Prognostic significance of CCND1 (cyclin D1) overexpression in primary resected non-small-cell lung cancer.

PubMed Central

Betticher, D. C.; Heighway, J.; Hasleton, P. S.; Altermatt, H. J.; Ryder, W. D.; Cerny, T.; Thatcher, N.

1996-01-01

Amplification of the CCDN1 gene encoding cyclin D1 was examined by Southern blotting and multiplex polymerase chain reaction (PCR) and occurred in 8 of 53 patients (15%) with primary resected non-small-cell lung cancer (NSCLC). These tumours and 17 additional tumours with a normal gene copy number showed overexpression of cyclin D1 (25/53, 47%), as assessed by immunostaining using a monoclonal antibody. In 22/25 cases, cyclin D1 was localised in the cytoplasm, but some (7/25) had simultaneous nuclear staining. This result is in marked contrast to that reported in breast, hepatocellular and colorectal carcinoma studies where immunostaining was invariably nuclear. Examination of a restriction fragment length polymorphic (RFLP) site within the 3'untranslated region of the cDNA following reverse transcriptase (RT)-PCR (29/53 informative cases) showed a strong association between cytoplasmic staining and imbalance in allele-specific message levels. Cyclin D1 overexpression was associated with a poorly differentiated histology (P = 0.04), less lymphocytic infiltration of the tumour (P = 0.02) and a reduction in local relapse rate (P = 0.01). The relative risk of local relapse was 9.1 in tumours without cyclin D1 overexpression (P = 0.01, Cox regression analysis). We conclude that genetic alteration of cyclin D1 is a key abnormality in lung carcinogenesis and may have diagnostic and prognostic importance in the treatment of resectable NSCLC. Images Figure 1 Figure 2 Figure 3 PMID:8562333

p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

PubMed Central

Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

2011-01-01

Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

Expression of p53 protein in advanced head and neck squamous cell carcinoma before and after chemotherapy.

PubMed

Dunphy, C H; Dunphy, F R; Boyd, J H; Varvares, M A; Kim, H J; Lowe, V; Dunleavy, T L; Rodriguez, J; McDonough, E M; Minster, J

1997-11-01

The expression of p53 protein has been reported to be in the range of 35% to 67% in head and neck squamous cell carcinoma (HNSCC). Mutations of the gene for p53 protein have been associated with rapidly proliferating tumors, and p53 protein expression has been shown to be a significant predictor of worse survival in surgically resected HNSCC. To determine whether p53 protein expression in advanced (stages III and IV) HNSCC has any impact on tumor response to 2 to 3 courses of paclitaxel (Taxol) and carboplatin, we prospectively studied prechemotherapy specimens from patients with previously untreated, advanced-stage HNSCC. We also attempted to study residual tumors after chemotherapy to determine if the p53 status of the tumor changed. The expression of p53 protein was evaluated by immunohistochemical analysis (clone BP53-12-1; Bio-Genex, San Ramon, Calif). Tertiary university medical center. Two to 3 courses of chemotherapy with paclitaxel and carboplatin. Pathologic complete remission or residual tumor. The results of p53 immunostaining were positive in 24 (67%) of 36 HNSCC specimens before chemotherapy. After chemotherapy, 8 patients achieved pathologic complete remission. Before chemotherapy, the tumor was p53 negative in 2 patients and positive in 6 patients. No correlation of p53 protein expression with response to chemotherapy was noted. The expression of p53 protein converted from positive to negative in 5 (42%) of 12 specimens from patients with residual tumor after chemotherapy, with no impact on clinical outcome.

Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients.

PubMed

Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; De Lena, M; Allegra, C J; Johnston, P G

2000-02-01

The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated-5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53- cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively; P < 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P < 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34-1.01; two-sided P < 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85-1.26; two-sided P < 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy.

Expression of p53, p21 and cyclin D1 in penile cancer: p53 predicts poor prognosis.

PubMed

Gunia, Sven; Kakies, Christoph; Erbersdobler, Andreas; Hakenberg, Oliver W; Koch, Stefan; May, Matthias

2012-03-01

To evaluate the role of p53, p21 and cyclin D1 expression in patients with penile cancer (PC). Paraffin-embedded tissues from PC specimens from six pathology departments were subjected to a central histopathological review performed by one pathologist. The tissue microarray technique was used for immunostaining which was evaluated by two independent pathologists and correlated with cancer-specific survival (CSS). κ-statistics were used to assess interobserver variability. Uni- and multivariable Cox proportional hazards analysis was applied to assess the independent effects of several prognostic factors on CSS over a median of 32 months (IQR 6-66 months). Specimens and clinical data from 110 men treated surgically for primary PC were collected. p53 staining was positive in 30 and negative in 62 specimens. κ-statistics showed substantial interobserver reproducibility of p53 staining evaluation (κ=0.73; p<0.001). The 5-year CSS rate for the entire study cohort was 74%. Five-year CSS was 84% in p53-negative and 51% in p53-positive PC patients (p=0.003). Multivariable analysis showed p53 (HR=3.20; p=0.041) and pT-stage (HR=4.29; p<0.001) as independent significant prognostic factors for CSS. Cyclin D1 and p21 expression were not correlated with survival. However, incorporating p21 into a multivariable Cox model did contribute to improved model quality for predicting CSS. In patients with PC, the expression of p53 in the primary tumour specimen can be reproducibly assessed and is negatively associated with cancer specific survival.

Accumulation of p53 in infectious mononucleosis tissues.

PubMed

Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

2000-11-01

Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

Clear cell odontogenic carcinoma: report of 7 new cases and systematic review of the current knowledge.

PubMed

Loyola, Adriano Mota; Cardoso, Sergio Vitorino; de Faria, Paulo Rogério; Servato, João Paulo Silva; Barbosa de Paulo, Luiz Fernando; Eisenberg, Ana Lúcia Amaral; Dias, Fernando Luiz; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago

2015-10-01

The goal of this study is to describe 7 cases of clear cell odontogenic carcinoma among a Brazilian population and compare these data with a systematic review of the English-language literature. Descriptive statististics were used to compare the clinicopathologic data gathered retrospectively with those compiled from a review. Tumor sections were immunostained for Ki-67, p16, p53, and cytokeratins (CKs) 7, 8, 14, 18, and 19. Log-rank tests were performed for survival analysis. Most cases occurred in the posterior mandible (5/7, 71.4%), and recurrence was diagnosed in all treated patients. Metastatic disease occurred in 2 patients (28.6%). Tumors were focally positive for CKs 7, 8, 14, and 18 and diffusely positive for CK19, p53, and p16. The mean number of Ki-67-positive cells was 35.2 cells/high-power field. Our systematic review provided evidence that tumor size (P = .046), histologic pattern (P = .034), regional metastasis (P = .001), distant metastasis (P = .001), and local recurrence (P = .05) were of significant prognostic value. This study has contributed to improved characterization of clear cell odontogenic carcinoma, which is an aggressive odontogenic malignant neoplasm diagnosed mainly in the posterior mandible of middle-aged women and typically at an advanced stage. Radical surgical procedures remain the gold standard treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

KRAS, BRAF genotyping reveals genetic heterogeneity of ovarian borderline tumors and associated implants

PubMed Central

2013-01-01

Background Patients diagnosed for a serous ovarian borderline tumor (s-BOT) typically present with an excellent clinical outcome. However there have been controversies concerning the prognostic impact of so-called implants, an extra ovarian spread occurring alongside the s-BOT in certain cases. It remains obscure whether these implants actually resemble metastasis owning the same genetic pattern as the ovarian primary or whether they develop independently. Methods The current study, in the aim of further clarifying the genetic origin of implants, assessed BRAF/KRAS hot spot mutations and the p53/p16INK4a immunophenotype of s-BOTs and corresponding implants (n = 49) of 15 patients by pyro-sequencing and immunostaining, respectively. Results A significant proportion of both s-BOTs and implants showed KRAS or BRAF mutation and though p16INK4a was found to be abundantly expressed, p53 immunoreactivity was rather low. When genotypes of BRAF/KRAS mutated s-BOTs and corresponding implants were compared no patient presented with a fully matching mutation profile of s-BOTs and all corresponding implants. Conclusions The current study reveals genetic heterogeneity of s-BOTs and implants, as none of the markers examined showed constant reciprocity. Hence, our findings may assist to explain the different clinical presentation of s-BOTs and implants and might encourage to applying more individualized follow up protocols. PMID:24139521

KRAS, BRAF genotyping reveals genetic heterogeneity of ovarian borderline tumors and associated implants.

PubMed

Heublein, Sabine; Grasse, Katinka; Hessel, Harald; Burges, Alexander; Lenhard, Miriam; Engel, Jutta; Kirchner, Thomas; Jeschke, Udo; Mayr, Doris

2013-10-18

Patients diagnosed for a serous ovarian borderline tumor (s-BOT) typically present with an excellent clinical outcome. However there have been controversies concerning the prognostic impact of so-called implants, an extra ovarian spread occurring alongside the s-BOT in certain cases. It remains obscure whether these implants actually resemble metastasis owning the same genetic pattern as the ovarian primary or whether they develop independently. The current study, in the aim of further clarifying the genetic origin of implants, assessed BRAF/KRAS hot spot mutations and the p53/p16INK4a immunophenotype of s-BOTs and corresponding implants (n=49) of 15 patients by pyro-sequencing and immunostaining, respectively. A significant proportion of both s-BOTs and implants showed KRAS or BRAF mutation and though p16INK4a was found to be abundantly expressed, p53 immunoreactivity was rather low. When genotypes of BRAF/KRAS mutated s-BOTs and corresponding implants were compared no patient presented with a fully matching mutation profile of s-BOTs and all corresponding implants. The current study reveals genetic heterogeneity of s-BOTs and implants, as none of the markers examined showed constant reciprocity. Hence, our findings may assist to explain the different clinical presentation of s-BOTs and implants and might encourage to applying more individualized follow up protocols.

Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

PubMed

Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

2018-03-09

The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Analysis of cell cycle-related proteins in gastric intramucosal differentiated-type cancers based on mucin phenotypes: a novel hypothesis of early gastric carcinogenesis based on mucin phenotype

PubMed Central

2010-01-01

Background Abnormalities of cell cycle regulators are common features in human cancers, and several of these factors are associated with the early development of gastric cancers. However, recent studies have shown that gastric cancer tumorigenesis was characterized by mucin expression. Thus, expression patterns of cell cycle-related proteins were investigated in the early phase of differentiated-type gastric cancers to ascertain any mechanistic relationships with mucin phenotypes. Methods Immunostaining for Cyclins D1, A, E, and p21, p27, p53 and β-catenin was used to examine impairments of the cell cycle in 190 gastric intramucosal differentiated-type cancers. Mucin phenotypes were determined by the expressions of MUC5AC, MUC6, MUC2 and CD10. A Ki-67 positive rate (PR) was also examined. Results Overexpressions of p53, cyclin D1 and cyclin A were significantly more frequent in a gastric phenotype than an intestinal phenotype. Cyclin A was overexpressed in a mixed phenotype compared with an intestinal phenotype, while p27 overexpression was more frequent in an intestinal phenotype than in a mixed phenotype. Reduction of p21 was a common feature of the gastric intramucosal differentiated-type cancers examined. Conclusions Our results suggest that the levels of some cell cycle regulators appear to be associated with mucin phenotypes of early gastric differentiated-type cancers. PMID:20525401

Abnormal expression and mutation of p53 in cervical cancer--a study at protein, RNA and DNA levels.

PubMed

Ngan, H Y; Tsao, S W; Liu, S S; Stanley, M

1997-02-01

The objectives of this study are to document the status of p53 expression and mutation in cervical cancer at protein, RNA and DNA levels and to relate this to the presence of HPV. Biopsy specimens from one hundred and three squamous cell carcinoma of the cervix and histologically normal ectocervix were analysed. Fresh tissues were extracted for protein, RNA and DNA and flash frozen tissue cryostat sectioned for immunohistochemical staining. HPV DNA status was determined by PCR using L1 consensus primers and typed for HPV 16 and 18 with E6 specific primers. p53 expression was determined at the protein level by Western blotting on protein extracts and at RNA level by Northern blotting. There was no p53 overexpression or mutation detectable in the protein extracts. Three of 65 (4.6%) of the carcinomas were positive for p53 by immunostaining with the polyclonal antibody CM1. Overexpression at the RNA level was detected in 2 of 32 (6.3%) carcinomas. p53 mutation was screened for by PCR/SSCP (single strand conformation polymorphism) followed by sequencing to define the site of mutation. Two of the cervical cancers (2.0%) showed mutation in p53 in exons 7 or 8. The mutation rate in HPV positive tumours was 1.2% (1/81) and in HPV negative tumours was 5.2% (1/19). p53 overexpression or mutation does not seem to play a significant role in cervical carcinomas.

Endometrioid adenocarcinoma of the uterus with a minimal deviation invasive pattern.

PubMed

Landry, D; Mai, K T; Senterman, M K; Perkins, D G; Yazdi, H M; Veinot, J P; Thomas, J

2003-01-01

Minimal deviation adenocarcinoma of endometrioid type is a rare pathological entity. We describe a variant of typical endometrioid adenocarcinoma associated with minimal deviation adenocarcinoma of endometrioid type. One 'pilot' case of minimal deviation adenocarcinoma of endometrioid type associated with typical endometrioid adenocarcinoma was encountered at our institution in 2001. A second case of same type was received in consultation. We reviewed 168 consecutive hysterectomy specimens diagnosed with 'endometrioid adenocarcinoma' specifically to identify areas of minimal deviation adenocarcinoma of endometrioid type. Immunohistochemistry was done with the following antibodies: MIB1, p53, oestrogen receptor (ER), progesterone receptor (PR), cytokeratin 7 (CK7), cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), and vimentin (VIM). Four additional cases of minimal deviation adenocarcinoma of endometrioid type were identified. All six cases of minimal deviation adenocarcinoma of endometrioid type were associated with superficial endometrioid adenocarcinoma. In two cases with a large amount of minimal deviation adenocarcinoma of endometrioid type, the cervix was involved. The immunoprofile of two representative cases was ER+, PR+, CK7+, CK20-, CEA-, VIM+. MIB1 immunostaining of four cases revealed little proliferative activity of the minimal deviation adenocarcinoma of endometrioid type glandular cells (0-1%) compared with the associated 'typical' endometrioid adenocarcinoma (20-30%). The same four cases showed no p53 immunostaining in minimal deviation adenocarcinoma of endometrioid type compared with a range of positive staining in the associated endometrioid adenocarcinoma. Minimal deviation adenocarcinoma of endometrioid type more often develops as a result of differentiation from typical endometrioid adenocarcinoma than de novo. Due to its deceptively benign microscopic appearance, minimal deviation adenocarcinoma of endometrioid type may be overlooked and may lead to incorrect assessment of tumour depth and pathological stage. There was a tendency for tumour with a large amount of minimal deviation adenocarcinoma of endometrioid type to invade the cervix.

Interrelationship between TP53 gene deletion, protein expression and chromosome 17 aneusomy in gastric adenocarcinoma

PubMed Central

2009-01-01

Background This study evaluates the existence of numerical alterations of chromosome 17 and TP53 gene deletion in gastric adenocarcinoma. The p53 protein expression was also evaluated, as well as, possible associations with clinicopathological characteristics. Methods Dual-color fluorescence in situ hybridization and immunostaining were performed in twenty gastric cancer samples of individuals from Northern Brazil. Results Deletion of TP53 was found in all samples. TP53 was inactivated mainly by single allelic deletion, varying to 7–39% of cells/case. Aneusomy of chromosome 17 was observed in 85% of cases. Chromosome 17 monosomy and gain were both observed in about half of cases. Cells with gain of chromosome 17 frequently presented TP53 deletion. The frequency of cells with two chr17 and one TP53 signals observed was higher in diffuse than in intestinal-type GC. Immunoreactivity of p53 was found only in intestinal-type samples. The frequency of cells with two chr17 and two TP53 signals found was higher in samples with positive p53 expression than in negative cases in intestinal-type GC. Conclusion We suggest that TP53 deletion and chromosome 17 aneusomy is a common event in GC and other TP53 alterations, as mutation, may be implicated in the distinct carcinogenesis process of diffuse and intestinal types. PMID:19619279

Infrequent Immunohistochemical Expression of Napsin A in Endometrial Carcinomas.

PubMed

Al-Maghrabi, Jaudah A; Butt, Nadeem S; Anfinan, Nisrin; Sait, Khalid; Sait, Hesham; Marzouki, Anas; Khabaz, Mohamad Nidal

2017-10-01

Many studies described napsin A as a specific diagnostic marker that aids in differentiating lung adenocarcinomas from other respiratory tumors. This study describes the expression phenotype of napsin A in endometrial neoplasms, it investigates the relationship between this expression profile and the clinicopathologic parameters, and assess its utilization as an independent predictive marker. A total of 76 cases of previously diagnosed endometrial carcinoma (including 53 endometrioid adenocarcinomas, 6 endometrioid adenocarcinomas with squamous differentiation, 9 serous adenocarcinomas, 6 clear cell adenocarcinomas, and 2 malignant mixed mullerian tumors) and 30 tissue samples of noncancerous endometrium (including 16 proliferative endometriums, 10 secretory endometriums and 4 endometrial polyps) were retrieved from the archives of Pathology Department at King Abdulaziz University, Jeddah, Saudi Arabia. For napsin A detection, tissue microarrays and immunostaining were used. A total number of 12 (15.78%) cases were positive for napsin A immunostaining. Brown granular cytoplasmic expression of napsin A was detected in 9.4% of endometrioid adenocarcinomas, 16.7% of endometrioid adenocarcinomas with squamous differentiation, 22.2% of papillary serous endometrial carcinomas, and 66.7% of clear cell carcinomas. Three (10%) control cases showed similar granular cytoplasmic expression. Positive napsin A immunostaining was more frequent in clear cell carcinoma, and there is a significant association between positive napsin A immunostaining and clear cell carcinoma (P-value=0.007). Significant associations have been found also between napsin A expression and older ages (above 60 y) and higher stage (IVB), the P-values of which were 0.035 and 0.043, respectively, but not with the tumor recurrence or survival rate. Although napsin A is infrequently expressed in endometrial carcinomas, positive results of napsin A immunostaining in endometrial neoplasms might support the diagnosis of clear cell carcinoma when the pathologic differential diagnosis includes other histologic subtypes.

Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients

PubMed Central

Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; Lena, M De; Allegra, C J; Johnston, P G

2000-01-01

The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated–5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53– cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively;P< 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P< 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34–1.01; two-sided P< 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85–1.26; two-sided P< 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy. © 2000 Cancer Research Campaign PMID:10682666

Polymorphous low grade adenocarcinoma has a consistent p63+/p40- immunophenotype that helps distinguish it from adenoid cystic carcinoma and cellular pleomorphic adenoma.

PubMed

Rooper, Lisa; Sharma, Rajni; Bishop, Justin A

2015-03-01

Polymorphous low grade adenocarcinoma (PLGA) is a tumor of minor salivary glands that exhibits considerable morphologic overlap with adenoid cystic carcinoma and cellular pleomorphic adenoma, especially in small biopsy specimens. Unlike these other tumor types. PLGAs do not harbor a myoepithelial component, yet their frequent positivity for p63 diminishes the usefulness of this particular myoepithelial marker as a discriminating immunostain. p40 is an antibody that recognizes ΔNp63, a p63 isoform that is more specific for true myoepithelial differentiation. As such, p40 immunostaining could help distinguish PLGAs from adenoid cystic carcinomas and pleomorphic adenomas. In this study, p63 and p40 immunohistochemistry was performed on paraffin embedded, formalin fixed tissue from 11 PLGAs, 101 adenoid cystic carcinomas, and 31 pleomorphic adenomas. All 11 PLGAs (100 %) were positive for p63 but completely negative for p40. Among adenoid cystic carcinomas, 91 of 101 (90 %) were positive for p63 and 90/101 (89 %) were positive for p40. The single discordant p63+/p40- adenoid cystic carcinoma exhibited solid architecture and high grade features not typically seen in PLGA. Among pleomorphic adenomas, 21/31 (68 %) were positive for p63 and 13/31 (42 %) were positive for p40. For the pleomorphic adenomas, the discordant p63+/p40- staining pattern was seen only in the overtly mesenchymal chondromyxoid stroma. The cellular epithelial component of the pleomorphic adenomas demonstrated concordant p63+/p40+ or p63-/p40- immunophenotypes. PLGA consistently exhibits a p63+/p40- immunophenotype that can help distinguish it from adenoid cystic carcinoma and cellular pleomorphic adenoma, tumors that characteristically demonstrate concordant p63 and p40 immunostaining patterns. A p63/p40 immunohistochemical panel can provide a valuable tool for making the distinction between these morphologically similar but clinically divergent entities.

Two-color immunostaining of liver fine needle aspiration biopsies with CD34 and carcinoembryonic antigen. Potential utilization in the diagnosis of primary hepatocellular carcinoma vs. metastatic tumor.

PubMed

Yoder, Michael; Zimmerman, Robert L; Bibbo, Marluce

2004-04-01

To examine immunohistochemical staining of cell block material with antibodies against vascular marker CD34 and polyclonal carcinoembryonic antigen (pCEA) for their clinical utility as part of a 2-color staining protocol in fine needle aspiration (FNA) biopsy of liver masses to distinguish metastases from primary hepatocellular carcinoma (HCC). The authors obtained cell block material from 96 liver FNAs and performed simultaneous (i.e., "dual-color") immunohistochemical staining utilizing antibodies against vascular marker CD34 and pCEA. Cases were blinded and evaluated by the authors for staining pattern and intensity. A consensus was obtained, the results were unblinded, and the diagnoses were correlated. After staining, 89 cases had sufficient tissue for evaluation. Of the 19 HCC cases, 16 (84%) showed peripheral staining with CD34, and 13 (68%) showed a canalicular or mixed canalicular-cytoplasmic staining pattern for pCEA. Thirteen cases (68%) showed staining for both antigens. All HCC exhibited immunostaining for at least 1 antibody in an appropriate staining pattern. Of the 67 cases of metastatic malignancy, 5 (7%) showed a predominantly transgressing pattern of CD34 staining, 43 (64%) showed a predominantly cytoplasmic or mixed cytoplasmic-canalicular pattern of pCEA staining, and 2 cases (3%) showed staining for both antigens in a transgressing CD34 pattern and cytoplasmic pCEA pattern. None of the 3 normal liver tissue blocks showed staining with either antigen. Two-color immunohistochemical staining of liver cell block material obtained by FNA with antibodies to CD34 and pCEA can be helpful in differentiating metastatic tumors vs. primary HCC.

A Selected Immunohistochemical Panel Aids in Differential Diagnosis and Prognostic Stratification of Subtypes of High-grade Endometrial Carcinoma: A Clinicopathologic and Immunohistochemical Study at a Single Institution.

PubMed

Taskin, Orhun Çiğ; Onder, Semen; Topuz, Samet; Sozen, Hamdullah; Sen, Fatma; Ilhan, Ridvan; Yavuz, Ekrem

This study aimed to investigate whether a selected immunohistochemical panel (estrogen receptor, p53, ARID1A, PPP2R1A, HNF-1β) could contribute to the diagnostic process of high-grade endometrial carcinomas (HG-ECs). We also aimed to analyze the correlation of these immunohistochemical results with several morphologic variables and survival data. After revising the diagnosis of 78 HG-ECs, immunohistochemical analysis was performed for each case. After immunohistochemical analysis, a specific diagnosis of prototypic HG-EC was established in most of the cases that were uncertain due to morphologic ambiguity. In the univariate analysis, older patient age, type II morphology, undifferentiated carcinoma and carcinosarcoma type of histology, altered p53 immunostaining, strong membranous staining of PPP2R1A, presence of lymphovascular invasion in serous carcinoma, and microcystic, elongated, and fragmented-type infiltration pattern in endometrioid carcinoma were significantly related to poor prognosis. In the multivariate analysis, only older patient age and carcinosarcoma or undifferentiated/dedifferentiated carcinoma type histology were found to be significantly poor prognostic factors (P=0.011), whereas advanced FIGO stage and type II histology were found to be correlated with poor prognosis, but did not reach statistical significance. We suggest that immunohistochemistry should be used in the differential diagnosis of HG-ECs, especially those with ambiguous morphology. Markers used in this study made a valuable contribution to the diagnostic process as well as prediction of prognosis.

Molecular characterization of Wilms tumor from a resource-constrained region of sub-Saharan Africa

PubMed Central

Murphy, Andrew J.; Axt, Jason R.; de Caestecker, Christian; Pierce, Janene; Correa, Hernan; Seeley, Erin H.; Caprioli, Richard M.; Newton, Mark W.; de Caestecker, Mark P.; Lovvorn, Harold N.

2012-01-01

Sub-Saharan African children have an increased incidence of Wilms tumor (WT) and experience alarmingly poor outcomes. Although these outcomes are largely due to inadequate therapy, we hypothesized that WT from this region exhibit features of biologic aggressiveness that may warrant broader implementation of high-risk therapeutic protocols. We evaluated 15 Kenyan WT (KWT) for features of aggressive disease (blastemal predominance, Ki67/cellular proliferation) and treatment resistance (anaplasia, p53 immunopositivity). To explore additional biologic features of KWT, we determined the mutational status of the CTNNB1/β-catenin and WT1 genes and performed immunostaining for markers of Wnt pathway activation (β-catenin) and nephronic progenitor cell self-renewal (WT1, CITED1, SIX2). We characterized the proteome of KWT using imaging mass spectrometry (IMS). Results were compared to histology and age-matched North American WT (NAWT) controls. For KWT patients, blastemal predominance was noted in 53.3% and anaplasia in 13%. We detected increased loss to follow up (p=0.028), disease relapse (p=0.044), mortality (p=0.001), and nuclear unrest (p=0.001) in KWT patients compared to controls. KWT and NAWT showed similar Ki67/cellular proliferation. We detected an increased proportion of epithelial nuclear β-catenin in KWT (p=0.013). All 15 KWT were found to harbor wild-type β-catenin, and 1 contained a WT1 nonsense mutation. WT1 was detected by immunostaining in 100% of KWT, CITED1 in 80%, and SIX2 in 80%. IMS revealed a molecular signature unique to KWT that was distinct from NAWT. African WTs appear to express markers of adverse clinical behavior and treatment resistance and may require alternative therapies or implementation of high-risk treatment protocols. PMID:22437966

The clinical use of a P63/cytokeratin7/18/cytokeratin5/14 antibody cocktail in diagnostic breast pathology.

PubMed

Reisenbichler, Emily S; Ross, John R; Hameed, Omar

2014-12-01

An antibody cocktail directed against p63, cytokeratin (CK)5/14, and CK7/18 is reported to be useful in distinguishing noninvasive from invasive breast lesions and for the characterization of intraductal epithelial proliferations. However, limited studies evaluate its use in clinical practice. A retrospective review of breast material at a university medical center identified cases that were immunostained with the above antibody cocktail. Additional p63 immunostaining alone was performed to further determine the utility of the antibody cocktail in the evaluation of invasion. Of 50 breast cases identified, the antibody cocktail was used to confirm or exclude invasion in 44 (88%). Twenty-two (50%) of these had easily identifiable p63/CK5/14-positive myoepithelial cells, whereas the remainder lacked such staining, confirming the diagnosis of invasive carcinoma. In 27 cases with available diagnostic material for additional p63 immunostaining, the cocktail better highlighted myoepithelial cells by staining nuclei and cytoplasm. Easier identification of invasion was also facilitated by CK7/18 expression in invasive foci, especially those composed of single cells. Ten cases were immunostained to help determine the nature of an intraductal proliferation. The cocktail demonstrated a mosaic staining pattern of both CK7/18- and CK5/14-positive epithelial cells in 3 (30%) cases consistent with usual hyperplasia; homogenous CK7/18 expression in the remaining cases supported the diagnosis of atypical ductal hyperplasia or carcinoma in situ. In summary, the p63/CK7/18/CK5/14 cocktail stain appears to be a useful tool in diagnostic breast pathology, in the evaluation of possible invasion, particularly in the setting of minute foci of invasion as well as in epithelial proliferations. Copyright © 2014 Elsevier Inc. All rights reserved.

Association between Breast Cancer Recurrence and Cellular Dissociation Assessed Using Fine-Needle Aspiration.

PubMed

Koike, Etsuko; Iwaya, Keiichi; Watanabe, Akinori; Miyake, Shinji; Sato, Eiichi; Ishikawa, Takashi

2016-01-01

To determine the associations between breast cancer recurrence and cytological findings of fine-needle aspiration cytology (FNAC). The study included 117 women who had undergone a modified radical mastectomy for invasive ductal carcinoma of the breast. FNAC samples of these patients were reexamined, and cytological findings, such as cellular dissociation, nuclear pleomorphism, nuclear atypia, chromatin pattern, and nuclear size, were scored. Uni- and multivariate analyses were performed to determine the prognostic significance of the cytological findings. Corresponding cancer tissues were immunostained for estrogen receptor, progesterone receptor, human epidermal growth factor 2 (HER2), p53, and E-cadherin to determine their associations with cytological findings. Coexpression of Arp2 and WAVE2 was also examined immunohistochemically as a cell locomotion signal. Cellular dissociation (p = 0.0259) and nuclear size (p = 0.0417) were significantly associated with cancer recurrence. Multivariate analysis showed that cellular dissociation and histological grade were significant independent predictors of cancer recurrence. Cellular dissociation was found to be associated with coexpression of Arp2 and WAVE2 (p = 0.0356) and HER2 (p = 0.0469). The cytological finding of cell dissociation was associated with the activation of Arp2 and WAVE2 signals and was an independent predictor of recurrence. © 2016 S. Karger AG, Basel.

Immunohistochemistry Study of P53 and C-erbB-2 Expression in Trophoblastic Tissue and Their Predictive Values in Diagnosing Malignant Progression of Simple Molar Pregnancy

PubMed Central

Hasanzadeh, Malihe; Sharifi, Norrie; Farazestanian, Marjaneh; Nazemian, Seyed Saman; Madani Sani, Faezeh

2016-01-01

Background Finding a tumor marker to predict the aggressive behavior of molar pregnancy in early stages has yet been a topic for studies. Objectives In this survey we planned to study patients with molar pregnancy to 1) assess the p53 and c-erbB-2 expression in trophoblastic tissue, 2) to study the relationship between their expression intensity and progression of a molar pregnancy to gestational trophoblastic neoplasia, and 3) to determine a cut off value for the amount of p53 and c-erbB-2 expression which might correlate with aggressive behavior of molar pregnancy. Patients and Methods In a prospective cross sectional study by using a high accuracy technique EnVision Tm system for immunohistochemistry staining of molar pregnancy samples, we evaluated p53 and c-erbB-2 expression in cytotrophoblast and syncytiotrophoblast and the correlation of their expression with progression of molar pregnancy to gestational trophoblastic neoplasia (GTN). Normal prostatic tissue and Breast cancer tissue were used as positive controls. Results We studied 28 patients with simple molar pregnancy (SMP) and 30 with GTN. Cytotrophobalst had significantly higher expression of p53 and c-erbB-2 and syncytiotrophoblast had greater expression of p53 in GTN group as compared to SMP group. The cut off values for percentage of p53 positive immunostained cytotrophoblast and syncytiotrophoblast were 5.5% and 2.5%. In c-erbB-2 positive membranous stained cytotrophoblast the cut off was 12.5%. Conclusions Our data suggests that over expression of p53 and c-erbB-2 is associated with malignant progression of molar pregnancy. We encountered that high expression of p53 and c-erbB-2 in trophoblastic cells could predict gestational trophoblastic neoplasia during the early stages. PMID:27703642

[Interaction between p53 and MDM2 in human lung cancer cells].

PubMed

Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

2014-01-01

The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.

Influence of apoptosis on neurological outcome following traumatic cerebral contusion.

PubMed

Nathoo, Narendra; Narotam, Pradeep K; Agrawal, Devendra K; Connolly, Catherine A; van Dellen, James R; Barnett, Gene H; Chetty, Runjan

2004-08-01

Apoptosis has increasingly been implicated in the pathobiology of traumatic brain injury (TBI). The present study was undertaken to confirm the presence of apoptosis in the periischemic zone (PIZ) of traumatic cerebral contusions and to determine the role of apoptosis, if any, in neurological outcome. Brain tissue harvested at Wentworth Hospital from the PIZ in 29 patients with traumatic supratentorial contusions was compared with brain tissue resected in patients with epilepsy. Immunohistochemical analyses were performed on the tissues to see if they contained the apoptosis-related proteins p53, bcl-2, bax, and caspase-3. The findings were then correlated to demographic, clinical, surgical, neuroimaging, and outcome data. In the PIZ significant increases of bax (18-fold; p < 0.005) and caspase-3 (20-fold; p < 0.005) were recorded, whereas bcl-2 was upregulated in only 14 patients (48.3%; 2.9-fold increase) compared with control tissue. Patients in the bcl-2-positive group exhibited improved outcomes at the 18-month follow-up examination despite an older mean age and lower mean admission Glasgow Coma Scale score (p < 0.03). Caspase-3 immunostaining was increased in those patients who died (Glasgow Outcome Scale [GOS] Score 1, 12 patients) when compared with those who experienced a good outcome (GOS Score 4 or 5, 17 patients) (p < 0.005). Regression analysis identified bcl-2-negative status (p < 0.04, odds ratio [OR] 5.5; 95% confidence interval [CI] 1.1-28.4) and caspase-3-positive status (p < 0.01, OR 1.4, 95% CI 1.1-1.8) as independent predictors of poor outcome. No immunostaining for p53 was recorded in the TBI specimens. The present findings confirm apoptosis in the PIZ of traumatic cerebral contusions and indicate that this form of cell death can influence neurological outcome following a TBI.

p16INK4a immunostaining in cytological and histological specimens from the uterine cervix: a systematic review and meta-analysis

PubMed Central

Tsoumpou, I; Arbyn, M; Kyrgiou, M; Wentzensen, N; Koliopoulos, G; Martin-Hirsch, P; Paraskevaidis, E

2009-01-01

Background P16INK4a is a biomarker for transforming HPV infections that could act as an adjunct to current cytological and histological assessment of cervical smears and biopsies, allowing the identification of those women with ambiguous results that require referral to colposcopy and potentially treatment. Material and Methods We conducted a systematic review of all studies that evaluated the use of p16INK4a in cytological or histological specimens from the uterine cervix. We also estimated the mean proportion of samples that were positive for p16INK4a in cytology and histology, stratified by the grade of the lesion. Results Sixty-one studies were included. The proportion of cervical smears overexpressing p16INK4a increased with the severity of cytological abnormality. Among normal smears, only 12% (95% CI: 7–17%) were positive for the biomarker compared to 45% of ASCUS and LSIL (95% CI: 35–54% and 37– 57% respectively) and 89% of HSIL smears (95% CI: 84–95%). Similarly, in histology only 2% of normal biopsies (95% CI: 0.4– 30%) and 38% of CIN1 (95% CI: 23– 53%) showed diffuse staining for p16INK4a compared to 68% of CIN2 (95% CI: 44– 92%) and 82% of CIN3 (95% CI: 72– 92%). Conclusion Although there is good evidence that p16INK4a immunostaining correlates with the severity of cytological/histological abnormalities, the reproducibility is limited due to insufficiently standardized interpretation of the immunostaining. Therefore, a consensus needs to be reached regarding the evaluation of p16INK4a staining and the biomarker needs to be evaluated in various clinical settings addressing specific clinical questions. PMID:19261387

Phosphorylation of Smad2/3 at specific linker threonine indicates slow-cycling intestinal stem-like cells before reentry to cell cycle.

PubMed

Kishimoto, Masanobu; Fukui, Toshiro; Suzuki, Ryo; Takahashi, Yu; Sumimoto, Kimi; Okazaki, Takashi; Sakao, Masayuki; Sakaguchi, Yutaku; Yoshida, Katsunori; Uchida, Kazushige; Nishio, Akiyoshi; Matsuzaki, Koichi; Okazaki, Kazuichi

2015-02-01

Quiescent (slow-cycling) and active (rapid-cycling) stem cells are demonstrated in small intestines. We have identified significant expression of Smad2/3, phosphorylated at specific linker threonine residues (pSmad2/3L-Thr), in murine stomach, and suggested these cells are epithelial stem cells. Here, we explore whether pSmad2/3L-Thr could serve as a biomarker for small intestine and colon stem cells. We examined small intestines and colons from C57BL/6 mice and colons with dextran sulfate sodium (DSS)-induced colitis. We performed double-immunofluorescent staining of pSmad2/3L-Thr with Ki67, cytokeratin 8, chromogranin A, CDK4, DCAMKL1, and Musashi-1. Small intestines and colons from Lgr5-EGFP knock-in mice were examined by pSmad2/3L-Thr immunofluorescent staining. To examine BrdU label retention of pSmad2/3L-Thr immunostaining-positive cells, we collected specimens after BrdU administration and observed double-immunofluorescent staining of pSmad2/3L-Thr with BrdU. In small intestines and colons, pSmad2/3L-Thr immunostaining-strongly positive cells were detected around crypt bases. Immunohistochemical co-localization of pSmad2/3L-Thr with Ki67 was not observed. pSmad2/3L-Thr immunostaining-strongly positive cells showed co-localization with cytokeratin 8, CDK4, and Musashi-1 and different localization from chromogranin A and DCAMKL1 immunostaining-positive cells. Under a light microscope, pSmad2/3L-Thr immunostaining-strongly positive cells were morphologically undifferentiated. In Lgr5-EGFP knock-in mice, some but not all pSmad2/3L-Thr immunostaining-strongly positive cells showed co-localization with Lgr5. pSmad2/3L-Thr immunostaining-strongly positive cells showed co-localization with BrdU at 5, 10, and 15 days after administration. In DSS-induced colitis, pSmad2/3L-Thr and Ki67 immunostaining-positive cells increased in the regeneration phase and decreased in the injury phase. In murine small intestines and colons, we suggest pSmad2/3L-Thr immunostaining-strongly positive cells are epithelial stem-like cells just before reentry to the cell cycle.

Immunohistochemical Expression of Ki67 and p53 in Wilms Tumor and Its Relationship with Tumor Histology and Stage at Presentation

PubMed Central

Krishna, O. H. Radhika; Kayla, Geetha; Abdul Aleem, Mohammed; Malleboyina, Ramani; Reddy Kota, Ramesh

2016-01-01

Aim. Evaluate tumor proliferation marker (Ki67) and p53 tumor suppressor marker in Wilms tumor and correlate with histology, anaplasia, and staging. Design. Prospective, hospital based study conducted at a tertiary pediatric referral centre in south India. Setting. Wilms tumor is the most common childhood renal malignancy worldwide. Anaplasia on histology is associated with treatment resistance but not with aggressiveness clinical presentation. Chemotherapy for Wilms tumor is based on histology and staging. Most patients respond to current chemotherapy protocol. However, a small fraction relapses or metastasizes. Affordable prognostic markers are needed for histopathological evaluation of this tumor. Subjects. Cases of histologically confirmed Wilms tumor over five years. Cases after chemotherapy were excluded as the immunostaining was inconsistent in necrotic areas. Methods. The clinical and radiological findings of 31 cases of Wilms tumor were documented at a tertiary pediatric referral hospital over five years. In addition to Hematoxylin and Eosin staining, Ki67 proliferation index and p53 expression were correlated with tumor histology and staging. Results. Age incidence was 3–8 years with female preponderance. Significant correlation was noted between Ki67 proliferation index and tumor staging. p53 expression was not useful in stratification of Wilms tumor. Conclusion. Ki67 was cost-effective immunohistochemical marker for prognostication of pediatric Wilms tumor. PMID:26904359

Profiling of expression of human papillomavirus-related cancer miRNAs in penile squamous cell carcinomas.

PubMed

Barzon, Luisa; Cappellesso, Rocco; Peta, Elektra; Militello, Valentina; Sinigaglia, Alessandro; Fassan, Matteo; Simonato, Francesca; Guzzardo, Vincenza; Ventura, Laura; Blandamura, Stella; Gardiman, Marina; Palù, Giorgio; Fassina, Ambrogio

2014-12-01

Penile squamous cell carcinoma (PSCC) is a rare tumor associated with high-risk human papillomavirus (HR-HPV) infection in 30% to 60% of cases. Altered expression of miRNAs has been reported in HPV-related cervical and head and neck cancers, but such data have not been available for PSCC. We analyzed a series of 59 PSCCs and 8 condylomata for presence of HPV infection, for p16(INK4a), Ki-67, and p53 immunohistochemical expression, and for expression of a panel of cellular miRNAs (let-7c, miR-23b, miR-34a, miR-145, miR-146a, miR-196a, and miR-218) involved in HPV-related cancer. HR-HPV DNA (HPV16 in most cases) was detected in 17/59 (29%) PSCCs; all penile condylomata (8/8) were positive for low-risk HPV6 or HPV11. HR-HPV(+) PSCCs overexpressed p16(INK4a) in 88% cases and p53 in 35% of cases, whereas HR-HPV(-) PSCCs were positive for p16(INK4a) and p53 immunostaining in 9% and 44% of cases, respectively. Among the miRNAs investigated, expression of miR-218 was lower in PSCCs with HR-HPV infection and in p53(-) cancers. Hypermethylation of the promoter of the SLIT2 gene, which contains miR-218-1 in its intronic region, was frequently observed in PSCCs, mainly in those with low miR-218 expression. Epigenetic silencing of miR-218 is a common feature in HR-HPV(+) PSCCs and in HR-HPV(-) PSCCs without immunohistochemical detection of p53. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Expression of matrix metalloproteinase 1, matrix metalloproteinase 2, and matrix metalloproteinase 9 in carcinoma of the head and neck.

PubMed

Franchi, Alessandro; Santucci, Marco; Masini, Emanuela; Sardi, Iacopo; Paglierani, Milena; Gallo, Oreste

2002-11-01

Numerous reports have documented a direct involvement of matrix metalloproteinase (MMP) overexpression in the development and progression of head and neck squamous cell carcinoma (HNSCC). In this study, the authors examined whether the expression of MMPs in HNSCC is correlated with other steps involved in tumor growth and metastasis, like angiogenesis, activation the nitric oxide (NO) pathway, and alteration of the p53 tumor suppressor gene. MMP-1, MMP-2, and MMP-9 expression levels were examined immunohistochemically in samples from 43 patients with HNSCC. Microvessel density (MVD) was determined by immunostaining of endothelial cells with anti-CD31 monoclonal antibody. Inducible nitric oxide synthase (iNOS) activity and cyclic guanosine monophosphatate (cGMP) levels were assessed in fresh tumor samples, whereas exons 5-9 of the p53 gene were analyzed by reverse transcriptase-polymerase chain reaction, single-strand conformation polymorphism analysis and were sequenced. MMP-1 overexpression (>10% of tumor cells) was identified in 32 tumors (74.5%), whereas elevated levels of MMP-2 and MMP-9 were detected in 17 tumors (39.5%) each. Tumors with MMP-9 overexpression were characterized by significantly higher MVD (P = 0.05) and significantly higher iNOS activity and cGMP levels (P = 0.005 and P = 0.02, respectively). Moreover, p53 mutation was associated strongly with MMP-9 overexpression (P = 0.004). Conversely, no correlation was found between MMP-1 and MMP-2 expression, angiogenesis, iNOS activity, cGMP levels, and p53 mutation in this series. This study documents the existence of a correlation between MMP-9 expression, activity of the iNOS pathway, p53 status, and angiogenesis in patients with HNSCC. This raises the possibility that p53 mutation, which frequently is present in HNSCC, may result in increased angiogenesis and invasiveness related to increased nitric oxide and MMP production by tumor cells, ultimately contributing to tumor progression. Copyright 2002 American Cancer Society.

The specific linker phosphorylation of Smad2/3 indicates epithelial stem cells in stomach; particularly increasing in mucosae of Helicobacter-associated gastritis.

PubMed

Fukui, Toshiro; Kishimoto, Masanobu; Nakajima, Atsushi; Yamashina, Masao; Nakayama, Shinji; Kusuda, Takeo; Sakaguchi, Yutaku; Yoshida, Katsunori; Uchida, Kazushige; Nishio, Akiyoshi; Matsuzaki, Koichi; Okazaki, Kazuichi

2011-04-01

The gastric corpus and antrum are believed to contain epithelial stem cells in the isthmus. However, the lack of useful markers has hindered studies of their origin. We explored whether Smad2/3, phosphorylated at specific linker threonine residues (pSmad2/3L-Thr), could serve as a marker for stem cells. Stomachs, small intestines, and colons from Helicobacter felis-infected and noninfected C57BL/6 mice were examined. Double immunofluorescent staining of pSmad2/3L-Thr with Ki67, cytokeratin 8, or doublecortin and calcium/calmodulin-dependent protein kinase-like-1 (DCAMKL1) was performed, and pSmad2/3L-Thr immunostaining-positive cells were counted. After immunofluorescent staining, we stained the same sections with hematoxylin-eosin and observed these cells under a light microscope. In infected mice, pSmad2/3L-Thr immunostaining-positive cells were significantly increased in the corpus and antrum compared with those of noninfected mice (p < 0.0001). The number of Ki67 immunostaining-positive cells in the corpus and antrum of infected mice was also much greater than in the noninfected mice. Although pSmad2/3L-Thr immunostaining-positive cells were detected among the Ki67 cells, immunohistochemical co-localization of pSmad2/3L-Thr with Ki67 was never observed. pSmad2/3L-Thr immunostaining-positive cells showed immunohistochemical co-localization with cytokeratin 8, but some of them showed co-localization or adjacent localization with DCAMKL1 immunostaining-positive cells. Under a light microscope, pSmad2/3L-Thr immunostaining-positive cells indicated undifferentiated morphological features and were confirmed in the isthmus. In small intestines and colons, pSmad2/3L-Thr immunostaining-positive cells were detected in specific epithelial cells around crypt bases, where the respective putative stem cells are thought to exist. We have identified the significant expression of pSmad2/3L-Thr in specific epithelial cells of the murine stomach and have suggested these cells to be epithelial stem cells.

[Aromatase activities of endometrial carcinomas and both basic and clinical analyses of endometrial hyperplasia as a premalignant disease].

PubMed

Sasaki, H

1993-08-01

Paraffin-embedded materials obtained from 117 cases of endometrial hyperplasia and 84 cases of carcinoma were used for measurement of both ki-ras and p53 gene mutation and aromatase (ARO) and TGF-alpha immunostaining. The overall incidence of ki-ras mutations in the hyperplasia specimens (16%) was similar to the incidence detected in carcinomas (18%). None of 117 endometrial hyperplasias were found to have mutations in the p53 gene, whereas mutations were seen in 3 (13.3%) endometrial carcinomas. The intensity of both ARO and TGF-alpha immunostaining was increased in glands of both hyperplasia and carcinoma, and also in the interstitium of carcinoma. The positive sites of both ARO and TGF-alpha were almost the same, with an incidence below 40% in both hyperplasias and carcinomas. The cultured cells of endometrial carcinoma showed aromatase activity below MCF-7 cells, because testosterone was converted to estradiol (E2). TGF-alpha induced cell growth with at an optimal concentration. In HEC-59 cells, TGF-alpha increased both ARO-activity and mRNA. Some promoters on ARO-exon 1 in HEC-59 cells were different from those in BeWo cells. Progesterone inhibited the E2-induced excretion of pre TGF-alpha in endometrial carcinoma cells. These findings suggest that endometrial hyperplasia can be a premalignant condition of carcinoma, and can be initiated by both ki-ras codon 12 mutation and abnormal activity of ARO induced by TGF-alpha. In addition, HEC-59 cells may possess autocrine/paracrine properties involving ARO, E2 and TGF-alpha.

Agmatine induces gastric protection against ischemic injury by reducing vascular permeability in rats

PubMed Central

Masri, Abeer A Al; Eter, Eman El

2012-01-01

AIM: To investigate the effect of administration of agmatine (AGM) on gastric protection against ischemia reperfusion (I/R) injury. METHODS: Three groups of rats (6/group); sham, gastric I/R injury, and gastric I/R + AGM (100 mg/kg, i.p. given 15 min prior to gastric ischemia) were recruited. Gastric injury was conducted by ligating celiac artery for 30 min and reperfusion for another 30 min. Gastric tissues were histologically studied and immunostained with angiopoietin 1 (Ang-1) and Ang-2. Vascular endothelial growth factor (VEGF) and monocyte chemoattractant protein-1 (MCP-1) were measured in gastric tissue homogenate. To assess whether AKt/phosphatidyl inositol-3-kinase (PI3K) mediated the effect of AGM, an additional group was pretreated with Wortmannin (WM) (inhibitor of Akt/PI3K, 15 μg/kg, i.p.), prior to ischemic injury and AGM treatment, and examined histologically and immunostained. Another set of experiments was run to study vascular permeability of the stomach using Evan’s blue dye. RESULTS: AGM markedly reduced Evan’s blue dye extravasation (3.58 ± 0.975 μg/stomach vs 1.175 ± 0.374 μg/stomach, P < 0.05), VEGF (36.87 ± 2.71 pg/100 mg protein vs 48.4 ± 6.53 pg/100 mg protein, P < 0.05) and MCP-1 tissue level (29.5 ± 7 pg/100 mg protein vs 41.17 ± 10.4 pg/100 mg protein, P < 0.01). It preserved gastric histology and reduced congestion. Ang-1 and Ang-2 immunostaining were reduced in stomach sections of AGM-treated animals. The administration of WM abolished the protective effects of AGM and extensive hemorrhage and ulcerations were seen. CONCLUSION: AGM protects the stomach against I/R injury by reducing vascular permeability and inflammation. This protection is possibly mediated by Akt/PI3K. PMID:22611311

A mutation spectrum that includes GNAS, KRAS and TP53 may be shared by mucinous neoplasms of the appendix.

PubMed

Hara, Kieko; Saito, Tsuyoshi; Hayashi, Takuo; Yimit, Alkam; Takahashi, Michiko; Mitani, Keiko; Takahashi, Makoto; Yao, Takashi

2015-09-01

Appendiceal mucinous tumors (AMTs) are classified as low-grade appendiceal mucinous neoplasms (LAMNs) or mucinous adenocarcinomas (MACs), although their carcinogenesis is not well understood. As somatic activating mutations of GNAS are considered to be characteristic of LAMNs while TP53 mutations have been shown to be specific to MACs, MACs are unlikely to result from transformation of LAMNs. However, emerging evidence also shows the presence of GNAS mutations in MACs. We examined 16 AMTs (11 LAMNs and 5 MACs) for genetic alterations of GNAS, KRAS, BRAF, TP53, CTNNB1, and TERT promoter in order to elucidate the possibility of a shared genetic background in the two tumor types. Extensive histological examination revealed the presence of a low-grade component in all cases of MAC. GNAS mutations were detected in two LAMNs and in one MAC, although the GNAS mutation in this MAC was a nonsense mutation (Q227X) expected not to be activating mutation. TP53 mutations were detected in three LAMNs; they were frequently detected in MACs. KRAS mutations were detected in three LAMNs and three MACs, and CTNNB1 mutations were detected in two LAMNs. KRAS mutation and activating mutation of GNAS occurred exclusively in AMTs. BRAF and TERT mutations were not detected. Overexpression of p53 was observed in only two MACs, and p53 immunostaining clearly discriminated the high-grade lesion from a low-grade component in one. These findings suggest that p53 overexpression plays an important role in the carcinogenesis of AMTs and that, in addition to mutations of GNAS, KRAS and TP53 alterations might be shared by AMTs, thus providing evidence for the possible progression of LAMNs to MAC. Copyright © 2015 Elsevier GmbH. All rights reserved.

Two different immunostaining patterns of beta-amyloid precursor protein (APP) may distinguish traumatic from nontraumatic axonal injury.

PubMed

Hayashi, Takahito; Ago, Kazutoshi; Nakamae, Takuma; Higo, Eri; Ogata, Mamoru

2015-09-01

Immunostaining for beta-amyloid precursor protein (APP) is recognized as an effective tool for detecting traumatic axonal injury, but it also detects axonal injury due to ischemic or other metabolic causes. Previously, we reported two different patterns of APP staining: labeled axons oriented along with white matter bundles (pattern 1) and labeled axons scattered irregularly (pattern 2) (Hayashi et al. (Leg Med (Tokyo) 11:S171-173, 2009). In this study, we investigated whether these two patterns are consistent with patterns of trauma and hypoxic brain damage, respectively. Sections of the corpus callosum from 44 cases of blunt head injury and equivalent control tissue were immunostained for APP. APP was detected in injured axons such as axonal bulbs and varicose axons in 24 of the 44 cases of head injuries that also survived for three or more hours after injury. In 21 of the 24 APP-positive cases, pattern 1 alone was observed in 14 cases, pattern 2 alone was not observed in any cases, and both patterns 1 and 2 were detected in 7 cases. APP-labeled injured axons were detected in 3 of the 44 control cases, all of which were pattern 2. These results suggest that pattern 1 indicates traumatic axonal injury, while pattern 2 results from hypoxic insult. These patterns may be useful to differentiate between traumatic and nontraumatic axonal injuries.

Prognostic significance of biomarkers (c-erbB-2, p53, proliferating cell nuclear antigen, and DNA content) in salivary duct carcinoma.

PubMed

Felix, A; El-Naggar, A K; Press, M F; Ordonez, N G; Fonseca, I; Tucker, S L; Luna, M A; Batsakis, J G

1996-06-01

Salivary duct carcinoma (SDC), a rare neoplasm of the major salivary glands, is a high-grade carcinoma with a predilection for elderly men. The authors investigated the prognostic role of p53, c-erbB2, proliferating cell nuclear antigen (PCNA), and DNA flow cytometry in a pathobiological evaluation of a cohort of 30 patients with these neoplasms. The patient group comprised 24 men and 6 women, with ages ranging from 22 to 87 years (mean = 61 years). Twenty-eight tumors were located in the parotid gland and two in the submandibular gland. Tumor size ranged from 1.0 to 8.0 cm (mean = 3.48 cm). Regional metastases were found in 73.3% (22 patients), systemic metastases in 43.3% (13 patients), and recurrences in 8 (26.6%) patients. DNA aneuploidy was found in 18 tumors (58.0%) and DNA diploidy in 12 (42%), with proliferative fractions ranging from 8.60% to 15.5 (mean = 10.6%). p53 protein nuclear immunostaining was positive in 56.6% and c-erbB2 overexpression was observed in 63% of the tumors. PCNA positivity ranged from 16.5% to 91.0%, with a mean of 49.5%. p53 immunopositivity, DNA aneuploidy, high growth, and proliferative fractions by PCNA and flow cytometry did not correlate with patient outcome. These results indicate that tumor size (P = .05), distant metastasis (P = .006), and C-erbB2 amplification (P = .04) are independent prognostic parameters in patients with salivary duct carcinoma.

Concordant p53 and mdm-2 protein expression in vulvar squamous cell carcinoma and adjacent lichen sclerosus.

PubMed

Carlson, J A; Amin, S; Malfetano, J; Tien, A T; Selkin, B; Hou, J; Goncharuk, V; Wilson, V L; Rohwedder, A; Ambros, R; Ross, J S

2001-06-01

To determine if carcinogenic events in vulvar skin precede the onset of morphologic atypia, the authors investigated for derangements in DNA content, cell proliferation, and cell death in vulvar carcinomas and surrounding skin in 140 samples of tumor and surrounding skin collected from 35 consecutive vulvectomy specimen for squamous cell carcinoma (SCC) or vulvar intraepithelial neoplasia (VIN) 3. Vulvar non-cancer excisions were used as controls. Investigations consisted of histologic classification and measurement of 9 variables--epidermal thickness (acanthosis and rete ridge length), immunolabeling index (LI) for 3 proteins (p53 protein, Ki-67, and mdm-2), pattern of p53 expression (dispersed vs. compact), DNA content index, and presence of aneuploidy by image analysis and apoptotic rate by Apotag labeling. Significant positive correlations were found for all nine variables studied versus increasing histologic severity in two proposed histologic stepwise models of vulvar carcinogenesis (lichen sclerosus (LS) and VIN 3 undifferentiated associated SCC groups). High p53 LI (>25) and the compact pattern of p53 expression (suspected oncoprotein) significantly correlated with LS and its associated vulvar samples compared with samples not associated with LS (P < or = 0.001). Furthermore, p53 LI, mdm-2 LI, and pattern of p53 expression were concordant between patient matched samples of LS and SCC. In addition, mdm-2 LI significantly correlated with dispersed pattern p53 LI suggesting a response to wild-type p53 protein accumulation. These findings support the hypothesis that neoplastic transformation occurs in sequential steps and compromises proteins involved in the cell cycle control. Concordance of p53 and mdm-2 protein expression in LS and adjacent SCC provides evidence that LS can act as a precursor lesion in the absence of morphologic atypia. Overexpression of mdm-2 with stabilization and inactivation of p53 protein may provide an alternate pathway for vulvar carcinogenesis.

Pattern of Expression of p53, Its Family Members, and Regulators during Early Ocular Development and in the Post-Mitotic Retina

PubMed Central

Vuong, Linda; Brobst, Daniel E.; Saadi, Anisse; Ivanovic, Ivana; Al-Ubaidi, Muayyad R.

2012-01-01

Purpose. Because of its role in cell cycle regulation and apoptosis, p53 may be involved in maintaining the post-mitotic state of the adult eye. To shed light on the role of p53 in retinal development and maintenance, this study investigated the pattern of expression of p53, its family members, and its regulators during the development of the mouse eye. Methods. Relative quantitative real-time PCR (qRT-PCR) was used to determine the steady-state levels of target transcripts in RNA extracted from wild-type mouse whole eyes or retinas between embryonic day (E) 15 and post-natal day (P) 30. Immunoblotting was used to compare the steady-state levels of the protein to that of the transcript. Results. Transcript and protein levels for p53 in the eye were highest at E17 and E18, respectively. However, both p53 transcript and protein levels dropped precipitously thereafter, and no protein was detected on immunoblots after P3. Expression patterns of p63, p73, Mdm2, Mdm4, and Yy1 did not follow that of p53. Immunohistochemistry analysis of the developing eye showed that both p53 and Mdm2 are abundantly expressed at E18 in all layers of the retinal neuroblast. Conclusions. Downregulation of p53 in the post-mitotic retina suggests that, although p53 may be involved in ocular and retinal development, it may play a minimal role in healthy adult retinal function. PMID:22714890

Immunohistochemical evidence for an endocrine/paracrine role for ghrelin in the reproductive tissues of sheep

PubMed Central

Miller, David W; Harrison, Joanne L; Brown, Yvonne A; Doyle, Una; Lindsay, Alanna; Adam, Clare L; Lea, Richard G

2005-01-01

Background The gut hormone, ghrelin, is involved in the neuroendocrine and metabolic responses to hunger. In monogastric species, circulating ghrelin levels show clear meal-related and body weight-related changes. The pattern of secretion and its role in ruminant species is less clear. Ghrelin acts via growth hormone secretagogue receptors (GHSR-1a) to alter food intake, fat utilization, and cellular proliferation. There is also evidence that ghrelin is involved in reproductive function. In the present study we used immunohistochemistry to investigate the presence of ghrelin and GHSR-1a in sheep reproductive tissues. In addition, we examined whether ghrelin and GHSR-1a protein expression is developmentally regulated in the adult and fetal ovine testis, and whether there is an association with markers of cellular proliferation, i.e. stem cell factor (SCF) and proliferating cell nuclear antigen (PCNA). Methods Antibodies raised against ghrelin and its functional receptor, GHSR-type 1a, were used in standard immunohistochemical protocols on various reproductive tissues collected from adult and fetal sheep. GHSR-1a mRNA presence was also confirmed by in situ hybridisation. SCF and PCNA immunoexpression was investigated in fetal testicular samples. Adult and fetal testicular immunostaining for ghrelin, GHSR-1a, SCF and PCNA was analysed using computer-aided image analysis. Image analysis data were subjected to one-way ANOVA, with differences in immunostaining between time-points determined by Fisher's least significant difference. Results In adult sheep tissue, ghrelin and GHSR-1a immunostaining was detected in the stomach (abomasum), anterior pituitary gland, testis, ovary, and hypothalamic and hindbrain regions of the brain. In the adult testis, there was a significant effect of season (photoperiod) on the level of immunostaining for ghrelin (p < 0.01) and GHSR-1a (p < 0.05). In the fetal sheep testis, there was a significant effect of gestational age on the level of immunostaining for ghrelin (p < 0.001), GHSR-1a (p < 0.05), SCF (p < 0.05) and PCNA (p < 0.01). Conclusion Evidence is presented for the presence of ghrelin and its receptor in various reproductive tissues of the adult and fetal sheep. In addition, the data indicate that testicular expression of ghrelin and its receptor is physiologically regulated in the adult and developmentally regulated in the fetus. Therefore, the ghrelin ligand/receptor system may have a role (endocrine and/or paracrine) in the development (cellular proliferation) and function of the reproductive axis of the sheep. PMID:16259638

Phosphorylation of Smad2/3 at the specific linker threonine residue indicates slow-cycling esophageal stem-like cells before re-entry to the cell cycle.

PubMed

Takahashi, Y; Fukui, T; Kishimoto, M; Suzuki, R; Mitsuyama, T; Sumimoto, K; Okazaki, T; Sakao, M; Sakaguchi, Y; Yoshida, K; Uchida, K; Nishio, A; Matsuzaki, K; Okazaki, K

2016-01-01

The stem cell compartment in the esophageal epithelium is possibly located in the basal layer. We have identified significant expression of Smad2/3, phosphorylated at specific linker threonine residues (pSmad2/3L-Thr), in the epithelial cells of murine stomach and intestine, and have suggested that these cells are epithelial stem cells. In this study, we explore whether pSmad2/3L-Thr could serve as a biomarker for esophageal stem cells. We examined esophageal tissues from normal C57BL/6 mice and those with esophagitis. Double immunofluorescent staining of pSmad2/3L-Thr with Ki67, CDK4, p63, or CK14 was performed. After immunofluorescent staining, we stained the same sections with hematoxylin-eosin and observed these cells under a light microscope. We used the 5-bromo-2-deoxyuridine (BrdU) labeling assay to examine label retention of pSmad2/3L-Thr immunostaining-positive cells. We collected specimens 5, 10, 15 and 20 days after repeated BrdU administrations and observed double immunofluorescent staining of pSmad2/3L-Thr with BrdU. In the esophagus, pSmad2/3L-Thr immunostaining-positive cells were detected in the basal layer. These cells were detected between Ki67 immunostaining-positive cells, but they were not co-localized with Ki67. pSmad2/3L-Thr immunostaining-positive cells showed co-localization with CDK4, p63, and CK14. Under a light microscope, pSmad2/3L-Thr immunostaining-positive cells indicated undifferentiated morphological features. Until 20 days follow-up period, pSmad2/3L-Thr immunostaining-positive cells were co-localized with BrdU. pSmad2/3L-Thr immunostaining-positive cells significantly increased in the regeneration phase of esophagitis mucosae, as compared with control mice (esophagitis vs. 6.889 ± 0.676/cm vs. 4.293 ± 0.659/cm; P < 0.001). We have identified significant expression of pSmad2/3L-Thr in the specific epithelial cells of murine esophagi. We suggest that these cells are slow-cycling epithelial stem-like cells before re-entry to the cell cycle. © 2016 International Society for Diseases of the Esophagus.

Phagocytosis (cannibalism) of apoptotic neutrophils by tumor cells in gastric micropapillary carcinomas.

PubMed

Barresi, Valeria; Branca, Giovanni; Ieni, Antonio; Rigoli, Luciana; Tuccari, Giovanni; Caruso, Rosario Alberto

2015-05-14

To identify those with a micropapillary pattern, ascertain relative frequency and document clinicopathological characteristics by reviewing gastric carcinomas. One hundred and fifty-one patients diagnosed with gastric cancer who underwent gastrectomy were retrospectively studied and the presence of a regional invasive micropapillary component was evaluated by light microscopy. All available hematoxylin-eosin (HE)-stained slides were histologically reviewed and 5 tumors were selected as putative micropapillary carcinoma when cancer cell clusters without a vascular core within empty lymphatic-like space comprised at least 5% of the tumor. Tumor tissues from these 5 invasive gastric carcinomas were immunostained using an anti-mucin 1 (MUC1) antibody (clone MA695) to detect the characteristic inside-out pattern and with D2-40 antibody to determine the presence of intratumoral lymph vessels. Detection of intraepithelial neutrophil apoptosis was evaluated in consecutive histological tissue sections by three independent methods, namely light microscopy with HE staining, the conventional terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end-labeling (TUNEL) method and immunohistochemistry for activated caspase-3 (clone C92-605). Among 151 gastric cancers resected for cure, 5 (3.3%) were adenocarcinomas with a micropapillary component. Four of the patients died of disease from 6 to 23 mo and one patient was alive with metastases at 9 mo. All patients had advanced-stage cancer (≥ pT2) and lymph node metastasis. Positive MUC1 immunostaining on the stroma-facing surface (inside-out pattern) of the carcinomatous cluster cells, together with negative immunostaining for D2-40 in the cells limiting lymphatic-like spaces, confirmed the true micropapillary pattern in these gastric neoplasms. In all five cases, several micropapillae were infiltrated by neutrophils. HE staining, TUNEL assay and immunostaining for caspase-3 demonstrated apoptotic neutrophils within cytoplasmic vacuoles of tumor cells. These data suggest phagocytosis (cannibalism) of apoptotic neutrophils by micropapillary tumor cells. Tumor cell cannibalism is usually found in aggressive tumors with anaplastic morphology. Our data extend these observations to gastric micropapillary carcinoma: a tumor histotype analogously characterized by aggressive behavior and poor prognosis. The results are of interest because they raise the intriguing possibility that neutrophil cannibalism by tumor cells may be one of the mechanisms favoring tumor growth in gastric micropapillary carcinomas. This is the first study showing phagocytosis (cannibalism) of apoptotic neutrophils by tumor cells in gastric micropapillary carcinomas.

Proposed Terminology for Anal Squamous Lesions: Its Application and Interobserver Agreement Among Pathologists in Academic and Community Hospitals.

PubMed

Roma, Andres A; Liu, Xiuli; Patil, Deepa T; Xie, Hao; Allende, Daniela

2017-07-01

To analyze interobserver reproducibility and compare practice patterns between academic and community settings of Lower Anogenital Squamous Terminology (LAST). In total, 132 anal biopsy slides were revised as well as p16 immunostains. LAST was used in 49% of cases (academic center, 68%; satellite hospitals [community practice setting], 32%). After pathology review and consensus interpretation, 23 (17%) case diagnoses were reclassified: eight (34.8%) cases (benign or low-grade squamous intraepithelial lesion [LSIL]) were upgraded to high-grade squamous intraepithelial lesion (HSIL) (p16 confirmed ordered during review); four (17.4%) cases originally classified as HSIL were downgraded to LSIL (p16 originally ordered in one case). There was no significant difference in discrepancies between original and consensus diagnosis in the community vs academic setting or by subspecialty (gynecological vs gastrointestinal). Overall interobserver agreement among reviewers was substantial (κ = 0.63) and improved with the use of p16 immunostain in challenging cases (κ = 0.71; P < .001). This new terminology is not yet uniformly used by pathologists in anal/perianal biopsy specimens; this two-tier system has a good interobserver agreement and is further improved with p16 use in appropriate cases. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Molecular Classification of Grade 3 Endometrioid Endometrial Cancers Identifies Distinct Prognostic Subgroups.

PubMed

Bosse, Tjalling; Nout, Remi A; McAlpine, Jessica N; McConechy, Melissa K; Britton, Heidi; Hussein, Yaser R; Gonzalez, Carlene; Ganesan, Raji; Steele, Jane C; Harrison, Beth T; Oliva, Esther; Vidal, August; Matias-Guiu, Xavier; Abu-Rustum, Nadeem R; Levine, Douglas A; Gilks, C Blake; Soslow, Robert A

2018-05-01

Our aim was to investigate whether molecular classification can be used to refine prognosis in grade 3 endometrial endometrioid carcinomas (EECs). Grade 3 EECs were classified into 4 subgroups: p53 abnormal, based on mutant-like immunostaining (p53abn); MMR deficient, based on loss of mismatch repair protein expression (MMRd); presence of POLE exonuclease domain hotspot mutation (POLE); no specific molecular profile (NSMP), in which none of these aberrations were present. Overall survival (OS) and recurrence-free survival (RFS) rates were compared using the Kaplan-Meier method (Log-rank test) and univariable and multivariable Cox proportional hazard models. In total, 381 patients were included. The median age was 66 years (range, 33 to 96 y). Federation Internationale de Gynecologie et d'Obstetrique stages (2009) were as follows: IA, 171 (44.9%); IB, 120 (31.5%); II, 24 (6.3%); III, 50 (13.1%); IV, 11 (2.9%). There were 49 (12.9%) POLE, 79 (20.7%) p53abn, 115 (30.2%) NSMP, and 138 (36.2%) MMRd tumors. Median follow-up of patients was 6.1 years (range, 0.2 to 17.0 y). Compared to patients with NSMP, patients with POLE mutant grade 3 EEC (OS: hazard ratio [HR], 0.36 [95% confidence interval, 0.18-0.70]; P=0.003; RFS: HR, 0.17 [0.05-0.54]; P=0.003) had a significantly better prognosis; patients with p53abn tumors had a significantly worse RFS (HR, 1.73 [1.09-2.74]; P=0.021); patients with MMRd tumors showed a trend toward better RFS. Estimated 5-year OS rates were as follows: POLE 89%, MMRd 75%, NSMP 69%, p53abn 55% (Log rank P=0.001). Five-year RFS rates were as follows: POLE 96%, MMRd 77%, NSMP 64%, p53abn 47% (P=0.000001), respectively. In a multivariable Cox model that included age and Federation Internationale de Gynecologie et d'Obstetrique stage, POLE and MMRd status remained independent prognostic factors for better RFS; p53 status was an independent prognostic factor for worse RFS. Molecular classification of grade 3 EECs reveals that these tumors are a mixture of molecular subtypes of endometrial carcinoma, rather than a homogeneous group. The addition of molecular markers identifies prognostic subgroups, with potential therapeutic implications.

Immunohistochemical study of Ki67, CD34 and p53 expression in human tooth buds.

