland. Moreover, combined inactivation of E-cadherin and p53 induced lactation-independent development of invasive and metastatic mammary carcinomas, which showed strong resemblance to human pleomorphic ILC. Dissemination patterns of mouse ILC mimic the human malignancy, showing metastasis to the gastrointestinal tract, peritoneum, lung, lymph nodes and bone. Our results confirm that loss of E-cadherin contributes to both mammary tumor initiation and metastasis, and establish a preclinical mouse model of human ILC that can be used for the development of novel intervention strategies to treat invasive breast cancer.
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407
Takeuchi, Tadahisa; Ohishi, Yoshihiro; Imamura, Hiroko; Aman, Murasaki; Shida, Kaai; Kobayashi, Hiroaki; Kato, Kiyoko; Oda, Yoshinao
2013-07-01
Ovarian transitional cell tumors include Brenner tumors (BTs) and transitional cell carcinoma (TCC; non-BTs) according to the most recent World Health Organization classification. However, it remains a matter of debate whether TCC represents a distinct entity or a morphologic variant of high-grade serous adenocarcinoma (HG-SC). The purpose of this study was to resolve the above question by clarifying the morphologic, immunohistochemical, and molecular features of TCC. We reviewed 488 cases of epithelial ovarian carcinomas and reclassified them on the basis of the most recent World Health Organization classification with the modifications proposed by Köbel and colleagues, and 35 cases of TCC were identified; 25 and 6 TCCs were admixed with HG-SC and endometrioid adenocarcinoma (EC), respectively, and the remaining 4 cases were pure TCC. TCC components were not observed in any clear cell carcinomas or mucinous adenocarcinomas. Only 2 cases of malignant BT were identified. In addition to TCCs, malignant BTs, and related adenocarcinomas, benign and borderline BTs were included in the following immunohistochemical and molecular analyses. Immunohistochemically, pure TCCs, TCCs admixed with HG-SC, and pure HG-SCs were characterized by frequent aberrant p53 expression (diffuse or null pattern) and WT1+/ER+/PR+/IMP2+ immunophenotype, whereas BTs, including benign, borderline, and malignant BTs, were characterized by lack of aberrant p53 expression and WT1-/ER-/PR-/IMP2- immunophenotype. In contrast to the BTs, pure ECs and TCCs admixed with EC showed an ER+/PR+ immunophenotype. Nearly all the tumors with a TP53 gene mutation by molecular analysis showed aberrant p53 staining patterns. In conclusion, TCC is not a distinct entity but a poorly differentiated form of serous or EC, as (1) most TCCs coexist with HG-SC (mostly) or EC (occasionally), and (2) the immunophenotype and molecular features are similar to those of HG-SC or EC but different from those of BTs.
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Adimonye, Anthony; Stankiewicz, Elzbieta; Kudahetti, Sakunthala; Trevisan, Giorgia; Tinwell, Brendan; Corbishley, Cathy; Lu, Yong-Jie; Watkin, Nick; Berney, Daniel
2018-03-23
To determine whether phosphatidylinositol-4,5-bisphosphate 3- kinase, catalytic subunit alpha (PIK3CA) copy number gain is common and could prove a useful marker for the activation status of the PI3K-AKT-mTOR pathway in penile squamous cell carcinoma (PSCC). Fresh frozen tissue and archival blocks were collected from 24 PSCC patients with 15 matched normal penile epithelium (NPE) tissue from St George's Hospital. PIK3CA mutational and copy number status (CNS) was assessed via Sanger sequencing and fluorescence in-situ hybridisation, respectively. PIK3CA RNA expression was quantified using TaqMan gene expression assay. HPV DNA was detected with INNO-LiPA assay. p-AKT and p-mTOR protein expression were assessed using western blot and immunohistochemistry. PIK3CA copy number gain was found in 11/23 (48%) patients, with mutations present in only 2/24 (8%) patients. In comparison to NPE, PSCC showed significantly lower PIK3CA RNA expression (p=0.0007), p-AKT (Ser473) nuclear immunoexpression (p=0.026) and protein expression of p-AKT (Thr308) (p=0.0247) and p-mTOR (Ser2448) (p=0.0041). No association was found between PIK3CA CNS and p-AKT and p-mTOR protein expression. Based on our results the PI3K-AKT-mTOR pathway is not a key driver in PSCC carcinogenesis and the therapeutic targeting of this pathway is unlikely to produce significant clinical benefit.
Prognostic Factors and Expression of MDM2 in Patients with Primary Extremity Liposarcoma
Júnior, Rosalvo Zósimo Bispo; de Camargo, Olavo Pires; de Oliveira, Cláudia Regina G. C. M.; Filippi, Renée Zon; Baptista, André Mathias; Caiero, Marcelo Tadeu
2008-01-01
OBJECTIVE The objective of this study was to investigate MDM2 (murine double minute 2) protein expression and evaluate its relationship with some anatomical and pathological aspects, aiming also to identify prognostic factors concerning local recurrence-free survival, metastasis-free survival and overall survival in patients with primary liposarcomas of the extremities. MATERIALS AND METHODS Of 50 patients with primary liposarcomas of the extremities admitted to a Reference Service, between 1968 and 2004, 25 were enrolled in the study, following eligibility and exclusion criteria. RESULTS The adverse factors that influenced the risk for local recurrence in the univariant analysis included male sex (P = 0.023), pleomorphic histological subtype (P = 0.027), and high histological grade (P = 0.007). Concerning metastasis-free survival, age less than 50 years (P = 0.040), male sex (P = 0.040), pleomorphic subtype (P < 0.001), and high histological grade (P = 0.003) had a worse prognosis. Adverse factors for overall survival were age under 50 years (P = 0.040), male sex (P = 0.040), pleomorphic subtype (P < 0.001), and high histological grade (P = 0.003). CONCLUSIONS There was no correlation between immunohistochemically observed MDM2 protein expressions and the anatomical and pathological variables studied. The immunohistochemical expression of MDM2 protein was not considered to have a prognostic value for any of the surviving patients in this study (local recurrence-free survival, metastasis-free survival, or overall survival). The immunoexpression of MDM2 protein was a frequent event in the different subtypes of liposarcomas. PMID:18438568
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun
2015-03-01
The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.
The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status.
Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer
2011-03-11
The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21- combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21- carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status.
Negative feedback regulation of wild-type p53 biosynthesis.
Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W
1995-01-01
When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087
Combined radiation and p53 gene therapy of malignant glioma cells.
Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A
1999-01-01
More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.
Asgari, Mojgan; Nabi Maybodi, Mahtab; Abolhasani, Maryam
2016-01-01
Background: Flat urothelial lesions comprise a spectrum of morphologic changes ranging from reactive atypia to carcinoma in situ (CIS). Urothelial dysplasia and CIS are associated with the recurrence and progression of urothelial carcinoma. Distinguishing CIS and dysplasia from reactive atypia based on histolopathogical features alone is often difficult. Using different immunohistochemical markers such as Cytokeratin 20 (CK20), CD44, p53, and Ki-67 is recommended for differential diagnosis. The aim of this study was to evaluate the immunohistochemical pattern of these antibodies to differentiate different flat urothelial lesions. Methods: In this cross- sectional study, three groups of bladder biopsy specimens were evaluated: 20 samples with reactive urothelial lesions, 20 histologically diagnosed as CIS, and 20 morphologically normal samples. Immunohistochemical staining of CK20, p53, CD44 and Ki-67 markers was performed on paraffin-embedded blocks. The groups were compared using chi square test, and the diagnostic value of the markers were evaluated with sensitivity, specificity, positive and negative predictive values. Results: CK20 was full thickness positive in 15 (75%) CIS samples and negative in all samples of the normal and reactive groups (p<0.001); CD44 was positive in 2 (10%) cases of the CIS group and in 17 (85%) of the reactive group; this marker was negative in all the normal samples (p<0.001). P53 was positive in 12 (60%) samples of the CIS group and negative in all samples of the normal and reactive groups (p<0.001). Ki67 was positive in 13 (65%) samples of the CIS group and 1 (5%) sample of the reactive group. This marker was negative in all samples of the normal group (p<0.001). Conclusion: The results of this study revealed that CK20, CD44, P53 and Ki67 are useful in distinguishing CIS from reactive and normal samples. However, they should be used in a panel including at least three markers. Correlation with the morphologic features is necessary. PMID:27579290
DOE Office of Scientific and Technical Information (OSTI.GOV)
An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min
Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less
Sperandio, Felipe F.; Simões, Alyne; Corrêa, Luciana; Aranha, Ana Cecília C.; Giudice, Fernanda S.; Hamblin, Michael R.; Sousa, Suzana C.O.M.
2015-01-01
Low-level laser therapy (LLLT) has been extensively employed to improve epithelial wound healing, though the exact response of epithelium maturation and stratification after LLLT is unknown. Thus, this study aimed to assess the in vitro growth and differentiation of keratinocytes (KCs) and in vivo wound healing response when treated with LLLT. Human KCs (HaCaT cells) showed an enhanced proliferation with all the employed laser energy densities (3, 6 and 12 J/cm2, 660nm, 100mW), together with an increased expression of Cyclin D1. Moreover, the immunoexpression of proteins related to epithelial proliferation and maturation (p63, CK10, CK14) all indicated a faster maturation of the migrating KCs in the LLLT-treated wounds. In that way, an improved epithelial healing was promoted by LLLT with the employed parameters; this improvement was confirmed by changes in the expression of several proteins related to epithelial proliferation and maturation. PMID:25411997
Angadi, Vidya C; Angadi, Punnya V
2015-06-01
Glucose transporters, such as GLUT-1, mediate the important mechanisms involved in cellular glucose influx, allowing cells to proliferate and survive. The significance of GLUT-1 expression in oral epithelial dysplasia (OED) and oral squamous cell carcinoma (OSCC) has been less explored, and no study has investigated it in relation to verrucous carcinoma (VC). We evaluated 30 cases each of OED, OSCC, and VC, graded further on the basis of their differentiation, immunohistochemically for GLUT-1 expression, along with 10 specimens of normal oral mucosa (NOM) as controls. In OSCC, GLUT-1 expression increased with the degree of dysplasia and increasing grade (P < 0.001). The expression in VC was predominantly membranous and intense, resembling well differentiated OSCC. This increase of GLUT-1 expression in OSCC along with the degree of dysplasia and the histologic grade reflects the expanding glycolytic response to hypoxia. This is the first study to have revealed prominent GLUT-1 expression in VC, highlighting its inherent metabolic capacity.
Yoo, Su-Hyang; Lim, Yong; Kim, Seung-Jung; Yoo, Kyu-Dong; Yoo, Hwan-Soo; Hong, Jin-Tae; Lee, Mi-Yea; Yun, Yeo-Pyo
2013-01-01
Vascular diseases such as atherosclerosis and restenosis artery angioplasty are associated with vascular smooth muscle cell (VSMC) proliferation and intimal thickening arterial walls. In the present study, we investigated the inhibitory effects of sulforaphane, an isothiocyanate produced in cruciferous vegetables, on VSMC proliferation and neointimal formation in a rat carotid artery injury model. Sulforaphane at the concentrations of 0.5, 1.0, and 2.0 μM significantly inhibited platelet-derived growth factor (PDGF)-BB-induced VSMC proliferation in a concentration-dependent manner, determined by cell count. The IC50 value of sulforaphane-inhibited VSMC proliferation was 0.8 μM. Sulforaphane increased the cyclin-dependent kinase inhibitor p21 and p53 levels, while it decreased CDK2 and cyclin E expression. The effects of sulforaphane on vascular thickening were determined 14 days after the injury to the rat carotid artery. The angiographic mean luminary diameters of the group treated with 2 and 4 μM sulforaphane were 0.25±0.1 and 0.09±0.1 mm², respectively, while the value of the control groups was 0.40±0.1 mm², indicating that sulforaphane may inhibit neointimal formation. The expression of PCNA, maker for cell cycle arrest, was decreased, while that of p53 and p21 was increased, which showed the same pattern as one in in-vitro study. These results suggest that sulforaphane-inhibited VSMC proliferation may occur through the G1/S cell cycle arrest by up-regulation of p53 signaling pathway, and then lead to the decreased neointimal hyperplasia thickening. Thus, sulforaphane may be a promising candidate for the therapy of atherosclerosis and post-angiography restenosis. © 2013.
The up-regulation of miR-300 in gastric cancer and its effects on cells malignancy
Shen, Zhen; Li, Chunsheng; Zhang, Kai; Yu, Wei; Xiao, Huijie; Li, Bo; Liu, Tongjun
2015-01-01
Objective: In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of gastric cancer cells. Methods: MicroRNA and protein expression patterns were compared between gastric cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in AGS gastric cancer cells. Results: We observed that miR-300 expression was frequently and dramatically up-regulated in human gastric cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote gastric cancer cell proliferation and invasion by increasing p53 expression. Conclusion: Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in gastric cancer cell proliferation during gastric tumorigenesis. PMID:26221215
The up-regulation of miR-300 in gastric cancer and its effects on cells malignancy.
Shen, Zhen; Li, Chunsheng; Zhang, Kai; Yu, Wei; Xiao, Huijie; Li, Bo; Liu, Tongjun
2015-01-01
In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of gastric cancer cells. MicroRNA and protein expression patterns were compared between gastric cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in AGS gastric cancer cells. We observed that miR-300 expression was frequently and dramatically up-regulated in human gastric cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote gastric cancer cell proliferation and invasion by increasing p53 expression. Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in gastric cancer cell proliferation during gastric tumorigenesis.
The organization and expression of the mdm2 gene.
de Oca Luna, R M; Tabor, A D; Eberspaecher, H; Hulboy, D L; Worth, L L; Colman, M S; Finlay, C A; Lozano, G
1996-05-01
The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequencing of normal BalbC/J DNA and the original cosmid clone isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues.
Sarkar, F H; Valdivieso, M; Borders, J; Yao, K L; Raval, M M; Madan, S K; Sreepathi, P; Shimoyama, R; Steiger, Z; Visscher, D W
1995-12-01
The p53 tumor suppressor gene has been found to be altered in almost all human solid tumors, whereas K-ras gene mutations have been observed in a limited number of human cancers (adenocarcinoma of colon, pancreas, and lung). Studies of mutational inactivation for both genes in the same patient's sample on non-small-cell lung cancer have been limited. In an effort to perform such an analysis, we developed and compared methods (for the mutational detection of p53 and K-ras gene) that represent a modified and universal protocol, in terms of DNA extraction, polymerase chain reaction (PCR) amplification, and nonradioisotopic PCR-single-strand conformation polymorphism (PCR-SSCP) analysis, which is readily applicable to either formalin-fixed, paraffin-embedded tissues or frozen tumor specimens. We applied this method to the evaluation of p53 (exons 5-8) and K-ras (codon 12 and 13) gene mutations in 55 cases of non-small-cell lung cancer. The mutational status in the p53 gene was evaluated by radioisotopic PCR-SSCP and compared with PCR-SSCP utilizing our standardized nonradioisotopic detection system using a single 6-microns tissue section. The mutational patterns observed by PCR-SSCP were subsequently confirmed by PCR-DNA sequencing. The mutational status in the K-ras gene was similarly evaluated by PCR-SSCP, and the specific mutation was confirmed by Southern slot-blot hybridization using 32P-labeled sequence-specific oligonucleotide probes for codons 12 and 13. Mutational changes in K-ras (codon 12) were found in 10 of 55 (18%) of non-small-cell lung cancers. Whereas adenocarcinoma showed K-ras mutation in 33% of the cases at codon 12, only one mutation was found at codon 13. As expected, squamous cell carcinoma samples (25 cases) did not show K-ras mutations. Mutations at exons 5-8 of the p53 gene were documented in 19 of 55 (34.5%) cases. Ten of the 19 mutations were single nucleotide point mutations, leading to amino acid substitution. Six showed insertional mutation, and three showed deletion mutations. Only three samples showed mutations of both K-ras and p53 genes. We conclude that although K-ras and p53 gene mutations are frequent in non-small-cell lung cancer, mutations of both genes in the same patient's samples are not common. We also conclude that this universal nonradioisotopic method is superior to other similar methods and is readily applicable to the rapid screening of large numbers of formalin-fixed, paraffin-embedded or frozen samples for the mutational analysis of multiple genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth
Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less
Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.
Suppiah, Aravind; Greenman, John
2013-08-07
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.
Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo
2012-04-01
Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.
Zeestraten, Eliane C M; Speetjens, Frank M; Welters, Marij J P; Saadatmand, Sepideh; Stynenbosch, Linda F M; Jongen, Rogier; Kapiteijn, Ellen; Gelderblom, Hans; Nijman, Hans W; Valentijn, A Rob P M; Oostendorp, Jaap; Fathers, Lorraine M; Drijfhout, Jan W; van de Velde, Cornelis J H; Kuppen, Peter J K; van der Burg, Sjoerd H; Melief, Cornelis J M
2013-04-01
We previously established safety and immunogenicity of a p53 synthetic long peptides (p53-SLP®) vaccine. In the current trial, we investigated whether combination of interferon-alpha (IFN-α) with p53-SLP® is both safe and able to improve the induced p53-specific IFN-γ response. Eleven colorectal cancer patients successfully treated for metastatic disease were enrolled in this study. Of these, nine patients completed follow-up after two injections with p53-SLP® together with IFN-α. Safety and p53-specific immune responses were determined before and after vaccination. Furthermore, cryopreserved PBMCs were compared head-to-head to cryopreserved PBMCs obtained in our previous trial with p53-SLP® only. Toxicity of p53-SLP® vaccination in combination with IFN-α was limited to Grade 1 or 2, with predominantly small ongoing swellings at the vaccination site. All patients harbored p53-specific T cells after vaccination and most patients showed p53-specific antibodies. Compared to the previous trial, addition of IFN-α significantly improved the frequency of p53-specific T cells in IFN-γ ELISPOT. Moreover, in this trial, p53-specific T cells were detectable in blood samples of all patients in a direct ex vivo multiparameter flowcytometric assay, opposed to only 2 of 10 patients vaccinated with p53-SLP® only. Finally, patients in this trial displayed a broader p53-specific immunoglobulin-G response, indicating an overall better p53-specific T-helper response. Our study shows that p53-SLP® vaccination combined with IFN-α injection is safe and capable of inducing p53-specific immunity. When compared to a similar trial with p53-SLP® vaccination alone the combination was found to induce significantly more IFN-γ producing p53-specific T cells. Copyright © 2012 UICC.
Nakamura, Takeshi; Miyagawa, Shinichi; Katsu, Yoshinao; Sato, Tomomi; Iguchi, Taisen; Ohta, Yasuhiko
2012-01-01
Estrogen regulates morphological changes in reproductive organs, such as the vagina and uterus, during the estrous cycles in mice. Estrogen depletion by ovariectomy in adults results in atrophy accompanied by apoptosis in vaginal and uterine cells, while estrogen treatment following ovariectomy elicits cell proliferation in both organs. Sequential changes in mRNA expression of wingless-related MMTV integration site (Wnt) and Notch signaling genes were analyzed in the vagina and uterus of ovariectomized adult mice after a single injection of 17β-estradiol to provide understanding over the molecular basis of differences in response to estrogen in these organs. We found estrogen-dependent up-regulation of Wnt4, Wnt5a and p21 and down-regulation of Wnt11, hairy/enhancer-of-split related with YRPW motif-1 (Hey1) and delta-like 4 (Dll4) in the vagina, and up-regulation of Wnt4, Wnt5a, Hey1, Heyl, Dll1, p21 and p53 and down-regulation of Wnt11, Hey2 and Dll4 in the uterus. The expression of Wnt4, Hey1, Hey2, Heyl, Dll1 and p53 showed different patterns after the estrogen injection. Expression patterns for Wnt5a, Wnt11, Dll4 and p21 in the vagina and uterus were similar, suggesting that these genes are involved in the proliferation of cells in both those organs in mice.
Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko
2015-01-01
A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.
Expressions of p53 and p21 in primary gastric lymphomas.
Go, J. H.; Yang, W. I.
2001-01-01
The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353
p73 coordinates with Δ133p53 to promote DNA double-strand break repair.
Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun
2018-03-06
Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.
Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.
2018-01-01
Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555
Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.
2000-01-01
p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327
Harajly, Mohamad; Zalzali, Hasan; Nawaz, Zafar; Ghayad, Sandra E.; Ghamloush, Farah; Basma, Hussein; Zainedin, Samiha; Rabeh, Wissam; Jabbour, Mark; Tawil, Ayman; Badro, Danielle A.; Evan, Gerard I.
2015-01-01
The restoration of p53 has been suggested as a therapeutic approach in tumors. However, the timing of p53 restoration in relation to its efficacy during tumor progression still is unclear. We now show that the restoration of p53 in murine premalignant proliferating pineal lesions resulted in cellular senescence, while p53 restoration in invasive pineal tumors did not. The effectiveness of p53 restoration was not dependent on p19Arf expression but showed an inverse correlation with Mdm2 expression. In tumor cells, p53 restoration became effective when paired with either DNA-damaging therapy or with nutlin, an inhibitor of p53-Mdm2 interaction. Interestingly, the inactivation of p53 after senescence resulted in reentry into the cell cycle and rapid tumor progression. The evaluation of a panel of human supratentorial primitive neuroectodermal tumors (sPNET) showed low activity of the p53 pathway. Together, these data suggest that the restoration of the p53 pathway has different effects in premalignant versus invasive pineal tumors, and that p53 activation needs to be continually sustained, as reversion from senescence occurs rapidly with aggressive tumor growth when p53 is lost again. Finally, p53 restoration approaches may be worth exploring in sPNET, where the p53 gene is intact but the pathway is inactive in the majority of examined tumors. PMID:26598601
Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.
Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B
2018-05-23
TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less
TP53 mutations in primary breast carcinomas from white and African-Brazilian patients.
Nagai, Maria Aparecida; Schaer Barbosa, Helenemarie; Zago, Marco Antonio; Araújo Silva, Wilson; Nishimoto, Inês Nobuko; Salaorni, Sibeli; Guerreiro Costa, Lívia Nery Franco; Silva Araújo, Marcos; Caldas Oliveira, Ana Gabriela; Mourâo Neto, Mário; Brentani, Maria Mitzi
2003-07-01
We have attempted to determine the incidence, nature and clinical significance of TP53 mutation in a group of white (242 cases) and African-Brazilian (52 cases) patients with breast cancer. The interethnic admixture as estimated by STR markers showed that white subjects displayed 67.9+/-0.4%, 25.0+/-1.7% and 7.0%+/-1.6% and the black populations had 34.4+/-1.9%, 56.2+/-1.9 and 9.4+/-2.2% respectively of European, African and Amerindian genes. Clinical parameters such as age, lymph node status and steroid receptors were similar in both groups. African-Brazilian patients presented more advanced lesions. Mutation screening was performed using polymerase chain reaction-single strand conformation analysis followed by sequencing. Compared to whites (13.6%), a relatively high frequency of TP53 mutation was found in blacks (32.7%) (p=0.001). African-Brazilian women have a larger proportion of mutations in exons 5 and 7, whereas white women have more mutations in exon 8. Mutations within exon 4 were found only in tumors of white patients. The spectra of TP53 mutations show that A:T-->G:C nucleotide transversion and G:C-->C:G transition were more common in African-Brazilian women whereas G:C-->T:A transversion occurs very frequently in whites. A high prevalence of G:C-->A:T nucleotide transitions and deletions was detected in both groups. No association was found between p53 gene mutation and tumor or clinical parameters independently of the ethnic group. With a median follow-up of 35.6 months for whites and 43.4 months for the blacks, no differences in overall survival were found. If white patients were stratified according to the type and location of TP53 mutations, patients with mutations affecting amino acids directly involved in DNA or Zn binding displayed a poor prognosis. The pattern of mutations found in our population seems to reflect a base line pattern observed in populations with similar ethnic profile with some modifications, which might be derived from specific etiological factors.
Peluso, Marco; Bollati, Valentina; Munnia, Armelle; Srivatanakul, Petcharin; Jedpiyawongse, Adisorn; Sangrajrang, Suleeporn; Piro, Sara; Ceppi, Marcello; Bertazzi, Pier Alberto; Boffetta, Paolo; Baccarelli, Andrea A
2012-01-01
Background Adverse biological effects from airborne pollutants are a primary environmental concern in highly industrialized areas. Recent studies linked air pollution exposures with altered blood Deoxyribo-nucleic acid (DNA) methylation, but effects from industrial sources and underlying biological mechanisms are still largely unexplored. Methods The Ma Ta Phut industrial estate (MIE) in Rayong, Thailand hosts one of the largest steel, oil refinery and petrochemical complexes in south-eastern Asia. We measured a panel of blood DNA methylation markers previously associated with air pollution exposures, including repeated elements [long interspersed nuclear element-1 (LINE-1) and Alu] and genes [p53, hypermethylated-in-cancer-1 (HIC1), p16 and interleukin-6 (IL-6)], in 67 MIE workers, 65 Ma Ta Phut residents and 45 rural controls. To evaluate the role of DNA damage and oxidation, we correlated DNA methylation measures with bulky DNA and 3-(2-deoxy-β-D-erythro-pentafuranosyl)pyrimido[1,2-α]purin-10(3H)-one deoxyguanosine (M1dG) adducts. Results In covariate-adjusted models, MIE workers, compared with rural residents, showed lower LINE-1 (74.8% vs 78.0%; P < 0.001), p53 (8.0% vs 15.7%; P < 0.001) and IL-6 methylation (39.2% vs 45.0%; P = 0.027) and higher HIC1 methylation (22.2% vs 15.3%, P < 0.001). For all four markers, Ma Ta Phut residents exhibited methylation levels intermediate between MIE workers and rural controls (LINE-1, 75.7%, P < 0.001; p53, 9.0%, P < 0.001; IL-6, 39.8%, P = 0.041; HIC1, 17.8%, P = 0.05; all P-values vs rural controls). Bulky DNA adducts showed negative correlation with p53 methylation (P = 0.01). M1dG showed negative correlations with LINE-1 (P = 0.003) and IL-6 methylation (P = 0.05). Conclusions Our findings indicate that industrial exposures may induce alterations of DNA methylation patterns detectable in blood leucocyte DNA. Correlation of DNA adducts with DNA hypomethylation suggests potential mediation by DNA damage. PMID:23064502
Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo
2015-01-01
ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792
Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer
Suppiah, Aravind; Greenman, John
2013-01-01
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463
Mechanisms that enhance sustainability of p53 pulses.
Kim, Jae Kyoung; Jackson, Trachette L
2013-01-01
The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.
Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina
2013-01-01
The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961
Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function
Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.
2011-01-01
The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107
HIPK2 modulates p53 activity towards pro-apoptotic transcription.
Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella
2009-10-14
Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.
[Heart failure patterns in Djibouti: epidemiologic transition].
Massoure, P L; Roche, N C; Lamblin, G; Topin, F; Dehan, C; Kaiser, E; Fourcade, L
2013-05-01
The features of heart failure (HF) in Djibouti have not been well described. We sought to document the current patterns of HF here. We prospectively included Djiboutian adults hospitalized for HF in the French Military Hospital (Djibouti) from August 2008 through December 2010. Of 1688 adults hospitalized in the medical department, 45 (2.7%) had symptomatic HF: 38 (84%) men, mean age 55.8 years (range 27-75). Twenty-five (56%) patients were initially hospitalized for acute pulmonary edema. The underlying diseases included coronary artery disease (CAD) (62%), hypertensive heart disease (18%), rheumatic valvular disease (13%), and primary dilated cardiomyopathy (7%). Their cardiovascular risk factors included tobacco use (53%), hypertension (69%), diabetes (47%), and hypercholesterolemia (51%). Patients in the CAD group were older, and had diabetes more often (p<0.01). All khat chewers (53%) were males and smokers. Mean left ventricular ejection fraction (LVEF) was 39 ± 14%. During follow-up (14.4 ± 9 months), 8 (18%) patients died, 9 (20%) were again hospitalized for HF, and 3 (7%) had ischemic strokes. One month after discharge, the New York Heart Association (NYHA) class was II for 40%, III for 44%, and IV for 16%. Higher NYHA classes and dilated cardiomyopathy were both associated with poorer outcomes (p<0.03). In hospitalized Djiboutians, most HF patterns are similar to those in industrialized countries. CAD is more prevalent than previously reported in African patients with HF.
An adaptive molecular timer in p53-meidated cell fate decision
NASA Astrophysics Data System (ADS)
Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei
The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).
Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.
Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald
2013-04-17
The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.
UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation
Du, Cheng; Wu, Hong; Leng, Roger P.
2016-01-01
Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821
Soares, Joana; Raimundo, Liliana; Pereira, Nuno A L; dos Santos, Daniel J V A; Pérez, Maria; Queiroz, Glória; Leão, Mariana; Santos, Maria M M; Saraiva, Lucília
2015-01-01
Inactivation of the p53 tumor suppressor protein by interaction with murine double minute (MDM) proteins, MDM2 and MDMX, is a common event in human tumors expressing wild-type p53. In these tumors, the simultaneous inhibition of these interactions with MDMs, for a full p53 reactivation, represents a promising anticancer strategy. Herein, we report the identification of a dual inhibitor of the p53 interaction with MDM2 and MDMX, the (S)-tryptophanol derivative OXAZ-1, from the screening of a small library of enantiopure tryptophanol-derived oxazolopiperidone lactams, using a yeast-based assay. With human colon adenocarcinoma HCT116 cell lines expressing wild-type p53 (HCT116 p53(+/+)) and its p53-null isogenic derivative (HCT116 p53(-/-)), it was shown that OXAZ-1 induced a p53-dependent tumor growth-inhibitory effect. In fact, OXAZ-1 induced p53 stabilization, up-regulated p53 transcription targets, such as MDM2, MDMX, p21, Puma and Bax, and led to PARP cleavage, in p53(+/+), but not in p53(-/-), HCT116 cells. In addition, similar tumor cytotoxic effects were observed for OXAZ-1 against MDMX-overexpressing breast adenocarcinoma MCF-7 tumor cells, commonly described as highly resistant to MDM2-only inhibitors. In HCT116 p53(+/+) cells, the disruption of the p53 interaction with MDMs by OXAZ-1 was further confirmed by co-immunoprecipitation. It was also shown that OXAZ-1 potently triggered a p53-dependent mitochondria-mediated apoptosis, characterized by reactive oxygen species generation, mitochondrial membrane potential dissipation, Bax translocation to mitochondria, and cytochrome c release, and exhibited a p53-dependent synergistic effect with conventional chemotherapeutic drugs. Collectively, in this work, a novel selective activator of the p53 pathway is reported with promising antitumor properties to be explored either alone or combined with conventional chemotherapeutic drugs. Moreover, OXAZ-1 may represent a promising starting scaffold to search for new dual inhibitors of the p53-MDMs interaction. Copyright © 2015 Elsevier Ltd. All rights reserved.
Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.
2012-01-01
During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738
Roninson, Igor B
2002-05-08
p21(Waf1/Cip1/Sdi1) is best known as a broad-specificity inhibitor of cyclin/cyclin-dependent kinase complexes, but p21 also interacts with many other regulators of transcription or signal transduction. p21 induction, which is mediated by p53 and by p53-independent mechanisms, is essential for the onset of cell cycle arrest in damage response and cell senescence. The effects of p21 knockout in mice and its expression patterns in human cancer are consistent with a role for p21 as both a tumour suppressor and an oncogene. Several functions of p21 are likely to promote carcinogenesis and tumour progression. These include endoreduplication and abnormal mitosis that develop in tumour cells after release from p21-induced growth arrest, the ability of p21 to inhibit apoptosis through several different mechanisms, and its ability to stimulate transcription of secreted factors with mitogenic and anti-apoptotic activities. The latter effects of p21 show close resemblance to paracrine activities of senescent cells and to tumour-promoting functions of stromal fibroblasts. Therapeutic strategies targeting the oncogenic consequences of p21 expression may provide a new approach to chemoprevention and treatment of cancer.
Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.
el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.
1997-01-01
We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405
Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils
Stegh, Alexander H.
2012-01-01
Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*
Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi
2011-01-01
Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Level of PAX5 in differential diagnosis of non-Hodgkin's lymphoma
Bharti, Brij; Shukla, Sachin; Tripathi, Ratnakar; Mishra, Suman; Kumar, Mohan; Pandey, Manoj; Mishra, Rajnikant
2016-01-01
Background & objectives: The PAX5, a paired box transcription factor and B-cell activator protein (BSAP), activates B-cell commitment genes and represses non-B-cell lineage genes. About 14 transcript variants of PAX5 have been observed in human. Any alteration in its expression pattern leads to lymphogenesis or associated diseases and carcinogenesis in non-lymphoid tissues. Its mechanisms of function in pathophysiology of non-Hodgkin's lymphoma (NHL) are unclear. This study was intended to explore influence of PAX5 in cascade of NHL pathogenesis and diagnosis. Methods: Samples of 65 patients were evaluated by immunohistochemical staining for cellular localization of PAX5, CD19, CD3, cABL, p53, Ras and Raf and by TUNEL assay, RNA-isolation and reverse transcriptase (RT)-PCR, Western blot analysis, and lactate dehydrogenase (LDH) specific staining. Results: B-cell type NHL patients were positive for PAX5, p53, Ras, CD19, Raf and CD3. All of them showed TUNEL-positive cells. The differential expression pattern of PAX5, CD19, p53, CD3, ZAP70, HIF1α, Ras, Raf and MAPK (mitogen-activated protein kinase) at the levels of transcripts and proteins was observed. The LDH assay showed modulation of LDH4 and LDH5 isoforms in the lymph nodes of NHL patients. Interpretation & conclusions: The histological observations suggested that the patients represent diverse cases of NHL like mature B-cell type, mature T-cell type and high grade diffuse B-cell type NHL. The findings indicate that patients with NHL may also be analyzed for status of PAX5, CD19 and ZAP70, and their transcriptional and post-translational variants for the differential diagnosis of NHL and therapy. PMID:27748274
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.
2008-01-01
Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558
Yadav, Poonam; Kumar, Parveen; Mukesh, Manishi; Kataria, R S; Yadav, Anita; Mohanty, A K; Mishra, B P
2015-04-01
Expression patterns of lipogenic genes (LPL, ABCG2, ACSS2, ACACA, SCD, BDH, LIPIN1, SREBF1, PPARα and PPARγ) were studied in milk purified MEC across different stages of lactation (15, 30, 45, 60, 90, 120 and 240 days relative to parturition) in buffalo. PPARα was the most abundant gene while ABCG2 and ACSS2 had moderate level of expression; whereas expression of SREBF and PPARγ was very low. The expression patterns of some genes (BDH1, ACSS2, and LIPIN1) across lactation were positively correlated with milk yield while negatively correlated with fat yield. SCD also showed weak correlation with milk yield (p, 0.53) and fat yield (p, -0.47). On the other hand, expression pattern of ACACA was negatively correlated with milk yield (p, -0.88) and positively correlated with fat yield (p, 0.62). Strong correlation was observed between genes involved in de novo milk fat synthesis (BDH1, ACSS2, LIPIN2 and SCD) and milk yield. Copyright © 2015 Elsevier Ltd. All rights reserved.
Deliberador, Tatiana Miranda; Giovanini, Allan Fernando; Lopes, Tertuliano Ricardo; Zielak, João César; Moro, Alexandre; Baratto Filho, Flares; Santos, Felipe Rychuv; Storrer, Carmen L Mueller
2014-01-01
Immunoexpression of PPAR-γ and osteocalcin proteins was evaluated for bone repair of critical-size defects (CSDs), created in rat calvaria (n=42) and treated with fragmented abdominal autogenous adipose tissue graft. Three groups (n=14) were formed: C (control - blood clot), AB (autogenous bone) and AT (fragmented adipose tissue). The groups were divided into subgroups (n=7) for euthanasia at 30 and 90 days. Histological and immunohistochemical analyses were performed. Data were subjected to descriptive statistics (mode). A complete bone closure was observed in Group AB 90 days after surgery. In Group C, repair was achieved by the formation of collagen fiber bundles oriented parallel to the wound surface at both post-surgery periods. In Group AT the type of healing was characterized by dense connective tissue containing collagen fiber bundles arranged amidst the remaining adipose tissue, with rare heterotopic bone formation associated with fibrosis and different types of tissue necrosis. Immunostaining of PPAR-γ was not observed in any specimen from Groups C and AB. In Group AT, the immunostaining of PPAR-γ was more evident 30 days after surgery. Immunostaining of osteocalcin was present in all groups and at both postoperative periods. The fragmented autogenous abdominal adipose tissue graft did not favor the repair of critical-size bone defects created surgically in rat calvaria as evidenced by the positive immunostaining of PPAR-γ protein and the negative immunostaining of osteocalcin in the osteoblast-like cells and bone matrix.
Expression of CD44 and CD29 by PEComa cells suggests their possible origin of mesenchymal stem cells
Liu, Ruixue; Jia, Wei; Zou, Hong; Wang, Xinhua; Ren, Yan; Zhao, Jin; Wang, Lianghai; Li, Man; Qi, Yan; Shen, Yaoyuan; Liang, Weihua; Jiang, Jinfang; Sun, Zhenzhu; Pang, Lijuan; Li, Feng
2015-01-01
Background: Perivascular epithelioid cell tumor (PEComa) is a rare mesenchymal tumor composed of histologically and immunohistochemically distinctive perivascular epithelioid cells. The perivascular epithelioid cell (PEC) co-expresses melanocytic and muscle markers. Since no normal counterpart to the PEC has ever been identified in any normal tissue, the cell origin of these tumors is still uncertain. Although, several hypotheses have recently been advanced to explain the histogenesis of PEComa, it remains unclear. Methods: The aim of this study was to discuss whether differential expression of stem cell-associated proteins could be used to aid in determining the histogenesis of PEComa. For this purpose, we detected the immunoexpression of 5 kinds of stem cell markers on PEComas, including CD29, CD44, CD133, ALDH1, and nestin. In addition to observed histopathologic morphology, we also performed PEComa relevant clinical diagnostic markers (HMB-45, SMA, melan-A, Desmin, Ki-67, S-100 and TFE3) to identify whether they belonged to PEComas. Results: Our study included 13 PEComa samples, and we obtained positive immunoexpression results as follows: CD29 (13/13), CD44 (8/13), ALDH1 (10/13), nestin (1/13), and CD133 (0/13). Conclusions: Since CD44 and CD29 are surface proteins associated with MSCs, these results suggest that PEComa might arise from MSCs. However, whether MSCs are the origin of PEComa needs to be further explored in the future. PMID:26722497
A stapled p53 helix overcomes HDMX-mediated suppression of p53.
Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D
2010-11-16
Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.
MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.
Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M
2018-04-17
The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.
Mutation at p53 serine 389 does not rescue the embryonic lethality in mdm2 or mdm4 null mice.
Iwakuma, Tomoo; Parant, John M; Fasulo, Mark; Zwart, Edwin; Jacks, Tyler; de Vries, Annemieke; Lozano, Guillermina
2004-10-07
Mdm2 and its homolog Mdm4 inhibit the function of the tumor suppressor p53. Targeted disruption of either mdm2 or mdm4 genes in mice results in embryonic lethality that is completely rescued by concomitant deletion of p53, suggesting that deletion of negative regulators of p53 results in a constitutively active p53. Thus, these mouse models offer a unique in vivo system to assay the functional significance of different p53 modifications. Phosphorylation of serine 389 in murine p53 occurs specifically after ultraviolet-light-induced DNA damage, and phosphorylation of this site enhances p53 activity both in vitro and in vivo. Recently, mice with a serine to alanine substitution at serine 389 (p53S389A) in the endogenous p53 locus were generated. To examine the in vivo significance of serine 389 phosphorylation during embryogenesis, we crossed these mutant mice to mice lacking mdm2 or mdm4. The p53S389A allele did not alter the embryonic lethality of mdm2 or mdm4. Additional crosses to assay the effect of one p53S389A allele with a p53 null allele also did not rescue the lethal phenotypes. In conclusion, the phenotypes due to loss of mdm2 or mdm4 were not even partially rescued by p53S389A, suggesting that p53S389A is functionally wild type during embryogenesis.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less
Patterns of Gene Expression Associated with Recovery and Injury in Heat-stressed Rats
2014-12-03
Schultz CR, Golembieski WA, King DA, Brown SL, Brodie C, Rempel SA: Inhibition of HSP27 alone or in combination with pAKT inhibition as therapeutic...Extracellular HSP27 acts as a signaling molecule to activate NF-kappaB in macrophages. Cell Stress Chaperones 2013, 18(1):53–63. 68. Thompson MR, Xu D
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Polato, Federica; Rusconi, Paolo
2014-01-01
Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.
Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L
1999-12-01
The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy, not only in human gliomas that express mutant p53, but also in those that express wild-type p53.
Han, Jun-hua; Li, Yan-ping; Men, Jian-hua; Yu, Wen-tao; Yang, Yue-xin
2009-12-01
To investigate the dietary phytosterol intake of elderly women in three different cities of China, and to compare the main dietary sources, so that to discuss the relationship of dietary phytosterol intake and serum lipids. Based on the dietary pattern, women more than 50 years old from Beijing, Hefei and Urumchi were chosen as testers, 80 - 100 people for each city respectively. The dietary survey was done by continues 24 hours review of two days, the plant food were collected and the phytosterol content (include beta-sitosterol, campesterol, stigmasterol, sitostanol) were analyzed by GC methods, the total phytosterols content were calculated. The dietary phytosterol intake were calculated and serum lipids were also analyzed in all the testers. Testers from Beijing, Hefei and Urumchi were 100, 101 and 84 respectively. The average dietary phytosterol intake of people in Beijing and Hefei were 340.3 mg/d and 313.5 mg/d, the main sources were plant oil and cereals, while the average dietary phytosterol intake of people in Urumchi were 550.4 mg/d, higher than the other two cities (t values were 9.369, 10.420, respectively, both P values < 0.01), the main source in Urumchi was cereal (provide 53.1% of the total phytosterol intake). The laboratory results showed, testers in Urumchi had significantly lower serum TC content ((4.04 +/- 0.78) mmol/L) than that in Beijing ((4.89 +/- 0.91) mmol/L) and Hefei ((4.71 +/- 0.83) mmol/L) (t value were 6.766 and 5.401 respectively, both P values < 0.01); serum TG content in Urumchi((1.01 +/- 0.48) mmol/L) was also lower than that in Beijing ((1.31 +/- 0.53) mmol/L) and Hefei ((1.66 +/- 0.75) mmol/L) (t values were 3.343 and 7.293 respectively, both P values < 0.01); the serum glucose is also lower in testers in Urumchi ((5.02 +/- 2.18) mmol/L) compared with testers in Beijing ((5.69 +/- 1.53) mmol/L, t = 2.561, P < 0.05) and Hefei ((5.78 +/- 1.53) mmol/L, t = 2.934, P < 0.01). Different dietary pattern result in significantly different dietary phytosterol intake in elder women in three cities, higher, phytosterol intake seemed to contribute to lower serum lipids.
Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.
2017-01-01
Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158
Development of an adenoviral vector with robust expression driven by p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology
2008-02-05
Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less
The impact of p53 on the early stage replication of retrovirus.
Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan
2017-08-09
The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.
MicroRNAs as Key Effectors in the p53 Network.
Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni
2017-01-01
The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.
Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.
Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto
2015-01-01
Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.
Rigby, Cynthia M; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K; Dhar, Deepanshi; Orlicky, David J; Agarwal, Chapla; Agarwal, Rajesh
2017-01-01
Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53 +/- ) and p53 knockout (p53 -/- ) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53 +/+ mice, p53 +/- mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53 +/+ mice but silibinin' protective efficacy was significantly compromised in p53 +/- mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53 -/- mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53 +/+ mice while its efficacy was partially compromised in p53 -/- mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Rigby, Cynthia M.; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K.; Dhar, Deepanshi; Orlicky, David J.; Agarwal, Chapla; Agarwal, Rajesh
2017-01-01
Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53+/−) and p53 knockout (p53−/−) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53+/+ mice, p53+/− mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53+/+ mice but silibinin’ protective efficacy was significantly compromised in p53+/− mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53−/− mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53+/+ mice while its efficacy was partially compromised in p53−/− mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. PMID:27729375
Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay
Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto
2015-01-01
Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429
Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.
Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng
2011-02-11
The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.
Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*
Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng
2011-01-01
The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074
Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.
La Perle, K M; Jhiang, S M; Capen, C C
2000-08-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice =28 weeks of age or p53-/- mice = 17 weeks of age; however, an older (170-day-old) male p53-/- mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas.
Battle against cancer: an everlasting saga of p53.
Hao, Qian; Cho, William C
2014-12-01
Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Xie, Xiaolei; He, Guangan; Siddik, Zahid H.
2017-01-01
Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409
Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.
2009-01-01
Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229
The impact of p53 protein core domain structural alteration on ovarian cancer survival.
Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E
2003-09-15
Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.
CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.
He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu
2016-01-01
The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
2014-01-01
Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies. PMID:24927749
Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan
2018-03-23
p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu
2012-06-29
Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less
Dorado, J; Acha, D; Ortiz, I; Gálvez, M J; Carrasco, J J; Díaz, B; Gómez-Arrones, V; Calero-Carretero, R; Hidalgo, M
2013-12-01
Sperm quality has an important role in determining fertility. The aims of this study were to compare the conventional sperm parameters, plus the characteristics of the motility patterns of the different sperm subpopulations, of donkey donors with different fertility level, and to determine their relationships to fertility. Thirty ejaculates from 6 Andalusian donkeys were assessed for gel-free volume, pH, sperm concentration, motility and morphology. The fertility of donkeys was classified on the basis of pregnancy rates per cycle, where donkeys with a per cycle pregnancy rate ≥60% were considered to be "fertile" (n=3) and those with a per cycle pregnancy rate <40% were categorized to be "sub-fertile" (n=3). Significant differences (P<0.001) between the "fertile" and the "sub-fertile" group were found for total and progressive motility, and for straight line velocity. Sperm variables associated (P<0.05) with an increase in percent pregnant per cycle included total motility (r=0.37), progressive motility (r=0.53), curvilinear velocity (r=0.44), straightness (r=0.39), beat cross frequency (r=0.44), and gel-free volume (r=0.53). Four sperm subpopulations (sP) were identified in fresh semen: sP1 (slow and non-progressive spermatozoa, 20%), sP2 (moderately slow but progressive spermatozoa, 71.2%), sP3 (highly active but non-progressive spermatozoa, 2.9%), and sP4 (highly active and progressive spermatozoa, 5.9%). The lowest percentage (3.1%; P<0.001) of sP4 spermatozoa was observed in the "sub-fertile" group. Three of the sperm subpopulations were related (P<0.05) to fertility (sP2, r=0.54; sP3, r=0.45; sP4, r=0.56). In conclusion, we were able to relate the fertility of donkeys with in vitro measures of sperm motility using computer-assisted sperm analysis techniques. Copyright © 2013 Elsevier B.V. All rights reserved.
Insights into wild-type and mutant p53 functions provided by genetically engineered mice.
Donehower, Lawrence A
2014-06-01
Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.
p53 Specifically Binds Triplex DNA In Vitro and in Cells
Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej
2016-01-01
Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175
NASA Astrophysics Data System (ADS)
Zhou, Zhigang; Li, Yumin
2009-10-01
As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Accumulation of p53 in infectious mononucleosis tissues.
Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L
2000-11-01
Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company
A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis
Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A
2015-01-01
Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829
Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent
2013-01-01
We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169
Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent
2013-09-01
We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.
Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G
2014-01-01
Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150
Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef
2003-09-17
The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.
Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei
2018-03-09
The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong
2015-08-18
p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.
Jabbur, James R; Tabor, Amy D; Cheng, Xiaodong; Wang, Hua; Uesugi, Motonari; Lozano, Guillermina; Zhang, Wei
2002-10-10
Analyses of five wild-type p53 containing cell lines revealed lineage specific differences in phosphorylation of Thr18 after treatment with ionizing (IR) or ultraviolet (UV) radiation. Importantly, Thr18 phosphorylation correlated with induction of the p53 downstream targets p21(Waf1/Cip1) (p21) and Mdm-2, suggesting a transactivation enhancing role. Thr18 phosphorylation has been shown to abolish side-chain hydrogen bonding between Thr18 and Asp21, an interaction necessary for stabilizing alpha-helical conformation within the transactivation domain. Mutagenesis-derived hydrogen bond disruption attenuated the interaction of p53 with the transactivation repressor Mdm-2 but had no direct effect on the interaction of p53 with the basal transcription factor TAF(II)31. However, prior incubation of p53 mutants with Mdm-2 modulated TAF(II)31 interaction with p53, suggesting Mdm-2 blocks the accessibility of p53 to TAF(II)31. Consistently, p53-null cells transfected with hydrogen bond disrupting p53 mutants demonstrated enhanced endogenous p21 expression, whereas p53/Mdm-2-double null cells exhibited no discernible differences in p21 expression. We conclude disruption of intramolecular hydrogen bonding between Thr18 and Asp21 enhances p53 transactivation by modulating Mdm-2 binding, facilitating TAF(II)31 recruitment.
Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy
Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.
2006-01-01
The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686
β-Catenin C-terminal signals suppress p53 and are essential for artery formation
Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.
2016-01-01
Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244
Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.
Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina
2010-05-01
Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe
2016-03-10
In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.
Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.
Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi
2018-05-18
The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.
Jessen-Eller, Kathryn; Kreiling, Jill A; Begley, Gail S; Steele, Marjorie E; Walker, Charles W; Stephens, Raymond E; Reinisch, Carol L
2002-01-01
The cell-cycle checkpoint protein p53 both directs terminal differentiation and protects embryos from DNA damage. To study invertebrate p53 during early development, we identified three differentially expressed p53 family members (p53, p97, p120) in the surf clam, Spisula solidissima. In these mollusks, p53 and p97 occur in both embryonic and adult tissue, whereas p120 is exclusively embryonic. We sequenced, cloned, and characterized p120 cDNA. The predicted protein, p120, resembles p53 across all evolutionarily conserved regions and contains a C-terminal extension with a sterile alpha motif (SAM) as in p63 and p73. These vertebrate forms of p53 are required for normal inflammatory, epithelial, and neuronal development. Unlike clam p53 and p97, p120 mRNA and protein levels are temporally expressed in embryos, with mRNA levels decreasing with increasing p120 protein (R(2) = 0.97). Highest surf clam p120 mRNA levels coincide with the onset of neuronal growth. In earlier work we have shown that neuronal development is altered by exposure to polychlorinated biphenyls (PCBs), a neurotoxic environmental contaminant. In this study we show that PCBs differentially affect expression of the three surf clam p53 family members. p120 mRNA and protein are reduced the most and earliest in development, p97 protein shows a smaller and later reduction, and p53 protein levels do not change. For the first time we report that unlike p53 and p97, p120 is specifically embryonic and expressed in a time-dependent manner. Furthermore, p120 responds to PCBs by 48 hr when PCB-induced suppression of the serotonergic nervous system occurs. PMID:11940455
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava
Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication
Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra
2017-01-01
Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53–induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262
Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas
La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.
2000-01-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169
Zhang, Qing-Yu; Jin, Rui; Zhang, Xian; Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong
2016-10-25
Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53-/- cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin.
Expression of GLUT-1 in oral squamous cell carcinoma in tobacco and non-tobacco users
Azad, Neha; Kumari Maurya, Malti; Kar, Meenakshi; Goel, Madhu Mati; Singh, Ajay Kumar; Sagar, Mala; Mehrotra, Divya; Kumar, Vijay
2016-01-01
Background GLUTs are a family of proteins that mediate glucose transport through the membrane, expressed in head and neck squamous cell carcinoma. GLUT-1 positivity in malignant cells indicates increased proliferative activity, energy requirements, aggressive behaviour and poor radiation response. Aim To observe the expression of GLUT-1 protein in oral squamous cell carcinoma in tobacco and non-tobacco users and to correlate the expression with histopathological grading and pathological staging. Methods 50 cases (25 tobacco and 25 non-tobacco) of oral squamous cell carcinoma, selected during period of August 2014 to July 2015. Histopathological grading, TNM and staging were done. Immunohistochemical staining was performed using standard protocol for paraffin embedded sections. Analysis was performed on SPSS software (Windows version 17.0). Results Significant association of GLUT-1 expression was found with history of tobacco (p < 0.001), Bryne's grade (p < 0.001), tumour size (p = 0.001), nodal metastasis (p = 0.022) and stage (p < 0.001). Higher GLUT-1 expression in stage II, stage III and stage IV was found as compared to stage I. GLUT-1 immunoexpression also shows progressive switch from membranous to cytoplasmic to combined location correlating with histopathologic grade and pTNM stage. Conclusion GLUT-1 expression correlates significantly with histological grade and pTNM staging of oral squamous cell carcinoma. It also significantly correlates with tobacco addiction. Thus, GLUT-1 expression may serve as a biomarker for patients of oral squamous cell carcinoma. PMID:26937365
USDA-ARS?s Scientific Manuscript database
Mdm2 is an E3 ubiquitin ligase that targets p53 for degradation. p53(515C) (encoding p53R172P) is a hypomorphic allele of p53 that rescues the embryonic lethality of Mdm2(-/-) mice. Mdm2(-/-) p53(515C/515C) mice, however, die by postnatal day 13 resulting from hematopoietic failure. Hematopoietic st...
Exponential growth and selection in self-replicating materials from DNA origami rafts
NASA Astrophysics Data System (ADS)
He, Xiaojin; Sha, Ruojie; Zhuo, Rebecca; Mi, Yongli; Chaikin, Paul M.; Seeman, Nadrian C.
2017-10-01
Self-replication and evolution under selective pressure are inherent phenomena in life, and but few artificial systems exhibit these phenomena. We have designed a system of DNA origami rafts that exponentially replicates a seed pattern, doubling the copies in each diurnal-like cycle of temperature and ultraviolet illumination, producing more than 7 million copies in 24 cycles. We demonstrate environmental selection in growing populations by incorporating pH-sensitive binding in two subpopulations. In one species, pH-sensitive triplex DNA bonds enable parent-daughter templating, while in the second species, triplex binding inhibits the formation of duplex DNA templating. At pH 5.3, the replication rate of species I is ~1.3-1.4 times faster than that of species II. At pH 7.8, the replication rates are reversed. When mixed together in the same vial, the progeny of species I replicate preferentially at pH 7.8 similarly at pH 5.3, the progeny of species II take over the system. This addressable selectivity should be adaptable to the selection and evolution of multi-component self-replicating materials in the nanoscopic-to-microscopic size range.
The small molecule 2-phenylethynesulfonamide induces covalent modification of p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent
p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less
Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17
Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.
2012-01-01
Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468
Therapeutic targeting of the p53 pathway in cancer stem cells
Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.
2013-01-01
Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602
Regulation of autophagy by cytoplasmic p53
Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2009-01-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141
Recognition of Local DNA Structures by p53 Protein
Brázda, Václav; Coufal, Jan
2017-01-01
p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang
2012-05-04
Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less
The transcription factor p53: Not a repressor, solely an activator
Fischer, Martin; Steiner, Lydia; Engeland, Kurt
2014-01-01
The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564
Chaperone-mediated autophagy degrades mutant p53
Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying
2013-01-01
Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L
2010-01-01
The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih
2012-01-01
Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.
Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar
2017-06-23
Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53
Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia
2015-01-01
Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu
2013-06-15
Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less
Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.
Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi
2016-03-01
Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.
Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T
1999-06-01
The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.
A SENSITIVE IMMUNOFLUORESCENCE ASSAY FOR DETECTION OF P53 PROTEIN ACCUMULATION IN SPUTUM
p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...
2002-10-01
there is a mutation in the p53 gene itself (4, 5). Interestingly, -80% of p53 mutations are missense changes that lead to single amino acid...substitutions, a feature that distinguishes p53 from other tumor suppressor genes (e.g., APC, NF1, BRCAJ) (6). The incidence of p53 mutations and the types of...intronic promoter is contained within the human mutation hotspot maps of p53: correlation with p53 protein structural and mdm2 gene . Nucleic Acids Res
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina
2010-04-15
Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.
Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J
2000-11-23
Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.
Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.
Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel
2016-04-12
p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.
Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S
2000-01-01
Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.
Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.
Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J
2006-04-01
p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.
Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong
2016-01-01
Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53−/− cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin. PMID:27626169
Expression of C-terminal deleted p53 isoforms in neuroblastoma
Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha
2006-01-01
The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100
p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin
2008-01-25
S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt}more » cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.« less
2010-01-01
Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441
Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri
2011-07-01
There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P < .001). Survival assessed from the time of abnormality detection was significantly reduced in patients with both missense (P < .001) and nonmissense p53 mutations (P = .004). In addition, patients harboring missense mutation located in p53 DNA-binding motifs (DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.
Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M
1998-07-01
Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR. Thus, the fate of cells with p53 accumulation may depend on the interaction and the stoichiometry of the p53 and MDM2 proteins. Cells were indeed found with strong p53 accumulation and nuclear morphology typical for apoptosis and there were a few MIB1/Ki-67-positive cells with co-expression of MDM2, indicating a possible role for MDM2 in reversing the negative regulatory effects of p53 for cell cycle progression. The nuclear co-localization of p53 IR with MDM2 IR and the co-immunoprecipitation assay indicate the presence of p53-MDM2 complex formation in vivo in human atherosclerotic tissue. The destiny of individual p53 and MDM2-co-expressing cells either to undergo p53-dependent apoptosis or to re-enter the cycle of cell proliferation may depend on the relative ratios of the two proteins. p53 and MDM2 may therefore play an important role in regulating cellularity and inflammatory activity in human atherosclerotic plaques.
Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B
2017-01-01
PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I - LO1413. The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study. The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 13. 3. 2017Accepted: 26. 3. 2017.
Scesnaite, Asta; Jarmalaite, Sonata; Mutanen, Pertti; Anttila, Sisko; Nyberg, Fredrik; Benhamou, Simone; Boffetta, Paolo; Husgafvel-Pursiainen, Kirsti
2012-07-01
Tobacco smoke causes lung cancer in smokers and in never-smokers exposed to second-hand tobacco smoke (SHS). Nonetheless, molecular mechanisms of lung cancer in SHS-exposed never-smokers are still elusive. We studied lung cancers from current smokers (n = 109), former smokers (n = 56) and never-smokers (n = 47) for promoter hypermethylation of five tumour suppressor genes--p16, RARB, RASSF1, MGMT and DAPK1--using methylation-specific polymerase chain reaction. Lung tumours from ever-smokers suggested an increased risk of p16 hypermethylation as compared to never-smokers (P = 0.073), with former smokers having the highest frequency of p16 hypermethylation (P = 0.044 versus current smokers and P = 0.009 versus never-smokers). In the never-smoking group, p16 hypermethylation was seen in lung tumours from SHS-exposed individuals (4/33; 12%) but in none of the non-exposed individuals (0/9). The overall occurrence of hypermethylation (measured both as methylation index and as number of genes affected) was similar in those ever exposed to tobacco smoke (smokers, SHS-exposed never-smokers) and differed from non-exposed never-smokers. In multivariate analysis, p16 hypermethylation was more prevalent in lung tumours from male than female patients (P = 0.018) and in squamous cell carcinomas than in adenocarcinomas (P = 0.025). Occurrence of TP53 mutation in the tumour was associated with hypermethylation of at least one gene (P = 0.027). In all, our data suggest that promoter hypermethylation pattern in SHS-exposed never-smokers resembles that observed in smokers. Association between TP53 mutation, a hallmark of smokers' lung cancer, and methylation of one or more of the lung cancer-related genes studied, provides further evidence for common tobacco smoke-related origin for both types of molecular alterations.
p53 suppresses hyper-recombination by modulating BRCA1 function
Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui
2015-01-01
Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908
Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R
2016-04-12
Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.
Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming
2017-03-01
Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.
Mutant p53 expression in fallopian tube epithelium drives cell migration.
Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E
2015-10-01
Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.
MicroRNA-125b is a novel negative regulator of p53.
Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing
2009-04-01
The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.
MicroRNA-125b is a novel negative regulator of p53
Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing
2009-01-01
The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287
Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L
2018-05-31
The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Both germ line and somatic genetics of the p53 pathway affect ovarian cancer incidence and survival.
Bartel, Frank; Jung, Juliane; Böhnke, Anja; Gradhand, Elise; Zeng, Katharina; Thomssen, Christoph; Hauptmann, Steffen
2008-01-01
Although p53 is one of the most studied genes/proteins in ovarian carcinomas, the predictive value of p53 alterations is still ambiguous. We performed analyses of the TP53 mutational status and its protein expression using immunohistochemistry. Moreover, the single nucleotide polymorphism SNP309 in the P2 promoter of the MDM2 gene was investigated. We correlated the results with age of onset and outcome from 107 patients with ovarian carcinoma. In our study, we identified a large group of patients with p53 overexpression despite having a wild-type gene (49% of all patients with wild-type TP53). This was associated with a significantly shortened overall survival time (P = 0.019). Patients with p53 alterations (especially those with overexpression of wild-type TP53) were also more refractory to chemotherapy compared with patients with normal p53 (P = 0.027). The G-allele of SNP309 is associated with an earlier age of onset in patients with estrogen receptor-overexpressing FIGO stage III disease (P = 0.048). In contrast, in patients with FIGO stage III disease, a weakened p53 pathway (either the G-allele of SNP309 or a TP53 mutation) was correlated with increased overall survival compared with patients whose tumors were wild-type for both TP53 and SNP309 (P = 0.0035). Our study provides evidence that both germ line and somatic alterations of the p53 pathway influence the incidence and survival of ovarian carcinoma, and it underscores the importance of assessing the functionality of p53 in order to predict the sensitivity of platinum-based chemotherapies and patient outcome.
p53-dependent cell death/apoptosis is required for a productive adenovirus infection.
Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W
1998-09-01
The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.
Bhattacharya, Sujoy; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.
2012-01-01
Purpose. Relatively little is known about the contribution of p53/Mdm2 pathway in apoptosis of retinal pigment epithelial (RPE) cells or its possible link to dysfunction of aging RPE or to related blinding disorders such as age-related macular degeneration (AMD). Methods. Age-associated changes in p53 activation were evaluated in primary RPE cultures from human donor eyes of various ages. Apoptosis was evaluated by activation of caspases and DNA fragmentation. Gene-specific small interfering RNA was used to knock down expression of p53. Results. We observed that the basal rate of p53-dependent apoptosis increased in an age-dependent manner in human RPE. The age-dependent increase in apoptosis was linked to alterations in several aspects of the p53 pathway. p53 phosphorylation Ser15 was increased through the stimulation of ATM-Ser1981. p53 acetylation Lys379 was increased through the inhibition of SIRT1/2. These two posttranslational modifications of p53 blocked the sequestration of p53 by Mdm2, thus resulting in an increase in free p53 and of p53 stimulation of apoptosis through increased expression of PUMA (p53 upregulated modulator of apoptosis) and activation of caspase-3. Aged RPE also had reduced expression of antiapoptotic Bcl-2, which contributed to the increase in apoptosis. Of particular interest in these studies was that pharmacologic treatments to block p53 phosphorylation, acetylation, or expression were able to protect RPE cells from apoptosis. Conclusions. Our studies suggest that aging in the RPE leads to alterations of specific checkpoints in the apoptotic pathway, which may represent important molecular targets for the treatment of RPE-related aging disorders such as AMD. PMID:23139272
Selective activation of p53-mediated tumour suppression in high-grade tumours.
Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P
2010-11-25
Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.
Hoang, Lien N; Han, Guangming; McConechy, Melissa; Lau, Sherman; Chow, Christine; Gilks, C Blake; Huntsman, David G; Köbel, Martin; Lee, Cheng-Han
2014-03-01
The great majority of ovarian clear cell carcinomas have a hepatocyte nuclear factor 1 homeobox B (HNF-1β)-positive and oestrogen receptor (ER)-negative immunoprofile. However, the pattern of HNF-1β and ER immunostaining in clear cell carcinomas of the endometrium and the usefulness of this panel in distinguishing clear cell carcinoma from other histological types of endometrial carcinoma have yet to be well defined. We examined the immunostaining patterns of HNF-1β, ER and p53 in 15 morphologically classic pure endometrial clear cell carcinomas, and compared these patterns with 15 endometrioid and 15 serous carcinomas of the endometrium. We observed the presence of diffuse (>70%) moderate to strong nuclear HNF-1β staining and negative ER staining in 14 of 15 clear cell carcinomas, with the remaining case showing both diffuse strong nuclear HNF-1β staining and focal ER staining. In comparison, only one of 15 serous carcinomas and none of 15 endometrioid carcinomas showed a combination of diffuse moderate to strong HNF-1β nuclear staining and negative ER staining. Aberrant p53 immunostaining was observed in five of 15 (33%) clear cell carcinomas. Overall, our findings demonstrate that, similarly to the situation for the ovary, a diagnostic panel of HNF-1β and ER may be considered for separating clear cell carcinoma from endometrioid and serous carcinoma of the endometrium. © 2013 John Wiley & Sons Ltd.
Eymin, Béatrice; Gazzeri, Sylvie; Brambilla, Christian; Brambilla, Elisabeth
2002-04-18
Pathways involving p53 and pRb tumor suppressor genes are frequently deregulated during lung carcinogenesis. Through its location at the interface of these pathways, Mdm2 can modulate the function of both p53 and pRb genes. We have examined here the pattern of expression of Mdm2 in a series of 192 human lung carcinomas of all histological types using both immunohistochemical and Western blot analyses and four distinct antibodies mapping different epitopes onto the Mdm2 protein. Using Immunohistochemistry (IHC), Mdm2 was overexpressed as compared to normal lung in 31% (60 out of 192) of all tumors analysed, whatever their histological types. Western blotting was performed on 28 out of the 192 tumoral samples. Overexpression of p85/90, p74/76 and p57 Mdm2 isoforms was detected in 18% (5 out of 28), 25% (7 out of 28) and 39% (11 out of 28) of the cases respectively. Overall, overexpression of at least one isoform was observed in 14 out of 28 (50%) lung tumors and concomittant overexpression of at least two isoforms in 7 out of 28 (25%) cases. A good concordance (82%) was observed between immunohistochemical and Western blot data. Interestingly, a highly significant inverse relationship was detected between p14(ARF) loss and Mdm2 overexpression either in NSCLC (P=0.0089) or in NE lung tumors (P<0.0001). Furthermore, a Mdm2/p14(ARF) >1 ratio was correlated with a high grade phenotype among NE tumors overexpressing Mdm2 (P=0.0021). Taken together, these data strongly suggest that p14(ARF)and Mdm2 act on common pathway(s) to regulate p53 and/or pRb-dependent or independent functions and that the Mdm2 : p14(ARF) ratio might act as a rheostat in modulating the activity of both proteins.
The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells.
Kim, H; You, S; Foster, L K; Farris, J; Foster, D N
2001-08-23
The steady-state levels of p53 mRNA were dramatically lower in immortal chicken embryo fibroblast (CEF) cell lines compared to primary CEF cells. In the presence of cycloheximide (CHX), the steady-state levels of p53 mRNA markedly increased in immortal CEF cell lines, similar to levels found in primary cells. The de novo synthetic rates of p53 mRNA were relatively similar in primary and immortal cells grown in the presence or absence of CHX. Destabilization of p53 mRNA was observed in the nuclei of immortal, but not primary, CEF cells. The half-life of p53 mRNA in primary cells was found to be a relatively long 23 h compared to only 3 h in immortal cells. The expression of transfected p53 cDNA was inhibited in immortal cells, but restored upon CHX treatment. The 5'-region of the p53 mRNA was shown to be involved in the rapid p53 mRNA destabilization in immortal cells by expression analysis of 5'- and 3'-deleted p53 cDNAs as well as fusion mRNA constructs of N-terminal p53 and N-terminal deleted LacZ genes. Together, it is suggestive that the downregulation of p53 mRNA in immortal CEF cells occurs through a post-transcriptional destabilizing mechanism.
Trivers, G E; De Benedetti, V M; Cawley, H L; Caron, G; Harrington, A M; Bennett, W P; Jett, J R; Colby, T V; Tazelaar, H; Pairolero, P; Miller, R D; Harris, C C
1996-10-01
Serum anti-p53 antibodies (p53-Abs) may be surrogate markers for both p53 alterations and preclinical cancer. Ancillary to a prospective trial to abate progressive development of clinical stages of chronic obstructive pulmonary disease, we conducted a retrospective, nested case-control study. Twenty-three cases were diagnosed with cancer during the trial. Enzyme immunoassay, immunoblotting, and immunoprecipitation were used to detect p53-Abs in serum, immunohistochemistry (IHC) to detect p53 accumulation, and single-strand conformation polymorphism and DNA sequencing to detect p53 mutations in tumor samples. p53-Abs were detected by three types of assays in five (23%) of the cancer patients, 80% of whom had detectable p53-Abs before diagnosis: 2 lung cancers (7 and 6 months before), 1 prostate cancer (11 months), and 1 breast cancer (5 months). Four Ab-positive patients had IHC-positive tumors. Two of 4 Ab-positive patients and 2 of 14 Ab-negative had p53 missense mutations or base pair deletion and IHC-positive tumors. The 44 noncancer COPD controls, matched with the cancer cases for age, gender, and smoking habits, were negative for p53-Abs. These results indicate that p53-Abs may facilitate the early diagnosis of cancer in a subset of smokers with chronic obstructive pulmonary disease who are at an increased cancer risk.
Xu, Grace; Gottschalk, Byron H; Anselm, Daniel D; Benditt, David G; Maheshwari, Ankit; Sreenivasan, Shiva; Shama, Raed Abu; Dendramis, Gregory; Barajas-Martínez, Héctor; Rubio Campal, José Manuel; Aznaurov, Sam G; Baranchuk, Adrian
2018-03-15
Brugada phenocopies (BrPs) are clinical entities that differ in etiology from true congenital Brugada syndrome but have identical electrocardiographic (ECG) patterns. Hyperkalemia is known to be one of the causes of BrP. The aim of this study was to determine the clinical characteristics and evolution of hyperkalemia-induced BrP. Data from 27 cases of hyperkalemia-induced BrP were collected from the International Registry at www.brugadaphenocopy.com. Data were extracted from publications. Of the 27 patients included in the analysis, 18 (67%) were male; mean age was 53 ± 15 years (range 31 to 89). Mean serum potassium concentration was 7.45 ± 0.89 mmol/L. Type-1 Brugada ECG pattern was observed in 21 cases (78%), whereas 6 cases (22%) showed a type-2 Brugada ECG pattern. The Brugada ECG pattern resolved once the hyperkalemia was corrected, with no arrhythmic events. Estimated time to resolution was 7 ± 3 hours. In 4 cases (16%), a concurrent metabolic abnormality was detected: 3 (11%) presented with acidosis, 2 (7%) with hyponatremia, 1 (4%) with hypocalcaemia, 1 (4%) with hyperphosphatemia, and 1 (4%) with hyperglycemia. In 7 cases (26%), provocative testing using sodium channel blockers was performed, and all failed to reproduce a BrS ECG pattern (BrP class A). Additionally, no sudden cardiac death or malignant ventricular arrhythmias were detected. Hyperkalemia was found a common cause of BrP in our International Registry. The Brugada ECG pattern appears to occur at high serum potassium concentrations (>6.5 mmol/L). The ECG normalizes within hours of correcting the electrolyte imbalance. Importantly, hyperkalemia-induced BrP has not been associated with sudden cardiac death or ventricular arrhythmia. Copyright © 2017 Elsevier Inc. All rights reserved.
Zn(II)-curc targets p53 in thyroid cancer cells.
Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella
2015-10-01
TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.
Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction
Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protei...
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
Baccouche, Sami; Daoud, Jamel; Frikha, Mounir; Mokdad-Gargouri, Raja; Gargouri, Ali; Jlidi, Rachid
2003-12-01
TP53 gene alterations have been associated with sporadic breast cancer. To assess the role of p53 in invasive ductal carcinoma (IDC) of the breast among Tunisian patients, p53 protein status was studied by immuno-histochemical analysis. The p53 protein was expressed in 41 of 70 (58%) tumors. Study of the status of its target gene expression showed that MDM2 was overexpressed in 43 tumors (61%), bcl2 in 29 (41%), and bax in only 9 (12%). Estrogen receptor (ER) was detected in 38 tumor tissues (54%). The accumulated p53 was significantly associated with MDM2-positive, bcl2-negative, and ER-negative tumors (P = 0.024, P = 0.000027, and P = 0.000008, respectively), whereas with bax the correlaton was not significant. Bcl2 immunostaining displayed a positive correlation with ER (P = 0.001). A significantly higher fraction of p53-positive cells was observed in ER-negative SBRII-SBRIII tumors than in ER-positive SBRI-SBRII tumors (P = 0.000066). bcl2-positive tumors were significantly correlated with ER-positive/SBRI-SBRII tumors (P = 0.007), but negatively correlated with p53/bax (P = 0000004). MDM2 immunostaining displayed the same phenotype as p53 in the correlation with bcl2 and ER (P = 0.003), strengthened by significant associations between MDM2-positive/p53-positive and bcl2-negative or ER-negative, respectively (P = 0.00005 and P = 0.000001, respectively). MDM2-positive cells were significantly correlated with the p53-positive/bax-negative phenotype (P = 0.04). These results suggest that p53 accumulated in these tumor tissues is associated with bad prognostic markers (ER-negative, SBRIII) of IDC. MDM2 overexpression might be responsible for the accumulated p53 value in IDC. Regulation of the apoptotic process is involved in IDC; bcl2 is associated with a good prognostic marker (ER-positive and SBRI-II), whereas the regulation of bax is complex and does not necessarily correlate with the overexpression of p53.
Schmoeckel, Elisa; Odai-Afotey, Ashley A.; Schleiβheimer, Michael; Rottmann, Miriam; Flesken-Nikitin, Andrea; Ellenson, Lora H.; Kirchner, Thomas; Mayr, Doris; Nikitin, Alexander Yu.
2017-01-01
Recently it has been reported that serous tubal intraepithelial carcinoma (STIC), the likely precursor of ovarian/extra-uterine high-grade serous carcinoma, are frequently located in the vicinity of tubal-peritoneal junctions, consistent with the cancer-prone features of many epithelial transitional regions. To test if p53 (aka TP53)-signatures and secretory cell outgrowths (SCOUTs) also localize to tubal-peritoneal junctions, we examined these lesions in the fallopian tubes of patients undergoing salpingo-oophorectomy for sporadic high-grade serous carcinomas or as a prophylactic procedure for carriers of familial BRCA1 or 2 mutations. STICs were located closest to the tubal-peritoneal junctions with an average distance of 1.31 mm, while SCOUTs were not detected in the fimbriated end of the fallopian tube. Since many epithelial transitional regions contain stem cells, we also determined the expression of stem cell markers in the normal fallopian tube, tubal intraepithelial lesions and high-grade serous carcinomas. Of those, LEF1 was consistently expressed in the tubal-peritoneal junctions and all lesions, independent of p53 status. All SCOUTs demonstrated strong nuclear expression of β-catenin consistent with the LEF1 participation in the canonical WNT pathway. However, β-catenin was preferentially located in the cytoplasm of cells comprising STICs and p53 signatures, suggesting WNT-independent function of LEF1 in those lesions. Both frequency of LEF1 expression and β-catenin nuclear expression correlated with the worst 5 year patient survival, supporting important role of both proteins in high-grade serous carcinoma. Taken together, our findings suggest the existence of stem cell niche within the tubal-peritoneal junctions. Furthermore, they support the notion that the pathogenesis of SCOUTs is distinct from that of STICs and p53 signatures. The location and discrete patterns of LEF1 and β-catenin expression may serve as highly sensitive and reliable ancillary markers for the detection and differential diagnosis of tubal intraepithelial lesions. PMID:28664938
DOE Office of Scientific and Technical Information (OSTI.GOV)
Finlay, C.A.; Hinds, P.W.; Tan, T.H.