PubMed

Muica Nagy-Bota, Monica Cristina; Pap, Zsuzsanna; Denes, Lóránd; Ghizdavăţ, Alexandru; Brînzaniuc, Klara; Lup Coşarcă, Adina Simona; Chibelean Cireş-Mărginean, Manuela; Păcurar, Mariana; Pávai, Zoltán

2014-01-01

Establishment of Ki67, p53 and CD34 expression in human tooth buds of different stages of odontogenetic development. Tissue samples containing tooth buds were removed from the incisor areas of human fetuses in different stages of development (weeks 9-10, 12-13, 13-16, 21-24), and from the canine and molar areas of 21-24 weeks fetuses. The tissue fragments were fixed using formalin and were processed using common histological techniques with paraffin embedding. Immunostaining for Ki67, p53 and CD34 has been performed using the dextran method and moist heat antigen retrieval (except for CD34). The resulting slides were photographed and quantitatively evaluated. Ki67 immunoexpression decreases with advancement of the developmental stage of the tooth bud: in the inner enamel epithelium, between weeks 9 and 16 (IEE), in the preameloblasts (PB) between weeks 13 and 16, in the ameloblasts (AB) between weeks 21 and 24; outer enamel epithelium (OEE); stratum intermedium (SI); in the dental papilla: between weeks 9 and 10 in the dental papilla (DP), between weeks 13 and 16 in the outer layer of the dental papilla (DP1) and in the central layer of the dental papilla (DP2). Likewise, we noted Ki67 expression in the odontoblast layer (O) and pulp (P), between weeks 21 and 24. Concerning CD34 expression, we observed a decrease from weeks 9-10 until weeks 13-16, followed by an increase until weeks 21-24 of intrauterine life. From weeks 9-10, we observed a constant decrease of expression until weeks 13-16, followed by an increase during weeks 21-24. All Ki67, p53 and CD34 have been identified in the tooth bud. Ki67 expression gradually decreases with the embryonic development of the tooth, while p53 and CD34 expression decreases from weeks 9-10 to weeks 13-16 of intrauterine life, followed by an increase until weeks 21-24.

The immunohistochemical detection of involucrin in denture induced fibrous inflammatory hyperplasia of oral mucous membrane.

PubMed

Thomas, G A

1991-01-01

Involucrin is a major structural protein specific to the cross-linked cell envelope found in the stratum corneum of stratified squamous epithelium. This protein is considered to be an excellent immunohistochemical marker of normal squamous differentiation. Detection of variations to the patterns of immunostaining for involucrin may also be of value in the differential diagnosis between benign and malignant lesions. Previous studies of involucrin expression in oral mucosa have failed to clarify the effect of chronic inflammatory change upon the patterns of immunoreactivity. This study investigated involucrin staining patterns in fibrous inflammatory hyperplasia of oral mucous membrane (FIH). The results suggest that in FIH an altered pattern of involucrin immunostain occurs in areas of severe inflammatory change. This may reflect changes to the pattern of squamous differentiation in this tissue.

Phase II trial of cetuximab, gemcitabine, and oxaliplatin followed by chemoradiation with cetuximab for locally advanced (T4) pancreatic adenocarcinoma: correlation of Smad4(Dpc4) immunostaining with pattern of disease progression.

PubMed

Crane, Christopher H; Varadhachary, Gauri R; Yordy, John S; Staerkel, Gregg A; Javle, Milind M; Safran, Howard; Haque, Waqar; Hobbs, Bridgett D; Krishnan, Sunil; Fleming, Jason B; Das, Prajnan; Lee, Jeffrey E; Abbruzzese, James L; Wolff, Robert A

2011-08-01

This phase II trial was designed to assess the efficacy and safety of cetuximab, gemcitabine, and oxaliplatin followed by cetuximab, capecitabine, and radiation therapy in locally advanced pancreatic cancer (LAPC). Treatment-naive eligible patients (n = 69) received intravenous gemcitabine (1,000 mg/m(2)) and oxaliplatin (100 mg/m(2)) every 2 weeks for four doses, followed by radiation (50.4 Gy to the gross tumor only) with concurrent capecitabine (825 mg/m(2) twice daily on radiation treatment days). Cetuximab (500 mg/m(2)) was started on day 1 of chemotherapy and was continued every 2 weeks during chemotherapy and chemoradiotherapy. Diagnostic cytology specimens were immunostained for Smad4(Dpc4) expression. Median overall survival time was 19.2 months (95% CI, 14.2 to 24.2 months), and 1-year, 2-year, and 4-year actuarial overall survival rates were 66.0%, 25.02%, and 11.3%, respectively. Acneiform rash correlated with improved survival (P = .001), but initial CA19-9, borderline resectable initial stage, and surgical resection (n = 7) did not. The 1-year and 2-year radiographic local progression rates were 22.8% and 61.0%, respectively. The worst acute toxic effects were GI toxicity (32% and 10% for grades 2 and 3, respectively); fatigue (26% and 6% for grades 2 and 3, respectively); sensory neuropathy (9% and 1% for grades 2 and 3, respectively); and acneiform rash (54% and 3% for grades 2 and 3, respectively). Smad4(Dpc4) expression correlated with a local rather than a distant dominant pattern of disease progression (P = .016). This regimen appears effective and has acceptable toxicity. The primary end point (1-year overall survival rate > 45%) was met, with encouraging survival duration. Smad4(Dpc4) immunostaining correlated with the pattern of disease progression. Prospective validation of Smad4(Dpc4) expression in cytology specimens as a predictive biomarker is warranted and may lead to personalized treatment strategies for patients with localized pancreatic cancer.

In utero betamethasone affects 3β-hydroxysteroid dehydrogenase and inhibin-α immunoexpression during testis development.

PubMed

Pedrana, G; Viotti, H; Lombide, P; Sanguinetti, G; Pino, C; Cavestany, D; Sloboda, D M; Martin, G B

2016-08-01

Prenatal glucocorticoids, commonly used in women at risk of preterm delivery, can predispose the newborn to disease in later life. Since male reproductive function is likely to reflect testis development during fetal life, we studied the effects of prenatal glucocorticoids on two key intra-testicular factors that play roles in cellular proliferation and differentiation, 3β-hydroxysteroid dehydrogenase (3β-HSD) and inhibin-α. Pregnant sheep (n=42) were treated with betamethasone (0.5 mg/kg) or saline (control) at 104, 111 and 118 days of gestation (DG). Testicular tissue was sampled from fetuses at 121 and 132DG, and from lambs at 45 and 90 postnatal days (PD). Within the betamethasone treated group, 3β-HSD immunostaining area was greater at 121DG than at 90PD (P=0.04), but the intensity of immunostaining was higher at 90PD than at 121DG (P=0.04), 132DG (P=0.04) and 45PD (P=0.03). Control animals showed no changes in 3β-HSD area or intensity of immunostaining. No significant differences were observed between treated and control animals in immunostaining area, but immunostaining was more intense in the treated group than in the control group at 90PD (P=0.03). For inhibin-α, the proportion of immunostaining area declined in treated offspring from 121DG to 45PD, in contrast to control values, but recovered fully by 90PD, concomitantly with the onset of spermatogenesis. In conclusion, prenatal betamethasone increased the postnatal testicular expression of inhibin-α but reduced the expression of 3β-HSD. These effects could compromise androgen-mediated testicular development and therefore adult capacity for spermatogenesis.

Tenascin-C is associated with coronary plaque instability in patients with acute coronary syndromes.

PubMed

Kenji, Kajiwara; Hironori, Ueda; Hideya, Yamamoto; Michinori, Imazu; Yasuhiko, Hayashi; Nobuoki, Kohno

2004-03-01

Tenascin-C (TNC) is an extracellular matrix glycoprotein that increases after inflammation and injury. In cultured cells TNC has been reported to markedly induce the expression of matrix metalloproteinase-9, which stimulates collagen degradation in the fibrous cap of human atherosclerotic plaque. Immunohistochemical techniques were used to analyze the expression of TNC protein in 51 coronary atherectomy specimens obtained from patients with stable angina pectoris (SAP, n=23) or acute coronary syndromes (ACS) (n=28; unstable angina pectoris, n=20, acute myocardial infarction, n=8). Immunostaining for alpha-smooth muscle actin, CD68, CD45, and CD31 was also performed in serial sections to identify the cell types that express TNC protein. The %TNC + area (percentage of the area of immunostaining for TNC protein in the total surface area of the plaque) was larger in coronary samples with the plaque characteristics of thrombus, angiogenesis, intraplaque hemorrhage, and macrophage (CD68(+)), and lymphocyte (CD45 (+)) clusters than in coronary samples without them (52+/-3.4 vs 39+/-4.8, p<0.05; 57+/-3.7 vs 36+/-3.7, p<0.01; 51+/-3.6 vs 39+/-4.8, p<0.05; 53+/-3.4 vs 33+/-4.5, p<0.01; 56+/-4.1 vs 37+/-3.6, p<0.01, respectively). The presence of other components, such as dense fibrous tissue, neointimal hyperplasia, atheromatous gruel and calcification, was not significantly correlated with the %TNC + area. The %TNC + area was larger in coronary samples from patients with ACS than in samples from patients with SAP (56+/-3.2% vs 34+/-4.3%, p<0.01). The results suggest that TNC may have specific functions in coronary plaque formation and may be involved in the pathogenesis of coronary lesions in ACS.

Cyclin D1 is significantly associated with stage of tumor and predicts poor survival in endometrial carcinoma patients.

PubMed

Khabaz, Mohamad Nidal; Abdelrahman, Amer Shafie; Butt, Nadeem Shafique; Al-Maghrabi, Basim; Al-Maghrabi, Jaudah

2017-10-01

Cyclin D1 overexpression has been described to have oncogenic role and association with diagnosis, prognosis and survival in various tumors. This study will describe the immunohistochemical phenotype of cyclin D1, and investigate the correlation between these patterns of expression and clinicopathological parameters of endometrial carcinomas, to conclude the clinical relevance of cyclin D1 expression in the evolution of endometrial neoplasms. This study employed 101 endometrial tissue samples which include 71 endometrial carcinomas and thirty normal and benign endometrium cases. All these tissue samples were used in the assembly of tissue microarrays which have been utilized afterward in immunohistochemistry staining to detect cyclin D1 expression. Forty (56.3%) cases of endometrial carcinomas showed brown nuclear expression of cyclin D1 including 36 (61%) cases of endometrioid carcinomas, and 3 (33.3%) cases of serous carcinomas. Twenty three (76.6%) cases of control group demonstrated nuclear expression. High score cyclin D1 immunohistochemical staining has been significantly linked with patient age (P=0.0001). Large proportion of high score cyclin D1 immunohistochemical staining was observed in females who are <40years of age while high proportions of negative staining were observed in older age groups. Histologic type of tissue was also significantly related to cyclin D1 immunohistochemical staining (P-value=0.0001), high staining is more common in normal proliferative and secretory endometrium while serous carcinoma is more prevalent with negative staining. Stage of tumor was significantly associated with cyclin D1 immunohistochemical staining (P-value=0.029), proportion of stage III and IV are higher in negative cyclin D1 immunostaining. Significantly higher proportion of high score cyclin D1 immunostaining is observed in controls while higher proportion of negative cyclin D1 immunostaining is observed among carcinoma cases (P-value=0.0001). No significant associations between cyclin D1 immunohistochemical staining and grade, recurrence and alive status were observed. Significant different survival distributions were observed (P-value=0.011) and poor survival behavior was correlated with negative cyclin D1 immunohistochemical staining. In conclusion, greater frequency of cyclin D1 expression was revealed in normal endometrial tissues in comparison with carcinomas. The distribution pattern of cyclin D1 immunoexpression suggests poor prognoses in endometrial carcinoma patients. Copyright © 2017 Elsevier Inc. All rights reserved.

Cystic mucinous adenocarcinoma of the lung: a case report

PubMed Central

2011-01-01

Mucinous cystic tumors of the lung are uncommon, the preoperative pathologic diagnosis is difficult and their biological behavior is still controversial. We report the case of a patient with a clinically benign cystic lesion that post-operatively showed to be consistent with an invasive adenocarcinoma arising in a mucinous cystadenoma of the lung, We underline the difficulty of the clinical pre-operative diagnosis of this cystic neoplasia radiologically mimicking a hydatid cyst, and we report the negative TTF1 immunostaining potentially misleading in the differential diagnosis with metastatic mucinous carcinomas. Finallly, we evidence the presence of a pre-existing mucinous benign lesion suggesting early and complete resection of benign appearing lung cysts because they can undergo malignant transformation if left untreated or they can already harbor foci of invasive carcinoma at the time of the presentation. Even if a good prognosis, better than in other lung carcinomas, with no recurrrence or metastasis after complete surgical exicision, has been reported for cystic mucinous cystoadenocarcinomas, the follow-up showed an aggressive biological behaviour, with the early onset of metastasis, in keeping with P53 positive immunostaining and high Ki-67 proliferation index. PMID:21970610

High androgen receptor immunoexpression in human "Sertoli cell only" testis.

PubMed

Loukil, L Hadjkacem; Boudawara, T Sellami; Ayadi, I; Bahloul, A; Jlidi, R; Ayadi, H; Keskes, L Ammar

2005-01-01

Our purpose was to evaluate cellular androgen receptor (AR) distribution and intensity of immunostaining in the human azoospermic testis. Thirty six biopsy specimens from azoospermic men were immunostained, using a monoclonal antibody of human AR. The localization and the intensity of AR immunostaining was evaluated in Sertoli Cell Only (SCO) testis (G1, n = 21), in spermatogenesis arrest testis (G2, n = 11) and in histologically normal testis (G3, n = 4). We found an AR immunostaining in Sertoli, peritubular myoid and Leydig cells, but not in germ cells. The intensity of the immunostaining varied substantially between biopsy specimens of different patients. Sertoli and Leydig cells AR immunostaining (score and intensity) in SCO group was higher than in the other groups. For Sertoli cells, the score means of AR immunoreactivity were 20 +/- 2.36, 10.18 +/- 1.0 and 1 +/- 1, for G1, G2 and G3 groups, respectively. For Leydig cells, the score means were 10.24 +/- 1.37, 6 +/- 0.71 and 0, for G1, G2 and G3 groups, respectively. We found significant differences between G1 and G2 (p = 0.0008), between G1 and G3 (p = 1.54 10-7) and G2 and G3 (p = 0.00032). These results suggest that in the testis AR is located exclusively in somatic cells and its expression is higher in SCO syndrome than in normal and in arrest spermatogenesis testes.

Deletion of Dual Specificity Phosphatase 1 Does Not Predispose Mice to Increased Spontaneous Osteoarthritis

PubMed Central

Pest, Michael Andrew; Pest, Courtney Alice; Bellini, Melina Rodrigues; Feng, Qingping; Beier, Frank

2015-01-01

Background Osteoarthritis (OA) is a degenerative joint disease with poorly understood etiology and pathobiology. Mitogen activated protein kinases (MAPKs) including ERK and p38 play important roles in the mediation of downstream pathways involved in cartilage degenerative processes. Dual specificity phosphatase 1 (DUSP1) dephosphorylates the threonine/serine and tyrosine sites on ERK and p38, causing deactivation of downstream signalling. In this study we examined the role of DUSP1 in spontaneous OA development at 21 months of age using a genetically modified mouse model deficient in Dusp1 (DUSP1 knockout mouse). Results Utilizing histochemical stains of paraffin embedded knee joint sections in DUSP1 knockout and wild type female and male mice, we showed similar structural progression of cartilage degeneration associated with OA at 21 months of age. A semi-quantitative cartilage degeneration scoring system also demonstrated similar scores in the various aspects of the knee joint articular cartilage in DUSP1 knockout and control mice. Examination of overall articular cartilage thickness in the knee joint demonstrated similar results between DUSP1 knockout and wild type mice. Immunostaining for cartilage neoepitopes DIPEN, TEGE and C1,2C was similar in the cartilage lesion sites and chondrocyte pericellular matrix of both experimental groups. Likewise, immunostaining for phosphoERK and MMP13 showed similar intensity and localization between groups. SOX9 immunostaining demonstrated a decreased number of positive cells in DUSP1 knockout mice, with correspondingly decreased staining intensity. Analysis of animal walking patterns (gait) did not show a discernable difference between groups. Conclusion Loss of DUSP1 does not cause changes in cartilage degeneration and gait in a mouse model of spontaneous OA at 21 months of age. Altered staining was observed in SOX9 immunostaining which may prove promising for future studies examining the role of DUSPs in cartilage and OA, as well as models of post-traumatic OA. PMID:26562438

Altered expression of key cell cycle regulators in renal cell carcinoma associated with Xp11.2 translocation.

PubMed

Barroca, H; Castedo, S; Vieira, J; Teixeira, M; Müller-Höcker, J

2009-01-01

Renal cell carcinoma (RCC) is a rare tumor in the pediatric population. Recently, a phenotypically and genetically distinct kidney carcinoma, mainly prevalent in children and associated with an Xp11.2 translocation or TFE3 gene fusion, has been described. It has been advanced that in this subtype of RCC, there is an accumulation of cyclin D1, cyclin D3, and p21 ((wafl/cip1)). The aim of the present study was to figure out in two pediatric RCC recently diagnosed in our department (one clear cell-type RCC and one TFE3-positive RCC) whether those features are indeed specific of the latter tumor or occur in pediatric RCC irrespective of the tumor type. The following immunostains were performed in both cases: Ki67, p16(ink4a), p21 ((wafl/cip1)), p27(kip1), p53, p63, mdm2, cyclin D1, cyclin D3, TFE3, CD10, vimentin, E-cadherin, and RCC-antigen. We observed in the TFE3-positive carcinoma an intense immunoreaction for p21 ((wafl/cip1)), cyclin D1, and cyclin D3, without expression for p53, p16, p27(kip1), and mdm2, whereas the immunoexpression profile observed in the classic RCC was similar to that of clear cell, adult-type RCC. Our study confirms that TFE3-positive RCC exhibits a deregulation of the cell cycle apparently unrelated to the young age of the patients.

Identification of the G protein-coupled estrogen receptor (GPER) in human prostate: expression site of the estrogen receptor in the benign and neoplastic gland.

PubMed

Rago, V; Romeo, F; Giordano, F; Ferraro, A; Carpino, A

2016-01-01

Estrogens are involved in growth, differentiation and pathogenesis of human prostate through the mediation of the classical estrogen receptors ERα and ERβ. The G protein-coupled estrogen receptor (GPER) is a 'novel' mediator of estrogen signaling which has been recently recognized in some human reproductive tissues, but its expression in the prostate gland is still unknown. Here, we investigated GPER in benign (from 5 patients) and neoplastic prostatic tissues (from 50 patients) by immunohistochemical analysis and Western blotting. Normal areas of benign prostates revealed a strong GPER immunoreactivity in the basal epithelial cells while luminal epithelial cells were unreactive and stromal cells were weakly immunostained. GPER was also immunolocalized in adenocarcinoma samples but the immunoreactivity of tumoral areas decreased from Gleason pattern 2 to Gleason pattern 4. Furthermore, a strong GPER immunostaining was also revealed in cells of pre-neoplastic lesions (high-grade prostatic intra-epithelial neoplasia). Western blot analysis of benign and tumor protein extracts showed the presence of a ~42 kDa band, consistent with the GPER molecular weight. An increase in both pAkt and p cAMP-response-binding protein (pCREB) levels was also observed in poorly differentiated PCa samples. Finally, this work identified GPER in the epithelial basal cells of benign human prostate, with a different localization with respect to the classical estrogen receptors. Furthermore, the expression of GPER in prostatic adenocarcinoma cells was also observed but with a modulation of the immunoreactivity according to tumor cell arrangements. © 2015 American Society of Andrology and European Academy of Andrology.

Development of A-type allatostatin immunoreactivity in antennal lobe neurons of the sphinx moth Manduca sexta.

PubMed

Utz, Sandra; Schachtner, Joachim

2005-04-01

The antennal lobe (AL) of the sphinx moth Manduca sexta is a well-established model system for studying mechanisms of neuronal development. To understand whether neuropeptides are suited to playing a role during AL development, we have studied the cellular localization and temporal expression pattern of neuropeptides of the A-type allatostatin family. Based on morphology and developmental appearance, we distinguished four types of AST-A-immunoreactive cell types. The majority of the cells were local interneurons of the AL (type Ia) which acquired AST-A immunostaining in a complex pattern consisting of three rising (RI-RIII) and two declining phases (DI, DII). Type Ib neurons consisted of two local neurons with large cell bodies not appearing before 7/8 days after pupal ecdysis (P7/P8). Types II and III neurons accounted for single centrifugal neurons, with type II neurons present in the larva and disappearing in the early pupa. The type III neuron did not appear before P7/P8. RI and RII coincided with the rises of the ecdysteroid hemolymph titer. Artificially shifting the pupal 20-hydroxyecdysone (20E) peak to an earlier developmental time point resulted in the precocious appearance of AST-A immunostaining in types Ia, Ib, and III neurons. This result supports the hypothesis that the pupal rise in 20E plays a role in AST-A expression during AL development. Because of their early appearance in newly forming glomeruli, AST-A-immunoreactive fibers could be involved in glomerulus formation. Diffuse AST-A labeling during early AL development is discussed as a possible signal providing information for ingrowing olfactory receptor neurons.

Racial differences in clinically localized prostate cancers of black and white men.

PubMed

deVere White, R W; Deitch, A D; Jackson, A G; Gandour-Edwards, R; Marshalleck, J; Soares, S E; Toscano, S N; Lunetta, J M; Stewart, S L

1998-06-01

Tumor grade, deoxyribonucleic acid (DNA) ploidy, proliferation, p53 and bcl-2 expression were examined in clinically localized prostate cancers of black and white American men to learn whether these features showed racial differences. A total of 117 prostate cancers (43 black and 74 white patients) obtained at radical prostatectomy for clinically localized disease were assigned Gleason scores by a single pathologist. Enzymatically dissociated nuclei from archival prostate cancers were examined by DNA flow cytometry using propidium iodide staining and the multicycle program to remove debris and sliced nuclei and to perform cell cycle analysis. For immunostaining after microwave antigen retrieval we used a DO-1/DO-7 monoclonal antibody cocktail for p53 and the clone 124 antibody for bcl-2. Significantly more black than white men had Gleason score 7 tumors. The DNA ploidy distribution of Gleason 6 or less tumors was similar for both races. As anticipated, the ploidy distribution of higher grade prostate cancer in white men was more abnormal but, unexpectedly, this was not found for higher grade prostate cancer in black men. No significant racial differences were found in S phase fractions, p53 or bcl-2 immunopositivity. However, for prostate cancer in black men there was a significant association between bcl-2 immunopositivity and higher S-phase fractions. The aggressive prostate cancers of black men may be characterized by the 2 features of high proliferation and a block to programmed cell death.

FoxP2 expression in the cerebellum and inferior olive: development of the transverse stripe-shaped expression pattern in the mouse cerebellar cortex.

PubMed

Fujita, Hirofumi; Sugihara, Izumi

2012-02-15

Many molecules are expressed heterogeneously in subpopulations of cerebellar Purkinje cells (PCs) and inferior olive (IO) neurons during development or in adulthood. These expression patterns are often organized in longitudinal stripes in the cerebellar cortex, which may be related to functional compartmentalization. FoxP2, a transcription factor, is expressed in PCs and IO neurons, but the details of its expression pattern remain unclear. Here we examined FoxP2 expression patterns systematically by immunostaining serial sections of the hindbrain from embryonic day 14.5 to adulthood in mice. FoxP2 was highly expressed in virtually all PCs at and before postnatal day 6 (P6), except for those in the flocculus and small parts of the nodulus (vermal lobule X), where FoxP2 expression was moderate or absent. After P6, FoxP2 expression gradually diminished in PCs in some areas. In adults, FoxP2 was expressed, less intensely than in earlier stages, in subsets of PCs that were mostly arranged transversely along the folial apices. In contrast, FoxP2 was expressed intensely in most IO neurons during development and in adulthood. FoxP2 was also expressed in a small population of neurons in the cerebellar nuclei. FoxP2 expression in adult rats and chicks was generally comparable to that in adult mice, suggesting evolutionary conservation of the expression pattern. Thus, the FoxP2 expression pattern reflects new transverse compartmentalization in the adult cerebellar cortex, although its functional significance remains unclear. Copyright © 2011 Wiley-Liss, Inc.

Incidence of Serous Tubal Intraepithelial Carcinoma (STIC) by Algorithm Classification in Serous Ovarian Tumor Associated with PAX8 Expression in Tubal Epithelia: A Study of Single Institution in Japan

PubMed Central

Yamamoto, Toshiya

2015-01-01

Serous ovarian carcinoma is now hypothesized to originate from fallopian tube epithelium (FTE). We investigated the FTE abnormalities in the patients with epithelial ovarian tumors. Our study included 55 cases of serous tumors (24 carcinomas, 8 borderline tumors, and 23 adenomas), 14 mucinous carcinomas, 22 endometrioid carcinomas, 5 clear cell carcinomas, and 2 malignant Brenner tumors. FTE was diagnosed by the diagnostic algorithm, which combines the data of morphology, and p53, Ki-67 immunostaining, as serous tubal intraepithelial carcinoma, serous tubal intraepithelial lesion, p53 signature, and normal/reactive. Serous tubal intraepithelial carcinoma, serous tubal intraepithelial lesion, p53 signature, and normal/reactive were observed in 5, 3, 0, and 16 cases in serous carcinoma; 0, 3, 0, and 5 cases in serous borderline tumor; 0, 1, 1, and 21 cases in serous adenoma; 0, 0, 1, and 13 cases in mucinous carcinoma; 0, 0, 3, and 19 cases in endometrioid carcinoma; 0, 0, 0, and 5 cases in clear cell carcinoma; and 0, 1, 0, and 1 case in malignant Brenner tumor. Among tumors of serous histology and between carcinomas, FTE abnormalities differed significantly (P<0.05). Serous tubal intraepithelial carcinomas were only found in serous carcinoma. The incidence of secretory cell proliferation (SCP) was examined by PAX8 expression. The rate of SCP was extremely high in serous carcinoma (96%). Among tumors of serous histology and between carcinomas, an incidence of SCP differed significantly (P<0.05). Patients with SCP were significantly older (P<0.0001). Our observations were concordant with the hypothesis of serous ovarian carcinogenesis. The SCP has a meaningful association with serous ovarian cancer. PMID:25473747

Non-identical distribution pattern of epidermal growth factor and platelet-derived growth factor in the mouse uterus during the oestrous cycle and early pregnancy.

PubMed

Jaber, L; Kan, F W

1998-10-01

In the present study, we examined by immunohistochemistry the cell-specific distribution of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) in the mouse uterus during the oestrous cycle and throughout the first 7 days of pregnancy. Paraffin-embedded tissue samples were immunostained using the avidin-biotin peroxidase technique and then examined by light microscopy. Our results showed that immunostaining for EGF was detected in the stroma but not in the luminal or glandular epithelium. A high concentration of EGF was detected in the stroma around the time of embryo implantation at days 3, 4 and 5 of pregnancy. The implanted embryo at day 7 of gestation showed immunostaining for EGF between the ectoderm and endoderm layers. The cell distribution pattern for PDGF was found to be different from that observed with EGF. Luminal and glandular epithelia displayed PDGF immunostaining throughout the first 7 days of pregnancy, with the highest intensity at days 4 and 5 of gestation. In contrast, no immunostaining was observed in the luminal and glandular epithelia at post-oestrus, dioestrus and pro-oestrus stages. However, a weak reaction started to appear at oestrus. The embryo at the blastocyst stage displayed a strong immunoreaction for antibody against PDGF. In addition, the decidual boundary zone surrounding the implanted embryo at days 5, 6 and 7 of gestation also showed an immunostaining for PDGF. The present observations demonstrate clearly the presence of EGF and PDGF in the mouse uterus in high concentrations at the peri-implantation period. Thus, our results, together with what is known about the effect of EGF and PDGF in controlling the growth, differentiation and activation of a variety of cell types, suggest a possible role for these growth factors during the preparation of the endometrium for implantation in controlling the proliferation activity of stromal and/or epithelial cells.

Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

DOE PAGES

Botcheva, Krassimira; McCorkle, Sean R.

2014-11-21

The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

Stabilization and activation of p53 are regulated independently by different phosphorylation events

PubMed Central

Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

1998-01-01

Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

Different matrix micro-environments in colon cancer and diverticular disease.

PubMed

Klinge, U; Rosch, R; Junge, K; Krones, C J; Stumpf, M; Lynen-Jansen, P; Mertens, P R; Schumpelick, V

2007-05-01

The extracellular matrix and the interactive signalling between its components are thought to play a pivotal role for tumour development and metastasis formation. An altered matrix composition as potential underlying pathology for the development of colorectal cancer was hypothesized. In a retrospective study of patients with colon cancer, the extracellular matrix in tumour-free bowel specimen was investigated in comparison with non-infected bowel specimen from patients operated on for colonic diverticulosis. The following matrix parameters with known associations to tumour formation, cell proliferation, invasion and metastasis were analysed by immunohistochemistry and quantified by a scoring system: VEGF, TGF-beta, ESDN, CD117, c-erb-2, cyclin D1, p53, p27, COX-2, YB-1, collagen I/III, MMP-13, PAI and uPAR. Expression profiles and correlations were calculated. The comparison of the two groups revealed a significantly decreased immunostaining for CD117 and TGF-beta in the cancer group (8.5+/-2.6 vs 10.3+/-2,1 and 4.9+/-1.5 vs 8.1+/-3, respectively), whereas PAI scores were significantly higher than in patients with diverticular disease (8.1+/-1.6 vs 6.2+/-0.9). Overall correlation patterns of matrix parameters indicated pronounced differences between tumour-free tissue in cancer patients compared with patients with diverticular disease. Our results indicate distinct differences in the colonic tissue architecture between cancer patients and patients with diverticulitis that support the notion of an altered matrix composition predisposing to the development of colon cancer.

Patterns of Proteins that Associate with p53 or with p53 Binding Sites Present in the Ribosomal Gene Cluster and MDM2 (P2) Promoter

DTIC Science & Technology

2000-08-01

Spodoptera frugiperda (Sf21) cells were infected with a recombinant baculovirus expressing the wild-type human p53. 3-4 and 10-1 cells were grown at 37 ’C in...for further use. Spodoptera fugiperda (Sf21) cells were grown at 27 0C in TC-100 medium (GIBCO), supplemented with 10% of heat inactivated Fetal

IL-8 Expression in Granulocytic Epithelial Lesions of Idiopathic Duct-centric Pancreatitis (Type 2 Autoimmune Pancreatitis).

PubMed

Ku, Yuna; Hong, Seung-Mo; Fujikura, Kohei; Kim, Sung Joo; Akita, Masayuki; Abe-Suzuki, Shiho; Shiomi, Hideyuki; Masuda, Atsuhiro; Itoh, Tomoo; Azuma, Takeshi; Kim, Myung-Hwan; Zen, Yoh

2017-08-01

Type 2 autoimmune pancreatitis (type 2 AIP) develops in isolation or sometimes in association with ulcerative colitis. Its diagnosis requires the histologic confirmation of granulocytic epithelial lesions (GELs) with no diagnostic biomarker currently available. This study aimed to elucidate the tissue expression of cytokines and their diagnostic value in this condition. In quantitative polymerase chain reaction for multiple cytokines using tissue-derived mRNA, the expression level of interleukin (IL)-8 was markedly higher in type 2 AIP than in type 1 AIP (P<0.001). In immunostaining, IL-8 expression was detected in the ductal/ductular epithelium (11/13; 85%) and infiltrating neutrophils or lymphocytes (12/12; 100%) in type 2 AIP, but was almost entirely negative in type 1 AIP (n=13; both, P<0.001). Although obstructive pancreatitis adjacent to pancreatic cancers (peritumoral pancreatitis) exhibited IL-8 expression in the epithelium (3/12; 25%) and inflammatory cells (10/12; 83%), expression levels were significantly lower than those in type 2 AIP (P<0.001 and 0.020, respectively). The presence of either GELs or IL-8-positive epithelium discriminated type 2 AIP from type 1 AIP or obstructive pancreatitis with 92% sensitivity and 92% to 100% specificity. Furthermore, CD3/IL-8-coexpressing lymphocytes were almost restricted to type 2 AIP. Interestingly, a similar pattern of IL-8 expression was also observed in colonic biopsies of ulcerative colitis. In conclusion, the overexpression of IL-8 may underlie the development of GELs in type 2 AIP, and IL-8 immunostaining or IL-8/CD3 double staining may become an ancillary method for its diagnosis. The similar expression pattern of IL-8 in ulcerative colitis also suggests a pathogenetic link between the 2 conditions.

Immunohistochemical Analysis of p53, Ki-67, CD44, HER-2/neu Expression Patterns in Gastric Cancer, and Their Association with One Year Survival in North-West of Iran

PubMed Central

Sanaat, Zohreh; Halimi, Monireh; Ghojezadeh, Morteza; Pirovi, Amir Hossein; Gharamaleki, Jalil Vaez; Ziae, Ali Esfahani Jamal Eivazi; Kermani, Iraj Aswadi

2013-01-01

Introduction Gastric cancer remains the second most common cause of cancer-related deaths worldwide. In many malignancies like, lung and breast, multiple prognostic factors are known, such as mutations in Ki-67, HER-2/neu, p53. In this study, we evaluated immunohistochemical protein expression patterns of cell-cycle-regulators p53, proliferation marker Ki-67, surface expression of CD44, HER-2/neu oncogene proposed as useful prognostic factors. Methods In this descriptive-analytic study, we evaluate 100 patients with gastric cancer who were referred to Shahid Ghazi Hospital or other oncology clinics of Tabriz University of Medical Sciences in 2005-2010. Patients with pathologic confirmation of gastric cancer were selected. Expression of p53, ki-67, CD-44, HER-2/neu were detected by immunohistochemical staining. Results In this study, 100 patients with gastric cancer participated. 76(76%) were men and 24(24%) were women with mean age of 64.02(8.05) years. Seventy two samples were intestinal type and 28 were diffuse type. CD44 was positive in 27(27%) patients. P53 was positive in 35(35%) patients. Ki-67 was positive in 53(53%) patients. HER-2/neu was positive in 51(51%) patients. Conclusion The frequency of positive p53, Ki-67, CD44 and HER-2/neu varied in different studies. Positive Ki-67 and HER-2/neu were not associated with changes in survival but positive p53 and CD44 were significantly associated with improved survival. PMID:24505530

Immunohistochemical study of parathyroid hormone-related protein in vesical transitional epithelium of patients with spinal cord injury.

PubMed

Vaidyanathan, S; McCreavy, D T; McDicken, I W; Soni, B M; Mansour, P; Wlodarski, B; Carron, J A; Fraser, W D; Singh, G; Sett, P; Gallagher, J A

1999-11-01

Parathyroid hormone-related protein (PTHrP), in addition to the well-established role in endochrondral bone development, is believed to be an important mediator of cellular growth and differentiation in a number of non-bony tissues. To compare the immunohistochemical staining of vesical transitional epithelium to antibodies raised to synthetic peptides of PTHrP composed of amino acid sequences 43 - 52 and 127 - 138 in patients with spinal cord injury (SCI) and neuropathic bladder (n=14), and control patients with intact neuraxis and no history of bladder cancer (n=10). Male SCI patients registered with Regional Spinal Injuries Centre, Southport, England. Endoscopic cold cup biopsy from the trigone of the urinary bladder was taken from patients with SCI while they were undergoing a therapeutic procedure in the urinary bladder. The control samples of bladder biopsies were taken from the archives of the Department of Histopathology, District General Hospital, Southport. Immunohistochemistry was performed using rabbit antibodies raised against synthetic peptides of human PTHrP (43 - 52) and PTHrP (127 - 138). The biopsies were examined for immunostaining of transitional epithelium. Of the 14 biopsies of SCI patients, positive immunostaining using antibodies to both the PTHrP peptides was found in four cases; five biopsies showed positive immunostaining only to anti-PTHrP (43 - 52); and five biopsies showed no immunostaining with either of the PTHrP peptides. In contrast, transitional epithelium in the biopsy specimens of ten control subjects with no history of bladder cancer showed no immunostaining with either of the PTHrP peptides. This study revealed that the transitional epithelium of neuropathic urinary bladder exhibits increased predilection for positive immunohistochemical staining for PTHrP (43 - 52), and to a lesser extent, to PTHrP (127 - 138), as compared to the vesical transitional epithelium of able bodied individuals with no history of vesical malignancy. The possible role of PTHrP in the cellular differentiation of urothelium of neuropathic bladder, and thereby, in the pathogenesis of cystitis in SCI patients, needs to be explored.

Are the uterine serous carcinomas underdiagnosed? Histomorphologic and immunohistochemical correlates and clinical follow up in high-grade endometrial carcinomas initially diagnosed as high-grade endometrioid carcinoma.

PubMed

Hu, Shaomin; Hinson, Jeff L; Matnani, Rahul; Cibull, Michael L; Karabakhtsian, Rouzan G

2018-02-01

Histologic subclassification of high-grade endometrial carcinomas can sometimes be a diagnostic challenge when based on histomorphology alone. Here we utilized immunohistochemical markers to determine the immunophenotype in histologically ambiguous high-grade endometrial carcinomas that were initially diagnosed as pure or mixed high-grade endometrioid carcinoma, aiming to determine the utility of selected immunohistochemical panel in accurate classification of these distinct tumor types, while correlating these findings with the clinical outcome. A total of 43 high-grade endometrial carcinoma cases initially classified as pure high-grade endometrioid carcinoma (n=32), mixed high-grade endometrioid carcinoma/serous carcinoma (n=9) and mixed high-grade endometrioid carcinoma/clear cell carcinoma (n=2) were retrospectively stained with a panel of immunostains, including antibodies for p53, p16, estrogen receptor, and mammaglobin. Clinical follow-up data were obtained, and stage-to-stage disease outcomes were compared for different tumor types. Based on aberrant staining for p53 and p16, 17/43 (40%) of the high-grade endometrial carcinoma cases initially diagnosed as high-grade endometrioid carcinoma were re-classified as serous carcinoma. All 17 cases showed negative staining for mammaglobin, while estrogen receptor was positive in only 6 (35%) cases. The remaining 26 cases of high-grade endometrioid carcinoma showed wild-type staining for p53 in 25 (96%) cases, patchy staining for p16 in 20 (77%) cases, and were positive for mammaglobin and estrogen receptor in 8 (31%) and 19 (73%) cases, respectively, thus the initial diagnosis of high-grade endometrioid carcinoma was confirmed in these cases. In addition, the patients with re-classified serous carcinoma had advanced clinical stages at diagnosis and poorer overall survival on clinical follow-up compared to that of the remaining 26 high-grade endometrioid carcinoma cases. These results indicate that selected immunohistochemical panel, including p53, p16, and mammaglobin can be helpful in reaching accurate diagnosis in cases of histomorphologically ambiguous endometrial carcinomas, and can assist in providing guidance for appropriate therapeutic options for the patients.

Histotype-genotype correlation in 36 high-grade endometrial carcinomas.

PubMed

Hoang, Lien N; McConechy, Melissa K; Köbel, Martin; Han, Guangming; Rouzbahman, Marjan; Davidson, Ben; Irving, Julie; Ali, Rola H; Leung, Sam; McAlpine, Jessica N; Oliva, Esther; Nucci, Marisa R; Soslow, Robert A; Huntsman, David G; Gilks, C Blake; Lee, Cheng-Han

2013-09-01

Endometrioid, serous, and clear cell carcinomas are the major types of endometrial carcinoma. Histologic distinction between these different tumor types can be difficult in high-grade cases, in which significant interobserver diagnostic disagreement exists. Endometrioid and clear cell carcinomas frequently harbor ARID1A and/or PTEN mutations. Serous carcinoma acquires TP53 mutations/inactivation at onset, with a significant subset harboring an additional mutation in PPP2R1A. This study examines the correlation between tumor histotype and genotype in 36 previously genotyped high-grade endometrial carcinomas. This included 23 endometrioid/clear cell genotype and 13 serous genotype tumors. Eight subspecialty pathologists reviewed representative online slides and rendered diagnoses before and after receiving p53, p16, and estrogen receptor immunostaining results. κ statistics for histotype-genotype concordance were calculated. The average κ values for histotype-genotype concordance was 0.55 (range, 0.30 to 0.67) on the basis of morphologic evaluation alone and it improved to 0.68 (range, 0.54 to 0.81) after immunophenotype consideration (P<0.001). Genotype-incompatible diagnoses were rendered by at least 2 pathologists in 12 of 36 cases (33%) (3 cases by 2/8 pathologists, 2 by 3/8, 2 by 4/8, 3 by 6/8, 1 by 7/8, and 1 case by 8/8 pathologists). Six of the 12 were endometrioid/clear cell genotype tumors, and the other 6 were serous genotype tumors. The histopathologic features associated with histotype-genotype-discordant cases were reviewed, and specific diagnostic recommendations were made to improve concordance. This study found that although the majority of morphologic diagnoses are genotype concordant, genotype-incompatible diagnoses are made in a significant subset of cases. Judicious use and interpretation of p53 immunohistochemistry in selected scenarios can improve histotype-genotype concordance.

LRRK2 interacts with ATM and regulates Mdm2-p53 cell proliferation axis in response to genotoxic stress.

PubMed

Chen, Zhongcan; Cao, Zhen; Zhang, Wei; Gu, Minxia; Zhou, Zhi Dong; Li, Baojie; Li, Jing; Tan, Eng King; Zeng, Li

2017-11-15

Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself contributes to cancer risk remains unknown. DNA damage causes cancer, and DNA damage responses are among the most important pathways in cancer biology. To understand the role of LRRK2 in DNA damage response pathway, we induced DNA damage by applying genotoxic stress to the cells with Adriamycin. We found that DNA damage enhances LRRK2 phosphorylation at Serine 910, Serine 935 and Serine 1292. We further showed that LRRK2 phosphorylation is abolished in the absence of ATM, suggesting that LRRK2 phosphorylation requires ATM. It should also be noted that LRRK2 interacts with ATM. In contrast, overexpression or knockdown of LRRK2 does not affect ATM phosphorylation, indicating that LRRK2 is the downstream target of ATM in response to DNA damage. Moreover, we demonstrated that LRRK2 increases the expression of p53 and p21 by increasing the Mdm2 phosphorylation in response to DNA damage. Loss-of-function in LRRK2 has the opposite effect to that of LRRK2. In addition, FACS analysis revealed that LRRK2 enhances cell cycle progression into S phase in response to DNA damage, a finding that was confirmed by 5-bromo-2'-deoxyuridine immunostaining. Taken together, our findings demonstrate that LRRK2 plays an important role in the ATM-Mdm2-p53 pathway that regulates cell proliferation in response to DNA damage. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

High LET Radiation Can Enhance TGF(Beta) Induced EMT and Cross-Talk with ATM Pathways

NASA Technical Reports Server (NTRS)

Wang, Minli; Hada, Megumi; Huff, Janice; Pluth, Janice M.; Anderson, Janniffer; ONeill, Peter; Cucinotta, Francis A.

2010-01-01

The TGF(Beta) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation in mammary epithelial cells. We investigated possible interactions between the TGF(Beta) and ATM pathways following simulated space radiation using hTERT immortalized human esophageal epithelial cells (EPC-hTERT), mink lung epithelial cells (Mv1lu), and several human fibroblast cell lines. TGF(Beta) is a key modulator of the Epithelial-Mesenchymal Transition (EMT), important in cancer progression and metastasis. The implication of EMT by radiation also has several lines of developing evidence, however is poorly understood. The identification of TGF(Beta) induced EMT can be shown in changes to morphology, related gene over expression or down regulation, which can be detected by RT-PCR, and immunostaining and western blotting. In this study, we have observed morphologic and molecular alternations consistent with EMT after Mv1lu cells were treated with TGF(Beta) High LET radiation enhanced TGF(Beta) mediated EMT with a dose as low as 0.1Gy. In order to consider the TGF(Beta) interaction with ATM we used a potent ATM inhibitor Ku55933 and investigated gene expression changes and Smad signaling kinetics. Ku559933 was observed to reverse TGF(Beta) induced EMT, while this was not observed in dual treated cells (radiation+TGF(Beta)). In EPC-hTERT cells, TGF(Beta) alone was not able to induce EMT after 3 days of application. A combined treatment with high LET, however, significantly caused the alteration of EMT markers. To study the function of p53 in the process of EMT, we knocked down P53 through RNA interference. Morphology changes associated with EMT were observed in epithelial cells with silenced p53. Our study indicates: high LET radiation can enhance TGF(Beta) induced EMT; while ATM is triggering the process of TGF(Beta)-induced EMT, p53 might be an essential repressor for EMT phenotypes.

Diet, Helicobacter pylori, and p53 mutations in gastric cancer: a molecular epidemiology study in Italy.

PubMed

Palli, D; Caporaso, N E; Shiao, Y H; Saieva, C; Amorosi, A; Masala, G; Rice, J M; Fraumeni, J F

1997-12-01

A series of 105 gastric cancer (GC) cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. Overall, 33 of 105 cases had a mutation (p53+) identified by single-strand conformational polymorphism and confirmed by sequencing (Y-H. Shiao et al., submitted for publication). p53+ cases had a more traditional dietary pattern (i.e., corn meal mush, meat soup, and other homemade dishes) and reported less frequent consumption of raw vegetables (particularly lettuce and raw carrots). A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. In addition, p53+ cases tended to be located in the upper portion of the stomach and to be associated with advanced age and blood group A. No relation was found between the presence of p53 mutations and histologically defined Helicobacter pylori infection, smoking history, family history of gastric cancer, education, and social class. Of the 33 p53+ cases, 19 had G:C-->A:T transitions at CpG sites. These tumors tended to occur in females and in association with H. pylori infection but not other risk factors. The remaining 14 cases with a p53 mutation had mainly transversions but also two deletions and two transitions at non-CpG sites. These tumors showed a strong positive association with a traditional dietary pattern and with the estimated intake of selected nutrients (nitrite, protein, and fat, particularly from animal sources). The findings of this case-case analysis suggest that p53 mutations at non-CpG sites are related to exposure to alkylating compounds from diet, whereas p53 mutations at CpG sites might be related to H. pylori infection.

The Isoforms of the p53 Protein

PubMed Central

Khoury, Marie P.; Bourdon, Jean-Christophe

2010-01-01

p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

Oncogenic Smad3 signaling induced by chronic inflammation is an early event in ulcerative colitis-associated carcinogenesis.

PubMed

Kawamata, Seiji; Matsuzaki, Koichi; Murata, Miki; Seki, Toshihito; Matsuoka, Katsuyoshi; Iwao, Yasushi; Hibi, Toshifumi; Okazaki, Kazuichi

2011-03-01

Both chronic inflammation and somatic mutations likely contribute to the pathogenesis of ulcerative colitis (UC)-associated dysplasia and cancer. On the other hand, both tumor suppression and oncogenesis can result from transforming growth factor (TGF)-β signaling. TGF-β type I receptor (TβRI) and Ras-associated kinases differentially phosphorylate a mediator, Smad3, to become C-terminally phosphorylated Smad3 (pSmad3C), linker phosphorylated Smad3 (pSmad3L), and both C-terminally and linker phosphorylated Smad3 (pSmad3L/C). The pSmad3C/p21(WAF1) pathway transmits a cytostatic TGF-β signal, while pSmad3L and pSmad3L/C promote cell proliferation by upregulating c-Myc oncoprotein. The purpose of this study was to clarify the alteration of Smad3 signaling during UC-associated carcinogenesis. By immunostaining and immunofluorescence, we compared pSmad3C-, pSmad3L-, and pSmad3L/C-mediated signaling in colorectal specimens representing colitis, dysplasia, or cancer from eight UC patients with signaling in normal colonic crypts. We also investigated p53 expression and mutations of p53 and K-ras genes. We further sought functional meaning of the phosphorylated Smad3-mediated signaling in vitro. As enterocytes in normal crypts migrated upward toward the lumen, cytostatic pSmad3C/p21(WAF1) tended to increase, while pSmad3L/c-Myc shown by progenitor cells gradually decreased. Colitis specimens showed prominence of pSmad3L/C/c-Myc, mediated by TGF-β and tumor necrosis factor (TNF)-α, in all enterocyte nuclei throughout entire crypts. In proportion with increases in frequency of p53 and K-ras mutations during progression from dysplasia to cancer, the oncogenic pSmad3L/c-Myc pathway came to be dominant with suppression of the pSmad3C/p21(WAF1) pathway. Oncogenic Smad3 signaling, altered by chronic inflammation and eventually somatic mutations, promotes UC-associated neoplastic progression by upregulating growth-related protein. Copyright © 2010 Crohn's & Colitis Foundation of America, Inc.

Redistribution of annexin in gravistimulated pea plumules

NASA Technical Reports Server (NTRS)

Clark, G. B.; Rafati, D. S.; Bolton, R. J.; Dauwalder, M.; Roux, S. J.

2000-01-01

We used immunocytochemistry to investigate the effects of gravistimulation on annexin localization in etiolated pea plumule shoots. In longitudinal sections, an asymmetric annexin immunostaining pattern was observed in a defined group of cells located just basipetal to apical meristems at the main shoot apex and at all of the axillary buds, an area classically referred to as the leaf gap. The pattern was observed using both protein-A-purified anti-annexin and affinity-purified anti-annexin antibodies for the immunostaining. A subset of the cells with the annexin staining also showed an unusually high level of periodic acid Schiff (PAS) staining in their cell walls. Prior to gravistimulation, the highest concentration of annexin was oriented toward the direction of gravity along the apical end of these immunostained cells. In contrast, both at 15 and 30 min after gravistimulation, the annexin immunostain became more evenly distributed all around the cell and more distinctly cell peripheral. The asymmetry along the lower wall of these cells was no longer evident. In accord with current models of annexin action, we interpret the results to indicate that annexin-mediated secretion in the leaf gap area is preferentially toward the apical meristem prior to gravistimulation, and that gravistimulation results in a redirection of this secretion. These data are to our knowledge the first to show a correlation between the vector of gravity and the distribution of annexins in the cells of flowering plants. c 2000 Editions scientifiques et medicales Elsevier SAS.

Benzo[a]pyrene, Aflatoxine B1 and Acetaldehyde Mutational Patterns in TP53 Gene Using a Functional Assay: Relevance to Human Cancer Aetiology

PubMed Central

Paget, Vincent; Lechevrel, Mathilde; André, Véronique; Le Goff, Jérémie; Pottier, Didier; Billet, Sylvain; Garçon, Guillaume; Shirali, Pirouz; Sichel, François

2012-01-01

Mutations in the TP53 gene are the most common alterations in human tumours. TP53 mutational patterns have sometimes been linked to carcinogen exposure. In hepatocellular carcinoma, a specific G>T transversion on codon 249 is classically described as a fingerprint of aflatoxin B1 exposure. Likewise G>T transversions in codons 157 and 158 have been related to tobacco exposure in human lung cancers. However, controversies remain about the interpretation of TP53 mutational pattern in tumours as the fingerprint of genotoxin exposure. By using a functional assay, the Functional Analysis of Separated Alleles in Yeast (FASAY), the present study depicts the mutational pattern of TP53 in normal human fibroblasts after in vitro exposure to well-known carcinogens: benzo[a]pyrene, aflatoxin B1 and acetaldehyde. These in vitro patterns of mutations were then compared to those found in human tumours by using the IARC database of TP53 mutations. The results show that the TP53 mutational patterns found in human tumours can be only partly ascribed to genotoxin exposure. A complex interplay between the functional impact of the mutations on p53 phenotype and the cancer natural history may affect these patterns. However, our results strongly support that genotoxins exposure plays a major role in the aetiology of the considered cancers. PMID:22319594

B-cell posttransplant lymphoproliferative disorder isolated to the central nervous system is Epstein-Barr virus positive and lacks p53 and Myc expression by immunohistochemistry.

PubMed

Sundin, Andrew; Grzywacz, Bartosz J; Yohe, Sophia; Linden, Michael A; Courville, Elizabeth L

2017-03-01

In this retrospective study from one institution, we performed a clinicopathological study of a cohort of patients with posttransplant lymphoproliferative disorder (PTLD) confined to the central nervous system. We also identified a comparison cohort of patients with de novo primary diffuse large B-cell lymphoma of the central nervous system. We performed a detailed morphologic review, evaluated Epstein-Barr virus (EBV) by in situ hybridization, and interpreted a panel of immunohistochemical stains in a subset of cases including Hans classification markers (CD10, BCL6, MUM1), p53, CD30, Myc, and BCL2. All 17 of the posttransplant and none of 11 de novo cases were EBV positive (P < .005). Morphologic patterns identified in the PTLD cases were monomorphic diffuse large B-cell lymphoma pattern (10 patients) and "T-cell-rich" pattern (7 patients). The monomorphic posttransplant cases were more likely to be Myc negative (P = .015) and CD30 positive (P < .005) than the de novo cases, and showed a similarly low rate of p53 positivity by immunohistochemistry. No prognostic factors for overall survival were identified. Central nervous system PTLD is EBV positive, typically lacks p53 and Myc expression by immunohistochemistry, and can present with numerous background T lymphocytes. Copyright © 2016 Elsevier Inc. All rights reserved.

Significance of DNA Replication Licensing Proteins (MCM2, MCM5 and CDC6), p16 and p63 as Markers of Premalignant Lesions of the Uterine Cervix: Its Usefulness to Predict Malignant Potential

PubMed Central

Saritha, VN; Veena, VS; Krishna, KM Jagathnath; Somanathan, Thara; Sujathan, K

2018-01-01

Cervical cancer continues to be a leading cancer among women in many parts of the world. Nation-wide screening with the Pap smear has not been implemented in India due to the lack of adequately trained cytologists. Identification of biomarkers to predict malignant potential of the identified low risk lesions is essential to avoid excessive retesting and follow up. The current study analyzed the expression patterns of DNA replication licensing proteins, proliferation inhibitor protein p16INK4A and tumor suppresser protein p63 in cervical tissues and smears to assess the ability of these proteins to predict progression. Methods: Cervical smears and corresponding tissues were immunostained using mouse monoclonal antibodies against MCM2, MCM5, CDC6, p16 and p63. Smears were treated with a non-ionic surfactant sodium deoxycholate prior to immuno-cytochemistry. The standard ABC method of immunohistochemistry was performed using DAB as the chromogen. The immunostained samples were scored on a 0-3+ scale and staining patterns of smears were compared with those of tissue sections. Sensitivity and specificity for each of these markers were calculated taking histopathology as the gold standard. Result: All the markers were positive in malignant and dysplastic cells. MCM protein expression was found to be up-regulated in LSIL, HSIL and in malignancies to a greater extent than p16 as well as p63. CDC6 protein was preferentially expressed in high grade lesions and in invasive squamous cell carcinomas. A progressive increase in the expression of DNA replication licensing proteins in accordance with the grades of cervical intraepithelial lesion suggests these markers as significant to predict malignant potential of low grade lesions in cervical smears. Conclusion: MCMs and CDC6 can be applied as biomarkers to predict malignant potential of low grade lesions identified in screening programmes and retesting / follow up might be confined to those with high risk lesions alone so that overuse of resources can be safely avoided. PMID:29373905

Preliminary report on the effect of brachytherapy on expression of p53, bc1-2 and apoptosis in squamous cell carcinoma of the oesophagus.

PubMed

Sur, Monalisa; Sur, Ranjan K; Cooper, Kum; Bizos, Damon

2003-02-01

Pre-brachytherapy biopsies and post-brachytherapy oesophagectomy specimens of 10 patients with early squamous cell carcinoma of the middle third of the oesophagus were examined for the expression of p53, bcl-2 and apoptosis using immunohistochemical markers. There was no expression of p53 in one patient in both pre- and post-brachytherapy specimens. In 8 patients, p53 staining was strongly positive (3+) with approximately 50% or more cells, and with diffuse and no specific pattern in the pre-brachytherapy biopsies. The tumour areas of the post-brachytherapy specimens of this group showed strong 3+ positivity with p53 (10-50% positive cell count), with the pattern being focal and peripheral in the tumour islands. The centre of the tumour islands showed necrosis and/or keratinisation. In one patient, the pre-brachytherapy biopsy showed expression of p53 while the post-brachytherapy specimen was negative. bcl-2 expression in both pre- and post-brachytherapy was equivocal and inconclusive in both the pre- and post-brachytherapy specimens. Apoptosis was negative in all the pre- and post-brachytherapy tissue sections in the presence of positive controls. Brachytherapy does not cause cell death by apoptosis but by necrosis and maturation of the cells into better differentiated cells, which is caused by OH free radical, and induction of the keratin gene respectively. It is possible that brachytherapy may cause destruction of cells containing wild-type p53, while mutant p53 in cells located at the tumour periphery escape the effect of brachytherapy. This may be responsible for the high incidence of local recurrence and distant metastasis in oesophageal cancer treated with radiotherapy. There is no effect of brachytherapy on bcl-2 expression in oesophageal cancer.

The Thoc1 Ribonucleoprotein as a Novel Biomarker for Prostate Cancer Treatment Assignment

DTIC Science & Technology

2017-10-01

PI Mohler). Immunostaining of prostate cancer biopsy specimen of patients who qualified for active surveillance is complete (PI Goodrich). ELISA assay...specimens for use in constructing tissue microarrays, developing and optimizing ELISA assays to detect Thoc1 protein and anti-Thoc1 autoantibodies...set of TMAs made from 700 patients available at RPCI has been immunostained for PMP22 (figure 5). ELISA assays for measuring pThoc1 and pThoc1

Remote intracranial recurrence of IDH mutant gliomas is associated with TP53 mutations and an 8q gain

PubMed Central

Nakae, Shunsuke; Kato, Takema; Murayama, Kazuhiro; Sasaki, Hikaru; Abe, Masato; Kumon, Masanobu; Kumai, Tadashi; Yamashiro, Kei; Inamasu, Joji; Hasegawa, Mitsuhiro; Kurahashi, Hiroki; Hirose, Yuichi

2017-01-01

Most IDH mutant gliomas harbor either 1p/19q co-deletions or TP53 mutation; 1p/19q co-deleted tumors have significantly better prognoses than tumors harboring TP53 mutations. To investigate the clinical factors that contribute to differences in tumor progression of IDH mutant gliomas, we classified recurrent tumor patterns based on MRI and correlated these patterns with their genomic characterization. Accordingly, in IDH mutant gliomas (N = 66), 1p/19 co-deleted gliomas only recurred locally, whereas TP53 mutant gliomas recurred both locally and in remote intracranial regions. In addition, diffuse tensor imaging suggested that remote intracranial recurrence in the astrocytomas, IDH-mutant with TP53 mutations may occur along major fiber bundles. Remotely recurrent tumors resulted in a higher mortality and significantly harbored an 8q gain; astrocytomas with an 8q gain resulted in significantly shorter overall survival than those without an 8q gain. OncoScan® arrays and next-generation sequencing revealed specific 8q regions (i.e., between 8q22 and 8q24) show a high copy number. In conclusion, only tumors with TP53 mutations showed patterns of remote recurrence in IDH mutant gliomas. Furthermore, an 8q gain was significantly associated with remote intracranial recurrence and can be considered a poor prognostic factor in astrocytomas, IDH-mutant. PMID:29156679

Xp11 translocation renal cell carcinoma in adults: a clinicopathological and comparative genomic hybridization study

PubMed Central

Zou, Hong; Kang, Xueling; Pang, Li-Juan; Hu, Wenhao; Zhao, Jin; Qi, Yan; Hu, Jianming; Liu, Chunxia; Li, Hongan; Liang, Weihua; Yuan, Xianglin; Li, Feng

2014-01-01

To study the clinicopathological and genomic characteristics of Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) in adults, we analyzed 9 Xp11.2 RCCs, confirmed by transcription factor E3 (TFE3) immunohistochemistry, in patients aged ≥20 years. TFE3 expression was also determined in 12 cases of alveolar soft part sarcoma (ASPS) served as a positive control. Comparative genomic hybridization (CGH) was used to investigate genomic imbalances in all Xp11.2 RCC cases. Most of our Xp11.2 RCC patients (5/9) presented with TNM stages 3-4, and 6 patients died 10 months to 7 years after their operation. Histologically, Xp11.2 RCC was composed of a mixed papillary nested/alveolar growth pattern (8/9). Immunostaining showed that all Xp11.2 RCC and ASPS cases had strong TFE3 expression and high positive ratios for p53 and vimentin. However, there were significant differences in the expression of AMACR (p<0.001), AE1/AE3 (p=0.002), and CD10 (p=0.024) between the 2 diseases. CGH profiles showed chromosomal imbalances in all 9 Xp11.2 RCC cases; gains were observed in chromosomes Xp11 (6/9), 7q20-25, 12q25-31 (5/9), 7p16-24 (4/9), 8p12-13, 8q20-21, 16q20-22, 17q25-26, 20q22-23 (4/9), and losses occurred frequently on chromosomes 3p12-16, 9q31-32, 14q22-24 (4/9). Our Conclusions show Xp11.2 RCC that occur in adults may be aggressive cancers, the expressions of AMACR, CD10, AE1/AE3 are helpful in the differential diagnosis between Xp11.2 RCC and ASPS, and CGH assay is a useful complementary method for confirming the diagnosis of Xp11.2 RCC. PMID:24427344

Xp11 translocation renal cell carcinoma in adults: a clinicopathological and comparative genomic hybridization study.

PubMed

Zou, Hong; Kang, Xueling; Pang, Li-Juan; Hu, Wenhao; Zhao, Jin; Qi, Yan; Hu, Jianming; Liu, Chunxia; Li, Hongan; Liang, Weihua; Yuan, Xianglin; Li, Feng

2014-01-01

To study the clinicopathological and genomic characteristics of Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) in adults, we analyzed 9 Xp11.2 RCCs, confirmed by transcription factor E3 (TFE3) immunohistochemistry, in patients aged ≥20 years. TFE3 expression was also determined in 12 cases of alveolar soft part sarcoma (ASPS) served as a positive control. Comparative genomic hybridization (CGH) was used to investigate genomic imbalances in all Xp11.2 RCC cases. Most of our Xp11.2 RCC patients (5/9) presented with TNM stages 3-4, and 6 patients died 10 months to 7 years after their operation. Histologically, Xp11.2 RCC was composed of a mixed papillary nested/alveolar growth pattern (8/9). Immunostaining showed that all Xp11.2 RCC and ASPS cases had strong TFE3 expression and high positive ratios for p53 and vimentin. However, there were significant differences in the expression of AMACR (p<0.001), AE1/AE3 (p=0.002), and CD10 (p=0.024) between the 2 diseases. CGH profiles showed chromosomal imbalances in all 9 Xp11.2 RCC cases; gains were observed in chromosomes Xp11 (6/9), 7q20-25, 12q25-31 (5/9), 7p16-24 (4/9), 8p12-13, 8q20-21, 16q20-22, 17q25-26, 20q22-23 (4/9), and losses occurred frequently on chromosomes 3p12-16, 9q31-32, 14q22-24 (4/9). Our Conclusions show Xp11.2 RCC that occur in adults may be aggressive cancers, the expressions of AMACR, CD10, AE1/AE3 are helpful in the differential diagnosis between Xp11.2 RCC and ASPS, and CGH assay is a useful complementary method for confirming the diagnosis of Xp11.2 RCC.

Hidradenocarcinoma showing prominent mucinous and squamous differentiation and associated pagetoid cells.

PubMed

Honda, Yumi; Tanigawa, Hiroki; Harada, Miho; Fukushima, Satoshi; Masuguchi, Shinichi; Ishihara, Tsuyoshi; Ihn, Hironobu; Iyama, Ken-ichi

2013-05-01

Herein, we report a 63-year-old man presenting with hidradenocarcinoma showing prominent mucinous and squamous differentiation on his back. The tumor was dermal-based, solid and cystic. Tumor cells with squamous differentiation and with keratin pearl formation were identified predominantly in the superficial dermis, and mucinous cells were identified principally in the cystic lesion in the deep dermis. Interestingly, the additional feature of pagetoid cells was identified in the overlying epidermis. Both the mucinous cells in hidradenocarcinoma and pagetoid cells had intracytoplasmic mucin; however, they had different histopathologic findings and immunophenotypes. Mucinous cells in hidradenocarcinoma had small nuclei and abundant intracytoplasmic mucin presenting goblet cells with low rate of positive immunostaining for p53 and Ki67. In contrast, pagetoid cells had larger nuclei with less intracytoplasmic mucin. Both p53- and Ki67-positive cells were increased in pagetoid cells. Additionally, mucinous cells in hidradenocarcinoma were MUC1(+)/MUC2(-)/MUC5AC(+)/MUC6(+), but pagetoid cells were MUC1(+; focal)/MUC2(-)/MUC5AC(-)/MUC6(+; focal). The derivation of pagetoid cells is unclear; however, the localized small region of pagetoid cells over the hidradenocarcinoma in the present case may suggest a common histogenesis of these two malignant neoplasms. Copyright © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

Nuclear C-MYC expression level is associated with disease progression and potentially predictive of two year overall survival in prostate cancer.

PubMed

Zeng, Wen; Sun, Hanying; Meng, Fankai; Liu, Zeming; Xiong, Jing; Zhou, Sheng; Li, Fan; Hu, Jia; Hu, Zhiquan; Liu, Zheng

2015-01-01

Upregulation of nuclear C-MYC protein has been reported to be an early event in prostate cancer (PCa); however, its clinicopathological and prognostic significance remain controversial. We determined the association of nuclear C-MYC protein expression with clinicopathological parameters, prognosis, ETS-related gene (ERG) expression, and TMPRSS2-ERG status in PCa. Nuclear C-MYC and ERG expression by immunohistochemistry and TMPRSS2-ERG status by triple-color probe fluorescence in situ hybridization assay were determined in 50 hormone-naïve PCa patients and 31 radical prostatectomy specimens. Nuclear C-MYC immunostaining was negative, positive, and strong positive in 27.5%, 32.5%, and 40.0% of cases, respectively. C-MYC immunostaining was significantly associated with clinical T stage (P < 0.001), distant metastasis at the time of diagnosis (P < 0.001) and TMPRSS2-ERG status (P = 0.001) but not with ERG immunostaining (P = 0.818). In the Kaplan-Meier analysis, C-MYC positive cases were found to have worse 2-year OS compared with C-MYC negative cases (P = 0.027). However, in the univariate Cox analysis, only TMPRSS2-ERG status (hazard ratio [HR] 0.189, 95% CI 0.057-0.629; P = 0.007) and distant metastasis (HR 3.545, 95% CI 1.056-11.894; P = 0.040) were significantly associated with 2-year OS. After adjusting for these two factors, TMPRSS2-ERG status still impacted 2-year OS (HR 0.196, 95% CI 0.049-0.778; P = 0.020). Nuclear C-MYC overexpression may be associated with disease progression and potentially predictive of 2-year OS in PCa. This is the first study to demonstrate an association between nuclear C-MYC immunostaining and TMPRSS2-ERG status in PCa.

Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

PubMed Central

Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

1994-01-01

Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

Evaluation of the 8th TNM classification on p16-positive oropharyngeal squamous cell carcinomas in the Netherlands, and the importance of additional HPV DNA-testing.

PubMed

Nauta, I H; Rietbergen, M M; van Bokhoven, A A J D; Bloemena, E; Witte, B I; Heideman, D A M; Baatenburg de Jong, R J; Brakenhoff, R H; Leemans, C R

2018-02-09

Oropharyngeal squamous cell carcinomas (OPSCCs) are traditionally caused by smoking and excessive alcohol consumption. However, in the last decades high-risk human papillomavirus (HR-HPV) infections play an increasingly important role in tumorigenesis. HPV-driven OPSCCs are known to have a more favorable prognosis, which has led to important and marked changes in the recently released TNM-8. In this edition, OPSCCs are divided based on p16-immunostaining, with p16-overexpression as surrogate marker for the presence of HPV. The aims of this study are to evaluate TNM-8 on a Dutch consecutive cohort of patients with p16-positive OPSCC and to determine the relevance of additional HPV DNA-testing. All OPSCC patients without distant metastases at diagnosis and treated with curative intent at VU University Medical Center (2000-2015) and Erasmus Medical Center (2000-2006) were included (N = 1,204). HPV-status was established by p16-immunostaining followed by HPV DNA-PCR on the p16-immunopositive cases. We compared TNM-7 and TNM-8 using the Harrell's C index. In total, 388 of 1,204 (32.2%) patients were p16-immunopositive. In these patients, TNM-8 had a markedly better predictive prognostic power than TNM-7 (Harrell's C index 0.63 versus 0.53). Of the 388 p16-positive OPSCCs, 48 tumors (12.4%) were HPV DNA-negative. This subgroup had distinct demographic, clinical and morphologic characteristics and showed a significantly worse five-year overall survival compared to the HPV DNA-positive tumors (P < 0.001). TNM-8 has a better predictive prognostic power than TNM-7 in patients with p16-positive OPSCC. However, within p16-positive OPSCCs there is an HPV DNA-negative subgroup with distinct features and a worse overall survival, indicating the importance to perform additional HPV DNA-testing when predicting prognosis and particularly for selecting patients for de-intensified treatment regimens. © The Author 2018. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

The Smad4/PTEN Expression Pattern Predicts Clinical Outcomes in Colorectal Adenocarcinoma.

PubMed

Chung, Yumin; Wi, Young Chan; Kim, Yeseul; Bang, Seong Sik; Yang, Jung-Ho; Jang, Kiseok; Min, Kyueng-Whan; Paik, Seung Sam

2018-01-01

Smad4 and PTEN are prognostic indicators for various tumor types. Smad4 regulates tumor suppression, whereas PTEN inhibits cell proliferation. We analyzed and compared the performance of Smad4 and PTEN for predicting the prognosis of patients with colorectal adenocarcinoma. Combined expression patterns based on Smad4+/- and PTEN+/- status were evaluated by immunostaining using a tissue microarray of colorectal adenocarcinoma. The relationships between the protein expression and clinicopathological variables were analyzed. Smad4-/PTEN- status was most frequently observed in metastatic adenocarcinoma, followed by primary adenocarcinoma and tubular adenoma (p<.001). When Smad4-/PTEN- and Smad4+/PTEN+ groups were compared, Smad4-/PTEN- status was associated with high N stage (p=.018) and defective mismatch repair proteins (p=.006). Significant differences in diseasefree survival and overall survival were observed among the three groups (Smad4+/PTEN+, Smad4-/PTEN+ or Smad4+/PTEN-, and Smad4-/PTEN-) (all p<.05). Concurrent loss of Smad4 and PTEN may lead to more aggressive disease and poor prognosis in patients with colorectal adenocarcinoma compared to the loss of Smad4 or PTEN alone.

The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.

PubMed

Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang

2017-05-01

This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.

Integrative Analysis Reveals an Outcome-associated and Targetable Pattern of p53 and Cell Cycle Deregulation in Diffuse Large B-cell Lymphoma

PubMed Central

Monti, Stefano; Chapuy, Bjoern; Takeyama, Kunihiko; Rodig, Scott J; Hao, Yangsheng; Yeda, Kelly T.; Inguilizian, Haig; Mermel, Craig; Curie, Treeve; Dogan, Ahmed; Kutok, Jeffery L; Beroukim, Rameen; Neuberg, Donna; Habermann, Thomas; Getz, Gad; Kung, Andrew L; Golub, Todd R; Shipp, Margaret A

2013-01-01

Summary Diffuse large B-cell lymphoma (DLBCL) is a clinically and biologically heterogeneous disease with a high proliferation rate. By integrating copy number data with transcriptional profiles and performing pathway analysis in primary DLBCLs, we identified a comprehensive set of copy number alterations (CNAs) that decreased p53 activity and perturbed cell cycle regulation. Primary tumors either had multiple complementary alterations of p53 and cell cycle components or largely lacked these lesions. DLBCLs with p53 and cell cycle pathway CNAs had decreased abundance of p53 target transcripts and increased expression of E2F target genes and the Ki67 proliferation marker. CNAs of the CDKN2A-TP53-RB-E2F axis provide a structural basis for increased proliferation in DLBCL, predict outcome with current therapy and suggest targeted treatment approaches. PMID:22975378

Impact of HPV infection on oral squamous cell carcinoma.

PubMed

Götz, Carolin; Drecoll, Enken; Straub, Melanie; Bissinger, Oliver; Wolff, Klaus-Dietrich; Kolk, Andreas

2016-11-22

Head and neck squamous cell carcinomas (HNSCC) are often divided by their aetiology. Noxae associated collectives are compared with the human papilloma virus (HPV)-associated group, whereas different localisations of oral (OSCC) and oropharyngeal (OPSCC) squamous cell carcinomas are mostly discussed as one single group. Our aim was to show that classification by aetiology is not appropriate for OSCC. HPV DNA was detected by PCR in 7 (3.47%) patients, and we identified 12 (5.94%) positive (+) cases by p16INK4a immunostaining. Only 4 (1.98%) of the p16INK4a+ cases were + for HPV using PCR. Our homogenous collective of OSCC allowed us to compare HPV+ and HPV negative (-) patients without creating bias for tumour localisation, age, gender or tumour stage. After testing OSCC samples for HPV positivity, we compared the results of two commonly used HPV detection methods, p16INK4a immunostaining and HPV DNA-related PCR, on 202 OSCC patients. HPV subtypes were determined with an HPV LCD Array Kit. Clinicopathological features of the patients were analysed, and the disease specific survival rates (DSS) for HPV+ and HPV- patients were obtained. p16INK4a immunostaining is a not a reliable HPV detection method for OSCC. Positive p16INK4a immunostaining did not agree with + results from PCR of HPV DNA. Furthermore, the influence of HPV-related oncogenic transformation in OSCC is overestimated. The significance of HPV infection remains clinically unclear, and its influence on survival rates is not relevant to OSCC cases.

The minimal carcinoma triple stain is superior to commercially available multiplex immunohistochemical stains: breast triple stain and LC/DC breast cocktail.

PubMed

Ginter, Paula S; Varma, Sonal; Liu, Yi-Fang; Shin, Sandra J

2015-12-01

The Minimal Carcinoma (MC) Triple Stain is a tri-chromogen multiplex immunostain (CK7, p63, and E-cadherin) helpful in classifying morphologically ambiguous and/or small carcinomas as either ductal or lobular and/or in situ or invasive. We compared the utility of this stain with two commercially available duplex/multiplex immunostains: Breast Triple Stain (BTS) (Clarient, Aliso Viejo, CA; CK5, p63, and CK8/18) and LC/DC Breast Cocktail (LCDC) (Biocare, Concord, CA; E-cadherin and p120). Ninety-seven mammary carcinomas stained with the MC Triple Stain, BTS, and LCDC were compared. The MC Triple Stain, LCDC, and BTS were diagnostic in 90 (93%) of 97, 82 (85%) of 97, and 85 (88%) of 97 of cases, respectively. All stains showed decreased diagnostic utility due to variability in tissue integrity, quality of the staining, and/or ease of interpretation. In cases where all immunostains were interpretable, the MC Triple Stain yielded the most information. When technically sufficient, all three immunostains demonstrated relative strengths and weaknesses in their ability to provide diagnostic information with the highest consistency and ease of use. Many cases stained with LCDC were technically insufficient due to a suboptimal staining protocol provided by the company. Overall, the MC Triple Stain outperformed BTS and LCDC by more consistently providing more diagnostic information. The MC Triple Stain is a viable alternative to other multiplex immunostains in evaluating small foci of carcinoma, particularly when both the histologic type and extent of disease (in situ vs invasive) require clarification. Copyright© by the American Society for Clinical Pathology.

Protein expression patterns of cell cycle regulators in operable breast cancer.

PubMed

Zagouri, Flora; Kotoula, Vassiliki; Kouvatseas, George; Sotiropoulou, Maria; Koletsa, Triantafyllia; Gavressea, Theofani; Valavanis, Christos; Trihia, Helen; Bobos, Mattheos; Lazaridis, Georgios; Koutras, Angelos; Pentheroudakis, George; Skarlos, Pantelis; Bafaloukos, Dimitrios; Arnogiannaki, Niki; Chrisafi, Sofia; Christodoulou, Christos; Papakostas, Pavlos; Aravantinos, Gerasimos; Kosmidis, Paris; Karanikiotis, Charisios; Zografos, George; Papadimitriou, Christos; Fountzilas, George

2017-01-01

To evaluate the prognostic role of elaborate molecular clusters encompassing cyclin D1, cyclin E1, p21, p27 and p53 in the context of various breast cancer subtypes. Cyclin E1, cyclin D1, p53, p21 and p27 were evaluated with immunohistochemistry in 1077 formalin-fixed paraffin-embedded tissues from breast cancer patients who had been treated within clinical trials. Jaccard distances were computed for the markers and the resulted matrix was used for conducting unsupervised hierarchical clustering, in order to identify distinct groups correlating with prognosis. Luminal B and triple-negative (TNBC) tumors presented with the highest and lowest levels of cyclin D1 expression, respectively. By contrast, TNBC frequently expressed Cyclin E1, whereas ER-positive tumors did not. Absence of Cyclin D1 predicted for worse OS, while absence of Cyclin E1 for poorer DFS. The expression patterns of all examined proteins yielded 3 distinct clusters; (1) Cyclin D1 and/or E1 positive with moderate p21 expression; (2) Cyclin D1 and/or E1, and p27 positive, p53 protein negative; and, (3) Cyclin D1 or E1 positive, p53 positive, p21 and p27 negative or moderately positive. The 5-year DFS rates for clusters 1, 2 and 3 were 70.0%, 79.1%, 67.4% and OS 88.4%, 90.4%, 78.9%, respectively. It seems that the expression of cell cycle regulators in the absence of p53 protein is associated with favorable prognosis in operable breast cancer.

Uterine Serous Carcinomas Frequently Metastasize to the Fallopian Tube and Can Mimic Serous Tubal Intraepithelial Carcinoma.

PubMed

Kommoss, Friedrich; Faruqi, Asma; Gilks, C Blake; Lamshang Leen, Sarah; Singh, Naveena; Wilkinson, Nafisa; McCluggage, W Glenn

2017-02-01

We investigated the frequency, histopathologic, and immunohistochemical characteristics of tubal involvement in uterine serous carcinoma (USC) and aimed to clarify the relationship between "serous tubal intraepithelial carcinoma (STIC)" and USC in these cases. Cases of USC with complete tubal examination were prospectively collected and reviewed for the presence of tubal involvement. Immunohistochemical analysis for p53 and WT1 was performed on the endometrial and tubal tumor in cases with tubal involvement. Of 161 USC cases (pure USC or a component of a mixed carcinoma or a carcinosarcoma), 32 (20%) showed tubal involvement (unilateral: n=19; bilateral: n=13). The uterine tumors in cases with tubal involvement showed a trend toward increased likelihood of deep myometrial and lymphovascular invasion (LVI) compared with those without tubal involvement. The tubal fimbriae were involved in 15/32 cases. Tubal involvement was mucosal in 30/32 cases, mural in 14/32, serosal in 5/32, invasive in 22/32, and there was LVI in the tube in 13/32. STIC-like features were seen in 17/32 cases (7 as the only pattern of involvement, 9 with associated invasive carcinoma, and 5 with LVI). Immunostaining showed complete concordance of p53 and WT1 between the endometrial and tubal tumors in 26/32 cases, the majority being WT1 negative or only focally positive (19/26), and all exhibiting mutation-type p53 staining. On the basis of the histologic and immunohistochemical features, the tubal tumor was considered to represent metastatic USC in 26/32 cases, most likely metastatic USC in 2/32 cases, an independent tubal primary tumor in 3/32 cases, and to be of uncertain origin in the 1 remaining case. STIC-like lesions were considered to represent metastatic USC in 12/17 cases, most likely metastatic USC in 2/17 cases, an independent tubal primary in 2/17 cases, and of uncertain origin in the 1 remaining case. Tubal involvement, including STIC-like lesions, is seen in one fifth of USC when the tubes are examined in their entirety. The tubal involvement is metastatic in the vast majority of cases. Immunohistochemical studies assist, in most cases, in confirming the metastatic nature of the tubal disease. Consideration should be given to completely examining the fallopian tubes in apparent stage I or II USCs, as this will result in upstaging in a significant minority of cases.

Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma

PubMed Central

Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong

2007-01-01

Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291

Low rate of apoptosis and overexpression of bcl-2 in Epstein-Barr virus-associated gastric carcinoma.

PubMed

Kume, T; Oshima, K; Shinohara, T; Takeo, H; Yamashita, Y; Shirakusa, T; Kikuchi, M

1999-06-01

Epstein-Barr virus (EBV) has been demonstrated in about 10% of gastric carcinomas. However, the pathogenetic role of EBV in gastric carcinoma is uncertain. We compared the rate of apoptotic cell death, cell proliferation and the expression of apoptosis-related proteins in gastric carcinomas with or without EBV. Epstein-Barr virus was detected in 40 gastric carcinomas by EBV-encoded small RNA-1 in-situ hybridization. Apoptotic cell death, MIB-1, p53, bcl-2 and bcl-x were examined by the terminal deoxynucleotidyl-mediated dUTP-nick end labelling method and immunohistochemistry. We also included 40 age-, sex- and disease stage-matched EBV-negative cases as a control. The number of apoptotic cells was significantly lower in EBV-positive (20 +/- 15. 1/1000 cells) and bcl-2-positive (17 +/- 12.9/1000 cells) tumours than in EBV-negative (43 +/- 37.1) and bcl-2-negative tumours (38 +/- 32.1, P < 0.001, P < 0.001, respectively). bcl-2 immunostaining was significantly higher in EBV-positive tumours (24 cases) than in EBV-negative tumours (12 cases, P < 0.05). There was no significant difference in bcl-x and p53 expression between EBV-positive and -negative tumours. The number of MIB-1-positive cells in EBV-positive tumours (237 +/- 161/1000) was significantly lower than in EBV-negative tumours (480 +/- 208/1000 cells, P < 0.001). A low rate of apoptosis and high bcl-2 expression were recognized in EBV-positive gastric carcinomas, suggesting that bcl-2 protein is the main inhibitor of apoptosis in EBV-positive carcinomas. In addition, the low apoptotic and proliferative activities may reflect a low biological activity in EBV-positive gastric carcinomas.

Immunohistochemical expression of p53 and its clinicopathological correlation with modified Anneroth's histological grading system.

PubMed

Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G

2016-01-01

Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. The results obtained were analyzed using Spearman's Co-relation. The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found.

The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

PubMed

Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

2018-06-01

The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

Molecular and morphologic correlates of the alternative lengthening of telomeres phenotype in high-grade astrocytomas.

PubMed

Nguyen, Doreen N; Heaphy, Christopher M; de Wilde, Roeland F; Orr, Brent A; Odia, Yazmin; Eberhart, Charles G; Meeker, Alan K; Rodriguez, Fausto J

2013-05-01

Recent studies suggest that the telomere maintenance mechanism known as alternative lengthening of telomeres (ALT) is relatively more common in specific glioma subsets and strongly associated with ATRX mutations. We retrospectively examined 116 high-grade astrocytomas (32 pediatric glioblastomas, 65 adult glioblastomas, 19 anaplastic astrocytomas) with known ALT status using tissue microarrays to identify associations with molecular and phenotypic features. Immunohistochemistry was performed using antibodies against ATRX, DAXX, p53 and IDH1(R132H) mutant protein. EGFR amplification was evaluated by fluorescence in situ hybridization (FISH). Almost half of fibrillary and gemistocytic astrocytomas (44%) demonstrated ALT. Conversely all gliosarcomas (n = 4), epithelioid (n = 2), giant cell (n = 2) and adult small cell astrocytomas (n = 7) were ALT negative. The ALT phenotype was positively correlated with the presence of round cells (P = 0.002), microcysts (P < 0.0002), IDH1 mutant protein (P < 0.0001), ATRX protein loss (P < 0.0001), strong P53 immunostaining (P < 0.0001) and absence of EGFR amplification (P = 0.004). There was no significant correlation with DAXX expression. We conclude that ALT represents a specific phenotype in high-grade astrocytomas with distinctive pathologic and molecular features. Future studies are required to clarify the clinical and biological significance of ALT in high-grade astrocytomas. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO

PubMed Central

XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.

2015-01-01

The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern of the mitochondrial redox state in colon cancer and the first to indicate that at tissue level the mitochondrial redox state is p53 dependent. The findings should assist in our understanding on colon cancer pathology and developing new imaging biomarkers for clinical applications. PMID:26207147

The Smad4/PTEN Expression Pattern Predicts Clinical Outcomes in Colorectal Adenocarcinoma

PubMed Central

Chung, Yumin; Wi, Young Chan; Kim, Yeseul; Bang, Seong Sik; Yang, Jung-Ho; Jang, Kiseok; Min, Kyueng-Whan; Paik, Seung Sam

2018-01-01

Background Smad4 and PTEN are prognostic indicators for various tumor types. Smad4 regulates tumor suppression, whereas PTEN inhibits cell proliferation. We analyzed and compared the performance of Smad4 and PTEN for predicting the prognosis of patients with colorectal adenocarcinoma. Methods Combined expression patterns based on Smad4+/– and PTEN+/– status were evaluated by immunostaining using a tissue microarray of colorectal adenocarcinoma. The relationships between the protein expression and clinicopathological variables were analyzed. Results Smad4–/PTEN– status was most frequently observed in metastatic adenocarcinoma, followed by primary adenocarcinoma and tubular adenoma (p<.001). When Smad4–/PTEN– and Smad4+/PTEN+ groups were compared, Smad4–/PTEN– status was associated with high N stage (p=.018) and defective mismatch repair proteins (p=.006). Significant differences in diseasefree survival and overall survival were observed among the three groups (Smad4+/PTEN+, Smad4–/PTEN+ or Smad4+/PTEN–, and Smad4–/PTEN–) (all p<.05). Conclusions Concurrent loss of Smad4 and PTEN may lead to more aggressive disease and poor prognosis in patients with colorectal adenocarcinoma compared to the loss of Smad4 or PTEN alone. PMID:29056035

EBV-Negative Monomorphic B-Cell Posttransplant Lymphoproliferative Disorder with Marked Morphologic Pleomorphism and Pathogenic Mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53.

PubMed

Bogusz, Agata M

2017-01-01

Posttransplant lymphoproliferative disorders (PTLDs) are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV). EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL) 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL) with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1), and EBV-encoded RNA (EBER). Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH) were negative for cMYC , BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS) revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53 (x2) genes and 30 variants of unknown significance (VOUS) in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2.

EBV-Negative Monomorphic B-Cell Posttransplant Lymphoproliferative Disorder with Marked Morphologic Pleomorphism and Pathogenic Mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53

PubMed Central

2017-01-01

Posttransplant lymphoproliferative disorders (PTLDs) are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV). EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL) 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL) with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1), and EBV-encoded RNA (EBER). Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH) were negative for cMYC, BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS) revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53(x2) genes and 30 variants of unknown significance (VOUS) in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2. PMID:28487787

Structure and Kinetic Stability of the p63 Tetramerization Domain

PubMed Central

Natan, Eviatar; Joerger, Andreas C.

2012-01-01

The p53 family of transcription factors—comprising p53, p63 and p73—plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D2 symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. PMID:22100306

Familial Breast/Ovarian Cancer and BRCA1/2 Genetic Screening: The Role of Immunohistochemistry as an Additional Method in the Selection of Patients

PubMed Central

Vaz, Fátima H.; Machado, Patrícia M.; Brandão, Rita D.; Laranjeira, Cátia T.; Eugénio, Joana S.; Fernandes, Aires H.; André, Saudade P.

2007-01-01

Only 20–25% of families screened for BRCA1/2 mutations are found positive. Because only a positive result is informative, we studied the role of BRCA1/2 immunohistochemistry as an additional method for patient selection. From 53 high-risk-affected probands, 18 (34%) had available paraffin blocks of their tumors and were selected for this study. Mutation screening was done by conformation-sensitive gel electrophoresis and multiplex ligation-dependent probe amplification. For immunohistochemistry, 21 neoplastic specimens (15 breast carcinomas, 5 ovary neoplasms, and 1 rectal adenocarcinoma) were analyzed with BRCA1 (monoclonal antibody, Ab-1, oncogene) and BRCA2 (polyclonal antibody, Ab-2, oncogene) antibodies. Absence of the BRCA1 protein was confirmed in negative tumors by Western blotting. Seven patients were positive for BRCA1/2 mutations: 5 for BRCA1 and 2 for BRCA2. Four out of five positive patients had tumors negative for BRCA1 immunostaining, and the remaining 13 BRCA1-negative patients had positive BRCA1 immunostaining in all tumor samples. Sensitivity to predict for BRCA1 mutation carriers was 80%, and specificity was 100%, with a positive predictive value of 100% and a negative predictive value of 93%. This correlation was statistically significant (p=0.001). No correlation was observed for BRCA2. If larger studies confirm these results, high-risk patients with BRCA1-negative tumors should be screened first for this gene. PMID:17625228

Characterization of pituitary cells targeted by antipituitary antibodies in patients with isolated autoimmune diseases without pituitary insufficiency may help to foresee the kind of future hypopituitarism.

PubMed

De Bellis, A; Dello Iacovo, A; Bellastella, G; Savoia, A; Cozzolino, D; Sinisi, A A; Bizzarro, A; Bellastella, A; Giugliano, D

2014-10-01

Detection of antipituitary antibodies (APA) at high levels and with a particular immunofluorescence pattern in patients with autoimmune polyendocrine syndromes may indicate a possible future autoimmune pituitary involvement. This longitudinal study was aimed at characterizing in patients with a single organ-specific autoimmune disease the pituitary cells targeted by APA at start, verifying whether this characterization allows to foresee the kind of possible subsequent hypopituitarism. Thirty-six APA positive and 40 APA negative patients with isolated autoimmune diseases participated in the study. None of them had pituitary dysfunction at entry. Characterization by four-layer immunofluorescence of pituitary cells targeted by APA in APA positive patients at entry and study of pituitary function in all patients were performed every 6 months during a 5 year follow-up. Antipituitary antibodies immunostained selectively one type of pituitary-secreting cells in 21 patients (58.3 %, group 1), and several types of pituitary cells in the remaining 15 (41.7 %, group 2). All patients in group 1 showed subsequently a pituitary insufficiency, corresponding to the type of cells targeted by APA in 18 of them (85.7 %). Only 8 out of 15 patients in group 2 (53.3 %) showed a hypopituitarism, isolated in 7 and combined in the other one. None of APA negative patients showed hypopituitarism. The characterization of pituitary cells targeted by APA in patients with isolated autoimmune diseases, when the pituitary function is still normal, may help to foresee the kind of subsequent hypopituitarism, especially when APA immunostained selectively only one type of pituitary cells. A careful follow-up of pituitary function in these patients is advisable to allow an early diagnosis of hypopituitarism, even in subclinical phase and a consequent timely replacement therapy.

A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

PubMed

Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

2002-08-22

A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

Comparison of human papillomavirus detection between freshly frozen tissue and paraffin embedded tissue of invasive cervical cancer

PubMed Central

2010-01-01

Background Human Papillomavirus (HPV) detection results comparing paraffin embedded cervical tissue and other cervical specimens have been done with varying degrees of agreement. However, studies comparing freshly frozen specimens and paraffin embedded specimens of invasive cervical carcinomas are lacking. The aim of the study was to compare HPV detection using SPF10 broad-spectrum primers PCR followed by DEIA and genotyping by LiPA25 (version 1) between freshly frozen cervical tissue samples and paraffin embedded blocks of cervical tissue from the same patient. There were 171 pairs of paraffin embedded and freshly frozen samples analyzed from cervical carcinoma cases from Kampala, Uganda. Results 88.9% (95% CI: 83.2%-93.2%) of paraffin embedded samples were HPV positive compared with 90.1% (95% CI: 84.6%-94.1%) of freshly frozen samples, giving an overall agreement in HPV detection between fresh tissue and paraffin embedded tissue at 86.0% (95% CI: 79.8%-90.8%). Although the proportion of HPV positive cases in freshly frozen tissue was higher than those in paraffin blocks, the difference was not statistically significant (p > 0.05). In both types of tissues, single HPV infections were predominant, with HPV16 accounting for 47% of positive cases. Comparison in the overall agreement, taking into accounts not only positivity in general, but also HPV types, showed a 65% agreement (complete agreement of 59.7%, partial agreement of 5.3%) and complete disagreement of 35.0%. HPV detection in squamous cell carcinomas (SCC) and adenocarcinomas (ADC) was similar in fresh tissue or paraffin blocks (p ≥ 0.05). p16 immunostaining in samples that had at least one HPV negative results showed that 24 out of 25 cases had an over-expressed pattern. Conclusions HPV DNA detection was lower among ADC as compared to SCC. However, such differences were minimized when additional p16 testing was added, suggesting that the technical issues may largely explain the HPV negative cases. PMID:20846370

CDX2 immunostaining in primary and metastatic germ cell tumours of the testis.

PubMed

Oz Atalay, Fatma; Aytac Vuruskan, Berna; Vuruskan, Hakan

2016-12-01

Objective To evaluate the immunohistochemical staining pattern of caudal type homeobox 2 (CDX2) protein in germ cell tumours (GCTs) of the testis. Methods This study reassessed archival tissue samples collected from patients diagnosed with primary and metastatic testicular GCTs for CDX2 immunoreactivity using standard immunohistochemical techniques. Positive nuclear immunostaining was evaluated with regard to both the staining intensity and the extent of the staining. Results Tissue sections from primary and metastatic testicular GCTs ( n = 104), germ cell neoplasia in situ (GCNis) ( n = 5) and benign testicles ( n = 15) were analysed. The GCNis and benign testicular tissues showed no immunoreactivity for CDX2. Strong and diffuse staining of CDX2 was demonstrated only in the mature colonic epithelium of teratomas in both primary and metastatic GCTs. CDX2 positivity in other tumours (one pure yolk sac tumour, one yolk sac component of a mixed GCT and one pure seminoma) was infrequent, and was only weak and focal. Conclusions CDX2 immunostaining should be interpreted based on both the staining intensity and the extent of staining so as not to cause misdiagnosis. Teratomas with colonic-type epithelium should be considered in the differential diagnosis if a metastatic tumour with an unknown primary shows prominent CDX2 immunostaining.

Polygon on Mars

NASA Technical Reports Server (NTRS)

2008-01-01

This image shows a small-scale polygonal pattern in the ground near NASA's Phoenix Mars Lander. This pattern is similar in appearance to polygonal structures in icy ground in the arctic regions of Earth.

Phoenix touched down on the Red Planet at 4:53 p.m. Pacific Time (7:53 p.m. Eastern Time), May 25, 2008, in an arctic region called Vastitas Borealis, at 68 degrees north latitude, 234 degrees east longitude.

This image was acquired by the Surface Stereo Imager shortly after landing. On the Phoenix mission calendar, landing day is known as Sol 0, the first Martian day of the mission.

The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

A 9-protein biomarker molecular signature for predicting histologic type in endometrial carcinoma by immunohistochemistry.

PubMed

Santacana, Maria; Maiques, Oscar; Valls, Joan; Gatius, Sònia; Abó, Ana Isabel; López-García, María Ángeles; Mota, Alba; Reventós, Jaume; Moreno-Bueno, Gema; Palacios, Jose; Bartosch, Carla; Dolcet, Xavier; Matias-Guiu, Xavier

2014-12-01

Histologic typing may be difficult in a subset of endometrial carcinoma (EC) cases. In these cases, interobserver agreement improves when immunohistochemistry (IHC) is used. A series of endometrioid type (EEC) grades 1, 2, and 3 and serous type (SC) were immunostained for p53, p16, estrogen receptor, PTEN, IMP2, IMP3, HER2, cyclin B2 and E1, HMGA2, FolR1, MSLN, Claudins 3 and 4, and NRF2. Nine biomarkers showed significant differences with thresholds in IHC value scale between both types (p53 ≥ 20, IMP2 ≥ 115, IMP3 ≥ 2, cyclin E1 ≥ 220, HMGA2 ≥ 30, FolR1 ≥ 50, p16 ≥ 170, nuclear PTEN ≥ 2 and estrogen receptor ≤ 50; P < .005). This combination led to increased discrimination when considering cases satisfying 0 to 5 conditions predicted as EEC and those satisfying 6 to 9 conditions predicted as SC. This signature correctly predicted all 48 EEC grade 1-2 cases and 18 SC cases, but 3 SC cases were wrongly predicted as EEC. Sensitivity was 86% (95% confidence interval [CI], 64%-97%), and specificity was 100% (95% CI, 89%-100%). The classifier correctly predicted all 28 EEC grade 3 cases but only identified the EEC and SC components in 4 of 9 mixed EEC-SC. An independent validation series (29 EEC grades 1-2, 28 EEC grade 3, and 31 SC) showed 100% sensitivity (95% CI, 84%-100%) and 83% specificity (95% CI, 64%-94%). We propose an internally and externally validated 9-protein biomarker signature to predict the histologic type of EC (EEC or SC) by IHC. The results also suggest that mixed EEC-SC is molecularly ambiguous. Copyright © 2014 Elsevier Inc. All rights reserved.

Simultaneous immunostaining with anti-S100P and anti-SV40 antibodies revealed the origin of BK virus-infected decoy cells in voided urine samples.

PubMed

Ariyasu, S; Yanai, H; Sato, M; Shinno, Y; Taniguchi, K; Yamadori, I; Miki, Y; Sato, Y; Yoshino, T; Takahashi, K

2015-08-01

Methods for determining the origin of BK virus (BKV)-infected cells (decoy cells) in clinical urine samples have not been established although they could enhance the diagnosis of BKV infection in immunocompromised patients. We performed simultaneous immunostaining with anti-S100P (a urothelial marker) and anti-SV40 antibodies in 66 clinical urine samples exhibiting SV40 positivity and a decoy-cell appearance on Papanicolaou staining. The clinical voided urine samples included seven cases of renal transplantation, 47 cases of cancer therapy and 12 cases of non-neoplastic disease. SurePath(™) liquid-based cytology was used for the urine samples. BKV-infected cells were categorized as SV40(+)/S100P(+) and SV40 (+)/S100p(-). SV40(+)/S100P(-) cells were found in 55 cases (83.4%); nine cases (13.6%) carried both SV40(+)/S100P(-) and SV40(+)/S100P(+) cells. The former were identified as BKV infection in renal tubules and the latter in both the renal tubules and urothelial epithelia. The remaining two cases (3.0%) had only SV40(+)/S100P(+) cells of urothelial origin. Simultaneous immunostaining with anti-S100P and anti-SV40 is a useful method for determining the origin of BKV-infected cells in clinical urine samples from immunocompromised patients such as renal transplantation recipients. © 2014 John Wiley & Sons Ltd.

Detection of lymphovascular invasion by D2-40 (podoplanin) immunoexpression in endometrial cancer.

PubMed

Weber, Sarah K; Sauerwald, Axel; Pölcher, Martin; Braun, Michael; Debald, Manuel; Serce, Nuran Bektas; Kuhn, Walther; Brunagel-Walgenbach, Giesela; Rudlowski, Christian

2012-10-01

Lymph node involvement is a major feature in tumor spread of endometrial cancer and predicts prognosis. Therefore, evaluation of lymph vessel invasion (LVI) in tumor tissue as a predictor for lymph node metastasis is of great importance. Immunostaining of D2-40 (podoplanin), a specific marker for lymphatic endothelial cells, might be able to increase the detection rate of LVI compared with conventional hematoxylin-eosin (H-E) staining. The aim of this retrospective study was to analyze the eligibility of D2-40-based LVI evaluation for the prediction of lymph node metastases and patients' outcome. Immunohistochemical staining with D2-40 monoclonal antibodies was performed on paraffin-embedded tissue sections of 182 patients with primary endometrioid adenocarcinoma treated in 1 gynecologic cancer center. Tumors were screened for the presence of LVI. Correlations with clinicopathological features and clinical outcome were assessed. Immunostaining of D2-40 significantly increased the frequency LVI detection compared with conventional H-E staining. Lymph vessel invasion was identified by D2-40 in 53 (29.1%) of 182 tumors compared with 34 (18.3%) of 182 carcinomas by routine H-E staining (P = 0.001). D2-40 LVI was detectable in 81.0% (17/21) of nodal-positive tumors and significantly predicted lymph node metastasis (P = 0.001). Furthermore, D2-40 LVI was an independent prognostic factor for patients overall survival considering tumor stage, lymph node involvement, and tumor differentiation (P < 0.01). D2-40-negative tumors confined to the inner half of the myometrium showed an excellent outcome (5-year overall survival, 97.8%). D2-40-based LVI assessment improves the histopathological detection of lymphovascular invasion in endometrial cancer. Furthermore, LVI is of prognostic value and predicts lymph node metastasis. D2-40 LVI detection might help to select endometrial cancer patients who will benefit from a lymphadenectomy.

NBCe1 (SLC4A4) a potential pH Regulator in Enamel Organ Cells during Enamel Development in the Mouse

PubMed Central

Jalali, R; Guo, J; Zandieh-Doulabi, B; Bervoets, TJM; Paine, ML; Boron, W; Parker, M; Bijvelds, MJC; Medina, JF; DenBesten, PK; Bronckers, ALJJ

2016-01-01

During formation of dental enamel maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by co-transporting HCO3− with Na+. Mutation in SLC4A4 (coding for the Na+ bicarbonate co-transporter NBCe1) induces developmental defects in human and murine enamel. We hypothesized that NBCe1 in dental epithelium is engaged in neutralizing protons released during crystal formation in the enamel space. We immunolocalized NBCe1 protein in mouse wild-type dental epithelium and examined the effect of NBCe1-null mutation on enamel formation in mice. Ameloblasts expressed gene transcripts for NBCe1 isoforms B/D/C/E. In wild-type mice weak to moderate immunostaining for NBCe1 with antibodies that recognize isoforms A/B/D/E and isoform C was seen in ameloblasts in secretory stage, no or very low staining in early maturation-stage but moderately to high staining in late maturation-stage. The papillary layer showed the opposite pattern and immunostained prominently at early maturation-stage but gradually showed less staining at mid- and late maturation-stage. In NBCe1−/− mice ameloblasts were disorganized, the enamel thin and severely hypomineralized. Enamel organs of CFTR−/− and AE2a,b−/− mice (believed to be pH regulators in ameloblasts) contained higher levels of NBCe1 protein than wild-type mice. Our data show that expression of NBCe1 in ameloblast and papillary layer cell depends on developmental stage and possibly responds to pH changes. PMID:25012520

Cost analysis of different cervical cancer screening strategies in Mexico.

PubMed

Beal, Christyn M; Salmerón, Jorge; Flores, Yvonne N; Torres, Leticia; Granados-García, Víctor; Dugan, Ellen; Lazcano-Ponce, Eduardo

2014-01-01

To compare the costs and number of undetected cases of four cervical cancer screening strategies (CCSS) in Mexico. We estimated the costs and outcomes of the following CCSS: a) conventional Papanicolaou smear (Pap) alone; b) high-risk human papilloma virus testing (HR-HPV) as primary screening with Pap as reflex triage; c) HR-HPV as primary screening with HPV-16/18 typing, liquid-based cytology (LBC) and immunostaining for p16/Ki67 testing as reflex triage, and d) co-testing with HR-HPV and LBC with HPV-16/18 typing and immunostaining for p16/Ki67 as reflex triage. The outcome of interest was high-grade cervical lesions or cervical cancer. HR-HPV testing, HPV typing, LBC testing and immunostaining is the best alternative because it is the least expensive option with an acceptable number of missed cases. The opportunity costs of a poor quality CCSS is many false negatives. Combining multiple tests may be a more cost-effective way to screen for cervical cancer in Mexico.

Expression of miR-34c in response to overexpression of Boule and Stra8 in dairy goat male germ line stem cells (mGSCs).

PubMed

Li, Mingzhao; Yu, Meng; Liu, Chao; Zhu, Haijing; Hua, Jinlian

2013-06-01

Reproduction is required for the survival of all mammalian animals. Spermatogenesis is an essential and complex developmental process that ultimately results in production of haploid spermatozoa. Recent studies demonstrated that Boule and stimulated by retinoic acid 8 (Stra8) played important roles in initiation meiosis in male germ cells. miR-34c is indispensable in the late steps of spermatogenesis; remarkably, the main function of miR-34c is to reduce cell proliferation potentiality and promote cellular apoptosis. The objectives of this study were to investigate the expression patterns of Boule, Stra8, P53 and miR-34c in dairy goat testis and their relationship in male germ line stem cells (mGSCs). The results first revealed the expression patterns of Boule, Stra8, P53 and miR-34c in 30 dpp, 90 dpp and adult testes of dairy goats. The expression levels of Boule, Stra8, P53 and miR-34c in adult dairy goat testes were significantly higher than that of 30 dpp. Overexpression of Boule and Stra8 promoted the expression of miR-34c in dairy goat mGSCs. In our previous study, we showed that miR-34c was P53 dependent in mGSCs. These results have shown that the up-regulation of miR-34c was not due to P53 protein activation but which might be caused by the up-regulation of Boule and Stra8 promoting the advance of meiosis. In addition, we found retinoic acid would decrease the expression of P53 and miR-34c, however, did not change the expression of c-Myc greatly. It suggested that the function of driving differentiation of dairy goat mGSCs by retinoic acid might not be caused by P53. Copyright © 2013 John Wiley & Sons, Ltd.

CHK1-targeted therapy to deplete DNA replication-stressed, p53-deficient, hyperdiploid colorectal cancer stem cells

PubMed Central

Russo, Giorgio; Corradi, Francesca; Siteni, Silvia; Musella, Martina; Vitale, Sara; De Angelis, Maria Laura; Pallocca, Matteo; Amoreo, Carla Azzurra; Sperati, Francesca; Di Franco, Simone; Barresi, Sabina; Policicchio, Eleonora; De Luca, Gabriele; De Nicola, Francesca; Mottolese, Marcella; Zeuner, Ann; Fanciulli, Maurizio; Stassi, Giorgio; Maugeri-Saccà, Marcello; Baiocchi, Marta; Tartaglia, Marco

2018-01-01

Objective Cancer stem cells (CSCs) are responsible for tumour formation and spreading, and their targeting is required for tumour eradication. There are limited therapeutic options for advanced colorectal cancer (CRC), particularly for tumours carrying RAS-activating mutations. The aim of this study was to identify novel CSC-targeting strategies. Design To discover potential therapeutics to be clinically investigated as single agent, we performed a screening with a panel of FDA-approved or investigational drugs on primary CRC cells enriched for CSCs (CRC-SCs) isolated from 27 patients. Candidate predictive biomarkers of efficacy were identified by integrating genomic, reverse-phase protein microarray (RPPA) and cytogenetic analyses, and validated by immunostainings. DNA replication stress (RS) was increased by employing DNA replication-perturbing or polyploidising agents. Results The drug-library screening led to the identification of LY2606368 as a potent anti-CSC agent acting in vitro and in vivo in tumour cells from a considerable number of patients (∼36%). By inhibiting checkpoint kinase (CHK)1, LY2606368 affected DNA replication in most CRC-SCs, including RAS-mutated ones, forcing them into premature, lethal mitoses. Parallel genomic, RPPA and cytogenetic analyses indicated that CRC-SCs sensitive to LY2606368 displayed signs of ongoing RS response, including the phosphorylation of RPA32 and ataxia telangiectasia mutated serine/threonine kinase (ATM). This was associated with mutation(s) in TP53 and hyperdiploidy, and made these CRC-SCs exquisitely dependent on CHK1 function. Accordingly, experimental increase of RS sensitised resistant CRC-SCs to LY2606368. Conclusions LY2606368 selectively eliminates replication-stressed, p53-deficient and hyperdiploid CRC-SCs independently of RAS mutational status. These results provide a strong rationale for biomarker-driven clinical trials with LY2606368 in patients with CRC. PMID:28389531

Structure and kinetic stability of the p63 tetramerization domain.

PubMed

Natan, Eviatar; Joerger, Andreas C

2012-01-20

The p53 family of transcription factors--comprising p53, p63 and p73--plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D₂ symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. Copyright © 2011 Elsevier Ltd. All rights reserved.

p21 controls patterning but not homologous recombination in RPE development.

PubMed

Bishop, A J R; Kosaras, B; Hollander, M C; Fornace, A; Sidman, R L; Schiestl, R H

2006-01-05

p21/WAF1/CIP1/MDA6 is a key cell cycle regulator. Cell cycle regulation is an important part of development, differentiation, DNA repair and apoptosis. Following DNA damage, p53 dependent expression of p21 results in a rapid cell cycle arrest. p21 also appears to be important for the development of melanocytes, promoting their differentiation and melanogenesis. Here, we examine the effect of p21 deficiency on the development of another pigmented tissue, the retinal pigment epithelium. The murine mutation pink-eyed unstable (p(un)) spontaneously reverts to a wild-type allele by homologous recombination. In a retinal pigment epithelium cell this results in pigmentation, which can be observed in the adult eye. The clonal expansion of such cells during development has provided insight into the pattern of retinal pigment epithelium development. In contrast to previous results with Atm, p53 and Gadd45, p(un) reversion events in p21 deficient mice did not show any significant change. These results suggest that p21 does not play any role in maintaining overall genomic stability by regulating homologous recombination frequencies during development. However, the absence of p21 caused a distinct change in the positions of the reversion events within the retinal pigment epithelium. Those events that would normally arrest to produce single cell events continued to proliferate uncovering a cell cycle dysregulation phenotype. It is likely that p21 is involved in controlling the developmental pattern of the retinal pigment. We also found a C57BL/6J specific p21 dependent ocular defect in retinal folding, similar to those reported in the absence of p53.

Diagnostic reproducibility of hydatidiform moles: ancillary techniques (p57 immunohistochemistry and molecular genotyping) improve morphologic diagnosis.

PubMed

Vang, Russell; Gupta, Mamta; Wu, Lee-Shu-Fune; Yemelyanova, Anna V; Kurman, Robert J; Murphy, Kathleen M; Descipio, Cheryl; Ronnett, Brigitte M

2012-03-01

Distinction of hydatidiform moles (HMs) from nonmolar specimens (NMs) and subclassification of HMs as complete hydatidiform moles (CHMs) and partial hydatidiform moles (PHMs) are important for clinical practice and investigational studies; yet, diagnosis based solely on morphology is affected by interobserver variability. Molecular genotyping can distinguish these entities by discerning androgenetic diploidy, diandric triploidy, and biparental diploidy to diagnose CHMs, PHMs, and NMs, respectively. Eighty genotyped cases (27 CHMs, 27 PHMs, and 26 NMs) were selected from a series of 200 potentially molar specimens previously diagnosed using p57 immunostaining and genotyping. Cases were classified by 3 gynecologic pathologists on the basis of H&E slides (masked to p57 immunostaining and genotyping results) into 1 of 3 categories (CHM, PHM, or NM) during 2 diagnostic rounds; a third round incorporating p57 immunostaining results was also conducted. Consensus diagnoses (those rendered by 2 of 3 pathologists) were determined. Genotyping results were used as the gold standard for assessing diagnostic performance. Sensitivity of a diagnosis of CHM ranged from 59% to 100% for individual pathologists and from 70% to 81% by consensus; specificity ranged from 91% to 96% for individuals and from 94% to 98% by consensus. Sensitivity of a diagnosis of PHM ranged from 56% to 93% for individual pathologists and from 70% to 78% by consensus; specificity ranged from 58% to 92% for individuals and from 74% to 85% by consensus. The percentage of correct classification of all cases by morphology ranged from 55% to 75% for individual pathologists and from 70% to 75% by consensus. The κ values for interobserver agreement ranged from 0.59 to 0.73 (moderate to good) for a diagnosis of CHM, from 0.15 to 0.43 (poor to moderate) for PHM, and from 0.13 to 0.42 (poor to moderate) for NM. The κ values for intraobserver agreement ranged from 0.44 to 0.67 (moderate to good). Addition of the p57 immunostain improved sensitivity of a diagnosis of CHM to a range of 93% to 96% for individual pathologists and 96% by consensus; specificity was improved from a range of 96% to 98% for individual pathologists and 96% by consensus; there was no substantial impact on diagnosis of PHMs and NMs. Interobserver agreement for interpretation of the p57 immunostain was 0.96 (almost perfect). Even with morphologic assessment by gynecologic pathologists and p57 immunohistochemistry, 20% to 30% of cases will be misclassified, and, in particular, distinction of PHMs and NMs will remain problematic.

Immunohistochemical expression of CK7, CK5/6, CK19, and p63 in Warthin tumor.

PubMed

Dăguci, Luminiţa; Stepan, A; Mercuţ, Veronica; Dăguci, C; Bătăiosu, Marilena; Florescu, Alma

2012-01-01

Our study included a number of 24 cases with Warthin tumor, diagnosed between 2007-2011, which were analyzed in terms of clinical, histopathological and immunohistochemistry point of view, using CK7, CK5/6, CK19, and p63 antibodies. Warthin tumor is most often a tumor with a slow evolution, painless, usually affecting males (M/F 3.2/1) in the seventh decade of life. Histopathologically, it is distinguished the predominance of the typical forms of the tumor, with a balanced ratio epithelium/stroma. The immunostaining for CK7 showed positivity in all the investigated cases both in the columnar luminal cells and basal cells. The immunostaining for CK5/6 was positive in all the investigated cases in bilayer epithelial basal cells, both in the structure of the cysts and the papillae. In the case of the immunostaining for p63 we noticed limited nuclear positivity in the basal cells, while the columnar cells' nucleus were negative. The immunohistochemical study of the bilayer epithelial component of Warthin tumor showed different immunstaining of the two types of epithelia, the oncocytary columnar and the basal on, similar to those found in the salivary gland ducts.

Effect of hypothermia on doxorubicin-induced cardiac myoblast signaling and cell death.

PubMed

L'Ecuyer, Thomas J; Aggarwal, Sanjeev; Zhang, Jiang Ping; Van der Heide, Richard S

2012-01-01

Anthracyclines (AC) are useful chemotherapeutic agents whose principal limitation is cardiac toxicity, which may progress to heart failure, transplantation or even death. We have shown that this toxicity involves oxidative stress-induced activation of the DNA damage pathway. Hypothermia has been shown to be protective against other diseases involving oxidative stress but has not been studied in models of AC toxicity. In the current experiments, H9C2 cardiac myoblasts were treated with varying concentrations of the AC doxorubicin (DOX) during normothermia (37°C) or mild hypothermia (35°C). Total cell death was assayed using trypan blue exclusion and apoptosis by terminal deoxynucleotidyl transferase-mediated deoxyuridine-biotin nick end labeling (TUNEL) staining. Oxidative stress was assayed using the fluorescent indicator 2'7'-dichlorofluorescein diacetate. DNA damage pathway activation was assayed by immunostaining for H2AX and p53. Mitochondrial membrane potential was assayed by JC-1 staining. At all concentrations of DOX examined (1, 2.5 and 5 μM), hypothermia reduced oxidative stress, activation of H2AX and p53, loss of mitochondrial membrane potential and total and apoptotic cell death (P=.001-.03 for each observation). The reduction of oxidative stress-induced activation of the DNA damage pathway and consequent cell death by mild hypothermia supports a possible protective role to reduce the clinical impact of DOX-induced cardiac toxicity. Such an approach may allow expanded use of these effective chemotherapeutic agents to increase cancer cure rates. Copyright © 2012 Elsevier Inc. All rights reserved.

p14(ARF) nuclear overexpression in aggressive B-cell lymphomas is a sensor of malfunction of the common tumor suppressor pathways.

PubMed

Sánchez-Aguilera, Abel; Sánchez-Beato, Margarita; García, Juan F; Prieto, Ignacio; Pollan, Marina; Piris, Miguel A

2002-02-15

p14(ARF), the alternative product from the human INK4a/ARF locus, antagonizes Hdm2 and mediates p53 activation in response to oncogenic stimuli. An immunohistochemical study of p14(ARF) expression in 74 samples of aggressive B-cell lymphomas was performed, demonstrating an array of different abnormalities. A distinct nucleolar expression pattern was detected in nontumoral tissue and a subset of lymphomas (50/74). In contrast, a group of cases (8/74) showed absence of p14(ARF) expression, dependent either on promoter hypermethylation or gene loss. Additionally, 16 out of 74 cases displayed an abnormal nuclear p14(ARF) overexpression not confined to the nucleoli, as confirmed by confocal microscopy, and that was associated with high levels of p53 and Hdm2. A genetic study of these cases failed to show any alteration in the p14(ARF) gene, but revealed the presence of p53 mutations in over 50% of these cases. An increased growth fraction and a more aggressive clinical course, with a shortened survival time, also characterized the group of tumors with p14(ARF) nuclear overexpression. Moreover, this p14(ARF) expression pattern was more frequent in tumors displaying accumulated alterations in the p53, p16(INK4a), and p27(KIP1) tumor supressors. These observations, together with the consideration of the central role of p14(ARF) in cell cycle control, suggest that p14(ARF) abnormal nuclear overexpression is a sensor of malfunction of the major cell cycle regulatory pathways, and consequently a marker of a high tumor aggressivity.

Presenting symptoms and clinical findings in HPV-positive and HPV-negative oropharyngeal cancer patients.

PubMed

Carpén, Timo; Sjöblom, Anni; Lundberg, Marie; Haglund, Caj; Markkola, Antti; Syrjänen, Stina; Tarkkanen, Jussi; Mäkitie, Antti; Hagström, Jaana; Mattila, Petri

2018-05-01

Oropharyngeal squamous cell carcinoma (OPSCC) is divided in two different disease entities depending on HPV involvement. We investigated differences in presenting symptoms and clinical findings in patients with HPV-positive and -negative OPSCC tumors. Altogether 118 consecutive patients diagnosed with primary OPSCC between 2012 and 2014 at the Helsinki University Hospital were included. HPV-status of the tumors was assessed by PCR detection of HPV DNA and immunostaining with p16-INK4a antibody. Fifty-one (47.7%) of the patients had HPV-positive and 56 (52.3%) HPV-negative tumors. Forty-nine (49/51, 96.1%) of the HPV+ tumors were also p16+ showing high concordance. The most common presenting symptom among HPV+/p16+ patients was a neck mass (53.1%), whereas any sort of pain in the head and neck area was more frequently related to the HPV-/p16- (60.0%) group. HPV+/p16+ tumors had a tendency to locate in the tonsillar complex and more likely had already spread into regional lymph nodes compared with HPV-/p16- tumors. Smoking and heavy alcohol consumption were significantly more common among HPV-/p16- patients but also rather common among HPV+/p16+ patients. This analysis of symptoms and signs confirm that OPSCC can be dichotomized in two distinct disease entities as defined by HPV status.

Immunohistochemical expression of p16 in lipoblastomas.

PubMed

Cappellesso, Rocco; d'Amore, Emanuele S G; Dall'Igna, Patrizia; Guzzardo, Vincenza; Vassarotto, Elisa; Rugge, Massimo; Alaggio, Rita

2016-01-01

Lipoblastoma (LB) is a rare benign adipocytic tumor of childhood occasionally showing histological similarities to myxoid liposarcoma (ML) or well-differentiated liposarcoma (WDL). p16 immunohistochemistry has proved to be useful in distinguishing various types of liposarcomas, in particular WDL from lipoma, with higher sensitivity and specificity than MDM2 and CDK4 immunohistochemistry. In this study, we reported the histologic features of a series of 30 LB with emphasis on the potential diagnostic pitfalls and investigated the immunohistochemical expression of p16. Moreover, p16 immunostaining was performed in 16 liposarcomas (11 WDL and 5 ML), 16 lipomas, and 16 cases of liponecrosis in order to evaluate its usefulness in the differential diagnosis of challenging lesions occurring in older children. Overall, p16 immunostaining was positive in 3 LBs and in 12 out of 16 liposarcomas (10 WDL and 2 ML), with a sensitivity of 75%, a specificity of 90%, a positive predictive value of 80%, and a negative predictive value of 87%. All lipomas were p16 negative, whereas 5 liponecroses were positive. Accounting altogether the benign lesions versus liposarcomas, p16 showed a sensitivity of 75%, a specificity of 87%, a positive predictive value of 60%, and a negative predictive value of 93%. Our data suggest that a negative p16 immunostaining may be helpful in excluding a liposarcoma when occurring in unusual clinical contexts, such as in adolescence or late recurrence. However, such finding should be interpreted with caution since also some liposarcomas lack p16 and occasional LBs are positive. Copyright © 2015 Elsevier Inc. All rights reserved.

Establishment of a dog model for the p53 family pathway and identification of a novel isoform of p21 cyclin-dependent kinase inhibitor

PubMed Central

Zhang, Jin; Chen, Xiangling; Kent, Michael S.; Rodriguez, Carlos O.; Chen, Xinbin

2009-01-01

Spontaneous tumors in the dog offer a unique opportunity as models to study human cancer etiology and therapy. p53, the most commonly mutated gene in human cancers, is found to be altered in dog cancers. However, little is known about the role of p53 in dog tumorigenesis. Here, we found that upon exposure to DNA damage agents or Mdm2 inhibitor nutlin-3, canine p53 is accumulated and capable of inducing its target genes, MDM2 and p21. We also found that upon DNA damage, canine p53 is accumulated in the nucleus, followed by MDM2 nuclear translocation and increased 53BP1 foci formation. In addition, we found that canine p63 and p73 are up-regulated by DNA damage agents. Furthermore, colony formation assay showed that canine tumor cells are sensitive to DNA damage agents and nutlin-3 in a p53-dependent manner. Surprisingly, canine p21 is expressed as two isoforms. Thus, we generated multiple canine p21 mutants and found that aa 129 to 142 is required, whereas aa 139 is one of the key determinants, for two p21 isoform expression. Finally, we showed that although the full-length human p21 cDNA expresses one polypeptide, aa 139 appears to play a similar role as that in canine p21 for various migration patterns. Taken together, our results indicate that canine p53 family proteins have biological activities similar to human counterparts. These similarities make the dog as an excellent out-bred spontaneous tumor model and the dog can serve as a translation model from bench-top to cage-side and then to bed-side. PMID:19147538

Immunohistochemical co-expression status of cytokeratin 5/6, androgen receptor, and p53 as prognostic factors of adjuvant chemotherapy for triple negative breast cancer.

PubMed

Maeda, Tetsuyo; Nakanishi, Yoko; Hirotani, Yukari; Fuchinoue, Fumi; Enomoto, Katsuhisa; Sakurai, Kenichi; Amano, Sadao; Nemoto, Norimichi

2016-03-01

Triple negative breast cancer (TNBC) is immunohistochemically characterised by the lack of expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor type 2 (HER2). TNBC is known for its poor prognosis and high recurrence probability. There is no effective targeted treatment for TNBC, but only adjuvant chemotherapies. There are two TNBC subtypes, basal-like and non-basal-like, which are defined based on positive cytokeratin (CK) 5/6 and/or epidermal growth factor receptor (EGFR) expression. In particular, CK5/6 expression is reported to correlate with TNBC recurrence. TNBC lacks ER-α expression, but some TNBCs are known to express the androgen receptor (AR). Moreover, although p53 accumulation is detected in various malignant tumors, its influence on adjuvant chemotherapy for patients with TNBC remains unclear. The aim of this study was to assess the combined immunohistochemical expression of CK 5/6, AR, and p53 as a potential prognostic marker of adjuvant chemotherapy for patients with TNBC. The expression of CK5/6, AR, and p53 in formalin-fixed and paraffin-embedded (FFPE) surgical sections from 52 patients with TNBC was analysed by immunohistochemistry (IHC) and the co-expression patterns in individual cells were investigated by immunofluorescent (IF) staining. Low AR expression was correlated with high clinical stage (P < 0.05) and low nuclear grade (P < 0.05). The expression of CK5/6 and p53 did not correlate with clinicopathological features. Patients who needed adjuvant chemotherapy presented the worst prognosis. In particular, when the IHC expression pattern was CK5/6 (-), AR (-), and p53 (+), the disease free survival (DFS) and overall survival (OS) were the worst. On the other hand, patients with AR (+) and p53 (-) TNBC presented a good prognosis. The analysis of the co-expression status of these three markers showed that no cells presented both AR and CK5/6 expression. Furthermore, TP53 mRNA expression was higher in patients with AR-negative TNBC (P < 0.05) and in patients with the worst prognosis (P < 0.05) than in the other patients. These results suggested that, in patients with CK5/6-negative TNBC, AR expression correlated with good prognosis, but p53 accumulation correlated with poor prognosis. The present IHC markers allowed us to predict the post-surgery prognosis of patients with TNBC. In conclusion, TNBCs are heterogeneous. Patients with the CK5/6 (-), AR (-), and p53 (+) TNBC subtype, evaluated by IHC, presented the worst prognosis. These IHC markers will be helpful to follow patients with TNBC.

Establishment and characterization of a novel uterine carcinosarcoma cell line, TU-ECS-1, with mutations of TP53 and KRAS.

PubMed

Chiba, Yohei; Sato, Seiya; Itamochi, Hiroaki; Suga, Yasuko; Fukagawa, Tomoyuki; Oumi, Nao; Oishi, Tetsuro; Harada, Tasuku; Sugai, Tamotsu; Sugiyama, Toru

2017-04-01

A new human uterine carcinosarcoma (UCS) cell line, TU-ECS-1, was established and characterized. The morphological appearance of the cultured cells was an insular of epithelial-like cells arranged in the form of a jigsaw puzzle and mesenchymal-like cells with a spindle-shaped or fibroblast-like morphology. A relatively high proliferation rate was observed with a doubling time of 18.2 h. The chromosome number ranged from 44 to 49 and had an extra chromosome 12 (trisomy 12). The respective half-maximal inhibitory concentrations of cisplatin, paclitaxel, and doxorubicin were 2.9 µM, 154 nM, and 219 ng/mL, respectively. Mutational analysis revealed that TU-ECS-1 cells have mutations of TP53 in exons 4, 6, and 8 and of KRAS at codon 12 (G12D) in exon 2, which is a mutation hot spot on this gene. Western blot analysis showed that p53 protein was overexpressed in TU-ECS-1 cells. Immunostaining of the cultured cells and in vivo tumors showed that the TU-ECS-1 cells and xenografts were positive for epithelial marker cytokeratin AE1/3 and mesenchymal marker vimentin. These results suggested that TU-ECS-1 cells might have both epithelial and mesenchymal characteristics. This cell line may be useful to study the carcinogenesis of UCS and contribute to the development of novel treatment strategies.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

PubMed Central

McCorkle, Sean R; McCombie, WR; Dunn, John J

2011-01-01

Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

The p53 breast cancer tissue biomarker in Indian women

PubMed Central

Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev

2011-01-01

Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177

Potential Role of Semaphorin 3A and Its Receptors in Regulating Aberrant Sympathetic Innervation in Peritoneal and Deep Infiltrating Endometriosis

PubMed Central

Liang, Yanchun; Wang, Wei; Huang, Jiaming; Tan, Hao; Liu, Tianyu; Shang, Chunliang; Liu, Duo; Guo, Luyan; Yao, Shuzhong

2015-01-01

Previous studies have demonstrated the involvement of nerve repellent factors in regulation of the imbalanced innervation of endometriosis. This prospective study aims to explore the role of Sema 3A in regulating aberrant sympathetic innervation in peritoneal and deep infiltrating endometriosis. Ectopic endometriotic lesion were collected from patients with peritoneal endometriosis (n = 24) and deep infiltrating endometriosis of uterosacral ligament (n = 20) undergoing surgery for endometriosis. Eutopic endometrial samples were collected from patients with endometriosis (n = 22) or without endometriosis (n = 26). Healthy peritoneum (n = 13) from the lateral pelvic wall and healthy uterosacral ligament (n = 13) were obtained from patients who had no surgical and histological proof of endometriosis during hysterectomy for uterine fibroids. Firstly, we studied the immunostaining of Sema 3A, Plexin A1 and NRP-1 in all the tissues described above. Then we studied the nerve fiber density (NFD) of endometriosis-associated (sympathetic) nerve and para-endometriotic (sympathetic) nerve by double immunofluorescence staining. Finally we analyzed the relationship between expression of Sema 3A in stromal cells of endometriotic lesion and the aberrant innervation of endometriosis. Semi-quantitative immunostaining demonstrated that (1) Higher immunostaining of Sema 3A were found in the eutopic endometrial glandular epithelial cells from patients with endometriosis (p = 0.041) than those without endometriosis; (2) Sema 3A immunostaining was higher in glandular epithelial cells of peritoneal endometriosis (P<0.001) and deep infiltrating endometriotic lesions of uterosacral ligament (P = 0.028)compared with glandular epithelial cells of the endometrium from women with endometriosis, while its expression in ectopic stormal cells in both groups were significantly lower than that from eutopic endometrium of women without endometirosis (P<0.001, P<0.001, respectively). NFDs of Anti-TH (+) endometriosis-associated sympathetic nerve of peritoneal endometriosis (p<0.001) and deep endometriosis of uterosacral ligament (p<0.001) were significantly lower than NFDs of para-endometriotic sympathetic nerve. Our results suggest that Sema 3A may contribute to the regulation of aberrant sympathetic innervation in peritoneal and deep infiltrating endometriosis. PMID:26720585

Proteolysis of microtubule associated protein 2 and sensitivity of pancreatic tumours to docetaxel

PubMed Central

Veitia, R; David, S; Barbier, P; Vantard, M; Gounon, P; Bissery, M C; Fellous, A

2000-01-01

We have studied the state of microtubule associated protein 2 (MAP2) in the pancreatic ductal adenocarcinomas P03 and P02 (sensitive and refractory to docetaxel respectively) since they express the corresponding mRNA and MAP2-related peptides. Immunohistochemical localization showed that in tumour P03 the MAP2-related peptides are highly expressed and confined to the epithelial malignant cells while in P02 the intensity of the immunostaining is lower. However, anti α-tubulin staining followed a similar pattern suggesting that the net amount of macromolecular structures in the sensitive tumour is higher than in the refractory one. This may explain its higher sensitivity to docetaxel, because tubulin assembled into microtubules is the target of the drug. We found that protein extracts from both tumours differed in their proteolytic activity on rat brain MAP2. Since the proteolysis pattern obtained was similar to the one produced by Cathepsin D, we studied the effect of MAP2 proteolysed by this enzyme on microtubule formation in vitro. Proteolysis was found to increase the tendency of tubulin to assemble into macromolecular structures (microtubules and aggregates) in the presence of docetaxel. This suggests that in vivo proteolysis of MAP2 might increase microtubule alterations and potentiate the antitumour effect of docetaxel. © 2000 Cancer Research Campaign PMID:10945505

Immunohistochemical analysis of stromal fibrocytes and myofibroblasts to envision the invasion and lymph node metastasis in oral squamous cell carcinoma.

PubMed

Rao, Sowmya J; Rao, Jyothi Bellur Madhava; Rao, Pp Jagadish

2017-01-01

Tumor cells work in close coordination with stromal elements from its stage of emergence to metastasis. The study was designed to assess the presence and distribution pattern of stromal fibrocytes and myofibroblasts in oral squamous cell carcinoma (OSCC). Possibility of using these stromal cells as a marker for invasion and lymphnode metastasis was evaluated. A total of 40 cases of OSCC consisting twenty cases of each lymph node positive (pN+) and lymph node negative (pN0) samples and ten normal oral mucosa (NOM) tissues were subjected to double immunostaining using CD34 and alpha-smooth muscle actin (α-SMA) antibodies. Stained sections were evaluated semiquantitatively. CD34 fibrocytes were seen in 70% of NOM and none of OSCC samples. α-SMA myofibroblasts were seen in 80% of OSCC and none of NOM samples. A statistically significant difference was found in fibrocyte values ( P < 0.001) and myofibroblast values ( P < 0.001) between NOM and OSCC study samples. No statistical significance in myofibroblast values between pN0 and pN+ study groups; however, their distribution pattern appreciably varied. This study suggested that fibrocytes could be used as one of the markers for early invasion. Abrupt loss of fibrocytes at the transition zone toward carcinoma and statistical significance in their values supported this inference. Heterogeneity in the distribution pattern of myofibroblasts in tumor stroma indicates that this variability may predict the tumor behavior toward nodal metastasis rather than their mere presence or absence.

Evaluation of the clinical significance of human papillomavirus (HPV) 53.

PubMed

Padalko, Elizaveta; Ali-Risasi, Catherine; Van Renterghem, Lieve; Bamelis, Mieke; De Mey, Anja; Sturtewagen, Yolande; Vastenavond, Hilde; Vanden Broeck, Davy; Weyers, Steven; Praet, Marleen

2015-08-01

Human papillomaviruses (HPV) are classified according to their potential for the development of cervical neoplasia. However, the carcinogenicity of HPV types forms an evolving continuum based on the newly available data especially regarding the role of probable and possible high-risk HPV types (pHR-HPV). The objective of the present work was to evaluate clinical significance of the pHR-HPV53. An observational cohort study of potential aetiological association between infection with HPV53 and development of high-grade cervical cytology was performed. The study was conducted in two geographically remoted hospitals, in Belgium and Democratic Republic of Congo, as an attempt to collect data from regions with different geographical distribution of HPV genotypes. The samples were taken during routine gynaecological visit in outpatient clinics of both participating hospitals. A total of 2283 liquid-Pap samples were taken from 1465 women at Ghent University Hospital, Belgium, and from 660 women at General Hospital and Ngaliema Hospital of Kinshasa, DRC. "HPV53-only"-pattern as evaluated by full HPV genotyping was found in samples from only 34 (1.6%) samples. The initial cytology represented next to non-dysplastic, undetermined and low-grade lesions also high-grade lesions (12%). For 26 (76.5%) from the 34 women presented with "HPV53-only"-pattern follow-up results were available showing no progression to malignancy. Our findings support very low to lacking carcinogenic potential of HPV53. Recognising extreme rarity in cervical cancer next to high prevalence in general population of HPV53, further studies investigating progression to high-grade lesions are needed to elucidate the oncogenic potential of pHR-HPV53. Copyright © 2015. Published by Elsevier Ireland Ltd.

Morphological investigations of cells that adhered to the irregular patterned polydimethylsiloxane (PDMS) surface without reagents.

PubMed

Chung, Sung Hee; Min, Junhong

2009-07-01

Polydimethylsiloxane (PDMS) surface consisting irregular pattern was investigated to develop cell-based biochip using PDMS. PDMS surface was modified with nano- and micro-combined patterns using surface deformation technology. Hydrophobicity of nano-patterned PDMS surface was sustained. Nevertheless it has irregular patterns consisting of micro- and nano-patterns. According to atomic force microscopy (AFM), scanning electron microscopy (SEM) and confocal microscopy results by immunostaining method, human mammary epithelial cells (HMEC) adhered well on irregularly patterned surface without any reagents such as gelatin and collagen, compared to commercial culture dish. It implies PDMS material can be utilized as template for cell-based biochip without any reagents.

Clusterin immunoexpression is associated with early stage endometrial carcinomas.

PubMed

Al-Maghrabi, Jaudah Ahmed; Butt, Nadeem Shafique; Anfinan, Nisrin; Sait, Khalid; Sait, Hesham; Bajouh, Osama; Khabaz, Mohamad Nidal

2016-05-01

Clusterin has anti-apoptotic, regeneration and migration stimulating effects on tumor cells. This study investigates the relation between clusterin expression and the clinicopathological parameters in endometrial carcinomas. Seventy one cases of previously diagnosed endometrial carcinoma (including 59 endometrioid adenocarcinoma, 9 serous adenocarcinoma, 1 clear cell adenocarcinoma, and 2 malignant mixed Mullerian tumor) and 30 tissue samples of non-cancerous endometrium (including 16 proliferative endometrium, 10 secretory endometrium and 4 endometrial polyps) were employed for clusterin detection using tissue microarrays and immunostaining. A total number of 23 (32.4%) cases were positive for clusterin immunostaining. Brown granular cytoplasmic expression of clusterin was detected in 33.9% of endometrioid adenocarcinomas, 22.2% papillary serous endometrial carcinomas. Three (10%) control cases showed granular cytoplasmic expression. Positive clusterin immunostaining was found more frequent in well differentiated and stage I endometrial carcinomas, showing significant statistical association (p-value=0.036 and p-value=0.002 respectively). Significant difference in clusterin expression was observed between tumor cases and control group (P-Value=0.019), i.e., endometrial carcinoma cases are more than four times likely to show positive clusterin immunostaining (odds ratio 4.313 with 95% confidence interval 1.184-15.701). This study did not find relation between clusterin expression and disease recurrence, survival or any of the other clinicopathological parameters in endometrial tumors. The results of our study confirms the diagnostic values of clusterin in supporting the diagnosis of endometrioid carcinoma. When clusterin is expressed in endometrial tumors, it is associated with lower stage. The correlation of clusterin with tumor stage suggests involvement of this molecule in endometrial tumor progression. Copyright © 2016 Elsevier GmbH. All rights reserved.

Cathepsin B expression in prostate cancer of native Japanese and Japanese-American patients: an immunohistochemical study.

PubMed

Sinha, Akhouri A; Morgan, Jenifer L; Betre, Konjit; Wilson, Michael J; Le, Chap; Marks, Leonard S

2008-01-01

Japanese-American (J-A) men who have immigrated to the U.S.A. and acquired the Western lifestyle usually have more invasive prostate cancer (PCa) than native Japanese (NJ) living in Japan. The specific reasons for these differences remain unknown. The objective of this study was to examine immunostainings of cathepsin B (CB) and its endogenous inhibitor stefin A (SA) in tissue microarray (TMA) and radical prostatectomy (RP) tissue sections in the hope of obtaining insights into the invasiveness of PCa in Japanese patients. TMA and RP sections were evaluated in 50 men (25 NJ and 25 J-A) for CB and SA reaction products. The CB and SA immunostainings were imaged directly from microscope slides to a computer using a high performance charge coupled device (CCD) digital camera, quantified using Metamorph software, analyzed using the two-sample t-test, and confirmed by multiple regression analysis. The CB and SA proteins were localized in the carcinomatous glands and isolated cancer cells in the TMA and RP sections. The Gleason scores and pre-surgery serum total prostate-specific antigen (PSA) levels did not differ significantly in the NJ and J-A patients (p = 0.14, p = 0.16, respectively). The Chi-square analysis of clinical stage versus place of birth showed that the NJ patients had significantly more T2a and T2b clinical stages than the J-A patients who had more advanced T2c and T3a stages (p = 0.003). The CB and SA immunostainings and their ratios in Gleason score 6 tumors did not show any difference, but the CB:SA ratios in score > or = 7 tumors approached significance levels. The overall matching of specimens according to the Gleason grade/score, pre-RP serum total PSA levels, clinical stage and age prior to evaluation of immunostainings greatly minimizes subjectivity associated with the evaluation of markers in this ethnic sub-population of PCa patients. CB and SA immunostaining is similar in Japanese patients who have organ-confined and moderately-differentiated PCa. Analysis of the reaction product data provides indirect evidence that invasiveness of PCa is similar in the two Japanese patient populations.

Systemic administration of vascular endothelial growth factor monoclonal antibody reduces the growth of papillary thyroid carcinoma in a nude mouse model.

PubMed

Bauer, Andrew J; Patel, Aneeta; Terrell, Richard; Doniparthi, Krishna; Saji, Motoyasu; Ringel, Matthew; Tuttle, R Michael; Francis, Gary L

2003-01-01

Papillary thyroid carcinomas (PTC) are the most common thyroid cancers in children. Most are successfully treated with surgery and radioactive iodine, but some persist. PTC express high levels of vascular endothelial growth factor (VEGF) and VEGF receptor (Flt-1). PTC with the most intense expression of VEGF have the greatest recurrence risk. We hypothesized that blockade of VEGF would inhibit PTC growth. To test this, we used systemic VEGF monoclonal antibody (VEGF-MAb) to treat PTC xenografts in nude mice. Treated animals (n = 9) received 200 microg VEGF-MAb by daily i.p. injection for 10 wk, while control animals (n = 9) received vehicle alone. Tumor size was significantly reduced in the treatment group (0.28 +/- 0.06 vs 1.05 +/- 0.25 g, p = 0.008). VEGF immunostaining was more intense (2.57 +/- 0.30 vs 1.75 +/- 0.25, p = 0.06) and the number of p53 positive cells was increased (1.66 +/- 0.24 vs 0.83 +/- 0.31, p = 0.048) in treated tumors. Animal weight was similar in both groups (29.1 +/- 1.1 vs 27.4 +/- 1.1 g, p = 0.30). In conclusion, systemic VEGF-MAb significantly reduced the growth of PTC, suggesting that VEGF-MAb might be useful for treatment of resistant PTC.

HIV positivity but not HPV/p16 status is associated with higher recurrence rate in anal cancer.

PubMed

Meyer, Joshua E; Panico, Vinicius J A; Marconato, Heloisa M F; Sherr, David L; Christos, Paul; Pirog, Edyta C

2013-12-01

Human papillomavirus (HPV) is a pathogenic factor of squamous cell carcinoma in various mucosal locations, including anal carcinoma (ACA). It is also known that patients positive for HIV are at high risk of ACA. The goal of this study was to examine clinical outcome in ACA in relation to HPV/p16 positivity, histologic tumor differentiation, and HIV status. Patients with oropharyngeal cancers that are positive for HPV and show overexpression of p16 as well as having non-keratinizing/basaloid histology have been reported to have better outcomes following chemoradiation (CRT). However, such relationships in ACA remain unknown. Forty-two patients with SCC of the anus treated with CRT between 1997 and 2009 were identified. The tumors were subclassified as either non-keratinizing (including basaloid) or keratinizing categories. HPV testing was performed using SPF10-PCR, and all cases were immunostained for p16. There were 23 men and 19 women; 43% of men and 11% of women were HIV-positive (p = 0.04). Fifty-five percent of patients had local disease (stages I and II) and 41% were stages III and IV, with 4% stage unknown. All tumors were positive for high-oncogenic risk HPVs, and all were positive with p16 immunostain. Sixty-four percent of tumors were non-keratinizing/basaloid and 36 % were keratinizing. The keratinizing tumors were more common in HIV-positive patients (67%), whereas non-keratinizing/basaloid tumors were more common in HIV-negative patients (77%) (p = 0.008). Thirty-one percent of patients had recurrence of disease, including 50% HIV-positive patients and 23% HIV-negative patients (p = 0.09). There was no difference in the recurrence rate between non-keratinizing and keratinizing tumor subtypes (p = 0.80). The 24-month recurrence-free survival for the cohort was 66% (95% CI = 46%, 81%), with HIV-positive patients having worse recurrence-free survival compared to HIV-negative patients (HR = 2.85, 95% CI = 0.95, 8.53; p = 0.06). The regional and distant failure rate was not related to HPV/p16 positivity or histologic differentiation of ACA; however, HIV positivity appeared to be associated with a higher recurrence rate and worse recurrence-free survival.

Molecular Regulation of DNA Damage-Induced Apoptosis in Neurons of Cerebral Cortex

PubMed Central

Liu, Zhiping; Pipino, Jacqueline; Chestnut, Barry; Landek, Melissa A.