1988-02-01
The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less
MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer
Suh, Seong O.; Chen, Yi; Zaman, Mohd Saif; Hirata, Hiroshi; Yamamura, Soichiro; Shahryari, Varahram; Liu, Jan; Tabatabai, Z.Laura; Kakar, Sanjay; Deng, Guoren; Tanaka, Yuichiro; Dahiya, Rajvir
2011-01-01
MiR-145 is downregulated in various cancers including prostate cancer. However, the underlying mechanisms of miR-145 downregulation are not fully understood. Here, we reported that miR-145 was silenced through DNA hypermethylation and p53 mutation status in laser capture microdissected (LCM) prostate cancer and matched adjacent normal tissues. In 22 of 27 (81%) prostate tissues, miR-145 was significantly downregulated in the cancer compared with the normal tissues. Further studies on miR-145 downregulation mechanism showed that miR-145 is methylated at the promoter region in both prostate cancer tissues and 50 different types of cancer cell lines. In seven cancer cell lines with miR-145 hypermethylation, 5-aza-2′-deoxycytidine treatment dramatically induced miR-145 expression. Interestingly, we also found a significant correlation between miR-145 expression and the status of p53 gene in both LCM prostate tissues and 47 cancer cell lines. In 29 cell lines with mutant p53, miR-145 levels were downregulated in 28 lines (97%), whereas in 18 cell lines with wild-type p53 (WT p53), miR-145 levels were downregulated in only 6 lines (33%, P < 0.001). Electrophoretic mobility shift assay showed that p53 binds to the p53 response element upstream of miR-145, but the binding was inhibited by hypermethylation. To further confirm that p53 binding to miR-145 could regulate miR-145 expression, we transfected WT p53 and MUT p53 into PC-3 cells and found that miR-145 is upregulated by WT p53 but not with MUTp53. The apoptotic cells are increased after WT p53 transfection. In summary, this is the first report documenting that downregulation of miR-145 is through DNA methylation and p53 mutation pathways in prostate cancer. PMID:21349819
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less
NASA Technical Reports Server (NTRS)
Kohli, M.; Jorgensen, T. J.
1999-01-01
The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.
Nigam, Nidhi; George, Jasmine; Srivastava, Smita; Roy, Preeti; Bhui, Kulpreet; Singh, Madhulika; Shukla, Yogeshwer
2010-03-01
To unravel the molecular mechanisms underlying the chemopreventive potential of [6]-gingerol, a pungent ingredient of ginger rhizome (Zingiber officinale Roscoe, Zingiberaceae), against benzo[a]pyrene (B[a]P)-induced mouse skin tumorigenesis. Topical treatment of [6]-gingerol (2.5 muM/animal) was given to the animals 30 min prior and post to B[a]P (5 mug/animal) for 32 weeks. At the end of the study period, the skin tumors/tissues were dissected out and examined histopathologically. Flow cytometry was employed for cell cycle analysis. Further immunohistochemical localization of p53 and regulation of related apoptogenic proteins were determined by Western blotting. Chemopreventive properties of [6]-gingerol were reflected by delay in onset of tumorigenesis, reduced cumulative number of tumors, and reduction in tumor volume. Cell cycle analysis revealed that the appearance of sub-G1 peak was significantly elevated in [6]-gingerol treated animals with post treatment showing higher efficacy in preventing tumorigenesis induced by B[a]P. Moreover, elevated apoptotic propensity was observed in tumor tissues than the corresponding non-tumor tissues. Western blot analysis also showed the same pattern of chemoprevention with [6]-gingerol treatment increasing the B[a]P suppressed p53 levels, also evident by immunohistochemistry, and Bax while decreasing the expression of Bcl-2 and Survivin. Further, [6]-gingerol treatment resulted in release of Cytochrome c, Caspases activation, increase in apoptotic protease-activating factor-1 (Apaf-1) as mechanism of apoptosis induction. On the basis of the results we conclude that [6]-gingerol possesses apoptotic potential in mouse skin tumors as mechanism of chemoprevention hence deserves further investigation.
Clinical and pathologic relevance of p53 index in canine osseous tumors.
Loukopoulos, P; Thornton, J R; Robinson, W F
2003-05-01
The clinicopathologic value of the immunohistochemical (IHC) expression of p53 protein was evaluated in 167 canine osseous tumors. p53 staining frequency and intensity in tumor cells was expressed as a p53 index. p53 index was significantly higher in osteosarcomas than in other sarcomas, chondrosarcoma, multilobular tumor of bone, and tumors initially misdiagnosed as osteosarcomas as well as in appendicular versus axial and in distal versus proximal osteosarcomas. A strong correlation is demonstrated between the p53 index and a range of clinicopathologic parameters in osteosarcoma, including the tumor site, histologic grade and score, mitotic index, degree of tumor necrosis, and pleomorphism. Chondroblastic osteosarcomas had significantly higher and telangiectatic osteosarcomas significantly lower p53 index than did osteosarcomas belonging to other histopathologic subtypes, a fact that tends to reinforce the perception of these osteosarcomas as distinct clinicopathologic entities. Entire males had higher p53 index than did neutered males. p53 index was higher in Rottweilers than in Great Danes and Terriers, confirming breed susceptibilities to osteosarcoma. p53 index showed no association with age, primary or secondary site status, or the presence of metastases or other tumor types. Biopsy samples had a higher p53 index than did postmortem samples, either because of differences in sample processing or the possibility that p53 overexpression is more evident at the earlier stages of osteosarcoma pathogenesis, presumably represented by the biopsy material. IHC examination for p53 and the derived index has the potential to be used as an additional diagnostic tool and prognostic indicator for osseous tumors.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.
Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M
2015-06-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G
2011-01-01
Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907
Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G
2011-11-01
Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.
TRIM65 negatively regulates p53 through ubiquitination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yang; Ma, Chengyuan; Zhou, Tong
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less
The Transcription Factor p53 Influences Microglial Activation Phenotype
Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.
2011-01-01
Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312
Preeclampsia Is Associated with Alterations in the p53-Pathway in Villous Trophoblast
Sharp, Andrew N.; Heazell, Alexander E. P.; Baczyk, Dora; Dunk, Caroline E.; Lacey, Helen A.; Jones, Carolyn J. P.; Perkins, Jonathan E.; Kingdom, John C. P.; Baker, Philip N.; Crocker, Ian P.
2014-01-01
Background Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Methods Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT- α). Equally, Mdm2 was knocked-down with siRNA. Results Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. Conclusions These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation. PMID:24498154
Preeclampsia is associated with alterations in the p53-pathway in villous trophoblast.
Sharp, Andrew N; Heazell, Alexander E P; Baczyk, Dora; Dunk, Caroline E; Lacey, Helen A; Jones, Carolyn J P; Perkins, Jonathan E; Kingdom, John C P; Baker, Philip N; Crocker, Ian P
2014-01-01
Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT-α). Equally, Mdm2 was knocked-down with siRNA. Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation.
Kumpawat, K; Chatterjee, A
2003-07-01
Betel-nut (BN) chewing related oral mucosal lesions are potential hazards to a large population worldwide. Genotoxicity of betel alkaloids, polyphenol and tannin fractions have been reported. It has been shown earlier that BN ingredients altered the level of endogenous glutathione (GSH) which could modulate the host susceptibility to the action of other chemical carcinogens. The north-east Indian variety of BN, locally known as 'kwai', is raw, wet and consumed unprocessed with betel-leaf and slaked lime and contains higher alkaloids, polyphenol and tannins as compared to the dried one. Therefore, the purpose of this study was to investigate the extent of DNA damage, pattern of cell kinetics, the level of p53-protein and endogenous GSH in kwai chewers in the tribal population of Meghalaya state in the northeastern region of India with an aim to see whether these end-points could serve as biomarkers of genetic damage of relevance for genotoxic/carcinogenic process. The present data show higher DNA damage, delay in cell kinetics, p53 expression and lower GSH-level in heavy chewers (HC) than nonchewers (NC). The influence of bleomycin (BLM) on chromatid break induction in G2-phase of peripheral blood lymphocytes in NC and HC has been analysed to determine individual susceptibility to carcinogenic assaults. HC showed higher induction of chromatid breaks than NC. Risk assessment in this study suggests an interaction between carcinogen exposure and mutagen sensitivity measures, risk estimates being higher in those individuals who both consume kwai and express sensitivity to free radical oxygen damage in vitro. From this study it seems that besides cytogenetical parameters, the level of endogenous GSH and the level of p53 protein could act as effective biomarkers for kwai chewers.
Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.
1998-01-01
Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563
MDM4 is a key therapeutic target in cutaneous melanoma
Gembarska, Agnieszka; Luciani, Flavie; Fedele, Clare; Russell, Elisabeth A; Dewaele, Michael; Villar, Stéphanie; Zwolinska, Aleksandra; Haupt, Sue; de Lange, Job; Yip, Dana; Goydos, James; Haigh, Jody J; Haupt, Ygal; Larue, Lionel; Jochemsen, Aart; Shi, Hubing; Moriceau, Gatien; Lo, Roger S; Ghanem, Ghanem; Shackleton, Mark; Bernal, Federico; Marine, Jean-Christophe
2013-01-01
The inactivation of the p53 tumor suppressor pathway, which often occurs through mutations in TP53 (encoding tumor protein 53) is a common step in human cancer. However, in melanoma—a highly chemotherapy-resistant disease—TP53 mutations are rare, raising the possibility that this cancer uses alternative ways to overcome p53-mediated tumor suppression. Here we show that Mdm4 p53 binding protein homolog (MDM4), a negative regulator of p53, is upregulated in a substantial proportion (∼65%) of stage I–IV human melanomas and that melanocyte-specific Mdm4 overexpression enhanced tumorigenesis in a mouse model of melanoma induced by the oncogene Nras. MDM4 promotes the survival of human metastatic melanoma by antagonizing p53 proapoptotic function. Notably, inhibition of the MDM4-p53 interaction restored p53 function in melanoma cells, resulting in increased sensitivity to cytotoxic chemotherapy and to inhibitors of the BRAF (V600E) oncogene. Our results identify MDM4 as a key determinant of impaired p53 function in human melanoma and designate MDM4 as a promising target for antimelanoma combination therapy. PMID:22820643
Constant p53 Pathway Inactivation in a Large Series of Soft Tissue Sarcomas with Complex Genetics
Pérot, Gaëlle; Chibon, Frédéric; Montero, Audrey; Lagarde, Pauline; de Thé, Hugues; Terrier, Philippe; Guillou, Louis; Ranchère, Dominique; Coindre, Jean-Michel; Aurias, Alain
2010-01-01
Alterations of the p53 pathway are among the most frequent aberrations observed in human cancers. We have performed an exhaustive analysis of TP53, p14, p15, and p16 status in a large series of 143 soft tissue sarcomas, rare tumors accounting for around 1% of all adult cancers, with complex genetics. For this purpose, we performed genomic studies, combining sequencing, copy number assessment, and expression analyses. TP53 mutations and deletions are more frequent in leiomyosarcomas than in undifferentiated pleomorphic sarcomas. Moreover, 50% of leiomyosarcomas present TP53 biallelic inactivation, whereas most undifferentiated pleomorphic sarcomas retain one wild-type TP53 allele (87.2%). The spectrum of mutations between these two groups of sarcomas is different, particularly with a higher rate of complex mutations in undifferentiated pleomorphic sarcomas. Most tumors without TP53 alteration exhibit a deletion of p14 and/or lack of mRNA expression, suggesting that p14 loss could be an alternative genotype for direct TP53 inactivation. Nevertheless, the fact that even in tumors altered for TP53, we could not detect p14 protein suggests that other p14 functions, independent of p53, could be implicated in sarcoma oncogenesis. In addition, both p15 and p16 are frequently codeleted or transcriptionally co-inhibited with p14, essentially in tumors with two wild-type TP53 alleles. Conversely, in TP53-altered tumors, p15 and p16 are well expressed, a feature not incompatible with an oncogenic process. PMID:20884963
CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.
Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W
2007-07-25
We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.
JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation
Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng
2009-01-01
The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types—MDM2, Pirh2, and COP1—and the HECT-domain type—ARF-BP1—have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G1 phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation. PMID:19509332
JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.
Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng
2009-06-23
The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.
Wang, Lin; Yu, Peiwu
2016-12-01
p53 mutations in tumors can induce the loss of wild-type tumor-suppressing p53 function, which results in the increase in proliferation, migration and invasion ability in cancer cells. Studies have shown that the expression of p53 is regulated by several microRNAs (miRNAs). In the present study, we found that miR-300 and p53 were significantly increased in colorectal cancer (CRC) tissues when compared with levels noted in adjacent colorectal tissues. Both miR-300 and p53 were significantly correlated with lymphatic metastasis and TNM stage. Both miR-300 and p53 promoted CRC cell (SW480 and HT29) proliferation, migration, and invasion, respectively, in vitro. In addition, we found that miR-300 is a direct positive regulator of p53 through binding to the binding site in the 3'UTR of the p53 gene in human CRC cells. Moreover, both miR-300 and p53 induced CRC cell epithelial‑mesenchymal transition (EMT) respectively. Taken together, we demonstrated that miR-300 promoted proliferation and EMT-mediated CRC migration and invasion by targeting p53. These findings provide a new theoretical basis and potential therapeutic targets, and thus lays the foundation for exploring the pathogenesis of CRC.
Lee, Se Kyung; Bae, Soo Youn; Lee, Jun Ho; Lee, Hyun-Chul; Yi, Hawoo; Kil, Won Ho; Lee, Jeong Eon; Kim, Seok Won; Nam, Seok Jin
2015-01-01
Overexpression of p53 is the most frequent genetic alteration in breast cancer. Recently, many studies have shown that the expression of mutant p53 differs for each subtype of breast cancer and is associated with different prognoses. In this study, we aimed to determine the suitable cut-off value to predict the clinical outcome of p53 overexpression and its usefulness as a prognostic factor in each subtype of breast cancer, especially in luminal A breast cancer. Approval was granted by the Institutional Review Board of Samsung Medical Center. We analyzed a total of 7,739 patients who were surgically treated for invasive breast cancer at Samsung Medical Center between Dec 1995 and Apr 2013. Luminal A subtype was defined as ER&PR + and HER2- and was further subclassified according to Ki-67 and p53 expression as follows: luminal A (Ki-67-,p53-), luminal A (Ki-67+, p53-), luminal A (Ki-67 -, p53+) and luminal A (Ki-67+, p53+). Low-risk luminal A subtype was defined as negative for both Ki-67 and p53 (luminal A [ki-67-, p53-]), and others subtypes were considered to be high-risk luminal A breast cancer. A cut-off value of 10% for p53 was a good predictor of clinical outcome in all patients and luminal A breast cancer patients. The prognostic role of p53 overexpression for OS and DFS was only significant in luminal A subtype. The combination of p53 and Ki-67 has been shown to have the best predictive power as calculated by the area under curve (AUC), especially for long-term overall survival. In this study, we have shown that overexpression of p53 and Ki-67 could be used to discriminate low-risk luminal A subtype in breast cancer. Therefore, using the combination of p53 and Ki-67 expression in discriminating low-risk luminal A breast cancer may improve the prognostic power and provide the greatest clinical utility. PMID:26241661
Zhang, Ping; Kratz, Anne Sophie; Salama, Mohammed; Elabd, Seham; Heinrich, Thorsten; Wittbrodt, Joachim; Blattner, Christine; Davidson, Gary
2015-10-08
The p53 tumor suppressor protein is mainly regulated by alterations in the half-life of the protein, resulting in significant differences in p53 protein levels in cells. The major regulator of this process is Mdm2, which ubiquitinates p53 and targets it for proteasomal degradation. This process can be enhanced or reduced by proteins that associate with p53 or Mdm2 and several proteins have been identified with such an activity. Furthermore, additional ubiquitin ligases for p53 have been identified in recent years. Nevertheless, our understanding of how p53 abundance and Mdm2 activity are regulated remains incomplete. Here we describe a cell culture based overexpression screen to identify evolutionarily conserved regulators of the p53/Mdm2 circuit. The results from this large-scale screening method will contribute to a better understanding of the regulation of these important proteins. Expression screening was based on co-transfection of H1299 cells with pools of cDNA's from a Medaka library together with p53, Mdm2 and, as internal control, Ror2. After cell lysis, SDS-PAGE/WB analysis was used to detect alterations in these proteins. More than one hundred hits that altered the abundance of either p53, Mdm2, or both were identified in the primary screen. Subscreening of the library pools that were identified in the primary screen identified several potential novel regulators of p53 and/or Mdm2. We also tested whether the human orthologues of the Medaka genes regulate p53 and/or Mdm2 abundance. All human orthologues regulated p53 and/or Mdm2 abundance in the same manner as the proteins from Medaka, which underscores the suitability of this screening methodology for the identification of new modifiers of p53 and Mdm2. Despite enormous efforts in the last two decades, many unknown regulators for p53 and Mdm2 abundance are predicted to exist. This cross-species approach to identify evolutionarily conserved regulators demonstrates that our Medaka unigene cDNA library represents a powerful tool to screen for these novel regulators of the p53/Mdm2 pathway.
Wanka, C; Brucker, D P; Bähr, O; Ronellenfitsch, M; Weller, M; Steinbach, J P; Rieger, J
2012-08-16
P53 has an important role in the processing of starvation signals. P53-dependent molecular mediators of the Warburg effect reduce glucose consumption and promote mitochondrial function. We therefore hypothesized that the retention of wild-type p53 characteristic of primary glioblastomas limits metabolic demands induced by deregulated signal transduction in the presence of hypoxia and nutrient depletion. Here we report that short hairpin RNA-mediated gene suppression of wild-type p53 or ectopic expression of mutant temperature-sensitive dominant-negative p53(V135A) increased glucose consumption and lactate production, decreased oxygen consumption and enhanced hypoxia-induced cell death in p53 wild-type human glioblastoma cells. Similarly, genetic knockout of p53 in HCT116 colon carcinoma cells resulted in reduced respiration and hypersensitivity towards hypoxia-induced cell death. Further, wild-type p53 gene silencing reduced the expression of synthesis of cytochrome c oxidase 2 (SCO2), an effector necessary for respiratory chain function. An SCO2 transgene reverted the metabolic phenotype and restored resistance towards hypoxia in p53-depleted and p53 mutant glioma cells in a rotenone-sensitive manner, demonstrating that this effect was dependent on intact oxidative phosphorylation. Supplementation with methyl-pyruvate, a mitochondrial substrate, rescued p53 wild-type but not p53 mutant cells from hypoxic cell death, demonstrating a p53-mediated selective aptitude to metabolize mitochondrial substrates. Further, SCO2 gene silencing in p53 wild-type glioma cells sensitized these cells towards hypoxia. Finally, lentiviral gene suppression of SCO2 significantly enhanced tumor necrosis in a subcutaneous HCT116 xenograft tumor model, compatible with impaired energy metabolism in these cells. These findings demonstrate that glioma and colon cancer cells with p53 wild-type status can skew the Warburg effect and thereby reduce their vulnerability towards tumor hypoxia in an SCO2-dependent manner. Targeting SCO2 may therefore represent a valuable strategy to enhance sensitivity towards hypoxia and may complement strategies targeting glucose metabolism.
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.