2009-01-01

Cerebral cortical neuron degeneration occurs in brain disorders manifesting throughout life, but the mechanisms are understood poorly. We used cultured embryonic mouse cortical neurons and an in vivo mouse model to study mechanisms of DNA damaged-induced apoptosis in immature and differentiated neurons. p53 drives apoptosis of immature and differentiated cortical neurons through its rapid and prominent activation stimulated by DNA strand breaks induced by topoisomerase-I and -II inhibition. Blocking p53-DNA transactivation with α-pifithrin protects immature neurons; blocking p53-mitochondrial functions with μ-pifithrin protects differentiated neurons. Mitochondrial death proteins are upregulated in apoptotic immature and differentiated neurons and have nonredundant proapoptotic functions; Bak is more dominant than Bax in differentiated neurons. p53 phosphorylation is mediated by ataxia telangiectasia mutated (ATM) kinase. ATM inactivation is antiapoptotic, particularly in differentiated neurons, whereas inhibition of c-Abl protects immature neurons but not differentiated neurons. Cell death protein expression patterns in mouse forebrain are mostly similar to cultured neurons. DNA damage induces prominent p53 activation and apoptosis in cerebral cortex in vivo. Thus, DNA strand breaks in cortical neurons induce rapid p53-mediated apoptosis through actions of upstream ATM and c-Abl kinases and downstream mitochondrial death proteins. This molecular network operates through variations depending on neuron maturity. PMID:18820287

Decreased immunostaining for macrophage scavenger receptor is associated with poor prognosis of prostate cancer.

PubMed

Takayama, Hitoshi; Nonomura, Norio; Nishimura, Kazuo; Oka, Daizo; Shiba, Masahiro; Nakai, Yasutomo; Nakayama, Masashi; Tsujimura, Akira; Aozasa, Katsuyuki; Okuyama, Akihiko

2009-02-01

The aim of this study is to evaluate the expression of the macrophage scavenger receptor (MSR) in prostate needle biopsy specimens as a possible prognostic factor for prostate cancer. As MSR reportedly has a role in recognizing foreign pathogenic substances, MSR-positive inflammatory cells are often detected in solid tumours, and there is a correlation between the relative risk of prostate cancer and polymorphism of the MSR gene. MSR was evaluated by immunostaining in needle biopsies of the prostate from 135 patients who were confirmed to have prostate cancer. Among these men, 70 were treated by radical prostatectomy or by radiotherapy as definitive therapy; the other 65 were treated by hormonal therapy because of advanced disease or age. Needle-biopsy specimens were sectioned at 5 microm and immunostained with a monoclonal antibody against MSR. Six microscopic (x400) fields around the cancer foci were selected in each case for analysis. The median number of MSR-positive cells (MSR count) in each case was 24. There was an inverse correlation between the MSR count and Gleason score and clinical stage. The MSR count was lower in patients with biochemical (prostate-specific antigen, PSA) failure than that in those with no PSA failure (P < 0.001). In all patients, the recurrence-free survival (RFS) rate was significantly higher in those with a high MSR count (> or =24) than that in those with low MSR count (<24, P < 0.001). Moreover, for patients treated by definitive or hormonal therapy, the RFS rates in those with a higher MSR count were higher than in those with a lower MSR count (P < 0.001 and 0.014, respectively). Cox multivariate analysis showed that the MSR count was a prognostic factor for prostate cancer in addition to extraprostatic extension and Gleason score (P = 0.002, 0.038 and 0.011, respectively). The results of immunostaining of MSR in needle-biopsy specimens is a prognostic factor for prostate cancer.

Mutation analysis of the p53, APC, and p16 genes in the Barrett's oesophagus, dysplasia, and adenocarcinoma.

PubMed Central

González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E

1997-01-01

AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671

Presence of FoxP3+ regulatory T Cells predicts outcome of subclinical rejection of renal allografts.

PubMed

Bestard, Oriol; Cruzado, Josep M; Rama, Inés; Torras, Joan; Gomà, Montse; Serón, Daniel; Moreso, Francesc; Gil-Vernet, Salvador; Grinyó, Josep M

2008-10-01

Subclinical rejection (SCR) of renal allografts refers to histologic patterns of acute rejection despite stable renal function. The clinical approach to SCR is controversial; it would be helpful to identify biomarkers that could determine whether the identified cellular infiltrates were detrimental. For investigation of whether the presence of FoxP3+ regulatory T cells (Treg) could help determine the functional importance of tubulointerstitial infiltrates observed in 6-mo protocol biopsies, 37 cases of SCR were evaluated. The presence of FoxP3+ Treg discriminated harmless from injurious infiltrates, evidenced by independently predicting better graft function 2 and 3 yr after transplantation. Furthermore, the FoxP3+ Treg/CD3+ T cell ratio positively correlated with graft function at 2 yr after transplantation, suggesting that an increasing proportion of Treg within the global T cell infiltrate may facilitate renal engraftment; therefore, immunostaining for FoxP3+ Treg in patients with SCR on protocol biopsies may ultimately be useful to identify patients who may require alterations in their immunosuppressive regimens.

Presence of FoxP3+ Regulatory T Cells Predicts Outcome of Subclinical Rejection of Renal Allografts

PubMed Central

Bestard, Oriol; Cruzado, Josep M.; Rama, Inés; Torras, Joan; Gomà, Montse; Serón, Daniel; Moreso, Francesc; Gil-Vernet, Salvador; Grinyó, Josep M.

2008-01-01

Subclinical rejection (SCR) of renal allografts refers to histologic patterns of acute rejection despite stable renal function. The clinical approach to SCR is controversial; it would be helpful to identify biomarkers that could determine whether the identified cellular infiltrates were detrimental. For investigation of whether the presence of FoxP3+ regulatory T cells (Treg) could help determine the functional importance of tubulointerstitial infiltrates observed in 6-mo protocol biopsies, 37 cases of SCR were evaluated. The presence of FoxP3+ Treg discriminated harmless from injurious infiltrates, evidenced by independently predicting better graft function 2 and 3 yr after transplantation. Furthermore, the FoxP3+ Treg/CD3+ T cell ratio positively correlated with graft function at 2 yr after transplantation, suggesting that an increasing proportion of Treg within the global T cell infiltrate may facilitate renal engraftment; therefore, immunostaining for FoxP3+ Treg in patients with SCR on protocol biopsies may ultimately be useful to identify patients who may require alterations in their immunosuppressive regimens. PMID:18495961

Markers of potential malignancy in chronic hyperplastic candidiasis.

PubMed

Darling, Mark R; McCord, Christina; Jackson-Boeters, Linda; Copete, Maria

2012-08-01

To examine the presence of markers associated with malignancy, including p53, p21 cyclin-dependent kinase inhibitor 1A, murine double minutes-2, and others, in chronic hyperplastic candidiasis. Immunohistochemical methods were used to examine the expression of p53, murine double minutes-2, p21 cyclin-dependent kinase inhibitor 1A, metallothionein, and proliferating cell nuclear antigen in 42 chronic hyperplastic candidiasis lesions and 11 non-infected control tissues. Terminal deoxynucleotidyl transferase-mediated digoxigenin-dUTP nick-end labeling was used to examine apoptosis, which was correlated with p53 expression. These markers were measured in lesions of chronic hyperplastic candidiasis that did not show any epithelial dysplasia or histological signs of malignancy. p53 scores were higher in chronic hyperplastic candidiasis than in controls (P = 0.0046). Murine double-minutes 2 levels were not elevated. p21 cyclin-dependent kinase inhibitor 1A was increased in parabasal (P < 0.0001) and basal epithelial cells. Chronic hyperplastic candidiasis lesions showed a similar basal/parabasal metallothionein staining pattern to that seen in normal squamous epithelium. Proliferating cell nuclear antigen was increased (P = 0.0007), as was apoptosis (P = 0.0033). Increased p53 in oral chronic hyperplastic candidiasis suggests an increased potential for malignant change in the epithelium, above that of normal tissues. Further functional investigation is required, as well as clinical follow-up studies. © 2012 Blackwell Publishing Asia Pty Ltd.

Micromolecular methods for diagnosis and therapeutic strategy: a case study

PubMed Central

Elbouchtaoui, Morad; Tengher, Iulia; Miquel, Catherine; Brugière, Charlotte; Benbara, Amélie; Zelek, Laurent; Ziol, Marianne; Bouhidel, Fatiha; Janin, Anne; Bousquet, Guilhem; Leboeuf, Christophe

2018-01-01

An intraductal carcinoma, 55 mm across, was diagnosed on a total mastectomy in a 45-year-old woman. The 2 micro-invasive areas found were too small for reliable immunostainings for estrogen, progesterone, and HER2 receptors. In the sentinel lymph-node, a subcapsular tumor embole of about 50 cancer cells was identified on the extemporaneous cryo-cut section, but not on further sections after paraffin-embedding of the sample. Considering this tumor metastatic potential, we decided to assess HER2 status on the metastatic embole using pathological and molecular micro-methods. We laser-microdissected the tumor cells, extracted their DNA, and performed droplet-digital-PCR (ddPCR) for HER2 gene copy number variation. The HER2/RNaseP allele ratio was 5.2 in the laser-microdissected tumor cells, similar to the 5.3 ratio in the HER2-overexpressing breast cancer cell line BT-474. We thus optimized the adjuvant treatment of our patient and she received a trastuzumab-based adjuvant chemotherapy. PMID:29854320

BTK blocks the inhibitory effects of MDM2 on p53 activity

PubMed Central

Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador

2017-01-01

p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977

The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines

PubMed Central

2012-01-01

Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the induction of apoptosis in HCT116 p53 −/− cells. Considering the fact that most tumors show a functional p53 inactivation, further research is needed to elucidate the long-term effects of saffron in p53 −/− tumors. PMID:22640402

Diagnostic reproducibility of hydatidiform moles: ancillary techniques (p57 immunohistochemistry and molecular genotyping) improve morphologic diagnosis for both recently trained and experienced gynecologic pathologists.

PubMed

Gupta, Mamta; Vang, Russell; Yemelyanova, Anna V; Kurman, Robert J; Li, Fanghong Rose; Maambo, Emily C; Murphy, Kathleen M; DeScipio, Cheryl; Thompson, Carol B; Ronnett, Brigitte M

2012-12-01

Distinction of hydatidiform moles from nonmolar specimens (NMs) and subclassification of hydatidiform moles as complete hydatidiform mole (CHM) and partial hydatidiform mole (PHM) are important for clinical practice and investigational studies; however, diagnosis based solely on morphology is affected by interobserver variability. Molecular genotyping can distinguish these entities by discerning androgenetic diploidy, diandric triploidy, and biparental diploidy to diagnose CHMs, PHMs, and NMs, respectively. Eighty genotyped cases (27 CHMs, 27 PHMs, 26 NMs) were selected from a series of 200 potentially molar specimens previously diagnosed using p57 immunohistochemistry and genotyping. Cases were classified by 6 pathologists (3 faculty level gynecologic pathologists and 3 fellows) on the basis of morphology, masked to p57 immunostaining and genotyping results, into 1 of 3 categories (CHM, PHM, or NM) during 2 diagnostic rounds; a third round incorporating p57 immunostaining results was also conducted. Consensus diagnoses (those rendered by 2 of 3 pathologists in each group) were also determined. Performance of experienced gynecologic pathologists versus fellow pathologists was compared, using genotyping results as the gold standard. Correct classification of CHMs ranged from 59% to 100%; there were no statistically significant differences in performance of faculty versus fellows in any round (P-values of 0.13, 0.67, and 0.54 for rounds 1 to 3, respectively). Correct classification of PHMs ranged from 26% to 93%, with statistically significantly better performance of faculty versus fellows in each round (P-values of 0.04, <0.01, and <0.01 for rounds 1 to 3, respectively). Correct classification of NMs ranged from 31% to 92%, with statistically significantly better performance of faculty only in round 2 (P-values of 1.0, <0.01, and 0.61 for rounds 1 to 3, respectively). Correct classification of all cases combined ranged from 51% to 75% by morphology and 70% to 80% with p57, with statistically significantly better performance of faculty only in round 2 (P-values of 0.69, <0.01, and 0.15 for rounds 1 to 3, respectively). p57 immunostaining significantly improved recognition of CHMs (P<0.01) and had high reproducibility (κ=0.93 to 0.96) but had no impact on distinction of PHMs and NMs. Genotyping provides a definitive diagnosis for the ∼25% to 50% of cases that are misclassified by morphology, especially those that are also unresolved by p57 immunostaining.

Genomic Characterization of Vulvar (Pre)cancers Identifies Distinct Molecular Subtypes with Prognostic Significance.

PubMed

Nooij, Linda S; Ter Haar, Natalja T; Ruano, Dina; Rakislova, Natalia; van Wezel, Tom; Smit, Vincent T H B M; Trimbos, Baptist J B M Z; Ordi, Jaume; van Poelgeest, Mariette I E; Bosse, Tjalling

2017-11-15

Purpose: Vulvar cancer (VC) can be subclassified by human papillomavirus (HPV) status. HPV-negative VCs frequently harbor TP53 mutations; however, in-depth analysis of other potential molecular genetic alterations is lacking. We comprehensively assessed somatic mutations in a large series of vulvar (pre)cancers. Experimental Design: We performed targeted next-generation sequencing (17 genes), p53 immunohistochemistry and HPV testing on 36 VC and 82 precursors (sequencing cohort). Subsequently, the prognostic significance of the three subtypes identified in the sequencing cohort was assessed in a series of 236 VC patients (follow-up cohort). Results: Frequent recurrent mutations were identified in HPV-negative vulvar (pre)cancers in TP53 (42% and 68%), NOTCH1 (28% and 41%), and HRAS (20% and 31%). Mutation frequency in HPV-positive vulvar (pre)cancers was significantly lower ( P = 0.001). Furthermore, a substantial subset of the HPV-negative precursors (35/60, 58.3%) and VC (10/29, 34.5%) were TP53 wild-type (wt), suggesting a third, not-previously described, molecular subtype. Clinical outcomes in the three different subtypes (HPV + , HPV - /p53wt, HPV - /p53abn) were evaluated in a follow-up cohort consisting of 236 VC patients. Local recurrence rate was 5.3% for HPV + , 16.3% for HPV - /p53wt and 22.6% for HPV - /p53abn tumors ( P = 0.044). HPV positivity remained an independent prognostic factor for favorable outcome in the multivariable analysis ( P = 0.020). Conclusions: HPV - and HPV + vulvar (pre)cancers display striking differences in somatic mutation patterns. HPV - /p53wt VC appear to be a distinct clinicopathologic subgroup with frequent NOTCH1 mutations. HPV + VC have a significantly lower local recurrence rate, independent of clinicopathological variables, opening opportunities for reducing overtreatment in VC. Clin Cancer Res; 23(22); 6781-9. ©2017 AACR . ©2017 American Association for Cancer Research.

Prognostic value of S100/CD31 and S100/podoplanin double immunostaining in mucosal malignant melanoma of the head and neck.

PubMed

Wermker, Kai; Brauckmann, Till; Klein, Martin; Haßfeld, Stefan; Schulze, Hans-Joachim; Hallermann, Christian

2015-09-01

In uncommon mucosal melanomas of the head and neck established prognostic factors are rare and controversially discussed. The purpose of this study was to evaluate outcome and value of S100/podoplanin and S100/CD31 double immunostaining in head and neck mucosal melanomas. Retrospectively, patients with head and neck mucosal melanomas treated between 1973 and 2008 were analyzed. S100/podoplanin and S100/CD31 immunostaining were performed to detect lymph vessel invasion (LVI) and blood vessel invasion (BVI). Predictive parameters for disease-specific survival (DSS) were identified using univariate and multivariate statistics. Forty-two patients with head and neck mucosal melanoma were included. Three-year, 5-year, and 10-year DSS rates were 59%, 44%, and 20%, respectively. Age above 70 years, occurrence of distant metastasis, LVI, and BVI were significantly associated with shorter DSS time (p < .05), whereas localization at the conjunctiva showed better outcome. S100/podoplanin and S100/CD31 double immunostaining detect reliable LVI and BVI in head and neck mucosal melanoma and both are associated significantly with worse prognosis. © 2014 Wiley Periodicals, Inc.

Upregulation of Ryk expression in rat dorsal root ganglia after peripheral nerve injury.

PubMed

Li, Xin; Li, Yao-hua; Yu, Shun; Liu, Yaobo

2008-10-22

To study changes of Ryk expression in dorsal root ganglia (DRG) after peripheral nerve injury, we set up an animal model of unilateral sciatic nerve lesioned rats. Changes of Ryk protein expression in DRG neurons after unilateral sciatic nerve injury were investigated by immunostaining. Changes of Ryk mRNA were also tested by semi-quantitative PCR concurrently. We found, both at the level of protein and mRNA, that Ryk could be induced in cells of ipsilateral DRG after unilateral sciatic nerve lesion. Further investigation by co-immunostaining confirmed that the Ryk-immunoreactive (Ryk-IR) cells were NeuN-immunoreactive (NeuN-IR) neurons of DRG. We also showed the pattern of Ryk induction in DRG neurons after sciatic nerve injury: the number of Ryk IR neurons peaked at 2 weeks post-lesion and decreased gradually by 3 weeks post-lesion. The proportions of different sized Ryk IR neurons were also observed and counted at various stages after nerve lesion. Analysis of Ryk mRNA by RT-PCR showed the same induction pattern as by immunostaining. Ryk mRNA was not expressed in normal or contralateral DRG, but was expressed 1, 2 and 3 weeks post-lesion in the ipsilateral DRG. Ryk mRNA levels increased slightly from 1 to 2 weeks, decreased then by 3 weeks post-lesion. These results indicate that Ryk might be involved in peripheral nerve plasticity after injury. This is a novel function apart from its well-known fundamental activity as a receptor mediating axon guidance and outgrowth.

TP53 Germline Variations Influence the Predisposition and Prognosis of B-Cell Acute Lymphoblastic Leukemia in Children

PubMed Central

Qian, Maoxiang; Cao, Xueyuan; Devidas, Meenakshi; Yang, Wenjian; Cheng, Cheng; Dai, Yunfeng; Carroll, Andrew; Heerema, Nyla A.; Zhang, Hui; Moriyama, Takaya; Gastier-Foster, Julie M.; Xu, Heng; Raetz, Elizabeth; Larsen, Eric; Winick, Naomi; Bowman, W. Paul; Martin, Paul L.; Mardis, Elaine R.; Fulton, Robert; Zambetti, Gerard; Borowitz, Michael; Wood, Brent; Nichols, Kim E.; Carroll, William L.; Pui, Ching-Hon; Mullighan, Charles G.; Evans, William E.; Hunger, Stephen P.; Relling, Mary V.; Loh, Mignon L.

2018-01-01

Purpose Germline TP53 variation is the genetic basis of Li-Fraumeni syndrome, a highly penetrant cancer predisposition condition. Recent reports of germline TP53 variants in childhood hypodiploid acute lymphoblastic leukemia (ALL) suggest that this type of leukemia is another manifestation of Li-Fraumeni syndrome; however, the pattern, prevalence, and clinical relevance of TP53 variants in childhood ALL remain unknown. Patients and Methods Targeted sequencing of TP53 coding regions was performed in 3,801 children from the Children’s Oncology Group frontline ALL clinical trials, AALL0232 and P9900. TP53 variant pathogenicity was evaluated according to experimentally determined transcriptional activity, in silico prediction of damaging effects, and prevalence in non-ALL control populations. TP53 variants were analyzed for their association with ALL presenting features and treatment outcomes. Results We identified 49 unique nonsilent rare TP53 coding variants in 77 (2.0%) of 3,801 patients sequenced, of which 22 variants were classified as pathogenic. TP53 pathogenic variants were significantly over-represented in ALL compared with non-ALL controls (odds ratio, 5.2; P < .001). Children with TP53 pathogenic variants were significantly older at ALL diagnosis (median age, 15.5 years v 7.3 years; P < .001) and were more likely to have hypodiploid ALL (65.4% v 1.2%; P < .001). Carrying germline TP53 pathogenic variants was associated with inferior event-free survival and overall survival (hazard ratio, 4.2 and 3.9; P < .001 and .001, respectively). In particular, children with TP53 pathogenic variants were at a dramatically higher risk of second cancers than those without pathogenic variants, with 5-year cumulative incidence of 25.1% and 0.7% (P < .001), respectively. Conclusion Loss-of-function germline TP53 variants predispose children to ALL and to adverse treatment outcomes with ALL therapy, particularly the risk of second malignant neoplasms. PMID:29300620

Tuning the brain for motherhood: prolactin-like central signalling in virgin, pregnant, and lactating female mice.

PubMed

Salais-López, Hugo; Lanuza, Enrique; Agustín-Pavón, Carmen; Martínez-García, Fernando

2017-03-01

Prolactin is fundamental for the expression of maternal behaviour. In virgin female rats, prolactin administered upon steroid hormone priming accelerates the onset of maternal care. By contrast, the role of prolactin in mice maternal behaviour remains unclear. This study aims at characterizing central prolactin activity patterns in female mice and their variation through pregnancy and lactation. This was revealed by immunoreactivity of phosphorylated (active) signal transducer and activator of transcription 5 (pSTAT5-ir), a key molecule in the signalling cascade of prolactin receptors. We also evaluated non-hypophyseal lactogenic activity during pregnancy by administering bromocriptine, which suppresses hypophyseal prolactin release. Late-pregnant and lactating females showed significantly increased pSTAT5-ir resulting in a widespread pattern of immunostaining with minor variations between pregnant and lactating animals, which comprises nuclei of the sociosexual and maternal brain, including telencephalic (septum, nucleus of the stria terminalis, and amygdala), hypothalamic (preoptic, paraventricular, supraoptic, and ventromedial), and midbrain (periaqueductal grey) regions. During late pregnancy, this pattern was not affected by the administration of bromocriptine, suggesting it to be elicited mostly by non-hypophyseal lactogenic agents, likely placental lactogens. Virgin females displayed, instead, a variable pattern of pSTAT5-ir restricted to a subset of the brain nuclei labelled in pregnant and lactating mice. A hormonal substitution experiment confirmed that estradiol and progesterone contribute to the variability found in virgin females. Our results reflect how the shaping of the maternal brain takes place prior to parturition and suggest that lactogenic agents are important candidates in the development of maternal behaviours already during pregnancy.

Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia

PubMed Central

Foster, K. Wade; Liu, Zhaoli; Nail, Clinton D.; Li, Xingnan; Fitzgerald, Thomas J.; Bailey, Sarah K.; Frost, Andra R.; Louro, Iuri D.; Townes, Tim M.; Paterson, Andrew J.; Kudlow, Jeffrey E.; Lobo-Ruppert, Susan M.; Ruppert, J. Michael

2006-01-01

KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions. PMID:15674344

Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia.

PubMed

Foster, K Wade; Liu, Zhaoli; Nail, Clinton D; Li, Xingnan; Fitzgerald, Thomas J; Bailey, Sarah K; Frost, Andra R; Louro, Iuri D; Townes, Tim M; Paterson, Andrew J; Kudlow, Jeffrey E; Lobo-Ruppert, Susan M; Ruppert, J Michael

2005-02-24

KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes, KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions.

Next-Generation Sequencing of a Cohort of Pulmonary Large Cell Carcinomas Reclassified by World Health Organization 2015 Criteria.

PubMed

Driver, Brandon R; Portier, Bryce P; Mody, Dina R; Deavers, Michael; Bernicker, Eric H; Kim, Min P; Teh, Bin S; Santacruz, Jose F; Kopas, Lisa; Munden, Reginald F; Cagle, Philip T

2016-04-01

The classification of pulmonary large cell carcinoma has undergone a major revision with the recent World Health Organization (WHO) 2015 Classification. Many large cell carcinomas are now reassigned to either adenocarcinoma with solid pattern or nonkeratinizing squamous cell carcinoma based on immunopositivity for adenocarcinoma markers or squamous cell carcinoma markers, respectively. Large cell carcinomas that are negative for adenocarcinoma and squamous cell carcinoma immunomarkers are now classified as large cell carcinoma with null immunohistochemical features (LCC-N). Although a few studies investigated the mutation profile of large cell carcinomas grouped by immunostain profile before the publication of the new WHO classification, investigation of tumors previously diagnosed as large cell carcinoma and reclassified according to the 2015 WHO classification has not, to our knowledge, been reported. To determine the mutation profiles of pulmonary large cell carcinomas reclassified by WHO 2015 criteria. Archival cases of non-small cell lung carcinoma with large cell carcinoma morphology (n = 17) were reclassified according to 2015 WHO criteria. To determine mutation profile, we employed Ion Torrent (Life Technologies, Carlsbad, California)-based next-generation sequencing (50 genes; more than 2800 mutations) in addition to real-time quantitative reverse transcription polymerase chain reaction for ALK translocation detection. Two of 17 cases (12%) were reclassified as LCC-N, and both had mutations-BRAF D594N in one case and KRAS G12C in the other case. Seven of 17 cases (41%) were reclassified in the adenocarcinoma with solid pattern group, which showed one KRAS G12C and one EGFR E709K + G719C double mutation in addition to mutations in TP53. Eight of 17 cases (47%) were reclassified in the nonkeratinizing squamous cell carcinoma group, which showed mutations in PIK3CA, CDKN2A, and TP53. No ALK translocations or amplifications were detected. The adenocarcinoma with solid pattern group showed mutations typical of adenocarcinoma, whereas the nonkeratinizing squamous cell carcinoma group showed mutations typical of squamous cell carcinoma. Both LCC-N cases had mutations associated with adenocarcinoma, supporting the hypothesis that LCC-N is related to adenocarcinoma.

Morphological evidences in circumvallate papilla and von Ebners' gland development in mice

PubMed Central

Sohn, Wern-Joo; Gwon, Gi-Jeong; An, Chang-Hyeon; Moon, Cheil; Bae, Yong-Chul; Yamamoto, Hitoshi; Lee, Sanggyu

2011-01-01

In rodents, the circumvallate papilla (CVP), with its underlying minor salivary gland, the von Ebners' gland (VEG), is located on the dorsal surface of the posterior tongue. Detailed morphological processes to form the proper structure of CVP and VEG have not been properly elucidated. In particular, the specific localization patterns of taste buds in CVP and the branching formation of VEG have not yet been elucidated. To understand the developmental mechanisms underlying CVP and VEG formation, detailed histological observations of CVP and VEG were examined using a three-dimensional computer-aided reconstruction method with serial histological sections and pan-Cytokeratins immunostainings. In addition, to define the developmental processes in CVP and VEG formation, we examined nerve innervations and cell proliferation using microinjections of AM1-43 and immunostainings with various markers, including phosphoinositide 3-kinase, Ki-67, PGP9.5, and Ulex europaeus agglutinin 1 (UEA1). Results revealed specific morphogenesis of CVP and VEG with nerve innervations patterns, evaluated by the coincided localization patterns of AM1-43 and UEA1. Based on these morphological and immunohistochemical results, we suggest that nerve innervations and cell proliferations play important roles in the positioning of taste buds in CVP and branching morphogenesis of VEG in tongue development. PMID:22254156

In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis.

PubMed

Borrás, Elisa; Zaragozá, Rosa; Morante, María; García, Concha; Gimeno, Amparo; López-Rodas, Gerardo; Barber, Teresa; Miralles, Vicente J; Viña, Juan R; Torres, Luis

2003-04-01

Several clinical trials have revealed that individuals who were given beta-carotene and vitamin A did not have a reduced risk of cancer compared to those given placebo; rather, vitamin A could actually have caused an adverse effect in the lungs of smokers [Omenn, G.S., Goodman, G.E., Thornquist, M.D., Balmes, J., Cullen, M.R., Glass, A., Keogh, J.P., Meyskens, F.L., Valanis, B., Williams, J.H., Barnhart, S. & Hammar, S. N. Engl. J. Med (1996) 334, 1150-1155; Hennekens, C.H., Buring, J.E., Manson, J.E., Stampfer, M., Rosner, B., Cook, N.R., Belanger, C., LaMotte, F., Gaziano, J.M., Ridker, P.M., Willet, W. & Peto, R. (1996) N. Engl. J. Med. 334, 1145-1149]. Using differential display techniques, an initial survey using rats showed that liver RNA expression of c-H-Ras was decreased and p53 increased in rats with chronic vitamin A deficiency. These findings prompted us to evaluate the expression of c-Jun, p53 and p21WAF1/CIF1 (by RT-PCR) in liver and lung of rats. This study showed that c-Jun levels were lower and that p53 and p21WAF1/CIF1 levels were higher in chronic vitamin A deficiency. Vitamin A supplementation increased expression of c-Jun, while decreasing the expression of p53 and p21WAF1/CIF1. Western-blot analysis demonstrated that c-Jun and p53 showed a similar pattern to that found in the RT-PCR analyses. Binding of retinoic acid receptors (RAR) to the c-Jun promoter was decreased in chronic vitamin A deficiency when compared to control hepatocytes, but contrasting results were found with acute vitamin A supplementated cells. DNA fragmentation and cytochrome c release from mitochondria were analyzed and no changes were found. In lung, an increase in the expression of c-Jun produced a significant increase in cyclin D1 expression. These results may explain, at least in part, the conflicting results found in patients supplemented with vitamin A and illustrate that the changes are not restricted to lung. Furthermore, these results suggest that pharmacological vitamin A supplementation may increase the risk of adverse effects including the risk of oncogenesis.

Antineuronal antibodies in idiopathic achalasia and gastro-oesophageal reflux disease

PubMed Central

Moses, P L; Ellis, L M; Anees, M R; Ho, W; Rothstein, R I; Meddings, J B; Sharkey, K A; Mawe, G M

2003-01-01

Background and aims: The precise aetiology of achalasia is unknown although autoimmunity has been implicated and is supported by several studies. We screened sera from patients with achalasia or gastro-oesophageal reflux disease (GORD) to test for circulating antimyenteric neuronal antibodies. Methods: Serum was obtained from 45 individuals with achalasia, 16 with GORD, and 22 normal controls. Serum was used in immunohistochemistry to label whole mount preparations of ileum and oesophagus of the guinea pig and mouse. Also, sections of superior cervical and dorsal root ganglia, and spinal cord were examined. Results: Positive immunostaining of the myenteric plexus was detected in significantly more achalasia and GORD samples than control samples (achalasia, p<0.001; GORD, p<0.01), and immunoreactivity was significantly more intense with achalasia and GORD serum samples than controls (achalasia, p<0.01; GORD, p<0.05). There was no correlation between intensity of immunoreactivity and duration of achalasia symptoms. In most cases, achalasia and GORD sera stained all ileal submucosal and myenteric neurones, and oesophageal neurones. Immunostaining was not species specific; however, immunostaining was largely specific for enteric neurones. Western blot analysis failed to reveal specific myenteric neuronal proteins that were labelled by antibodies in achalasia or GORD serum. Conclusions: These data suggest that antineuronal antibodies are generated in response to tissue damage or some other secondary phenomenon in achalasia and GORD. We conclude that antineuronal antibodies found in the serum of patients with achalasia represent an epiphenomenon and not a causative factor. PMID:12692044

Expression profiling of cutaneous squamous cell carcinoma with perineural invasion implicates the p53 pathway in the process.

PubMed

Warren, Timothy A; Broit, Natasa; Simmons, Jacinta L; Pierce, Carly J; Chawla, Sharad; Lambie, Duncan L J; Quagliotto, Gary; Brown, Ian S; Parsons, Peter G; Panizza, Benedict J; Boyle, Glen M

2016-09-26

Squamous cell carcinoma (SCC) is the second most common cancer worldwide and accounts for approximately 30% of all keratinocyte cancers. The vast majority of cutaneous SCCs of the head and neck (cSCCHN) are readily curable with surgery and/or radiotherapy unless high-risk features are present. Perineural invasion (PNI) is recognized as one of these high-risk features. The molecular changes during clinical PNI in cSCCHN have not been previously investigated. In this study, we assessed the global gene expression differences between cSCCHN with or without incidental or clinical PNI. The results of the analysis showed signatures of gene expression representative of activation of p53 in tumors with PNI compared to tumors without, amongst other alterations. Immunohistochemical staining of p53 showed cSCCHN with clinical PNI to be more likely to exhibit a diffuse over-expression pattern, with no tumors showing normal p53 staining. DNA sequencing of cSCCHN samples with clinical PNI showed no difference in mutation number or position with samples without PNI, however a significant difference was observed in regulators of p53 degradation, stability and activity. Our results therefore suggest that cSCCHN with clinical PNI may be more likely to contain alterations in the p53 pathway, compared to cSCCHN without PNI.

Pleural epithelioid angiosarcoma with lymphatic differentiation arisen after radiometabolic therapy for thyroid carcinoma: immunohistochemical findings and review of the literature.

PubMed

Cabibi, Daniela; Pipitone, Giulia; Porcasi, Rossana; Ingrao, Sabrina; Benza, Ignazio; Porrello, Calogero; Cajozzo, Massimo; Giannone, Antonino Giulio

2017-08-15

Pleural angiosarcoma is a rare tumor that causes diffuse pleural thickening and effusion, mimicking mesothelioma. Immunohistochemistry is needed to highlight endothelial differentiation. We describe the first case of pleural angiosarcoma with lymphatic differentiation following radiometabolic therapy for thyroid carcinoma. A 50-year-old man showed diffuse pleural thickening and effusion. Nine years earlier, he underwent thyroidectomy and radiometabolic therapy for thyroid carcinoma with lymph node metastases. Histologically, the tumor consisted of a solid proliferation of atypical epithelioid cells and anastomosed vascular spaces, lacking of red blood cells and containing Alcian blue positive material. The tumor showed positive immunostaining for Vimentin, CD31, CK7, D2-40, c-MYC, Ki67, focal positivity for PanCK, and negative immunostaining for Factor VIII, CD34, WT1, CK5/6, Calretinin, EMA, HBME-1, CEA, p63, EpCAM, Bcl-2, TTF1 and Thyroglobulin. CD99 showed a granular/paranuclear pattern of positivity. The histological and immunohistochemical features were consistent with "pleural angiosarcoma with lymphatic differentiation, epithelioid variant". Epithelioid angiosarcoma with lymphatic differentiation is very rare and aggressive. Moreover, the positivity for c-MYC suggests the relationship with radiometabolic therapy. To our knowledge, this is the first case of pleural c-MYC-positive angiosarcoma with lymphatic differentiation reported in the literature and the first one arisen after radiometabolic therapy for thyroid carcinoma.

Are all grade group 4 prostate cancers created equal? Implications for the applicability of the novel grade grouping.

PubMed

Gandaglia, Giorgio; Karnes, R Jeffrey; Sivaraman, Arjun; Moschini, Marco; Fossati, Nicola; Zaffuto, Emanuele; DellʼOglio, Paolo; Cathelineau, Xavier; Montorsi, Francesco; Sanchez-Salas, Rafael; Briganti, Alberto

2017-07-01

According to the novel prostate cancer (PCa) grade grouping, men with Gleason score 8 should be included in the grade group 4 regardless of primary and secondary scores. We aimed at evaluating the effect of Gleason patterns on the risk of recurrence in men with grade group 4 PCa. Overall, 1,089 patients treated with radical prostatectomy with grade group 4 PCa at final pathology were identified. Biochemical recurrence (BCR) was defined as 2 consecutive prostate-specific antigen values≥0.2ng/ml and rising. Clinical recurrence (CR) was defined as positive imaging after BCR. Kaplan-Meier analyses assessed time to BCR and CR. Multivariable Cox regression analyses assessed the impact of Gleason patterns on the risk of BCR and CR. Overall, 295 (27.1%), 651 (59.8%), and 143 (13.1%) patients had pathologic Gleason pattern 3+5, 4+4, and 5+3. Overall, 435 (39.9%) patients had positive margins and 439 (30.2%), 300 (27.5%), 350 (32.1%), and 216 (19.8%) had pT2, pT3a, pT3b/4, and pN1 disease. Median follow-up was 83 months. Overall, 536 and 221 patients experienced BCR and CR. The 10-year BCR- and CR-free survival rates were 42.9% and 67.5% vs. 38.3% and 59.7% vs. 40.6% and 50.4% for patients with pathologic Gleason pattern 3+5 vs. 4+4 vs. 5+3, respectively (all P≤0.005). In multivariable analyses, patients with Gleason pattern 3+5 were at lower risk of BCR compared to those with 4+4 (P = 0.002). Men with Gleason pattern 3+5 were at lower risk of CR compared to those with 4+4 and 5+3 (all P≤ 0.01). Patients with a primary Gleason score 3 are at reduced risk of recurrence as compared to their counterparts with 4 or 5. Primary and secondary Gleason scores should be considered to stratify the risk of recurrence after surgery in patients with grade group 4 PCa. Copyright © 2017 Elsevier Inc. All rights reserved.

The ontogenetic development of neurons containing calcium-binding proteins in the septum of the guinea pig: Late onset of parvalbumin immunoreactivity versus calbindin and calretinin.

PubMed

Hermanowicz-Sobieraj, Beata; Robak, Anna

2017-01-01

The study describes the immunoreactivity of calbindin (CB), calretinin (CR) and parvalbumin (PV), their distribution pattern and the co-distribution of CB and CR as well as CB and PV in the septum of the guinea pig during development. Immunohistochemistry was conducted on embryonic (E40, E50, E60), newborn (P0) and postnatal (P5, P10, P20, P40, P100) guinea pig brains. The presence of both CB and CR was detected at E40, while PV began to be observed at E60. Immunoreactivity for CB was constant throughout ontogeny. In contrast to CR immunoreactivity, PV immunoreactivity was higher in the postnatal stages than in the prenatal and newborn stages. Double immunostaining showed that CB co-localized with CR from E40 onwards, while with PV from P5 onwards, suggesting that CB co-operates with these proteins in the guinea pig septum during different periods of ontogeny. Our results also indicate that among the studied CaBPs, CB exhibited the highest immunoreactivity during both embryonic and postnatal development. Copyright © 2016 Elsevier B.V. All rights reserved.

Expression patterns of the aquaporin gene family during renal development: influence of genetic variability.

PubMed

Parreira, Kleber S; Debaix, Huguette; Cnops, Yvette; Geffers, Lars; Devuyst, Olivier

2009-08-01

High-throughput analyses have shown that aquaporins (AQPs) belong to a cluster of genes that are differentially expressed during kidney organogenesis. However, the spatiotemporal expression patterns of the AQP gene family during tubular maturation and the potential influence of genetic variation on these patterns and on water handling remain unknown. We investigated the expression patterns of all AQP isoforms in fetal (E13.5 to E18.5), postnatal (P1 to P28), and adult (9 weeks) kidneys of inbred (C57BL/6J) and outbred (CD-1) mice. Using quantitative polymerase chain reaction (PCR), we evidenced two mRNA patterns during tubular maturation in C57 mice. The AQPs 1-7-11 showed an early (from E14.5) and progressive increase to adult levels, similar to the mRNA pattern observed for proximal tubule markers (Megalin, NaPi-IIa, OAT1) and reflecting the continuous increase in renal cortical structures during development. By contrast, AQPs 2-3-4 showed a later (E15.5) and more abrupt increase, with transient postnatal overexpression. Most AQP genes were expressed earlier and/or stronger in maturing CD-1 kidneys. Furthermore, adult CD-1 kidneys expressed more AQP2 in the collecting ducts, which was reflected by a significant delay in excreting a water load. The expression patterns of proximal vs. distal AQPs and the earlier expression in the CD-1 strain were confirmed by immunoblotting and immunostaining. These data (1) substantiate the clustering of important genes during tubular maturation and (2) demonstrate that genetic variability influences the regulation of the AQP gene family during tubular maturation and water handling by the mature kidney.

Synthesis and evaluation of modified chalcone based p53 stabilizing agents.

PubMed

Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdel-Hamid; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib

2017-09-01

Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (CAL-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI 50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI 50 of 0.473±0.043µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-h post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities. Copyright © 2017 Elsevier Ltd. All rights reserved.

SASH1, a new potential link between smoking and atherosclerosis.

PubMed

Weidmann, Henri; Touat-Hamici, Zahia; Durand, Herve; Mueller, Christian; Chardonnet, Solenne; Pionneau, Cedric; Charlotte, Frédéric; Janssen, Klaus-Peter; Verdugo, Ricardo; Cambien, Francois; Blankenberg, Stefan; Tiret, Laurence; Zeller, Tanja; Ninio, Ewa

2015-10-01

We have previously reported that SASH1 expression is increased in circulating human monocytes from smokers and was positively correlated with the number of carotid atherosclerotic plaques. The aim of this study was to further validate the link between smoking, SASH1 and atherosclerosis within the vascular wall and to assess the impact of SASH1 expression on endothelial cell functions. Human carotids with atherosclerotic plaques were obtained from 58 patients (45 of them with known smoking status: smoker, non-smoker, ex-smokers), and were processed for gene expression analyses and immunostaining. To investigate its function, SASH1 was silenced in human aortic endothelial cells (HAECs) using two different siRNA and subcellular localization of SASH1 was determined by immunostaining and subcellular fractionation. Subsequently the transcriptomic analyses and functional experiments (wound healing, WST-1 proliferation or Matrigel assays) were performed to characterize SASH1 function. SASH1 was expressed in human vascular cells (HAECs, smooth muscle cells) and in monocytes/macrophages. Its tissue expression was significantly higher in the atherosclerotic carotids of smokers compared to non-smokers (p < 0.01). In HAECs, SASH1 was expressed mostly in the cytoplasm and SASH1 knockdown resulted in an increased cell migration, proliferation and angiogenesis. Transcriptomic and pathway analyses showed that SASH1 silencing results in a decreased CYP1A1 expression possibly through the inhibition of TP53 activity. We showed that SASH1 expression is increased in atherosclerotic carotids in smokers and its silencing affects endothelial angiogenic functions; therefore we provide a potential link between smoking and atherosclerosis through SASH1 expression. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Internalization and localization of basal insulin peglispro in cells.

PubMed

Moyers, Julie S; Volk, Catherine B; Cao, Julia X C; Zhang, Chen; Ding, Liyun; Kiselyov, Vladislav V; Michael, M Dodson

2017-10-15

Basal insulin peglispro (BIL) is a novel, PEGylated insulin lispro that has a large hydrodynamic size compared with insulin lispro. It has a prolonged duration of action, which is related to a delay in insulin absorption and a reduction in clearance. Given the different physical properties of BIL compared with native insulin and insulin lispro, it is important to assess the cellular internalization characteristics of the molecule. Using immunofluorescent confocal imaging, we compared the cellular internalization and localization patterns of BIL, biosynthetic human insulin, and insulin lispro. We assessed the effects of BIL on internalization of the insulin receptor (IR) and studied cellular clearance of BIL. Co-localization studies using antibodies to either insulin or PEG, and the early endosomal marker EEA1 showed that the overall internalization and subcellular localization pattern of BIL was similar to that of human insulin and insulin lispro; all were rapidly internalized and co-localized with EEA1. During ligand washout for 4 h, concomitant loss of insulin, PEG methoxy group, and PEG backbone immunostaining was observed for BIL, similar to the loss of insulin immunostaining observed for insulin lispro and human insulin. Co-localization studies using an antibody to the lysosomal marker LAMP1 did not reveal evidence of lysosomal localization for insulin lispro, human insulin, BIL, or PEG using either insulin or PEG immunostaining reagents. BIL and human insulin both induced rapid phosphorylation and internalization of human IR. Our findings show that treatment of cells with BIL stimulates internalization and localization of IR to early endosomes. Both the insulin and PEG moieties of BIL undergo a dynamic cellular process of rapid internalization and transport to early endosomes followed by loss of cellular immunostaining in a manner similar to that of insulin lispro and human insulin. The rate of clearance for the insulin lispro portion of BIL was slower than the rate of clearance for human insulin. In contrast, the PEG moiety of BIL can recycle out of cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Genomic instability--an evolving hallmark of cancer.

PubMed

Negrini, Simona; Gorgoulis, Vassilis G; Halazonetis, Thanos D

2010-03-01

Genomic instability is a characteristic of most cancers. In hereditary cancers, genomic instability results from mutations in DNA repair genes and drives cancer development, as predicted by the mutator hypothesis. In sporadic (non-hereditary) cancers the molecular basis of genomic instability remains unclear, but recent high-throughput sequencing studies suggest that mutations in DNA repair genes are infrequent before therapy, arguing against the mutator hypothesis for these cancers. Instead, the mutation patterns of the tumour suppressor TP53 (which encodes p53), ataxia telangiectasia mutated (ATM) and cyclin-dependent kinase inhibitor 2A (CDKN2A; which encodes p16INK4A and p14ARF) support the oncogene-induced DNA replication stress model, which attributes genomic instability and TP53 and ATM mutations to oncogene-induced DNA damage.

The use of autologous adult, allogenic juvenile, and combined juvenile-adult cartilage fragments for the repair of chondral defects.

PubMed

Bonasia, Davide Edoardo; Martin, James A; Marmotti, Antonio; Kurriger, Gail L; Lehman, Abigail D; Rossi, Roberto; Amendola, Annunziato

2016-12-01

The goal of the study was to evaluate the repair of chondral lesions treated with combined autologous adult/allogenic juvenile cartilage fragments, compared with isolated adult and isolated juvenile cartilage fragments. Fifty-eight adult (>16 week old) and five juvenile (<6 week old) New Zealand White female rabbits were used. A large osteochondral defect was created in the center of the femoral trochlea of adult rabbits. The rabbits were divided in four groups: Group 1 = untreated defects (controls); Group 2 = adult cartilage fragments; Group 3 = juvenile cartilage fragments; and Group 4 = adult + juvenile cartilage fragments. Killings were performed at 3 and 6 months. The defects were evaluated with ICRS macroscopic score, modified O'Driscoll score, and Collagen type II immunostaining. At 3 months, Group 4 performed better than Group 1, in terms of modified O'Driscoll score (p = 0.001) and Collagen type II immunostaining (p = 0.015). At 6 months, Group 4 showed higher modified O'Driscoll score (p = 0.003) and Collagen type II immunostaining score (p < 0.001) than Group 1. Histologically, also Group 3 performed better than Group 1 (p = 0.03), and Group 4 performed better than Group 2 (p = 0.004). Mixing adult and juvenile cartilage fragments improved cartilage repair in a rabbit model. In the clinical setting, a new "one-stage" procedure combining the two cartilage sources can be hypothesized, with the advantages of improved chondral repair and large defect coverage, because of the use of an off-the-shelf juvenile allograft. Further studies on larger animals and clinical trials are required to confirm these results.

Activity-dependent regulation of NMDAR1 immunoreactivity in the developing visual cortex.

PubMed

Catalano, S M; Chang, C K; Shatz, C J

1997-11-01

NMDA receptors have been implicated in activity-dependent synaptic plasticity in the developing visual cortex. We examined the distribution of immunocytochemically detectable NMDAR1 in visual cortex of cats and ferrets from late embryonic ages to adulthood. Cortical neurons are initially highly immunostained. This level declines gradually over development, with the notable exception of cortical layers 2/3, where levels of NMDAR1 immunostaining remain high into adulthood. Within layer 4, the decline in NMDAR1 immunostaining to adult levels coincides with the completion of ocular dominance column formation and the end of the critical period for layer 4. To determine whether NMDAR1 immunoreactivity is regulated by retinal activity, animals were dark-reared or retinal activity was completely blocked in one eye with tetrodotoxin (TTX). Dark-rearing does not cause detectable changes in NMDAR1 immunoreactivity. However, 2 weeks of monocular TTX administration decreases NMDAR1 immunoreactivity in layer 4 of the columns of the blocked eye. Thus, high levels of NMDAR1 immunostaining within the visual cortex are temporally correlated with ocular dominance column formation and developmental plasticity; the persistence of staining in layers 2/3 also correlates with the physiological plasticity present in these layers in the adult. In addition, visual experience is not required for the developmental changes in the laminar pattern of NMDAR1 levels, but the presence of high levels of NMDAR1 in layer 4 during the critical period does require retinal activity. These observations are consistent with a central role for NMDA receptors in promoting and ultimately limiting synaptic rearrangements in the developing neocortex.

Topical infliximab for the suppression of wound healing following experimental glaucoma filtration surgery

PubMed Central

Turgut, Burak; Eren, Kenan; Akın, Mehmet Mustafa; Demir, Tamer; Kobat, Sabiha

2014-01-01

Background The purpose of this work was to look into the effects of infliximab on wound healing in experimental glaucoma filtration surgery and to compare the antifibrotic effects of this agent to that of mitomycin-C (MMC). Methods Twenty-eight male New Zealand White rabbits were randomly assigned to four groups, each including seven rabbits: control group, sham group, MMC group, and infliximab group. The rabbits in the control group were not operated on and did not receive any treatment. The rabbits in the sham group underwent trabeculectomy and had one drop of saline instilled four times a day for 14 days. The rabbits in the MMC treatment group underwent trabeculectomy, and a sponge soaked in 0.4 mg/mL MMC was applied intraoperatively to the scleral surgical site for three minutes. The rabbits in the infliximab treatment group underwent trabeculectomy and one drop of 10 mg/mL infliximab was instilled four times a day for 14 days after surgery. On day 14 of the experiment, the operated and control eyes were enucleated and histologically and immunohistochemically analyzed. Results The mean fibroblast and mononuclear cell (MNC) numbers and the mean immunostaining intensities of transforming growth factor-β (TGF-β), fibroblast growth factor-β (FGF-β), and platelet-derived growth factor (PDGF) in the sham group were higher than those of the control group (P<0.01). The mean fibroblast and MNC numbers and the mean immunostaining intensities of TGF-β, FGF-β, and PDGF in the MMC and infliximab groups were statistically significantly lower than those of the sham group (P<0.01). The mean fibroblast and MNC numbers and the mean TGF-β, FGF-β, and PDGF immunostaining intensities of the MMC and infliximab groups were similar (P>0.05). Conclusion Our study suggests that topical infliximab effectively suppresses the subconjunctival wound healing response after experimental glaucoma filtration surgery, reducing the MNC and fibroblast numbers and immunostaining intensities of TGF-β, FGF-β, and PDGF. PMID:24851041

p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

NASA Technical Reports Server (NTRS)

Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

2001-01-01

Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

Reduction of the immunostainable length of the hippocampal dentate granule cells' primary cilia in 3xAD-transgenic mice producing human A{beta}{sub 1-42} and tau

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakravarthy, Balu, E-mail: Balu.Chakravarthy@nrc-cnrc.gc.ca; Gaudet, Chantal; Menard, Michel

2012-10-12

Highlights: Black-Right-Pointing-Pointer A{beta} and tau-induced neurofibrillary tangles play a key role in Alzheimer's disease. Black-Right-Pointing-Pointer A{beta}{sub 1-42} and mutant tau protein together reduce the primary cilium length. Black-Right-Pointing-Pointer This shortening likely reduces cilium-dependent neurogenesis and memory function. Black-Right-Pointing-Pointer This provides a model of an A{beta}/tau targeting of a neuronal signaling organelle. -- Abstract: The hippocampal dentate gyrus is one of the two sites of continuous neurogenesis in adult rodents and humans. Virtually all dentate granule cells have a single immobile cilium with a microtubule spine or axoneme covered with a specialized cell membrane loaded with receptors such as the somatostatinmore » receptor 3 (SSTR3), and the p75 neurotrophin receptor (p75{sup NTR}). The signals from these receptors have been reported to stimulate neuroprogenitor proliferation and the post-mitotic maturation of newborn granule cells into functioning granule cells. We have found that in 6-24-months-old triple transgenic Alzheimer's disease model mice (3xTg-AD) producing both A{beta}{sub 1-42} and the mutant human tau protein tau{sub P301L,} the dentate granule cells still had immunostainable SSTR3- and p75{sup NTR}-bearing cilia but they were only half the length of the immunostained cilia in the corresponding wild-type mice. However, the immunostainable length of the granule cell cilia was not reduced either in 2xTg-AD mice accumulating large amounts of A{beta}{sub 1-42} or in mice accumulating only a mutant human tau protein. Thus it appears that a combination of A{beta}{sub 1-42} and tau protein accumulation affects the levels of functionally important receptors in 3xTg-AD mice. These observations raise the important possibility that structural and functional changes in granule cell cilia might have a role in AD.« less

Radiation-induced hyperproliferation of intestinal crypts results in elevated genome instability with inactive p53-related genomic surveillance.

PubMed

Zhou, Xin; Ma, Xiaofei; Wang, Zhenhua; Sun, Chao; Wang, Yupei; He, Yang; Zhang, Hong

2015-12-15

Radiation-induced hyperproliferation of intestinal crypts is well documented, but its potential tumorigenic effects remain elusive. Here we aim to determine the genomic surveillance process during crypt hyperproliferation, and its consequential outcome after ionizing radiation. Crypt regeneration in the intestine was induced by a single dose of 12Gy abdominal irradiation. γ-H2AX, 53BP1 and DNA-PKcs were used as DNA repair surrogates to investigate the inherent ability of intestinal crypt cells to recognize and repair double-strand breaks. Ki67 staining and the 5-bromo-2'-deoxyuridine incorporation assay were used to study patterns of cell proliferation in regenerating crypts. Staining for ATM, p53, Chk1 and Chk2 was performed to study checkpoint activation and release. Apoptosis was evaluated through H&E staining and terminal deoxynucleotidyl transferase (dUTP) nick-end labeling. The ATM-p53 pathway was immediately activated after irradiation. A second wave of DSBs in crypt cells was observed in regenerating crypts, accompanied with significantly increased chromosomal bridges. The p53-related genomic surveillance pathway was not active during the regeneration phase despite DSBs and chromosomal bridges in the cells of regenerating crypts. Non-homologous end joining (NHEJ) DSBs repair was involved in the DSBs repair process, as indicated by p-DNA-PKcs staining. Intestinal crypt cells retained hyperproliferation with inactive p53-related genomic surveillance system. NHEJ was involved in the resultant genomic instability during hyperproliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

Prognostic significance of human pituitary tumor-transforming gene immunohistochemical expression in differentiated thyroid cancer.

PubMed

Sáez, Carmen; Martínez-Brocca, M Asunción; Castilla, Carolina; Soto, Alfonso; Navarro, Elena; Tortolero, María; Pintor-Toro, José A; Japón, Miguel A

2006-04-01

Human securin pituitary tumor-transforming gene (hPTTG) is overexpressed in a variety of primary neoplasias, including differentiated thyroid cancer (DTC). The objective of this study was to examine the immunohistochemical expression of hPTTG in DTC and its association with known prognostic factors. hPTTG expression was analyzed by immunostaining on paraffin-embedded tissues. Clinical data were used to determine any associations between the expression of hPTTG and prognostic variables of DTC. A median follow-up of 43 months allowed us to analyze the persistence of disease and the response to radioiodine therapy. The study was conducted at a tertiary university hospital. Ninety-five patients undergoing surgical resection for DTC (n = 60) or benign nodular thyroid disease (n = 35) were studied. The main outcome measure was the association between hPTTG expression and prognostic factors in DTC. Among DTC cases, 21 (35%) had low and 39 (65%) had high hPTTG immunostaining. Adjacent nonneoplastic thyroid tissue was largely unstained. Among benign nodular thyroid disease cases, immunostaining was detected focally in eight (22.8%). A significant association was found between hPTTG expression and the presence of nodal (P < 0.01) or distant metastases (P < 0.05). A significant association with TNM was also found, because 83.3% of advanced TNM stages showed elevated hPTTG (P < 0.05). The association between hPTTG overexpression and decreased radioiodine uptake during follow-up was also significant (P < 0.05). The expression levels of hPTTG were confirmed as an independent prognostic factor for persistent disease (relative risk, 3.0; 95% confidence interval, 1.1-8.7; P < 0.05). Immunohistochemical analysis of hPTTG is of potential value in the determination of tumor aggressiveness in DTC.

Effect of ovarian aging on androgen biosynthesis in a cynomolgus macaque model

PubMed Central

Ethun, K. F.; Wood, C. E.; Parker, C. R.; Kaplan, J. R.; Chen, H.; Appt, S. E.

2013-01-01

Objective The role of androgens in chronic disease pathogenesis, cognitive function and libido during menopause is of increasing interest. The aim of this study was to characterize the distribution and expression of androgenic proteins in the macaque ovary and to investigate the relationship between serum androgen concentrations, follicle number, and the persistence of androgenesis in the aging macaque ovary. Methods The subjects were 26 adult female cynomolgus macaques. Ovaries were immunostained for cytochrome P450 17α-hydroxylase/17–20 lyase (P450c17), 3β-hydroxysteroid dehydrogenase (3βHSD), and cytochrome b5 (cytb5). Based on primordial follicle counts, animals were divided into tertiles (low (≤200), intermediate (226–1232), and high (2372–4356)) to evaluate differences in androgen staining and changes in serum androgen concentrations following ovariectomy. Results Positive immunostaining for P450c17 and cytb5 within the theca interna layer of growing follicles persisted in advanced atretic follicles and secondary interstitial cells (residual stromal cells). Ovaries with low follicle numbers had less staining for all androgenic proteins compared to ovaries with higher numbers of growing follicles. Immunostaining for cytb5 was the most reliable marker for persistent androgenesis in ovaries with minimal primordial follicle numbers (<100) and residual stromal cells. Following ovariectomy, a significant decrease in testosterone (−27.7%, −30.8%, −27.5%; p < 0.01) and androstenedione (−33.4%, −35.7%, −46.0%; p < 0.01) was observed in monkeys with low, intermediate, and high primordial follicle counts, respectively. Conclusions Despite low follicle numbers, the aging macaque ovary retains the necessary proteins for androgenesis within residual stromal cells and contributes to peripheral androgen concentrations. PMID:21864136

Reactive Oxygen Species in Planarian Regeneration: An Upstream Necessity for Correct Patterning and Brain Formation

PubMed Central

Pirotte, Nicky; Stevens, An-Sofie; Fraguas, Susanna; Plusquin, Michelle; Van Roten, Andromeda; Van Belleghem, Frank; Paesen, Rik; Ameloot, Marcel; Cebrià, Francesc; Artois, Tom; Smeets, Karen

2015-01-01

Recent research highlighted the impact of ROS as upstream regulators of tissue regeneration. We investigated their role and targeted processes during the regeneration of different body structures using the planarian Schmidtea mediterranea, an organism capable of regenerating its entire body, including its brain. The amputation of head and tail compartments induces a ROS burst at the wound site independently of the orientation. Inhibition of ROS production by diphenyleneiodonium (DPI) or apocynin (APO) causes regeneration defaults at both the anterior and posterior wound sites, resulting in reduced regeneration sites (blastemas) and improper tissue homeostasis. ROS signaling is necessary for early differentiation and inhibition of the ROS burst results in defects on the regeneration of the nervous system and on the patterning process. Stem cell proliferation was not affected, as indicated by histone H3-P immunostaining, fluorescence-activated cell sorting (FACS), in situ hybridization of smedwi-1, and transcript levels of proliferation-related genes. We showed for the first time that ROS modulate both anterior and posterior regeneration in a context where regeneration is not limited to certain body structures. Our results indicate that ROS are key players in neuroregeneration through interference with the differentiation and patterning processes. PMID:26180588

Cell proliferation and p53 expression in pseudoepitheliomatous hyperplasia of oral paracoccidioidomycosis.

PubMed

Kaminagakura, E; Bonan, P R F; Lopes, M A; Almeida, O P

2006-09-01

Paracoccidioidomycosis (PCMycosis) is a systemic mycosis frequently found in many regions of Latin America. Microscopically, it is characterised by granulomatous inflammation and pseudoepitheliomatous hyperplasia (PEH). This work describes the proliferation index and p53 expression by immunohistochemistry in PEH of PCMycosis, normal oral mucosa (NOM) and mild oral epithelial dysplasia (ED). Ki67 positive cells were present in the basal and parabasal layers in NOM and PEH, while in ED it was also observed in the spinous layer. Percentage of ki67 positive cells was 7.7, 28.2 and 46.0 in NOM, PEH and ED respectively. p53 was negative in NOM and in PEH it was expressed by few cells in the basal layer of only three cases. However, it was expressed in all cases of ED, in basal and parabasal layers. Although histologically PEH mimics well-differentiated squamous cell carcinoma, its proliferative pattern and p53 expression are more similar to NOM than to dysplasia. These findings, confirm PEH as a reactive process probably associated with the underlying chronic inflammation.

p53 nuclear accumulation and ERα expression in ductal hyperplasia of breast in a cohort of 215 Chinese women

PubMed Central

2010-01-01

Introduction Women with ductal hyperplasia including usual ductal hyperplasia (UDH) and atypical ductal hyperplasia (ADH) have an increased risk of developing invasive ductal carcinoma (IDC) of breast. The importance of several molecular markers in breast cancer has been of considerable interest during recent years such as p53 and estrogen receptor alpha (ERα). However, p53 nuclear accumulation and ERα expression have not been assessed in ductal hyperplasia co-existing with ductal carcinoma in situ (DCIS) or IDC versus pure ductal hyperplasia without DCIS or IDC. Materials and methods We investigated p53 nuclear accumulation and ERα expression in breast ductal hyperplasia in a cohort of 215 Chinese women by immunohistochemistry (IHC), which included 129 cases of pure ductal hyperplasia, 86 cases of ductal hyperplasia co-existing with DCIS (41 cases) or IDC (45 cases). Results Nuclear p53 accumulation was identified in 22.8% of ADH (31/136), 41.5% of DCIS (17/41) and 42.2% of IDC (19/45), and no case of UDH (0/79). No difference in nuclear p53 accumulation was observed between pure ADH and ADH co-existing with DCIS (ADH/DCIS) or IDC (ADH/IDC) (P > 0.05). The positive rate of ERα expression was lower in ADH (118/136, 86.8%) than that in UDH (79/79, 100%) (P < 0.001), but higher than that in DCIS (28/41, 68.3%) or IDC (26/45, 57.8%) respectively (P < 0.001). The frequency of ERα expression was lower in ADH/DCIS (23/29, 79.31%) and ADH/IDC (23/30, 76.67%) than that in pure ADH (72/77, 93.51%) respectively (P < 0.05). There was a negative weak correlation between p53 nuclear accumulation and ERα expression as for ADH (coefficient correlation -0.51; P < 0.001). Conclusions Different pathological types of ductal hyperplasia of breast are accompanied by diversity in patterns of nuclear p53 accumulation and ERα expression. At least some pure ADH is molecularly distinct from ADH/CIS or ADH/IDC which indicated the two types of ADH are molecularly distinct entities although they have the same morphological appearance. PMID:20712900

Calreticulin mutation-specific immunostaining in myeloproliferative neoplasms: pathogenetic insight and diagnostic value

PubMed Central

Vannucchi, A M; Rotunno, G; Bartalucci, N; Raugei, G; Carrai, V; Balliu, M; Mannarelli, C; Pacilli, A; Calabresi, L; Fjerza, R; Pieri, L; Bosi, A; Manfredini, R; Guglielmelli, P

2014-01-01

Mutations in the gene calreticulin (CALR) occur in the majority of JAK2- and MPL-unmutated patients with essential thrombocythemia (ET) and primary myelofibrosis (PMF); identifying CALR mutations contributes to the diagnostic pathway of ET and PMF. CALR mutations are heterogeneous spanning over the exon 9, but all result in a novel common protein C terminus. We developed a polyclonal antibody against a 17-amino-acid peptide derived from mutated calreticulin that was used for immunostaining of bone marrow biopsies. We show that this antibody specifically recognized patients harboring different types of CALR mutation with no staining in healthy controls and JAK2- or MPL-mutated ET and PMF. The labeling was mostly localized in megakaryocytes, whereas myeloid and erythroid cells showed faint staining, suggesting a preferential expression of calreticulin in megakaryocytes. Megakaryocytic-restricted expression of calreticulin was also demonstrated using an antibody against wild-type calreticulin and by measuring the levels of calreticulin RNA by gene expression analysis. Immunostaining using an antibody specific for mutated calreticulin may become a rapid, simple and cost-effective method for identifying CALR-mutated patients complementing molecular analysis; furthermore, the labeling pattern supports the preferential expansion of megakaryocytic cell lineage as a result of CALR mutation in an immature hematopoietic stem cell. PMID:24618731

Genomic alterations in spontaneous and carcinogen-induced murine melanoma cell lines.

PubMed

Melnikova, Vladislava O; Bolshakov, Svetlana V; Walker, Christopher; Ananthaswamy, Honnavara N

2004-03-25

We have conducted an analysis of genetic alterations in spontaneous murine melanoma cell line B16F0 and its two metastatic clones, B16F1 and B16F10 and the carcinogen-induced murine melanoma cell lines CM519, CM3205, and K1735. We found that unlike human melanomas, the murine melanoma cell lines did not have activating mutations in the Braf oncogene at exon 11 or 15. However, there were distinct patterns of alterations in the ras, Ink4a/Arf, and p53 genes in the two melanoma groups. In the spontaneous B16 melanoma cell lines, expression of p16Ink4a and p19Arf tumor suppressor proteins was lost as a consequence of a large deletion spanning Ink4a/Arf exons 1alpha, 1beta, and 2. In contrast, the carcinogen-induced melanoma cell lines expressed p16Ink4a but had inactivating mutations in either p19Arf (K1735) or p53 (CM519 and CM3205). Inactivation of p19Arf or p53 in carcinogen-induced melanomas was accompanied by constitutive activation of mitogen-activated protein kinases (MAPKs) and/or mutation-associated activation of N-ras. These results indicate that genetic alterations in p16Ink4a/p19Arf, p53 and ras-MAPK pathways can cooperate in the development of murine melanoma.

ALK1 expression in oral lichen planus: a possible relation to microvessel density.

PubMed

Hazzaa, Hala H A; El-Wakeel, Naglaa M; Attia, Enas A S; Abo Hager, Eman A

2016-05-01

To assess the expression of activin receptor-like kinase 1 (ALK1) and investigate its possible relationship with microvessel density (MVD) in different forms of oral lichen planus (OLP) compared to controls' biopsies. Biopsies from 20 reticular/papular OLP (R/PLP), 20 atrophic/erosive OLP (A/ELP) patients, and 20 healthy subjects were immunohistochemically analyzed and statistically compared and correlated for ALK1 expression and MVD as assessed by CD34 expression. All OLP specimens revealed the presence of positive cytoplasmic CD34 immunostaining in endothelial cells, with statistically high significant MVD in each of R/PLP (Median; M = 4.40) and A/ELP (M = 7.69) compared to controls (M = 1.16) (P < 0.001). Statistically significant MVD was found in A/ELP compared to R/PLP (P < 0.001). All control specimens revealed negative ALK1 immunostaining of the few inflammatory cells found, while 85% of A/ELP cases and 70% of R/PLP cases showed positively immunostained sections for ALK-1, with statistically significant higher ALK1 expression In A/ELP (M = 1.95) compared to R/PLP (M = 0.86) (P = 0.005). No significant correlation between CD34 and ALK1 was detected in R/PLP (r = 0.081), while a barely moderate positive correlation was found in A/ELP (r = 0.396). ALK1 expression and MVD are increased in OLP, particularly in A/ELP type. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Development of magnet configurations for magnetic immunostaining

NASA Astrophysics Data System (ADS)

Kaneko, Miki; Chikaki, Shinichi; Matsuda, Sachiko; Kuwahata, Akihiro; Namita, Masayuki; Saito, Itsuro; Sakamoto, Satoshi; Kusakabe, Moriaki; Sekino, Masaki

2018-05-01

Magnetic immunostaining using a magnet and antibody-labeled fluorescent ferrite (FF) beads is established as a rapid immunostaining. In this study, we proposed the novel configuration of magnets with the large magnetic field gradient and the strong magnetic force for magnetic immunostaining. To confirm the usefulness of the proposed magnet configuration, we performed numerical analysis of the magnetic characteristics of the proposed magnets, and the magnetic immunostaining with FF beads. It was revealed that the proposed magnets generated the strong magnetic force and promoted the immunoreaction rapidly.

The Profile of Heparanase Expression Distinguishes Differentiated Thyroid Carcinoma from Benign Neoplasms

PubMed Central

Matos, Leandro Luongo; Suarez, Eloah Rabello; Theodoro, Thérèse Rachell; Trufelli, Damila Cristina; Melo, Carina Mucciolo; Garcia, Larissa Ferraz; Oliveira, Olivia Capela Grimaldi; Matos, Maria Graciela Luongo; Kanda, Jossi Ledo; Nader, Helena Bonciani; Martins, João Roberto Maciel; Pinhal, Maria Aparecida Silva

2015-01-01

Introduction The search for a specific marker that could help to distinguish between differentiated thyroid carcinoma and benign lesions remains elusive in clinical practice. Heparanase (HPSE) is an endo-beta-glucoronidase implicated in the process of tumor invasion, and the heparanase-2 (HPSE2) modulates HPSE activity. The aim of this study was to evaluate the role of heparanases in the development and differential diagnosis of follicular pattern thyroid lesions. Methods HPSE and HPSE2 expression by qRT-PCR, immunohistochemistry evaluation, western blot analysis and HPSE enzymatic activity were evaluated. Results The expression of heparanases by qRT-PCR showed an increase of HPSE2 in thyroid carcinoma (P = 0.001). HPSE activity was found to be higher in the malignant neoplasms than in the benign tumors (P<0.0001). On Western blot analysis, HPSE2 isoforms were detected only in malignant tumors. The immunohistochemical assay allowed us to establish a distinct pattern for malignant and benign tumors. Carcinomas showed a typical combination of positive labeling for neoplastic cells and negative immunostaining in colloid, when compared to benign tumors (P<0.0001). The proposed diagnostic test presents sensitivity and negative predictive value of around 100%, showing itself to be an accurate test for distinguishing between malignant and benign lesions. Conclusions This study shows, for the first time, a distinct profile of HPSE expression in thyroid carcinoma suggesting its role in carcinogenesis. PMID:26488476

Antiapoptotic effects of anthocyanin from the seed coat of black soybean against oxidative damage of human lens epithelial cell induced by H2O2.

PubMed

Mok, Jee Won; Chang, Dong-Jin; Joo, Choun-Ki

2014-11-01

To describe the protective effect of anthocyanin from black soybean in human lens epithelial cell line (HLE-B3) under H2O2-induced oxidative stress. Cytotoxicity of anthocyanin and H2O2 were determined by Cell Counting Kit-8 test. Viability of HLE-B3 cells under various H2O2 concentration (0, 50 and 100 μM) with or without pretreatment of anthocyanin (0, 50, 100 and 200 μg/ml) was measured. After quantifying the percentage of the apoptosis by Annexin V assay and APO-BrdU TUNEL assay, we conducted western blot and immunostaining of apoptosis-related molecules; Bcl2, BAD, BAX, p53 and caspase-3. To confirm the effect of anthocyanin on an ex vivo model, its effect on cultures of the lenses of porcine were examined. Anthocyanin reduced cell death of HLE-B3 under H2O2-induced oxidative stress in a dose-dependent manner. In Annexin V analysis, anthocyanin protected HLE-B3 cells from apoptosis. H2O2 increased the expression of BAX, BAD, p53 and caspase-3 in a time-dependent manner, those of which anthocyanin significantly decreased. On the other hand, Bcl2 was increased from anthocyanin-treated lens cells. And in anthocyanin-treated lens organ culture, transparency was maintained. This study showed that anthocyanin protects HLE-B3 cells under oxidative stress from apoptosis, and the mechanism of the effect is related to the intrinsic pathway of apoptosis. Anthocyanin has a potential in prevention of cataract.

Distinction of Invasive Carcinoma Derived From Intraductal Papillary Mucinous Neoplasms From Concomitant Ductal Adenocarcinoma of the Pancreas Using Molecular Biomarkers.

PubMed

Tamura, Koji; Ohtsuka, Takao; Date, Kenjiro; Fujimoto, Takaaki; Matsunaga, Taketo; Kimura, Hideyo; Watanabe, Yusuke; Miyazaki, Tetsuyuki; Ohuchida, Kenoki; Takahata, Shunichi; Ishigami, Kousei; Oda, Yoshinao; Mizumoto, Kazuhiro; Nakamura, Masafumi; Tanaka, Masao

2016-07-01

To clarify the usefulness of molecular biomarkers for distinguishing invasive carcinoma derived from intraductal papillary mucinous neoplasms (IPMNs [Inv-IPMN]) from concomitant pancreatic ductal adenocarcinoma (PDAC). Data from 19 patients with resected concomitant PDAC were retrospectively reviewed. KRAS/GNAS mutations and immunohistochemical (IHC) expression of p53 and p16/CDKN2A were assessed in both IPMN and distinct PDAC. As controls, KRAS/GNAS mutations and IHC labeling were assessed between invasive and noninvasive components in 1 lesion of 22 independent patients. KRAS/GNAS mutation status of invasive and noninvasive components in Inv-IPMN was consistent in 18 (86%) of 21 patients. Conversely, mutational patterns in IPMN and distinct PDAC in the same pancreas differed from each other in 17 (89%) of 19. There were 10 (53%) and 8 (42%) of 19 patients who showed the same p53 and p16/CDKN2A staining between concomitant PDAC and distinct IPMN. In the Inv-IPMN cohort, 19 (86%) of 22 patients showed the same IHC expression pattern between the noninvasive and invasive components. It may be possible to distinguish Inv-IPMN from concomitant PDAC by assessing these molecular biomarkers. More precise distinction of Inv-IPMN and concomitant PDAC will lead to adequate recognition of the natural history of IPMNs and hence optimal management.

Correlation of High-Risk Soft Tissue Sarcoma Biomarker Expression Patterns with Outcome following Neoadjuvant Chemoradiation

PubMed Central

Magliocco, Anthony; Zhang, Qiang; Wang, Dian; Klimowicz, Alex; Harris, Jonathan; Simko, Jeff; DeLaney, Thomas; Kraybill, William; Kirsch, David G.

2018-01-01

Background Sarcoma mortality remains high despite adjuvant chemotherapy. Biomarker predictors of treatment response and outcome could improve treatment selection. Methods Tissue microarrays (TMAs) were created using pre- and posttreatment tumor from two prospective trials (MGH pilot and RTOG 9514) of neoadjuvant/adjuvant MAID chemotherapy and preoperative radiation. Biomarkers were measured using automated computerized imaging (AQUA or ACIS). Expression was correlated with disease-free survival (DFS), distant disease-free survival (DDFS), and overall survival (OS). Results Specimens from 60 patients included 23 pretreatment (PRE), 40 posttreatment (POST), and 12 matched pairs (MPs). In the MP set, CAIX, GLUT1, and PARP1 expression significantly decreased following neoadjuvant therapy, but p53 nuclear/cytoplasmic (N/C) ratio increased. In the PRE set, no biomarker expression was associated with DFS, DDFS, or OS. In the POST set, increased p53 N/C ratio was associated with a significantly decreased DFS and DDFS (HR 4.13, p=0.017; HR 4.16, p=0.016), while increased ERCC1 and XPF expression were associated with an improved DFS and DDFS. No POST biomarkers were associated with OS. Conclusions PRE biomarker expression did not predict survival outcomes. Expression pattern changes after neoadjuvant chemoradiation supports the concepts of tumor reoxygenation, altered HIF-1α signaling, and a p53 nuclear accumulation DNA damage response. Clinical Trial Registration NRG Oncology RTOG 9514 is registered with ClinicalTrials.gov. The ClinicalTrials.gov Identifier is NCT00002791. PMID:29681762

MYC, FBXW7 and TP53 copy number variation and expression in Gastric Cancer

PubMed Central

2013-01-01

Background MYC deregulation is a common event in gastric carcinogenesis, usually as a consequence of gene amplification, chromosomal translocations, or posttranslational mechanisms. FBXW7 is a p53-controlled tumor-suppressor that plays a role in the regulation of cell cycle exit and reentry via MYC degradation. Methods We evaluated MYC, FBXW7, and TP53 copy number, mRNA levels, and protein expression in gastric cancer and paired non-neoplastic specimens from 33 patients and also in gastric adenocarcinoma cell lines. We also determined the invasion potential of the gastric cancer cell lines. Results MYC amplification was observed in 51.5% of gastric tumor samples. Deletion of one copy of FBXW7 and TP53 was observed in 45.5% and 21.2% of gastric tumors, respectively. MYC mRNA expression was significantly higher in tumors than in non-neoplastic samples. FBXW7 and TP53 mRNA expression was markedly lower in tumors than in paired non-neoplastic specimens. Moreover, deregulated MYC and FBXW7 mRNA expression was associated with the presence of lymph node metastasis and tumor stage III-IV. Additionally, MYC immunostaining was more frequently observed in intestinal-type than diffuse-type gastric cancers and was associated with MYC mRNA expression. In vitro studies showed that increased MYC and reduced FBXW7 expression is associated with a more invasive phenotype in gastric cancer cell lines. This result encouraged us to investigate the activity of the gelatinases MMP-2 and MMP-9 in both cell lines. Both gelatinases are synthesized predominantly by stromal cells rather than cancer cells, and it has been proposed that both contribute to cancer progression. We observed a significant increase in MMP-9 activity in ACP02 compared with ACP03 cells. These results confirmed that ACP02 cells have greater invasion capability than ACP03 cells. Conclusion In conclusion, FBXW7 and MYC mRNA may play a role in aggressive biologic behavior of gastric cancer cells and may be a useful indicator of poor prognosis. Furthermore, MYC is a candidate target for new therapies against gastric cancer. PMID:24053468

The Chemical Chaperone, PBA, Reduces ER Stress and Autophagy and Increases Collagen IV α5 Expression in Cultured Fibroblasts From Men With X-Linked Alport Syndrome and Missense Mutations.

PubMed

Wang, Dongmao; Mohammad, Mardhiah; Wang, Yanyan; Tan, Rachel; Murray, Lydia S; Ricardo, Sharon; Dagher, Hayat; van Agtmael, Tom; Savige, Judy

2017-07-01

X-linked Alport syndrome (OMIM 301050) is caused by COL4A5 missense variants in 40% of families. This study examined the effects of chemical chaperone treatment (sodium 4-phenylbutyrate) on fibroblast cell lines derived from men with missense mutations. Dermal fibroblast cultures were established from 2 affected men and 3 normals. Proliferation rates were examined, the collagen IV α5 chain localized with immunostaining, and levels of the intra- and extracellular chains quantitated with an in-house enzyme-linked immunosorbent assay. COL4A5 mRNA was measured using quantitative reverse transcriptase polymerase chain reaction. Endoplasmic reticulum (ER) size was measured on electron micrographs and after HSP47 immunostaining. Markers of ER stress (ATF6, HSPA5, DDIT3), autophagy (ATG5, BECN1, ATG7), and apoptosis (CASP3, BAD, BCL 2 ) were also quantitated by quantitative reverse transcriptase polymerase chain reaction. Measurements were repeated after 48 hours of incubation with 10 mM sodium 4-phenylbutyrate acid. Both COL4A5 missense variants were associated with reduced proliferation rates on day 6 ( P  = 0.01 and P  = 0.03), ER enlargement, and increased mRNA for ER stress and autophagy (all P values < 0.05) when compared with normal. Sodium 4-phenylbutyrate treatment increased COL4A5 transcript levels ( P  < 0.01), and reduced ER size ( P  < 0.01 by EM and P  < 0.001 by immunostaining), ER stress (p HSPA5 and DDIT3, all P values < 0.01) and autophagy (ATG7, P  < 0.01). Extracellular collagen IV α5 chain was increased in the M1 line only ( P  = 0.06). Sodium 4-phenylbutyrate increases collagen IV α5 mRNA levels, reduces ER stress and autophagy, and possibly facilitates collagen IV α5 extracellular transport. Whether these actions delay end-stage renal failure in men with X-linked Alport syndrome and missense mutations will only be determined with clinical trials.

Downregulation of B-myb promotes senescence via the ROS-mediated p53/p21 pathway, in vascular endothelial cells.

PubMed

Zhou, Zhihui; Yin, Yanlin; Chang, Qun; Sun, Guanqun; Lin, Jiahui; Dai, Yalei

2017-04-01

To reveal whether B-myb is involved in preventing senescence of vascular endothelial cells, and if so, to identify possible mechanisms for it. C57/BL6 male mice and primary human aortic endothelial cells (HAECs) were used. Bleomycin was applied to induce stress-related premature senescence. B-myb knockdown was achieved using an siRNA technique and cell senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) assay. Intracellular reactive oxygen species (ROS) production was analysed using an ROS assay kit and cell proliferation was evaluated using KFluor488 EdU kit. Capillary tube network formation was determined by Matrigel assay. Expressions of mRNA and protein levels were detected by real-time PCR and western blotting. B-myb expression significantly decreased, while p53 and p21 expressions increased in the aortas of aged mice. This expression pattern was also found in replicative senescent HAECs and senescent HAECs induced by bleomycin. B-myb knockdown resulted in upregulation of p22 phox , ROS accumulation and cell senescence of HAECs. Downregulation of B-myb significantly inhibited cell proliferation and capillary tube network formation and activated the p53/p21 signalling pathway. Blocking ROS production or inhibiting p53 activation remarkably attenuated SA-β-gal activity and delayed cell senescence induced by B-myb-silencing. Downregulation of B-myb induced senescence by upregulation of p22 phox and activation of the ROS/p53/p21 pathway, in our vascular endothelial cells, suggesting that B-myb may be a novel candidate for regulating cell senescence to protect against endothelial senescence-related cardiovascular diseases. © 2016 John Wiley & Sons Ltd.

High cyclin A expression, but not Ki67, is associated with early recurrence in desmoid tumors.

PubMed

Santti, Kirsi; Ihalainen, Hanna; Rönty, Mikko; Böhling, Tom; Karlsson, Christina; Haglund, Caj; Tarkkanen, Maija; Blomqvist, Carl

2018-06-07

Desmoid tumors are soft-tissue tumors originating from myofibroblasts with a tendency to recur after surgery. High expression of proliferation markers is associated with shortened progression-free and/or overall survival in many neoplasms, including soft-tissue sarcomas. We investigated the prognostic role of cyclin A and Ki67 in desmoid tumors by immunohistochemistry. The study included 76 patients with desmoid tumor operated at Helsinki University Hospital between 1987 and 2011. A tissue micro array (TMA) was constructed and the TMA sections were immunostained with cyclin A and Ki67 antibodies. A computer-assisted image analysis was performed. Cyclin A expression was evaluable in 74 and Ki67 in 70 patients. Cyclin A immunopositivity varied from 0% to 9.9%, with a mean of 1.9%. Cyclin A expression correlated significantly with Ki67. Cyclin A expression was associated with recurrence-free survival (HR 1.9, 95% CI = 1.1-3.2, P = .02), as were positive margin (HR 6.0, 95% CI = 1.6-22.5, P = .008) and extremity location (HR 5.3, 95% CI = 1.7-16.8, P = 0.005). Ki67 immunopositivity varied from 0.33% to 13.8%, with a mean of 4.6%, but had no significant prognostic impact (HR 1.1, P = .2). Our study indicates that cyclin A may be a new prognostic biomarker in surgically treated desmoid tumors. © 2018 Wiley Periodicals, Inc.

Expression of Tissue Factor in Epithelial Ovarian Carcinoma Is Involved in the Development of Venous Thromboembolism.

PubMed

Sakurai, Manabu; Matsumoto, Koji; Gosho, Masahiko; Sakata, Akiko; Hosokawa, Yoshihiko; Tenjimbayashi, Yuri; Katoh, Takashi; Shikama, Ayumi; Komiya, Haruna; Michikami, Hiroo; Tasaka, Nobutaka; Akiyama-Abe, Azusa; Nakao, Sari; Ochi, Hiroyuki; Onuki, Mamiko; Minaguchi, Takeo; Yoshikawa, Hiroyuki; Satoh, Toyomi

2017-01-01

Our 2007 study of 32 patients with ovarian cancer reported the possible involvement of tissue factor (TF) in the development of venous thromboembolism (VTE) before treatment, especially in clear cell carcinoma (CCC). This follow-up study further investigated this possibility in a larger cohort. We investigated the intensity of TF expression (ITFE) and other variables for associations with VTE using univariate and multivariate analyses in 128 patients with epithelial ovarian cancer initially treated between November 2004 and December 2010, none of whom had received neoadjuvant chemotherapy. Before starting treatment, all patients were ultrasonographically screened for VTE. The ITFE was graded based on immunostaining of surgical specimens. Histological types were serous carcinoma (n = 42), CCC (n = 12), endometrioid carcinoma (n = 15), mucinous carcinoma (n = 53), and undifferentiated carcinoma (n = 6). The prevalence of VTE was significantly higher in CCC (34%) than in non-CCC (17%, P = 0.03). As ITFE increased, the frequencies of CCC and VTE increased significantly (P < 0.001 and P = 0.014, respectively). Multivariate analysis identified TF expression and pretreatment dimerized plasmin fragment D level as significant independent risk factors for VTE development. These factors showed particularly strong impacts on advanced-stage disease (P = 0.021). The 2007 cohort was small, preventing multivariate analysis. This study of a larger cohort yielded stronger evidence that the development of VTE in epithelial ovarian cancer may involve TF expression in cancer tissues.

Comparative utility of LC3, p62 and TDP-43 immunohistochemistry in differentiation of inclusion body myositis from polymyositis and related inflammatory myopathies.

PubMed

Hiniker, Annie; Daniels, Brianne H; Lee, Han S; Margeta, Marta

2013-07-01

Inclusion body myositis (IBM) is a slowly progressive inflammatory myopathy of the elderly that does not show significant clinical improvement in response to steroid therapy. Distinguishing IBM from polymyositis (PM) is clinically important since PM is steroid-responsive; however, the two conditions can show substantial histologic overlap. We performed quantitative immunohistochemistry for (1) autophagic markers LC3 and p62 and (2) protein aggregation marker TDP-43 in 53 subjects with pathologically diagnosed PM, IBM, and two intermediate T cell-mediated inflammatory myopathies (polymyositis with COX-negative fibers and possible IBM). The percentage of stained fibers was significantly higher in IBM than PM for all three immunostains, but the markers varied in sensitivity and specificity. In particular, both LC3 and p62 were sensitive markers of IBM, but the tradeoff between sensitivity and specificity was smaller (and diagnostic utility thus greater) for LC3 than for p62. In contrast, TDP-43 immunopositivity was highly specific for IBM, but the sensitivity of this test was low, with definitive staining present in just 67% of IBM cases. To differentiate IBM from PM, we thus recommend using a panel of LC3 and TDP-43 antibodies: the finding of <14% LC3-positive fibers helps exclude IBM, while >7% of TDP-43-positive fibers strongly supports a diagnosis of IBM. These data provide support for the hypothesis that disruption of autophagy and protein aggregation contribute to IBM pathogenesis.

Influence of parameter values on the oscillation sensitivities of two p53-Mdm2 models.

PubMed

Cuba, Christian E; Valle, Alexander R; Ayala-Charca, Giancarlo; Villota, Elizabeth R; Coronado, Alberto M

2015-09-01

Biomolecular networks that present oscillatory behavior are ubiquitous in nature. While some design principles for robust oscillations have been identified, it is not well understood how these oscillations are affected when the kinetic parameters are constantly changing or are not precisely known, as often occurs in cellular environments. Many models of diverse complexity level, for systems such as circadian rhythms, cell cycle or the p53 network, have been proposed. Here we assess the influence of hundreds of different parameter sets on the sensitivities of two configurations of a well-known oscillatory system, the p53 core network. We show that, for both models and all parameter sets, the parameter related to the p53 positive feedback, i.e. self-promotion, is the only one that presents sizeable sensitivities on extrema, periods and delay. Moreover, varying the parameter set values to change the dynamical characteristics of the response is more restricted in the simple model, whereas the complex model shows greater tunability. These results highlight the importance of the presence of specific network patterns, in addition to the role of parameter values, when we want to characterize oscillatory biochemical systems.

MiR-300 regulate the malignancy of breast cancer by targeting p53.

PubMed

Xu, Xiao-Heng; Li, Da-Wei; Feng, Hui; Chen, Hong-Mei; Song, Yan-Qiu

2015-01-01

In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of breast cancer (BC) cells. MicroRNA and protein expression patterns were compared between breast cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in MCF-7 breast cancer cells. We observed that miR-300 expression was frequently and dramatically up-regulated in human breast cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote breast cancer cell proliferation and invasion by regulating p53 expression. Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in breast cancer cell proliferation during breast tumorigenesis.

MiR-300 regulate the malignancy of breast cancer by targeting p53

PubMed Central

Xu, Xiao-Heng; Li, Da-Wei; Feng, Hui; Chen, Hong-Mei; Song, Yan-Qiu

2015-01-01

Objective: In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of breast cancer (BC) cells. Methods: MicroRNA and protein expression patterns were compared between breast cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in MCF-7 breast cancer cells. Results: We observed that miR-300 expression was frequently and dramatically up-regulated in human breast cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote breast cancer cell proliferation and invasion by regulating p53 expression. Conclusion: Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in breast cancer cell proliferation during breast tumorigenesis. PMID:26221232

In situ detection of a PCR-synthesized human pancentromeric DNA hybridization probe by color pigment immunostaining: application for dicentric assay automation.

PubMed

Kolanko, C J; Pyle, M D; Nath, J; Prasanna, P G; Loats, H; Blakely, W F

2000-03-01

We report a low cost and efficient method for synthesizing a human pancentromeric DNA probe by the polymerase chain reaction (PRC) and an optimized protocol for in situ detection using color pigment immunostaining. The DNA template used in the PCR was a 2.4 kb insert containing human alphoid repeated sequences of pancentromeric DNA subcloned into pUC9 (Miller et al. 1988) and the primers hybridized to internal sequences of the 172 bp consensus tandem repeat associated with human centromeres. PCR was performed in the presence of biotin-11-dUTP, and the product was used for in situ hybridization to detect the pancentromeric region of human chromosomes in metaphase spreads. Detection of pancentromeric probe was achieved by immunoenzymatic color pigment painting to yield a permanent image detected at high resolution by bright field microscopy. The ability to synthesize the centromeric probe rapidly and to detect it with color pigment immunostaining will lead to enhanced identification and eventually to automation of various chromosome aberration assays.

Impact of the Ki-67 labeling index and p53 expression status on disease-free survival in pT1 urothelial carcinoma of the bladder.

PubMed

Vetterlein, Malte W; Roschinski, Julia; Gild, Philipp; Marks, Phillip; Soave, Armin; Doh, Ousman; Isbarn, Hendrik; Höppner, Wolfgang; Wagner, Walter; Shariat, Shahrokh F; Brausi, Maurizio; Büscheck, Franziska; Sauter, Guido; Fisch, Margit; Rink, Michael

2017-12-01

The identification of protein biomarkers to guide treatment decisions regarding adjuvant therapies for high-risk non-muscle-invasive bladder cancer (NMIBC) has been of increasing interest. Evidence of the impact of tumor suppressor gene product p53 and cell proliferation marker Ki-67 on oncologic outcomes in bladder cancer patients at highest risk of recurrence and progression is partially contradictory. We sought to mirror contemporary expression patterns of p53 and Ki-67 in a select cohort of patients with pT1 bladder cancer. Patients from four Northern German institutions with a primary diagnosis of pT1 bladder cancer between 2009 and 2016 and complete data regarding p53 or Ki-67 expression status were included for final analyses. Baseline patient characteristics (age, gender, age-adjusted Charlson comorbidity index) and tumor characteristics [diagnostic sequence, tumor focality, concomitant carcinoma in situ, 1973 World Health Organization (WHO) grading, lymphovascular invasion, adjuvant instillation therapy] were abstracted by retrospective chart review. Immunohistochemistry for detection of p53 and Ki-67 expression was performed according to standardized protocols. Microscopic analyses were performed by central pathologic review. First, we compared patients with positive vs. negative p53 expression and Ki-67 labeling index [>40% vs. ≤40%; cutoffs based on best discriminative ability in univariable Cox regression analysis with disease-free survival (DFS) as endpoint] with regard to baseline and tumor characteristics. Second, we evaluated the effect of biomarker positivity on DFS by plotting univariable Kaplan-Meier curves and performing uni- and multivariable Cox regression analyses. Of 102 patients with complete information on p53 status, 44 (43.1%) were p53 positive, and they more often harbored concomitant carcinoma in situ (50.0% vs. 27.6%; P=0.032) and 1973 WHO grade 3 (97.7% vs. 69.0%; P=0.001) compared to their p53 negative counterparts. Of 79 patients with complete information on Ki-67 expression status, 30 (38.0%) had a labeling index >40%. Mean Ki-67 labeling index was higher in WHO grade 3 vs. grade 2 tumors (45.8 vs. 29.7; P=0.004). At a median follow-up of 51.0 months, 31/91 patients with complete follow-up information (34.1%) suffered from disease recurrence or progression. In univariable Kaplan-Meier analyses, no difference regarding DFS was found in p53 positive vs. negative (P=0.8) or Ki-67 labeling index >40% vs. ≤40% (P=0.078) patients. In multivariable analyses, Ki-67 labeling index >40% remained an independent predictor of DFS [hazard ratio (HR), 2.66; 95% confidence interval (CI), 1.02-6.95; P=0.046], after adjusting for p53 expression and lymphovascular invasion. However, p53 status was not associated with our endpoint (P=0.8). While we found an association of a Ki-67 labeling index >40% and shorter DFS in pT1 bladder cancer patients, this did not hold true for p53 positivity. Future research is needed to identify additional microscopic and molecular risk factors and biomarker panels to improve risk stratification and guide adjuvant therapies in those patients.

CD 10 expression intensity in various grades and stages of urothelial carcinoma of urinary bladder.

PubMed

Atique, Muhammad; Abbasi, Muhammad Sajjad; Jamal, Shahid; Khadim, Muhammad Tahir; Akhtar, Farhan; Jamal, Nighat

2014-05-01

To evaluate CD10 expression in urothelial carcinoma of the urinary bladder and the association of immunohistochemical (IHC) CD10 expression intensity with grade and stage. Descriptive cross-sectional analytical study. Armed Forces Institute of Pathology, Rawalpindi, from January to December 2011. Fifty consecutive cases of urothelial bladder carcinomas, obtained through transurethral resections, were included in this study. Hematoxylin-eosin (HE) stained sections from each case were re-evaluated histopathologically according to WHO 2004 grading system. The TNM system was used for pathologic staging. On selected slides IHC CD10 marker was applied and a semiquantitative scoring for its expression based on the percentage of positive cells and intensity was performed. Data was entered and analysed on SPSS version 17. Fisher's exact test was used to compare grades, stages of urothelial carcinoma with CD 10 expression and age groups. P < 0.05 was taken as level of significance. Urothelial carcinoma was more common in males. The male to female ratio was 9:1. The older patients > 50 years had higher grade and stage as compared to the younger patients. All cases of high grade urothelial carcinoma showed higher positivity for CD 10. Twenty cases (86.95%) of high grade urothelial carcinoma were positive with +2 immunostaining while 3 cases (13.04 %) were positive with +1 staining. None of the tumors of stage pTa was positive for CD 10 expression. Of all patients with stage pT 1 tumor, 1 case (5.3%) was CD 10 negative and 17 cases (89.9%) were CD 10 positive having +1 staining with 5 - 50% staining and 1 case (5.3%) had +2 staining with more then 50% expression. Out of all patients with stage pT 2, no tumor was CD 10 negative, 3 (13.6%) patients were CD 10 positive with +1 staining and 19 (86.4%) with stage pT 2 tumor had stained positive with +2 staining. CD 10 expression was greater in high grade and invasive urothelial carcinomas; it may be associated with tumor progression in bladder cancer pathogenesis.

Unclassified renal cell carcinoma: a clinicopathological, comparative genomic hybridization, and whole-genome exon sequencing study.

PubMed

Hu, Zhen-Yan; Pang, Li-Juan; Qi, Yan; Kang, Xue-Ling; Hu, Jian-Ming; Wang, Lianghai; Liu, Kun-Peng; Ren, Yuan; Cui, Mei; Song, Li-Li; Li, Hong-An; Zou, Hong; Li, Feng

2014-01-01

Unclassified renal cell carcinoma (URCC) is a rare variant of RCC, accounting for only 3-5% of all cases. Studies on the molecular genetics of URCC are limited, and hence, we report on 2 cases of URCC analyzed using comparative genome hybridization (CGH) and the genome-wide human exon GeneChip technique to identify the genomic alterations of URCC. Both URCC patients (mean age, 72 years) presented at an advanced stage and died within 30 months post-surgery. Histologically, the URCCs were composed of undifferentiated, multinucleated, giant cells with eosinophilic cytoplasm. Immunostaining revealed that both URCC cases had strong p53 protein expression and partial expression of cluster of differentiation-10 and cytokeratin. The CGH profiles showed chromosomal imbalances in both URCC cases: gains were observed in chromosomes 1p11-12, 1q12-13, 2q20-23, 3q22-23, 8p12, and 16q11-15, whereas losses were detected on chromosomes 1q22-23, 3p12-22, 5p30-ter, 6p, 11q, 16q18-22, 17p12-14, and 20p. Compared with 18 normal renal tissues, 40 mutated genes were detected in the URCC tissues, including 32 missense and 8 silent mutations. Functional enrichment analysis revealed that the missense mutation genes were involved in 11 different biological processes and pathways, including cell cycle regulation, lipid localization and transport, neuropeptide signaling, organic ether metabolism, and ATP-binding cassette transporter signaling. Our findings indicate that URCC may be a highly aggressive cancer, and the genetic alterations identified herein may provide clues regarding the tumorigenesis of URCC and serve as a basis for the development of targeted therapies against URCC in the future.

Unclassified renal cell carcinoma: a clinicopathological, comparative genomic hybridization, and whole-genome exon sequencing study

PubMed Central

Hu, Zhen-Yan; Pang, Li-Juan; Qi, Yan; Kang, Xue-Ling; Hu, Jian-Ming; Wang, Lianghai; Liu, Kun-Peng; Ren, Yuan; Cui, Mei; Song, Li-Li; Li, Hong-An; Zou, Hong; Li, Feng

2014-01-01

Unclassified renal cell carcinoma (URCC) is a rare variant of RCC, accounting for only 3-5% of all cases. Studies on the molecular genetics of URCC are limited, and hence, we report on 2 cases of URCC analyzed using comparative genome hybridization (CGH) and the genome-wide human exon GeneChip technique to identify the genomic alterations of URCC. Both URCC patients (mean age, 72 years) presented at an advanced stage and died within 30 months post-surgery. Histologically, the URCCs were composed of undifferentiated, multinucleated, giant cells with eosinophilic cytoplasm. Immunostaining revealed that both URCC cases had strong p53 protein expression and partial expression of cluster of differentiation-10 and cytokeratin. The CGH profiles showed chromosomal imbalances in both URCC cases: gains were observed in chromosomes 1p11-12, 1q12-13, 2q20-23, 3q22-23, 8p12, and 16q11-15, whereas losses were detected on chromosomes 1q22-23, 3p12-22, 5p30-ter, 6p, 11q, 16q18-22, 17p12-14, and 20p. Compared with 18 normal renal tissues, 40 mutated genes were detected in the URCC tissues, including 32 missense and 8 silent mutations. Functional enrichment analysis revealed that the missense mutation genes were involved in 11 different biological processes and pathways, including cell cycle regulation, lipid localization and transport, neuropeptide signaling, organic ether metabolism, and ATP-binding cassette transporter signaling. Our findings indicate that URCC may be a highly aggressive cancer, and the genetic alterations identified herein may provide clues regarding the tumorigenesis of URCC and serve as a basis for the development of targeted therapies against URCC in the future. PMID:25120763

Identification and genotyping of human papillomavirus in a Spanish cohort of penile squamous cell carcinomas: correlation with pathologic subtypes, p16(INK4a) expression, and prognosis.

PubMed

Ferrándiz-Pulido, Carla; Masferrer, Emili; de Torres, Ines; Lloveras, Belen; Hernandez-Losa, Javier; Mojal, Sergio; Salvador, Carlos; Morote, Juan; Ramon y Cajal, Santiago; Pujol, Ramon M; Garcia-Patos, Vicente; Toll, Agustin

2013-01-01

Penile squamous cell carcinoma (PSCC) is a tumor with a high metastatic potential. In PSCC the attributable fraction to human papillomavirus (HPV) is not well established. We sought to provide novel data about the prevalence of HPV in a large series of penile intraepithelial neoplasia (PeIN) and invasive PSCC, correlating the results with the histologic subtype, p16(INK4a) immunostaining, and prognosis. A total of 82 PSCC were included in the study, 69 invasive and 13 PeIN. HPV detection was performed by polymerase chain reaction with SPF-10 broad-spectrum primers followed by DNA enzyme immunoassay and genotyping with a reverse hybridization line probe assay. P16(INK4a) immunohistochemical expression on tissue microarrays was also analyzed. HPV DNA was identified in 31 of 77 (40.2%) PSCC (22 of 67 invasive and 9 of 10 PeIN). In 25 of 31 (80.6%) cases HPV-16 was identified. HPV detection was significantly associated with some histologic subtypes: most basaloid and warty tumors were high-risk HPV (hrHPV) positive, whereas only 15% of usual PSCC were hr-HPV positive. All hrHPV-positive PSCC had an adjacent undifferentiated PeIN. Strong p16(INK4a) immunostaining correlated with hrHPV infection. Most undifferentiated PeIN showed p16(INK4a) immunohistochemical overexpression. Both hrHPV-positive and p16(INK4a)-positive tumors showed a better overall survival without reaching statistical significance. This was a retrospective study. Our results suggest that most hrHPV-positive PSCC develop from undifferentiated hrHPV-positive PeIN. P16(INK4a) immunostaining may be useful in identifying both etiologically related hrHPV-positive tumors and those with better outcome. The routine use of p16(INK4a) staining should be incorporated in histologic evaluation of PSCC. Copyright © 2012 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

Regulators of apoptosis in cholangiocarcinoma.

PubMed

Jhala, Nirag C; Vickers, Selwyn M; Argani, Pedram; McDonald, Jay M

2005-04-01

Dysregulation of mediators of apoptosis is associated with carcinogenesis. For biliary duct cancers, p53 gene mutation is an important contributor to carcinogenesis. Mutations in the p53 gene affect transcription of the Fas gene, resulting in lack of Fas expression on cell membrane. It has been previously shown that cloned Fas-negative but not Fas-positive human cholangiocarcinoma cells are resistant to anti-Fas-mediated apoptosis and develop tumors in nude mice. In addition, interferon gamma induces Fas expression in Fas-negative cholangiocarcinoma cells and makes them susceptible to apoptosis. Therefore, it becomes important to characterize immunophenotypic expression of p53 and Fas in normal and neoplastic human tissues of the biliary tract to further understand the pathogenesis of the disease. To date, human studies to characterize differences in immunophenotypic expression of the Fas protein between intrahepatic and extrahepatic biliary duct cancers and in their precursor lesions have not been performed. To report the immunophenotypic expression of p53 and Fas expression in various stages in the development of bile duct cancers (intrahepatic and extrahepatic tumor location) and their association with tumor differentiation. Thirty bile duct cancer samples (13 intrahepatic and 17 extrahepatic) from 18 men and 12 women who ranged in age from 44 to 77 years (mean age, 65.6 years) were retrieved from the surgical pathology files. Hematoxylin-eosin-stained slides were evaluated for the type and grade of tumor and dysplastic changes in the biliary tract epithelium. Additional slides were immunohistochemically stained with p53 and anti-Fas mouse monoclonal antibody. The pattern of Fas distribution and percentage of cells positive for p53 and Fas expression were determined. The percentage of Fas-expressing cells is significantly (P = .01) more frequently noted in extrahepatic tumors compared with intrahepatic tumors. Furthermore, Fas expression decreased from dysplastic epithelium to cholangiocarcinoma (P = .01), and this decreasing trend continued from well to poorly differentiated tumors. Nuclear p53 expression was not identified in normal and dysplastic epithelium but was noted in 30% of carcinomas (P = .02). Fas expression is an early event in pathogenesis of bile duct cancers. Immunophenotypic expression of Fas is associated with well to moderately differentiated tumors but not with poor tumor differentiation.

BRAF mutation and anaplasia may be predictive factors of progression-free survival in adult pleomorphic xanthoastrocytoma.

PubMed

Tabouret, E; Bequet, C; Denicolaï, E; Barrié, M; Nanni, I; Metellus, P; Dufour, Henri; Chinot, O; Figarella-Branger, D

2015-12-01

Pleomorphic xanthoastrocytoma (PXA) is a rare, low-grade glioma that frequently occurs in pediatric patients. To analyze adult patients diagnosed with PXA and to search for pathological and molecular markers of diagnosis and prognosis. We retrospectively included patients older than 16 years with PXA who were referred to our institution between October 2003 and September 2013. All pathological diagnoses were reviewed by a neuropathologist. Histological characteristics and immunostaining of GFAP, OLIG2, neurofilament, CD34, Ki67, p53, p16, and IDH1 R132H were analyzed. The following molecular alterations were analyzed: mutations of IDH1/2, BRAF and the histone H3.3 and the EGFR amplification. Clinical data, treatment modalities, and patient outcome were recorded. We identified 16 adult patients with reviewed PXA diagnosis. No IDH neither histone H3.3 mutations were found; BRAF V600E mutation was recorded in six patients. Ten patients presented with anaplastic features. BRAF mutations were associated with lower Ki67, OLIG2 expression, and lack of p16 expression. Median PFS and OS were 41.5 months (95% CI: 11.4-71.6) and 71.4 months (95% CI: 15.5-127.3), respectively. BRAF mutation tended to be associated with greater PFS (p = 0.051), whereas anaplastic features were associated with minimal PFS (p = 0.042). PXA in adults PXA may present features distinct from pediatric PXA. Anaplastic features and BRAF mutation may potentially identify specific subgroups with distinct prognoses. Copyright © 2015 Elsevier Ltd. All rights reserved.

Growth hormone and prolactin responses to corticotrophin-releasing-hormone in patients with Cushing's disease: a paracrine action of the adenomatous corticotrophic cells?

PubMed

Loli, P; Boccardi, E; Branca, V; Bramerio, M; Barberis, M; Losa, M; Terreni, M T; Lodrini, S; Pollo, B; Vignati, F

1998-10-01

In patients with Cushing's disease multihormonal responses to ovine corticotrophin releasing hormone (oCRH) have been detected in blood from inferior petrosal sinuses. This finding has been explained by co-secretion of other hormones, in addition to ACTH, by the pituitary adenoma itself or by paracrine effects exerted by the adenoma on normal periadenomatous pituitary cells. To assess these hypotheses we compared the presence of a CRH induced GH and/or PRL response during inferior petrosal sinus sampling to the immunohistochemical detection of PRL and GH in adenomatous tissue removed from patients with Cushing's disease. Twenty-two patients with Cushing's disease and two patients with ectopic ACTH syndrome due to a bronchial carcinoid were studied; each patient had undergone preoperative inferior petrosal sinus sampling for diagnostic purposes with determination of GH and PRL in addition to ACTH, before and after administration of oCRH. Immunohistochemical studies for ACTH, GH and PRL detection were carried out on adenomatous tissue removed at surgery in the patients with pituitary dependent Cushing's disease and on the carcinoid tumours from the two patients with ectopic ACTH syndrome. All pituitary adenomas immunostained for ACTH, and four adenomas immunostained for GH or PRL in addition to ACTH. A PRL increase in the inferior petrosal sinus after oCRH administration was found in 11 of 22 patients, but none of their tumours immunostained for PRL. Immunostaining for PRL was found in the pituitary tumours from two patients but in neither patient was there a PRL response after oCRH. A GH response was found in 13 of 20 patients in whom it was sought; no patient showed immunostaining in their tumour. GH immunostaining was found in two tumours but in neither patient was there a GH response after oCRH. The oCRH-induced increase of GH and PRL was always recorded in the dominant inferior petrosal sinus. The ACTH response to oCRH was significantly higher in patients who showed oCRH induced increases in GH and/or PRL than in patients who did not, both in terms of area under the response-curve (22,032 +/- 9876 vs. 4371 +/- 2870 ng/l/10 min; P < 0.05) or mean percentage increase above baseline (754 +/- 229% vs. 147.2 +/- 67%, P < 0.02). A significant correlation was observed between ACTH and GH responses to oCRH. The two patients with ectopic Cushing's syndrome did not show ACTH, GH or PRL increases after oCRH administration and did not show immunostaining for GH or PRL in their tumours. The present data do not support the hypothesis of co-secretion of hormones by the pituitary adenoma as the cause of the GH and PRL responses to ovine corticotrophin releasing hormone observed in patients with Cushing's disease; it is suggested that a different mechanism, possibly involving an interaction between the ACTH secreting adenoma and the normal periadenomatous GH and PRL secreting cells, may be responsible.

The effects of dietary supplementation of methionine on genomic stability and p53 gene promoter methylation in rats.

PubMed

Amaral, Cátia Lira Do; Bueno, Rafaela de Barros E Lima; Burim, Regislaine Valéria; Queiroz, Regina Helena Costa; Bianchi, Maria de Lourdes Pires; Antunes, Lusânia Maria Greggi

2011-05-18

Methionine is a component of one-carbon metabolism and a precursor of S-adenosylmethionine (SAM), the methyl donor for DNA methylation. When methionine intake is high, an increase of S-adenosylmethionine (SAM) is expected. DNA methyltransferases convert SAM to S-adenosylhomocysteine (SAH). A high intracellular SAH concentration could inhibit the activity of DNA methyltransferases. Therefore, high methionine ingestion could induce DNA damage and change the methylation pattern of tumor suppressor genes. This study investigated the genotoxicity of a methionine-supplemented diet. It also investigated the diet's effects on glutathione levels, SAM and SAH concentrations and the gene methylation pattern of p53. Wistar rats received either a methionine-supplemented diet (2% methionine) or a control diet (0.3% methionine) for six weeks. The methionine-supplemented diet was neither genotoxic nor antigenotoxic to kidney cells, as assessed by the comet assay. However, the methionine-supplemented diet restored the renal glutathione depletion induced by doxorubicin. This fact may be explained by the transsulfuration pathway, which converts methionine to glutathione in the kidney. Methionine supplementation increased the renal concentration of SAH without changing the SAM/SAH ratio. This unchanged profile was also observed for DNA methylation at the promoter region of the p53 gene. Further studies are necessary to elucidate this diet's effects on genomic stability and DNA methylation. 2011 Elsevier B.V. All rights reserved.

A comparative study of cell cycle mediator protein expression patterns in anaplastic and papillary thyroid carcinoma.

PubMed

Evans, Juanita J; Crist, Henry S; Durvesh, Saima; Bruggeman, Richard D; Goldenberg, David

2012-07-01

Anaplastic thyroid carcinoma (ATC) is an extremely aggressive and rapidly fatal neoplasm. The aim of this study was to identify a limited cell cycle associated protein expression pattern unique to ATC and to correlate that pattern with clinical outcome. This represents one of the largest tissue micro-array projects comparing the cell cycle protein expression data of ATC to other well-differentiated tumors in the literature. Tissue microarrays were created from 21 patients with ATC and an age and gender matched cohort of patients with papillary thyroid carcinoma (PTC). Expression of epidermal growth factor receptor, cyclin D1, cyclin E, p53, p21, p16, aurora kinase A, opioid growth factor (OGF), OGF-receptor, thyroglobulin and Ki-67 was evaluated in a semi-quantitative fashion. Differences in protein expression between the cohorts were evaluated using chi-square tests with Bonferroni adjustments. Survival time and presence of metastasis at presentation were collected. The ATC cohort showed a statistically significant decrease (p < 0.05) in thyroglobulin expression and statistically significant increases (p < 0.05) in Ki-67 and p53 expression as compared with the PTC cohort. A trend toward loss of p16 and p21 expression was noted in the ATC cohort. A trend toward decreased survival was noted with p21 expression. These data indicate disruption of the normal cell cycle with aberrant expression of multiple protein markers suggesting increased proliferative activity and loss of control of cell cycle progression to G₁ phase. These findings support the assertion that ATC may represent the furthest end of a continuum of thyroid carcinoma dedifferentiation.

The Thoc1 Ribonucleoprotein as a Novel Biomarker for Prostate Cancer Treatment Assignment

DTIC Science & Technology

2016-10-01

patients on active surveillance is ongoing (PI Mohler). Developing ELISA assays for measuring pThoc1 and pThoc1 autoantibodies is complete (PI...assessment of 1146 patient specimens for use in constructing tissue microarrays, developing and optimizing ELISA assays to detect anti-Thoc1 autoantibodies...700 patients available at RPCI has been immunostained for PMP22 (figure 3). ELISA assays for measuring pThoc1 and pThoc1 autoantibodies have been

Carboxypeptidase-D is elevated in prostate cancer and its anti-apoptotic activity is abolished by combined androgen and prolactin receptor targeting.

PubMed

Thomas, Lynn N; Merrimen, Jennifer; Bell, David G; Rendon, Ricardo; Goffin, Vincent; Too, Catherine K L

2014-05-01

Carboxypeptidase-D (CPD) cleaves C-terminal arginine for nitric oxide (NO) production. CPD and NO levels are upregulated by testosterone (T) and prolactin (PRL) to promote survival of prostate cancer (pCa) cells. This study evaluated CPD immunostaining and T/PRL regulation of CPD and NO levels in benign and malignant prostate tissues/cells to determine the role of CPD in pCa. Immunohistochemistry (IHC) and tissue microarrays (TMA) were used to determine CPD immunostaining in prostate specimens. QPCR and immunoblotting were used to quantify CPD mRNA/protein expression in prostate cells. NO production was measured using 4,5-diaminofluorescein diacetate assay. CPD staining increased from 8.9 ± 3.8% (Mean ± SEM, n = 15) of benign epithelial cell area to 30.9 ± 2.9% (n = 30) of tumor cell area in one set of TMAs (P = 0.0008) and from 5.9 ± 0.9% (n = 45) of benign epithelial cell area to 18.8 ± 1.9% (n = 55) of tumor area in another (P < 0.0001). IHC of prostate tissues (≥50 mm(2)) confirmed increased CPD staining, from 13.1 ± 2.9% in benign (n = 16) to 29.5 ± 4.4% in pCa (n = 31, P = 0.0095). T and/or PRL increased CPD expression in several pCa but not benign cell lines. T and PRL acted synergistically to increase NO production, which was abolished only when receptor antagonists flutamide and Δ1-9-G129R-hPRL were used together. CPD immunostaining and T/PRL-stimulated CPD expression were higher in pCa than benign tissues/cells. Elevated CPD increased NO production, which was abolished when both AR and PRLR were inhibited. Our study implicates a critical role for the T/PRL-stimulated CPD-Arg-NO pathway in pCa progression, and suggests that AR+PRLR inhibition is a more effective treatment for pCa. © 2014 Wiley Periodicals, Inc.

Ring-like distribution of constitutive heterochromatin in bovine senescent cells.

PubMed

Pichugin, Andrey; Beaujean, Nathalie; Vignon, Xavier; Vassetzky, Yegor

2011-01-01

Cells that reach "Hayflick limit" of proliferation, known as senescent cells, possess a particular type of nuclear architecture. Human senescent cells are characterized by the presence of highly condensed senescent associated heterochromatin foci (SAHF) that can be detected both by immunostaining for histone H3 three-methylated at lysine 9 (H3K9me3) and by DAPI counterstaining. We have studied nuclear architecture in bovine senescent cells using a combination of immunofluorescence and 3D fluorescent in-situ hybridization (FISH). Analysis of heterochromatin distribution in bovine senescent cells using fluorescent in situ hybridization for pericentric chromosomal regions, immunostaining of H3K9me3, centromeric proteins CENP A/B and DNA methylation showed a lower level of heterochromatin condensation as compared to young cells. No SAHF foci were observed. Instead, we observed fibrous ring-like or ribbon-like heterochromatin patterns that were undetectable with DAPI counterstaining. These heterochromatin fibers were associated with nucleoli. Constitutive heterochromatin in bovine senescent cells is organized in ring-like structures.

Hydraulic conductivity of endothelial cell-initiated arterial cocultures.

PubMed

Mathura, Rishi A; Russell-Puleri, Sparkle; Cancel, Limary M; Tarbell, John M

2014-04-01

This study describes cocultures of arterial smooth muscle cells (SMCs) and endothelial cells (ECs) and the influences of their heterotypic interactions on hydraulic conductivity (L p ), an important transport property. A unique feature of these cocultures is that ECs were first grown to confluence and then SMCs were inoculated. Bovine aortic smooth muscle cells and bovine aortic endothelial cells (BAECs) were cocultured on Transwell Permeable Supports, and then exposed to a pressure-driven transmural flow. L p across each culture was measured using a bubble tracking apparatus that determined water flux (J v ). Our results indicate that arterial L p is significantly modulated by EC-SMC proximity, and serum content in culture. The L p of cocultures was also compared to the predictions of a resistances-in-series model to distinguish the contributions of heterotypic interactions between SMCs and ECs. Conditions that lead to significantly reduced coculture L p , compared to BAEC monoculture controls, have been uncovered and the lowest L p in the literature for an in vitro system are reported. In addition, VE-cadherin immunostaining of intact BAEC monolayers in each culture configuration reveals that EC-SMC proximity on a porous membrane has a dramatic influence on EC morphology patterns. The cocultures with the lowest L p have ECs with significantly elongated morphology. Confocal imaging indicates that there are no direct EC-SMC contacts in coculture.

Analysis of immunostaining and western blotting of endothelin 1 and its receptors in mitral stenosis

PubMed Central

Leão, Sydney Correia; Dashwood, Michael R.; de Andrade, Mateus Santana; Santos, Nicolas Nascimento; Teles, Olivia Regina Lins Leal; de Souza, Williasmin Batista; Rodrigues, Tania Maria de Andrade

2015-01-01

Introduction Rheumatic Fever represents a serious public health problem in developing countries, with thousands of new cases each year. It is an autoimmune disease, which occurs in response to infection by streptococcus A. Objective The aim of this study was to evaluate the immunolabeling and protein expression for endothelin-1 and 3 (ET-1, ET-3) and its receptors (ETA, ETB) in rheumatic mitral valves. Methods Immunohistochemistry was used to identify ET-1/ET-3 and ETA/ETB receptors in rheumatic and control mitral valves. Quantitative analysis of immunostaining for ET-1/ET-3 and ETA/ETB receptors was performed. In addition, western blot analysis was carried out to assess protein levels in tissue samples. Results ET-1 and ETA receptor immunostaining predominated in stenotic valves, mainly associated with fibrotic regions, inflammatory areas and neovascularization. Quantitative analysis showed that the average area with positive expression of ET-1 was 18.21±14.96%. For ETA and ETB, the mean expressed areas were respectively 15.06±13.13% and 9.20±11.09%. ET-3 did not have a significant expression. The correlation between the expression of both endothelin receptors were strongly positive (R=0.74, P=0.02), but the correlation between ET-1 and its receptor were negative for both ETA (R=-0.37, P=0.25), and ETB (R=-0.14, P=0.39). This data was supported by western blot analysis. Conclusion The strong correlation between ET-1 and its receptors suggests that both play a role in the pathophysiology of rheumatic mitral valve stenosis and may potentially act as biomarkers of this disease. PMID:26107453

Mincle in the innate immune response of mice fungal keratitis.

PubMed

Yu, Guo-Rong; Lin, Jing; Zhang, Jie; Che, Cheng-Ye; Peng, Xu-Dong; Li, Cui; Hu, Li-Ting; Zhu, Guo-Qiang; He, Kun; Zhao, Gui-Qiu

2018-01-01

To investigate how macrophage inducible C-type lectin (Mincle) influences inflammation in mice fungal keratitis induced by Aspergillus fumigatus ( A. fumigatus ). C57BL/6 mice were infected with A. fumigatus after pretreated with Mincle agonist TDB or Mincle neutralizing antibody (MincleAb), taking DMSO or IgG as control group respectively. The cornea lesions were monitored with slit-lamp microscope and evaluated by clinical score. Mincle expression was assessed using reverse transcription-ploymerase chain reaction (RT-PCR) and immunostaining. The expression of cytokines (IL-1β, TNF-α and IL-6) chemokines (CXCL-1 and MIP-2) was determined by RT-PCR and ELISA. Neutrophil infiltration was observed by immunostaining. The levels of nitric oxide (NO) generated by corneas were tested by Griess reaction. Mincle mRNA and protein levels were higher in infected corneas than normal corneas of C57BL/6 mice, saving clinical scores revealed differences. When pretreated with Mincle agonist TDB, the mRNA and protein levels of IL-1β, TNF-α and IL-6 in infected corneas were significantly increased compared with the control group ( P <0.01). Results of the counterpart in corneas pretreated with Mincle neutralizing antibody was decreased consistently ( P <0.01). Expression of CXCL1 and MIP-2 mRNA levels were up-regulated in TDB group and down-regulated in MincleAb group ( P <0.01), coincide with neutrophil aggregation degree in corneas showed by immunostaining. As for the concentration of NO, it was promoted in TDB group compared with DMSO control group, and decreased in MincleAb group compared with IgG control group. Mincle plays a dual role in mice fungal keratitis. It participates in the innate immune system by enhancing inflammation. What's more, Mincle can mediate cytotoxic effects by regulating the formation of NO.

p53 Mutagenesis by Benzo[a]pyrene derived Radical Cations

PubMed Central

Sen, Sushmita; Bhojnagarwala, Pratik; Francey, Lauren; Lu, Ding; Jeffrey Field, Trevor M. Penning

2013-01-01

Benzo[a]pyrene (B[a]P), a major human carcinogen in combustion products such as cigarette smoke and diesel exhaust, is metabolically activated into DNA-reactive metabolites via three different enzymatic pathways. The pathways are the anti-(+)-benzo[a]pyrene 7,8-diol 9, 10-epoxide pathway (P450/ epoxide hydrolase catalyzed) (B[a]PDE), the benzo[a]pyrene o-quinone pathway (aldo ketose reductase (AKR) catalyzed) and the B[a]P radical cation pathway (P450 peroxidase catalyzed). We used a yeast p53 mutagenesis system to assess mutagenesis by B[a]P radical cations. Because radical cations are short-lived, they were generated in situ by reacting B[a]P with cumene hydroperoxide (CuOOH) and horse radish peroxidase (HRP) and then monitoring the generation of the more stable downstream products, B[a]P-1,6-dione and B[a]P-3,6-dione. Based on the B[a]P-1,6 and 3,6-dione formation, approximately 4µM of radical cation was generated. In the mutagenesis assays, the radical cations produced in situ showed a dose-dependent increase in mutagenicity from 0.25 µM to 10 µM B[a]P with no significant increase seen with further escalation to 50 µM B[a]P. However, mutagenesis was 200-fold less than with the AKR pathway derived B[a]P, 7–8 dione. Mutant p53 plasmids, which yield red colonies, were recovered from the yeast to study the pattern and spectrum of mutations. The mutation pattern observed was G to T (31%) > G to C (29%) > G to A (14%). The frequency of codons mutated by the B[a]P radical cations was essentially random and not enriched at known cancer hotspots. The quinone products of radical cations, B[a]P-1,6-dione and B[a]P-3,6-dione were more mutagenic than the radical cation reactions, but still less mutagenic than AKR derived B[a]P-7,8-dione. We conclude that B[a]P radical cations and their quinone products are weakly mutagenic in this yeast-based system compared to redox cycling PAH o-quinones. PMID:22768918

MSH-2 and MLH-1 Protein Expression in Muir Torre Syndrome-Related and Sporadic Sebaceous Neoplasms

PubMed Central

Morales-Burgos, Adisbeth; Sánchez, Jorge L.; Figueroa, Luz D.; De Jesús-Monge, Wilfredo E.; Cruz-Correa, Marcia R.; González-Keelan, Carmen; Nazario, Cruz María

2009-01-01

Background Muir-Torre Syndrome (MTS) is a rare autosomal-dominant disorder characterized by the predisposition to both sebaceous neoplasm and internal malignancies. MTS-associated sebaceous neoplasms reveal mutations in DNA mismatch repair (MMR) genes and microsatellite instability. A significant part of MTS patients represents a phenotypic variant, the hereditary nonpolyposis colorectal cancer (HNPCC). A strong correlation between microsatellite instability and immunostaining has been demonstrated. The early recognition of sebaceous neoplasm as part of MTS, and their differentiation from sporadic sebaceous neoplasm may have an important application in a clinical setting. The absence of MLH-1 or MSH-2 expression by immunostaining identifies tumors with mismatch repair deficiency. Objectives Our aim is to determine whether an immunohistochemical approach, targeting DNA repair proteins MSH-2 and MLH-1 in MTS-related sebaceous neoplasm and their sporadic counterparts, can be used for their identification. Methods We examined 15 sebaceous neoplasms (including 6 internal malignancy- associated sebaceous neoplasms and 8 sporadic sebaceous neoplasms) from 11 patients for the expression of MSH-2 and MLH-1 by immunohistochemistry. Results Four of 5 internal malignancy-associated sebaceous neoplasms showed loss of expression of MSH-2 or MLH-1. Correlation of the immunostaining pattern of the sebaceous neoplasms and the patients’ positive history of colon carcinoma was 80%. Seven of 8 sporadic sebaceous neoplasms showed a positive expression of MSH-2 and MLH-1. The prevalence for loss of expression of MMR proteins in sebaceous neoplasms was 38.5%. MMR immunostaining had 87.5% specificity and 80% sensitivity. Limitations This study is limited by a small sample size, and by bias selection due to the use of non nationwide data-base as the resource of cases. Conclusions Our findings demonstrate that immunohistochemical testing for internal malignancy-associated sebaceous neoplasms is a practical approach to confirm a suspected inherited MMR gene defect, and an accurate method to distinguish between sporadic and MTS-associated sebaceous lesions. PMID:19069357

Expression of survivin and clinical correlation in patients with breast cancer.

PubMed

Sohn, Doo Min; Kim, Sung Yong; Baek, Moo Jun; Lim, Cheol Wan; Lee, Min Hyuk; Cho, Moo Sik; Kim, Tae Yoon

2006-07-01

Survivin is a member of the inhibitor of apoptosis (IAP) family, which is also involved in the regulation of cell division and is also overexpressed and associated with parameters of poor prognosis in most human cancers, including carcinomas of the lung, breast, colon, stomach, esophagus and pancreas. This study examined the expression patterns of survivin in normal breast tissue, atypical hyperplasia, primary breast cancer and lymph node tissues involved in breast cancer and determined whether the expression of survivin is associated with the characteristics and prognosis of breast cancer. Formalin-fixed paraffin-embedded samples from 80 breast cancer, 20 atypical hyperplasia and 20 malignant lymph node tissue cases were immunostained using polyclonal survivin (Novus Biologicals, CO, USA). The degree of immunostaining was recorded on a scale of 0-3 according to the percentages of staining and distributions within the cytoplasm and nucleus. Survivin was expressed in 52, 14 and 17 of the 80 breast cancer (65%), atypical hyperplasia (70%) and breast cancer lymphoid (85%) specimens, respectively. Among those expressing cancer, 11.3%, 31.3% and 22.5% demonstrated only nuclear staining, only cytoplasmic staining and both nuclear and cytoplasmic staining, respectively. A statistical analysis revealed that cytoplasmic survivin expression was correlated with the stage, histological grade and L/N metastasis. In a Cox proportional hazard model analysis, the expression of survivin was not identified as a significant independent predictor of overall survival (P=0.168), although the decrease in the survival rate of survivin-positive patients did reach statistical significance (P=0.048). our results show that survivin is frequently overexpressed in primary breast cancer and its expression gradually increased from normal breast tissue to malignant lymph nodes. The expression of cytoplasmic survivin was common in breast cancer and could be both a useful diagnostic marker and an important source of prognostic information.

Investigating Various Thresholds as Immunohistochemistry Cutoffs for Observer Agreement.

PubMed

Ali, Asif; Bell, Sarah; Bilsland, Alan; Slavin, Jill; Lynch, Victoria; Elgoweini, Maha; Derakhshan, Mohammad H; Jamieson, Nigel B; Chang, David; Brown, Victoria; Denley, Simon; Orange, Clare; McKay, Colin; Carter, Ross; Oien, Karin A; Duthie, Fraser R

2017-10-01

Clinical translation of immunohistochemistry (IHC) biomarkers requires reliable and reproducible cutoffs or thresholds for interpretation of immunostaining. Most IHC biomarker research focuses on the clinical relevance (diagnostic, prognostic, or predictive utility) of cutoffs, with less emphasis on observer agreement using these cutoffs. From the literature, we identified 3 commonly used cutoffs of 10% positive epithelial cells, 20% positive epithelial cells, and moderate to strong staining intensity (+2/+3 hereafter) to use for investigating observer agreement. A series of 36 images of microarray cores stained for 4 different IHC biomarkers, with variable staining intensity and percentage of positive cells, was used for investigating interobserver and intraobserver agreement. Seven pathologists scored the immunostaining in each image using the 3 cutoffs for positive and negative staining. Kappa (κ) statistic was used to assess the strength of agreement for each cutoff. The interobserver agreement between all 7 pathologists using the 3 cutoffs was reasonably good, with mean κ scores of 0.64, 0.59, and 0.62, respectively, for 10%, 20%, and +2/+3 cutoffs. A good agreement was observed for experienced pathologists using the 10% cutoff, and their agreement was statistically higher than for junior pathologists (P=0.02). In addition, the mean intraobserver agreement for all 7 pathologists using the 3 cutoffs was reasonably good, with mean κ scores of 0.71, 0.60, and 0.73, respectively, for 10%, 20%, and +2/+3 cutoffs. For all 3 cutoffs, a positive correlation was observed with perceived ease of interpretation (P<0.003). Finally, cytoplasmic-only staining achieved higher agreement using all 3 cutoffs than mixed staining patterns. All 3 cutoffs investigated achieve reasonable strength of agreement, modestly decreasing interobserver and intraobserver variability in IHC interpretation. These cutoffs have previously been used in cancer pathology, and this study provides evidence that these cutoffs can be reproducible between practicing pathologists.

In vivo and in vitro cloning and phenotype characterization of tellurite resistance determinant conferred by plasmid pTE53 of a clinical isolate of Escherichia coli.

PubMed

Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J

1998-01-01

A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.

Identification of the advanced glycation end products N -carboxymethyllysine in the synovial tissue of patients with rheumatoid arthritis

PubMed Central

Drinda, S; Franke, S; Canet, C; Petrow, P; Brauer, R; Huttich, C; Stein, G; Hein, G

2002-01-01

Background: Generation of advanced glycation end products (AGEs) is an inevitable process in vivo and can be accelerated under pathological conditions such as oxidative stress. In serum and synovial fluid of patients with rheumatoid arthritis (RA) raised AGE levels have been found. Objective: To determine the presence of N -carboxymethyllysine (CML; marker of oxidative stress) in RA synovial tissue by immunohistology. Methods: Frozen synovial tissue samples from 10 patients with RA and eight controls (four patients without joint disease and four patients with osteoarthritis (OA)) were treated with rabbit-anti-CML-IgG and goat-antirabbit-IgG. Immunostaining was visualised by streptavidine-alkaline phosphatase (chromogen fuchsin). Cell differentiation was performed with antibodies against CD68, CD45RO, and CD20. Results: CML was detected in the synovial lining, sublining, and endothelium in 10/10 RA and 4/4 OA synovial specimens. In RA some macrophages (CD68+) and T cells (CD45RO+) showed positive immunostaining for CML, whereas B cells were negative. Staining in OA synovial sublining was weak compared with RA. Conclusions: CML was detected for the first time in RA and OA synovial tissue. Different patterns of immunostaining in RA and OA and the presence of CML on macrophages and T cells, suggest a role for CML in the pathogenesis of RA. This might be due to presentation of new epitopes which can maintain or even trigger an autoimmune response. PMID:12006318

Comparative utility of LC3, p62 and TDP-43 immunohistochemistry in differentiation of inclusion body myositis from polymyositis and related inflammatory myopathies

PubMed Central

2013-01-01

Background Inclusion body myositis (IBM) is a slowly progressive inflammatory myopathy of the elderly that does not show significant clinical improvement in response to steroid therapy. Distinguishing IBM from polymyositis (PM) is clinically important since PM is steroid-responsive; however, the two conditions can show substantial histologic overlap. Results We performed quantitative immunohistochemistry for (1) autophagic markers LC3 and p62 and (2) protein aggregation marker TDP-43 in 53 subjects with pathologically diagnosed PM, IBM, and two intermediate T cell-mediated inflammatory myopathies (polymyositis with COX-negative fibers and possible IBM). The percentage of stained fibers was significantly higher in IBM than PM for all three immunostains, but the markers varied in sensitivity and specificity. In particular, both LC3 and p62 were sensitive markers of IBM, but the tradeoff between sensitivity and specificity was smaller (and diagnostic utility thus greater) for LC3 than for p62. In contrast, TDP-43 immunopositivity was highly specific for IBM, but the sensitivity of this test was low, with definitive staining present in just 67% of IBM cases. Conclusions To differentiate IBM from PM, we thus recommend using a panel of LC3 and TDP-43 antibodies: the finding of <14% LC3-positive fibers helps exclude IBM, while >7% of TDP-43-positive fibers strongly supports a diagnosis of IBM. These data provide support for the hypothesis that disruption of autophagy and protein aggregation contribute to IBM pathogenesis. PMID:24252466

Interleukin (IL)-8 immunoreactivity of injured axons and surrounding oligodendrocytes in traumatic head injury.

PubMed

Hayashi, Takahito; Ago, Kazutoshi; Nakamae, Takuma; Higo, Eri; Ogata, Mamoru

2016-06-01

Interleukin (IL)-8 has been suggested to be a positive regulator of myelination in the central nervous system, in addition to its principal role as a chemokine for neutrophils. Immunostaining for beta-amyloid precursor protein (AβPP) is an effective tool for detecting traumatic axonal injury, although AβPP immunoreactivity can also indicate axonal injury due to hypoxic causes. In this study, we examined IL-8 and AβPP immunoreactivity in sections of corpus callosum obtained from deceased patients with blunt head injury and from equivalent control tissue. AβPP immunoreactivity was detected in injured axons, such as axonal bulbs and varicose axons, in 24 of 44 head injury cases. These AβPP immunoreactive cases had survived for more than 3h. The AβPP immunostaining pattern can be classified into two types: traumatic (Pattern 1) and non-traumatic (Pattern 2) axonal injuries, which we described previously [Hayashi et al. Int. J. Legal Med. 129 (2015) 1085-1090]. Three of 44 control cases also showed AβPP immunoreactive injured axons as Pattern 2. In contrast, IL-8 immunoreactivity was detected in 7 AβPP immunoreactive and in 2 non-AβPP immunoreactive head injury cases, but was not detected in any of the 44 control cases, including the 3 AβPP immunoreactive control cases. The IL-8 immunoreactive cases had survived from 3 to 24 days, whereas those cases who survived less than 3 days (n=29) and who survived 90 days (n=1) were not IL-8 immunoreactive. Moreover, IL-8 was detected as Pattern 1 axons only. In addition, double immunofluorescence analysis showed that IL-8 is expressed by oligodendrocytes surrounding injured axons. In conclusion, our results suggest that immunohistochemical detection of IL-8 may be useful as a complementary diagnostic marker of traumatic axonal injury. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Automated classification of immunostaining patterns in breast tissue from the human protein atlas.

PubMed

Swamidoss, Issac Niwas; Kårsnäs, Andreas; Uhlmann, Virginie; Ponnusamy, Palanisamy; Kampf, Caroline; Simonsson, Martin; Wählby, Carolina; Strand, Robin

2013-01-01

The Human Protein Atlas (HPA) is an effort to map the location of all human proteins (http://www.proteinatlas.org/). It contains a large number of histological images of sections from human tissue. Tissue micro arrays (TMA) are imaged by a slide scanning microscope, and each image represents a thin slice of a tissue core with a dark brown antibody specific stain and a blue counter stain. When generating antibodies for protein profiling of the human proteome, an important step in the quality control is to compare staining patterns of different antibodies directed towards the same protein. This comparison is an ultimate control that the antibody recognizes the right protein. In this paper, we propose and evaluate different approaches for classifying sub-cellular antibody staining patterns in breast tissue samples. The proposed methods include the computation of various features including gray level co-occurrence matrix (GLCM) features, complex wavelet co-occurrence matrix (CWCM) features, and weighted neighbor distance using compound hierarchy of algorithms representing morphology (WND-CHARM)-inspired features. The extracted features are used into two different multivariate classifiers (support vector machine (SVM) and linear discriminant analysis (LDA) classifier). Before extracting features, we use color deconvolution to separate different tissue components, such as the brownly stained positive regions and the blue cellular regions, in the immuno-stained TMA images of breast tissue. We present classification results based on combinations of feature measurements. The proposed complex wavelet features and the WND-CHARM features have accuracy similar to that of a human expert. Both human experts and the proposed automated methods have difficulties discriminating between nuclear and cytoplasmic staining patterns. This is to a large extent due to mixed staining of nucleus and cytoplasm. Methods for quantification of staining patterns in histopathology have many applications, ranging from antibody quality control to tumor grading.

Cell-permeable nanobodies for targeted immunolabelling and antigen manipulation in living cells

NASA Astrophysics Data System (ADS)

Herce, Henry D.; Schumacher, Dominik; Schneider, Anselm F. L.; Ludwig, Anne K.; Mann, Florian A.; Fillies, Marion; Kasper, Marc-André; Reinke, Stefan; Krause, Eberhard; Leonhardt, Heinrich; Cardoso, M. Cristina; Hackenberger, Christian P. R.

2017-08-01

Functional antibody delivery in living cells would enable the labelling and manipulation of intracellular antigens, which constitutes a long-thought goal in cell biology and medicine. Here we present a modular strategy to create functional cell-permeable nanobodies capable of targeted labelling and manipulation of intracellular antigens in living cells. The cell-permeable nanobodies are formed by the site-specific attachment of intracellularly stable (or cleavable) cyclic arginine-rich cell-penetrating peptides to camelid-derived single-chain VHH antibody fragments. We used this strategy for the non-endocytic delivery of two recombinant nanobodies into living cells, which enabled the relocalization of the polymerase clamp PCNA (proliferating cell nuclear antigen) and tumour suppressor p53 to the nucleolus, and thereby allowed the detection of protein-protein interactions that involve these two proteins in living cells. Furthermore, cell-permeable nanobodies permitted the co-transport of therapeutically relevant proteins, such as Mecp2, into the cells. This technology constitutes a major step in the labelling, delivery and targeted manipulation of intracellular antigens. Ultimately, this approach opens the door towards immunostaining in living cells and the expansion of immunotherapies to intracellular antigen targets.

Tumour compartment transcriptomics demonstrates the activation of inflammatory and odontogenic programmes in human adamantinomatous craniopharyngioma and identifies the MAPK/ERK pathway as a novel therapeutic target.

PubMed

Apps, John R; Carreno, Gabriela; Gonzalez-Meljem, Jose Mario; Haston, Scott; Guiho, Romain; Cooper, Julie E; Manshaei, Saba; Jani, Nital; Hölsken, Annett; Pettorini, Benedetta; Beynon, Robert J; Simpson, Deborah M; Fraser, Helen C; Hong, Ying; Hallang, Shirleen; Stone, Thomas J; Virasami, Alex; Donson, Andrew M; Jones, David; Aquilina, Kristian; Spoudeas, Helen; Joshi, Abhijit R; Grundy, Richard; Storer, Lisa C D; Korbonits, Márta; Hilton, David A; Tossell, Kyoko; Thavaraj, Selvam; Ungless, Mark A; Gil, Jesus; Buslei, Rolf; Hankinson, Todd; Hargrave, Darren; Goding, Colin; Andoniadou, Cynthia L; Brogan, Paul; Jacques, Thomas S; Williams, Hywel J; Martinez-Barbera, Juan Pedro

2018-05-01

Adamantinomatous craniopharyngiomas (ACPs) are clinically challenging tumours, the majority of which have activating mutations in CTNNB1. They are histologically complex, showing cystic and solid components, the latter comprised of different morphological cell types (e.g. β-catenin-accumulating cluster cells and palisading epithelium), surrounded by a florid glial reaction with immune cells. Here, we have carried out RNA sequencing on 18 ACP samples and integrated these data with an existing ACP transcriptomic dataset. No studies so far have examined the patterns of gene expression within the different cellular compartments of the tumour. To achieve this goal, we have combined laser capture microdissection with computational analyses to reveal groups of genes that are associated with either epithelial tumour cells (clusters and palisading epithelium), glial tissue or immune infiltrate. We use these human ACP molecular signatures and RNA-Seq data from two ACP mouse models to reveal that cell clusters are molecularly analogous to the enamel knot, a critical signalling centre controlling normal tooth morphogenesis. Supporting this finding, we show that human cluster cells express high levels of several members of the FGF, TGFB and BMP families of secreted factors, which signal to neighbouring cells as evidenced by immunostaining against the phosphorylated proteins pERK1/2, pSMAD3 and pSMAD1/5/9 in both human and mouse ACP. We reveal that inhibiting the MAPK/ERK pathway with trametinib, a clinically approved MEK inhibitor, results in reduced proliferation and increased apoptosis in explant cultures of human and mouse ACP. Finally, we analyse a prominent molecular signature in the glial reactive tissue to characterise the inflammatory microenvironment and uncover the activation of inflammasomes in human ACP. We validate these results by immunostaining against immune cell markers, cytokine ELISA and proteome analysis in both solid tumour and cystic fluid from ACP patients. Our data support a new molecular paradigm for understanding ACP tumorigenesis as an aberrant mimic of natural tooth development and opens new therapeutic opportunities by revealing the activation of the MAPK/ERK and inflammasome pathways in human ACP.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das, Amitabh, E-mail: amitabhdas.kn@gmail.com; Chai, Jin Choul, E-mail: jincchai@gmail.com; Jung, Kyoung Hwa, E-mail: khjung2@gmail.com

JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuationmore » significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup −/−} NE4C cells. • Finding JMJD2A-based molecular targets and crucial pathways in p53{sup −/−} NE4C cells.« less

Farewell to oligoastrocytoma: in situ molecular genetics favor classification as either oligodendroglioma or astrocytoma.