Inhibition of NAMPT pathway by FK866 activates the function of p53 in HEK293T cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thakur, Basant Kumar, E-mail: thakur.basant@mh-hannover.de; Department of Molecular Hematopoiesis, Hannover Medical School, Carl Neuberg Str-1, 30625 Hannover; Dittrich, Tino
2012-08-03
Highlights: Black-Right-Pointing-Pointer In 293T cells, p53 is considered to be inactive due to its interaction with the large T-antigen. Black-Right-Pointing-Pointer Acetylation of p53 at lysine 382 is important for its functional activation. Black-Right-Pointing-Pointer First evidence to document the presence of a functional p53 in 293T cells. Black-Right-Pointing-Pointer Inhibition of NAMPT/SIRT pathway by FK866 in 293T cells increases the functional activity of p53. Black-Right-Pointing-Pointer This activation of p53 involves reversible acetylation of p53 at lysine 382. -- Abstract: Inactivation of p53 protein by endogenous and exogenous carcinogens is involved in the pathogenesis of different human malignancies. In cancer associated with SV-40more » DNA tumor virus, p53 is considered to be non-functional mainly due to its interaction with the large T-antigen. Using the 293T cell line (HEK293 cells transformed with large T antigen) as a model, we provide evidence that p53 is one of the critical downstream targets involved in FK866-mediated killing of 293T cells. A reduced rate of apoptosis and an increased number of cells in S-phase was accompanied after knockdown of p53 in these cells. Inhibition of NAMPT by FK866, or inhibition of SIRT by nicotinamide decreased proliferation and triggered death of 293T cells involving the p53 acetylation pathway. Additionally, knockdown of p53 attenuated the effect of FK866 on cell proliferation, apoptosis, and cell cycle arrest. The data presented here shed light on two important facts: (1) that p53 in 293T cells is active in the presence of FK866, an inhibitor of NAMPT pathway; (2) the apoptosis induced by FK866 in 293T cells is associated with increased acetylation of p53 at Lys382, which is required for the functional activity of p53.« less
Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma
Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160
Lee, Se Kyung; Bae, Soo Youn; Lee, Jun Ho; Lee, Hyun-Chul; Yi, Hawoo; Kil, Won Ho; Lee, Jeong Eon; Kim, Seok Won; Nam, Seok Jin
2015-01-01
Overexpression of p53 is the most frequent genetic alteration in breast cancer. Recently, many studies have shown that the expression of mutant p53 differs for each subtype of breast cancer and is associated with different prognoses. In this study, we aimed to determine the suitable cut-off value to predict the clinical outcome of p53 overexpression and its usefulness as a prognostic factor in each subtype of breast cancer, especially in luminal A breast cancer. Approval was granted by the Institutional Review Board of Samsung Medical Center. We analyzed a total of 7,739 patients who were surgically treated for invasive breast cancer at Samsung Medical Center between Dec 1995 and Apr 2013. Luminal A subtype was defined as ER&PR + and HER2- and was further subclassified according to Ki-67 and p53 expression as follows: luminal A (Ki-67-,p53-), luminal A (Ki-67+, p53-), luminal A (Ki-67 -, p53+) and luminal A (Ki-67+, p53+). Low-risk luminal A subtype was defined as negative for both Ki-67 and p53 (luminal A [ki-67-, p53-]), and others subtypes were considered to be high-risk luminal A breast cancer. A cut-off value of 10% for p53 was a good predictor of clinical outcome in all patients and luminal A breast cancer patients. The prognostic role of p53 overexpression for OS and DFS was only significant in luminal A subtype. The combination of p53 and Ki-67 has been shown to have the best predictive power as calculated by the area under curve (AUC), especially for long-term overall survival. In this study, we have shown that overexpression of p53 and Ki-67 could be used to discriminate low-risk luminal A subtype in breast cancer. Therefore, using the combination of p53 and Ki-67 expression in discriminating low-risk luminal A breast cancer may improve the prognostic power and provide the greatest clinical utility.
Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.
Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru
2011-01-01
MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.
DIBENZO[A,L]PYRENE INDUCTION OF ERYTHROCYTE MICRONUCLEI IN A/J AND P53-DEFICIENT MICE
DIBENZO[a,l]PYRENE INDUCTION OF ERYTHROCYTE MICRONUCLEI IN AlJ AND P53-DEFICIENT MICE
Male A/J and C57Bl/6 background p53+/+, p53+/- and p53-/- mice were treated with dibenzo[a,l]pyrene (DB[a,l]P), and micronucleus (MN) frequencies were measured in erythrocytes from bone ...
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
Inhibition of Mdm2 Sensitizes Human Retinal Pigment Epithelial Cells to Apoptosis
Ray, Ramesh M.; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.
2011-01-01
Purpose. Because recent studies indicate that blocking the interaction between p53 and Mdm2 results in the nongenotoxic activation of p53, the authors sought to investigate whether the inhibition of p53-Mdm2 binding activates p53 and sensitizes human retinal epithelial cells to apoptosis. Methods. Apoptosis was evaluated by the activation of caspases and DNA fragmentation assays. The Mdm2 antagonist Nutlin-3 was used to dissociate p53 from Mdm2 and, thus, to increase p53 activity. Knockdown of p53 expression was accomplished by using p53 siRNA. Results. ARPE-19 and primary RPE cells expressed high levels of the antiapoptotic proteins Bcl-2 and Bcl-xL. Exposure of these cells to camptothecin (CPT) or TNF-α/ cycloheximide (CHX) failed to induce apoptosis. In contrast, treatment with the Mdm2 antagonist Nutlin-3 in the absence of CPT or TNF-α/CHX increased apoptosis. Activation of p53 in response to Nutlin-3 also increased levels of Noxa, p53-upregulated modulator of apoptosis (PUMA), and Siva-1, decreased expression of Bcl-2 and Bcl-xL, and simultaneously increased caspases-9 and -3 activities and DNA fragmentation. Knockdown of p53 decreased the basal expression of p21Cip1 and Bcl-2, inhibited the Nutlin-3–induced upregulation of Siva-1 and PUMA expression, and consequently inhibited caspase-3 activation. Conclusions. These results indicate that the normally available pool of intracellular p53 is predominantly engaged in the regulation of cell cycle checkpoints by p21Cip1 and does not trigger apoptosis in response to DNA-damaging agents. However, the blockage of p53 binding to Mdm2 frees a pool of p53 that is sufficient, even in the absence of DNA-damaging agents, to increase the expression of proapoptotic targets and to override the resistance of RPE cells to apoptosis. PMID:21345989
Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle
2016-01-01
Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199
The Neuronal Ischemic Tolerance Is Conditioned by the Tp53 Arg72Pro Polymorphism.
Ramos-Araque, Maria E; Rodriguez, Cristina; Vecino, Rebeca; Cortijo Garcia, Elisa; de Lera Alfonso, Mercedes; Sanchez Barba, Mercedes; Colàs-Campàs, Laura; Purroy, Francisco; Arenillas, Juan F; Almeida, Angeles; Delgado-Esteban, Maria
2018-04-23
Cerebral preconditioning (PC) confers endogenous brain protection after stroke. Ischemic stroke patients with a prior transient ischemic attack (TIA) may potentially be in a preconditioned state. Although PC has been associated with the activation of pro-survival signals, the mechanism by which preconditioning confers neuroprotection is not yet fully clarified. Recently, we have described that PC-mediated neuroprotection against ischemic insult is promoted by p53 destabilization, which is mediated by its main regulator MDM2. Moreover, we have previously described that the human Tp53 Arg72Pro single nucleotide polymorphism (SNP) controls susceptibility to ischemia-induced neuronal apoptosis and governs the functional outcome of patients after stroke. Here, we studied the contribution of the human Tp53 Arg72Pro SNP on PC-induced neuroprotection after ischemia. Our results showed that cortical neurons expressing the Pro72-p53 variant exhibited higher PC-mediated neuroprotection as compared with Arg72-p53 neurons. PC prevented ischemia-induced nuclear and cytosolic p53 stabilization in Pro72-p53 neurons. However, PC failed to prevent mitochondrial p53 stabilization, which occurs in Arg72-p53 neurons after ischemia. Furthermore, PC promoted neuroprotection against ischemia by controlling the p53/active caspase-3 pathway in Pro72-p53, but not in Arg72-p53 neurons. Finally, we found that good prognosis associated to TIA within 1 month prior to ischemic stroke was restricted to patients harboring the Pro72 allele. Our findings demonstrate that the Tp53 Arg72Pro SNP controls PC-promoted neuroprotection against a subsequent ischemic insult by modulating mitochondrial p53 stabilization and then modulates TIA-induced ischemic tolerance.
Phosphorylation of p53 modifies sensitivity to ionizing radiation.
Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi
2011-06-01
Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.
Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.
2014-01-01
SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139
p53 downregulates the Fanconi anaemia DNA repair pathway
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-01-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Morgia, Giuseppe; Micali, Antonio; Rinaldi, Mariagrazia; Irrera, Natasha; Marini, Herbert; Puzzolo, Domenico; Pisani, Antonina; Privitera, Salvatore; Russo, Giorgio I; Cimino, Sebastiano; Ieni, Antonio; Trichilo, Vincenzo; Altavilla, Domenica; Squadrito, Francesco; Minutoli, Letteria
2017-03-22
Benign prostatic hyperplasia (BPH) treatment includes the apoptosis machinery modulation through the direct inhibition of caspase cascade. We previously demonstrated that Serenoa repens (Ser) with lycopene (Ly) and selenium (Se) reawakened apoptosis by reducing survivin and neuronal apoptosis inhibitory protein (NAIP) levels in rats. The aim of this study was to evaluate the effectiveness of Ser-Se-Ly association on survivin and NAIP expression in BPH patients. Ninety patients with lower urinary tract symptoms (LUTS) due to clinical BPH were included in this randomized, double-blind, placebo-controlled trial. Participants were randomly assigned to receive placebo (Group BPH + placebo, n = 45) or Ser-Se-Ly association (Group BPH + Ser-Se-Ly; n = 45) for 3 months. At time 0, all patients underwent prostatic biopsies. After 3 months of treatment, they underwent prostatic re-biopsy and specimens were collected for molecular, morphological, and immunohistochemical analysis. After 3 months, survivin and NAIP were significantly decreased, while caspase-3 was significantly increased in BPH patients treated with Ser-Se-Ly when compared with the other group. In BPH patients treated with Ser-Se-Ly for 3 months, the glandular epithelium was formed by a single layer of cuboidal cells. PSA showed high immunoexpression in all BPH patients and a focal positivity in Ser-Se-Ly treated patients after 3 months. Evident prostate specific membrane antigen (PSMA) immunoexpression was shown in all BPH patients, while no positivity was present after Ser-Se-Ly administration. Ser-Se-Ly proved to be effective in promoting apoptosis in BPH patients.
PONCE-BRAVO, Santa; LEDESMA-MONTES, Constantino; GARCÉS-ORTÍZ, Maricela
2015-01-01
Pleomorphic adenoma (PA) is the most common salivary gland tumor and its microscopic features and histogenesis are a matter of debate. Human milk fat globule protein membrane (HMFG) monoclonal antibodies (MoAbs) comprise a set of antibodies against the mucin 1 (MUC-1) protein detected in several salivary gland tumors. Objective The aim of this study was to assess the immunoexpression of the PA neoplastic cells to MUC-1 protein using HMFG-1 and HMFG-2 MoAbs, contrasting these results with those from normal salivary gland tissue. Material and Methods Immunohistochemical detection of MUC-1 protein using HMFG-1 and HMFG-2 MoAbs was made in 5 mm thick, paraffin embedded slides, and the avidin-biotin method was used. Results Positivity to HMFG-1 and HMFG-2 MoAbs was found in ductal, squamous metaplastic and neoplastic myoepithelial cells, keratin pearls and intraductal mucous material. Two kinds of myoepithelial cells were identified: classic myoepithelial cells around ducts were negative to both MoAbs, and modified myoepithelial cells were positive to both MoAbs. This last cellular group of the analyzed tumors showed similar MUC-1 immunoexpression to ductal epithelial cells using both HMFG antibodies. Intraductal mucous secretion was also HMFG-1 and HMFG-2 positive. Conclusions Our results showed there are two kinds of myoepithelial cells in PA. The first cellular group is represented by the different kinds of neoplastic myoepithelial cells and is HMFG-positive. The second one is HMFG-negative and represented by the neoplastic myoepithelial cells located around the ducts. PMID:26221920
Effects of topical phenytoin on nasal wound healing after mechanical trauma: An experimental study.
Şimşek, Gökçe; Ciftci, Osman; Karadag, Neşe; Karatas, Erkan; Kizilay, Ahmet
2014-12-01
Impaired postoperative wound healing is the second most common morbidity after synechia formation in endoscopic sinus surgery. The aim of this experimental study was to investigate the potential effects of topical phenytoin on wound healing after nasal mucosal trauma in rats. An experimental study at the Inonu University Faculty of Medicine. Twenty-four rats were randomized into three groups: 1) phenytoin group (n = 8), 2) control group (n = 8), and 3) vehicle group (n = 8). After damaging the right nasal cavity, in the phenytoin group, 1% topical phenytoin cream was applied for 7 days. The rats in the control group did not receive any treatment. The vehicle group was treated with daily topical cold cream for 1 week. The rats were sacrificed at the end, and the nasal cavities were excised. Tissue edema and inflammatory cell infiltration were compared among the groups. Additionally, proliferating cell nuclear antigen (PCNA) and cluster of differentiation 31 (CD31) immunoexpression levels were evaluated. Furthermore, in biochemical analysis, the tissue levels of vascular endothelial growth factor and (EGF) of the groups were investigated. In the phenytoin group, tissue edema and inflammatory cell infiltration were significantly decreased, and PCNA and CD31 immunoexpression levels were more prominent (P < .001) and the tissue EGF levels were significantly higher (P < .01). Topical phenytoin treatment may alter the nasal wound healing after mechanical trauma. The potential beneficial effects of topical phenytoin on nasal mucosa should be investigated by further experimental and human trials. NA. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.
The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential
Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre
2015-01-01
Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205
Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway
Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.
2011-01-01
Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980
1994-01-01
Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041
A Cohort Study of the Patterns of Third Molar Impaction in Panoramic Radiographs in Saudi Population
Al-Dajani, Mahmoud; Abouonq, Anas O; Almohammadi, Turki A; Alruwaili, Mohammed K; Alswilem, Rayan O; Alzoubi, Ibrahim A
2017-01-01
Objectives: To evaluate the epidemiological patterns of third molar impaction in a cohort of patients living in the north of Saudi Arabia. Materials and Methods: A retrospective cohort study comprised of analysing 2550 Orthopantomograms (OPGs) belonging to patients who attended Aljouf University College of Dentistry between September 2013 and December 2015. OPGs were examined to determine the frequency of third molar impaction, their levels of eruption and angulations. Mixed effects logistic regression analysis was performed to calculate adjusted odds ratios. Data were weighted by age and sex based on population regional estimates. Results: 1551 patients (60.8%) with a mean age of 33.5 years-old (95%CI: 32.9 to 34) demonstrated 2650 impacted third molars. Third molars were more likely present in patients aged from 20 to 39 years-old (p<0.001); and in mandible more than maxilla (p<0.001). It showed highest vertical impaction and higher impaction rate in mandible than maxilla. Level A impaction was the most common among other levels by 1365 (53.5%). Vertical impaction was the most common pattern (1354 patients; 53.1%). Mesioangular impaction ranked second in mandible, while distoangular impaction ranked second in maxilla. There was no statistically significant difference between males and females concerning impaction frequency, depth levels and angulations. Conclusion: Impacted third molars is still a public health concern among youth and young adults. Vertically impacted mandibular third molars with their occlusal plane at the same level as the occlusal plane of adjacent tooth is the most prevalent pattern of third molar impaction in the northern region of Saudi Arabia. PMID:29387281
Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo
Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah
2016-01-01
Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting “oncogene addiction” could be a promising strategy for combatting p53 mutant tumors. PMID:27765910
Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo.
Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah
2016-11-22
Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting "oncogene addiction" could be a promising strategy for combatting p53 mutant tumors.
PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage
Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C
2012-01-01
p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459
PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.
Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C
2012-12-13
p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.
Involvement of stromal p53 in tumor-stroma interactions
Bar, Jair; Moskovits, Neta; Oren, Moshe
2009-01-01
p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385
Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun
2016-11-22
Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.
Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R
2016-01-01
Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462
Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; De Lena, M; Allegra, C J; Johnston, P G
2000-02-01
The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated-5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53- cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively; P < 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P < 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34-1.01; two-sided P < 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85-1.26; two-sided P < 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy.
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.
Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen
2017-10-15
Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and DNA damage-mediated cellular stresses. This seems to be the first report that p53 activates a viral oncogene; therefore, the discovery would be interesting to a broad readership from the fields of oncology to virology. Copyright © 2017 American Society for Microbiology.
Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena
2006-01-01
The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF-kappaB distinctively, while modulating the pathways of JNK and AP-1 similarly. These differences may influence cellular processes such as proliferation, differentiation, and apoptosis. 2005 Wiley-Liss, Inc.
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2016-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 are non-redundant pathways possessing similar capabilities to activate p53 upon c-Myc overexpression. PMID:25823025
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tommaso, Anne di; Hagen, Jussara; Tompkins, Van
2009-04-15
The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala{sup 14} and Thr{sup 31}) were found to destabilize the protein while two others (Val{sup 24} and Ala{sup 41}) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significantmore » biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val{sup 24} was required for p53-independent growth suppression whereas multiple residues (Val{sup 24}, Thr{sup 31}, Ala{sup 41} and His{sup 60}) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.« less
Bhanot, Gyan; Alexe, Gabriela; Levine, Arnold J; Stolovitzky, Gustavo
2005-01-01
A major challenge in cancer diagnosis from microarray data is the need for robust, accurate, classification models which are independent of the analysis techniques used and can combine data from different laboratories. We propose such a classification scheme originally developed for phenotype identification from mass spectrometry data. The method uses a robust multivariate gene selection procedure and combines the results of several machine learning tools trained on raw and pattern data to produce an accurate meta-classifier. We illustrate and validate our method by applying it to gene expression datasets: the oligonucleotide HuGeneFL microarray dataset of Shipp et al. (www.genome.wi.mit.du/MPR/lymphoma) and the Hu95Av2 Affymetrix dataset (DallaFavera's laboratory, Columbia University). Our pattern-based meta-classification technique achieves higher predictive accuracies than each of the individual classifiers , is robust against data perturbations and provides subsets of related predictive genes. Our techniques predict that combinations of some genes in the p53 pathway are highly predictive of phenotype. In particular, we find that in 80% of DLBCL cases the mRNA level of at least one of the three genes p53, PLK1 and CDK2 is elevated, while in 80% of FL cases, the mRNA level of at most one of them is elevated.
Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.
Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D
2016-10-01
TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.
Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma
Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie
2016-01-01
Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%. PMID:27840695
Gozé, Catherine; Blonski, Marie; Le Maistre, Guillaume; Bauchet, Luc; Dezamis, Edouard; Page, Philippe; Varlet, Pascale; Capelle, Laurent; Devaux, Bertrand; Taillandier, Luc; Duffau, Hugues; Pallud, Johan
2014-01-01
Background We explored whether spontaneous imaging tumor growth (estimated by the velocity of diametric expansion) and isocitrate dehydrogenase 1 (IDH1) mutation (estimated by IDH1 immunoexpression) were independent predictors of long-term outcomes of diffuse low-grade gliomas in adults. Methods One hundred thirty-one adult patients with newly diagnosed supratentorial diffuse low-grade gliomas were retrospectively studied. Results Isocitrate dehydrogenase 1 mutations were present in 107 patients. The mean spontaneous velocity of diametric expansion was 5.40 ± 5.46 mm/y. During follow-up (mean, 70 ± 54.7 mo), 56 patients presented a malignant transformation and 23 died. The median malignant progression-free survival and the overall survival were significantly longer in cases of slow velocity of diametric expansion (149 and 198 mo, respectively) than in cases of fast velocity of diametric expansion (46 and 82 mo; P < .001 and P < .001, respectively) and in cases with IDH1 mutation (100 and 198 mo, respectively) than in cases without IDH1 mutation (72 mo and not reached; P = .028 and P = .001, respectively). In multivariate analyses, spontaneous velocity of diametric expansion and IDH1 mutation were independent prognostic factors for malignant progression-free survival (P < .001; hazard ratio, 4.23; 95% CI, 1.81–9.40 and P = .019; hazard ratio, 2.39; 95% CI, 1.19–4.66, respectively) and for overall survival (P < .001; hazard ratio, 26.3; 95% CI, 5.42–185.2 and P = .007; hazard ratio, 17.89; 95% CI, 2.15–200.1, respectively). Conclusions The spontaneous velocity of diametric expansion and IDH1 mutation status are 2 independent prognostic values that should be obtained at the beginning of the management of diffuse low-grade gliomas in adults. PMID:24847087
Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53
Murakami, Yohei; Takada, Shoji
2012-01-01
Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606
Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A
1998-01-01
A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.
Cross Talk between PML and p53 during Poliovirus Infection: Implications for Antiviral Defense
Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K.
2006-01-01
PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation. PMID:16912307
Cross talk between PML and p53 during poliovirus infection: implications for antiviral defense.
Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K
2006-09-01
PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation.
Miller, David W; Harrison, Joanne L; Brown, Yvonne A; Doyle, Una; Lindsay, Alanna; Adam, Clare L; Lea, Richard G
2005-01-01
Background The gut hormone, ghrelin, is involved in the neuroendocrine and metabolic responses to hunger. In monogastric species, circulating ghrelin levels show clear meal-related and body weight-related changes. The pattern of secretion and its role in ruminant species is less clear. Ghrelin acts via growth hormone secretagogue receptors (GHSR-1a) to alter food intake, fat utilization, and cellular proliferation. There is also evidence that ghrelin is involved in reproductive function. In the present study we used immunohistochemistry to investigate the presence of ghrelin and GHSR-1a in sheep reproductive tissues. In addition, we examined whether ghrelin and GHSR-1a protein expression is developmentally regulated in the adult and fetal ovine testis, and whether there is an association with markers of cellular proliferation, i.e. stem cell factor (SCF) and proliferating cell nuclear antigen (PCNA). Methods Antibodies raised against ghrelin and its functional receptor, GHSR-type 1a, were used in standard immunohistochemical protocols on various reproductive tissues collected from adult and fetal sheep. GHSR-1a mRNA presence was also confirmed by in situ hybridisation. SCF and PCNA immunoexpression was investigated in fetal testicular samples. Adult and fetal testicular immunostaining for ghrelin, GHSR-1a, SCF and PCNA was analysed using computer-aided image analysis. Image analysis data were subjected to one-way ANOVA, with differences in immunostaining between time-points determined by Fisher's least significant difference. Results In adult sheep tissue, ghrelin and GHSR-1a immunostaining was detected in the stomach (abomasum), anterior pituitary gland, testis, ovary, and hypothalamic and hindbrain regions of the brain. In the adult testis, there was a significant effect of season (photoperiod) on the level of immunostaining for ghrelin (p < 0.01) and GHSR-1a (p < 0.05). In the fetal sheep testis, there was a significant effect of gestational age on the level of immunostaining for ghrelin (p < 0.001), GHSR-1a (p < 0.05), SCF (p < 0.05) and PCNA (p < 0.01). Conclusion Evidence is presented for the presence of ghrelin and its receptor in various reproductive tissues of the adult and fetal sheep. In addition, the data indicate that testicular expression of ghrelin and its receptor is physiologically regulated in the adult and developmentally regulated in the fetus. Therefore, the ghrelin ligand/receptor system may have a role (endocrine and/or paracrine) in the development (cellular proliferation) and function of the reproductive axis of the sheep. PMID:16259638
Slug, Twist, and E-Cadherin as Immunohistochemical Biomarkers in Meningeal Tumors
Nagaishi, Masaya; Nobusawa, Sumihito; Tanaka, Yuko; Ikota, Hayato; Yokoo, Hideaki; Nakazato, Yoichi
2012-01-01
The overexpression of Twist and Slug and subsequent down-regulation of E-cadherin facilitate the acquirement of invasive growth properties in cancer cells. It is unclear which of these molecules are expressed in mesenchymal tumors in the central nervous system. Here, we investigated 10 cases each of hemangiopericytoma, solitary fibrous tumor, meningothelial, fibrous, angiomatous, and atypical meningiomas, and 5 cases of anaplastic meningioma for Slug, Twist, E-cadherin, and N-cadherin immunoexpression. Nuclear Slug expression was observed in 9/10 (90%) hemangiopericytomas and 5/10 (50%) solitary fibrous tumors, but not in any meningiomas, except for 1 case. Similarly, nuclear Twist expression was more extensive in hemangiopericytomas and solitary fibrous tumors than meningiomas. In contrast to Slug and Twist, the positive expression of E-cadherin was observed in 39/45 (87%) meningiomas, but not in any hemangiopericytomas or solitary fibrous tumors (P<0.0001). The fraction of tumor cells expressing E-cadherin in meningeal tumors was negatively correlated to those of Twist (P = 0.004) and Slug (P<0.0001). The overexpression of Slug and Twist with down-regulation of E-cadherin was characteristic findings in hemangiopericytomas and solitary fibrous tumors, but not in meningiomas. The immunohistochemical profiles of the two tumor groups may be useful as diagnostic markers in cases that present a differential diagnosis challenge. PMID:23029385
MMP-1 and MMP-8 expression in giant-cell fibroma and inflammatory fibrous hyperplasia.
de Oliveira, Henrique Climeck; Tschoeke, André; da Cruz, Gabriele Claudino; Noronha, Lúcia; de Moraes, Rafaela Scariot; Mesquita, Ricardo Alves; de Aguiar, Maria Cássia Ferreira; Caldeira, Patrícia Carlos; de Oliveira Ribas, Marina; Grégio, Ana Maria Trindade; Alanis, Luciana Reis Azevedo; Ignácio, Sérgio Aparecido; Dos Santos, Jean Nunes; de Lima, Antonio Adilson Soares; Johann, Aline Cristina Batista Rodrigues
2016-12-01
The aim of this study is to compare the immunoexpression of metalloproteinases 1 and 8 in giant-cell fibroma, inflammatory fibrous hyperplasia and normal mucosa. Twenty-two cases of giant-cell fibroma, inflammatory fibrous hyperplasia and oral mucosa (control) each were subjected to immunohistochemistry using anti-metalloproteinase-1 and anti-metalloproteinase-8 antibodies. Eight images of each case were captured and analysed through the a) application of a count grid to count the number of positive neutrophils, macrophages, lymphocytes, plasma cells, fibroblasts and blood vessels to obtain the percentage of staining and b) semi-automated segmentation quantifying the stained area in square micrometres. Statistical tests included ANOVA Two-way, Kruskal Wallis and Games-Howell, with a significance level of 5%. An increased percentage of metalloproteinase-1-immunopositive blood vessels were observed in giant-cell fibroma (26.6±22.4; p=0.02) and inflammatory fibrous hyperplasia (34.3±31.5; p=0.01) compared with the control group (19.6±9.2). No significant differences in inflammatory cells, fibroblasts and total area of metalloproteinase-1 and -8 were noted among the three groups. Metalloproteinase-1 apparently acts within the pathogenesis of giant-cell fibroma and inflammatory fibrous hyperplasia. Copyright © 2016 Elsevier GmbH. All rights reserved.
Clinical value of protein expression of kallikrein-related peptidase 7 (KLK7) in ovarian cancer.
Dorn, Julia; Gkazepis, Apostolos; Kotzsch, Matthias; Kremer, Marcus; Propping, Corinna; Mayer, Katharina; Mengele, Karin; Diamandis, Eleftherios P; Kiechle, Marion; Magdolen, Viktor; Schmitt, Manfred
2014-01-01
Expression of the kallikrein-related peptidase 7 (KLK7) is dysregulated in ovarian cancer. We assessed KLK7 expression by ELISA and quantitative immunohistochemistry and analyzed its association with clinicopathological parameters and patients' outcome. KLK7 antigen concentrations were determined in tumor tissue extracts of 98 ovarian cancer patients by ELISA. For analysis of KLK7 immunoexpression in ovarian cancer tissue microarrays, a manual quantitative scoring system as well as a software tool for quantitative high-throughput automated image analysis was used. In immunohistochemical analyses, expression levels of KLK7 were not associated with patients' outcome. However, in multivariate analyses, KLK7 antigen levels in tumor tissue extracts were significantly associated with both overall and progression-free survival: ovarian cancer patients with high KLK7 levels had a significantly, 2-fold lower risk of death [hazard ratio (HR)=0.51, 95% confidence interval (CI)=0.29-0.90, p=0.019] or relapse [HR=0.47, 95% CI=0.25-0.91, p=0.024), as compared with patients who displayed low KLK7 levels. Our results indicate that - in contrast to earlier findings - high KLK7 antigen levels in tumor tissue extracts may be associated with a better prognosis of ovarian cancer patients.
p53 sequence analysis predicts treatment response and outcome of patients with esophageal carcinoma.
Ribeiro, U; Finkelstein, S D; Safatle-Ribeiro, A V; Landreneau, R J; Clarke, M R; Bakker, A; Swalsky, P A; Gooding, W E; Posner, M C
1998-07-01
The ability to predict biologic behavior and treatment responsiveness would be a valuable asset in the multimodality approach to esophageal carcinoma. The authors examined whether alterations of the p53 gene correlate with clinicopathologic parameters, response to preoperative chemotherapy/radiotherapy, and outcome in patients with esophageal carcinoma. METHODS. Histopathologic/genetic analysis of p53 was performed on formalin fixed, paraffin embedded tissues. Tissue sections were stained immunohistochemically for p53 protein followed by topographic genotyping comprised of polymerase chain reaction amplification and direct sequencing of p53 exons 5-8. All patients received induction chemotherapy (5-fluorouracil, cisplatin, and alpha-interferon) and concurrent external beam radiotherapy (4500 centigrays) followed by resection. p53 analysis performed on 42 tumors from patients with potentially resectable esophageal carcinoma revealed 25 of the 42 tumors (59.5%) to be p53 immunopositive; however, only 17 of the 42 tumors (40.5%) were proven to contain p53 point mutational damage in exons 8 (n=5), 5 (n=5), 7 (n=4), and 6 (n=3). Eight cases were weakly immunopositive and had no genotype mutation suggesting hyperexpression of normal wild-type p53. Genotyping also identified two immunonegative cases with deletion-type mutations (exons 5 and 6). Tissue samples collected before and after chemotherapy/radiotherapy exhibited fidelity in p53 mutational genotype in all cases. The presence of a p53 point mutation positively correlated with pTNM stage (P=0.003) and residual disease in the resected specimen (P=0.01). Moreover, survival of patients with p53 mutations was significantly lower than that of patients without mutations (overall survival of 21.6 months vs. 40 months; P=0.0038; and disease free survival of 14.1 months vs. 38 months; P=0.0004). Histopathologic/genetic analysis is a better determinant of p53 mutational damage than immunohistochemistry alone and can be used as a prognostic marker for esophageal carcinoma. p53 genotyping may define a subset of patients who respond to chemotherapy/radiotherapy and may predict who potentially benefits from multimodality therapy.
p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression
Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella
2016-01-01
SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916
Myc, Aurora Kinase-A, and mutant p53R172H co-operate in a mouse model of metastatic skin carcinoma
Torchia, Enrique C.; Caulin, Carlos; Acin, Sergio; Terzian, Tamara; Kubick, Bradley J.; Box, Neil F.; Roop, Dennis R.
2015-01-01
Clinical observations, as well as data obtained from the analysis of genetically engineered mouse models, firmly established the gain-of-function (GOF) properties of certain p53 mutations. However, little is known about the underlying mechanisms. We have used two independent microarray platforms to perform a comprehensive and global analysis of tumors arising in a model of metastatic skin cancer progression, which compares the consequences of a GOF p53R172H mutant vs. p53 deficiency. DNA profiling revealed a higher level of genomic instability in GOF vs. loss-of-function (LOF) p53 squamous cell carcinomas (SCCs). Moreover, GOF p53 SCCs showed preferential amplification of Myc with a corresponding increase in its expression and deregulation of Aurora Kinase-A. Fluorescent in situ hybridization confirmed amplification of Myc in primary GOF p53 SCCs and its retention in metastatic tumors. We also identified by RNA profiling distinct gene expression profiles in GOF p53 tumors, which included enriched integrin and Rho signaling, independent of tumor stage. Thus, the progression of GOF p53 papillomas to carcinoma was marked by the acquisition of epithelial to mesenchymal transition and metastatic signatures. In contrast, LOF p53 tumors showed enrichment of genes associated with cancer proliferation and chromosomal instability. Collectively, these observations suggest that genomic instability plays a prominent role in the early stages of GOF p53 tumor progression (i.e., papillomas), while it is implicated at a later stage in LOF p53 tumors (i.e., SCCs). This model will allow us to identify specific targets in mutant p53 SCCs, which may lead to the development of new therapeutic agents for the treatment of metastatic SCCs. PMID:21963848
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
2012-01-01
Abstract Introduction Pre-clinical data suggest p53-dependent anthracycline-induced apoptosis and p53-independent taxane activity. However, dedicated clinical research has not defined a predictive role for TP53 gene mutations. The aim of the current study was to retrospectively explore the prognosis and predictive values of TP53 somatic mutations in the BIG 02-98 randomized phase III trial in which women with node-positive breast cancer were treated with adjuvant doxorubicin-based chemotherapy with or without docetaxel. Methods The prognostic and predictive values of TP53 were analyzed in tumor samples by gene sequencing within exons 5 to 8. Patients were classified according to p53 protein status predicted from TP53 gene sequence, as wild-type (no TP53 variation or TP53 variations which are predicted not to modify p53 protein sequence) or mutant (p53 nonsynonymous mutations). Mutations were subcategorized according to missense or truncating mutations. Survival analyses were performed using the Kaplan-Meier method and log-rank test. Cox-regression analysis was used to identify independent predictors of outcome. Results TP53 gene status was determined for 18% (520 of 2887) of the women enrolled in BIG 02-98. TP53 gene variations were found in 17% (90 of 520). Nonsynonymous p53 mutations, found in 16.3% (85 of 520), were associated with older age, ductal morphology, higher grade and hormone-receptor negativity. Of the nonsynonymous mutations, 12.3% (64 of 520) were missense and 3.6% were truncating (19 of 520). Only truncating mutations showed significant independent prognostic value, with an increased recurrence risk compared to patients with non-modified p53 protein (hazard ratio = 3.21, 95% confidence interval = 1.740 to 5.935, P = 0.0002). p53 status had no significant predictive value for response to docetaxel. Conclusions p53 truncating mutations were uncommon but associated with poor prognosis. No significant predictive role for p53 status was detected. Trial registration ClinicalTrials.gov NCT00174655 PMID:22551440
Relationships between p53 mutation, HPV status and outcome in oropharyngeal squamous cell carcinoma.
Hong, Angela; Zhang, Xiaoying; Jones, Deanna; Veillard, Anne-Sophie; Zhang, Mei; Martin, Andrew; Lyons, J Guy; Lee, C Soon; Rose, Barbara
2016-02-01
This study aimed to examine the rate and type of p53 mutation in oropharyngeal cancer (OSCC). Relationships were sought between human papillomavirus (HPV) status and p53 mutation. The role of p53 mutation as a prognostic factor independent of HPV status and as a modifier of the effect of HPV on outcomes was also examined. The HPV status of 202 cases was determined by HPV DNA by RT-PCR and p16 immunohistochemistry. P53 mutation in exon 5-8 was determined by pyrosequencing. Findings were correlated with known clinicopathological factors and outcomes. 48% of the cases were HPV positive and they were significantly less likely to have a p53 mutation than HPV-negative OSCCs (25.8% vs 46.7%, p=0.0021). Mutation was most common in exon 5. Among patients with HPV-positive OSCC, there was no significant difference in p53 mutation by smoking status (22.2% for never smokers and 30.8% for current or ex-smokers). Patients with p53 mutant OSCC had significantly worse overall survival (p=0.01). There was no statistical evidence that p53 mutation modified the effect of HPV status on outcomes. In the multivariate analysis, positive HPV status remained the strongest predictor of outcomes. p53 mutation status was not a significant predictor of outcome after adjusting for age, gender, T stage, N stage and HPV status. In summary, HPV-positive OSCC are less likely to have mutant p53 than HPV-negative OSCC. Our study did not show any evidence that p53 mutation could modify the effect of HPV status on outcomes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Sfoungaristos, S; Kavouras, A; Kanatas, P; Polimeros, N; Perimenis, P
2011-01-01
To compare the predictive ability of primary and secondary Gleason pattern for positive surgical margins in patients with clinically localized prostate cancer and a preoperative Gleason score ≤ 6. A retrospective analysis of the medical records of patients undergone a radical prostatectomy between January 2005 and October 2010 was conducted. Patients' age, prostate volume, preoperative PSA, biopsy Gleason score, the 1st and 2nd Gleason pattern were entered a univariate and multivariate analysis. The 1st and 2nd pattern were tested for their ability to predict positive surgical margins using receiver operating characteristic curves. Positive surgical margins were noticed in 56 cases (38.1%) out of 147 studied patients. The 2nd pattern was significantly greater in those with positive surgical margins while the 1st pattern was not significantly different between the 2 groups of patients. ROC analysis revealed that area under the curve was 0.53 (p=0.538) for the 1st pattern and 0.60 (p=0.048) for the 2nd pattern. Concerning the cases with PSA <10 ng/ml, it was also found that only the 2nd pattern had a predictive ability (p=0.050). When multiple logistic regression analysis was conducted it was found that the 2nd pattern was the only independent predictor. The second Gleason pattern was found to be of higher value than the 1st one for the prediction of positive surgical margins in patients with preoperative Gleason score ≤ 6 and this should be considered especially when a neurovascular bundle sparing radical prostatectomy is planned, in order not to harm the oncological outcome.
de Moura, C F G; Ribeiro, F A P; Handan, B A; Aguiar, O; Oshima, C T F; Ribeiro, D A
2016-07-01
The aim of this study was to investigate if grape juice concentrate is able to protect rat liver against cadmium toxicity. For this purpose, histopathological analysis, cytochrome C expression and immunoexpresssion of metalloproteinases (MMP) 2 and 9 were investigated. A total of 15 Wistar rats weighing 250 g on the average, and 8 weeks age were distributed into 3 groups (n=5), as follows: Control group (non-treated group, CTRL); Cadmium group (Cd) and grape juice concentrate group (Cd+GJ). Histopathological analysis revealed that liver from animals treated with grape juice concentrate improved tissue degeneration induced by cadmium intoxication. Animals intoxicated with cadmium and treated with grape juice concentrate showed higher cytochrome C gene expression in liver cells. No significant statistically differences (p>0.05) were found to MMP 2 and 9 immunoexpression between groups. Taken together, our results demonstrate that grape juice concentrate is able to prevent tissue degeneration in rat liver as a result of increasing apoptosis. © Georg Thieme Verlag KG Stuttgart · New York.