PubMed

Sahm, Felix; Reuss, David; Koelsche, Christian; Capper, David; Schittenhelm, Jens; Heim, Stephanie; Jones, David T W; Pfister, Stefan M; Herold-Mende, Christel; Wick, Wolfgang; Mueller, Wolf; Hartmann, Christian; Paulus, Werner; von Deimling, Andreas

2014-10-01

Astrocytoma and oligodendroglioma are histologically and genetically well-defined entities. The majority of astrocytomas harbor concurrent TP53 and ATRX mutations, while most oligodendrogliomas carry the 1p/19q co-deletion. Both entities share high frequencies of IDH mutations. In contrast, oligoastrocytomas (OA) appear less clearly defined and, therefore, there is an ongoing debate whether these tumors indeed constitute an entity or whether they represent a mixed bag containing both astrocytomas and oligodendrogliomas. We investigated 43 OA diagnosed in different institutions employing histology, immunohistochemistry and in situ hybridization addressing surrogates for the molecular genetic markers IDH1R132H, TP53, ATRX and 1p/19q loss. In all but one OA the combination of nuclear p53 accumulation and ATRX loss was mutually exclusive with 1p/19q co-deletion. In 31/43 OA, only alterations typical for oligodendroglioma were observed, while in 11/43 OA, only indicators for mutations typical for astrocytomas were detected. A single case exhibited a distinct pattern, nuclear expression of p53, ATRX loss, IDH1 mutation and partial 1p/19q loss. However, this was the only patient undergoing radiotherapy prior to surgery, possibly contributing to the acquisition of this uncommon combination. In OA with oligodendroglioma typical alterations, the portions corresponding to astrocytic part were determined as reactive, while in OA with astrocytoma typical alterations the portions corresponding to oligodendroglial differentiation were neoplastic. These data provide strong evidence against the existence of an independent OA entity.

A Survey of Korean Physicians' Prescription Patterns for Allergic Rhinitis.

PubMed

Seo, Min Young; Kim, Dong-Kyu; Jee, Hye Mi; Ahn, Young Min; Kim, Yong Min; Hong, Sang Duk

2017-12-01

The aim of this study was to compare the prescription patterns according to characteristics of physicians using a survey distributed amongst physicians in Korea. We surveyed the prescription patterns for allergic rhinitis (AR) of the members of the Korean Academy of Asthma, Allergy and Clinical Immunology (KAAACI) and the Korean Association of Otorhinolaryngologists (KAO). Questionnaire contained 4 categories with 28 queries. 448 physicians including 98 internal medicine (IM), 113 pediatrics (PED), and 237 otorhinolaryngology (ENT) were responded. Although the Allergic Rhinitis and its Impact on Asthma (ARIA) guidelines are most frequently used in all specialties, seasonal or perennial AR is the most frequent classification system. For the definitive diagnosis of AR, ENT physicians reported using multiple allergen simultaneous test (MAST)/radio allergy sorbent test (RAST) more than others (IM, 10.9%; PED, 20.6%; ENT, 44.2%; P<0.001). In treatment, most physicians reported that antihistamine medication is the initial treatment for AR. PED physicians prescribed fewer intranasal steroid to combinations with an antihistamine than other specialists (IM, 65.3%; PED, 42.5%; ENT, 63.3%), but preferred leukotriene antagonists (IM, 4.1%; PED, 23.0%; ENT, 3.9%; P=0.041). Overall, 53% (235/448) of the physicians performed allergen immunotherapy (AIT), and IM administers the most AIT (IM, 71.6%; PED, 42.0%; ENT, 39.5%; P=0.019). Furthermore, university and general hospital physicians prescribed more AIT than doctors at other hospital types (university hospital, 76.4%; general hospital, 64.3%; local hospital, 21.4%; private clinic, 20.2%; P<0.001). The prescription patterns for AR were different according to the physicians' characteristics and general rate of prescribing AIT is just about 53% in Korea. Thus, the development of complementary Korean-specific guidelines is needed and proper clinical instruction of AIT would be necessary.

Detection of inflamed atherosclerotic lesions with diadenosine-5',5'''-P1,P4-tetraphosphate (Ap4A) and positron-emission tomography.

PubMed

Elmaleh, D R; Fischman, A J; Tawakol, A; Zhu, A; Shoup, T M; Hoffmann, U; Brownell, A-L; Zamecnik, P C

2006-10-24

Diadenosine-5',5'''-P(1),P(4)-tetraphosphate (Ap(4)A) and its analog P(2),P(3)-monochloromethylene diadenosine-5',5'''-P(1),P(4)-tetraphosphate (AppCHClppA) are competitive inhibitors of adenosine diphosphate-induced platelet aggregation, which plays a central role in arterial thrombosis and plaque formation. In this study, we evaluate the imaging capabilities of positron-emission tomography (PET) with P(2),P(3)-[(18)F]monofluoromethylene diadenosine-5',5'''-P(1),P(4)-tetraphosphate ([(18)F]AppCHFppA) to detect atherosclerotic lesions in male New Zealand White rabbits. Three to six months after balloon injury to the aorta, the rabbits were injected with [(18)F]AppCHFppA, and microPET imaging showed rapid accumulation of this radiopharmaceutical in the atherosclerotic abdominal aorta, with lesions clearly visible 30 min after injection. Computed tomographic images were coregistered with PET images to improve delineation of aortoiliac tracer activity. Plaque macrophage density, quantified by immunostaining with RAM11 against rabbit macrophages, correlated with PET measurements of [(18)F]AppCHFppA uptake (r = 0.87, P < 0.0001), whereas smooth-muscle cell density, quantified by immunostaining with 1A4 against smooth muscle actin, did not. Biodistribution studies of [(18)F]AppCHFppA in normal rats indicated typical adenosine dinucleotide behavior with insignificant myocardial uptake and fast kidney clearance. The accumulation of [(18)F]AppCHFppA in macrophage-rich atherosclerotic plaques can be quantified noninvasively with PET. Hence, [(18)F]AppCHFppA holds promise for the noninvasive characterization of vascular inflammation.

Evaluation of Vitality in the Experimental Hanging Model of Rats by Using Immunohistochemical IL-1β Antibody Staining.

PubMed

Balandiz, Hüseyin; Pehlivan, Sultan; Çiçek, Ali Fuat; Tuğcu, Harun

2015-12-01

Hanging is the most common suicide method in the world, and the discrimination of antemortem-postmortem hanging must be done at autopsy. The aim of this experimental study was to examine the immunohistochemical expression of IL-1β antibody at the hanging mark skin samples of rats to discriminate antemortem and postmortem hangings. A total of 20 Wistar albino rats were used for this study. The groups were as follows: A-1, antemortem control group; A-2, antemortem second-hour hanging mark skin samples; A-3, antemortem 24th-hour hanging mark skin samples; A-4, antemortem 72nd-hour hanging mark skin samples; B-1, postmortem control group; and B-2, postmortem second-hour hanging mark skin samples. Interleukin-1β immunostaining was performed to all tissue samples. For epidermal cells, group A-1 samples did not show IL-1β immunostaining, group A-2 samples were severely immunostained, and groups A-3 and A-4 samples' staining were slightly decreased. There was no IL-1β antibody staining in groups B-1 and B-2 samples. For adnexal cells, groups A-1 and B-1 samples did not show IL-1β immunostaining, staining of group A-2 samples was mild to severe, and groups A-3 and A-4 samples' staining were slightly decreased. Half of the group B-2 samples did not show IL-1β immunostaining. For subepidermal cells, most of the samples of groups A-1 and B-1 showed slight immunostaining, groups A-2 and B-2 samples' staining were mild to severe, and there were slight immunostaining in groups A-3 and A-4 samples. The majority of vascular structure cells did not show IL-1β immunostaining. Interleukin-1β immunostaining of epidermal cells can discriminate antemortem-postmortem hangings, but vascular structure cells and subepidermal cells cannot discriminate vital hangings.

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

PubMed

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Promotive Effect of Minoxidil Combined with All-trans Retinoic Acid (tretinoin) on Human Hair Growth in Vitro

PubMed Central

Kwon, Oh Sang; Pyo, Hyun Keol; Oh, Youn Jin; Han, Ji Hyun; Lee, Se Rah; Chung, Jin Ho; Eun, Hee Chul

2007-01-01

Minoxidil induces hair growth in male pattern baldness and prolongs the anagen phase. All-trans retinoic acid (ATRA) has been reported to act synergistically with minoxidil in vivo: they can enhance more dense hair regrowth than either compound alone. We evaluated the effect of minoxidil combined with ATRA on hair growth in vitro. The effect of co-treatment of minoxidil and ATRA on hair growth was studied in hair follicle organ culture. In cultured human dermal papilla cells (DPCs) and normal human epidermal keratinocytes, the expressions of Erk, Akt, Bcl-2, Bax, P53 and P21 were evaluated by immunoblot analysis. Minoxidil plus ATRA additively promoted hair growth in vitro, compared with minoxidil alone. In addition, minoxidil plus ATRA elevated phosphorylated Erk, phosphorylated Akt and the ratio of Bcl-2/Bax, but decreased the expressions of P53 and P21 more effectively than by minoxidil alone. Our results suggest that minoxidil plus ATRA would additively enhance hair growth by mediating dual functions: 1) the prolongation of cell survival by activating the Erk and Akt signaling pathways, and 2) the prevention of apoptosis of DPCs and epithelial cells by increasing the ratio of Bcl-2/Bax and downregulating the expressions of P53 and P21. PMID:17449938

Arctic Landscape Within Reach

NASA Technical Reports Server (NTRS)

2008-01-01

This image, one of the first captured by NASA's Phoenix Mars Lander, shows flat ground strewn with tiny pebbles and marked by small-scale polygonal cracking, a pattern seen widely in Martian high latitudes and also observed in permafrost terrains on Earth. The polygonal cracking is believed to have resulted from seasonal contraction and expansion of surface ice.

Phoenix touched down on the Red Planet at 4:53 p.m. Pacific Time (7:53 p.m. Eastern Time), May 25, 2008, in an arctic region called Vastitas Borealis, at 68 degrees north latitude, 234 degrees east longitude.

This image was acquired at the Phoenix landing site by the Surface Stereo Imager on day 1 of the mission on the surface of Mars, or Sol 0, after the May 25, 2008, landing.

The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

Increased mast cell numbers in a calcaneal tendon overuse model.

PubMed

Pingel, J; Wienecke, J; Kongsgaard, M; Behzad, H; Abraham, T; Langberg, H; Scott, A

2013-12-01

Tendinopathy is often discovered late because the initial development of tendon pathology is asymptomatic. The aim of this study was to examine the potential role of mast cell involvement in early tendinopathy using a high-intensity uphill running (HIUR) exercise model. Twenty-four male Wistar rats were divided in two groups: running group (n = 12); sedentary control group (n = 12). The running-group was exposed to the HIUR exercise protocol for 7 weeks. The calcaneal tendons of both hind limbs were dissected. The right tendon was used for histologic analysis using Bonar score, immunohistochemistry, and second harmonic generation microscopy (SHGM). The left tendon was used for quantitative polymerase chain reaction (qPCR) analysis. An increased tendon cell density in the runners were observed compared to the controls (P = 0.05). Further, the intensity of immunostaining of protein kinase B, P = 0.03; 2.75 ± 0.54 vs 1.17 ± 0.53, was increased in the runners. The Bonar score (P = 0.05), and the number of mast cells (P = 0.02) were significantly higher in the runners compared to the controls. Furthermore, SHGM showed focal collagen disorganization in the runners, and reduced collagen density (P = 0.03). IL-3 mRNA levels were correlated with mast cell number in sedentary animals. The qPCR analysis showed no significant differences between the groups in the other analyzed targets. The current study demonstrates that 7-week HIUR causes structural changes in the calcaneal tendon, and further that these changes are associated with an increased mast cell density. © 2013 The Authors. Scand J Med Sci Sports published by John Wiley & Sons Ltd.

Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

PubMed Central

Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

2014-01-01

In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

Comparison of Estrogen Receptor Assay Results from Pathology Reports with Results from Central Laboratory Testing: Implications for Population-Based Studies of Breast Cancer

PubMed Central

Collins, LC; Marotti, J; Baer, HJ; Deitz, AC; Colditz, GA; Tamimi, RM

2014-01-01

Population-based studies of women with breast cancer commonly utilize information culled from pathology reports rather than central pathology review. The reliability of this information, particularly with regard to tumor biomarker results, is of concern. To address this, we evaluated the concordance between estrogen receptor (ER) results as determined from the original pathology reports and ER results obtained on the same specimens following testing in a single laboratory. Tissue microarrays (TMAs) were constructed from paraffin blocks of 3,167 breast cancers that developed in women enrolled in the Nurses’ Health Study. ER immunostains were performed on all TMA sections in single run. Results of ER immunostains performed on the TMA sections were compared with ER assay results abstracted from pathology reports. Among 1,851 cases of invasive breast cancer in which both ER results from pathology reports and central ER test results were available, the reported ER status and the ER status as determined from immunostains on TMAs were in agreement in 1,651 cases (87.3 %; kappa value 0.64, p<0.0001). When the comparison was restricted to ER assays originally performed by immunohistochemistry, the agreement rate increased to 92.3% (kappa value 0.78, p<0.0001). These results provide a framework for the accuracy of ER results abstracted from clinical records. Further, they suggest that utilizing ER assay results from pathology reports is a reasonable, albeit imperfect, alternative to central laboratory ER testing for large, population-based studies of patients with breast cancer. PMID:18230800

Subepithelial corneal fibrosis partially due to epithelial-mesenchymal transition of ocular surface epithelium

PubMed Central

Kawashima, Motoko; Higa, Kazunari; Satake, Yoshiyuki; Omoto, Masahiro; Tsubota, Kazuo; Shimmura, Shigeto; Shimazaki, Jun

2010-01-01

Purpose To determine whether epithelial-mesenchymal transition is involved in the development of corneal subepithelial fibrosis (pannus). Methods Frozen samples of pannus tissue removed from human corneas with a diagnosis of total limbal stem cell deficiency were characterized by immunostaining for both epithelial and mesenchymal markers. We selected transformation-related protein 63 (p63) and pancytokeratin as epithelial markers and vimentin and α-smooth muscle actin (α-SMA) as mesenchymal markers. Immunostaining for β-catenin and E-cadherin was performed to determine wingless-Int (Wnt)-pathway activation. RT–PCR analysis was also performed on epithelial tissue obtained from pannus samples after dispase digestion. Results Immunohistochemistry revealed strong nuclear expression of p63 and weak intercellular expression of E-cadherin in epithelial basal cells of pannus tissue. Furthermore, translocation of β-catenin from intercellular junctions to the nucleus and cytoplasm was also observed. Double-positive cells for both p63 and α-SMA were observed in the subepithelial stroma of pannus tissue, which was supported by RT–PCR and cytospin analysis. Conclusions Epithelial-mesenchymal transition may be partially involved in the development of subepithelial corneal fibrosis due to total limbal stem cell deficiency. PMID:21179238

Hidradenocarcinoma: a histological and immunohistochemical study.

PubMed

Ko, Christine J; Cochran, Alistair J; Eng, William; Binder, Scott W

2006-11-01

The diagnosis of hidradenocarcinoma is difficult due to a combination of factors including inconsistent nomenclature/ classification, rarity of the neoplasm, and variable morphology of cells composing the neoplasm. Immunohistochemistry has not been previously performed on a series of hidradenocarcinomas. We evaluated six cases of hidradenocarcinoma histologically and immunohistochemically using antibodies to gross cystic disease fluid protein-15 (GCDFP-15), carcino-embryonic antigen (CEA), epithelial membrane antigen (EMA), S-100 protein, keratin AE1/3, cytokeratin 5/6, p53, bcl-1, bcl-2, and Ki67. Histology suggested concurrent eccrine and apocrine differentiation of the cases. Ki67 and p53 staining was strongly positive in five of six tumors. The neoplasms stained with antibodies to CEA, S-100 protein, GCDFP-15, EMA, bcl-1, and bcl-2 in no consistent pattern. All tumors studied stained positively for keratin AE1/3 and cytokeratin 5/6. In making the diagnosis of hidradenocarcinoma, it may be unnecessary to separate hidradenocarcinoma into eccrine and apocrine categories, and although Ki67 and p53 may be helpful, histological parameters remain paramount.

Spindle assembly checkpoint gene expression in childhood adrenocortical tumors (ACT): Overexpression of Aurora kinases A and B is associated with a poor prognosis.

PubMed

Borges, Kleiton Silva; Moreno, Daniel Antunes; Martinelli, Carlos Eduardo; Antonini, Sonir Roberto Rauber; de Castro, Margaret; Tucci, Silvio; Neder, Luciano; Ramalho, Leandra Naira Zambelli; Seidinger, Ana Luiza; Cardinalli, Izilda; Mastellaro, Maria José; Yunes, José Andres; Brandalise, Silvia Regina; Tone, Luiz Gonzaga; Scrideli, Carlos Alberto

2013-11-01

Pediatric adrenocortical tumors (ACT) are rare malignancies and treatment has a small impact on survival in advanced disease and the discovery of potential target genes could be important in new therapeutic approaches. The mRNA expression levels of spindle checkpoint genes AURKA, AURKB, BUB, and BUBR1 were analyzed in 60 children with ACT by quantitative real time PCR. The anticancer effect of ZM447439, an experimental AURK inhibitor, was analyzed in a primary childhood ACT culture carrying the TP53 p.R337H mutation. A significant association was observed between malignancy as defined by Weiss score ≥3 and higher AURKA (2.0-fold, P = 0.01), AURKB (7.0-fold, P = 0.007), and BUBR1 (5.8-fold, P = 0.007) gene expression, and between unfavorable event (death or relapse) and higher expression of AURKA (6.0-fold, P = 0.034) and AURKB (17-fold, P = 0.013). Overexpression of AURKA and AURKB was associated with lower event-free survival in uni- (P < 0.001 and P = 0.006, respectively) and multivariate (P = 0.002 and P = 0.03, respectively) analysis. Significant lower Event free survival (EFS) was also observed in patients with moderate/strong immunostaining to AURKA (P = 0.012) and AURKB (P = 0.045). ZM447439 was able to induce inhibition of proliferation and colony formation in a primary childhood ACT culture carrying the TP53 p.R337H mutation. Our results suggest that AURKA and AURKB overexpression in pediatric ACT may be related to more aggressive disease and the inhibition of these proteins could be an interesting approach for the treatment of these tumors. Copyright © 2013 Wiley Periodicals, Inc.

Dual occurrence of ALK G1202R solvent front mutation and small cell lung cancer transformation as resistance mechanisms to second generation ALK inhibitors without prior exposure to crizotinib. Pitfall of solely relying on liquid re-biopsy?

PubMed

Ou, Sai-Hong Ignatius; Lee, Thomas K; Young, Lauren; Fernandez-Rocha, Maria Y; Pavlick, Dean; Schrock, Alexa B; Zhu, Viola W; Milliken, Jeffrey; Ali, Siraj M; Gitlitz, Barbara J

2017-04-01

Development of the acquired ALK G1202R solvent front mutation and small cell lung cancer (SCLC) transformation have both been independently reported as resistance mechanisms to ALK inhibitors in ALK-rearranged (ALK+) non-small cell lung cancer (NSCLC) patients but have not been reported in the same patient. Here we report an ALK+ NSCLC patient who had disease progression after ceritinib and then alectinib where an ALK G1202R mutation was detected on circulating tumor (ct) DNA prior to enrollment onto a trial of another next generation ALK inhibitor, lorlatinib. The patient's central nervous system (CNS) metastases responded to lorlatinib together with clearance of ALK G1202R mutation by repeat ctDNA assay. However, the patient developed a new large pericardial effusion. Resected pericardium from the pericardial window revealed SCLC transformation with positive immunostaining for synaptophysin, chromogranin, and ALK (D5F3 antibody). Comprehensive genomic profiling (CGP) of the tumor infiltrating pericardium revealed the retainment of an ALK rearrangement with emergence of an inactivating Rb1 mutation (C706Y) and loss of exons 1-11 in p53 that was not detected in the original tumor tissue at diagnosis. The patient was subsequently treated with carboplatin/etoposide and alectinib, but had rapid clinical deterioration and died. The patient never received crizotinib. This case illustrates that multiple/compound resistance mechanisms to ALK inhibitors can occur and provide supporting information that loss of p53 and Rb1 are important in SCLC transformation. If clinically feasible, tissue-based re-biopsy allowing histological examination and CGP remains the gold standard to assess resistance mechanism(s) and to direct subsequent rational clinical care. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

2011-01-01

Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

Metabonomics applied in exploring the antitumour mechanism of physapubenolide on hepatocellular carcinoma cells by targeting glycolysis through the Akt-p53 pathway

PubMed Central

Ma, Ting; Fan, Bo-Yi; Zhang, Chao; Zhao, Hui-Jun; Han, Chao; Gao, Cai-Yun; Luo, Jian-Guang; Kong, Ling-Yi

2016-01-01

Metabolomics can be used to identify potential markers and discover new targets for future therapeutic interventions. Here, we developed a novel application of the metabonomics method based on gas chromatography-mass spectrometry (GC/MS) analysis and principal component analysis (PCA) for rapidly exploring the anticancer mechanism of physapubenolide (PB), a cytotoxic withanolide isolated from Physalis species. PB inhibited the proliferation of hepatocellular carcinoma cells in vitro and in vivo, accompanied by apoptosis-related biochemical events, including the cleavage of caspase-3/7/9 and PARP. Metabolic profiling analysis revealed that PB disturbed the metabolic pattern and significantly decreased lactate production. This suggests that the suppression of glycolysis plays an important role in the anti-tumour effects induced by PB, which is further supported by the decreased expression of glycolysis-related genes and proteins. Furthermore, the increased level of p53 and decreased expression of p-Akt were observed, and the attenuated glycolysis and enhanced apoptosis were reversed in the presence of Akt cDNA or p53 siRNA. These results confirm that PB exhibits anti-cancer activities through the Akt-p53 pathway. Our study not only reports for the first time the anti-tumour mechanism of PB, but also suggests that PB is a promising therapeutic agent for use in cancer treatments and that metabolomic approaches provide a new strategy to effectively explore the molecular mechanisms of promising anticancer compounds. PMID:27416811

Metabonomics applied in exploring the antitumour mechanism of physapubenolide on hepatocellular carcinoma cells by targeting glycolysis through the Akt-p53 pathway.

PubMed

Ma, Ting; Fan, Bo-Yi; Zhang, Chao; Zhao, Hui-Jun; Han, Chao; Gao, Cai-Yun; Luo, Jian-Guang; Kong, Ling-Yi

2016-07-15

Metabolomics can be used to identify potential markers and discover new targets for future therapeutic interventions. Here, we developed a novel application of the metabonomics method based on gas chromatography-mass spectrometry (GC/MS) analysis and principal component analysis (PCA) for rapidly exploring the anticancer mechanism of physapubenolide (PB), a cytotoxic withanolide isolated from Physalis species. PB inhibited the proliferation of hepatocellular carcinoma cells in vitro and in vivo, accompanied by apoptosis-related biochemical events, including the cleavage of caspase-3/7/9 and PARP. Metabolic profiling analysis revealed that PB disturbed the metabolic pattern and significantly decreased lactate production. This suggests that the suppression of glycolysis plays an important role in the anti-tumour effects induced by PB, which is further supported by the decreased expression of glycolysis-related genes and proteins. Furthermore, the increased level of p53 and decreased expression of p-Akt were observed, and the attenuated glycolysis and enhanced apoptosis were reversed in the presence of Akt cDNA or p53 siRNA. These results confirm that PB exhibits anti-cancer activities through the Akt-p53 pathway. Our study not only reports for the first time the anti-tumour mechanism of PB, but also suggests that PB is a promising therapeutic agent for use in cancer treatments and that metabolomic approaches provide a new strategy to effectively explore the molecular mechanisms of promising anticancer compounds.

Differentiated intraepithelial neoplasia of the vulva.

PubMed

Mulvany, Nicholas J; Allen, David G

2008-01-01

We present the clinical and pathological findings of 6 women with intraepithelial neoplasia of differentiated or simplex type (DVIN). The mean age was 68 years (range 55-82). One lesion was still in situ, whereas 5 were associated with squamous carcinoma, 4 of well-differentiated keratinizing type and 1 of poorly differentiated spindle-cell type. The invasive depth of the squamous carcinomas ranged from 0.6 to 8 mm and the surgical margins of all of the resection specimens were uninvolved by neoplastic cells. In contrast, DVIN involved the surgical margins in 5 specimens while the remaining specimen had normal surgical margins. In all 6 vulvar specimens, DVIN showed intense immunoreactivity for Ki-67 in the basal and parabasal cells while only 4 specimens showed reactivity for p53. In 5 surgical specimens with DVIN the number of CD1a cells was increased but little if any immunoreactivity could be found amongst the corresponding invasive neoplastic cells. Four squamous carcinomas also showed diffuse p53 reactivity. There was little difference in the pattern of Ki-67 expression between DVIN and squamous carcinoma. For a number of reasons, DVIN present diagnostic difficulty and considerable interobserver variation also exists. Our study suggests that Ki-67 and p16 are useful for distinguishing DVIN and classical VIN 3, whereas p53 and CD1a are useful for distinguishing DVIN and invasive squamous carcinoma. Furthermore, p53 appears to have higher specificity than sensitivity for distinguishing DVIN from normal squamous epithelium.

The Association of Normal Range Glycated Hemoglobin with Restrictive Lung Pattern in the General Population

PubMed Central

Oh, Il Hwan; Park, Jung Hwan; Lee, Chang Hwa; Park, Joon-Sung

2015-01-01

Glycated hemoglobin (HbA1c) is an important diagnostic indicator of diabetes mellitus, and some authors have argued that it is related to impaired lung function in the diabetic population. However, there was rare study for association between lung function and HbA1c in the non-diabetic population. We investigated whether HbA1c below the diagnostic threshold is related to deficits in lung function. We analyzed biochemical and spirometry data from a nation-wide, population-based, case-control study (the KNHANES IV and V). Eligible as cases were all native Koreans aged 40 years or more with no medical illness. A total of 3670 participants were divided into 4 groups according to HbA1c (%) as follows: Group I (n = 842), ≥ 4.0 and ≤ 5.3; Group II (n = 833), > 5.3 and ≤ 5.5; Group III (n = 898), > 5.5 and ≤ 5.7; and Group IV (n = 1097), > 5.7 and ≤ 6.4. Group I had the greatest forced vital capacity (FVC, 96.3 ± 0.5% pred, P < 0.0001), forced expiratory volume per second (FEV1, 93.8 ± 0.5% pred, P < 0.0001) and FEV1/FVC (0.792 ± 0.003, P < 0.0001) compared with the other groups. Linear regression showed that HbA1c was closely related to FVC (β = -6.972154, P < 0.0001) and FEV1 (β = -5.591589, P < 0.0001), but not to FEV1/FVC. Logistic regression analysis revealed a significant association between HbA1c and a restrictive spirometric pattern (FVC < 80% pred., FEV1/FVC ≥ 0.70; OR = 3.772, 95% CI = 1.234-11.53), indicating that elevated HbA1c is closely associated with lung impairment in the non-diabetic population. In the healthy population, relatively high HbA1c level is associated with decrements of FVC and FEV1 and may be a reliable predictor of poor lung function, especially the restrictive pattern. PMID:25658743

Renal distal tubule proliferation and increased aquaporin 2 level but decreased urine osmolality in db/db mouse: treatment with chromium picolinate.

PubMed

Mozaffari, Mahmood S; Abdelsayed, Rafik; Liu, Jun Yao; Zakhary, Ibrahim; Baban, Babak

2012-02-01

Hallmark features of type 2 diabetes mellitus include glucosuria and polyuria. Further, renal aquaporin 2 is pivotal to regulation of fluid excretion and urine osmolality. Accordingly, we tested the hypothesis that the db/db mouse displays increased glucosuria and fluid excretion but reduced urine osmolality in association with decreased renal aquaporin 2 level. In addition, we examined the effect of chromium picolinate (Cr(pic)3) which is purported to improve glycemic control. The db/db mice excreted more urine in association with marked glucose excretion but lower urine osmolality than db/m control group. Light microscopic examination of renal tissue revealed proliferation of tubular structures in db/db compared to the db/m mice, a feature validated with Ki67 immunostaining. Further, these tubules showed generally similar immunostaining intensity and pattern for aquaporin 2 indicating that proliferated tubules are of distal origin. On the other hand, renal aquaporin 2 protein level was significantly higher in the db/db than db/m group. Treatment of db/db mice with Cr(pic)3 reduced plasma glucose and hemoglobin A1c (~15-17%, p<0.05) and Ki67 positive cells but other parameters were similar to their untreated counterparts. Collectively, these findings suggest that proliferation of renal distal tubules and increased aquaporin 2 level likely represent an adaptive mechanism to regulate fluid excretion to prevent dehydration in the setting of marked glucosuria in the db/db mouse, features not affected by Cr(pic)3 treatment. These observations are of relevance to increasing interest in developing therapeutic agents that facilitate renal glucose elimination. Copyright © 2011 Elsevier Inc. All rights reserved.

Renal distal tubule proliferation and increased aquaporin 2 level but decreased urine osmolality in db/db mouse: treatment with chromium picolinate

PubMed Central

Mozaffari, Mahmood S.; Abdelsayed, Rafik; Liu, Jun Yao; Zakhary, Ibrahim; Baban, Babak

2011-01-01

Hallmark features of type 2 diabetes mellitus include glucosuria and polyuria. Further, renal aquaporin 2 is pivotal to regulation of fluid excretion and urine osmolality. Accordingly, we tested the hypothesis that the db/db mouse displays increased glucosuria and fluid excretion but reduced urine osmolality in association with decreased renal aquaporin 2 level. In addition, we examined the effect of chromium picolinate (Cr(pic)3) which is purported to improve glycemic control. The db/db mice excreted more urine in association with marked glucose excretion but lower urine osmolality than db/m control group. Light microscopic examination of renal tissue revealed proliferation of tubular structures in db/db compared to the db/m mice, a feature validated with Ki67 immunostaining. Further, these tubules showed generally similar immunostaining intensity and pattern for aquaporin 2 indicating that proliferated tubules are of distal origin. On the other hand, renal aquaporin 2 protein level was significantly higher in the db/db than db/m group. Treatment of db/db mice with Cr(pic)3 reduced plasma glucose and hemoglobin A1c (~ 15–17%, p<0.05) and Ki67 positive cells but other parameters were similar to their untreated counterparts. Collectively, these findings suggest that proliferation of renal distal tubules and increased aquaporin 2 level likely represent an adaptive mechanism to regulate fluid excretion to prevent dehydration in the setting of marked glucosuria in the db/db mouse, features not affected by Cr(pic)3 treatment. These observations are of relevance to increasing interest in developing therapeutic agents that facilitate renal glucose elimination. PMID:21983138

Morphological, immunohistochemical, and chromosomal analysis of multicystic chromophobe renal cell carcinoma, an architecturally unusual challenging variant.

PubMed

Foix, Maria Pané; Dunatov, Ana; Martinek, Petr; Mundó, Enric Condom; Suster, Saul; Sperga, Maris; Lopez, Jose I; Ulamec, Monika; Bulimbasic, Stela; Montiel, Delia Perez; Alaghehbandan, Reza; Peckova, Kvetoslava; Pivovarcikova, Krystina; Ondrej, Daum; Rotterova, Pavla; Skenderi, Faruk; Prochazkova, Kristyna; Dusek, Martin; Hora, Milan; Michal, Michal; Hes, Ondrej

2016-12-01

Chromophobe renal cell carcinoma (ChRCC) is typically composed of large leaf-like cells and smaller eosinophilic cells arranged in a solid-alveolar pattern. Eosinophilic, adenomatoid/pigmented, or neuroendocrine variants have also been described. We collected 10 cases of ChRCC with a distinct multicystic pattern out of 733 ChRCCs from our registry, and subsequently analyzed these by morphology, immunohistochemistry, and array comparative genomic hybridization. Of the 10 patients, 6 were males with an age range of 50-89 years (mean 68, median 69). Tumor size ranged between 1.2 and 20 cm (mean 5.32, median 3). Clinical follow-up was available for seven patients, ranging 1-19 years (mean 7.2, median 2.5). No aggressive behavior was documented. We observed two growth patterns, which were similar in all tumors: (1) variable-sized cysts, resembling multilocular cystic neoplasm of low malignant potential and (2) compressed cystic and tubular pattern with slit-like spaces. Raisinoid nuclei were consistently present while necrosis was absent in all cases. Half of the cases showed eosinophilic/oncocytic cytology, deposits of pigment (lipochrome) and microcalcifications. The other half was composed of pale or mixed cell populations. Immunostains for epithelial membrane antigen (EMA), CK7, OSCAR, CD117, parvalbumin, MIA, and Pax 8 were positive in all tumors while negative for vimentin, TFE3, CANH 9, HMB45, cathepsin K, and AMACR. Ki67 immunostain was positive in up to 1 % of neoplastic cells. Molecular genetic examination revealed multiple chromosomal losses in two fifths analyzable tumors, while three cases showed no chromosomal numerical aberrations. ChRCC are rarely arranged in a prominent multicystic pattern, which is probably an extreme form of the microcystic adenomatoid pigmented variant of ChRCC. The spectrum of tumors entering the differential diagnosis of ChRCC is quite different from that of conventional ChRCC. The immunophenotype of ChRCC is identical with that of conventional ChRCC. Chromosomal numerical aberration pattern was variable; no chromosomal numerical aberrations were found in three cases. All the cases in this series have shown an indolent and non-aggressive behavior.

Mechanism of p53-Dependent Apoptosis and its Role in Breast Cancer Therapy

DTIC Science & Technology

1999-07-01

inducibly express p53 as previously described (Chen et a!., 1996). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A62-91)-l, -5, and -6 cells...1994) was used as template, ( a ) Levels of p53, p21 and actin in p53-3 and p53(gln22-ser23/A62-91)-2 and -14 cells were assayed by Western blot...CGG TAC CCC TGT CAT CTT CTG TC; and reverse primer C393 as used for generating p53(A62-91). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A74

Utilization of nuclear structural proteins for targeted therapy and detection of proliferative and differentiation disorders

DOEpatents

Lelievre, Sophie; Bissell, Mina

2001-01-01

The localization of nuclear apparatus proteins (NUMA) is used to identify tumor cells and different stages in the tumor progression and differentiation processes. There is a characteristic organization of NuMA in tumor cells and in phenotypically normal cells. NuMA distribution patterns are significantly less diffuse in proliferating non-malignant cells compared to malignant cells. The technique encompasses cell immunostaining using a NuMA specific antibody, and microscopic analysis of NuMA distribution within each nucleus.

VRPD Novel Combinatory Approaches to Repair Visual System After Optic Nerve Damage

DTIC Science & Technology

2015-05-01

At 4 and 8 weeks after injury, retinas were immunostained with an antibody against beta III tubulin (TUJ1) to estimate RGC survival. The degree of...Optic chiasm presentation of Semaphorin6D in the context of Plexin-A1 and Nr- CAM promotes retinal axon midline crossing. Neuron 74, 676–690. Leaver...for Nr- CAM in the patterning of binocular visual pathways. Neuron 50, 535–547. Williams, S.E., Mann, F., Erskine, L., Sakurai, T., Wei, S., Rossi, D.J

p53 shapes genome-wide and cell type-specific changes in microRNA expression during the human DNA damage response.

PubMed

Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R

2014-01-01

The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.

Hypoxia-ischemia brain damage disrupts brain cholesterol homeostasis in neonatal rats.

PubMed

Yu, Z; Li, S; Lv, S H; Piao, H; Zhang, Y H; Zhang, Y M; Ma, H; Zhang, J; Sun, C K; Li, A P

2009-08-01

The first 3 weeks of life is the peak time of oligodendrocytes development and also the critical period of cholesterol increasing dramatically in central nervous system in rats. Neonatal hypoxia-ischemia (HI) brain damage happening in this period may disturb the brain cholesterol balance as well as white matter development. To test this hypothesis, postnatal day 7 (P7) Sprague-Dawley rats were subjected to HI insult. Cholesterol concentrations from brain and plasma were measured. White matter integrity was evaluated by densitometric analysis of myelin basic protein (MBP) immunostaining and electron microscopy. Brain TNF-alpha and IL-6 levels were also measured. HI-induced brain cholesterol, but not the plasma cholesterol, levels decreased significantly during the first three days after HI compared with naïve and sham operated rats (p<0.05). Obvious hypomyelination was indicated by marked reductions in MBP immunostaining on both P10 and P14 (p<0.01) and less and thinner myelinated axons were detected on P21 by electron microscopy observation. High expressions of brain TNF-alpha and IL-6 12 h after HI (p<0.05) were also observed. The present work provides evidence that HI insult destroyed brain cholesterol homeostasis, which might be important in the molecular pathology of hypoxic-ischemic white matter injury. Proinflammatory cytokines insulting oligodendrocytes, may cause cholesterol unbalance. Furthermore, specific therapeutic interventions to maintain brain cholesterol balance may be effective for the recovery of white matter function. Georg Thieme Verlag KG Stuttgart New York.

[Application of Warthin-Starry stain, immunohistochemistry and transmission electron microscopy in diagnosis of cat scratch disease].

PubMed

Huang, Juan; Dai, Lin; Lei, Song; Liao, Dian-ying; Wang, Xiao-qing; Luo, Tian-you; Chen, Yu; Hang, Zhen-biao; Li, Gan-di; Dong, Dan-dan; Xu, Gang; Gu, Zheng-ce; Hao, Ji-ling; Hua, Ping; He, Lei; Duan, Fang-lei

2010-04-01

To evaluate the diagnostic utility of Warthin-Starry silver stain, immunohistochemistry and transmission electron microscopy in the detection of human Bartonella henselae infection and pathologic diagnosis of cat scratch disease (CSD). The paraffin-embedded lymph node tissues of 77 histologically-defined cases of cat scratch disease collected during the period from January, 1998 to December, 2008 were retrieved and studied using Warthin-Starry silver stain (WS stain) and mouse monoclonal antibody against Bartonella henselae (BhmAB stain). Five cases rich in bacteria were selected for transmission electron microscopy. Under electron microscope, the organisms Bartonella henselae appeared polymorphic, round, elliptical, short rod or bacilliform shapes, ranged from 0.489 to 1.110 microm by 0.333 to 0.534 microm and often clustered together. Black short rod-shaped bacilli arranged in chains or clumps were demonstrated in 61.0% (47/77) of CSD by WS stain. The organisms were located outside the cells and lie mainly in the necrotic debris, especially near the nodal capsule. In 72.7% (56/77) of the cases, dot-like, granular as well as few linear positive signals were observed using BhmAB immunostain and showed similar localization. Positive results for both stains were identified in 59.7% (46/77) of the cases. When applying both stains together, Bartonella henselae was observed in 74.0% (57/77) of the case. The difference between the results obtained by WS stain and BhmAB immunostain was of statistical significance (P < 0.05). Bartonella henselae is the causative pathogen of cat scratch disease. WS stain, BhmAB immunostain and transmission electron microscopy are helpful in confirming the histologic diagnosis. Immunostaining using BhmAB can be a better alternative than WS stain in demonstrating the organisms.

Reversing the effects of formalin fixation with citraconic anhydride and heat: a universal antigen retrieval method.

PubMed

Namimatsu, Shigeki; Ghazizadeh, Mohammad; Sugisaki, Yuichi

2005-01-01

Formalin is a commonly used fixative for tissue preservation in pathology laboratories. A major adverse effect of this fixative is the concealing of tissue antigens by protein cross-linking. To achieve a universal antigen retrieval method for immunohistochemistry under a constant condition, we developed a new method in which the effects of formalin fixation were reversed with citraconic anhydride (a reversible protein cross-linking agent) plus heating. Formalin-fixed, paraffin-embedded tissues from various organs were examined for immunohistochemical localization of a wide variety of antigens. Deparaffinized tissue sections were placed in an electric kitchen pot containing 0.05% citraconic anhydride solution, pH 7.4, and the pot was set at "keep warm" temperature mode of 98C for 45 min. This mode allowed heating the sections at a constant temperature. The sections were then washed in buffer solution and immunostained using a labeled streptavidin-biotin method using an automated stainer. In general, formalin-fixed tissues demonstrated specific immunostainings comparable to that in fresh frozen tissues and significantly more enhanced than after conventional antigen retrieval methods. In particular, even difficult-to-detect antigens such as CD4, cyclin D1, granzyme beta, bcl-6, CD25, and lambda chain revealed distinct immunostainings. Different classes of antigens such as cellular markers and receptors, as well as cytoplasmic and nuclear proteins, consistently produced enhanced reactions. This method provides efficient antigen retrieval for successful immunostaining of a wide variety of antigens under an optimized condition. It also allows standardization of immunohistochemistry for formalin-fixed tissues in pathology laboratories, eliminating inter-laboratory discrepancies in results for accurate clinical and research studies.

Tissue preparation for immunocytochemistry.

PubMed Central

Williams, J H; Mepham, B L; Wright, D H

1997-01-01

AIMS: To investigate the effect of tissue preparation on immunostaining and to establish whether there is a standard tissue preparation schedule that allows optimal demonstration of all antigens. METHODS: Blocks of tonsil were subjected to variations to a standard fixation, processing, and section preparation schedule. The sections were stained with five antibodies-L26 (CD20), UCHL1 (CD45RO), CD3, vimentin, and anti-kappa light chain--using the streptavidinbiotin immunostaining technique. When further investigation was necessary, other tissues and antibodies were used and where weak immunostaining was obtained the use of microwave pretreatment to improve staining was tested. RESULTS: Several factors involved in fixation were found to affect immunoreactivity. These included the duration, pH, and type of fixative used. In tissue processing only temperature and the duration of the dehydration and wax infiltration steps affected immunoreactivity. Of all the factors investigated, the temperature and duration of the section drying had the greatest effect. In contrast, long term storage of cut sections before immunostaining had no effect on the reactivity of the antibodies tested. Antibodies were found to be affected by alterations to tissue preparation by varying degrees, UCHL1 and vimentin being the most susceptible to changes in fixation and L26 to changes in processing. Where weak staining occurred, microwave pretreatment was generally found to eliminate the problem. CONCLUSIONS: There is no standard tissue preparation schedule for the optimal demonstration of all antigens. Factors involved in all aspects of tissue preparation can affect immunoreactivity, so it is important that precise details of the preparation schedule are given when reporting immunocytochemical studies, rather than using the general term "routinely fixed and processed". Images PMID:9215127

Java Web Start based software for automated quantitative nuclear analysis of prostate cancer and benign prostate hyperplasia.

PubMed

Singh, Swaroop S; Kim, Desok; Mohler, James L

2005-05-11

Androgen acts via androgen receptor (AR) and accurate measurement of the levels of AR protein expression is critical for prostate research. The expression of AR in paired specimens of benign prostate and prostate cancer from 20 African and 20 Caucasian Americans was compared to demonstrate an application of this system. A set of 200 immunopositive and 200 immunonegative nuclei were collected from the images using a macro developed in Image Pro Plus. Linear Discriminant and Logistic Regression analyses were performed on the data to generate classification coefficients. Classification coefficients render the automated image analysis software independent of the type of immunostaining or image acquisition system used. The image analysis software performs local segmentation and uses nuclear shape and size to detect prostatic epithelial nuclei. AR expression is described by (a) percentage of immunopositive nuclei; (b) percentage of immunopositive nuclear area; and (c) intensity of AR expression among immunopositive nuclei or areas. The percent positive nuclei and percent nuclear area were similar by race in both benign prostate hyperplasia and prostate cancer. In prostate cancer epithelial nuclei, African Americans exhibited 38% higher levels of AR immunostaining than Caucasian Americans (two sided Student's t-tests; P < 0.05). Intensity of AR immunostaining was similar between races in benign prostate. The differences measured in the intensity of AR expression in prostate cancer were consistent with previous studies. Classification coefficients are required due to non-standardized immunostaining and image collection methods across medical institutions and research laboratories and helps customize the software for the specimen under study. The availability of a free, automated system creates new opportunities for testing, evaluation and use of this image analysis system by many research groups who study nuclear protein expression.

Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

PubMed Central

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

2016-01-01

Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

Smad2/3 Linker Phosphorylation Is a Possible Marker of Pancreatic Stem/Progenitor Cells in the Regenerative Phase of Acute Pancreatitis.

PubMed

Sakao, Masayuki; Sakaguchi, Yutaku; Suzuki, Ryo; Takahashi, Yu; Kishimoto, Masanobu; Fukui, Toshiro; Uchida, Kazushige; Nishio, Akiyoshi; Matsuzaki, Koichi; Okazaki, Kazuichi

The aims of this study are to characterize cell proliferation and differentiation during regeneration after pancreatitis and pancreatic buds during development to evaluate the role of Smad2/3, phosphorylated at the specific linker threonine residues (pSmad2/3L-Thr) in positive cells. Male C57BL/6 mice received hourly intraperitoneal injections of cerulein and were analyzed after induced pancreatitis. Pancreatitis-affected tissue sections and pancreatic buds were immunostained for pSmad2/3L-Thr, with other markers thought to be stem/progenitor markers of the pancreas. pSmad2/3L-Thr immunostaining-positive cells increased as the pancreatitis progressed. The expression of pSmad2/3L-Thr was seen in acinar cells and ductlike tubular complexes. These results suggest that pSmad2/3L-Thr is expressed during acinar-ductal metaplasia. Immunohistochemical colocalization of pSmad2/3L-Thr with Ki67 was never observed. pSmad2/3L-Thr-positive cells may remain in an undifferentiated state. During the pancreatic development process, pSmad2/3L-Thr was expressed as other markers. pSmad2/3L-Thr develops in duct structure of the undifferentiated cell population in the last part of viviparity that acinar structure is formed clearly. pSmad2/3L-Thr expression occurs during acinar-ductal metaplasia after pancreatitis and may represent the contribution of stem cells and/or progenitor cells to the differentiation of the pancreas.

Effect of the biodegradation rate controlled by pore structures in magnesium phosphate ceramic scaffolds on bone tissue regeneration in vivo.

PubMed

Kim, Ju-Ang; Lim, Jiwon; Naren, Raja; Yun, Hui-Suk; Park, Eui Kyun

2016-10-15

Similar to calcium phosphates, magnesium phosphate (MgP) ceramics have been shown to be biocompatible and support favorable conditions for bone cells. Micropores below 25μm (MgP25), between 25 and 53μm (MgP53), or no micropores (MgP0) were introduced into MgP scaffolds using different sizes of an NaCl template. The porosities of MgP25 and MgP53 were found to be higher than that of MgP0 because of their micro-sized pores. Both in vitro and in vivo analysis showed that MgP scaffolds with high porosity promoted rapid biodegradation. Implantation of the MgP0, MgP25, and MgP53 scaffolds into rabbit calvarial defects (with 4- and 6-mm diameters) was assessed at two times points (4 and 8weeks), followed by analysis of bone regeneration. The micro-CT and histologic analyses of the 4-mm defect showed that the MgP25 and MgP53 scaffolds were degraded completely at 4weeks with simultaneous bone and marrow-like structure regeneration. For the 6-mm defect, a similar pattern of regeneration was observed. These results indicate that the rate of degradation is associated with bone regeneration. The MgP25 and MgP53 scaffold-implanted bone showed a better lamellar structure and enhanced calcification compared to the MgP0 scaffold because of their porosity and degradation rate. Tartrate-resistant acid phosphatase (TRAP) staining indicated that the newly formed bone was undergoing maturation and remodeling. Overall, these data suggest that the pore architecture of MgP ceramic scaffolds greatly influence bone formation and remodeling activities and thus should be considered in the design of new scaffolds for long-term bone tissue regeneration. The pore structural conditions of scaffold, including porosity, pore size, pore morphology, and pore interconnectivity affect cell ingrowth, mechanical properties and biodegradabilities, which are key components of scaffold in bone tissue regeneration. In this study, we designed hierarchical pore structure of the magnesium phosphate (MgP) scaffold by combination of the 3D printing process, self-setting reaction and salt-leaching technique, and first studied the effect of pore structures of bioceramic scaffolds on bone tissue regeneration through both in vitro and in vivo studies (rabbit calvarial model). The MgP scaffolds with higher porosity promoted more rapid biodegradation and enhanced new bone formation and remodeling activities at the same time. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Sebaceous carcinoma of the vulva: critical approach to grading and review of the literature.

PubMed

Pusiol, T; Morichetti, D; Zorzi, M G

2011-06-01

Sebaceous glands are abundant on the vulva, but vulvar sebaceous carcinoma (SC) is an uncommon neoplasm. We report a case of SC of the vulva in a 51 year-old woman. The patient presented a 6-month history of an asymptomatic 2.5 x 1.5 cm exophytic tumour localized on the left labium majora. Tumorectomy was performed. Histologically, the lesion had an irregular lobular growth pattern composed of lobules or sheets of malignant cells separated by fibrovascular stroma. There was a mixture of sebaceous-type differentiation, small ducts and areas showing basaloid or squamous features. Centrally-located tumour cells showed moderate EMA immunoreactivity, especially enhancing cytoplasmic "bubbliness". Tumour cells were immunoreactive for CAM 5.2. The immunoreactivity for intranuclear p53 staining was > 10%. Southern blot hybridization and PCR studies did not detect HPV DNA. Hemivulvectomy was performed. After 18 months of follow-up, the patient has no evidence of recurrence, metastases or other malignant tumours. The grading of cutaneous SC proposed by Rutten et al. (World Health Organization Classification of Skin Tumours) and Patterson & Wick (Nonmelanocytic Tumours of the Skin. Armed Forces Institute of Pathology) is based on patterns of tumour growth rather than cytological features. Such grading of skin SC, including vulvar SC, should not be used since its prognostic value has not been sufficiently documented. As the number of reported vulvar SCs is very limited, their natural history is unknown and the optimal treatment has not been established. The follow-up of 7 reported cases supports the general opinion that the tumour may be aggressive. SC groin node metastases carry a devastating prognosis, and unrecognized disease in the inguinofemoral lymph nodes is nearly always fatal. The use of sentinel lymph nodes (SLN) has evolved as an effective surgical technique for identifying early subclinical regional nodal involvement for many solid tumours throughout the body for staging disease; this is because extra-ocular SCs cause widespread metastatic disease. In our opinion, SLN should be used in conjunction with wide local excision of the primary tumour to investigate regional subclinical metastases. In the presence of a positive sentinel node, early lymphadenectomy with or without radiotherapy could be used to reduce tumour-related morbidity and mortality. The histopathologic differential diagnosis of SC is wide-ranging, including virtually all other malignant clear cell tumours of the skin. The proliferative pattern, immunostaining and cytologic features permit exclusion of neoplasms that mimic SC, but a diagnosis of SC should be rendered only if the overall attributes of the lesion are appropriate for such a interpretation.

Visualizing the enteric nervous system using genetically engineered double reporter mice: Comparison with immunofluorescence.

PubMed

Jiang, Yanfen; Dong, Hui; Eckmann, Lars; Hanson, Elaine M; Ihn, Katherine C; Mittal, Ravinder K

2017-01-01

The enteric nervous system (ENS) plays a crucial role in the control of gastrointestinal motility, secretion and absorption functions. Immunohistochemistry has been widely used to visualize neurons of the ENS for more than two decades. Genetically engineered mice that report specific proteins can also be used to visualize neurons of the ENS. The goal of our study was to develop a mouse that expresses fluorescent neuronal nitric oxide synthase (nNOS) and choline acetyltransferase (ChAT), the two proteins expressed in 95% of the ENS neurons. We compared ENS neurons visualized in the reporter mouse with the wild type mouse stained using classical immunostaining techniques. Mice hemizygous for ChAT-ChR2-YFP BAC transgene with expression of the mhChR2:YFP fusion protein directed by ChAT promoter/enhancer regions on the BAC transgene were purchased commercially. The Cre/LoxP technique of somatic recombination was used to construct mice with nNOS positive neurons. The two mice were crossbred and tissues were harvested and examined using fluorescent microscopy. Immunostaining was performed in the wild type mice, using antibodies to nNOS, ChAT, Hu and PGP 9.5. Greater than 95% of the ENS neurons were positive for either nNOS or ChAT or both. The nNOS and ChAT neurons and their processes in the ENS were well visualized in all the regions of the GI tract, i.e., esophagus, small intestine and colon. The number of nNOS and ChAT neurons was approximately same in the reporter mouse and immunostaining method in the wild type mouse. The nNOS fluorescence in the reporter mouse was seen in both cytoplasm as well as nucleus but in the immunostained specimens it was seen only in the cytoplasm. We propose that the genetically engineered double reporter mouse for ChAT and nNOS proteins is a powerful tool to study of the effects of various diseases on the ENS without the need for immunostaining.

Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

PubMed

He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

2015-02-10

Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

Clinicopathological characteristics of Xp11.2 translocation renal cell carcinoma in adolescents and adults: Diagnosis using immunostaining of transcription factor E3 and fluorescence in situ hybridization analysis.

PubMed

Hirobe, Megumi; Masumori, Naoya; Tanaka, Toshiaki; Kitamura, Hiroshi; Tonooka, Akiko; Hasegawa, Tadashi; Tsukamoto, Taiji

2016-02-01

To determine the rate and clinicopathological features of Xp11.2 translocation carcinoma using immunostaining of transcription factor E3 and fluorescence in situ hybridization analysis. We evaluated 638 patients with renal cell carcinoma treated at Sapporo Medical University Hospital, Sapporo, Japan, from 1990 to 2009 by reviewing all hematoxylin-eosin-stained sections and carrying out immunostaining of transcription factor E3 for all cases. Fluorescence in situ hybridization analysis was carried out for patients with positive immunostaining or with findings suspicious for Xp11.2 translocation carcinoma on hematoxylin-eosin-stained sections. In this analysis, we set a cut-off level for split signals of at least 10% of nuclei. Of the 631 patients, 20 (3.2%) were positive for immunostaining. Finally, five patients were diagnosed with Xp11.2 translocation carcinoma (0.8%). Four of these patients were female and aged less than 50 years, and three cases were diagnosed as stage IV with multiple regional lymph nodal or visceral metastases. The positive predictive value of immunostaining was 25%. Patients with Xp11 translocation renal cell carcinoma tend to be younger, more frequently female and diagnosed at a more advanced stage. Immunostaining followed by fluorescence in situ hybridization analysis is an accurate and cost-effective approach for diagnosis of Xp11 translocation renal cell carcinoma. © 2015 The Japanese Urological Association.

TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

PubMed

Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

2005-12-08

TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

PubMed

Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

2014-03-18

Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

Immunohistochemical localization and functional characterization of somatostatin receptor subtypes in a corticotropin releasing hormone-secreting adrenal phaeochromocytoma: review of the literature and report of a case

PubMed Central

Ruggeri, R.M.; Ferraù, F.; Campennì, A.; Simone, A.; Barresi, V.; Giuffrè, G.; Tuccari, G.; Baldari, S.; Trimarchi, F.

2009-01-01

Somastostatin receptors are frequently expressed in phaeochromocytoma but data on somatostatin receptor subtyping are scanty and the functional response to the somatostatin analogue octretide is still debated.We report an unusual case of pheochromocytoma, causing ectopic Cushing’s syndrome due to CRH production by the tumour cells, in a 50-yr-old woman. Abdominal computed tomography revealed an inhomogeneous, 9-cm mass in the right adrenal gland, and [111In-DTPA0] octreotide scintigraphy showed an abnormal uptake of the radiotracer in the right perirenal region, corresponding to the adrenal mass. The patient underwent laparoscopic surgery and formalin-fixed and paraffin-embedded samples were studied. The tumour was extensively characterized by immunohistochemistry and somatostatin receptor (SSTRs) subtypes expression was analyzed. Histological and immunohistochemical examination of the surgical specimens displayed a typical pheochromocytoma, which was found to be immunoreative to S-100, chromogranin A and neurofilaments. Immunostaining for SSTR subtypes showed a positive reaction for SSTR1, SSTR2A, SSTR2B, antisera on tumour cells. The intense and diffuse immunostaining for corticotropin releasing hormone (CRH) antiserum indicated that Cushing’s disease was dependent on CRH overproduction by the pheochromocytoma, in which no immunostaining for adrenocorticotropic hormone was found. Our report confirms the heterogeneity of the pattern of SSTR expression in pheochromocytomas, and provide further evidence for functional SSTR subtype SSTR2a in a subgroup of pheochromocytomas, suggesting that these tumours may represent potential target for octreotide treatment.

Immunohistochemical localization and functional characterization of somatostatin receptor subtypes in a corticotropin releasing hormone- secreting adrenal phaeochromocytoma: review of the literature and report of a case.

PubMed

Ruggeri, Rosaria M; Ferraù, F; Campennì, A; Simone, A; Barresi, V; Giuffrè, G; Tuccari, G; Baldari, S; Trimarchi, F

2009-01-01

Somastostatin receptors are frequently expressed in phaeochromocytoma but data on somatostatin receptor subtyping are scanty and the functional response to the somatostatin analogue octretide is still debated.We report an unusual case of pheochro-mocytoma,causing ectopic Cushing's syndrome due to CRH production by the tumour cells, in a 50-yr-old woman. Abdominal computed tomography revealed an inhomogeneous,9-cm mass in the right adrenal gland,and [111In-DTPA0] octreotide scintigraphy showed an abnormal uptake of the radiotracer in the right perirenal region,corresponding to the adrenal mass.The patient underwent laparoscopic surgery and formalin-fixed and paraffin embedded samples were studied. The tumour was extensively characterized by immunohistochemistry and somatostatin receptor (SSTRs) subtypes expression was analyzed.Histological and immunohistochemical examination of the surgical specimens displayed a typical pheochromocytoma,which was found to be immunoreative to S-100, chromogranin A and neurofilaments. Immunostaining for SSTR subtypes showed a positive reaction for SSTR1, SSTR2A, SSTR2B, antisera on tumour cells. The intense and diffuse immunostaining for corticotropin releasing hormone (CRH) antiserum indicated that Cushing's disease was dependent on CRH overproduction by the pheochromocytoma,in which no immunostaining for adrenocorticotropic hormone was found. Our report confirms the heterogeneity of the pattern of SSTR expression in pheochromocytomas,and provide further evidence for functional SSTR subtype SSTR2a in a subgroup of pheochromocytomas,suggesting that these tumours may represent potential target for octreotide treatment.

Effects of tissue fixation conditions and protease pretreatment on immunohistochemical performance of a large series of new anti-keratin monoclonal antibodies: value in oncopathology.

PubMed

Bártková, J; Bártek, J; Lukás, Z; Vojtĕsek, B; Stasková, Z; Bursová, H; Pavlovská, R; Rejthar, A; Kovarík, J

1991-01-01

A comparative study with 21 recently raised monoclonal antibodies (3 of which are reported here for the first time) to human keratin polypeptides was performed on a wide range of paraffin-embedded tissues and tumors, aimed at the examination of effects of four different fixatives and protease pretreatment on the immunohistochemical detection of keratins. Our data demonstrated that: (a) formaldehyde-based fixatives modified by acidification and/or addition of methanol gave results superior to those achieved by routinely used formol saline; (b) relatively rare antibodies (4 out of 21) could be identified which gave reliable immunostaining patterns even on routine formalin-fixed material; (c) a proteolytic digestion step preceding the immunostaining was beneficial for the performance of the majority of antibodies in our panel. Additional options which could potentially lead to further improvement of keratin immunohistochemistry in paraffin embedded specimens are also suggested. This work provides the necessary basis for wider application of the anti-keratin antibodies of the C-series in both routine oncopathology and research-oriented retrospective studies.

Role of Nuclear Matrix in Estrogen Regulated Gene Expression in Human Breast Cancer Cells

DTIC Science & Technology

1998-08-01

reticular pattern evenly distributed throughout the nucleus, excluding the nucleolus (Figure 4A). This is not so for T47D cells where a composite pattern...acetylation is required to maintain the unfolded nucleosome structure associated with transcribing DNA. Journal of Biological Chemistry 273:14516...nuclear matrix include ER, YY1, AML-1, Spl, Oct1, mutant p53, and Rb [25,28,31,34-40]. Appendix A, part 4 reviews alterations in nuclear matrix composition

Small cell and large cell neuroendocrine carcinomas of the pancreas are genetically similar and distinct from well-differentiated pancreatic neuroendocrine tumors.

PubMed

Yachida, Shinichi; Vakiani, Efsevia; White, Catherine M; Zhong, Yi; Saunders, Tyler; Morgan, Richard; de Wilde, Roeland F; Maitra, Anirban; Hicks, Jessica; Demarzo, Angelo M; Shi, Chanjuan; Sharma, Rajni; Laheru, Daniel; Edil, Barish H; Wolfgang, Christopher L; Schulick, Richard D; Hruban, Ralph H; Tang, Laura H; Klimstra, David S; Iacobuzio-Donahue, Christine A

2012-02-01

Poorly differentiated neuroendocrine carcinomas (NECs) of the pancreas are rare malignant neoplasms with a poor prognosis. The aim of this study was to determine the clinicopathologic and genetic features of poorly differentiated NECs and compare them with other types of pancreatic neoplasms. We investigated alterations of KRAS, CDKN2A/p16, TP53, SMAD4/DPC4, DAXX, ATRX, PTEN, Bcl2, and RB1 by immunohistochemistry and/or targeted exomic sequencing in surgically resected specimens of 9 small cell NECs, 10 large cell NECs, and 11 well-differentiated neuroendocrine tumors (PanNETs) of the pancreas. Abnormal immunolabeling patterns of p53 and Rb were frequent (p53, 18 of 19, 95%; Rb, 14 of 19, 74%) in both small cell and large cell NECs, whereas Smad4/Dpc4, DAXX, and ATRX labeling was intact in virtually all of these same carcinomas. Abnormal immunolabeling of p53 and Rb proteins correlated with intragenic mutations in the TP53 and RB1 genes. In contrast, DAXX and ATRX labeling was lost in 45% of PanNETs, whereas p53 and Rb immunolabeling was intact in these same cases. Overexpression of Bcl-2 protein was observed in all 9 small cell NECs (100%) and in 5 of 10 (50%) large cell NECs compared with only 2 of 11 (18%) PanNETs. Bcl-2 overexpression was significantly correlated with higher mitotic rate and Ki67 labeling index in neoplasms in which it was present. Small cell NECs are genetically similar to large cell NECs, and these genetic changes are distinct from those reported in PanNETs. The finding of Bcl-2 overexpression in poorly differentiated NECs, particularly small cell NEC, suggests that Bcl-2 antagonists/inhibitors may be a viable treatment option for these patients.

Expression of the pituitary tumor transforming gene (PTTG1) in pheochromocytoma as a potential marker for distinguishing benign versus malignant tumors.

PubMed

Haji Amousha, Mohamad Reza; Sabetkish, Nastaran; Sabet Kish, Nastaran; Heshmat, Ramin; Rajabiani, Afsaneh; Saffar, Hiva; Haghpanah, Vahid; Tavangar, Seyed Mohammad

2015-01-01

The Distinction between malignant and benign pheochromocytoma has always been a diagnostic challenge over the last decades. To date, the only reliable criterion is metastasis. The aim of the present study was to investigate the possible expression of pituitary-tumor transforming gene (PTTG1) and retinoblastoma (Rb) in benign and malignant pheochromocytoma. Paraffin blocks of 44 and 11 patients diagnosed with benign and malignant pheochromocytoma were collected. Parameters such as sex, age, tumor size, necrosis, and histological features were compared between the benign and malignant groups as well as immunohistochemical labeling using specific antibodies. PTTG1 showed negative expression in all (44) benign and 9 out of 11 (81.8%) malignant tumors with only 2 out of 11 (18.2%) malignant tumors showed positive reactivity for PTTG1 (P: 0.037) with spindle cell histological pattern in both of them (P: 0.013). Although Rb expression in malignant tumors (81.8%) was slightly more than the benign ones (52.3%), no statistically significant correlation was observed (P: 0.087). These results suggest that PTTG1 immunostaining may play a key role in distinguishing between benign and malignant phaeochromocytoma. However, larger studies are necessary to confirm the outcomes of the present study.

Dynamics of buckbrush populations under simulated forest restoration alternatives (P-53)

Treesearch

David W. Huffman; Margaret M. Moore

2008-01-01

Plant population models are valuable tools for assessing ecological tradeoffs between forest management approaches. In addition, these models can provide insight on plant life history patterns and processes important for persistence and recovery of populations in changing environments. In this study, we evaluated a set of ecological restoration alternatives for their...

Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

PubMed Central

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

2014-01-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

Role of the Mdm2 SNIP 309 Polymorphism in Gastric Mucosal Morphologic Patterns of Patients with Helicobacter pylori Associated Gastritis.

PubMed

Tongtawee, Taweesak; Dechsukhum, Chavaboon; Leeanansaksiri, Wilairat; Kaewpitoon, Soraya; Kaewpitoon, Natthawut; Loyd, Ryan A; Matrakool, Likit; Panpimanmas, Sukij

2016-01-01

The tumor suppressor p53 is as a regulator of cell proliferation, apoptosis and many other biological processes as well as external and internal stress responses. Mdm2 SNIP309 is a negative regulator of 53. Therefore, this study aimed to determine the role of the Mdm2 SNIP 309 polymorphism in the gastric mucosal morphological patterns in patients with Helicobacter pylori associated gastritis. A prospective cross-sectional study was carried out from November 2014 through November 2015. Biopsy specimens were obtained from patients and infection was proven by positive histology. Gastric mucosa specimens were sent to the Molecular Genetics Unit, Institute of Medicine, Suranaree University of Technology where they were tested by molecular methods to detect the patterns of Mdm2 SNIP 309 polymorphism using the real-time PCR hybridization probe method. The results were analyzed and correlated with gastric mucosal morphological patterns by using C-NBI endoscopy. A total of 300 infected patients were enrolled and gastric mucosa specimens were collected. In this study the percentage of Mdm2 SNIP 309 T/T homozygous and Mdm2 SNIP309 G/T heterozygous was 78% and 19 % respectively whereas Mdm2 SNIP309 G/G homozygous was 3%. Mdm2 SNIP 309 T/T homozygous and Mdm2 SNIP309 G/T heterozygosity correlated with type 1 to type 3 gastric mucosal morphological patterns (P<0.01) whereas Mdm2 SNIP309 G/G homozygous correlated with type 4 and type 5 (P<0.01). Our study finds the frequency of Mdm2 SNIP309 G/G in a Thai population is very low, and suggests that this can explain ae Thailand enigma. Types 1 to type 3 are the most common gastric mucosal morphological patterns according to the unique genetic polymorphism of MDM2 SNIP 309 in the Thai population.

Expression of motility-related molecule Cdc42 in endometrial tissue in women with adenomyosis and ovarian endometriomata.

PubMed

Goteri, Gaia; Ciavattini, Andrea; Lucarini, Guendalina; Montik, Nina; Filosa, Alessandra; Stramazzotti, Daniela; Biagini, Graziella; Tranquilli, Andrea Luigi

2006-09-01

To evaluate Cdc42 expression in eutopic and ectopic endometrial tissue in patients with adenomyosis and ovarian endometriotic cysts compared with patients without endometriosis. Experimental retrospective study. University hospital. Twenty-four patients with adenomyosis, 19 with ovarian endometriomata, and 9 with fibroids or benign ovarian cysts. Hysterectomy and bilateral oophorectomy. Immunostaining for Cdc42 of eutopic and ectopic endometrial tissues. In eutopic endometrium of patients with adenomyosis and with fibroids or benign ovarian cysts, the intensity of Cdc42 immunostaining was weaker, especially in the specialized stromal cells, compared with cases with ovarian endometriosis (chi(2) test, P=.003). Expression of Cdc42 in eutopic endometrium showed a trend to be higher in the secretory than in the proliferative phase and in patients with ovarian endometriotic cysts compared with patients with adenomyosis (unpaired t test, P=.005), especially in the proliferative phase. An abnormally high expression of Cdc42 in eutopic endometrium in the secretory phase may contribute to the development of ovarian endometriosis, but it does not seem to be involved in the pathogenesis of adenomyosis.

Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

PubMed

Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

2010-11-01

Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

The unique luminal staining pattern of cytokeratin 5/6 in adenoid cystic carcinoma of the breast may aid in differentiating it from its mimickers.

PubMed

Nakai, Tokiko; Ichihara, Shu; Kada, Akiko; Ito, Noriko; Moritani, Suzuko; Kawasaki, Tomonori; Uchiyama, Tomoko; Itami, Hiroe; Morita, Kouhei; Takano, Masato; Takeda, Maiko; Hatakeyama, Kinta; Ohbayashi, Chiho

2016-08-01

Adenoid cystic carcinoma (AdCC) of the breast is an uncommon but distinct neoplasm composed of a dual cell population polarized around true glandular (luminal) spaces and pseudolumina. The aim of this study was to clarify whether various immunohistochemical markers (CK7, EMA, CD117, p63, calponin, CD10, S100, CK5/6, CK14, vimentin, and type IV collagen) can distinguish between the two cell types in classical AdCC (n = 14) and in collagenous spherulosis (n = 5). The sensitivity and specificity of these 11 markers to distinguish luminal from abluminal cells were evaluated using a curve created by plotting the true-positive rate (sensitivity) against the false-positive rate (1 - specificity) at threshold settings of 0, 10, 50, and 70 %. The most sensitive and specific markers for luminal cells in AdCC were CK7 and EMA; those for abluminal cells were type IV collagen, p63, and vimentin. CD10 and S100 did not act as abluminal markers in AdCC. CK5/6, one of the basal/myoepithelial markers, was expressed more frequently in luminal than in abluminal cells of AdCC. Thus, CK5/6 immunostaining resulted in a reverse expression pattern, analogous to what we recently documented in clear cells in mammary adenomyoepithelioma. In conclusion, compared with myoepithelial/abluminal cells of normal breast or collagenous spherulosis, the neoplastic abluminal cells of classical AdCC are characterized by enhanced vimentin and attenuated CD10 and S100. Furthermore, the luminal cells of AdCC show a unique aberrant staining pattern for CK5/6 that may aid in the differential diagnosis.

A case report of CIC-rearranged undifferentiated small round cell sarcoma in the cerebrum.