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K
2011-09-27
Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.
EBNA3C regulates p53 through induction of Aurora kinase B
Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.
2015-01-01
In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063
Stark, L. A.; Arends, M. J.; McLaren, K. M.; Benton, E. C.; Shahidullah, H.; Hunter, J. A.; Bird, C. C.
1994-01-01
Renal allograft recipients suffer from a markedly increased susceptibility to premalignant and malignant cutaneous lesions. Although various aetiological factors have been implicated, little is known of the associated genetic events. In this study we initially employed immunocytochemical techniques to investigate the prevalence and localisation of accumulated p53 in over 200 cutaneous biopsies (including 56 squamous cell carcinomas) from renal allograft recipients and immunocompetent controls. In renal allograft recipients accumulated p53 was present in 24% of uninvolved skin samples, 14% of viral warts, 41% of premalignant keratoses, 65% of intraepidermal carcinomas and 56% of squamous cell carcinomas [squamous cell carcinoma and intraepidermal carcinoma differed significantly from uninvolved skin (P < 0.005) and viral warts (P < 0.01)]. A similar trend was revealed in immunocompetent patients (an older, chronically sun-exposed population) but with lower prevalence of p53 immunoreactivity: 25% of uninvolved skin samples, 0% of viral warts, 25% of keratoses, 53% of intraepidermal carcinomas and 53% of squamous cell carcinomas. These differences were not statistically significant. Morphologically, p53 immunoreactivity strongly associated with areas of epidermal dysplasia and the abundance of staining correlated positively with the severity of dysplasia. These data suggest that p53 plays a role in skin carcinogenesis and is associated with progression towards the invasive state. No correlation was observed between accumulated p53 and the presence of human papillomavirus (HPV) DNA in any of the lesions. Single-strand conformational polymorphism analysis (exons 5-8) was used to determine the frequency of mutated p53 in 28 malignancies with varying degrees of immunopositivity. p53 mutations were found in 5/9 (56%) malignancies with p53 staining in > 50% of cells, reducing to 1/6 (17%) where 10-50% of cells were positively stained and none where < 10% of cells were stained. These data imply that factors other than p53 gene mutation play a part in accumulation of p53 in skin cancers. Images Figure 2 Figure 3 PMID:7917913
Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen.
O'Neill, F J; Hu, Y; Chen, T; Carney, H
1997-02-27
In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.
Michaelis, M; Rothweiler, F; Barth, S; Cinatl, J; van Rikxoort, M; Löschmann, N; Voges, Y; Breitling, R; von Deimling, A; Rödel, F; Weber, K; Fehse, B; Mack, E; Stiewe, T; Doerr, H W; Speidel, D; Cinatl, J
2011-01-01
Six p53 wild-type cancer cell lines from infrequently p53-mutated entities (neuroblastoma, rhabdomyosarcoma, and melanoma) were continuously exposed to increasing concentrations of the murine double minute 2 inhibitor nutlin-3, resulting in the emergence of nutlin-3-resistant, p53-mutated sublines displaying a multi-drug resistance phenotype. Only 2 out of 28 sublines adapted to various cytotoxic drugs harboured p53 mutations. Nutlin-3-adapted UKF-NB-3 cells (UKF-NB-3rNutlin10 μM, harbouring a G245C mutation) were also radiation resistant. Analysis of UKF-NB-3 and UKF-NB-3rNutlin10 μM cells by RNA interference experiments and lentiviral transduction of wild-type p53 into p53-mutated UKF-NB-3rNutlin10 μM cells revealed that the loss of p53 function contributes to the multi-drug resistance of UKF-NB-3rNutlin10 μM cells. Bioinformatics PANTHER pathway analysis based on microarray measurements of mRNA abundance indicated a substantial overlap in the signalling pathways differentially regulated between UKF-NB-3rNutlin10 μM and UKF-NB-3 and between UKF-NB-3 and its cisplatin-, doxorubicin-, or vincristine-resistant sublines. Repeated nutlin-3 adaptation of neuroblastoma cells resulted in sublines harbouring various p53 mutations with high frequency. A p53 wild-type single cell-derived UKF-NB-3 clone was adapted to nutlin-3 in independent experiments. Eight out of ten resulting sublines were p53-mutated harbouring six different p53 mutations. This indicates that nutlin-3 induces de novo p53 mutations not initially present in the original cell population. Therefore, nutlin-3-treated cancer patients should be carefully monitored for the emergence of p53-mutated, multi-drug-resistant cells. PMID:22170099
Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S
2007-11-07
Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wakatsuki, Masaru; Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba; Ohno, Tatsuya
2008-03-15
Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RTmore » and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.« less
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
CDIP, a novel pro-apoptotic gene, regulates TNFα-mediated apoptosis in a p53-dependent manner
Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W
2007-01-01
We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-α expression tightly correlates with CDIP expression, and that inhibition of TNF-α signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-α is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-α impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 → CDIP → TNF-α apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy. PMID:17599062
Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O
2015-07-16
p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.
Replication of damaged DNA in vitro is blocked by p53
Zhou, Jianmin; Prives, Carol
2003-01-01
The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603
Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE
2014-01-01
p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643
Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.
Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M
1995-04-15
The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic and preferential killing of p53-defective tumor cells that do not readily undergo apoptosis.
Jawallapersand, Poojah; Mashele, Samson Sitheni; Kovačič, Lidija; Stojan, Jure; Komel, Radovan; Pakala, Suresh Babu; Kraševec, Nada; Syed, Khajamohiddin
2014-01-01
Cytochrome P450 monooxygenases (CYPs/P450s) are heme-thiolate proteins whose role as a drug target against pathogenic microbes has been explored because of their stereo- and regio-specific oxidation activity. We aimed to assess the CYP53 family's role as a common alternative drug target against animal (including human) and plant pathogenic fungi and its role in fungal-mediated wood degradation. Genome-wide analysis of fungal species revealed the presence of CYP53 members in ascomycetes and basidiomycetes. Basidiomycetes had a higher number of CYP53 members in their genomes than ascomycetes. Only two CYP53 subfamilies were found in ascomycetes and six subfamilies in basidiomycetes, suggesting that during the divergence of phyla ascomycetes lost CYP53 P450s. According to phylogenetic and gene-structure analysis, enrichment of CYP53 P450s in basidiomycetes occurred due to the extensive duplication of CYP53 P450s in their genomes. Numerous amino acids (103) were found to be conserved in the ascomycetes CYP53 P450s, against only seven in basidiomycetes CYP53 P450s. 3D-modelling and active-site cavity mapping data revealed that the ascomycetes CYP53 P450s have a highly conserved protein structure whereby 78% amino acids in the active-site cavity were found to be conserved. Because of this rigid nature of ascomycetes CYP53 P450s' active site cavity, any inhibitor directed against this P450 family can serve as a common anti-fungal drug target, particularly toward pathogenic ascomycetes. The dynamic nature of basidiomycetes CYP53 P450s at a gene and protein level indicates that these P450s are destined to acquire novel functions. Functional analysis of CYP53 P450s strongly supported our hypothesis that the ascomycetes CYP53 P450s ability is limited for detoxification of toxic molecules, whereas basidiomycetes CYP53 P450s play an additional role, i.e. involvement in degradation of wood and its derived components. This study is the first report on genome-wide comparative structural (gene and protein structure-level) and evolutionary analysis of a fungal P450 family.
Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53
Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng
2016-01-01
Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502
The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.
Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun
2005-07-01
Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.
PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence
Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues
2015-01-01
Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773
PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.
Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues
2015-11-17
Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.
Pleomorphic dermal sarcoma: a more aggressive neoplasm than previously estimated.
Tardío, Juan C; Pinedo, Fernando; Aramburu, José A; Suárez-Massa, Dolores; Pampín, Ana; Requena, Luis; Santonja, Carlos
2016-02-01
Pleomorphic dermal sarcoma (PDS) is a rare neoplasm sharing pathological features with atypical fibroxanthoma, but adding tumor necrosis, invasion beyond superficial subcutis or vascular or perineural infiltration. Although its metastatic risk has been estimated to be less than 5%, its real outcome is presently uncertain because of its rarity and to the lack of homogeneous criteria used in reported cases. Retrospective clinicopathological study of 18 cases of PDS. The lesions presented as tumors or plaques (size: 7-70 mm) on the head of elderly patients (median: 81 years), without a gender predominance. Histopathologically, they consisted of spindle cells arranged in a fascicular pattern, containing pleomorphic epithelioid and giant multinucleated cells in varying proportions, and usually exhibiting numerous mitotic figures and infiltrative tumor margins. No immunoexpression for cytokeratins, S100 protein, desmin or CD34 was observed. Necrosis and venous invasion were found in three tumors each (17%). Follow-up was available in 15 cases (median: 33 months). Three patients (20%) had local recurrences, all with incomplete primary surgical resections. Three patients (20%) developed distant metastases in the skin, regional lymph nodes and/or lungs and died from the disease. Our data suggest that PDS may be a more aggressive neoplasm than previously estimated. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif
Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin
2015-01-01
Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy. PMID:26098630
A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif.
Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin
2015-01-01
Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were -0.44 Kcal/mol and -9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.
Detection of genotoxic and non-genotoxic carcinogens in Xpc{sup −/−}p53{sup +/−} mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melis, Joost P.M.; Leiden University Medical Center, Department of Toxicogenetics, Leiden; Speksnijder, Ewoud N.
2013-01-15
An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed themore » Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wan, Chunhua; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu; Ma, Xa
2014-12-15
Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleavedmore » PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly activated in Mn-exposed brain cells. • p53 translocates into mitochondria following Mn exposure. • p53 causes mitochondrial deficit via transcription-dependent and -independent actions. • PFT-α and PFT-μ ameliorate Mn-induced mitochondrial deficit and neuronal apoptosis.« less
The role of p53 in cancer drug resistance and targeted chemotherapy.
Hientz, Karin; Mohr, André; Bhakta-Guha, Dipita; Efferth, Thomas
2017-01-31
Cancer has long been a grievous disease complicated by innumerable players aggravating its cure. Many clinical studies demonstrated the prognostic relevance of the tumor suppressor protein p53 for many human tumor types. Overexpression of mutated p53 with reduced or abolished function is often connected to resistance to standard medications, including cisplatin, alkylating agents (temozolomide), anthracyclines, (doxorubicin), antimetabolites (gemcitabine), antiestrogenes (tamoxifen) and EGFR-inhibitors (cetuximab). Such mutations in the TP53 gene are often accompanied by changes in the conformation of the p53 protein. Small molecules that restore the wild-type conformation of p53 and, consequently, rebuild its proper function have been identified. These promising agents include PRIMA-1, MIRA-1, and several derivatives of the thiosemicarbazone family. In addition to mutations in p53 itself, p53 activity may be also be impaired due to alterations in p53's regulating proteins such as MDM2. MDM2 functions as primary cellular p53 inhibitor and deregulation of the MDM2/p53-balance has serious consequences. MDM2 alterations often result in its overexpression and therefore promote inhibition of p53 activity. To deal with this problem, a judicious approach is to employ MDM2 inhibitors. Several promising MDM2 inhibitors have been described such as nutlins, benzodiazepinediones or spiro-oxindoles as well as novel compound classes such as xanthone derivatives and trisubstituted aminothiophenes. Furthermore, even naturally derived inhibitor compounds such as α-mangostin, gambogic acid and siladenoserinols have been discovered. In this review, we discuss in detail such small molecules that play a pertinent role in affecting the p53-MDM2 signaling axis and analyze their potential as cancer chemotherapeutics.
Tsuji, Takemasa; Matsuzaki, Junko; Ritter, Erika; Miliotto, Anthony; Ritter, Gerd; Odunsi, Kunle; Old, Lloyd J.; Gnjatic, Sacha
2011-01-01
Analyses of NY-ESO-1-specific spontaneous immune responses in cancer patients revealed that antibody and both CD4+ and CD8+ T cell responses were induced together in cancer patients. To explore whether such integrated immune responses are also spontaneously induced for other tumor antigens, we have evaluated antibody and T cell responses against self/tumor antigen p53 in ovarian cancer patients and healthy individuals. We found that 21% (64/298) of ovarian cancer patients but no healthy donors showed specific IgG responses against wild-type p53 protein. While none of 12 patients with high titer p53 antibody showed spontaneous p53-specific CD8+ T cell responses following a single in vitro sensitization, significant p53-specific IFN-γ producing CD4+ T cells were detected in 6 patients. Surprisingly, similar levels of p53-specific CD4+ T cells but not CD8+ T cells were also detected in 5/10 seronegative cancer patients and 9/12 healthy donors. Importantly, p53-specific CD4+ T cells in healthy donors originated from a CD45RA− antigen-experienced T cell population and recognized naturally processed wild-type p53 protein. These results raise the possibility that p53-specific CD4+ T cells reflect abnormalities in p53 occurring in normal individuals and that they may play a role in processes of immunosurveillance or immunoregulation of p53-related neoplastic events. PMID:21858191
Contreras, Esteban G.; Sierralta, Jimena
2018-01-01
Background Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called ‘brain sparing’. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Results Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Conclusions Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals. PMID:29621246
Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro
2018-01-01
Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.
Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.
Garner, Elizabeth; Raj, Kenneth
2008-02-01
There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.
Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi
2004-06-01
The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Cavuslu, S; Goodlad, J; Hobbs, C; Connor, A M; Raju, K S; Best, J M; Cason, J
1997-10-01
Overexpression of p53 protein is common in cervical carcinoma. We investigated archival biopsies from 26 cervical cancer patients (24 with available lymph nodes) to determine the relationship between p53 overexpression and HPV infection at the cervix and lymph nodes. Twelve cervical carcinoma patients had p53 protein in cervical biopsies detectable by immunohistochemistry using monoclonal antibody DO-1, and 22 were positive for HPV DNA in polymerase chain reaction assays (16, contained HPV-16; 3, HPV-18; and, 3 HPV-X). Seven cervical cancer patients had one or more lymph nodes positive for p53 protein, and all but one of these were concordantly p53 positive at the cervix. However, detection of p53 protein in cervical biopsies was predictive neither of the expression of p53 at draining lymph nodes (P > 0.1) nor of the occurrence of metastases (P > 0.1). Fourteen patients were positive at one or more lymph nodes for HPV DNA. Cervical positivity for HPV DNA was associated significantly with concordant HPV positivity at the lymph nodes (P = 0.039) and was predictive of metastases (P = 0.019). There was no association between positivity for p53 and for HPV DNA at primary cervical carcinomas or at the lymph nodes (all P > 0.1). We conclude that, although detectable p53 protein is a common feature of cervical carcinomas, it is not predictive of metastases and is independent of HPV infection.
Expression of P53 protein after exposure to ionizing radiation
NASA Astrophysics Data System (ADS)
Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.
2001-10-01
One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence.
Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J
2009-06-19
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence
Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.
2009-01-01
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo. PMID:19393630
Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang
1998-01-01
Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860
CRISPR-Cas9-based target validation for p53-reactivating model compounds
Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten
2015-01-01
Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461
Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M
2012-12-01
We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Zhang, S-R; Li, D-B; Xue, J-W
2018-03-01
Given the important functions of TP53 pathway in various biological processes, this study aimed to investigate the expression of TP53 pathway-related proteins in ovarian carcinoma transplanted subcutaneously in nude mice with and without the presence of p53 inhibitor and to explore possible roles of p53 in the development of ovarian cancer. Thirty BALB/c-nu female nude mice were randomly divided into model group, control group and p53 inhibitor group (Pftα group). There were 10 rats in each group. The nude mice were subcutaneously inoculated with human ovarian cancer cell line SKOV3, and the tumor growth was observed. Morphological changes of tumor tissue were observed by hematoxylin and eosin (HE) staining. The mRNA and protein levels of TP53 pathway related factors-p53, p21 and mouse double minute 2 homolog (MDM2) were detected by RT-PCR and Western blot. p53 inhibitor can increase the growth rate of subcutaneously transplanted tumor in nude mice. p53 inhibitor could decrease the expression of p53 and p21 at both mRNA and protein levels and increase the expression of MDM2 at both mRNA and protein levels in ovarian carcinoma transplanted subcutaneously in nude mice. TP53 pathway may play pivotal roles in the development of ovarian cancer and TP53 pathway may be a new target for the treatment of ovarian cancer.
Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei
2014-01-01
The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765
Rathore, Mangal S; Jha, Bhavanath
2016-03-01
The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.
Yildirim, Müjdat; Müller von der Grün, Jens; Winkelmann, Ria; Fokas, Emmanouil; Rödel, Franz; Ackermann, Hanns; Rödel, Claus; Balermpas, Panagiotis
2017-04-01
Cervical cancer of unknown primary (CUP) represents an uncommon and heterogeneous subentity of head and neck cancer. However, both optimal diagnostics and therapy remain unclear. An improved understanding of the underlying pathology is essential to enable future tailored therapies and optimized outcomes. We retrospectively analyzed 53 patients with head and neck CUP and 48 available cervical lymph node specimens. All patients have received radiotherapy between 2007 and 2015. Preradiotherapy involved lymph node specimens were analyzed for p16 and p53 immunoreactivity. The prognostic relevance of the combined p16 and p53 status and other clinical parameters were examined by univariate and multivariate analyses. Median patient age was 61.5 years and median irradiation dose to the involved nodal levels was 66 Gy. Of the 48 evaluated specimens, 13 (27%) were p16-positive and 31 (64.6%) p53-positive. After a median follow up of 32.9 months, patients with p16-negative and simultaneously p53-positive tumors showed a significantly inferior tumor-specific survival (TSS) compared to those with either p16+/p53-, p16+/p53+, or p16-/p53- (univariate: p = 0.055, multivariate: p = 0.038). Other factors with an adverse impact on TSS in the univariate analysis were smoking history (p = 0.032) and nodal stage (p = 0.038). The combined p16- and p53-expression status in cervical metastases of CUP may represent a simple method for risk stratification. Further validation of these biomarkers in large prospective trials is essential to design rational trials for CUP treatment optimization.
Ogino, Shuji; Brahmandam, Mohan; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S
2006-01-01
Abstract Cyclooxygenase-2 (COX-2) overexpression and mutations of p53 (a known COX-2 regulator) are inversely associated with microsatellite instability—high (MSI-H) and CpG island methylator phenotype (CIMP), characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15%) tumors were CIMP-high (≥ 4 of 5 methylated promoters), 251 (33%) were CIMP-low (1 to 3 methylated promoters), and the remaining 385 (51%) were CIMP-0 (no methylated promoters). CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6%) than in COX-2+/p53- tumors (19%; P < .0001), COX-2-/p53+ tumors (17%; P= .04), and COX-2-/p53- tumors (28%; P < .0001). In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7%) than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P< .0001). In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone. PMID:16820091