PubMed

Ito, Mayumi; Ishikawa, Misawo; Kitajima, Masateru; Narita, Jun; Hattori, Shinya; Endo, Otone; Goto, Keisuke

2016-10-01

CIC-rearranged undifferentiated small round cell sarcoma (CIC-rearranged USRCS) is a recently established type of Ewing-like small round cell sarcomas, characterized by CIC gene rearrangement, most commonly CIC-DUX4 fusion. This report presents the second case of CIC-rearranged USRCS arising primarily in the cerebrum. A 64-year-old otherwise healthy woman presented with a 1 × 1 cm sized hemorrhagic subcortical tumor in the left temporo-parietal lobe. The tumor repeatedly recurred, and the patient underwent three surgeries, chemotherapy with doxorubicin and ifosfamide, and radiotherapy, as well as gamma knife surgery. Systemic examination revealed no other extracranial masses. Imprint cytology revealed small to moderate-sized round-to-ovoid tumor cells with mild pleomorphism and variations in size and shape. The nuclei contained finely granular chromatin, and some had easily-recognizable nucleoli. The tumor exhibited a mainly cytoplasmic pattern of CD99 immunostaining, rather than a diffuse membranous pattern. The tumor also exhibited diffuse positivity for calretinin and p16, as well as partial positivity for WT1 (nuclear and cytoplasmic staining pattern) and D2-40. FISH assessment showed CIC split signals. In conclusion, CIC-rearranged USRCSs can occur primarily in the cerebrum. It would be impossible to diagnose them through cytology alone, but cytology would be useful to rule out other small round cell brain tumors including gliomas, lymphomas, carcinomas, and germinoma. Immunohistochemical analysis including tests for CD99, calretinin, and WT1 would help to suggest CIC-rearranged USRCSs and distinguish them from Ewing sarcomas. Additionally, immunohistochemistry for p16 might be useful in the diagnosis. Diagn. Cytopathol. 2016;44:828-832. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Dietary Patterns and Body Mass Index in Children with Autism and Typically Developing Children

PubMed Central

Evans, E. Whitney; Must, Aviva; Anderson, Sarah E.; Curtin, Carol; Scampini, Renee; Maslin, Melissa; Bandini, Linda

2012-01-01

To determine whether dietary patterns (juice and sweetened non-dairy beverages, fruits, vegetables, fruits & vegetables, snack foods, and kid’s meals) and associations between dietary patterns and body mass index (BMI) differed between 53 children with autism spectrum disorders (ASD) and 58 typically developing children, ages 3 to 11, multivariate regression models including interaction terms were used. Children with ASD were found to consume significantly more daily servings of sweetened beverages (2.6 versus 1.7, p=0.03) and snack foods (4.0 versus 3.0, p=0.01) and significantly fewer daily servings of fruits and vegetables (3.1 versus 4.4, p=0.006) than typically developing children. There was no evidence of statistical interaction between any of the dietary patterns and BMI z-score with autism status. Among all children, fruits and vegetables (p=0.004) and fruits alone (p=0.005) were positively associated with BMI z-score in our multivariate models. Children with ASD consume more energy-dense foods than typically developing children; however, in our sample, only fruits and vegetables were positively associated with BMI z-score. PMID:22936951

Detection of inflamed atherosclerotic lesions with diadenosine-5′,5‴-P1,P4-tetraphosphate (Ap4A) and positron-emission tomography

PubMed Central

Elmaleh, D. R.; Fischman, A. J.; Tawakol, A.; Zhu, A.; Shoup, T. M.; Hoffmann, U.; Brownell, A.-L.; Zamecnik, P. C.

2006-01-01

Diadenosine-5′,5‴-P1,P4-tetraphosphate (Ap4A) and its analog P2,P3-monochloromethylene diadenosine-5′,5‴-P1,P4-tetraphosphate (AppCHClppA) are competitive inhibitors of adenosine diphosphate-induced platelet aggregation, which plays a central role in arterial thrombosis and plaque formation. In this study, we evaluate the imaging capabilities of positron-emission tomography (PET) with P2,P3-[18F]monofluoromethylene diadenosine-5′,5‴-P1,P4-tetraphosphate ([18F]AppCHFppA) to detect atherosclerotic lesions in male New Zealand White rabbits. Three to six months after balloon injury to the aorta, the rabbits were injected with [18F]AppCHFppA, and microPET imaging showed rapid accumulation of this radiopharmaceutical in the atherosclerotic abdominal aorta, with lesions clearly visible 30 min after injection. Computed tomographic images were coregistered with PET images to improve delineation of aortoiliac tracer activity. Plaque macrophage density, quantified by immunostaining with RAM11 against rabbit macrophages, correlated with PET measurements of [18F]AppCHFppA uptake (r = 0.87, P < 0.0001), whereas smooth-muscle cell density, quantified by immunostaining with 1A4 against smooth muscle actin, did not. Biodistribution studies of [18F]AppCHFppA in normal rats indicated typical adenosine dinucleotide behavior with insignificant myocardial uptake and fast kidney clearance. The accumulation of [18F]AppCHFppA in macrophage-rich atherosclerotic plaques can be quantified noninvasively with PET. Hence, [18F]AppCHFppA holds promise for the noninvasive characterization of vascular inflammation. PMID:17038498

Hematoxylin and Eosin Counterstaining Protocol for Immunohistochemistry Interpretation and Diagnosis.

PubMed

Grosset, Andrée-Anne; Loayza-Vega, Kevin; Adam-Granger, Éloïse; Birlea, Mirela; Gilks, Blake; Nguyen, Bich; Soucy, Geneviève; Tran-Thanh, Danh; Albadine, Roula; Trudel, Dominique

2017-12-21

Hematoxylin and eosin (H&E) staining is a well-established technique in histopathology. However, immunohistochemistry (IHC) interpretation is done exclusively with hematoxylin counterstaining. Our goal was to investigate the potential of H&E as counterstaining (H&E-IHC) to allow for visualization of a marker while confirming the diagnosis on the same slide. The quality of immunostaining and the fast-technical performance were the main criteria to select the final protocol. We stained multiple diagnostic tissues with class I IHC tests with different subcellular localization markers (anti-CK7, CK20, synaptophysin, CD20, HMB45, and Ki-67) and with double-staining on prostate tissues with anti-high molecular weight keratins/p63 (DAB detection) and p504s (alkaline phosphatase detection). To validate the efficacy of the counterstaining, we stained tissue microarrays from the Canadian Immunohistochemistry Quality Control (cIQc) with class II IHC tests (ER, PR, HER2, and p53 markers). Interobserver and intraobserver concordance was assessed by κ statistics. Excellent agreement of H&E-IHC interpretation was observed in comparison with standard IHC from our laboratory (κ, 0.87 to 1.00), and with the cIQc reference values (κ, 0.81 to 1.00). Interobserver and intraobserver agreement was excellent (κ, 0.89 to 1.00 and 0.87 to 1.00, respectively). We therefore show for the first time the potential of using H&E counterstaining for IHC interpretation. We recommend the H&E-IHC protocol to enhance diagnostic precision for the clinical workflow and research studies.

Mechanisms for ribotoxin-induced ribosomal RNA cleavage

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Kaiyu; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Zhou, Hui-Ren

The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activatedmore » kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via activation of p53, caspases and cathepsins. ► DON- and anisomycin-triggered rRNA cleavage is p38-dependent. ► SG- and ricin-induced rRNA cleavage is p38-independent.« less

Contrasting plasma free amino acid patterns in elite athletes: association with fatigue and infection

PubMed Central

Kingsbury, K. J.; Kay, L.; Hjelm, M.

1998-01-01

AIM: There is little information on the plasma free amino acid patterns of elite athletes against which fatigue and nutrition can be considered. Therefore the aim was to include analysis of this pattern in the medical screening of elite athletes during both especially intense and light training periods. METHODS: Plasma amino acid analysis was undertaken in three situations. (1) A medical screening service was offered to elite athletes during an intense training period before the 1992 Olympics. Screening included a blood haematological/biochemical profile and a microbial screen in athletes who presented with infection. The athletes were divided into three groups who differed in training fatigue and were considered separately. Group A (21 track and field athletes) had no lasting fatigue; group B (12 judo competitors) reported heavy fatigue at night but recovered overnight to continue training; group C (18 track and field athletes, one rower) had chronic fatigue and had been unable to train normally for at least several weeks. (2) Athletes from each group were further screened during a post- Olympic light training period. (3) Athletes who still had low amino acid levels during the light training period were reanalysed after three weeks of additional protein intake. RESULTS: (1) The pre-Olympics amino acid patterns were as follows. Group A had a normal amino acid pattern (glutamine 554 (25.2) micromol/l, histidine 79 (6.1) micromol/l, total amino acids 2839 (92.1) micromol/l); all results are means (SEM). By comparison, both groups B and C had decreased plasma glutamine (average 33%; p<0.001) with, especially in group B, decreased histidine, glucogenic, ketogenic, and branched chain amino acids (p<0.05 to p<0.001). None in group A, one in group B, but ten athletes in group C presented with infection: all 11 athletes had plasma glutamine levels of less than 450 micromol/l. No intergroup differences in haematological or other blood biochemical parameters, apart from a lower plasma creatine kinase activity in group C than in group B (p<0.05) and a low neutrophil to lymphocyte ratio in the athletes with viral infections (1.2 (0.17)), were found. (2) During post-Olympic light training, group A showed no significant amino acid changes. In contrast, group B recovered normal amino acid levels (glutamine 528 (41.4) micromol/l, histidine 76 (5.3) micromol/l, and total amino acids 2772 (165) micromol/l) (p<0.05 to p<0.001) to give a pattern comparable with that of group A, whereas, in group C, valine and threonine had increased (p<0.05), but glutamine (441 (24.5) micromol/l) and histidine (58 (5.3) micromol/l) remained low. Thus none in group A, two in group B, but ten (53%) in group C still had plasma glutamine levels below 450 micromol/l, including eight of the 11 athletes who had presented with infection. (3) With the additional protein intake, virtually all persisting low glutamine levels increased to above 500 micromol/l. Plasma glutamine rose to 592 (35.1) micromol/l and histidine to 86 (6.0) micromol/l. Total amino acids increased to 2761 (128) micromol/l (p<0.05 to p<0.001) and the amino acid pattern normalised. Six of the ten athletes on this protein intake returned to increased training within the three weeks. CONCLUSION: Analysis of these results provided contrasting plasma amino acid patterns: (a) a normal pattern in those without lasting fatigue; (b) marked but temporary changes in those with acute fatigue; (c) a persistent decrease in plasma amino acids, mainly glutamine, in those with chronic fatigue and infection, for which an inadequate protein intake appeared to be a factor. 


 PMID:9562160

Targeted p120-catenin ablation disrupts dental enamel development.

PubMed

Bartlett, John D; Dobeck, Justine M; Tye, Coralee E; Perez-Moreno, Mirna; Stokes, Nicole; Reynolds, Albert B; Fuchs, Elaine; Skobe, Ziedonis

2010-09-16

Dental enamel development occurs in stages. The ameloblast cell layer is adjacent to, and is responsible for, enamel formation. When rodent pre-ameloblasts become tall columnar secretory-stage ameloblasts, they secrete enamel matrix proteins, and the ameloblasts start moving in rows that slide by one another. This movement is necessary to form the characteristic decussating enamel prism pattern. Thus, a dynamic system of intercellular interactions is required for proper enamel development. Cadherins are components of the adherens junction (AJ), and they span the cell membrane to mediate attachment to adjacent cells. p120 stabilizes cadherins by preventing their internalization and degradation. So, we asked if p120-mediated cadherin stability is important for dental enamel formation. Targeted p120 ablation in the mouse enamel organ had a striking effect. Secretory stage ameloblasts detached from surrounding tissues, lost polarity, flattened, and ameloblast E- and N-cadherin expression became undetectable by immunostaining. The enamel itself was poorly mineralized and appeared to be composed of a thin layer of merged spheres that abraded from the tooth. Significantly, p120 mosaic mouse teeth were capable of forming normal enamel demonstrating that the enamel defects were not a secondary effect of p120 ablation. Surprisingly, blood-filled sinusoids developed in random locations around the developing teeth. This has not been observed in other p120-ablated tissues and may be due to altered p120-mediated cell signaling. These data reveal a critical role for p120 in tooth and dental enamel development and are consistent with p120 directing the attachment and detachment of the secretory stage ameloblasts as they move in rows.

Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

PubMed Central

Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

2000-01-01

p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

PubMed

Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

2013-04-16

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy

PubMed Central

Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.

2013-01-01

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

PubMed

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

2014-07-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

Spiral ligament and stria vascularis changes in cochlear otosclerosis: effect on hearing level.

PubMed

Doherty, Joni K; Linthicum, Fred H

2004-07-01

To investigate the effect of changes within the spiral ligament and stria vascularis on hearing in cochlear otosclerosis, we examined spiral ligament hyalinization, stria vascularis atrophy, and sensory hearing loss in cochlear otosclerosis and described changes in ion transport molecule expression. Retrospective. Tertiary referral center. Thirty-two cochleae from 24 temporal bone donors with histologic evidence of cochlear otosclerosis, including spiral ligament hyalinization. Audiography. Measurements of spiral ligament width, stria vascularis, and bone-conduction thresholds were compared by the amount of hyalinization. Expression of the ion transport molecules Na,K-ATPase, connexin 26, and carbonic anhydrase II were assessed by immunohistochemical techniques. Hyalinization most often involved the posterior basal turn (88%) and the posterior middle turn (27%). Spiral ligament hyalinization correlated significantly with stria vascularis atrophy in the posterior middle turn of the cochlea (rho = -0.63, p < 0.01). There was a trend toward a significant association in the posterior basal turn (rho = -0.31, p < 0.08). Bone-conduction thresholds at 2,000 and 4,000 Hz were significantly associated with the amount of stria vascularis atrophy (rho = -0.44, -0.40, p < 0.05). In addition, we observed decreased immunostaining for both carbonic anhydrase II with Type I fibrocytes and Na,K-ATPase with stria vascularis and Type II and Type IV fibrocytes of the spiral ligament in cochlear otosclerosis sections compared with normal cochlea. Na,K-ATPase staining within the stria vascularis was further decreased in the presence of spiral ligament hyalinization. No significant differences were seen with connexin 26 immunostaining. However, immunostaining results were somewhat inconsistent. These data suggest that spiral ligament structure and function are essential for stria vascularis survival. In addition, dampened expression of ion transport molecules within the spiral ligament and stria vascularis may disrupt potassium ion recycling, resulting in loss of endocochlear potential and sensory hearing loss.

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

PubMed Central

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-01-01

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

PubMed

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

Heterogeneous distribution of P53 immunoreactivity in human lung adenocarcinoma correlates with MDM2 protein expression, rather than with P53 gene mutation.

PubMed

Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K

2001-07-20

Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.

Shared and Distinct Patterns of Oligodendroglial Response in α-Synucleinopathies and Tauopathies.

PubMed

Rohan, Zdenek; Milenkovic, Ivan; Lutz, Mirjam I; Matej, Radoslav; Kovacs, Gabor G

2016-12-01

Pathological protein deposits in oligodendroglia are common but variable features of various neurodegenerative conditions. To evaluate oligodendrocyte response in neurodegenerative diseases (NDDs) with different extents of oligodendroglial protein deposition we performed immunostaining for tubulin polymerization-promoting protein p25α (TPPP/p25α), α-synuclein (α-syn), phospho-tau, ubiquitin, myelin basic protein, and the microglial marker HLA-DR. We investigated cases of multiple system atrophy ([MSA] n = 10), Lewy body disease ([LBD] n = 10), globular glial tauopathy ([GGT] n = 7) and progressive supranuclear palsy ([PSP] n = 10). Loss of nuclear TPPP/p25α immunoreactivity correlated significantly with the degree of microglial reaction and loss of myelin basic prtein density as a marker of tract degeneration. This was more prominent in MSA and GGT, which, together with enlarged cytoplasmic TPPP/p25α immunoreactivity and inclusion burden allowed these disorders to be grouped as predominant oligodendroglial proteinopathies. However, distinct features, ie more colocalization of α-syn than tau with TPPP/p25α, more obvious loss of oligodendrocyte density in MSA, but more prominent association of tau protein inclusions in GGT to loss of nuclear TPPP/p25α immunoreactivity, were also recognized. In addition, we observed previously underappreciated oligodendroglial α-synuclein pathology in the pallidothalamic tract in LBD. Our study demonstrates common and distinct aspects of oligodendroglial involvement in the pathogenesis of diverse NDDs. © 2016 American Association of Neuropathologists, Inc. All rights reserved.

Best practices recommendations in the application of immunohistochemistry in testicular tumors: report from the International Society of Urological Pathology consensus conference.

PubMed

Ulbright, Thomas M; Tickoo, Satish K; Berney, Daniel M; Srigley, John R

2014-08-01

The judicious use of immunostains can be of significant diagnostic assistance in the interpretation of testicular neoplasms when the light microscopic features are ambiguous. A limited differential diagnosis by traditional morphology is required for the effective use of immunohistochemistry (IHC); otherwise, the inevitable occurrence of exceptions to anticipated patterns will lead to "immunoconfusion." The diagnosis of tumors in the germ cell lineage, the great majority of primary tumors of the testis, has been considerably facilitated over the past decade by IHC directed at developmentally important nuclear transcription factors, including OCT4, SALL4, SOX2, and SOX17, that are mostly restricted to certain tumor histotypes. In conjunction with other markers, a specific diagnosis can be achieved in most instances through a panel of 3 or 4 immunostains and often fewer. IHC among tumors in the sex cord-stromal group may produce a significant proportion of false-negative cases until more sensitive and equally specific markers are validated. The negativity of these tumors for the IHC stains used for germ cell tumors is key in the important distinction of neoplasms in these 2 general categories. In this review, the International Society of Urological Pathologists (ISUP) provides diagnostic guidelines in the form of algorithms to assist practicing pathologists confronting a differential diagnostic question concerning a testicular neoplasm. The goal of ISUP is to anticipate commonly encountered differential diagnoses and recommend an efficient and limited pattern of IHC stains to resolve the question.

Using oligonucleotide aptamer probes for immunostaining of formalin-fixed and paraffin-embedded tissues

PubMed Central

Zeng, Zihua; Zhang, Peng; Zhao, Nianxi; Sheehan, Andrea M; Tung, Ching-Hsuan; Chang, Chung-Che; Zu, Youli

2011-01-01

For tissue immunostaining, antibodies are currently the only clinically validated and commercially available probes. Aptamers, which belong to a class of small molecule ligands composed of short single-stranded oligonucleotides, have emerged as probes over the last several decades; however, their potential clinical value has not yet been fully explored. Using cultured cells and an RNA-based CD30 aptamer, we recently demonstrated that the synthetic aptamer is useful as a specific probe for flow cytometric detection of CD30-expressing lymphoma cells. In this study, we further validated the use of this aptamer probe for immunostaining of formalin-fixed and paraffin-embedded lymphoma tissues. Using CD30 antibody as a standard control, we demonstrated that the synthetic CD30 aptamer specifically recognized and immunostained tumor cells of classical Hodgkin lymphoma and anaplastic large cell lymphoma, but did not react with background cells within tumor sites. Notably, the CD30 aptamer probe optimally immunostained lymphoma cells with lower temperature antigen retrieval (37 vs 96°C for antibody) and shorter probing reaction times (20 vs 90 min for antibody) than typical antibody immunostaining protocols. In addition, the CD30 aptamer probe showed no nonspecific background staining of cell debris in necrotic tissue and exhibited no cross-reaction to tissues that do not express CD30, as confirmed by a standard CD30 antibody staining. Therefore, our findings indicate that the synthetic oligonucleotide CD30 aptamer can be used as a probe for immunostaining of fixed tissue sections for disease diagnosis. PMID:20693984

TRIM25 has a dual function in the p53/Mdm2 circuit.

PubMed

Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

2015-11-12

P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

Serum p53 antibody as a potential tumor marker in extrahepatic cholangiocarcinoma.

PubMed

Okada, Rei; Shimada, Hideaki; Otsuka, Yuichiro; Tsuchiya, Masaru; Ishii, Jun; Katagiri, Toshio; Maeda, Tetsuya; Kubota, Yoshihisa; Nemoto, Tetsuo; Kaneko, Hironori

2017-12-01

Only a few studies have evaluated the clinicopathological significance of the p53 protein expression and s-p53-Abs level in patients with cholangiocarcinoma. We therefore analyzed the clinicopathological and prognostic significance of s-p53-Abs in patients with extrahepatic cholangiocarcinoma. We prospectively evaluated s-p53-Abs levels before and after surgery in 61 patients with extrahepatic cholangiocarcinoma to determine the relationship between clinicopathological factors and the prognostic significance of s-p53-Abs. Among a total of 61 primary extrahepatic cholangiocarcinoma cases, 23% were positive for s-p53-Abs. Combination of s-p53-Abs with the conventional serum markers carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) significantly increased the rate of positive extrahepatic cholangiocarcinoma cases (57% for CEA and/or CA19-9 vs. 75% for CEA and/or CA19-9 and/or s-p53-Abs, P = 0.035). There were no significant differences in clinicopathological factors between the p53-seropositive and p53-seronegative patients. An immunohistochemical analysis showed the presence of significant associations between the intensity (P = 0.003) and extent (P = 0.001) of p53 immunoreactivity and p53-seropositivitly. Although s-p53-Abs was not a significant prognostic factor for the survival in either univariate or multivariate analyses, p53 immunoreactivity was independently associated with a poor survival. Among patients positive for s-p53-Abs before surgery, the s-p53-Abs levels were reduced after surgery in most. These findings suggested that s-p53-Abs might be associated with p53 immunoreactivity. In addition, s-p53-Abs may be useful for a diagnosis, but was not useful for predicting tumor recurrence or the survival. This study was registered as UMIN000014530.

The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

PubMed Central

2010-01-01

Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

Morphometric evaluation of oesophageal wall in patients with nutcracker oesophagus and ineffective oesophageal motility.

PubMed

Kim, H S; Park, H; Lim, J H; Choi, S H; Park, C; Lee, S I; Conklin, J L

2008-08-01

The pathogenesis of nutcracker oesophagus (NE) and ineffective oesophageal motility (IEM) is unclear. Damage to the enteric nervous system or smooth muscle can cause oesophageal dysmotility. We tested the hypothesis that NE and IEM are associated with abnormal muscular or neural constituents of the oesophageal wall. Oesophageal manometry was performed in patients prior to total gastrectomy for gastric cancer. The oesophageal manometries were categorized as normal (n = 7), NE (n = 13), or IEM (n = 5). Histologic examination of oesophageal tissue obtained during surgery was performed after haematoxylin and eosin (H&E) and trichrome staining. Oesophageal innervation was examined after immunostaining for protein gene product-9.5 (PGP-9.5), choline acetyltransferase (ChAT) and neuronal nitric oxide synthase (nNOS). There were no significant differences in inner circular smooth muscle thickness or degree of fibrosis among the three groups. Severe muscle fibre loss was found in four of five patients with IEM. The density of PGP-9.5-reactive neural structures was not different among the three groups. The density of ChAT immunostaining in the myenteric plexus (MP) was significantly greater in patients with NE (P < 0.05) and the density of nNOS immunostaining in the circular muscle (CM) was significantly greater in IEM patients (P < 0.05). The ChAT/nNOS ratio in both MP and CM was significantly greater in NE patients. NE may result from an imbalance between the excitatory and inhibitory innervation of the oesophagus, because more than normal numbers of ChAT-positive myenteric neurones are seen in NE. Myopathy and/or increased number of nNOS neurones may contribute to the hypocontractile motor activity of IEM.

Mammary-specific inactivation of E-cadherin and p53 impairs functional gland development and leads to pleomorphic invasive lobular carcinoma in mice.

PubMed

Derksen, Patrick W B; Braumuller, Tanya M; van der Burg, Eline; Hornsveld, Marten; Mesman, Elly; Wesseling, Jelle; Krimpenfort, Paul; Jonkers, Jos

2011-05-01

Breast cancer is the most common malignancy in women of the Western world. Even though a large percentage of breast cancer patients show pathological complete remission after standard treatment regimes, approximately 30-40% are non-responsive and ultimately develop metastatic disease. To generate a good preclinical model of invasive breast cancer, we have taken a tissue-specific approach to somatically inactivate p53 and E-cadherin, the cardinal cell-cell adhesion receptor that is strongly associated with tumor invasiveness. In breast cancer, E-cadherin is found mutated or otherwise functionally silenced in invasive lobular carcinoma (ILC), which accounts for 10-15% of all breast cancers. We show that mammary-specific stochastic inactivation of conditional E-cadherin and p53 results in impaired mammary gland function during pregnancy through the induction of anoikis resistance of mammary epithelium, resulting in loss of epithelial organization and a dysfunctional mammary gland. Moreover, combined inactivation of E-cadherin and p53 induced lactation-independent development of invasive and metastatic mammary carcinomas, which showed strong resemblance to human pleomorphic ILC. Dissemination patterns of mouse ILC mimic the human malignancy, showing metastasis to the gastrointestinal tract, peritoneum, lung, lymph nodes and bone. Our results confirm that loss of E-cadherin contributes to both mammary tumor initiation and metastasis, and establish a preclinical mouse model of human ILC that can be used for the development of novel intervention strategies to treat invasive breast cancer.

A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

PubMed Central

Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

2016-01-01

p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

Ovarian transitional cell carcinoma represents a poorly differentiated form of high-grade serous or endometrioid adenocarcinoma.

PubMed

Takeuchi, Tadahisa; Ohishi, Yoshihiro; Imamura, Hiroko; Aman, Murasaki; Shida, Kaai; Kobayashi, Hiroaki; Kato, Kiyoko; Oda, Yoshinao

2013-07-01

Ovarian transitional cell tumors include Brenner tumors (BTs) and transitional cell carcinoma (TCC; non-BTs) according to the most recent World Health Organization classification. However, it remains a matter of debate whether TCC represents a distinct entity or a morphologic variant of high-grade serous adenocarcinoma (HG-SC). The purpose of this study was to resolve the above question by clarifying the morphologic, immunohistochemical, and molecular features of TCC. We reviewed 488 cases of epithelial ovarian carcinomas and reclassified them on the basis of the most recent World Health Organization classification with the modifications proposed by Köbel and colleagues, and 35 cases of TCC were identified; 25 and 6 TCCs were admixed with HG-SC and endometrioid adenocarcinoma (EC), respectively, and the remaining 4 cases were pure TCC. TCC components were not observed in any clear cell carcinomas or mucinous adenocarcinomas. Only 2 cases of malignant BT were identified. In addition to TCCs, malignant BTs, and related adenocarcinomas, benign and borderline BTs were included in the following immunohistochemical and molecular analyses. Immunohistochemically, pure TCCs, TCCs admixed with HG-SC, and pure HG-SCs were characterized by frequent aberrant p53 expression (diffuse or null pattern) and WT1+/ER+/PR+/IMP2+ immunophenotype, whereas BTs, including benign, borderline, and malignant BTs, were characterized by lack of aberrant p53 expression and WT1-/ER-/PR-/IMP2- immunophenotype. In contrast to the BTs, pure ECs and TCCs admixed with EC showed an ER+/PR+ immunophenotype. Nearly all the tumors with a TP53 gene mutation by molecular analysis showed aberrant p53 staining patterns. In conclusion, TCC is not a distinct entity but a poorly differentiated form of serous or EC, as (1) most TCCs coexist with HG-SC (mostly) or EC (occasionally), and (2) the immunophenotype and molecular features are similar to those of HG-SC or EC but different from those of BTs.

The critical role of catalase in prooxidant and antioxidant function of p53

PubMed Central

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

A dual role of p53 in the control of autophagy.

PubMed

Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

2008-08-01

Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

PubMed

Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

2015-03-01

The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status.

PubMed

Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer

2011-03-11

The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21- combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21- carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status.

Negative feedback regulation of wild-type p53 biosynthesis.

PubMed Central

Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

1995-01-01

When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

Immunoexpression of Th17-related cytokines in oral lichen planus.

PubMed

Monteiro, Bárbara Vanessa de Brito; Pereira, Joabe Dos Santos; Nonaka, Cassiano F W; Godoy, Gustavo P; da Silveira, Éricka J D; Miguel, Márcia Cristina da Costa

2015-07-01

A recently described lineage of lymphocytes, Th17 cells, has been associated with inflammatory and autoimmune diseases. The aim of this article was to assess the immunoexpression of cytokines related to this lineage, interleukin-17 (IL-17) and IL-23 and in reticular and erosive oral lichen planus (OLP). The sample included 41 cases of OLP (23 reticular and 18 erosive) and 10 cases of inflammatory fibrous hyperplasia (IFH). Lymphocytes exhibiting cytoplasmic immunostaining were counted. Epithelial immunostaining was also evaluated. There was no statistical differences in the number of IL-17 and IL-23 lymphocytes between the OLP (55.40 and 48.40, respectively) and IFH (39.30 and 44.40, respectively). A significantly higher number of IL-23 lymphocytes was found in erosive OLP group (63.80) when compared with reticular (41.40) and IFH lesions (44.40) (P=0.019). Furthermore, epithelial immunopositivity for IL-17 and IL-23 was higher in OLP lesions than in IFH (P=0.012 and P=0.011, respectively). A significantly higher number of IL-23 lymphocytes in erosive OLP and the strong epithelial immunopositivity for IL-23 and IL-17 in OLP group could suggest an important participation of TCD4 Th17 response in this disorder.

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

Differential diagnosis of urothelial carcinoma in situ from non-neoplastic urothelia: Analysis of CK20, CD44, P53 and Ki67

PubMed Central

Asgari, Mojgan; Nabi Maybodi, Mahtab; Abolhasani, Maryam

2016-01-01

Background: Flat urothelial lesions comprise a spectrum of morphologic changes ranging from reactive atypia to carcinoma in situ (CIS). Urothelial dysplasia and CIS are associated with the recurrence and progression of urothelial carcinoma. Distinguishing CIS and dysplasia from reactive atypia based on histolopathogical features alone is often difficult. Using different immunohistochemical markers such as Cytokeratin 20 (CK20), CD44, p53, and Ki-67 is recommended for differential diagnosis. The aim of this study was to evaluate the immunohistochemical pattern of these antibodies to differentiate different flat urothelial lesions. Methods: In this cross- sectional study, three groups of bladder biopsy specimens were evaluated: 20 samples with reactive urothelial lesions, 20 histologically diagnosed as CIS, and 20 morphologically normal samples. Immunohistochemical staining of CK20, p53, CD44 and Ki-67 markers was performed on paraffin-embedded blocks. The groups were compared using chi square test, and the diagnostic value of the markers were evaluated with sensitivity, specificity, positive and negative predictive values. Results: CK20 was full thickness positive in 15 (75%) CIS samples and negative in all samples of the normal and reactive groups (p<0.001); CD44 was positive in 2 (10%) cases of the CIS group and in 17 (85%) of the reactive group; this marker was negative in all the normal samples (p<0.001). P53 was positive in 12 (60%) samples of the CIS group and negative in all samples of the normal and reactive groups (p<0.001). Ki67 was positive in 13 (65%) samples of the CIS group and 1 (5%) sample of the reactive group. This marker was negative in all samples of the normal group (p<0.001). Conclusion: The results of this study revealed that CK20, CD44, P53 and Ki67 are useful in distinguishing CIS from reactive and normal samples. However, they should be used in a panel including at least three markers. Correlation with the morphologic features is necessary. PMID:27579290

Changes in mast cell number and stem cell factor expression in human skin after radiotherapy for breast cancer.

PubMed

Westbury, Charlotte B; Freeman, Alex; Rashid, Mohammed; Pearson, Ann; Yarnold, John R; Short, Susan C

2014-05-01

Mast cells are involved in the pathogenesis of radiation fibrosis and may be a therapeutic target. The mechanism of increased mast cell number in relation to acute and late tissue responses in human skin was investigated. Punch biopsies of skin 1 and 15-18 months after breast radiotherapy and a contralateral control biopsy were collected. Mast cells were quantified by immunohistochemistry using the markers c-Kit and tryptase. Stem cell factor (SCF) and collagen-1 expression was analysed by qRT-PCR. Clinical photographic scores were performed at post-surgical baseline and 18 months and 5 years post-radiotherapy. Primary human dermal microvascular endothelial cell (HDMEC) cultures were exposed to 2Gy ionising radiation and p53 and SCF expression was analysed by Western blotting and ELISA. Dermal mast cell numbers were increased at 1 (p=0.047) and 18 months (p=0.040) using c-Kit, and at 18 months (p=0.024) using tryptase immunostaining. Collagen-1 mRNA in skin was increased at 1 month (p=0.047) and 18 months (p=0.032) and SCF mRNA increased at 1 month (p=0.003). None of 16 cases scored had a change in photographic appearance at 5 years, compared to baseline. SCF expression was not increased in HDMECs irradiated in vitro. Increased mast cell number was associated with up-regulated collagen-1 expression in human skin at early and late time points. This increase could be secondary to elevated SCF expression at 1 month after radiotherapy. Although mast cells accumulate around blood vessels, no endothelial cell secretion of SCF was seen after in vitro irradiation. Modification of mast cell number and collagen-1 expression may be observed in skin at 1 and 18 months after radiotherapy in breast cancer patients with no change in photographic breast appearance at 5 years. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

No Gut No Gain! Enteral Bile Acid Treatment Preserves Gut Growth but Not Parenteral Nutrition-Associated Liver Injury in a Novel Extensive Short Bowel Animal Model.

PubMed

Villalona, Gustavo; Price, Amber; Blomenkamp, Keith; Manithody, Chandrashekhara; Saxena, Saurabh; Ratchford, Thomas; Westrich, Matthew; Kakarla, Vindhya; Pochampally, Shruthika; Phillips, William; Heafner, Nicole; Korremla, Niraja; Greenspon, Jose; Guzman, Miguel A; Kumar Jain, Ajay

2018-04-27

Parenteral nutrition (PN) provides nutrition intravenously; however, this life-saving therapy is associated with significant liver disease. Recent evidence indicates improvement in PN-associated injury in animals with intact gut treated with enteral bile acid (BA), chenodeoxycholic acid (CDCA), and a gut farnesoid X receptor (FXR) agonist, which drives the gut-liver cross talk (GLCT). We hypothesized that similar improvement could be translated in animals with short bowel syndrome (SBS). Using piglets, we developed a novel 90% gut-resected SBS model. Fifteen SBS piglets receiving PN were given CDCA or control (vehicle control) for 2 weeks. Tissue and serum were analyzed posteuthanasia. CDCA increased gut FXR (quantitative polymerase chain reaction; P = .008), but not downstream FXR targets. No difference in gut fibroblast growth factor 19 (FGF19; P = .28) or hepatic FXR (P = .75), FGF19 (P = .86), FGFR4 (P = .53), or Cholesterol 7 α-hydroxylase (P = .61) was noted. PN resulted in cholestasis; however, no improvement was noted with CDCA. Hepatic fibrosis or immunostaining for Ki67, CD3, or Cytokeratin 7 was not different with CDCA. PN resulted in gut atrophy. CDCA preserved (P = .04 vs control) gut mass and villous/crypt ratio. The median (interquartile range) for gut mass for control was 0.28 (0.17-0.34) and for CDCA was 0.33 (0.26-0.46). We note that, unlike in animals with intact gut, in an SBS animal model there is inadequate CDCA-induced activation of gut-derived signaling to cause liver improvement. Thus, it appears that activation of GLCT is critically dependent on the presence of adequate gut. This is clinically relevant because it suggests that BA therapy may not be as effective for patients with SBS. © 2018 American Society for Parenteral and Enteral Nutrition.

Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

Clinical and Economic Value of p16INK4a for the Differential Diagnosis of Morphologic Cervical Intraepithelial Neoplasia 2.

PubMed

Fishkel, Vanina S; Monge, Fernando C; von Petery, Felicitas M; Tapper, Karen E; Peña, Teresa M; Torres, Florencia; Poletta, Fernando A; Elgart, Jorge F; Avagnina, Alejandra; Denninghoff, Valeria

2018-05-04

The detection of high-grade intraepithelial lesions requires highly sensitive and specific methods that allow more accurate diagnoses. This contributes to a proper management of preneoplastic lesions, thus avoiding overtreatment. The purpose of this study was to analyze the value of immunostaining for p16 in the morphologic assessment of cervical intraepithelial neoplasia 2 lesions, to help differentiate between low-grade (p16-negative) and high-grade (p16-positive) squamous intraepithelial lesions. The direct medical cost of the treatment of cervical intraepithelial neoplasia 2 morphologic lesions was estimated. A retrospective observational cross-sectional study was carried out. This study analyzed 46 patients treated with excisional procedures because of cervical intraepithelial neoplasia 2 lesions, using loop electrosurgical excision procedures. Immunostaining for the biomarker was performed. For the estimation of overtreatment, percentages (%) and their 95% confidence interval were calculated. Of the 41 patients analyzed, 32 (78%) showed overexpression of p16 and 9 (22%) were negative (95% confidence interval, 11%-38%). Mean follow-up was 2.9 years, using cervical cytology testing (Pap) and colposcopy. High-risk human papillomavirus DNA tests were performed in 83% of patients. These retrospective results reveal the need for larger biopsy samples, which would allow a more accurate prediction of lesion risk. Considering the cost of p16 staining, and assuming the proper management of the low-grade lesion, an average of US$919 could be saved for each patient with a p16-negative result, which represents a global direct cost reduction of 10%.

Sulforaphane inhibits PDGF-induced proliferation of rat aortic vascular smooth muscle cell by up-regulation of p53 leading to G1/S cell cycle arrest.

PubMed

Yoo, Su-Hyang; Lim, Yong; Kim, Seung-Jung; Yoo, Kyu-Dong; Yoo, Hwan-Soo; Hong, Jin-Tae; Lee, Mi-Yea; Yun, Yeo-Pyo

2013-01-01

Vascular diseases such as atherosclerosis and restenosis artery angioplasty are associated with vascular smooth muscle cell (VSMC) proliferation and intimal thickening arterial walls. In the present study, we investigated the inhibitory effects of sulforaphane, an isothiocyanate produced in cruciferous vegetables, on VSMC proliferation and neointimal formation in a rat carotid artery injury model. Sulforaphane at the concentrations of 0.5, 1.0, and 2.0 μM significantly inhibited platelet-derived growth factor (PDGF)-BB-induced VSMC proliferation in a concentration-dependent manner, determined by cell count. The IC50 value of sulforaphane-inhibited VSMC proliferation was 0.8 μM. Sulforaphane increased the cyclin-dependent kinase inhibitor p21 and p53 levels, while it decreased CDK2 and cyclin E expression. The effects of sulforaphane on vascular thickening were determined 14 days after the injury to the rat carotid artery. The angiographic mean luminary diameters of the group treated with 2 and 4 μM sulforaphane were 0.25±0.1 and 0.09±0.1 mm², respectively, while the value of the control groups was 0.40±0.1 mm², indicating that sulforaphane may inhibit neointimal formation. The expression of PCNA, maker for cell cycle arrest, was decreased, while that of p53 and p21 was increased, which showed the same pattern as one in in-vitro study. These results suggest that sulforaphane-inhibited VSMC proliferation may occur through the G1/S cell cycle arrest by up-regulation of p53 signaling pathway, and then lead to the decreased neointimal hyperplasia thickening. Thus, sulforaphane may be a promising candidate for the therapy of atherosclerosis and post-angiography restenosis. © 2013.

The up-regulation of miR-300 in gastric cancer and its effects on cells malignancy

PubMed Central

Shen, Zhen; Li, Chunsheng; Zhang, Kai; Yu, Wei; Xiao, Huijie; Li, Bo; Liu, Tongjun

2015-01-01

Objective: In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of gastric cancer cells. Methods: MicroRNA and protein expression patterns were compared between gastric cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in AGS gastric cancer cells. Results: We observed that miR-300 expression was frequently and dramatically up-regulated in human gastric cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote gastric cancer cell proliferation and invasion by increasing p53 expression. Conclusion: Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in gastric cancer cell proliferation during gastric tumorigenesis. PMID:26221215

The up-regulation of miR-300 in gastric cancer and its effects on cells malignancy.

PubMed

Shen, Zhen; Li, Chunsheng; Zhang, Kai; Yu, Wei; Xiao, Huijie; Li, Bo; Liu, Tongjun

2015-01-01

In this study, we investigated the role of miR-300 in regulating cell proliferation and invasion of gastric cancer cells. MicroRNA and protein expression patterns were compared between gastric cancer tissue and normal tissue and between two different prognostic groups. The up-regulation of miR-300 was confirmed by real-time reverse transcription polymerase chain reaction and its expression was analyzed in AGS gastric cancer cells. We observed that miR-300 expression was frequently and dramatically up-regulated in human gastric cancer tissues and cell lines compared with the matched adjacent normal tissues and cells. We further showed that transient and stable over-expression of miR-300 could promote cell proliferation and cell cycle progression. Moreover, p53, a key inhibitor of cell cycle, was verified as a direct target of miR-300, suggesting that miR-300 might promote gastric cancer cell proliferation and invasion by increasing p53 expression. Our findings indicated that miR-300 up-regulation might exert some sort of antagonistic function by targeting p53 in gastric cancer cell proliferation during gastric tumorigenesis.

The organization and expression of the mdm2 gene.

PubMed

de Oca Luna, R M; Tabor, A D; Eberspaecher, H; Hulboy, D L; Worth, L L; Colman, M S; Finlay, C A; Lozano, G

1996-05-01

The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequencing of normal BalbC/J DNA and the original cosmid clone isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues.

A universal method for the mutational analysis of K-ras and p53 gene in non-small-cell lung cancer using formalin-fixed paraffin-embedded tissue.

PubMed

Sarkar, F H; Valdivieso, M; Borders, J; Yao, K L; Raval, M M; Madan, S K; Sreepathi, P; Shimoyama, R; Steiger, Z; Visscher, D W

1995-12-01

The p53 tumor suppressor gene has been found to be altered in almost all human solid tumors, whereas K-ras gene mutations have been observed in a limited number of human cancers (adenocarcinoma of colon, pancreas, and lung). Studies of mutational inactivation for both genes in the same patient's sample on non-small-cell lung cancer have been limited. In an effort to perform such an analysis, we developed and compared methods (for the mutational detection of p53 and K-ras gene) that represent a modified and universal protocol, in terms of DNA extraction, polymerase chain reaction (PCR) amplification, and nonradioisotopic PCR-single-strand conformation polymorphism (PCR-SSCP) analysis, which is readily applicable to either formalin-fixed, paraffin-embedded tissues or frozen tumor specimens. We applied this method to the evaluation of p53 (exons 5-8) and K-ras (codon 12 and 13) gene mutations in 55 cases of non-small-cell lung cancer. The mutational status in the p53 gene was evaluated by radioisotopic PCR-SSCP and compared with PCR-SSCP utilizing our standardized nonradioisotopic detection system using a single 6-microns tissue section. The mutational patterns observed by PCR-SSCP were subsequently confirmed by PCR-DNA sequencing. The mutational status in the K-ras gene was similarly evaluated by PCR-SSCP, and the specific mutation was confirmed by Southern slot-blot hybridization using 32P-labeled sequence-specific oligonucleotide probes for codons 12 and 13. Mutational changes in K-ras (codon 12) were found in 10 of 55 (18%) of non-small-cell lung cancers. Whereas adenocarcinoma showed K-ras mutation in 33% of the cases at codon 12, only one mutation was found at codon 13. As expected, squamous cell carcinoma samples (25 cases) did not show K-ras mutations. Mutations at exons 5-8 of the p53 gene were documented in 19 of 55 (34.5%) cases. Ten of the 19 mutations were single nucleotide point mutations, leading to amino acid substitution. Six showed insertional mutation, and three showed deletion mutations. Only three samples showed mutations of both K-ras and p53 genes. We conclude that although K-ras and p53 gene mutations are frequent in non-small-cell lung cancer, mutations of both genes in the same patient's samples are not common. We also conclude that this universal nonradioisotopic method is superior to other similar methods and is readily applicable to the rapid screening of large numbers of formalin-fixed, paraffin-embedded or frozen samples for the mutational analysis of multiple genes.

The absence of p53 during Human Cytomegalovirus infection leads to decreased UL53 expression, disrupting UL50 localization to the inner nuclear membrane, and thereby inhibiting capsid nuclear egress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth

Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less

Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.

PubMed

Suppiah, Aravind; Greenman, John

2013-08-07

Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.

Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

PubMed

Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

2012-04-01

Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

A microdissection approach to detect molecular markers during progression of prostate cancer.

PubMed Central

Berthon, P.; Dimitrov, T.; Stower, M.; Cussenot, O.; Maitland, N. J.

1995-01-01

To investigate the underlying mechanisms of carcinogenesis, we have developed a technique to determine the frequency of genetic changes in prostatic carcinoma tissue. We have demonstrated that at a ratio of between 1:4 and 1:9 mutant-normal alleles, the signal from a mutant TP53 allele is not apparent after polymerase chain reaction (PCR) amplification and further direct sequencing or single-strand conformation polymorphism (SSCP) analysis. To bypass this problem, which is inherent in the heterogeneity of the prostate tissue and of the tumour, we selected areas of graded prostate tumours (Gleason score) from cryosectioned preparations and microdissected these cells (20-100 cells). After anionic resin removal of proteins, PCR amplification of TP53 gene exons 5/6 and SSCP analysis, an abnormal SSCP band shift was observed in suspected tumour cells, compared with microdissected stromal cells used as an internal control, while (1) a crude preparation of tissue DNA carrying the tumour did not show any abnormality and (2) immunostaining by a set of monoclonal antibodies against TP53 protein remained negative. Nucleotide sequence analysis of the different bands confirmed the presence of a mutation in the TP53 gene exon 6 position 13,336 in an abnormal band for one specimen, while no mutation was detected in the normal SSCP band. By targeting recognised tumour cells we can find DNA mutations which are undetectable using the standard technique of whole-tissue DNA extraction, particularly in a heterogeneous tumour such as carcinoma of the prostate. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:7547246

Addition of interferon-α to the p53-SLP® vaccine results in increased production of interferon-γ in vaccinated colorectal cancer patients: a phase I/II clinical trial.

PubMed

Zeestraten, Eliane C M; Speetjens, Frank M; Welters, Marij J P; Saadatmand, Sepideh; Stynenbosch, Linda F M; Jongen, Rogier; Kapiteijn, Ellen; Gelderblom, Hans; Nijman, Hans W; Valentijn, A Rob P M; Oostendorp, Jaap; Fathers, Lorraine M; Drijfhout, Jan W; van de Velde, Cornelis J H; Kuppen, Peter J K; van der Burg, Sjoerd H; Melief, Cornelis J M

2013-04-01

We previously established safety and immunogenicity of a p53 synthetic long peptides (p53-SLP®) vaccine. In the current trial, we investigated whether combination of interferon-alpha (IFN-α) with p53-SLP® is both safe and able to improve the induced p53-specific IFN-γ response. Eleven colorectal cancer patients successfully treated for metastatic disease were enrolled in this study. Of these, nine patients completed follow-up after two injections with p53-SLP® together with IFN-α. Safety and p53-specific immune responses were determined before and after vaccination. Furthermore, cryopreserved PBMCs were compared head-to-head to cryopreserved PBMCs obtained in our previous trial with p53-SLP® only. Toxicity of p53-SLP® vaccination in combination with IFN-α was limited to Grade 1 or 2, with predominantly small ongoing swellings at the vaccination site. All patients harbored p53-specific T cells after vaccination and most patients showed p53-specific antibodies. Compared to the previous trial, addition of IFN-α significantly improved the frequency of p53-specific T cells in IFN-γ ELISPOT. Moreover, in this trial, p53-specific T cells were detectable in blood samples of all patients in a direct ex vivo multiparameter flowcytometric assay, opposed to only 2 of 10 patients vaccinated with p53-SLP® only. Finally, patients in this trial displayed a broader p53-specific immunoglobulin-G response, indicating an overall better p53-specific T-helper response. Our study shows that p53-SLP® vaccination combined with IFN-α injection is safe and capable of inducing p53-specific immunity. When compared to a similar trial with p53-SLP® vaccination alone the combination was found to induce significantly more IFN-γ producing p53-specific T cells. Copyright © 2012 UICC.

Sequential changes in the expression of Wnt- and Notch-related genes in the vagina and uterus of ovariectomized mice after estrogen exposure.

PubMed

Nakamura, Takeshi; Miyagawa, Shinichi; Katsu, Yoshinao; Sato, Tomomi; Iguchi, Taisen; Ohta, Yasuhiko

2012-01-01

Estrogen regulates morphological changes in reproductive organs, such as the vagina and uterus, during the estrous cycles in mice. Estrogen depletion by ovariectomy in adults results in atrophy accompanied by apoptosis in vaginal and uterine cells, while estrogen treatment following ovariectomy elicits cell proliferation in both organs. Sequential changes in mRNA expression of wingless-related MMTV integration site (Wnt) and Notch signaling genes were analyzed in the vagina and uterus of ovariectomized adult mice after a single injection of 17β-estradiol to provide understanding over the molecular basis of differences in response to estrogen in these organs. We found estrogen-dependent up-regulation of Wnt4, Wnt5a and p21 and down-regulation of Wnt11, hairy/enhancer-of-split related with YRPW motif-1 (Hey1) and delta-like 4 (Dll4) in the vagina, and up-regulation of Wnt4, Wnt5a, Hey1, Heyl, Dll1, p21 and p53 and down-regulation of Wnt11, Hey2 and Dll4 in the uterus. The expression of Wnt4, Hey1, Hey2, Heyl, Dll1 and p53 showed different patterns after the estrogen injection. Expression patterns for Wnt5a, Wnt11, Dll4 and p21 in the vagina and uterus were similar, suggesting that these genes are involved in the proliferation of cells in both those organs in mice.

Comparison of candidate scaffolds for tissue engineering for stress urinary incontinence and pelvic organ prolapse repair.

PubMed

Mangera, Altaf; Bullock, Anthony J; Roman, Sabiniano; Chapple, Christopher R; MacNeil, Sheila

2013-09-01

To identify candidate materials which have sufficient potential to be taken forward for an in vivo tissue-engineering approach to restoring the tissue structure of the pelvic floor in women with stress urinary incontinence (SUI) or pelvic organ prolapse (POP). Oral mucosal fibroblasts were seeded onto seven different scaffold materials, AlloDerm ( LifeCell Corp., Branchburg, NJ, USA), cadaveric dermis, porcine dermis, polypropylene, sheep forestomach, porcine small intestinal submucosa (SIS) and thermoannealed poly(L) lactic acid (PLA) under both free and restrained conditions. The scaffolds were assessed for: cell attachment using AlamarBlue and 4,6-diamidino-2-phenylindole (DAPI); contraction using serial photographs; and extracellular matrix production using Sirius red staining, immunostaining and scanning electron microscopy. Finally the biomechanical properties of all the scaffolds were assessed. Of the seven, there were two biodegradable scaffolds, synthetic PLA and natural SIS, which supported good cell attachment and proliferation. Immunostaining confirmed the presence of collagen I, III and elastin which was highest in SIS and PLA. The mechanical properties of PLA were closest to native tissue with an ultimate tensile strength of 0.72 ± 0.18 MPa, ultimate tensile strain 0.53 ± 0.16 and Young's modulus 4.5 ± 2.9 MPa. Scaffold restraint did not have a significant impact on the above properties in the best scaffolds. These data support both PLA and SIS as good candidate materials for use in making a tissue-engineered repair material for SUI or POP. © 2013 BJU International.

Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

PubMed

Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

2015-01-01

A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

Expressions of p53 and p21 in primary gastric lymphomas.

PubMed Central

Go, J. H.; Yang, W. I.

2001-01-01

The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

Anal cytology and p16 immunostaining for screening anal intraepithelial neoplasia in HIV-positive and HIV-negative men who have sex with men: a cross-sectional study.

PubMed

Arora, Rahul; Pandhi, Deepika; Mishra, Kiran; Bhattacharya, Sambit N; Yhome, Vizodilhou A

2014-09-01

Summary Akin to cervical cancer in sexually-active women, men who have sex with men (MSM) are predisposed to anal cancers, especially those with HIV co-infection. This cross-sectional study endeavored to assess the prevalence of anal dysplasia using Pap smears and p16 immunostaining amongst Indian MSM. A total of 31 consecutive HIV-positive and 34 HIV-negative MSM, from a cohort of sexually transmitted infection clinic attendees, underwent anal cytological evaluation with Pap smear and p16 staining. Chi square test and coefficient of correlation were used for comparison. Eighteen (27.7%) had abnormal anal cytology; increased in HIV-positive as compared to HIV-negative men (35% versus 20%, p = 0.180). Similarly, both low-grade (25.8% versus 17.6%) and high-grade lesions (8.3% versus 4.8%) were comparable in HIV-positive and HIV-negative group. Thirteen (20%) smears were p16-positive with a sensitivity and specificity for anal dysplasia of 72.3% and 100%, respectively. Anal cytology may be used to screen for anal dysplasia in MSM irrespective of HIV status. Furthermore, the addition of p16, with greater specificity for high-grade lesions, may improve diagnostic accuracy especially for high-grade lesions. A larger study to further corroborate these observations is warranted. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

PubMed

Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

2018-03-06

Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

PubMed Central

Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

2018-01-01

Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

PubMed Central

Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

2000-01-01

p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

Analysis of differential protein expression in normal and neoplastic human breast epithelial cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, K.; Chubb, C.; Huberman, E.

High resolution two dimensional get electrophoresis (2DE) and database analysis was used to establish protein expression patterns for cultured normal human mammary epithelial cells and thirteen breast cancer cell lines. The Human Breast Epithelial Cell database contains the 2DE protein patterns, including relative protein abundances, for each cell line, plus a composite pattern that contains all the common and specifically expressed proteins from all the cell lines. Significant differences in protein expression, both qualitative and quantitative, were observed not only between normal cells and tumor cells, but also among the tumor cell lines. Eight percent of the consistently detected proteinsmore » were found in significantly (P < 0.001) variable levels among the cell lines. Using a combination of immunostaining, comigration with purified protein, subcellular fractionation, and amino-terminal protein sequencing, we identified a subset of the differentially expressed proteins. These identified proteins include the cytoskeletal proteins actin, tubulin, vimentin, and cytokeratins. The cell lines can be classified into four distinct groups based on their intermediate filament protein profile. We also identified heat shock proteins; hsp27, hsp60, and hsp70 varied in abundance and in some cases in the relative phosphorylation levels among the cell lines. Finally, we identified IMP dehydrogenase in each of the cell lines, and found the levels of this enzyme in the tumor cell lines elevated 2- to 20-fold relative to the levels in normal cells.« less

Squamous cell carcinoma antigen in human liver carcinogenesis.

PubMed

Guido, M; Roskams, T; Pontisso, P; Fassan, M; Thung, S N; Giacomelli, L; Sergio, A; Farinati, F; Cillo, U; Rugge, M

2008-04-01

Squamous cell carcinoma antigen (SCCA) is a serine protease inhibitor that can be overexpressed in hepatocellular carcinoma (HCC) at both molecular and protein level, but no data are available on its expression in pre-malignant stages. To assess SCCA expression by immunohistochemistry in HCC and its nodular precursors in cirrhotic livers. 55 nodules from 42 explanted livers were evaluated: 7 large regenerative nodules (LRNs), 7 low-grade dysplastic nodules (LG-DNs), 10 high-grade DNs (HG-DNs), and 31 HCC. SCCA expression was semiquantitatively scored on a four-tiered scale. SCCA hepatocyte immunostaining was always restricted to the cytoplasm, mainly exhibiting a granular pattern. Stain intensity varied, ranging from weak to very strong. Within the nodules, positive cells were unevenly distributed, either scattered or in irregular clusters. The prevalence of SCCA expression was 29% in LRNs, 100% in DNs and 93% in HCC. A significant difference emerged in both prevalence and score for LRNs versus LG-DNs (p<0.039), HG-DNs (p = 0.001), and HCC (p = 0.000). A barely significant difference (p = 0.49) was observed between LG-DNs and HG-DNs, while no difference in SCCA expression was detected between HG-DNs and HCC. Cirrhotic tissue adjacent to the nodules was positive in 96% of cases, with a significant difference in the score (p = 0.000) between hepatocytes adjacent to HCC and those surrounding LRNs. This study provides the first evidence that aberrant SCCA expression is an early event in liver cell carcinomatous transformation.

p53 Restoration in Induction and Maintenance of Senescence: Differential Effects in Premalignant and Malignant Tumor Cells

PubMed Central

Harajly, Mohamad; Zalzali, Hasan; Nawaz, Zafar; Ghayad, Sandra E.; Ghamloush, Farah; Basma, Hussein; Zainedin, Samiha; Rabeh, Wissam; Jabbour, Mark; Tawil, Ayman; Badro, Danielle A.; Evan, Gerard I.

2015-01-01

The restoration of p53 has been suggested as a therapeutic approach in tumors. However, the timing of p53 restoration in relation to its efficacy during tumor progression still is unclear. We now show that the restoration of p53 in murine premalignant proliferating pineal lesions resulted in cellular senescence, while p53 restoration in invasive pineal tumors did not. The effectiveness of p53 restoration was not dependent on p19Arf expression but showed an inverse correlation with Mdm2 expression. In tumor cells, p53 restoration became effective when paired with either DNA-damaging therapy or with nutlin, an inhibitor of p53-Mdm2 interaction. Interestingly, the inactivation of p53 after senescence resulted in reentry into the cell cycle and rapid tumor progression. The evaluation of a panel of human supratentorial primitive neuroectodermal tumors (sPNET) showed low activity of the p53 pathway. Together, these data suggest that the restoration of the p53 pathway has different effects in premalignant versus invasive pineal tumors, and that p53 activation needs to be continually sustained, as reversion from senescence occurs rapidly with aggressive tumor growth when p53 is lost again. Finally, p53 restoration approaches may be worth exploring in sPNET, where the p53 gene is intact but the pathway is inactive in the majority of examined tumors. PMID:26598601

p16 immunostaining in histological grading of anal squamous intraepithelial lesions: a systematic review and meta-analysis.

PubMed

Albuquerque, Andreia; Rios, Elisabete; Dias, Claudia Camila; Nathan, Mayura

2018-02-13

p16 is the most widely studied biomarker in lower anogenital tract squamous intraepithelial lesions and, currently the only recommended biomarker for histological grade assessment. The aim of this systematic review and meta-analysis was to evaluate p16-positive rates according to anal squamous intraepithelial lesions/anal intraepithelial neoplasia (AIN) grade. Two investigators independently searched four electronic databases: PubMed, Web of Sciences, Scopus, and Embase from inception until August 2017. Studies that evaluated p16 immunostaining in histological samples of anal and/or perianal squamous intraepithelial lesions and defined a p16-positive result as diffuse block staining with nuclear or nuclear plus cytoplasmic staining were included. A meta-analysis was performed using a random effects model. Fifteen studies consisting of 790 samples were included. The proportion of p16 expression increased with the severity of histological grade. p16 positivity was 2% (95% CI: 0.2-5%) in normal histology, 12% (95% CI: 2-27%) in low-grade squamous intraepithelial lesions (LSILs)/AIN1 (excluding condylomas), 7% (95% CI: 2-13%) in all LSIL (AIN1/LSIL/condyloma), 76% (95% CI: 61-88%) in AIN2, and 90% (95% CI: 82-95%) in AIN3. For anal high-grade squamous intraepithelial lesions (HSILs), in studies using a two-tiered nomenclature, p16 positivity was 84% (95% CI: 66-96%) and for all HSIL (AIN2, AIN3, HSIL combined) it was 82% (95% CI: 72-91%). In summary, p16 positivity in anal squamous intraepithelial lesions appears to be in a similar range to the commonly described cervical squamous intraepithelial lesions, however, for anal low-grade lesions positivity seems to be lower.

Hypothalamus-Olfactory System Crosstalk: Orexin A Immunostaining in Mice

PubMed Central

Gascuel, Jean; Lemoine, Aleth; Rigault, Caroline; Datiche, Frédérique; Benani, Alexandre; Penicaud, Luc; Lopez-Mascaraque, Laura

2012-01-01

It is well known that olfaction influences food intake, and conversely, that an individual’s nutritional status modulates olfactory sensitivity. However, what is still poorly understood is the neuronal correlate of this relationship, as well as the connections between the olfactory bulb and the hypothalamus. The goal of this report is to analyze the relationship between the olfactory bulb and hypothalamus, focusing on orexin A immunostaining, a hypothalamic neuropeptide that is thought to play a role in states of sleep/wakefulness. Interestingly, orexin A has also been described as a food intake stimulator. Such an effect may be due in part to the stimulation of the olfactory bulbar pathway. In rats, orexin positive cells are concentrated strictly in the lateral hypothalamus, while their projections invade nearly the entire brain including the olfactory system. Therefore, orexin appears to be a good candidate to play a pivotal role in connecting olfactory and hypothalamic pathways. So far, orexin has been described in rats, however, there is still a lack of information concerning its expression in the brains of adult and developing mice. In this context, we revisited the orexin A pattern in adult and developing mice using immunohistological methods and confocal microscopy. Besides minor differences, orexin A immunostaining in mice shares many features with those observed in rats. In the olfactory bulb, even though there are few orexin projections, they reach all the different layers of the olfactory bulb. In contrast to the presence of orexin projections in the main olfactory bulb, almost none have been found in the accessory olfactory bulb. The developmental expression of orexin A supports the hypothesis that orexin expression only appears post-natally. PMID:23162437

Cancer testis antigen OY-TES-1: analysis of protein expression in ovarian cancer with tissue microarrays.

PubMed

Fan, R; Huang, W; Luo, B; Zhang, Q M; Xiao, S W; Xie, X X

2015-01-01

Revised manuscript accepted for publication March 5, Objectives: The purpose of this study was to determine the potential of cancer testis antigen OY-TES-1 as a vaccine for ovarian cancer (OC). A tissue microarray (TMA) containing 107 samples from OC tissues and 48 samples from OC adjacent tissues was analyzed by immunohistochemistry with the OY-TES-1 polyclonal antibody. The correlation between OY-TES-1 and clinic pathological traits of OC was statistically analyzed. The expression of OY-TES-1 protein was found in 81% (87/107) of OC tissues and 56% (27/48) of OC adjacent tissues. The immunostaining intensity of OY-TES-1 in OC tissues was significantly higher than that in OC adjacent tissues tested (p = 0.040). OC adjacent tissues only demonstrated lower immunostaining intensity, whereas some of OC tissues presented higher immunostaining intensity and majority showed the heterogeneity of protein distribution. There was no statistically significant correlation found between OY-TES-1 expression and any other clinicopathological traits such as age, FIGO stage, pathological grade, and histological type. OY-TES-1 was expressed in OC tissues with a high proportion, and some of OC tissues presented OY-TES-1 expression in high level vs OC adjacent tissues. OY-TES-1 could be an attractive target for immunotherapy for OC in the future.

Quantifying the pattern of beta/A4 amyloid protein distribution in Alzheimer's disease by image analysis.

PubMed

Bruce, C V; Clinton, J; Gentleman, S M; Roberts, G W; Royston, M C

1992-04-01

We have undertaken a study of the distribution of the beta/A4 amyloid deposited in the cerebral cortex in Alzheimer's disease. Previous studies which have examined the differential distribution of amyloid in the cortex in order to determine the laminar pattern of cortical pathology have not proved to be conclusive. We have developed an alternative method for the solution of this problem. It involves the immunostaining of sections followed by computer-enhanced image analysis. A mathematical model is then used to describe both the amount and the pattern of amyloid across the cortex. This method is both accurate and reliable and also removes many of the problems concerning inter and intra-rater variability in measurement. This method will provide the basis for further quantitative studies on the differential distribution of amyloid in Alzheimer's disease and other cases of dementia where cerebral amyloidosis occurs.

Haemangiopericytoma: histological spectrum, immunohistochemical characterization and prognosis.

PubMed

Mazzei, Maurizio; Millanta, Francesca; Citi, Simona; Lorenzi, Davide; Poli, Alessandro

2002-02-01

Canine haemangiopericytoma (CHP) is a vascular neoplasm thought to be derived from pericytes. The histological pattern and immunohistochemical profile were studied in 31 CHPs. Twenty-three subjects were followed for 2 years to evaluate the correlation among tumour location, histotype, immunostaining and outcome of the disease. Of the 31 CHPs examined, 20 exhibited a perivascular whorled pattern, 8 were storiform and 3 were epithelioid. All tumours were positive for vimentin and negative for cytokeratin, factor VIII-related antigen, glial fibrillary acidic protein and S-100 protein. Seventeen CHPs were positive for actin and nine co-expressed desmin. Six CHPs were also positive for CD34 antigen. The panel of immunohistochemical markers used confirmed the vascular lineage of CHP and aided in the exclusion of other mesenchymal tumours. Of the 23 dogs submitted to follow-up, 6 had recurrence or metastases of the primary tumour. The epithelioid pattern or a noncutaneous location were associated with a poorer prognosis.

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila

2016-10-15

Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

TP53 mutations in primary breast carcinomas from white and African-Brazilian patients.

PubMed

Nagai, Maria Aparecida; Schaer Barbosa, Helenemarie; Zago, Marco Antonio; Araújo Silva, Wilson; Nishimoto, Inês Nobuko; Salaorni, Sibeli; Guerreiro Costa, Lívia Nery Franco; Silva Araújo, Marcos; Caldas Oliveira, Ana Gabriela; Mourâo Neto, Mário; Brentani, Maria Mitzi

2003-07-01

We have attempted to determine the incidence, nature and clinical significance of TP53 mutation in a group of white (242 cases) and African-Brazilian (52 cases) patients with breast cancer. The interethnic admixture as estimated by STR markers showed that white subjects displayed 67.9+/-0.4%, 25.0+/-1.7% and 7.0%+/-1.6% and the black populations had 34.4+/-1.9%, 56.2+/-1.9 and 9.4+/-2.2% respectively of European, African and Amerindian genes. Clinical parameters such as age, lymph node status and steroid receptors were similar in both groups. African-Brazilian patients presented more advanced lesions. Mutation screening was performed using polymerase chain reaction-single strand conformation analysis followed by sequencing. Compared to whites (13.6%), a relatively high frequency of TP53 mutation was found in blacks (32.7%) (p=0.001). African-Brazilian women have a larger proportion of mutations in exons 5 and 7, whereas white women have more mutations in exon 8. Mutations within exon 4 were found only in tumors of white patients. The spectra of TP53 mutations show that A:T-->G:C nucleotide transversion and G:C-->C:G transition were more common in African-Brazilian women whereas G:C-->T:A transversion occurs very frequently in whites. A high prevalence of G:C-->A:T nucleotide transitions and deletions was detected in both groups. No association was found between p53 gene mutation and tumor or clinical parameters independently of the ethnic group. With a median follow-up of 35.6 months for whites and 43.4 months for the blacks, no differences in overall survival were found. If white patients were stratified according to the type and location of TP53 mutations, patients with mutations affecting amino acids directly involved in DNA or Zn binding displayed a poor prognosis. The pattern of mutations found in our population seems to reflect a base line pattern observed in populations with similar ethnic profile with some modifications, which might be derived from specific etiological factors.

DNA methylation differences in exposed workers and nearby residents of the Ma Ta Phut industrial estate, Rayong, Thailand

PubMed Central

Peluso, Marco; Bollati, Valentina; Munnia, Armelle; Srivatanakul, Petcharin; Jedpiyawongse, Adisorn; Sangrajrang, Suleeporn; Piro, Sara; Ceppi, Marcello; Bertazzi, Pier Alberto; Boffetta, Paolo; Baccarelli, Andrea A

2012-01-01

Background Adverse biological effects from airborne pollutants are a primary environmental concern in highly industrialized areas. Recent studies linked air pollution exposures with altered blood Deoxyribo-nucleic acid (DNA) methylation, but effects from industrial sources and underlying biological mechanisms are still largely unexplored. Methods The Ma Ta Phut industrial estate (MIE) in Rayong, Thailand hosts one of the largest steel, oil refinery and petrochemical complexes in south-eastern Asia. We measured a panel of blood DNA methylation markers previously associated with air pollution exposures, including repeated elements [long interspersed nuclear element-1 (LINE-1) and Alu] and genes [p53, hypermethylated-in-cancer-1 (HIC1), p16 and interleukin-6 (IL-6)], in 67 MIE workers, 65 Ma Ta Phut residents and 45 rural controls. To evaluate the role of DNA damage and oxidation, we correlated DNA methylation measures with bulky DNA and 3-(2-deoxy-β-D-erythro-pentafuranosyl)pyrimido[1,2-α]purin-10(3H)-one deoxyguanosine (M1dG) adducts. Results In covariate-adjusted models, MIE workers, compared with rural residents, showed lower LINE-1 (74.8% vs 78.0%; P < 0.001), p53 (8.0% vs 15.7%; P < 0.001) and IL-6 methylation (39.2% vs 45.0%; P = 0.027) and higher HIC1 methylation (22.2% vs 15.3%, P < 0.001). For all four markers, Ma Ta Phut residents exhibited methylation levels intermediate between MIE workers and rural controls (LINE-1, 75.7%, P < 0.001; p53, 9.0%, P < 0.001; IL-6, 39.8%, P = 0.041; HIC1, 17.8%, P = 0.05; all P-values vs rural controls). Bulky DNA adducts showed negative correlation with p53 methylation (P = 0.01). M1dG showed negative correlations with LINE-1 (P = 0.003) and IL-6 methylation (P = 0.05). Conclusions Our findings indicate that industrial exposures may induce alterations of DNA methylation patterns detectable in blood leucocyte DNA. Correlation of DNA adducts with DNA hypomethylation suggests potential mediation by DNA damage. PMID:23064502

Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

PubMed Central

Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

2015-01-01

ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer

PubMed Central

Suppiah, Aravind; Greenman, John

2013-01-01

Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463

Mechanisms that enhance sustainability of p53 pulses.

PubMed

Kim, Jae Kyoung; Jackson, Trachette L

2013-01-01

The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

PubMed Central

Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

2013-01-01

The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

PubMed Central

Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

2011-01-01

The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

HIPK2 modulates p53 activity towards pro-apoptotic transcription.

PubMed

Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

2009-10-14

Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.

[Heart failure patterns in Djibouti: epidemiologic transition].

PubMed

Massoure, P L; Roche, N C; Lamblin, G; Topin, F; Dehan, C; Kaiser, E; Fourcade, L

2013-05-01

The features of heart failure (HF) in Djibouti have not been well described. We sought to document the current patterns of HF here. We prospectively included Djiboutian adults hospitalized for HF in the French Military Hospital (Djibouti) from August 2008 through December 2010. Of 1688 adults hospitalized in the medical department, 45 (2.7%) had symptomatic HF: 38 (84%) men, mean age 55.8 years (range 27-75). Twenty-five (56%) patients were initially hospitalized for acute pulmonary edema. The underlying diseases included coronary artery disease (CAD) (62%), hypertensive heart disease (18%), rheumatic valvular disease (13%), and primary dilated cardiomyopathy (7%). Their cardiovascular risk factors included tobacco use (53%), hypertension (69%), diabetes (47%), and hypercholesterolemia (51%). Patients in the CAD group were older, and had diabetes more often (p<0.01). All khat chewers (53%) were males and smokers. Mean left ventricular ejection fraction (LVEF) was 39 ± 14%. During follow-up (14.4 ± 9 months), 8 (18%) patients died, 9 (20%) were again hospitalized for HF, and 3 (7%) had ischemic strokes. One month after discharge, the New York Heart Association (NYHA) class was II for 40%, III for 44%, and IV for 16%. Higher NYHA classes and dilated cardiomyopathy were both associated with poorer outcomes (p<0.03). In hospitalized Djiboutians, most HF patterns are similar to those in industrialized countries. CAD is more prevalent than previously reported in African patients with HF.

Immunohistochemical differentiation of atypical hyperplasia vs. carcinoma in situ of the breast.

PubMed

Masood, S; Sim, S J; Lu, L

1992-01-01

The distinction between atypical hyperplasia and carcinoma in situ in breast lesions can be difficult. The identification of myoepithelial cell layers may be helpful in establishing a diagnosis of proliferative breast disease vs. intraepithelial neoplasia. We reviewed pathologic material on 20 cases of atypical hyperplasia and 29 cases of carcinoma in situ. Immunohistochemical stains were employed against muscle-specific actin, S-100 protein, and cytokeratin to identify myoepithelial cells and to recognize different staining patterns. In atypical hyperplasia, muscle-specific actin staining identified myoepithelial cells in fine branching fibrovascular layers or as scattered cells between other proliferating cells. This pattern was absent in carcinoma in situ. S-100 protein showed more positive staining in atypical hyperplasia than in carcinoma in situ with patterns distinct from muscle-specific actin. Immunostaining for cytokeratin demonstrated distinctly different patterns between the two lesions. This study suggests that muscle-specific actin, S-100 protein, and cytokeratin in combination may assist in distinguishing proliferative breast disease with atypia from carcinoma in situ.

An adaptive molecular timer in p53-meidated cell fate decision

NASA Astrophysics Data System (ADS)

Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

PubMed

Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

2013-04-17

The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

PubMed Central

Du, Cheng; Wu, Hong; Leng, Roger P.

2016-01-01

Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

A tryptophanol-derived oxazolopiperidone lactam is cytotoxic against tumors via inhibition of p53 interaction with murine double minute proteins.

PubMed

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A L; dos Santos, Daniel J V A; Pérez, Maria; Queiroz, Glória; Leão, Mariana; Santos, Maria M M; Saraiva, Lucília

2015-01-01

Inactivation of the p53 tumor suppressor protein by interaction with murine double minute (MDM) proteins, MDM2 and MDMX, is a common event in human tumors expressing wild-type p53. In these tumors, the simultaneous inhibition of these interactions with MDMs, for a full p53 reactivation, represents a promising anticancer strategy. Herein, we report the identification of a dual inhibitor of the p53 interaction with MDM2 and MDMX, the (S)-tryptophanol derivative OXAZ-1, from the screening of a small library of enantiopure tryptophanol-derived oxazolopiperidone lactams, using a yeast-based assay. With human colon adenocarcinoma HCT116 cell lines expressing wild-type p53 (HCT116 p53(+/+)) and its p53-null isogenic derivative (HCT116 p53(-/-)), it was shown that OXAZ-1 induced a p53-dependent tumor growth-inhibitory effect. In fact, OXAZ-1 induced p53 stabilization, up-regulated p53 transcription targets, such as MDM2, MDMX, p21, Puma and Bax, and led to PARP cleavage, in p53(+/+), but not in p53(-/-), HCT116 cells. In addition, similar tumor cytotoxic effects were observed for OXAZ-1 against MDMX-overexpressing breast adenocarcinoma MCF-7 tumor cells, commonly described as highly resistant to MDM2-only inhibitors. In HCT116 p53(+/+) cells, the disruption of the p53 interaction with MDMs by OXAZ-1 was further confirmed by co-immunoprecipitation. It was also shown that OXAZ-1 potently triggered a p53-dependent mitochondria-mediated apoptosis, characterized by reactive oxygen species generation, mitochondrial membrane potential dissipation, Bax translocation to mitochondria, and cytochrome c release, and exhibited a p53-dependent synergistic effect with conventional chemotherapeutic drugs. Collectively, in this work, a novel selective activator of the p53 pathway is reported with promising antitumor properties to be explored either alone or combined with conventional chemotherapeutic drugs. Moreover, OXAZ-1 may represent a promising starting scaffold to search for new dual inhibitors of the p53-MDMs interaction. Copyright © 2015 Elsevier Ltd. All rights reserved.

Utility of p57 immunohistochemistry in differentiating between complete mole, partial mole & non-molar or hydropic abortus.

PubMed

Samadder, Abhimanyu; Kar, Rakhee

2017-01-01

There is considerable inter-observer variability in the diagnosis of molar pregnancies by histomorphological examination of products of conception (POC). The p57KIP2 gene is paternally imprinted and expressed from the maternal allele. On immunohistochemistry (IHC) with p57, complete mole (CM) shows absent staining whereas hydropic abortus (HA) and partial mole (PM) show positive staining. This study was undertaken to evaluate the role of p57 IHC along with histomorphology in differentiating between CM, PM and non-molar or HA. This was a cross-sectional study over a period of three and a half years on archival material. Detailed histomorphological review along with p57 IHC was carried out in 28 diagnosed cases (23 CM, 4 PM and 1 molar pregnancy not categorized) and 25 controls of four normal placentas and 21 POC (8 non-hydropic and 13 HA). In 14.8 per cent (4/27) cases, there was discordance in accurate subtyping of molar pregnancy. One case of CM showed inconsistent IHC pattern. In 15.4 per cent (2/13) HA, molar pregnancy was final diagnosis. After final review, there were 25 CM, five PM, 22 non-molar controls including 10 HA and one not assigned (PM/HA). IHC with p57 was negative in 96 per cent CM and positive in 100 and 95 per cent PM and non-molar controls, respectively. This study showed that negative p57KIP2 immunostaining reliably identified CM and could be used in association with the histological findings to distinguish CM from its mimics.

Evidence for the Involvement of p38 MAPK Activation in Barnacle Larval Settlement

PubMed Central

He, Li-Sheng; Xu, Ying; Matsumura, Kiyotaka; Zhang, Yu; Zhang, Gen; Qi, Shu-Hua; Qian, Pei-Yuan

2012-01-01

The barnacle Balanus ( = Amphibalanus) amphitrite is a major marine fouling animal. Understanding the molecular mechanism of larval settlement in this species is critical for anti-fouling research. In this study, we cloned one isoform of p38 MAPK (Bar-p38 MAPK) from this species, which shares the significant characteristic of containing a TGY motif with other species such as yeast, Drosophila and humans. The activation of p38 MAPK was detected by an antibody that recognizes the conserved dual phosphorylation sites of TGY. The results showed that phospho-p38 MAPK (pp38 MAPK) was more highly expressed at the cyprid stage, particularly in aged cyprids, in comparison to other stages, including the nauplius and juvenile stages. Immunostaining showed that Bar-p38 MAPK and pp38 MAPK were mainly located at the cyprid antennules, and especially the third and fourth segments, which are responsible for substratum exploration during settlement. The expression and localization patterns of Bar-p38 MAPK suggest its involvement in larval settlement. This postulation was also supported by the larval settlement bioassay with the p38 MAPK inhibitor SB203580. Behavioral analysis by live imaging revealed that the larvae were still capable of exploring the surface of the substratum after SB203580 treatment. This shows that the effect of p38 MAPK on larval settlement might be by regulating the secretion of permanent proteinaceous substances. Furthermore, the level of pp38 MAPK dramatically decreased after full settlement, suggesting that Bar-p38 MAPK maybe plays a role in larval settlement rather than metamorphosis. Finally, we found that Bar-p38 MAPK was highly activated when larvae confronted extracts of adult barnacle containing settlement cues, whereas larvae pre-treated with SB203580 failed to respond to the crude adult extracts. PMID:23115639

p16INK4A expression as biomarker for HPV 16-related vulvar neoplasias.

PubMed

Riethdorf, Sabine; Neffen, Eduardo F; Cviko, Aida; Löning, Thomas; Crum, Christopher P; Riethdorf, Lutz

2004-12-01

Up-regulation of p16INK4A is associated with high-risk human papillomavirus (HPV) in preinvasive and invasive cervical neoplasia. However, its expression in vulvar carcinomas, which have a diverse pathogenesis, has not been extensively studied. One hundred seventy-seven vulvar intraepithelial neoplasms (VIN), squamous cell carcinomas (SCC), and benign squamous epithelia were analyzed for p16 expression. RNA/RNA in situ hybridization was used to detect HPV 16 E6/E7 transcripts in 112. Ninety-five percent of VIN 3 and basaloid or warty SCCs (76/80) and 4% of keratinizing SCC (2/48) were moderately to strongly immunopositive for p16, which localized to nucleus and cytoplasm; 52/58 analyzed (90%) contained HPV 16 transcripts. The positive predictive value (PPV) of moderate to strong diffuse p16 immunostaining and HPV positivity for the diagnosis of VIN 3 and of basaloid or warty SCC was 97% and 95%, respectively. Conversely, 94% of keratinizing SCC contained heterogeneous staining, and when present, it was strictly cytoplasmic and frequently localized to the cells at the epithelial-stromal interface. Benign squamous epithelia were p16 negative, with the exception of lichen sclerosus, which contained focal and heterogeneously p16 positive in 42%. As in the cervix, intense diffuse p16 expression supports an HPV-related neoplastic process in vulvar neoplasia, irrespective of the level of differentiation. Up-regulation of p16 at the epithelial-stromal interface in HPV negative keratinizing SCCs is consistent with an HPV-independent response to alterations associated with invasion. These disparate patterns of p16 expression underscore 2 different mechanisms for p16 expression in HPV-related and HPV-unrelated vulvar carcinomas.

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

PubMed Central

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Oncogenic functions of tumour suppressor p21(Waf1/Cip1/Sdi1): association with cell senescence and tumour-promoting activities of stromal fibroblasts.

PubMed

Roninson, Igor B

2002-05-08

p21(Waf1/Cip1/Sdi1) is best known as a broad-specificity inhibitor of cyclin/cyclin-dependent kinase complexes, but p21 also interacts with many other regulators of transcription or signal transduction. p21 induction, which is mediated by p53 and by p53-independent mechanisms, is essential for the onset of cell cycle arrest in damage response and cell senescence. The effects of p21 knockout in mice and its expression patterns in human cancer are consistent with a role for p21 as both a tumour suppressor and an oncogene. Several functions of p21 are likely to promote carcinogenesis and tumour progression. These include endoreduplication and abnormal mitosis that develop in tumour cells after release from p21-induced growth arrest, the ability of p21 to inhibit apoptosis through several different mechanisms, and its ability to stimulate transcription of secreted factors with mitogenic and anti-apoptotic activities. The latter effects of p21 show close resemblance to paracrine activities of senescent cells and to tumour-promoting functions of stromal fibroblasts. Therapeutic strategies targeting the oncogenic consequences of p21 expression may provide a new approach to chemoprevention and treatment of cancer.

Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

PubMed Central

el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

1997-01-01

We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

PubMed Central

Stegh, Alexander H.

2012-01-01

Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

Mutant p53 protein localized in the cytoplasm inhibits autophagy.

PubMed

Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

2008-10-01

The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*

PubMed Central

Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi

2011-01-01

Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

PubMed Central

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

PubMed

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

Level of PAX5 in differential diagnosis of non-Hodgkin's lymphoma

PubMed Central

Bharti, Brij; Shukla, Sachin; Tripathi, Ratnakar; Mishra, Suman; Kumar, Mohan; Pandey, Manoj; Mishra, Rajnikant

2016-01-01

Background & objectives: The PAX5, a paired box transcription factor and B-cell activator protein (BSAP), activates B-cell commitment genes and represses non-B-cell lineage genes. About 14 transcript variants of PAX5 have been observed in human. Any alteration in its expression pattern leads to lymphogenesis or associated diseases and carcinogenesis in non-lymphoid tissues. Its mechanisms of function in pathophysiology of non-Hodgkin's lymphoma (NHL) are unclear. This study was intended to explore influence of PAX5 in cascade of NHL pathogenesis and diagnosis. Methods: Samples of 65 patients were evaluated by immunohistochemical staining for cellular localization of PAX5, CD19, CD3, cABL, p53, Ras and Raf and by TUNEL assay, RNA-isolation and reverse transcriptase (RT)-PCR, Western blot analysis, and lactate dehydrogenase (LDH) specific staining. Results: B-cell type NHL patients were positive for PAX5, p53, Ras, CD19, Raf and CD3. All of them showed TUNEL-positive cells. The differential expression pattern of PAX5, CD19, p53, CD3, ZAP70, HIF1α, Ras, Raf and MAPK (mitogen-activated protein kinase) at the levels of transcripts and proteins was observed. The LDH assay showed modulation of LDH4 and LDH5 isoforms in the lymph nodes of NHL patients. Interpretation & conclusions: The histological observations suggested that the patients represent diverse cases of NHL like mature B-cell type, mature T-cell type and high grade diffuse B-cell type NHL. The findings indicate that patients with NHL may also be analyzed for status of PAX5, CD19 and ZAP70, and their transcriptional and post-translational variants for the differential diagnosis of NHL and therapy. PMID:27748274

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

PubMed

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Activation of mTORC1/mTORC2 signaling in pediatric low-grade glioma and pilocytic astrocytoma reveals mTOR as a therapeutic target

PubMed Central

Hütt-Cabezas, Marianne; Karajannis, Matthias A.; Zagzag, David; Shah, Smit; Horkayne-Szakaly, Iren; Rushing, Elisabeth J.; Cameron, J. Douglas; Jain, Deepali; Eberhart, Charles G.; Raabe, Eric H.; Rodriguez, Fausto J.

2013-01-01

Background Previous studies support a role for mitogen-activated protein kinase pathway signaling, and more recently Akt/mammalian target of rapamycin (mTOR), in pediatric low-grade glioma (PLGG), including pilocytic astrocytoma (PA). Here we further evaluate the role of the mTORC1/mTORC2 pathway in order to better direct pharmacologic blockade in these common childhood tumors. Methods We studied 177 PLGGs and PAs using immunohistochemistry and tested the effect of mTOR blockade on 2 PLGG cell lines (Res186 and Res259) in vitro. Results Moderate (2+) to strong (3+) immunostaining was observed for pS6 in 107/177 (59%) PAs and other PLGGs, while p4EBP1 was observed in 35/115 (30%), pElF4G in 66/112 (59%), mTOR (total) in 53/113 (47%), RAPTOR (mTORC1 component) in 64/102 (63%), RICTOR (mTORC2 component) in 48/101 (48%), and pAkt (S473) in 63/103 (61%). Complete phosphatase and tensin homolog protein loss was identified in only 7/101 (7%) of cases. In PA of the optic pathways, compared with other anatomic sites, there was increased immunoreactivity for pS6, pElF4G, mTOR (total), RICTOR, and pAkt (P < .05). We also observed increased pS6 (P = .01), p4EBP1 (P = .029), and RICTOR (P = .05) in neurofibromatosis type 1 compared with sporadic tumors. Treatment of the PLGG cell lines Res186 (PA derived) and Res259 (diffuse astrocytoma derived) with the rapalog MK8669 (ridaforolimus) led to decreased mTOR pathway activation and growth. Conclusions These findings suggest that the mTOR pathway is active in PLGG but varies by clinicopathologic subtype. Additionally, our data suggest that mTORC2 is differentially active in optic pathway and neurofibromatosis type 1–associated gliomas. MTOR represents a potential therapeutic target in PLGG that merits further investigation. PMID:24203892

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

Kinetics of lipogenic genes expression in milk purified mammary epithelial cells (MEC) across lactation and their correlation with milk and fat yield in buffalo.

PubMed

Yadav, Poonam; Kumar, Parveen; Mukesh, Manishi; Kataria, R S; Yadav, Anita; Mohanty, A K; Mishra, B P

2015-04-01

Expression patterns of lipogenic genes (LPL, ABCG2, ACSS2, ACACA, SCD, BDH, LIPIN1, SREBF1, PPARα and PPARγ) were studied in milk purified MEC across different stages of lactation (15, 30, 45, 60, 90, 120 and 240 days relative to parturition) in buffalo. PPARα was the most abundant gene while ABCG2 and ACSS2 had moderate level of expression; whereas expression of SREBF and PPARγ was very low. The expression patterns of some genes (BDH1, ACSS2, and LIPIN1) across lactation were positively correlated with milk yield while negatively correlated with fat yield. SCD also showed weak correlation with milk yield (p, 0.53) and fat yield (p, -0.47). On the other hand, expression pattern of ACACA was negatively correlated with milk yield (p, -0.88) and positively correlated with fat yield (p, 0.62). Strong correlation was observed between genes involved in de novo milk fat synthesis (BDH1, ACSS2, LIPIN2 and SCD) and milk yield. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cyclo-oxygenase 2 expression is associated with angiogenesis and lymph node metastasis in human breast cancer.

PubMed

Costa, C; Soares, R; Reis-Filho, J S; Leitão, D; Amendoeira, I; Schmitt, F C

2002-06-01

Cyclo-oxygenases 1 and 2 (COX-1 and COX-2) are key enzymes in prostaglandin biosynthesis. COX-2 is induced by a wide variety of stimuli, and present during inflammation. COX-2 overexpression has been observed in colon, head and neck, lung, prostate, stomach, and breast cancer. In colon and gastric cancer, COX-2 expression was associated with angiogenesis. The aim of this study was to determine the relation between COX-2 expression and angiogenesis in breast cancer, and to correlate the expression of this enzyme with classic clinicopathological parameters. COX-2 expression was investigated by immunohistochemistry and western blotting analysis. The expression of COX-2 was then related to age, histological grade, nodal status, oestrogen receptor status, p53 expression,c-erb-B2 overexpression, mitotic counts, MIB-1 labelling index, apoptotic index, sialyl-Tn expression, transforming growth factor alpha expression, microvessel density, and disease free survival in 46 patients with invasive ductal breast carcinoma. By means of immunohistochemistry, COX-2 expression was detected in eight of the 46 carcinomas studied. Western blotting showed COX-2 protein expression in the same breast tumours, but not in normal adjacent tissues. The density of microvessels immunostained with anti-F-VIII related antigen was significantly higher in patients with COX-2 expression than in those without expression (p = 0.03). In addition, COX-2 was significantly associated with the presence of sialyl-Tn expression (p = 0.02), lymph node metastasis (p = 0.03), a high apoptotic index (p = 0.03), and a short disease free survival (p = 0.03) in univariate analyses. These data suggest that COX-2 expression is associated with angiogenesis, lymph node metastasis, and apoptosis in human breast cancer. Moreover, these results warrant further studies with larger series of patients to confirm the association with short disease free survival in patients with breast cancer.

Integration of HPV6 and Downregulation of AKR1C3 Expression Mark Malignant Transformation in a Patient with Juvenile-Onset Laryngeal Papillomatosis

PubMed Central

Kolligs, Jutta; Vent, Julia; Stenner, Markus; Wieland, Ulrike; Silling, Steffi; Drebber, Uta; Speel, Ernst-Jan M.; Klussmann, Jens Peter

2013-01-01

Juvenile-onset recurrent respiratory papillomatosis (RRP) is associated with low risk human papillomavirus (HPV) types 6 and 11. Malignant transformation has been reported solely for HPV11-associated RRP in 2–4% of all RRP-cases, but not for HPV6. The molecular mechanisms in the carcinogenesis of low risk HPV-associated cancers are to date unknown. We report of a female patient, who presented with a laryngeal carcinoma at the age of 24 years. She had a history of juvenile-onset RRP with an onset at the age of three and subsequently several hundred surgical interventions due to multiple recurrences of RRP. Polymerase chain reaction (PCR) or bead-based hybridization followed by direct sequencing identified HPV6 in tissue sections of previous papilloma and the carcinoma. P16INK4A, p53 and pRb immunostainings were negative in all lesions. HPV6 specific fluorescence in situ hybridization (FISH) revealed nuclear staining suggesting episomal virus in the papilloma and a single integration site in the carcinoma. Integration-specific amplification of papillomavirus oncogene transcripts PCR (APOT-PCR) showed integration in the aldo-keto reductase 1C3 gene (AKR1C3) on chromosome 10p15.1. ArrayCGH detected loss of the other gene copy as part of a deletion at 10p14-p15.2. Western blot analysis and immunohistochemistry of the protein AKR1C3 showed a marked reduction of its expression in the carcinoma. In conclusion, we identified a novel molecular mechanism underlying a first case of HPV6-associated laryngeal carcinoma in juvenile-onset RRP, i.e. that HPV6 integration in the AKR1C3 gene resulted in loss of its expression. Alterations of AKR1C gene expression have previously been implicated in the tumorigenesis of other (HPV-related) malignancies. PMID:23437342

A stapled p53 helix overcomes HDMX-mediated suppression of p53.

PubMed

Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D

2010-11-16

Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.

MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

PubMed

Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

2018-04-17

The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

Mutation at p53 serine 389 does not rescue the embryonic lethality in mdm2 or mdm4 null mice.

PubMed

Iwakuma, Tomoo; Parant, John M; Fasulo, Mark; Zwart, Edwin; Jacks, Tyler; de Vries, Annemieke; Lozano, Guillermina

2004-10-07

Mdm2 and its homolog Mdm4 inhibit the function of the tumor suppressor p53. Targeted disruption of either mdm2 or mdm4 genes in mice results in embryonic lethality that is completely rescued by concomitant deletion of p53, suggesting that deletion of negative regulators of p53 results in a constitutively active p53. Thus, these mouse models offer a unique in vivo system to assay the functional significance of different p53 modifications. Phosphorylation of serine 389 in murine p53 occurs specifically after ultraviolet-light-induced DNA damage, and phosphorylation of this site enhances p53 activity both in vitro and in vivo. Recently, mice with a serine to alanine substitution at serine 389 (p53S389A) in the endogenous p53 locus were generated. To examine the in vivo significance of serine 389 phosphorylation during embryogenesis, we crossed these mutant mice to mice lacking mdm2 or mdm4. The p53S389A allele did not alter the embryonic lethality of mdm2 or mdm4. Additional crosses to assay the effect of one p53S389A allele with a p53 null allele also did not rescue the lethal phenotypes. In conclusion, the phenotypes due to loss of mdm2 or mdm4 were not even partially rescued by p53S389A, suggesting that p53S389A is functionally wild type during embryogenesis.

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

Patterns of Gene Expression Associated with Recovery and Injury in Heat-stressed Rats

DTIC Science & Technology

2014-12-03

Schultz CR, Golembieski WA, King DA, Brown SL, Brodie C, Rempel SA: Inhibition of HSP27 alone or in combination with pAKT inhibition as therapeutic...Extracellular HSP27 acts as a signaling molecule to activate NF-kappaB in macrophages. Cell Stress Chaperones 2013, 18(1):53–63. 68. Thompson MR, Xu D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting

Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

The chemotherapeutic agent paclitaxel selectively impairs reversal learning while sparing prior learning, new learning and episodic memory.

PubMed

Panoz-Brown, Danielle; Carey, Lawrence M; Smith, Alexandra E; Gentry, Meredith; Sluka, Christina M; Corbin, Hannah E; Wu, Jie-En; Hohmann, Andrea G; Crystal, Jonathon D

2017-10-01

Chemotherapy is widely used to treat patients with systemic cancer. The efficacy of cancer therapies is frequently undermined by adverse side effects that have a negative impact on the quality of life of cancer survivors. Cancer patients who receive chemotherapy often experience chemotherapy-induced cognitive impairment across a variety of domains including memory, learning, and attention. In the current study, the impact of paclitaxel, a taxane derived chemotherapeutic agent, on episodic memory, prior learning, new learning, and reversal learning were evaluated in rats. Neurogenesis was quantified post-treatment in the dentate gyrus of the same rats using immunostaining for 5-Bromo-2'-deoxyuridine (BrdU) and Ki67. Paclitaxel treatment selectively impaired reversal learning while sparing episodic memory, prior learning, and new learning. Furthermore, paclitaxel-treated rats showed decreases in markers of hippocampal cell proliferation, as measured by markers of cell proliferation assessed using immunostaining for Ki67 and BrdU. This work highlights the importance of using multiple measures of learning and memory to identify the pattern of impaired and spared aspects of chemotherapy-induced cognitive impairment. Copyright © 2017 Elsevier Inc. All rights reserved.

Regulation of autophagy by cytoplasmic p53.

PubMed

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

PubMed

Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

1999-12-01

The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy, not only in human gliomas that express mutant p53, but also in those that express wild-type p53.

Immunoexpression of p16 in uterine leiomyomas with infarct-type necrosis: an analysis of 35 cases.

PubMed

Ip, Philip P; Lim, Diana; Cheung, Annie N Y; Oliva, Esther

2017-11-01

Uterine leiomyosarcomas frequently show p16 immunoexpression. However, p16 may also be expressed in some benign leiomyoma variants such as leiomyomas with bizarre nuclei and cellular leiomyomas, limiting its utility as a biomarker to distinguish between benign and malignant neoplasms. We investigated p16 expression in leiomyomas with infarct-type necrosis, tumours which may sometimes be misinterpreted as smooth muscle tumours of uncertain malignant potential or even leiomyosarcoma on conventional light microscopy. p16 immunostaining was performed on 35 leiomyomas with infarct-type necrosis and the staining pattern was analysed. Staining was classified as absent, scattered/isolated, <33-, 33-66- or >66%-positive cells, and was assessed in the areas immediately surrounding and distant from the infarct. The median age of patients was 44 years. Seventeen had hormonal/non-hormonal drugs and three were pregnant. The median tumour size was 7.25 cm. The mean mitotic count was 0.9/10 high-power fields. Only one tumour had multifocal mild nuclear atypia. Positive p16 was noted in 34 of 35 (97.2%) tumours. It was typically patchy, and was concentrated in areas immediately surrounding the necrosis. Distant from the necrosis, p16 positivity was seen predominantly in scattered/isolated cells. One tumour without any worrisome microscopic features showed diffuse p16 positivity throughout. Median follow-up was 55 months, and none of the patients experienced any recurrence. p16 expression in benign uterine smooth muscle tumours with infarct-type necrosis is common. The staining is particularly concentrated adjacent to areas of necrosis. It is important to be aware of this potential pitfall when interpreting p16 expression. © 2017 John Wiley & Sons Ltd.

Targeted p120-Catenin Ablation Disrupts Dental Enamel Development

PubMed Central

Bartlett, John D.; Dobeck, Justine M.; Tye, Coralee E.; Perez-Moreno, Mirna; Stokes, Nicole; Reynolds, Albert B.; Fuchs, Elaine; Skobe, Ziedonis

2010-01-01

Dental enamel development occurs in stages. The ameloblast cell layer is adjacent to, and is responsible for, enamel formation. When rodent pre-ameloblasts become tall columnar secretory-stage ameloblasts, they secrete enamel matrix proteins, and the ameloblasts start moving in rows that slide by one another. This movement is necessary to form the characteristic decussating enamel prism pattern. Thus, a dynamic system of intercellular interactions is required for proper enamel development. Cadherins are components of the adherens junction (AJ), and they span the cell membrane to mediate attachment to adjacent cells. p120 stabilizes cadherins by preventing their internalization and degradation. So, we asked if p120-mediated cadherin stability is important for dental enamel formation. Targeted p120 ablation in the mouse enamel organ had a striking effect. Secretory stage ameloblasts detached from surrounding tissues, lost polarity, flattened, and ameloblast E- and N-cadherin expression became undetectable by immunostaining. The enamel itself was poorly mineralized and appeared to be composed of a thin layer of merged spheres that abraded from the tooth. Significantly, p120 mosaic mouse teeth were capable of forming normal enamel demonstrating that the enamel defects were not a secondary effect of p120 ablation. Surprisingly, blood-filled sinusoids developed in random locations around the developing teeth. This has not been observed in other p120-ablated tissues and may be due to altered p120-mediated cell signaling. These data reveal a critical role for p120 in tooth and dental enamel development and are consistent with p120 directing the attachment and detachment of the secretory stage ameloblasts as they move in rows. PMID:20862276

[Comparison of the dietary phytosterols intake and serum lipids content in elderly women from three cities of China].

PubMed

Han, Jun-hua; Li, Yan-ping; Men, Jian-hua; Yu, Wen-tao; Yang, Yue-xin

2009-12-01

To investigate the dietary phytosterol intake of elderly women in three different cities of China, and to compare the main dietary sources, so that to discuss the relationship of dietary phytosterol intake and serum lipids. Based on the dietary pattern, women more than 50 years old from Beijing, Hefei and Urumchi were chosen as testers, 80 - 100 people for each city respectively. The dietary survey was done by continues 24 hours review of two days, the plant food were collected and the phytosterol content (include beta-sitosterol, campesterol, stigmasterol, sitostanol) were analyzed by GC methods, the total phytosterols content were calculated. The dietary phytosterol intake were calculated and serum lipids were also analyzed in all the testers. Testers from Beijing, Hefei and Urumchi were 100, 101 and 84 respectively. The average dietary phytosterol intake of people in Beijing and Hefei were 340.3 mg/d and 313.5 mg/d, the main sources were plant oil and cereals, while the average dietary phytosterol intake of people in Urumchi were 550.4 mg/d, higher than the other two cities (t values were 9.369, 10.420, respectively, both P values < 0.01), the main source in Urumchi was cereal (provide 53.1% of the total phytosterol intake). The laboratory results showed, testers in Urumchi had significantly lower serum TC content ((4.04 +/- 0.78) mmol/L) than that in Beijing ((4.89 +/- 0.91) mmol/L) and Hefei ((4.71 +/- 0.83) mmol/L) (t value were 6.766 and 5.401 respectively, both P values < 0.01); serum TG content in Urumchi((1.01 +/- 0.48) mmol/L) was also lower than that in Beijing ((1.31 +/- 0.53) mmol/L) and Hefei ((1.66 +/- 0.75) mmol/L) (t values were 3.343 and 7.293 respectively, both P values < 0.01); the serum glucose is also lower in testers in Urumchi ((5.02 +/- 2.18) mmol/L) compared with testers in Beijing ((5.69 +/- 1.53) mmol/L, t = 2.561, P < 0.05) and Hefei ((5.78 +/- 1.53) mmol/L, t = 2.934, P < 0.01). Different dietary pattern result in significantly different dietary phytosterol intake in elder women in three cities, higher, phytosterol intake seemed to contribute to lower serum lipids.

Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

PubMed Central

Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

2017-01-01

Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

Increased Detection of Lymphatic Vessel Invasion by D2-40 (Podoplanin) in Early Breast Cancer: Possible Influence on Patient Selection for Accelerated Partial Breast Irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Debald, Manuel, E-mail: debald@uni-bonn.d; Poelcher, Martin; Flucke, Uta

2010-07-15

Purpose: Several international trials are currently investigating accelerated partial breast irradiation (APBI) for patients with early-stage breast cancer. According to existing guidelines, patients with lymphatic vessel invasion (LVI) do not qualify for APBI. D2-40 (podoplanin) significantly increases the frequency of LVI detection compared with conventional hematoxylin and eosin (HE) staining in early-stage breast cancer. Our purpose was to retrospectively assess the hypothetical change in management from APBI to whole breast radiotherapy with the application of D2-40. Patients and Methods: Immunostaining with D2-40 was performed on 254 invasive breast tumors of 247 patients. The following criteria were used to determine themore » eligibility for APBI: invasive ductal adenocarcinoma of {<=}3 cm, negative axillary node status (N0), and unifocal disease. Of the 247 patients, 74 with available information concerning LVI, as detected by D2-40 immunostaining and routine HE staining, formed our study population. Results: Using D2-40, our results demonstrated a significantly greater detection rate (p = .031) of LVI compared with routine HE staining. LVI was correctly identified by D2-40 (D2-40-positive LVI) in 10 (13.5%) of 74 tumors. On routine HE staining, 4 tumors (5.4%) were classified as HE-positive LVI. Doublestaining of these specimens with D2-40 unmasked false-positive LVI status in 2 (50%) of the 4 tumors. According to the current recommendations for APBI, immunostaining with D2-40 would have changed the clinical management from APBI to whole breast radiotherapy in 8 (10.8%) of 74 patients and from whole breast radiotherapy to APBI in 2 patients (2.7%). Conclusion: These data support the implementation of D2-40 immunostaining in the routine workup to determine a patient's eligibility for APBI.« less

The impact of p53 on the early stage replication of retrovirus.

PubMed

Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan

2017-08-09

The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.

MicroRNAs as Key Effectors in the p53 Network.

PubMed

Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni

2017-01-01

The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.

Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

PubMed

Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

2015-01-01

Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis.

PubMed

Rigby, Cynthia M; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K; Dhar, Deepanshi; Orlicky, David J; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53 +/- ) and p53 knockout (p53 -/- ) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53 +/+ mice, p53 +/- mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53 +/+ mice but silibinin' protective efficacy was significantly compromised in p53 +/- mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53 -/- mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53 +/+ mice while its efficacy was partially compromised in p53 -/- mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis

PubMed Central

Rigby, Cynthia M.; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K.; Dhar, Deepanshi; Orlicky, David J.; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53+/−) and p53 knockout (p53−/−) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53+/+ mice, p53+/− mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53+/+ mice but silibinin’ protective efficacy was significantly compromised in p53+/− mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53−/− mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53+/+ mice while its efficacy was partially compromised in p53−/− mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. PMID:27729375

Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

PubMed Central

Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

2015-01-01

Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

PubMed

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-02-11

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

PubMed Central

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.

PubMed

La Perle, K M; Jhiang, S M; Capen, C C

2000-08-01

Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Functional activation of mutant p53V172F by platinum analogs in cisplatin-resistant human tumor cells is dependent on serine-20 phosphorylation

PubMed Central

Xie, Xiaolei; He, Guangan; Siddik, Zahid H.

2017-01-01

Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409

Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

PubMed Central

Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

2009-01-01

Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

Evidence for the presence of serotonin in Mysidacea (Crustacea, Peracarida) as revealed by fluorescence immunohistochemistry.

PubMed

Moreau, X; Benzid, D; De Jong, L; Barthélémy, R-M; Casanova, J-P

2002-12-01

In crustaceans, serotonin (5-HT) exerts a wide range of physiological actions on many tissues. However, 5-HT has not been detected to date in Mysidacea (Crustacea, Peracarida). We have investigated the presence of 5-HT in the brain and the eyestalks of two Mysida (Leptomysis lingvura, Hemimysis margalefi) and one Lophogastrida (Lophogaster typicus) species by using the immunohistofluorescence technique. 5-HT-like immunopositive areas exhibit a similar pattern in the three species. 5-HT-like immunostaining is present in the retinular photosensitive cells, except in the deep-living species L. typicus. 5-HT-like cell bodies and fibres are observed in the lamina ganglionaris and in the three medullae. In the sinus gland, only 5-HT-like endings are detected. In the eyestalks, 5-HT-like fibres detected in the optic tract link with the protocerebrum, in which 5-HT-like somata and their extensions are found. Some neurones are detected in the anterior median cell cluster, in the protocerebral bridge and in the central body. In the deutocerebrum, the paracentral lobes are connected by immunoreactive fibres that run along the deutocerebral commissure. The glomeruli of the olfactory lobes exhibit strong diffuse immunostaining. Beside and in the median part of the deutocerebrum, at least two large serotoninergic neurones project their axons into the olfactory lobe cell cluster. Immunoreactive fibres are also found in the antennular neuropiles. Our results demonstrate the presence of 5-HT-like cell bodies and fibres in Mysidacea. The distribution patterns of the 5-HT immunoreactivity found herein are compared with those of other peracarids and decapods.

The impact of p53 protein core domain structural alteration on ovarian cancer survival.

PubMed

Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E

2003-09-15

Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.

CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

PubMed

He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

2016-01-01

The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

Regulation of branchial V-H(+)-ATPase, Na(+)/K(+)-ATPase and NHE2 in response to acid and base infusions in the Pacific spiny dogfish (Squalus acanthias).

PubMed

Tresguerres, Martin; Katoh, Fumi; Fenton, Heather; Jasinska, Edyta; Goss, Greg G

2005-01-01

To study the mechanisms of branchial acid-base regulation, Pacific spiny dogfish were infused intravenously for 24 h with either HCl (495+/- 79 micromol kg(-1) h(-1)) or NaHCO(3) (981+/-235 micromol kg(-1) h(-1)). Infusion of HCl produced a transient reduction in blood pH. Despite continued infusion of acid, pH returned to normal by 12 h. Infusion of NaHCO(3) resulted in a new steady-state acid-base status at approximately 0.3 pH units higher than the controls. Immunostained serial sections of gill revealed the presence of separate vacuolar proton ATPase (V-H(+)-ATPase)-rich or sodium-potassium ATPase (Na(+)/K(+)-ATPase)-rich cells in all fish examined. A minority of the cells also labeled positive for both transporters. Gill cell membranes prepared from NaHCO(3)-infused fish showed significant increases in both V-H(+)-ATPase abundance (300+/-81%) and activity. In addition, we found that V-H(+)-ATPase subcellular localization was mainly cytoplasmic in control and HCl-infused fish, while NaHCO(3)-infused fish demonstrated a distinctly basolateral staining pattern. Western analysis in gill membranes from HCl-infused fish also revealed increased abundance of Na(+)/H(+) exchanger 2 (213+/-5%) and Na(+)/K(+)-ATPase (315+/-88%) compared to the control.

Feline morbillivirus, a previously undescribed paramyxovirus associated with tubulointerstitial nephritis in domestic cats

PubMed Central

Woo, Patrick C. Y.; Lau, Susanna K. P.; Wong, Beatrice H. L.; Fan, Rachel Y. Y.; Wong, Annette Y. P.; Zhang, Anna J. X.; Wu, Ying; Choi, Garnet K. Y.; Li, Kenneth S. M.; Hui, Janet; Wang, Ming; Zheng, Bo-Jian; Chan, K. H.; Yuen, Kwok-Yung

2012-01-01

We describe the discovery and isolation of a paramyxovirus, feline morbillivirus (FmoPV), from domestic cat (Felis catus). FmoPV RNA was detected in 56 (12.3%) of 457 stray cats (53 urine, four rectal swabs, and one blood sample) by RT-PCR. Complete genome sequencing of three FmoPV strains showed genome sizes of 16,050 bases, the largest among morbilliviruses, because of unusually long 5′ trailer sequences of 400 nt. FmoPV possesses identical gene contents (3′-N-P/V/C-M-F-H-L-5′) and is phylogenetically clustered with other morbilliviruses. IgG against FmoPV N protein was positive in 49 sera (76.7%) of 56 RT-PCR–positive cats, but 78 (19.4%) of 401 RT-PCR–negative cats (P < 0.0001) by Western blot. FmoPV was isolated from CRFK feline kidney cells, causing cytopathic effects with cell rounding, detachment, lysis, and syncytia formation. FmoPV could also replicate in subsequent passages in primate Vero E6 cells. Infected cell lines exhibited finely granular and diffuse cytoplasmic fluorescence on immunostaining for FmoPV N protein. Electron microscopy showed enveloped virus with typical “herringbone” appearance of helical N in paramyxoviruses. Histological examination of necropsy tissues in two FmoPV-positive cats revealed interstitial inflammatory infiltrate and tubular degeneration/necrosis in kidneys, with decreased cauxin expression in degenerated tubular epithelial cells, compatible with tubulointerstitial nephritis (TIN). Immunohistochemical staining revealed FmoPV N protein-positive renal tubular cells and mononuclear cells in lymph nodes. A case-control study showed the presence of TIN in seven of 12 cats with FmoPV infection, but only two of 15 cats without FmoPV infection (P < 0.05), suggesting an association between FmoPV and TIN. PMID:22431644

Different DNA damage and cell cycle checkpoint control in low- and high-risk human papillomavirus infections of the vulva.

PubMed

Santegoets, Lindy A M; van Baars, Romy; Terlou, Annelinde; Heijmans-Antonissen, Claudia; Swagemakers, Sigrid M A; van der Spek, Peter J; Ewing, Patricia C; van Beurden, Marc; van der Meijden, Willem I; Helmerhorst, Theo J M; Blok, Leen J

2012-06-15

Human papillomavirus (HPV) infections may result in benign hyperplasia, caused by low-risk HPV types, or (pre)malignant lesions caused by high-risk HPV types. The molecular basis of this difference in malignant potential is not completely understood. Here, we performed gene profiling of different HPV infected vulvar tissues (condylomata acuminata (n = 5), usual type vulvar intraepithelial neoplasia (uVIN) (n = 9)) and control samples (n = 14) using Affymetrix Human U133A plus 2 GeneChips. Data were analyzed using OmniViz®, Partek® and Ingenuity® Software. Results were validated by real-time RT-PCR and immunostaining. Although similarities were observed between gene expression profiles of low- and high-risk HPV infected tissues (e.g., absence of estrogen receptor in condylomata and uVIN), high-risk HPV infected tissues showed more proliferation and displayed more DNA damage than tissues infected with low-risk HPV. These observations were confirmed by differential regulation of cell cycle checkpoints and by increased expression of DNA damage-biomarkers p53 and γH2AX. Furthermore, FANCA, FANCD2, BRCA1 and RAD51, key players in the DNA damage response, were significantly upregulated (p < 0.05). In addition, we compared our results with publicly available gene expression profiles of various other HPV-induced cancers (vulva, cervix and head-and-neck). This showed p16(INK4a) was the most significant marker to detect a high-risk HPV infection, but no other markers could be found. In conclusion, this study provides insight into the molecular basis of low- and high-risk HPV infections and indicates two main pathways (cell cycle and DNA damage response) that are much stronger affected by high-risk HPV as compared to low-risk HPV. Copyright © 2011 UICC.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

PubMed

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

PubMed Central

2014-01-01

Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies. PMID:24927749

The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

PubMed

Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

2018-03-23

p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

2012-06-29

Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less

Relationship between conventional semen characteristics, sperm motility patterns and fertility of Andalusian donkeys (Equus asinus).

PubMed

Dorado, J; Acha, D; Ortiz, I; Gálvez, M J; Carrasco, J J; Díaz, B; Gómez-Arrones, V; Calero-Carretero, R; Hidalgo, M

2013-12-01

Sperm quality has an important role in determining fertility. The aims of this study were to compare the conventional sperm parameters, plus the characteristics of the motility patterns of the different sperm subpopulations, of donkey donors with different fertility level, and to determine their relationships to fertility. Thirty ejaculates from 6 Andalusian donkeys were assessed for gel-free volume, pH, sperm concentration, motility and morphology. The fertility of donkeys was classified on the basis of pregnancy rates per cycle, where donkeys with a per cycle pregnancy rate ≥60% were considered to be "fertile" (n=3) and those with a per cycle pregnancy rate <40% were categorized to be "sub-fertile" (n=3). Significant differences (P<0.001) between the "fertile" and the "sub-fertile" group were found for total and progressive motility, and for straight line velocity. Sperm variables associated (P<0.05) with an increase in percent pregnant per cycle included total motility (r=0.37), progressive motility (r=0.53), curvilinear velocity (r=0.44), straightness (r=0.39), beat cross frequency (r=0.44), and gel-free volume (r=0.53). Four sperm subpopulations (sP) were identified in fresh semen: sP1 (slow and non-progressive spermatozoa, 20%), sP2 (moderately slow but progressive spermatozoa, 71.2%), sP3 (highly active but non-progressive spermatozoa, 2.9%), and sP4 (highly active and progressive spermatozoa, 5.9%). The lowest percentage (3.1%; P<0.001) of sP4 spermatozoa was observed in the "sub-fertile" group. Three of the sperm subpopulations were related (P<0.05) to fertility (sP2, r=0.54; sP3, r=0.45; sP4, r=0.56). In conclusion, we were able to relate the fertility of donkeys with in vitro measures of sperm motility using computer-assisted sperm analysis techniques. Copyright © 2013 Elsevier B.V. All rights reserved.

Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

PubMed

Donehower, Lawrence A

2014-06-01

Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Molecular dynamics simulation of S100B protein to explore ligand blockage of the interaction with p53 protein

NASA Astrophysics Data System (ADS)

Zhou, Zhigang; Li, Yumin

2009-10-01

As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.

Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

PubMed

De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

2017-05-01

Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Techniques of Celloidin Removal From Temporal Bone Sections

PubMed Central

O’Malley, Jennifer T.; Burgess, Barbara J.; Jones, Diane D.; Adams, Joe C.; Merchant, Saumil N.

2009-01-01

Objectives We sought to determine whether the technique of celloidin removal influences the results of immunostaining in celloidin-embedded cochleae. Methods We compared four protocols of celloidin removal, including those using clove oil, acetone, ether-alcohol, and methanol saturated with sodium hydroxide. By optimally fixing our tissue (perfused mice), and keeping constant the fixative type (formalin plus acetic acid), fixation time (25 hours), and decalcification time (ethylenediaminetetraacetic acid for 7 days), we determined whether the technique of celloidin removal influenced the immunostaining results. Six antibodies were used with each removal method: prostaglandin D synthase, sodium, potassium adenosine triphosphatase (Na+,K+-ATPase), aquaporin 1, connective tissue growth factor, tubulin, and 200 kd neurofilament. Results Clove oil, acetone, and ether-alcohol resulted in incomplete removal of the celloidin, thereby negatively affecting the results of immunostaining. The methanol–sodium hydroxide method was effective in completely removing the celloidin; it produced the cleanest and most reproducible immunostaining for all six antibodies. Conclusions Freshly prepared methanol saturated with sodium hydroxide and diluted 1:2 with methanol was the best solvent for removing celloidin from mouse temporal bone sections, resulting in consistent and reproducible immunostaining with the six antibodies tested. PMID:19663375

The Role of Intrinsic Pathway in Apoptosis Activation and Progression in Peyronie's Disease

PubMed Central

Loreto, Carla; Caltabiano, Rosario; Vespasiani, Giuseppe; Castorina, Sergio; Ralph, David J.; Musumeci, Giuseppe; Djinovic, Rados; Sansalone, Salvatore

2014-01-01

Peyronie's disease (PD) is characterized with formation of fibrous plaques which result in penile deformity, pain, and erectile dysfunction. The aim of this study was to investigate the activation of the intrinsic apoptotic pathway in plaques from PD patients. Tunica albuginea from either PD or control patients was assessed for the expression of bax, bcl-2 and caspases 9 and 3 using immunohistochemistry and by measurement of apoptotic cells using TUNEL assay. Bax overexpression was observed in metaplastic bone tissue, in fibroblasts, and in myofibroblast of plaques from PD patients. Little or no bcl-2 immunostaining was detected in samples from either patients or controls. Caspase 3 immunostaining was very strong in fibrous tissue, in metaplasic bone osteocytes, and in primary ossification center osteoblasts. Moderate caspase 9 immunostaining was seen in fibrous cells plaques and in osteocytes and osteoblasts of primary ossification centers from PD patients. Control samples were negative for caspase 9 immunostaining. In PD patients the TUNEL immunoassay showed intense immunostaining of fibroblasts and myofibroblasts, the absence of apoptotic cells in metaplasic bone tissue and on the border between fibrous and metaplastic bone tissue. Apoptosis occurs in stabilized PD plaques and is partly induced by the intrinsic pathway. PMID:25197653

Effects of a single course versus repeated courses of antenatal corticosteroids on fetal growth, placental morphometry and the differential regulation of vascular endothelial growth factor.

PubMed

Elfayomy, Amr K; Almasry, Shaima M

2014-11-01

To investigate the impact of antenatal exposure to a single course or repeated courses of dexamethasone (DEX) on neonatal anthropometrics, placental morphometry and potential effect on maternal plasma levels and placental expression of vascular endothelial growth factor (VEGF). Pregnant women between 27 and 32 weeks of gestation who delivered between 28 and 40 weeks and received a single course (n = 38) or repeated courses (n = 33) of DEX were compared to gestational age-matched controls (n = 30). Maternal blood samples were obtained, and placental biopsy was taken. Area percent of VEGF immunostaining and villous capillarization index were evaluated using image analysis. Infants exposed to repeated courses of DEX were significantly associated with decreased birthweight, body length, head circumference and placental weight compared with controls (P = 0.011, P < 0.001, P = 0.004, P < 0.001, respectively) and with the group that received a single course of DEX (P = 0.021, P = 0.020, P = 0.049, P = 0.010, respectively). There was a significant decrease in maternal VEGF plasma levels and percentage of VEGF immunostained area after repeated courses of DEX compared with controls (P < 0.001 and P = 0.001, respectively) or a single course (P = 0.028 and P = 0.002, respectively). Notably, repeated courses of DEX impaired normal increase in villous capillarization index compared with controls or a single course (P = 0.001 and P = 0.041, respectively). Repeated antenatal courses of DEX compromised fetal and placental growth compared with a single course of DEX, and these effects were potentially mediated by altered maternal plasma levels and placental expression of VEGF with consequent decrease in placental vascularization. Because of continuing uncertainties, several key messages for clinicians are provided. © 2014 The Authors. Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology.

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

PubMed Central

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-01-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

PubMed

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-09-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

ROS-dependent activation of JNK converts p53 into an efficient inhibitor of oncogenes leading to robust apoptosis

PubMed Central

Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G

2014-01-01

Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150

Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

PubMed

Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

2003-09-17

The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

PubMed

Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

2015-08-18

p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

Mdm-2 binding and TAF(II)31 recruitment is regulated by hydrogen bond disruption between the p53 residues Thr18 and Asp21.

PubMed

Jabbur, James R; Tabor, Amy D; Cheng, Xiaodong; Wang, Hua; Uesugi, Motonari; Lozano, Guillermina; Zhang, Wei

2002-10-10

Analyses of five wild-type p53 containing cell lines revealed lineage specific differences in phosphorylation of Thr18 after treatment with ionizing (IR) or ultraviolet (UV) radiation. Importantly, Thr18 phosphorylation correlated with induction of the p53 downstream targets p21(Waf1/Cip1) (p21) and Mdm-2, suggesting a transactivation enhancing role. Thr18 phosphorylation has been shown to abolish side-chain hydrogen bonding between Thr18 and Asp21, an interaction necessary for stabilizing alpha-helical conformation within the transactivation domain. Mutagenesis-derived hydrogen bond disruption attenuated the interaction of p53 with the transactivation repressor Mdm-2 but had no direct effect on the interaction of p53 with the basal transcription factor TAF(II)31. However, prior incubation of p53 mutants with Mdm-2 modulated TAF(II)31 interaction with p53, suggesting Mdm-2 blocks the accessibility of p53 to TAF(II)31. Consistently, p53-null cells transfected with hydrogen bond disrupting p53 mutants demonstrated enhanced endogenous p21 expression, whereas p53/Mdm-2-double null cells exhibited no discernible differences in p21 expression. We conclude disruption of intramolecular hydrogen bonding between Thr18 and Asp21 enhances p53 transactivation by modulating Mdm-2 binding, facilitating TAF(II)31 recruitment.

Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

PubMed Central

Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

2006-01-01

The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

β-Catenin C-terminal signals suppress p53 and are essential for artery formation

PubMed Central

Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

2016-01-01

Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

PubMed

Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

2010-05-01

Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Human Cytomegalovirus Nuclear Egress Proteins Ectopically Expressed in the Heterologous Environment of Plant Cells are Strictly Targeted to the Nuclear Envelope.

PubMed

Lamm, Christian E; Link, Katrin; Wagner, Sabrina; Milbradt, Jens; Marschall, Manfred; Sonnewald, Uwe

2016-03-10

In all eukaryotic cells, the nucleus forms a prominent cellular compartment containing the cell's nuclear genome. Although structurally similar, animal and plant nuclei differ substantially in details of their architecture. One example is the nuclear lamina, a layer of tightly interconnected filament proteins (lamins) underlying the nuclear envelope of metazoans. So far no orthologous lamin genes could be detected in plant genomes and putative lamin-like proteins are only poorly described in plants. To probe for potentially conserved features of metazoan and plant nuclear envelopes, we ectopically expressed the core nuclear egress proteins of human cytomegalovirus pUL50 and pUL53 in plant cells. pUL50 localizes to the inner envelope of metazoan nuclei and recruits the nuclear localized pUL53 to it, forming heterodimers. Upon expression in plant cells, a very similar localization pattern of both proteins could be determined. Notably, pUL50 is specifically targeted to the plant nuclear envelope in a rim-like fashion, a location to which coexpressed pUL53 becomes strictly corecruited from its initial nucleoplasmic distribution. Using pUL50 as bait in a yeast two-hybrid screening, the cytoplasmic re-initiation supporting protein RISP could be identified. Interaction of pUL50 and RISP could be confirmed by coexpression and coimmunoprecipitation in mammalian cells and by confocal laser scanning microscopy in plant cells, demonstrating partial pUL50-RISP colocalization in areas of the nuclear rim and other intracellular compartments. Thus, our study provides strong evidence for conserved structural features of plant and metazoan nuclear envelops and identifies RISP as a potential pUL50-interacting plant protein.

Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

PubMed

Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

2018-05-18

The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

A new invertebrate member of the p53 gene family is developmentally expressed and responds to polychlorinated biphenyls.

PubMed Central

Jessen-Eller, Kathryn; Kreiling, Jill A; Begley, Gail S; Steele, Marjorie E; Walker, Charles W; Stephens, Raymond E; Reinisch, Carol L

2002-01-01

The cell-cycle checkpoint protein p53 both directs terminal differentiation and protects embryos from DNA damage. To study invertebrate p53 during early development, we identified three differentially expressed p53 family members (p53, p97, p120) in the surf clam, Spisula solidissima. In these mollusks, p53 and p97 occur in both embryonic and adult tissue, whereas p120 is exclusively embryonic. We sequenced, cloned, and characterized p120 cDNA. The predicted protein, p120, resembles p53 across all evolutionarily conserved regions and contains a C-terminal extension with a sterile alpha motif (SAM) as in p63 and p73. These vertebrate forms of p53 are required for normal inflammatory, epithelial, and neuronal development. Unlike clam p53 and p97, p120 mRNA and protein levels are temporally expressed in embryos, with mRNA levels decreasing with increasing p120 protein (R(2) = 0.97). Highest surf clam p120 mRNA levels coincide with the onset of neuronal growth. In earlier work we have shown that neuronal development is altered by exposure to polychlorinated biphenyls (PCBs), a neurotoxic environmental contaminant. In this study we show that PCBs differentially affect expression of the three surf clam p53 family members. p120 mRNA and protein are reduced the most and earliest in development, p97 protein shows a smaller and later reduction, and p53 protein levels do not change. For the first time we report that unlike p53 and p97, p120 is specifically embryonic and expressed in a time-dependent manner. Furthermore, p120 responds to PCBs by 48 hr when PCB-induced suppression of the serotonergic nervous system occurs. PMID:11940455

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

PubMed

Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

2016-09-06

The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication

PubMed Central

Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra

2017-01-01

Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53–induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262

Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas

PubMed Central

La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.

2000-01-01

Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169

The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment.

PubMed

Zhang, Qing-Yu; Jin, Rui; Zhang, Xian; Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

2016-10-25

Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53-/- cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin.

Mdm2 is required for survival of hematopoietic stem cells/progenitors via dampening of ROS-induced p53 activity

USDA-ARS?s Scientific Manuscript database

Mdm2 is an E3 ubiquitin ligase that targets p53 for degradation. p53(515C) (encoding p53R172P) is a hypomorphic allele of p53 that rescues the embryonic lethality of Mdm2(-/-) mice. Mdm2(-/-) p53(515C/515C) mice, however, die by postnatal day 13 resulting from hematopoietic failure. Hematopoietic st...

Exponential growth and selection in self-replicating materials from DNA origami rafts

NASA Astrophysics Data System (ADS)

He, Xiaojin; Sha, Ruojie; Zhuo, Rebecca; Mi, Yongli; Chaikin, Paul M.; Seeman, Nadrian C.

2017-10-01

Self-replication and evolution under selective pressure are inherent phenomena in life, and but few artificial systems exhibit these phenomena. We have designed a system of DNA origami rafts that exponentially replicates a seed pattern, doubling the copies in each diurnal-like cycle of temperature and ultraviolet illumination, producing more than 7 million copies in 24 cycles. We demonstrate environmental selection in growing populations by incorporating pH-sensitive binding in two subpopulations. In one species, pH-sensitive triplex DNA bonds enable parent-daughter templating, while in the second species, triplex binding inhibits the formation of duplex DNA templating. At pH 5.3, the replication rate of species I is ~1.3-1.4 times faster than that of species II. At pH 7.8, the replication rates are reversed. When mixed together in the same vial, the progeny of species I replicate preferentially at pH 7.8 similarly at pH 5.3, the progeny of species II take over the system. This addressable selectivity should be adaptable to the selection and evolution of multi-component self-replicating materials in the nanoscopic-to-microscopic size range.

Clinical significance of detecting circulating tumor cells in colorectal cancer using subtraction enrichment and immunostaining-fluorescence in situ hybridization (SE-iFISH)

PubMed Central

Shen, Zhen; Jing, Yan; Lu, Haibo; Li, Heng; Yang, Xiaoye; Cui, Xiangbin; Li, Yuqing; Lou, Zheng; Liu, Peng; Zhang, Cun; Zhang, Wei

2017-01-01

Circulating tumor cells (CTC) are useful in early detection of colorectal cancer. This study described a newly developed platform, integrated subtraction enrichment and immunostaining-fluorescence in situ hybridization (SE-iFISH), to assess CTCs in colorectal cancer. CTCs were detected by SE-iFISH in 40 of 44 preoperative colorectal cancer patients, and yielded a sensitivity of 90.9%, which was significantly higher than CellSearch system (90.9% vs. 43.2%, P=0.033). No significant association was found between tumor stage, survival and preoperative CTC number. CTCs were detected in 10 colorectal cancer patients one week after surgery; seven patients with decreased CTC numbers (compared with preoperative CTC number) were free of recurrence; whereas two of the three patients with increased CTC numbers had tumor recurrence. Moreover, CTCs were detected in 34 colorectal cancer patients three months after surgery; patients with CTC<2 at three months after surgery had significantly longer Progression Free Survival than those with CTC>=2 (P=0.019); patients with decreased CTC number (compared with preoperative CTC number) had significantly longer Progression Free Survival than those with increased CTC number (P=0.003). In conclusion, CTCs could be detected in various stages of colorectal cancer using SE-iFISH. Dynamic monitoring of CTC numbers could predict recurrence and prognosis. PMID:28423493

The small molecule 2-phenylethynesulfonamide induces covalent modification of p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent

p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less

Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

PubMed Central

Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

2012-01-01

Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

Therapeutic targeting of the p53 pathway in cancer stem cells

PubMed Central

Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

2013-01-01

Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

Regulation of autophagy by cytoplasmic p53

PubMed Central

Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2009-01-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

Amelogenins as Potential Buffers during Secretory-stage Amelogenesis

PubMed Central

Guo, J.; Lyaruu, D.M.; Takano, Y.; Gibson, C.W.; DenBesten, P.K.

2015-01-01

Amelogenins are the most abundant protein species in forming dental enamel, taken to regulate crystal shape and crystal growth. Unprotonated amelogenins can bind protons, suggesting that amelogenins could regulate the pH in enamel in situ. We hypothesized that without amelogenins the enamel would acidify unless ameloblasts were buffered by alternative ways. To investigate this, we measured the mineral and chloride content in incisor enamel of amelogenin-knockout (AmelX-/-) mice and determined the pH of enamel by staining with methyl-red. Ameloblasts were immunostained for anion exchanger-2 (Ae2), a transmembrane pH regulator sensitive for acid that secretes bicarbonate in exchange for chloride. The enamel of AmelX-/- mice was 10-fold thinner, mineralized in the secretory stage 1.8-fold more than wild-type enamel and containing less chloride (suggesting more bicarbonate secretion). Enamel of AmelX-/- mice stained with methyl-red contained no acidic bands in the maturation stage as seen in wild-type enamel. Secretory ameloblasts of AmelX-/- mice, but not wild-type mice, were immunopositive for Ae2, and stained more intensely in the maturation stage compared with wild-type mice. Exposure of AmelX-/- mice to fluoride enhanced the mineral content in the secretory stage, lowered chloride, and intensified Ae2 immunostaining in the enamel organ in comparison with non-fluorotic mutant teeth. The results suggest that unprotonated amelogenins may regulate the pH of forming enamel in situ. Without amelogenins, Ae2 could compensate for the pH drop associated with crystal formation. PMID:25535204

Familial Prion Disease with Alzheimer Disease-Like Tau Pathology and Clinical Phenotype

PubMed Central

Jayadev, Suman; Nochlin, David; Poorkaj, Parvoneh; Steinbart, Ellen J.; Mastrianni, James A.; Montine, Thomas J.; Ghetti, Bernardino; Schellenberg, Gerard D.; Bird, Thomas D.; Leverenz, James B.

2011-01-01

Objective To describe the Alzheimer disease (AD)-like clinical and pathological features, including marked neurofibrillary tangle (NFT) pathology, of a familial prion disease due to a rare nonsense mutation of the prion gene (PRNP). Methods Longitudinal clinical assessments were available for the proband and her mother. After death, both underwent neuropathological evaluation. PRNP was sequenced after failure to find immunopositive Aβ deposits in the proband and the documentation of prion protein (PrP) immunopositive pathology. Results The proband presented at age 42 years with a 3-year history of progressive short-term memory impairment and depression. Neuropsychological testing found impaired memory performance, with relatively preserved attention and construction. She was diagnosed with AD and died at age 47 years. Neuropathologic evaluation revealed extensive limbic and neocortical NFT formation and neuritic plaques consistent with a Braak stage of VI. The NFTs were immunopositive, with multiple tau antibodies, and electron microscopy revealed paired helical filaments. However, the neuritic plaques were immunonegative for Aβ, whereas immunostaining for PrP was positive. The mother of the proband had a similar presentation, including depression, and had been diagnosed clinically and pathologically as AD. Reevaluation of her brain tissue confirmed similar tau and PrP immunostaining findings. Genetic analysis revealed that both the proband and her mother had a rare PRNP mutation (Q160X) that resulted in the production of truncated PrP. Interpretation We suggest that PRNP mutations that result in a truncation of PrP lead to a prolonged clinical course consistent with a clinical diagnosis of AD and severe AD-like NFTs. PMID:21416485

Amelogenins as potential buffers during secretory-stage amelogenesis.

PubMed

Guo, J; Lyaruu, D M; Takano, Y; Gibson, C W; DenBesten, P K; Bronckers, A L J J

2015-03-01

Amelogenins are the most abundant protein species in forming dental enamel, taken to regulate crystal shape and crystal growth. Unprotonated amelogenins can bind protons, suggesting that amelogenins could regulate the pH in enamel in situ. We hypothesized that without amelogenins the enamel would acidify unless ameloblasts were buffered by alternative ways. To investigate this, we measured the mineral and chloride content in incisor enamel of amelogenin-knockout (AmelX(-/-)) mice and determined the pH of enamel by staining with methyl-red. Ameloblasts were immunostained for anion exchanger-2 (Ae2), a transmembrane pH regulator sensitive for acid that secretes bicarbonate in exchange for chloride. The enamel of AmelX(-/-) mice was 10-fold thinner, mineralized in the secretory stage 1.8-fold more than wild-type enamel and containing less chloride (suggesting more bicarbonate secretion). Enamel of AmelX(-/-) mice stained with methyl-red contained no acidic bands in the maturation stage as seen in wild-type enamel. Secretory ameloblasts of AmelX(-/-) mice, but not wild-type mice, were immunopositive for Ae2, and stained more intensely in the maturation stage compared with wild-type mice. Exposure of AmelX(-/-) mice to fluoride enhanced the mineral content in the secretory stage, lowered chloride, and intensified Ae2 immunostaining in the enamel organ in comparison with non-fluorotic mutant teeth. The results suggest that unprotonated amelogenins may regulate the pH of forming enamel in situ. Without amelogenins, Ae2 could compensate for the pH drop associated with crystal formation. © International & American Associations for Dental Research 2014.

Transcriptional inhibition of p21{sup WAF1/CIP1} gene (CDKN1) expression by survivin is at least partially p53-dependent: Evidence for survivin acting as a transcription factor or co-factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang

2012-05-04

Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less

The transcription factor p53: Not a repressor, solely an activator

PubMed Central

Fischer, Martin; Steiner, Lydia; Engeland, Kurt

2014-01-01

The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

PubMed

Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

2009-06-17

P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

PubMed Central

Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

2010-01-01

The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

Stimulation of autophagy by the p53 target gene Sestrin2.

PubMed

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

PubMed Central

Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

2012-01-01

Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

Friend or Foe: MicroRNAs in the p53 network.

PubMed

Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

2018-04-10

The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

PubMed

Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

2017-10-01

In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

PubMed

Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

2005-01-20

Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.

PubMed

Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar

2017-06-23

Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

PubMed Central

Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

2015-01-01

Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

Adenosine receptor distribution in Rhesus monkey ocular tissue.

PubMed

Beach, Krista M; Hung, Li-Fang; Arumugam, Baskar; Smith, Earl L; Ostrin, Lisa A

2018-05-21

Adenosine receptor (ADOR) antagonists, such as 7-methylxanthine (7-MX), have been shown to slow myopia progression in humans and animal models. Adenosine receptors are found throughout the body, and regulate the release of neurotransmitters such as dopamine and glutamate. However, the role of adenosine in eye growth is unclear. Evidence suggests that 7-MX increases scleral collagen fibril diameter, hence preventing axial elongation. This study used immunohistochemistry (IHC) and reverse-transcription quantitative polymerase chain reaction (RT-qPCR) to examine the distribution of the four ADORs in the normal monkey eye to help elucidate potential mechanisms of action. Eyes were enucleated from six Rhesus monkeys. Anterior segments and eyecups were separated into components and flash-frozen for RNA extraction or fixed in 4% paraformaldehyde and processed for immunohistochemistry against ADORA1, ADORA2a, ADORA2b, and ADORA3. RNA was reverse-transcribed, and qPCR was performed using custom primers. Relative gene expression was calculated using the ΔΔCt method normalizing to liver expression, and statistical analysis was performed using Relative Expression Software Tool. ADORA1 immunostaining was highest in the iris sphincter muscle, trabecular meshwork, ciliary epithelium, and retinal nerve fiber layer. ADORA2a immunostaining was highest in the corneal epithelium, trabecular meshwork, ciliary epithelium, retinal nerve fiber layer, and scleral fibroblasts. ADORA2b immunostaining was highest in corneal basal epithelium, limbal stem cells, iris sphincter, ciliary muscle, ciliary epithelium, choroid, isolated retinal ganglion cells and scattered scleral fibroblasts. ADORA3 immunostaining was highest in the iris sphincter, ciliary muscle, ciliary epithelium, choroid, isolated retinal ganglion cells, and scleral fibroblasts. Compared to liver mRNA, ADORA1 mRNA was significantly higher in the brain, retina and choroid, and significantly lower in the iris/ciliary body. ADORA2a expression was higher in brain and retina, ADORA2b expression was higher in retina, and ADORA3 was higher in the choroid. In conclusion, immunohistochemistry and RT-qPCR indicated differential patterns of expression of the four adenosine receptors in the ocular tissues of the normal non-human primate. The presence of ADORs in scleral fibroblasts and the choroid may support mechanisms by which ADOR antagonists prevent myopia. The potential effects of ADOR inhibition on both anterior and posterior ocular structures warrant investigation. Copyright © 2018 Elsevier Ltd. All rights reserved.

p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

2013-06-15

Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

Atypical Clinical Behavior of p16-Confirmed HPV-Related Oropharyngeal Squamous Cell Carcinoma Treated With Radical Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang Shaohui; Perez-Ordonez, Bayardo; Liu Feifei

Purpose: To report atypical clinical behavior observed in human papillomavirus (HPV)-related oropharyngeal carcinoma (OPC) treated with radiotherapy. Methods and Materials: A retrospective cohort study was conducted for all newly diagnosed OPC cases treated with radiotherapy on July 1, 2003 to April 30, 2009. HPV positivity was determined by p16 immunostaining in tumors. The incidence of additional malignancies and the pattern of distant metastases (DMs) were compared between the HPV-positive (HPV+) and HPV-negative (HPV-) cohorts. Results: HPV status was evaluated in 318 of 613 consecutive OPC cases (52%), showing 236 HPV+ and 82 HPV- patients. Compared with HPV-, HPV+ cases weremore » less likely to have additional malignancies (prior: 11% vs. 20%, p = 0.038; synchronous: 1% vs. 9%, p = 0.001; metachronous: 6% vs. 16%, p = 0.003). Whereas the majority (10 of 12) of HPV- additional head-and-neck (HN) mucosal malignancies were in the oral cavity, there was none (0 of 7) in the HPV+ cohort (p < 0.001). HPV+ synchronous HN second primaries (SPs) were in the supraglottis, post-cricoid, and nasopharynx; metachronous HN SPs were in the glottis, supraglottis, and ethmoid plus glottis/post-cricoid region. All SPs that could be tested were HPV+. There was no difference in DM rate (10% vs. 15%, p = 0.272), but HPV+ DMs were more likely to involve multiple organs (46% vs. 0%, p = 0.005) and unusual sites. Conclusions: This study reports atypical clinical behavior seen in HPV+ OPC, including multicentric lesions in HN mucosa and DM to multiple organs and unusual sites. The frequency of these events is low, but they may have clinical implications. The routine assessment of HPV status for all OPC is warranted.« less

Early changes in synaptic connectivity following progressive photoreceptor degeneration in RCS rats.

PubMed

Cuenca, Nicolás; Pinilla, Isabel; Sauvé, Yves; Lund, Raymond

2005-09-01

The Royal College of Surgeons (RCS) rat has a retinal pigment epithelial cell defect that causes progressive loss of photoreceptors. Although it is extensively used in retinal degeneration and repair studies, how photoreceptor degeneration affects retinal circuitry has not been fully explored. This study examined the changes in synaptic connectivity between photoreceptors and their target cells using immunocytochemistry and correlated these changes with retinal function using the electroretinogram (ERG). Immunostaining with bassoon and synaptophysin (as presynaptic markers) and metabotropic glutamate receptor (mGluR6, a postsynaptic marker for ON-bipolar dendrites) was already impaired at postnatal day (P) 21 and progressively lost with infrequent pairing of presynaptic and postsynaptic elements at P60. By P90 to P120, staining became increasingly patchy and was eventually restricted to sparsely and irregularly distributed foci in which the normal pairing of presynaptic and postsynaptic markers was lost. ERG results showed that mixed scotopic a-waves and b-waves were already reduced by P21 but not oscillatory potentials. While cone-driven responses (photopic b-wave) reached normal levels at P30, they were impaired by P60 but could still be recorded at P120, although with reduced amplitude; rod responses never reached normal amplitudes. Thus, only cone-driven activity attained normal levels, but declined rapidly thereafter. In conclusion, the synaptic markers associated with photoreceptors and processes of bipolar and horizontal cells show abnormalities prior to significant photoreceptor loss. These changes are paralleled with the deterioration of specific aspects of ERG responsiveness with age. Besides providing information on the effects of photoreceptor dysfunction and loss on connection patterns in the retina, the work addresses the more general issue of how disorder of input neurons affects downstream circuitry.

Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

PubMed

Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

2016-03-01

Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

PubMed

Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

1999-06-01

The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

A SENSITIVE IMMUNOFLUORESCENCE ASSAY FOR DETECTION OF P53 PROTEIN ACCUMULATION IN SPUTUM

EPA Science Inventory

p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...

Development of Yeast as an In Vivo Test Tube to Characterize a Broad Spectrum of p53 Mutations Associated with Breast Cancer

DTIC Science & Technology

2002-10-01

there is a mutation in the p53 gene itself (4, 5). Interestingly, -80% of p53 mutations are missense changes that lead to single amino acid...substitutions, a feature that distinguishes p53 from other tumor suppressor genes (e.g., APC, NF1, BRCAJ) (6). The incidence of p53 mutations and the types of...intronic promoter is contained within the human mutation hotspot maps of p53: correlation with p53 protein structural and mdm2 gene . Nucleic Acids Res

Immunohistochemical analysis of P53 protein in odontogenic cysts

PubMed Central

Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

2010-01-01

The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

PubMed

Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

2010-04-15

Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

PubMed

Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

2000-11-23

Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

PubMed

Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

2016-04-12

p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

p53 adenoviral vector (Ad-CMV-p53) induced prostatic growth inhibition of primary cultures of human prostate and an experimental rat model.

PubMed

Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S

2000-01-01

Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.